Sample records for liposomal geiv phthalocyanine

  1. Enhanced photodynamic leishmanicidal activity of hydrophobic zinc phthalocyanine within archaeolipids containing liposomes.

    PubMed

    Perez, Ana Paula; Casasco, Agustina; Schilrreff, Priscila; Tesoriero, Maria Victoria Defain; Defain Tesoriero, Maria Victoria; Duempelmann, Luc; Altube, Maria Julia; Higa, Leticia; Morilla, Maria Jose; Petray, Patricia; Romero, Eder L

    2014-01-01

    In this work, the in vitro anti-Leishmania activity of photodynamic liposomes made of soybean phosphatidylcholine, sodium cholate, total polar archaeolipids (TPAs) extracted from the hyperhalophile archaea Halorubrum tebenquichense and the photosensitizer zinc phthalocyanine (ZnPcAL) was compared to that of ultradeformable photodynamic liposomes lacking TPAs (ZnPcUDLs). We found that while ZnPcUDLs and ZnPcALs (130 nm mean diameter and -35 mV zeta potential) were innocuous against promastigotes, a low concentration (0.01 ?M ZnPc and 7.6 ?M phospholipids) of ZnPcALs irradiated at a very low-energy density (0.2 J/cm(2)) eliminated L. braziliensis amastigotes from J774 macrophages, without reducing the viability of the host cells. In such conditions, ZnPcALs were harmless for J774 macrophages, HaCaT keratinocytes, and bone marrow-derived dendritic cells. Therefore, topical photodynamic treatment would not likely affect skin-associated lymphoid tissue. ZnPcALs were extensively captured by macrophages, but ZnPcUDLs were not, leading to 2.5-fold increased intracellular delivery of ZnPc than with ZnPcUDLs. Despite mediating low levels of reactive oxygen species, the higher delivery of ZnPc and the multiple (caveolin- and clathrin-dependent plus phagocytic) intracellular pathway followed by ZnPc would have been the reason for the higher antiamastigote activity of ZnPcALs. The leishmanicidal activity of photodynamic liposomal ZnPc was improved by TPA-containing liposomes. PMID:25045264

  2. Localization of zinc(II)-phthalocyanine within implanted tumors after intravenous administration of a liposomal formulation

    NASA Astrophysics Data System (ADS)

    Duk, Saskia; Biolo, Roberta; Love, William G.; Jori, Giulio; Taylor, Peter W.

    1995-03-01

    The liposomal zinc(II) phthalocyanine (Zn-Pc) formulation CGP55847 was administered intravenously (0.5 mg Zn-Pc/kg) to C57/BL6 mice bearing subcutaneously implanted B16 melanomas or to Swiss mice bearing intramuscularly implanted Ehrlich carcinomas. Tumors were removed 3 or 24 h after dosing, and the Zn-Pc content and intratumoral distribution determined by extraction and quantitative fluorescence microscopy. Localization of the photosensitizer within the tumor mass occurred more rapidly in the highly vascularized Ehrlich carcinoma compared to the less highly vascularized B16 melanoma. Zn-Pc was evident in and around blood vessels 3 but not 24 h after dosing. More Zn-Pc was found in necrotic areas compared to viable tumor tissue; little or no Zn-Pc was detected in the muscle tissue invaded by the Ehrlich carcinoma. At the cellular level, Zn-Pc was associated with membranes and the cytosol but not the nucleus.

  3. In vivo fluorescence and photodynamic activity of zinc phthalocyanine administered in liposomes.

    PubMed Central

    van Leengoed, H. L.; Cuomo, V.; Versteeg, A. A.; van der Veen, N.; Jori, G.; Star, W. M.

    1994-01-01

    Zinc(II) phthalocyanine, a hydrophobic photosensitiser, was incorporated in unilamellar liposomes and studied in vivo for fluorescence kinetics and photodynamic activity. An observation chamber mounted in a dorsal skinfold of female WAG/Rij rats was used as a model system. In the chamber, an isogeneic mammary carcinoma was transplanted in the subcutaneous tissue. Phthalocyanine fluorescence was excited at 610 nm with a power density of 0.25 mW cm-2 and was detected above 665 nm through a high-pass filter using a two-stage image intensifier coupled to a charge-coupled device (CCD) camera. Following i.v. administration of 0.14 mg kg-1 of the drug, the fluorescence pharmacokinetics of the dye in vasculature, normal tissue and tumour tissue was determined as a function of time. Tumour fluorescence increased slowly to a maximum about 3 h post injection (p.i.), and remained well above the normal tissue fluorescence till 24 h p.i. Fluorescence in the circulation was always stronger than in the tissues. A treatment light dose at a wavelength of 675 nm was delivered 24 h p.i. One group of six animals received a total light dose of 150 J cm-2 (100 mW cm-2). A second group of six animals received a total light dose of 450 J cm-2 at the same dose rate. Vascular damage resulting from treatment was observed only at the final stages of the irradiation, despite the relatively high levels of fluorescence in the circulation. Immediate post-treatment (re)transplantation of the content of the chamber into the flank always resulted in tumour regrowth, confirming the presence of viable tumour cells following photodynamic therapy (PDT). When the chamber was left intact, the light dose of 450 J cm-2 yielded complete tissue necrosis. The role of the dye-carrier complex in shielding the vascular surrounding from photoproducts was studied in a third group of animals. The presence of peroxides was demonstrated in the serum of these animals after PDT with zinc phthalocyanine in liposomes (ZnPc-lip) using a total light dose of 450 J cm-2. This ex vivo observation supports the previously reported observations in vitro that the carrier complex is able to quench the photoproducts resulting from photoactivation of the photosensitiser which is present in the circulation. Images Figure 2 PMID:8180012

  4. CGP 55 847, liposome-delivered zinc(II)-phthalocyanine as a phototherapeutic agent for tumors

    NASA Astrophysics Data System (ADS)

    Schieweck, Klaus; Capraro, Hans-Georg; Isele, Ute; van Hoogevest, Peter; Ochsner, Martin; Maurer, Thomas; Batt, Ernst

    1994-03-01

    Zinc(II)-phthalocyanine (Zn-Pc) was chosen for development as a second-generation photosensitizer for photodynamic therapy (PDT) of tumors and for benign conditions because of its advantageous chemical and photophysical properties. Zn-Pc displayed good selectivity for malignant tissue in pharmacokinetic studies with Meth-A-sarcoma-bearing BALB/c mice when injected in a dose of 0.125 mg/kg, delivered by CGP 55 847. Intravenous doses of Zn- Pc ranging from 0.032 to 0.375 mg/kg caused tumor necrosis and, subsequently, cure of Meth-A-sarcoma-bearing mice when phototreatment was performed 48 hours after injection of CGP 55 847. Intravenous injection of Zn-Pc into hairless mice in doses ranging from 0.1 to 1.0 mg/kg caused dose- and time-dependent phototoxicity. We conclude that the promising pharmacological properties of liposomally delivered Zn-Pc, along with its advantageous chemical and photophysical properties, warrant the development of CGP 55 847 as a candidate drug for photodynamic therapy of tumors in humans.

  5. Liposome- or LDL-administered Zn (II)-phthalocyanine as a photodynamic agent for tumours. I. Pharmacokinetic properties and phototherapeutic efficiency.

    PubMed Central

    Reddi, E.; Zhou, C.; Biolo, R.; Menegaldo, E.; Jori, G.

    1990-01-01

    The pharmacokinetics of Zn-phthalocyanine (Zn-Pc) in mice bearing a transplanted MS-2 fibrosarcoma has been studied using dipalmitoyl-phosphatidylcholine (DPPC) liposomes and low density lipoproteins (LDL) as drug delivery systems. LDL induce a higher Zn-Pc uptake by the tumour and improve the selectivity of tumour targeting as compared to DPPC liposomes. Experimental photodynamic therapy (PDT) of the MS-2 fibrosarcoma has been performed using liposome-delivered Zn-Pc and the efficiency of tumour necrosis has been measured following four different irradiation protocols. We found that Zn-Pc doses as low as 0.07-0.35 mg kg-1 are sufficient for inducing an efficient tumour response that is linearly dependent on the injected dose. The amount of Zn-Pc in the tumour decreases very slowly as a function of time, hence PDT gives satisfactory results even if performed at relatively long time intervals after administration. PMID:2328207

  6. Phthalocyanine polymers

    NASA Technical Reports Server (NTRS)

    Achar, B. N.; Fohlen, G. M.; Parker, J. A. (inventors)

    1985-01-01

    A method of forming 4,4',4'',4''' -tetraamino phthalocyanines involves reducing 4,4',4'',4''' -tetranitro phthalocyanines, polymerizing the metal tetraamino phthalocyanines with a tetracarboxylic dianhydride (preferably aromatic) or copolymerizing with a tetracarboxylic dianhydride and a diamine (preferably also aromatic) to produce amic acids which are then dehydrocyclized to imides. Thermally and oxidatively stable polymers result which form tough, flexible films, varnishes, adhesives, and fibers.

  7. Doped colorimetric assay liposomes

    DOEpatents

    Charych, Deborah (Albany, CA); Stevens, Raymond C. (Albany, CA)

    2001-01-01

    The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

  8. Photoconductivity in crystalline phthalocyanines

    Microsoft Academic Search

    Francis P Xavier; Géorge J Goldsmith

    1995-01-01

    The wavelength, temperature, time and intensity dependence of photocurrent of metal-free phthalocyanine (H2Pc) and copper phthalocyanine (CuPc) single crystals were investigated. The thermal activation energies in the dark are 0·5\\u000a and 0·6 eV for H2Pc and CuPc respectively and the corresponding photo-thermal activation energies are 0·3 and 0·2 eV. An energy level scheme\\u000a for single crystals of H2Pc and CuPc

  9. Thermosetting Phthalocyanine Polymers

    NASA Technical Reports Server (NTRS)

    Fohlen, G.; Parker, J.; Achar, B.

    1985-01-01

    Group of phthalocyanine polymers resist thermal degradation. Polymers expected semiconducting. Principal applications probably in molded or laminated parts that have to withstand high temperatures. Polymers made from either of two classes of monomer: Bisphthalonitriles with imide linkages or Bisphthalonitriles with ester-imide linkages.

  10. Fluorescence resonance energy transfer measurements as a tool to detect fusion and drug exchange in liposomal suspensions

    NASA Astrophysics Data System (ADS)

    Hilfinker, Rolf; Willi, Annette; Isele, Ute; van Hoogevest, Peter

    1994-03-01

    Zinc-(II)-phthalocyanine (ZnPc) is a drug that can potentially be used in photodynamic therapy. A promising formulation approach for the strongly hydrophobic ZnPc is to embed the molecule in liposomes. CGP 55847 is such a liposomal ZnPc formulation. From our data, we could conclude that approximately one quarter of the drug molecules were only loosely bound to the liposomes and exchanged between them with a relaxation time of about 15 min. Energy transfer measurements before and after the lyophilization process revealed that the liposomes were stable when suspended in a 10% lactose solution, i.e. no fusion of liposomes took place. In aqueous solution, however, lyophilization induced fusion of liposomes to a small extent with a concomitant increase in size.

  11. Metal phthalocyanine polymers

    NASA Technical Reports Server (NTRS)

    Achar, B. N.; Fohlen, G. M.; Parker, J. A. (inventors)

    1984-01-01

    Metal 4, 4', 4", 4"'=tetracarboxylic phthalocyanines (MPTC) are prepared by reaction of trimellitic anhydride, a salt or hydroxide of the desired metal (or the metal in powdered form), urea and a catalyst. A purer form of MPTC is prepared than heretofore. These tetracarboxylic acids are then polymerized by heat to sheet polymers which have superior heat and oxidation resistance. The metal is preferably a divalent metal having an atomic radius close to 1.35A.

  12. Method of solubilizing phthalocyanines and metallophthalocyanines

    DOEpatents

    Rathke, Jerome W.; Chen, Michael J.; Fendrick, Carol M.

    1997-11-04

    A one-step method of manufacturing soluble phthalocyanines and metallophthalocyanines, like zinc phthalocyanine, by converting a phthalocyanine or a metallophthalocyanine to a trialkylsilyl-substituted derivative is disclosed. The phthalocyanine or metallophthalocyanine is converted to a soluble trialkylsilyl-substituted derivative by interacting the phthalocyanine or metallophthalocyanine with an active metal amide, like lithium 2,2,6,6-tetramethylpiperidide, and a halotrialkylsilane, like chlorotrimethylsilane, to provide a phthalocyanine compound, like phthalocyanine monomers, dimers or polymers, metalated or unmetalated, that are soluble in organic media.

  13. Gold liposomes

    SciTech Connect

    Hainfeld, J.F. [Brookhaven National Lab., Upton, NY (United States)

    1996-12-31

    Lipids are an important class of molecules, being found in membranes, HDL, LDL, and other natural structures, serving essential roles in structure and with varied functions such as compartmentalization and transport. Synthetic liposomes are also widely used as delivery and release vehicles for drugs, cosmetics, and other chemicals; soap is made from lipids. Lipids may form bilayer or multilammellar vesicles, micelles, sheets, tubes, and other structures. Lipid molecules may be linked to proteins, carbohydrates, or other moieties. EM study of this essential ingredient of life has lagged, due to lack of direct methods to visualize lipids without extensive alteration. OsO4 reacts with double bonds in membrane phospholipids, forming crossbridges. This has been the method of choice to both fix and stain membranes, thus far. An earlier work described the use of tungstate clusters (W{sub 11}) attached to lipid moieties to form lipid structures and lipid probes. With the development of gold clusters, it is now possible to covalently and specifically link a dense gold sphere to a lipid molecule; for example, reacting a mono-N-hydroxysuccinimide Nanogold cluster with the amino group on phosphatidyl ethanolaminine. Examples of a gold-fatty acid and a gold-phospholipid are shown.

  14. Liposomes as nanomedical devices

    PubMed Central

    Bozzuto, Giuseppina; Molinari, Agnese

    2015-01-01

    Since their discovery in the 1960s, liposomes have been studied in depth, and they continue to constitute a field of intense research. Liposomes are valued for their biological and technological advantages, and are considered to be the most successful drug-carrier system known to date. Notable progress has been made, and several biomedical applications of liposomes are either in clinical trials, are about to be put on the market, or have already been approved for public use. In this review, we briefly analyze how the efficacy of liposomes depends on the nature of their components and their size, surface charge, and lipidic organization. Moreover, we discuss the influence of the physicochemical properties of liposomes on their interaction with cells, half-life, ability to enter tissues, and final fate in vivo. Finally, we describe some strategies developed to overcome limitations of the “first-generation” liposomes, and liposome-based drugs on the market and in clinical trials. PMID:25678787

  15. Copper phthalocyanine and metal free phthalocyanine bulk heterojunction photodetector

    NASA Astrophysics Data System (ADS)

    Farooq, Amjad; Karimov, Kh. S.; Ahmed, Nisar; Ali, Taimoor; Khalid Alamgir, M.; Usman, Muhammad

    2015-01-01

    In this study we present the dependence of electrical properties of copper phthalocyanine (CuPc) and metal free phthalocyanine (H2Pc) bulk heterojunction structure under different illumination levels. To fabricate the device on ITO coated glass substrate the bulk heterojunction thin film of CuPc and H2Pc with thickness varying from 100 nm to 300 nm are deposited by thermal evaporator. Aluminum thin film was deposited by thermal evaporation as a top contact. The optical properties of the fabricated device are investigated using UV-vis spectroscopy. The current-voltage characteristics in dark and under illumination show that the device is sensitive towards visible light. The absorption spectrum describes its photo sensitivity in the range of wavelength from 200 nm to 850 nm. Simulation of current-intensity of light curve is carried out and experimental results are found in good agreement with simulated ones.

  16. Phthalocyanine Blends Improve Bulk Heterojunction Solar Cells

    PubMed Central

    Varotto, Alessandro; Nam, Chang-Yong; Radivojevic, Ivana; Tomé, Joao; Cavaleiro, José A.S.; Black, Charles T.; Drain, Charles Michael

    2010-01-01

    A core phthalocyanine platform allows engineering the solubility properties the band gap; shifting the maximum absorption toward the red. A simple method to increase the efficiency of heterojunction solar cells uses a self-organized blend of the phthalocyanine chromophores fabricated by solution processing. PMID:20136126

  17. Octasubstituted phthalocyanine assemblies: Characterization, polymerization, and patterning

    Microsoft Academic Search

    Rebecca Anne Zangmeister

    2001-01-01

    This dissertation explores the characterization of new phthalocyanine materials, and the processability of these materials with regard to thin film structures envisioned for use in organic based electronic devices. Highly ordered, coherent molecular assemblies are formed by Cu centered benzyloxyethoxy-substituted phthalocyanines. The influence of molecular aggregate interactions with solid supports, based on phenyl-phenyl interactions, manifests itself in large changes in

  18. Liposomes in silicosis investigations.

    PubMed Central

    Erdogdu, G; Hasirci, V N

    1983-01-01

    The effects of quartz and sodium metasilicate on liposomes were studied in order to understand the mechanism of silicosis. 8-Hydroxyquinoline-5-sulfonic acid was tested for its in situ silicosis-prevention capacity. Two types of liposomes--(A) those incorporating cholesterol and (B) those without cholesterol--were used. The tests consisted of measuring permeability changes caused by the above-mentioned chemicals. Permeabilities were found to depend on membrane composition. Tests on quartz action led us to the conclusion that liposomes of this composition did not simulate the erythrocytes very well. It was also observed that absence or presence of cholesterol and the mode of contact altered the effect of quartz. Silicate destabilized type A liposomes, but this was less than that caused by quartz. This was explained by the concentration of monosilicic acid that dissolves out from quartz and silicate. When quartz was pretreated with the preventive, the type A liposomes were stabilized, but a slight destabilizing effect was observed on type B. 8-Hydroxyquinoline-5-sulfonic acid augmented the destabilizing effect of silicate, whereas it decreased the hemolytic activity of uncoated quartz, indicating a preventive potential in in vivo. Images FIGURE 1. PMID:6416823

  19. Hexacoordinate bonding and aromaticity in silicon phthalocyanine.

    PubMed

    Yang, Yang

    2010-12-23

    Si-E bondings in hexacoordinate silicon phthalocyanine were analyzed using bond order (BO), energy partition, atoms in molecules (AIM), electron localization function (ELF), and localized orbital locator (LOL). Bond models were proposed to explain differences between hexacoordinate and tetracoordinate Si-E bondings. Aromaticity of silicon phthalocyanine was investigated using nucleus-independent chemical shift (NICS), harmonic oscillator model of aromaticity (HOMA), conceptual density functional theory (DFT), ring critical point (RCP) descriptors, and delocalization index (DI). Structure, energy, bonding, and aromaticity of tetracoordinate silicon phthalocyanine were studied and compared with hexacoordinate one. PMID:21105726

  20. Liposome-based nanocapsules.

    PubMed

    Ruysschaert, Tristan; Germain, Matthieu; Gomes, Joana Filipa Pereira da Silva; Fournier, Didier; Sukhorukov, Gleb B; Meier, Wolfgang; Winterhalter, Mathias

    2004-03-01

    Here we present three different types of mechanically stable nanometer-sized hollow capsules. The common point of the currently developed systems in our laboratory is that they are liposome based. Biomolecules can be used to functionalize lipid vesicles to create a new type of intelligent material. For example, insertion of membrane channels into the capsule wall can modify the permeability. Covalent binding of antibodies allows targeting of the capsule to specific sites. Liposomes loaded with enzymes may provide an optimal environment for them with respect to the maximal turnover and may stabilize the enzyme. However, the main drawback of liposomes is their instability in biological media as well as their sensitivity to many external parameters such as temperature or osmotic pressure. To increase their stability we follow different strategies: 1) polymerize a two-dimensional network in the hydrophobic core of the membrane; 2) coat the liposome with a polyelectrolyte shell; or 3) add surface active polymers to form mixed vesicular structures. PMID:15382644

  1. Adsorption of ammonia on multilayer iron phthalocyanine

    SciTech Connect

    Isvoranu, Cristina; Knudsen, Jan; Ataman, Evren; Andersen, Jesper N.; Schnadt, Joachim [Division of Synchrotron Radiation Research, Department of Physics, Lund University, Box 118, 221 00 Lund (Sweden); Schulte, Karina [MAX-lab, Lund University, Box 118, 221 00 Lund (Sweden); Wang Bin; Bocquet, Marie-Laure [Laboratoire de chimie, Ecole normale superieure de Lyon, 46, Allee d'Italie, 69364 Lyon Cedex 07 (France)

    2011-03-21

    The adsorption of ammonia on multilayers of well-ordered, flat-lying iron phthalocyanine (FePc) molecules on a Au(111) support was investigated by x-ray photoelectron spectroscopy. We find that the electron-donating ammonia molecules coordinate to the metal centers of iron phthlalocyanine. The coordination of ammonia induces changes of the electronic structure of the iron phthalocyanine layer, which, in particular, lead to a modification of the FePc valence electron spin.

  2. Synthesis of Metal Phthalocyanine Sheet Polymers

    NASA Technical Reports Server (NTRS)

    Achar, B. N.; Fohlen, G. M.; Parker, J. A.

    1986-01-01

    New method for synthesizing metal phthalocyanine tetracarboxylic acids (MPTCA's) yields high purity end product. In addition, high-purity metal phthalocyanine sheet polymers synthesized from compounds. Monomer formed into sheet polymer by heating. Units of polymer linked in manner similar to phenyl-group linkages in biphenyl: Conjugation extends throughout macromolecule, thereby increasing delocalization of TT-electrons. Increases conductivity and thermal stability of polymer.

  3. Laser-Desorption Supersonic Jet Spectroscopy of Phthalocyanines

    Microsoft Academic Search

    Fiona L. Plows; Anita C. Jones

    1999-01-01

    The laser-induced fluorescence excitation spectra of zinc phthalocyanine, chloroaluminum phthalocyanine, magnesium phthalocyanine, and free-base phthalocyanine have been investigated under jet-cooled conditions, by using pulsed infrared laser desorption as the means of vaporization. Assignment of the observed vibronic transitions reveals that many of them gain intensity from coupling of theS1(Q) state with theS2(B) andQ' states. Low-frequency out-of-plane modes of the macrocycle

  4. Laser-Desorption Supersonic Jet Spectroscopy of Phthalocyanines

    Microsoft Academic Search

    Fiona L. Plows; Anita C. Jones

    1999-01-01

    The laser-induced fluorescence excitation spectra of zinc phthalocyanine, chloroaluminum phthalocyanine, magnesium phthalocyanine, and free-base phthalocyanine have been investigated under jet-cooled conditions, by using pulsed infrared laser desorption as the means of vaporization. Assignment of the observed vibronic transitions reveals that many of them gain intensity from coupling of theS1(Q) state with theS2(B) andQ? states. Low-frequency out-of-plane modes of the macrocycle

  5. Ligation Strategies for Targeting Liposomal Nanocarriers

    PubMed Central

    Marqués-Gallego, Patricia; de Kroon, Anton I. P. M.

    2014-01-01

    Liposomes have been exploited for pharmaceutical purposes, including diagnostic imaging and drug and gene delivery. The versatility of liposomes as drug carriers has been demonstrated by a variety of clinically approved formulations. Since liposomes were first reported, research of liposomal formulations has progressed to produce improved delivery systems. One example of this progress is stealth liposomes, so called because they are equipped with a PEGylated coating of the liposome bilayer, leading to prolonged blood circulation and improved biodistribution of the liposomal carrier. A growing research area focuses on the preparation of liposomes with the ability of targeting specific tissues. Several strategies to prepare liposomes with active targeting ligands have been developed over the last decades. Herein, several strategies for the functionalization of liposomes are concisely summarized, with emphasis on recently developed technologies for the covalent conjugation of targeting ligands to liposomes. PMID:25126543

  6. Liposome: classification, preparation, and applications

    PubMed Central

    2013-01-01

    Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s. Today, they are a very useful reproduction, reagent, and tool in various scientific disciplines, including mathematics and theoretical physics, biophysics, chemistry, colloid science, biochemistry, and biology. Since then, liposomes have made their way to the market. Among several talented new drug delivery systems, liposomes characterize an advanced technology to deliver active molecules to the site of action, and at present, several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles to ‘second-generation liposomes’, in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability and regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents. PMID:23432972

  7. Liposome: classification, preparation, and applications

    NASA Astrophysics Data System (ADS)

    Akbarzadeh, Abolfazl; Rezaei-Sadabady, Rogaie; Davaran, Soodabeh; Joo, Sang Woo; Zarghami, Nosratollah; Hanifehpour, Younes; Samiei, Mohammad; Kouhi, Mohammad; Nejati-Koshki, Kazem

    2013-02-01

    Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s. Today, they are a very useful reproduction, reagent, and tool in various scientific disciplines, including mathematics and theoretical physics, biophysics, chemistry, colloid science, biochemistry, and biology. Since then, liposomes have made their way to the market. Among several talented new drug delivery systems, liposomes characterize an advanced technology to deliver active molecules to the site of action, and at present, several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles to `second-generation liposomes', in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability and regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents.

  8. Studies of phthalocyanine-containing polymers

    NASA Astrophysics Data System (ADS)

    Lee, Pui Sze Priscilla

    This thesis reports the synthesis, spectroscopic and photophysical properties, and in vitro photodynamic activities of several series of phthalocyanine-containing polymers including poly(norbornene), poly(anhydride), and poly(epsilon-caprolactone). Chapter 1 gives a general overview of phthalocyanines including their synthesis and applications. Special emphasis has been placed on hydrophilic and non-aggregated phthalocyanines and their use in photodynamic therapy. In addition, different classes of phthalocyanine-containing polymers will also be mentioned. Chapter 2 discusses the synthesis, characterization, and photophysical properties of a series of poly(norbornene)s with zinc(II) phthalocyanine and amino acid moieties. The copolymers were prepared by copolymerization of 2-(2-norbornenylmethoxy)phthalocyaninatozinc(II) with 5-norbornenes substituted with phenylalanine and tyrosine. As shown by absorption and fluorescence spectroscopy, phthalocyanines in this series of polymer exhibit a rather strong aggregation tendency. Chapter 3 presents the synthesis, characterization, photophysical properties, and in vitro photodynamic activities of a related series of amino acid- and sugar-containing poly(norbornene)s connected axially to a silicon(IV) phthalocyanine core. These polymers exhibit a good solubility in common organic solvents. Due to the axial polymeric substituents, these compounds are free from aggregation and give a high singlet oxygen quantum yield. These polymers in Cremophor EL emulsions also show a high photodynamic activity against HepG2 cells, in particular the polymer with protected galactose moieties. Chapter 4 reports a series of silicon(IV) phthalocyanines substituted with two poly(sebacic anhydride) chains as the axial ligands. The polymers form nanoparticles in water in the presence of surfactants cetyltrimethylammonium bromide (CTAB) and sodium dodecylsulphate (SDS). The degradation of the nanoparticles was carried out in alkaline media and was followed by absorption and fluorescence spectroscopy, and laser light scattering. It was found that phthalocyanines are gradually released during degradation. Chapter 5 describes the preparation, characterization, photophysical properties, and in vitro photodynamic activities of homo- and co-polymers of epsilon-caprolactone and/or 5-ethylene ketyl epsilon-caprolactone connected axially to silicon(IV) phthalocyanine. Again, these polymers are non-aggregated in solution as shown by absorption and fluorescence spectroscopy. Enzymatic degradation of the nanoparticles formed from these polymers with Lipase PS leads to a graduate release of phthalocyanines. In addition, these polymers show high in vitro photodynamic activities toward HepG2 cells, showing that this novel polymer-based colloidal system is potentially useful for the delivery and release of photosensitizers in photodynamic therapy. In addition to polymeric phthalocyanines, a series of symmetrical and unsymmetrical galactose-containing silicon(IV) phthalocyanines has also been prepared. Chapter 6 describes the preparation and properties of these novel compounds, including their in vitro photoactivity toward HepG2 cells. Appendix A gives characterizing data for all the new compounds. Crystallographic details for the X-ray structure determinations are listed in Appendix B.

  9. Photoconductivity in thin films of phthalocyanine

    Microsoft Academic Search

    Francis P Xavier; George J Goldsmith

    1995-01-01

    The photocurrent and electrolyte electromodulation (EEM) spectra of thin films of metal-free phthalocyanine (H2Pc) and of copper phthalocyanine (CuPc) were investigated. The modulation spectra yielded three distinct features around 1·61,\\u000a 2·30 and 2·93 eV for H2Pc and around 1·63, 2·04 and 3·20 eV for CuPc. The spectral dependence maxima of photoconductivity correspond to the modulation\\u000a spectra. These features are interpreted

  10. Biological activity of liposomal vanillin.

    PubMed

    Castan, Leniher; Del Toro, Grisel; Fernández, Adolfo A; González, Manuel; Ortíz, Emilia; Lobo, Daliana

    2013-06-01

    This article presents a study of vanillin encapsulation inside multilamellar liposomes, with emphasis on the evaluation of antioxidant activity, the hemolytic effect, and the antisickling properties of these products. Egg phosphatidylcholine-cholesterol and egg phosphatidylcholine-cholesterol-1-O-decylglycerol liposomes were prepared by mechanical dispersion, all with vanillin included. Vesicles were characterized by determination of encapsulation efficiency and vanillin retention capacity. Antioxidant activity was determined by the 2,2-diphenyl-1-picrylhydrazyl (DPPH) method. The hemolytic effect of liposomes was also evaluated by spectrophotometry, as well as the antisickling activity by the Huck test using optical microscopy. Results showed that the lipid composition of liposomes did not significantly affect the encapsulation efficiency. Stable vesicles were obtained with a high retention percentage of vanillin. Liposomes exhibited a high capture of the DPPH radical compared to free vanillin and 1-O-decylglycerol (C10) in solution. Vesicles caused no significant hemolisys in normal erythrocytes, nor in those coming from patients with sickle cell anemia. Vanillin encapsulated in liposomes retained its antisickling activity, with a greater effect for C10-containing vesicles. Our results show that vanillin encapsulation in liposomes is a way to enhance the pharmacologic properties of this molecule using a suitable vehicle. PMID:23767864

  11. 40 CFR 721.9674 - Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...false Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic...9674 Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic...generically as sulfonated-copper phthalocyanine salt of a triarylmethane dye (PMN...

  12. 40 CFR 721.9674 - Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 2011-07-01 false Sulfonated-copper phthalocyanine salt of a triarylmethane...Substances § 721.9674 Sulfonated-copper phthalocyanine salt of a triarylmethane...identified generically as sulfonated-copper phthalocyanine salt of a...

  13. 40 CFR 721.9674 - Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 2013-07-01 false Sulfonated-copper phthalocyanine salt of a triarylmethane...Substances § 721.9674 Sulfonated-copper phthalocyanine salt of a triarylmethane...identified generically as sulfonated-copper phthalocyanine salt of a...

  14. 40 CFR 721.9674 - Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 2012-07-01 false Sulfonated-copper phthalocyanine salt of a triarylmethane...Substances § 721.9674 Sulfonated-copper phthalocyanine salt of a triarylmethane...identified generically as sulfonated-copper phthalocyanine salt of a...

  15. 40 CFR 721.9674 - Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 2014-07-01 false Sulfonated-copper phthalocyanine salt of a triarylmethane...Substances § 721.9674 Sulfonated-copper phthalocyanine salt of a triarylmethane...identified generically as sulfonated-copper phthalocyanine salt of a...

  16. Microwave-assisted synthesis and characterization of the monomeric phthalocyanines containing naphthalene-amide group moieties and the polymeric phthalocyanines containing oxa-aza bridge

    Microsoft Academic Search

    Musa Özil; Erbil A?ar; Selami ?a?maz; Bahittin Kahveci; Nesuhi Akdemir; ?smail Erdem Gümrükçüo?lu

    2007-01-01

    New naphthalene-amide substituted phthalocyanines and oxa-aza bridge polymeric phthalocyanines were prepared by conventional and microwave methods. The chlorides of Cu(I), Ni(II) and Co(II) were employed in order to synthesize the corresponding metal phthalocyanines and Zn(CH3COO)2 was used for the preparation of the zinc phthalocyanines. For the preparation of the Co-containing phthalocyanines, ammonium molybdate had to be added as catalyst. In

  17. Stability of dry liposomes in sugar glasses.

    PubMed Central

    Sun, W Q; Leopold, A C; Crowe, L M; Crowe, J H

    1996-01-01

    Sugars, particularly trehalose and sucrose, are used to stabilize liposomes during hydration (freeze-drying and air-drying). As a result, dry liposomes are trapped in a sugar glass, a supersaturated and thermodynamically unstable solid solution. We investigated the effects of the glassy state on liposome fusion and solute retention in the dry state. Solute leakage from dry liposomes was extremely slow at temperatures below the glass transition temperature (Tg); however, it increased exponentially as temperature increased to near or above the Tg, indicating that the glassy state had to be maintained for dry liposomes to retain trapped solutes. The leakage of solutes from dry liposomes followed the law of first-order kinetics and was correlated linearly with liposome fusion. The kinetics of solute leakage showed an excellent fit with the Arrhenius equation at temperatures both above and below the Tg, with a transitional break near the Tg. The activation energy of solute leakage was 1320 kJ/mol at temperatures above the Tg, but increased to 1991 kJ/mol at temperatures below the Tg. The stabilization effect of sugar glass on dry liposomes may be associated with the elevated energy barrier for liposome fusion and the physical separation of dry liposomes in the glassy state. The half-life of solute retention in dry liposomes may be prolonged by storing dry liposomes at temperatures below the Tg and by increasing the Tg of the dry liposome preparation. PMID:8785336

  18. Structural studies of aliphatic substituted phthalocyanine-lipid multilayers.

    PubMed

    Zarbakhsh, Ali; Campana, Mario; Mills, David; Webster, John R P

    2010-10-01

    A Langmuir-Blodgett film of aliphatic substituted phthalocyanines on a C18 silane supporting layer coupled onto a silicon substrate has been investigated using neutron reflectometry. This multilayer structure is seen as a possible candidate for phthalocyanine-lipid biosensor devices. The results show the suitability of the C18 ligands as an anchoring layer for the phthalocyanines. The scattering length density profiles demonstrate the effectiveness of a lipid monolayer in partitioning the composition of phthalocyanine layers from that of the bulk liquid. The effectiveness of this barrier is a critical factor in the efficiency of such devices. PMID:20831252

  19. Liposomal amphotericin B therapy of murine histoplasmosis.

    PubMed Central

    Graybill, J R; Bocanegra, R

    1995-01-01

    Liposomal amphotericin B (AmBisome) was compared with amphotericin B deoxycholate for the treatment of disseminated murine histoplasmosis. Liposomal amphotericin B was well tolerated and, milligram for milligram, was as potent as amphotericin B deoxycholate. PMID:7486941

  20. Development of liposomal anticancer drugs.

    PubMed

    Hyodo, Kenji; Yamamoto, Eiichi; Suzuki, Takuya; Kikuchi, Hiroshi; Asano, Makoto; Ishihara, Hiroshi

    2013-01-01

    Liposomes are drug delivery systems that can alter the pharmacokinetic properties of compounds. The adverse effects of anticancer agents are a limiting factor for cancer chemotherapy, therefore, liposomal formulations have the potential to improve the therapeutic efficacy of anticancer agents by enhancing their accumulation in tumors and reducing non-selective distribution to normal tissues, which is known as the enhanced permeability and retention effect. To develop a liposomal anticancer agent as a drug product, its formulation must be designed to ensure its quality until it is administered to patients and to exert maximum potency in clinical use rather than in animal experiments. The chemical stability and physicochemical stability of the ingredients are key factors in the design of liposomal formulations. Drug release rates are critical factors in the therapeutic efficacy of liposomal drug products because the encapsulated drug has no pharmacological activity, and only released drug can exert antitumor/toxic activities. Liposomes should maintain the drug in a stable state in the circulation and then promptly release it after accumulation in the target tissue in order to achieve a sufficient drug concentration. To understand the profile of the formulation and to guarantee the quality of drug product, a reliable analytical method that can determine the released and encapsulated drugs in biological fluids is required. Simple online solid phase extractions of the released and encapsulated drugs using a column-switching HPLC system meet the requirements and this system enables accurate in vitro release testing and in vivo pharmacokinetic evaluation. This review introduces the process of liposomal drug product development from various viewpoints. PMID:23649329

  1. Preparation and characterization of gemcitabine liposome injections.

    PubMed

    Zhou, Qinmei; Liu, Liucheng; Zhang, Dengshan; Fan, Xingfeng

    2012-10-01

    Gemcitabine liposome injection (stealth liposomes) has facilitated the targeting of gemcitabine for cancer treatment. We systemically review liposome-based drug-delivery systems, which can improve pharmacokinetics, reduce side effects and potentially increase tumor uptake, for pancreatic cancer therapy. A novel liposomal formulation, which allows for higher tumor targeting efficiencies and can be used in current clinical trials to treat this challenging disease, has gained great popularity and attention. In this study, since extrusion technology was used to make sterile preparation of liposomes, the process included aseptic production process and sterile filtration. During the preparation, it has been found that the lipid concentration, emulsification speed and time, the homogenization times and pattern, the lipid solution temperature are all critical parameters for the character of the gemcitabine liposome injection. The particle size method and zeta potential method to characterize a PEGylated liposomal drug formulation of the anti-cancer agent gemcitabine was developed. The methods are specific, precise, reproducible and sensitive, therefore they are suitable for the determination of particle size and zeta potential of gemcitabine liposome injection. Negative staining technology of transmission electron microscopy revealed that gemcitabine liposome injection has a typical morphology, which enables liposomal surfaces could be seen so additional visual information on the stealth liposome can be routinely obtained in a fast and reliable manner. Moreover, the above three methods are simple, fast and would be used for continuous quality control of gemcitabine liposome injection when it moves to cGMP production scale. PMID:23136718

  2. Encapsulated phthalocyanine blue pigment with polymerisable dispersant for inkjet printing inks

    Microsoft Academic Search

    Shai Fu; Kai Zhang; Mingjun Zhhang; Li Tian

    2012-01-01

    Purpose – The purpose of this paper is to provide a novel method for encapsulation of phthalocyanine blue pigment for inkjet printing inks. Design\\/methodology\\/approach – Phthalocyanine blue pigment was encapsulated by emulsion polymerisation of styrene and a polymerisable dispersant, allyloxy nonyl-phenoxy propanol polyoxyethylene ether ammonium sulphonate (ANPS). The encapsulated phthalocyanine blue pigment was further formulated into dispersion. The encapsulated phthalocyanine

  3. Phthalocyanines as oxidation-reduction indicators

    Microsoft Academic Search

    G. Gopala Rao; T. P. Sastri

    1959-01-01

    Investigations on the use of copper phthalocyanine tetrasulphonic acid (Cu-PTS) as a redox indicator in vanadametry have given the following results:1.Cu-PTS serves well as a redox indicator in the titration of iron(II) with 0.05 N sodium vanadate solution while keeping the sulphuric acid concentration of the medium at 12 N and adding 3 ml of syrupy phosphoric acid for each

  4. Single crystal growth of organic photoconductors: phthalocyanine

    Microsoft Academic Search

    Francis P Xavier; George J Goldsmith

    1996-01-01

    An effective method of growing single crystals of organic photoconductors such as phthalocyanine in the presence of doping\\u000a impurity such as iodine by vacuum sublimation is discussed in this paper. This method is very useful especially when an organic\\u000a material does not have a melting point but decomposes above a particular temperature. So far, doping has been done by exposing

  5. Phthalocyanine Tetraamine Epoxy-Curing Agents

    NASA Technical Reports Server (NTRS)

    Fohlen, G. M.; Achar, B. N.; Parker, J. A.

    1986-01-01

    Tough fire- and chemical-resistant epoxies produced by using metalphthalocyanine tetraamines (MPT's) of copper, cobalt, or nickel as curing agents. Synthesis of MPT's commercially realizable and gives pure compounds with almost 90-percent yield. Synthesis applicable for metals with atomic radii of about 1.35 angstroms, including Cu, Co, Ni, Zn, Fe, Pt, Al, and V. Possible to use metal phthalocyanines to cure epoxy resins in homogeneous reaction.

  6. Redox-Triggered Contents Release from Liposomes

    PubMed Central

    Ong, Winston; Yang, Yuming; Cruciano, Angela C.; McCarley*, Robin L.

    2008-01-01

    An exciting new direction in responsive liposome research is endogenous triggering of liposomal payload release by overexpressed enzyme activity in affected tissues and offers the unique possibility of active and site-specific release. Bringing to fruition the fully expected capabilities of this new class of triggered liposomal delivery system requires a collection of liposome systems that respond to different upregulated enzymes; however, a relatively small number currently exist. Here we show that stable, ~100 nm diameter liposomes can be made from previously unreported quinone-dioleoyl phosphatidylethanolamine (Q-DOPE) lipids, and complete payload release (quenched fluorescent dye) from Q-DOPE liposomes occurs upon their redox activation when the quinone headgroup possesses specific substituents. The key component of the triggerable, contents-releasing Q-DOPE liposomes is a “trimethyl-locked” quinone redox switch attached to the N-terminus of DOPE lipids that undergoes a cleavage event upon two-electron reduction. Payload release by aggregation and leakage of “uncapped” Q-DOPE liposomes is supported by results from liposomes wherein deliberate alteration of the “trimethyl-locked” switch completely deactivates the redox-destructible phenomena (liposome opening). We expect that Q-DOPE liposomes and their variants will be important in treatment of diseases with associated tissues that overexpress quinone reductases, such as cancers and inflammatory diseases, because the quinone redox switch is a known substrate for this group of reductases. PMID:18841890

  7. Room temperature ferromagnetism in a phthalocyanine based carbon material

    SciTech Connect

    Honda, Z., E-mail: honda@fms.saitama-u.ac.jp; Sato, K.; Sakai, M.; Fukuda, T.; Kamata, N. [Graduate School of Science and Engineering, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama 338-8570 (Japan); Hagiwara, M.; Kida, T. [KYOKUGEN (Center for Quantum Science and Technology under Extreme Conditions), Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531 (Japan)

    2014-02-07

    We report on a simple method to fabricate a magnetic carbon material that contains nitrogen-coordinated transition metals and has a large magnetic moment. Highly chlorinated iron phthalocyanine was used as building blocks and potassium as a coupling reagent to uniformly disperse nitrogen-coordinated iron atoms on the phthalocyanine based carbon material. The iron phthalocyanine based carbon material exhibits ferromagnetic properties at room temperature and the ferromagnetic phase transition occurs at T{sub c}?=?490?±?10?K. Transmission electron microscopy observation, X-ray diffraction analysis, and the temperature dependence of magnetization suggest that the phthalocyanine molecules form three-dimensional random networks in the iron phthalocyanine based carbon material.

  8. Liposome-like Nanostructures for Drug Delivery

    PubMed Central

    Gao, Weiwei; Hu, Che-Ming J.; Fang, Ronnie H.; Zhang, Liangfang

    2013-01-01

    Liposomes are a class of well-established drug carriers that have found numerous therapeutic applications. The success of liposomes, together with recent advancements in nanotechnology, has motivated the development of various novel liposome-like nanostructures with improved drug delivery performance. These nanostructures can be categorized into five major varieties, namely: (1) polymer-stabilized liposomes, (2) nanoparticle-stabilized liposomes, (3) core-shell lipid-polymer hybrid nanoparticles, (4) natural membrane-derived vesicles, and (5) natural membrane coated nanoparticles. They have received significant attention and have become popular drug delivery platforms. Herein, we discuss the unique strengths of these liposome-like platforms in drug delivery, with a particular emphasis on how liposome-inspired novel designs have led to improved therapeutic efficacy, and review recent progress made by each platform in advancing healthcare. PMID:24392221

  9. Capacious and programmable multi-liposomal carriers

    NASA Astrophysics Data System (ADS)

    Yaroslavov, Alexander A.; Sybachin, Andrey V.; Zaborova, Olga V.; Migulin, Vasiliy A.; Samoshin, Vyacheslav V.; Ballauff, Matthias; Kesselman, Ellina; Schmidt, Judith; Talmon, Yeshayahu; Menger, Fredric M.

    2015-01-01

    Spherical polycationic brushes (SPBs) were synthesized by grafting polycationic chains onto 100 nm polystyrene particles. These particles were exposed to unilamellar egg-lecithin (EL) liposomes with a mean diameter of 40 nm that had been rendered anionic via the presence of 10 molar% of phosphatidylserine (PS1-). The liposomes also contained 30 mole% of a morpholinocyclohexanol-based lipid (MOCH) that undergoes a conformational flip when the pH is decreased from 7.0 to 5.0. Mixtures of SPBs and liposomes at pH 7 gave an electrostatically-driven complex possessing, on average, about 40 liposomes for each SPB particle. It was found that the bound liposomes rapidly release much of their contents when the pH is reduced from 7.0 to 5.0 owing mostly to a MOCH conformational change that creates defects in the bilayer membrane. The drop in pH does not, however, induce a separation of the liposomes from the SPBs. Around 50-60% of the liposome contents escape before, it is reasoned, lateral and transmembrane motion of the membrane components heals the defects and prevents further release. Remarkably, the liposomes complexed with SPB release their cargo much faster than the identical but non-complexed liposomes.Spherical polycationic brushes (SPBs) were synthesized by grafting polycationic chains onto 100 nm polystyrene particles. These particles were exposed to unilamellar egg-lecithin (EL) liposomes with a mean diameter of 40 nm that had been rendered anionic via the presence of 10 molar% of phosphatidylserine (PS1-). The liposomes also contained 30 mole% of a morpholinocyclohexanol-based lipid (MOCH) that undergoes a conformational flip when the pH is decreased from 7.0 to 5.0. Mixtures of SPBs and liposomes at pH 7 gave an electrostatically-driven complex possessing, on average, about 40 liposomes for each SPB particle. It was found that the bound liposomes rapidly release much of their contents when the pH is reduced from 7.0 to 5.0 owing mostly to a MOCH conformational change that creates defects in the bilayer membrane. The drop in pH does not, however, induce a separation of the liposomes from the SPBs. Around 50-60% of the liposome contents escape before, it is reasoned, lateral and transmembrane motion of the membrane components heals the defects and prevents further release. Remarkably, the liposomes complexed with SPB release their cargo much faster than the identical but non-complexed liposomes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr06037g

  10. Controlling Growth Orientation of Phthalocyanine Films by Electrical Fields

    NASA Technical Reports Server (NTRS)

    Zhu, S.; Banks, C. E.; Frazier, D. O.; Ila, D.; Muntele, I.; Penn, B. G.; Sharma, A.; Rose, M. Franklin (Technical Monitor)

    2001-01-01

    Organic Phthalocyanine films have many applications ranging from data storage to various non-linear optical devices whose quality is affected by the growth orientation of Phthalocyanine films. Due to the structural and electrical properties of Phthalocyanine molecules, the film growth orientation depends strongly on the substrate surface states. In this presentation, an electrical field up to 4000 V/cm is introduced during film growth. The Phthalocyanine films are synthesized on quartz substrates using thermal evaporation. An intermediate layer is deposited on some substrates for introducing the electrical field. Scanning electron microscopy, x-ray diffraction, and Fourier transform infrared spectroscopy are used for measuring surface morphology, film structure, and optical properties, respectively. The comparison of Phthalocyanine films grown with and without the electrical field reveals different morphology, film density, and growth orientation, which eventually change optical properties of these films. These results suggest that the growth method in the electrical field can be used to synthesized Phthalocyanine films with a preferred crystal orientation as well as propose an interaction mechanism between the substrate surface and the depositing molecules. The details of growth conditions and of the growth model of how the Phthalocyanine molecules grow in the electrical field will be discussed.

  11. Capacious and programmable multi-liposomal carriers.

    PubMed

    Yaroslavov, Alexander A; Sybachin, Andrey V; Zaborova, Olga V; Migulin, Vasiliy A; Samoshin, Vyacheslav V; Ballauff, Matthias; Kesselman, Ellina; Schmidt, Judith; Talmon, Yeshayahu; Menger, Fredric M

    2015-02-01

    Spherical polycationic brushes (SPBs) were synthesized by grafting polycationic chains onto 100 nm polystyrene particles. These particles were exposed to unilamellar egg-lecithin (EL) liposomes with a mean diameter of 40 nm that had been rendered anionic via the presence of 10 molar% of phosphatidylserine (PS(1-)). The liposomes also contained 30 mole% of a morpholinocyclohexanol-based lipid (MOCH) that undergoes a conformational flip when the pH is decreased from 7.0 to 5.0. Mixtures of SPBs and liposomes at pH 7 gave an electrostatically-driven complex possessing, on average, about 40 liposomes for each SPB particle. It was found that the bound liposomes rapidly release much of their contents when the pH is reduced from 7.0 to 5.0 owing mostly to a MOCH conformational change that creates defects in the bilayer membrane. The drop in pH does not, however, induce a separation of the liposomes from the SPBs. Around 50-60% of the liposome contents escape before, it is reasoned, lateral and transmembrane motion of the membrane components heals the defects and prevents further release. Remarkably, the liposomes complexed with SPB release their cargo much faster than the identical but non-complexed liposomes. PMID:25554444

  12. Secretory phospholipase A? responsive liposomes.

    PubMed

    Zhu, Guodong; Mock, Jason N; Aljuffali, Ibrahim; Cummings, Brian S; Arnold, Robert D

    2011-08-01

    Secretory phospholipase A(2) (sPLA(2)) expression is increased in several cancers and has been shown to trigger release from some lipid carriers. This study used electrospray ionization mass spectrometry (ESI-MS) and release of 6-carboxyfluorescein (6-CF) to determine the effects of sPLA(2) on various liposome formulations. Different combinations of zwitterionic [1,2-dipalmitoyl-sn-glycero-3-phosphatidylcholine, 1,2-distearoyl-sn-glycero-3-phosphatidylcholine, and 1,2-distearoyl-sn-glycero-3-phosphatidylethanolamine (DSPE)] and anionic [1,2-distearoyl-sn-glycero-3-phosphatidic acid, 1,2-distearoyl-sn-glycero-3-phosphatidylglycerol (DSPG), 1,2-distearoyl-sn-glycero-3-phosphatidylserine, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-poly(ethylene glycol) 2000 (DSPE-PEG)] phospholipids were examined. DSPG and DSPE were most susceptible to sPLA(2)-mediated degradation compared with other phospholipids. Increased 6-CF release was observed after inclusion of 10 mol % DSPE and anionic lipids into different liposome formulations. Group IIa sPLA(2)-mediated 6-CF release was less than Group III and relatively insensitive to cholesterol (Chol), whereas Chol reduced sPLA(2)-mediated release. Inclusion of DSPE-PEG increased sPLA(2)-mediated 6-CF release, whereas serum reduced lipid degradation and 6-CF release significantly. These data demonstrate that ESI-MS and 6-CF release were useful in determining the selectivity of sPLA(2) and release from liposomes, that differences in the activity of different sPLA(2) isoforms exist, and that DSPE-PEG enhanced sPLA(2)-mediated release of liposomal constituents. These findings will aid in the selection of lipids and optimization of the kinetics of drug release for the treatment of cancers and diseases of inflammation in which sPLA(2) expression is increased. PMID:21455978

  13. Unsymmetrical pyrene-fused phthalocyanine derivatives: synthesis, structure, and properties.

    PubMed

    Pan, Houhe; Chen, Chao; Wang, Kang; Li, Wenjun; Jiang, Jianzhuang

    2015-02-16

    Novel pyrene-fused unsymmetrical phthalocyanine derivatives 2,3,9,10,16,17-hexakis(2,6-dimethylphenoxy)-22,25-diaza(2,7-di-tert-butylpyrene)[4,5]phthalocyaninato zinc complex Zn[Pc(Pz-pyrene)(OC8 H9 )6 ] (1) and 2,3,9,10-tra(2,6-dimethylphenoxy)-15,18,22,25-traza(2,7-di-tert-butylpyrene)[4,5]phthalocyaninato zinc compound Zn[Pc(Pz-pyrene)2 (OC8 H9 )4 ] (2) were isolated for the first time. These unsymmetrical pyrene-fused phthalocyanine derivatives have been characterized by a wide range of spectroscopic and electrochemical methods. In particular, the pyrene-fused phthalocyanine structure was unambiguously revealed on the basis of single crystal X-ray diffraction analysis of 1, representing the first structurally characterized phthalocyanine derivative fused with an aromatic moiety larger than benzene. PMID:25639659

  14. Syntheses of Octasubstituted Metal Phthalocyanines for Nonlinear Optics

    NASA Technical Reports Server (NTRS)

    Guo, Huaisong; Townsend, Cheryl; Sanghadasa, Mohan; Amai, Robert L. S.; Clark, Ronald D.; Penn, Benjamin

    1998-01-01

    Many organic materials can be used as nonlinear optical media. Phthalocyanines are of special interest because they show an unusually large third order nonlinear response, they are thermally and photochemically stable and they can be formed into oriented thin films (Langmuir-Blodgett films). They also can be easily complexed by a large variety of metals, which place them at the interface between organics and organometallics, and allows for fine tuning of the macro cycle electronic properties by the coordinated metal and substituent groups. A series of 1,4,8,11,15,18,22,25-octaalkoxy metal-free and metal phthalocyanines and 2,3,9,10,16,17,23,24-octaalkoxy metal phthalocyanines has been synthesized. Their nonlinear optical properties have been measured. The physical properties of all the phthalocyanines synthesized in this work are subject to both acid and solvent effects.

  15. Uranyl phthalocyanines show promise in the treatment of brain tumors

    NASA Technical Reports Server (NTRS)

    Frigerio, N. A.

    1967-01-01

    Processes synthesize sulfonated and nonsulfonated uranyl phthalocyanines for application in neutron therapy of brain tumors. Tests indicate that the compounds are advantageous over the previously used boron and lithium compounds.

  16. Nanoparticle Stabilized Liposomes for Acne Therapy

    NASA Astrophysics Data System (ADS)

    Fu, Victoria

    Acne vulgaris is a common skin disease that affects over 40 million people in the United States alone. The main cause of acne vulgaris is Propionibacterium acnes (P. acnes), resides deep in the pores and follicles of the skin in order to feed on oil produced by the sebaceous glands. The liposome is a lipid based nanoparticle with numerous advantages over free drug molecules as an acne treatment alternative. Bare liposomes loaded with lauric acid (LipoLA) were found to show strong antimicrobial activity against P. acnes while generating minimal toxicity. However, the platform is limited by the spontaneous tendency of liposomes to fuse with each other. Attaching nanoparticles to the surface of liposomes can overcome this challenge by providing steric repulsion and reduce surface tension. Thus, carboxyl-functionalized gold nanoparticles (AuC) were attached to the surface of liposomes (AuC-liposomes) loaded with doxycycline, a general tetracycline antibiotic. These particles were found to have a diameter of 120 nm and a zeta potential of 20.0 mV. Both fluorescent and antimicrobial studies demonstrated that based on electrostatic interaction, negatively charged AuC attached to the liposome's positively charged surface and stabilized liposomes in a neutral pH environment (pH = 7.4). Upon entering the skin's acidic environment (pH = 4), AuC detached from the liposome's surface and liposomes could fuse with P. acnes residing in the pores. Furthermore, toxicity studies showed that AuC-liposomes did not induce any significant toxicity, while two of the leading over-the-counter therapies, benzoyl peroxide and salicylic acid, generated substantial skin irritation.

  17. Topical photodynamic therapy using transfersomal aluminum phthalocyanine tetrasulfonate: in vitro and in vivo study.

    PubMed

    Kassab, Kawser; El Fadeel, Doaa Abd; Fadel, Maha

    2013-09-01

    The efficacy of transfersomes (flexible liposomes) as a novel technique for topical delivery of the hydrophilic tetra-anionic photodynamic sensitizer aluminum (III) phthalocyanine tetrasulfonate (AlPcS4) was investigated, on mammalian fibroblasts and on Balb/c mice dorsal skin. AlPcS4 was loaded in transfersomes composed of phosphatidylcholine/sodium deoxycholate (5:1, 10:1, and 15:1?w/w, ratios), resulting in 110-, 160-, and 200-nm mean size vesicles with encapsulation efficiencies of 16, 25, and 30 %, respectively. In vitro studies on baby hamster kidney-21 fibroblasts revealed twofold enhancement of the photocytotoxicity of AlPcS4 loaded in transfersomes (Trans-AlPcS4), compared to free AlPcS4 dissolved in culture medium. The photocytotoxicity of Trans-AlPcS4 was less dependent on the incubation time with cells, compared to free AlPcS4. Topical application on the dorsal skin of Balb/c mice revealed that both free AlPcS4 and Trans-AlPcS4 exhibited evident photosensitization towards mice skin, but acquiring different regions of skin. PMID:23291878

  18. Photodynamic pathogen inactivation in red cell concentrates with the silicon phthalocyanine Pc 4

    NASA Astrophysics Data System (ADS)

    Ben-Hur, Ehud; Chan, Wai-Shun; Yim, Zachary; Zuk, Maria M.; Dayal, Vinay; Roth, Nathan; Heldman, Eli; Lazlo, A.; Valeri, C. R.; Horowitz, Bernard

    2000-03-01

    The silicon phthalocyanine Pc 4, a photosensitizer activated with red light, has been studied for pathogen inactivation in red blood cell concentrates (RBCC). Pc 4 targets the envelope of pathogenic viruses such as HIV. To protect RBC during the process two main approaches are used: 1) Inclusion of quenches of reactive oxygen species produced during treatment. Tocopherol succinate was found to be most effective for this purpose. 2) Formulation of Pc 4, a lipophilic compound, in liposomes that reduce its binding to RBC but not to viruses. As a light source we used a light emitting diode array emitting at 660-680 nm. An efficient mixing device ensures homogeneous light exposure during treatment of intact RBCC. Treatment of RBCC with 5 (mu) M Pc 4 a d light results in the inactivation of >= 5.5 log10 HIV, >= 6.6 log10 VSV, and >= 5 log10 of PRV and BVDV. Parasites that can be transmitted by blood transfusion are even more sensitive than viruses. Following treatment, RBCC can be stored for 28 days at 4 degrees C with hemolysis below 1 percent. Baboon RBC circulate with an acceptable 24 hour recovery and half-life. Genetic toxicological studies of Pc 4 with or without light exposure are negative. We conclude that a process using Pc 4 and red light can potentially reduce the risk of transmitting pathogens in RBCC used for transfusion.

  19. Photophysical studies of newly derivatized mono substituted phthalocyanines grafted onto silica nanoparticles via click chemistry.

    PubMed

    Fashina, Adedayo; Amuhaya, Edith; Nyokong, Tebello

    2015-04-01

    This work reports on the synthesis, characterization and photophysical studies of newly derived phthalocyanine complexes and the phthalocyanine-silica nanoparticles conjugates. The derived phthalocyanine complexes have one terminal alkyne group. The derived phthalocyanine complexes showed improved photophysical properties (?F, ?T, ?? and ?T) compared to the respective phthalocyanine complexes from which they were derived. The derived phthalocyanine complexes were conjugated to the surface of an azide functionalized silica nanoparticles via copper (1) catalyzed cyclo-addition reaction. All the conjugates showed lower triplet quantum yields ranging from 0.37 to 0.44 compared to the free phthalocyanine complexes. The triplet lifetimes ranged from 352 to 484?s for the conjugates and from 341 to 366?s for the free phthalocyanine complexes. PMID:25615674

  20. Formation of iodinated nickel phthalocyanine thin films by double-source evaporation of iodine and nickel phthalocyanine

    Microsoft Academic Search

    M. Yudasaka; K. Hironaga; K. Nakanishi

    1991-01-01

    Thin films of iodinated nickel phthalocyanine were made by double-source evaporation of nickel phthalocyanine and iodine in vacuum. They were obtained by keeping the substrate temperature at about ?90 °C. The c axes of crystallites composing the film were almost perpendicular to the quartz glass substrate. The conductivities of the films were 0.1–1 S\\/cm at room temperature which decreased slightly

  1. Possible Side Effects of Liposomal Doxorubicin

    Cancer.gov

    Page of 1Possible Side Effects of Liposomal Doxorubicin (Table Version Date: October 24, 2013) COMMON, SOME MAY BE SERIOUS In 100 people receiving Liposomal Doxorubicin, more than 20 and up to 100 may have: Hair loss Vomiting, nausea Sores in mouth and

  2. Recent advances with liposomes as pharmaceutical carriers

    Microsoft Academic Search

    Vladimir P. Torchilin

    2005-01-01

    Liposomes — microscopic phospholipid bubbles with a bilayered membrane structure — have received a lot of attention during the past 30 years as pharmaceutical carriers of great potential. More recently, many new developments have been seen in the area of liposomal drugs — from clinically approved products to new experimental applications, with gene delivery and cancer therapy still being the

  3. Liposomal Nanocapsules in Food Science and Agriculture

    Microsoft Academic Search

    T. Matthew Taylor; Jochen Weiss; P. Michael Davidson; Barry D. Bruce

    2005-01-01

    Liposomes, spherical bilayer vesicles from dispersion of polar lipids in aqueous solvents, have been widely studied for their ability to act as drug delivery vehicles by shielding reactive or sensitive compounds prior to release. Liposome entrapment has been shown to stabilize encapsulated, bioactive materials against a range of environmental and chemical changes, including enzymatic and chemical modification, as well as

  4. Copper phthalocyanine as an efficient dopant in development of solar cells

    Microsoft Academic Search

    Anto Regis Inigo; Francis P. Xavier; George J. Goldsmith

    1997-01-01

    Organic semiconductors having conjugate bonds, such as phthalocyanines, are well known photoconductors. Phthalocyanines absorb light on either side of blue-green region in the visible spectrum. And polyaniline which has conjugate bonds is photosensitive. When polyaniline thin films are prepared with copper phthalocyanine powder the magnitude of absorption of the films not only increases but also broadens, indicating a wide absorption

  5. Quantifying the effects of melittin on liposomes.

    PubMed

    Popplewell, J F; Swann, M J; Freeman, N J; McDonnell, C; Ford, R C

    2007-01-01

    Melittin, the soluble peptide of bee venom, has been demonstrated to induce lysis of phospholipid liposomes. We have investigated the dependence of the lytic activity of melittin on lipid composition. The lysis of liposomes, measured by following their mass and dimensions when immobilised on a solid substrate, was close to zero when the negatively charged lipids phosphatidyl glycerol or phosphatidyl serine were used as the phospholipid component of the liposome. Whilst there was significant binding of melittin to the liposomes, there was little net change in their diameter with melittin binding reversed upon salt injection. For the zwitterionic phosphatidyl choline the lytic ability of melittin is dependent on the degree of acyl chain unsaturation, with melittin able to induce lysis of liposomes in the liquid crystalline state, whilst those in the gel state showed strong resistance to lysis. By directly measuring the dimensions and mass changes of liposomes on exposure to melittin using Dual Polarisation Interferometry, rather than following the florescence of entrapped dyes we attained further information about the initial stages of melittin binding to liposomes. PMID:17092481

  6. A comparative photophysicochemical study of phthalocyanines encapsulated in core-shell silica nanoparticles.

    PubMed

    Fashina, Adedayo; Amuhaya, Edith; Nyokong, Tebello

    2015-02-25

    This work presents the synthesis and characterization of a new zinc phthalocyanine complex tetrasubstituted with 3-carboxyphenoxy in the peripheral position. The photophysical properties of the new complex are compared with those of phthalocyanines tetra substituted with 3-carboxyphenoxy or 4-carboxyphenoxy at non-peripheral positions. Three phthalocyanine complexes were encapsulated within silica matrix to form a core shell and the hybrid nanoparticles particles obtained were spherical and mono dispersed. When encapsulated within the silica shell nanoparticles, phthalocyanines showed improved triplet quantum yields and singlet oxygen quantum yields than surface grafted derivatives. The improvements observed could be attributed to the protection provided for the phthalocyanine complexes by the silica matrix. PMID:25228037

  7. A comparative photophysicochemical study of phthalocyanines encapsulated in core-shell silica nanoparticles

    NASA Astrophysics Data System (ADS)

    Fashina, Adedayo; Amuhaya, Edith; Nyokong, Tebello

    2015-02-01

    This work presents the synthesis and characterization of a new zinc phthalocyanine complex tetrasubstituted with 3-carboxyphenoxy in the peripheral position. The photophysical properties of the new complex are compared with those of phthalocyanines tetra substituted with 3-carboxyphenoxy or 4-carboxyphenoxy at non-peripheral positions. Three phthalocyanine complexes were encapsulated within silica matrix to form a core shell and the hybrid nanoparticles particles obtained were spherical and mono dispersed. When encapsulated within the silica shell nanoparticles, phthalocyanines showed improved triplet quantum yields and singlet oxygen quantum yields than surface grafted derivatives. The improvements observed could be attributed to the protection provided for the phthalocyanine complexes by the silica matrix.

  8. Photophysical properties of dendrimer phthalocyanine-functionalized single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Yang, Hongqin; He, Dandan; Peng, Yiru; Ma, Dongdong; Wang, Yuhua

    2012-11-01

    The photophysical properties of a novel series dendrimer phthalocyanine-SWNTs nanoconjugates in which the dendrimer phthalocyanine was tetra-[3,5-di-(4-carboxylic benzyloxy)benzyloxy] zinc(?) phthalocyanine covalently linked with SWNTs using ethylenediamine or hexamethylenediamine as space linkers were investigated in detailed by the fluorescent spectra and time-resolved spectroscopy. The photoindued intramolecular electron was transferred from phthalocyanine (donor) to carbon nanotubes (acceptor). Novel functionalized constituents in this work are fundamentally important due to the synergy effects of carbon nanotubes and dendritic zinc phthalocyanine, which may find potential applications in the drug delivery, biological labels and many other related fields.

  9. Phthalocyanines prepared from 4-chloro-\\/4-hexylthio-5-(4-phenyloxyacetic acid)phthalonitriles and functionalization of the related phthalocyanines with hydroxymethylferrocene

    Microsoft Academic Search

    Meryem Çamur; Mustafa Bulut

    2010-01-01

    The phthalonitrile derivative chosen for the synthesis of substituted phthalocyanines [M: 2H, Zn(II), Co(II)] with four chloro and four phenyloxyacetic acid substituents on the periphery is 4-chloro-5-(4-phenyloxyacetic acid)phthalonitrile. The sodium salt of carboxyl substituted zinc phthalocyanine is good soluble in water. Further reactions of zinc and cobalt phthalocyanines bearing phenyloxyacetic acid with thionylchloride gave the corresponding acylchlorides. This functional group

  10. Liposomes as delivery systems for antineoplastic drugs

    NASA Astrophysics Data System (ADS)

    Medina, Luis Alberto

    2014-11-01

    Liposome drug formulations are defined as pharmaceutical products containing active drug substances encapsulated within the lipid bilayer or in the interior aqueous space of the liposomes. The main importance of this drug delivery system is based on its drastic reduction in systemic dose and concomitant systemic toxicity that in comparison with the free drug, results in an improvement of patient compliance and in a more effective treatment. There are several therapeutic drugs that are potential candidates to be encapsulated into liposomes; particular interest has been focused in therapeutic and antineoplastic drugs, which are characterized for its low therapeutic index and high systemic toxicity. The use of liposomes as drug carriers has been extensively justified and the importance of the development of different formulations or techniques to encapsulate therapeutic drugs has an enormous value in benefit of patients affected by neoplastic diseases.

  11. Ambipolar copper phthalocyanine transistors with carbon nanotube array electrodes

    NASA Astrophysics Data System (ADS)

    Cicoira, Fabio; Coppedé, Nicola; Iannotta, Salvatore; Martel, Richard

    2011-05-01

    We report on organic thin film transistors (OTFTs) based on copper phthalocyanine (CuPc) having electrodes consisting of isolated carbon nanotube (CNT) arrays embedded in the organic layer. CuPc OTFT with CNT array electrodes show p-type behavior with Ohmic hole injection, high hole mobility, and enhanced switching characteristics at low voltage. The p-type devices are converted to ambipolar OTFT by vacuum annealing. Despite the large offset between the CNT work function and the CuPc energy levels, electron injection characteristics are also Ohmic. The extension of CNT electrodes to the phthalocyanine family confirms the validity of this contact approach for organic electronic devices.

  12. Photoconductivity of iodine-doped single crystals of phthalocyanine

    Microsoft Academic Search

    Francis P Xavier; George J Goldsmith

    1995-01-01

    Single crystals of metal-free phthalocyanine (H2Pc) and of copper phthalocyanine (CuPc) were grown in the presence of iodine vapour. The presence of iodine enhances the spectral\\u000a dependence of photoconductivity of H2Pc in the visible region but of CuPc in the near-IR region. The dark current is decreased but the photocurrent is increased\\u000a by one order of magnitude in iodine-doped H2Pc

  13. Efficient passivated phthalocyanine-quantum dot solar cells.

    PubMed

    Blas-Ferrando, Vicente M; Ortiz, Javier; González-Pedro, Victoria; Sánchez, Rafael S; Mora-Seró, Iván; Fernández-Lázaro, Fernando; Sastre-Santos, Ángela

    2015-01-31

    The power conversion efficiency of CdSe and CdS quantum dot sensitized solar cells is enhanced by passivation with asymmetrically substituted phthalocyanines. The introduction of the phthalocyanine dye increases the efficiency up to 45% for CdSe and 104% for CdS. The main mechanism causing this improvement is the quantum dot passivation. This study highlights the possibilities of a new generation of dyes designed to be directly linked to QDs instead of the TiO2 electrodes. PMID:25519050

  14. New biotinylated phthalocyanines for the photodynamic therapy of cancer

    NASA Astrophysics Data System (ADS)

    Hirth, Andreas; Bartik, Bernd; Bogdahn-Rai, Tatjana; Woehrle, Dieter; Kaul, Sepp

    1997-12-01

    Suitable substituted phthalocyanines are promising and widely investigated photosensitizers (PS) for the photodynamic therapy of cancer (PDT). However, selective accumulation of the PSs in tumor tissues, avoiding contamination of healthy tissues, is still an unsolved central problem. We present first results on the synthesis of new biotinylated phthalocyanines as potentially selective photosensitizers when applied in a polyphasic tumor targeting (tumor cell plus first step: biotinylated/monoclonal antibody, second step: streptavidin, and third step: biotinylated PS). The binding and the photodynamic activity of biotinylated PS in this three step model is shown in tumor cell lines.

  15. Liposomal Formulation of Amphiphilic Fullerene Antioxidants

    PubMed Central

    Zhou, Zhiguo; Lenk, Robert P.; Dellinger, Anthony; Wilson, Stephen R.; Sadler, Robert; Kepley, Christopher L.

    2010-01-01

    Novel amphiphilic fullerene[70] derivatives that are rationally designed to intercalate in lipid bilayers are reported, as well as its vesicular formulation with surprisingly high loading capacity up to 65% by weight. The amphiphilic C70 bisadduct forms uniform and dimensionally stable liposomes with auxiliary natural phospholipids as demonstrated by buoyant density test, particle size distribution and 31P NMR. The antioxidant property of fullerenes is retained in the bipolarly functionalized C70 derivative, Amphiphilic Liposomal Malonylfullerene[70] (ALM) as well as in its liposomal formulations, as shown by both electron paramagnetic resonance (EPR) studies and in vitro reactive oxygen species (ROS) inhibition experiments. The liposomally formulated ALM efficiently quenched hydroxyl radicals and superoxide radicals. In addition, the fullerene liposome inhibited radical-induced lipid peroxidation and maintained the integrity of the lipid bilayer structure. This new class of liposomally formulated, amphipathic fullerene compounds represents a novel drug delivery system for fullerenes and provides a promising pathway to treat oxidative stress-related diseases. PMID:20839887

  16. Methods to monitor liposome fusion, permeability, and interaction with cells.

    PubMed

    Düzgüne?, Nejat; Faneca, Henrique; Lima, Maria C

    2010-01-01

    We describe fluorescence assays for membrane fusion involving the fusion of liposomes with each other and with cultured cells, fluorescence methods to assess liposome uptake by cells and the intracellular delivery of liposome contents, and assays to evaluate liposome membrane permeability. The Tb/DPA and ANTS/DPX assays monitor the intermixing of aqueous contents of liposomes. The NBD-PE/Rhodamine-PE assay follows the intermixing of liposomal lipids. A variation of this method is suitable for detecting the mixing of the inner monolayers of liposomes. The lipid-mixing assay is also used to study the fusion of cationic liposomes and lipoplexes with cultured cells. The intracellular delivery of liposome contents are monitored, via fluorescence microscopy or flow cytometry, by measuring the release of calcein from the liposome interior, and normalized to cell-associated liposomes quantitated with Rhodamine-PE in the membrane of the same liposomes. The release of liposome contents is monitored by the increase in fluorescence of encapsulated carboxyfluorescein, calcein, or ANTS/DPX, or by the decrease in fluorescence of encapsulated Tb/DPA. PMID:20013400

  17. Encapsulated liposomes for long-term drug delivery

    NSDL National Science Digital Library

    Powell, Adam C., IV

    2004-08-11

    Solve the steady-state radial diffusion equation in a sphere to calculate the resistance to drug diffusion through a liposome encapsulant; then compare to resistance to transport through the liposome membrane and determine the limiting step.

  18. A Review on Composite Liposomal Technologies for Specialized Drug Delivery

    PubMed Central

    Mufamadi, Maluta S.; Pillay, Viness; Choonara, Yahya E.; Du Toit, Lisa C.; Modi, Girish; Naidoo, Dinesh; Ndesendo, Valence M. K.

    2011-01-01

    The combination of liposomes with polymeric scaffolds could revolutionize the current state of drug delivery technology. Although liposomes have been extensively studied as a promising drug delivery model for bioactive compounds, there still remain major drawbacks for widespread pharmaceutical application. Two approaches for overcoming the factors related to the suboptimal efficacy of liposomes in drug delivery have been suggested. The first entails modifying the liposome surface with functional moieties, while the second involves integration of pre-encapsulated drug-loaded liposomes within depot polymeric scaffolds. This attempts to provide ingenious solutions to the limitations of conventional liposomes such as short plasma half-lives, toxicity, stability, and poor control of drug release over prolonged periods. This review delineates the key advances in composite technologies that merge the concepts of depot polymeric scaffolds with liposome technology to overcome the limitations of conventional liposomes for pharmaceutical applications. PMID:21490759

  19. Investigation on copper phthalocyanine\\/multiwalled carbon nanotube interface

    Microsoft Academic Search

    L. Lozzi; S. Santucci; F. Bussolotti; S. La Rosa

    2008-01-01

    The electronic and structural properties of copper phthalocyanine deposited onto multiwalled carbon nanotubes were studied as a function of the deposition thickness. The valence band and core level spectra were investigated using photoemission spectroscopy. A shift of the organic highest occupied molecular level toward the Fermi level was observed for very thin film, together with a small shift of the

  20. Schottky gate static induction transistor using copper phthalocyanine films

    Microsoft Academic Search

    Kazuhiro Kudo; Dong Xing Wang; Masaaki Iizuka; Shigekazu Kuniyoshi; Kuniaki Tanaka

    1998-01-01

    Static induction transistors (SITs) using copper phthalocyanine films and Al Schottky gate electrode are fabricated and the basic electrical characteristics are investigated. The electrical characteristics show that the current flows from the source to drain electrodes is controlled by the Al gate voltage and a typical SIT operation with non-saturating properties is examined. Furthermore, a high power and high frequency

  1. Selective Detection of Vapor Phase Hydrogen Peroxide with Phthalocyanine Chemiresistors

    E-print Network

    Kummel, Andrew C.

    Selective Detection of Vapor Phase Hydrogen Peroxide with Phthalocyanine Chemiresistors Forest I and toxicity (OSHA PEL ) 1 ppm), vapor phase monitoring of hydrogen peroxide (H2O2) is also an important, California 92093 Received November 14, 2007; E-mail: wtrogler@ucsd.edu Vapor phase monitoring of peroxides

  2. NO Adsorption on Copper Phthalocyanine Functionalized Graphite Jun Hong Park,,

    E-print Network

    Kummel, Andrew C.

    for fabrication of graphene based chemical or bio sensors.14-16 Metal phthalocyanines (MPc) may enhance: NO dosed on a CuPc monolayer deposited on Au(111) and HOPG is observed by scanning tunneling microscopy. After dosing NO with a supersonic molecular beam source onto CuPc/Au(111), about 7% of CuPc molecules

  3. Liposomes: presentation and actual applicative trends in medicine.

    PubMed

    Bejan, A; Turcu, G

    1995-01-01

    In this paper the main aspects of characterization, handling and applications of liposomes are presented. In the last 25 years much attention has been focused to liposomal systems for optimization of the drug targeting. Several pathways to optimize the drug action of liposomes in various situations as cancer, microbial therapy, vaccines, oral therapy and diagnosis were tested. Certain applications of liposomes especially those implying the phagocytic cells sustain a real interest for industrial applications. PMID:8646185

  4. Photodegradation of Lecithin Liposomes by Nanoparticulate Titanium Dioxide

    Microsoft Academic Search

    Aihua Zou; Qiang Gu; Jing Wang; Chunwei Yuan; Rong Guo

    2003-01-01

    Lecithin liposomes were studied by transmission electron microscopy (TEM), selected?area electron diffraction (SAED), IR, and GC?MS. Results indicate that titanium dioxide (TiO2) nanoparticles can gain access into lecithin liposomes during sonication and the lecithin liposomes can be effectively decomposed upon illumination with near?UV light.

  5. Electronic structure and bonding in metal phthalocyanines, Metal=Fe, Co, Ni, Cu, Zn, Mg

    Microsoft Academic Search

    Meng-Sheng Liao; Steve Scheiner

    2001-01-01

    Electronic structure and bonding in metal phthalocyanines (Metal=Fe, Co, Ni, Cu, Zn, Mg) is investigated in detail using a density functional method. The metal atoms are strongly bound to the phthalocyanine ring in each case, by as much as 10 eV. The calculated orbital energy levels and relative total energies of these D4h structures indicate that Fe and Co phthalocyanines

  6. Preparation and properties of polymer-encapsulated phthalocyanine blue pigment via emulsion polymerization

    Microsoft Academic Search

    Shaohai Fu; Changsen Du; Mingjun Zhang; Anli Tian; Xia Zhang

    Polymer-encapsulated phthalocyanine blue pigment dispersion was prepared with a polymerizable dispersant by emulsion polymerization method, and the effect of preparation conditions on the particle size of dispersion was investigated. Dynamic light scattering measurement demonstrated that allyloxy nonyl-phenoxypropanolpolyoxyethyleneetherammonium sulfonate (ANPS) was suitable for phthalocyanine blue pigment modification. The polymer-encapsulated phthalocyanine blue pigment dispersion with the small particles was obtained when the

  7. Hydrogen peroxide vapor sensor using metal-phthalocyanine functionalized carbon nanotubes

    Microsoft Academic Search

    A. L. Verma; Swasti Saxena; G. S. S. Saini; Vikesh Gaur; V. K. Jain

    2011-01-01

    We have developed a process for preparation of composites by blending and ultrasonification of multi-walled carbon nanotubes with metal-phthalocyanines and have used the same as very selective and sensitive sensor for detection of H2O2 vapors. A combination of sensors made from composites of cobalt-phthalocyanine and copper-phthalocyanine with multiwall carbon nanotubes has been found to show opposite conductivities to H2O2 vapors

  8. Zn(II)-phthalocyanine as a photodynamic agent for tumours. II. Studies on the mechanism of photosensitised tumour necrosis.

    PubMed Central

    Milanesi, C.; Zhou, C.; Biolo, R.; Jori, G.

    1990-01-01

    The mechanism of tumour necrosis photosensitised by liposome-delivered Zn(II) phthalocyanine (Zn-Pc) has been studied in mice bearing a transplanted MS-2 fibrosarcoma. Ultrastructural analyses of tumour specimens obtained at different times after red light-irradiation (300 J cm-2, dose-rate 180 mW cm-2) indicate an early (3 h) photodamage of malignant cells especially at the level of the mitochondria and rough endoplasmic reticulum. The cellular damage becomes more evident between 6 h and 15 h after photodynamic therapy. On the other hand, the capillaries supplying the tumour tissue are modified at a much slower rate and appear to be severely damaged only after 15 h from irradiation, when the whole tissue becomes necrotic. Occasionally, mildly damaged capillaries are observed even at 72 h after irradiation. These findings support the hypothesis that low density lipoproteins (LDL) play a major role in the delivery of Zn-Pc to the tumour tissue; the photosensitiser is released specifically to malignant cells as a consequence of a receptor-mediated endocytosis of LDL. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:2372486

  9. Laser-induced damage to stained liposomes Dégats induite par l'action du laser sur les liposomes tachées

    Microsoft Academic Search

    Nooshin Jamasbi; Mehrdad Mohebi; Martha O. Rivera Hernandez

    1998-01-01

    In this work we have studied the damaging effect of laser light on cell membranes using single bilayer liposomes as a model system. Liposomes, because of their structural similarities to membranes of biological cells, are the best model systems used for the investigation of the effect of laser radiation on biomembranes. Samples of liposomes were routinely prepared and stained in

  10. A combination of liposomal sunitinib plus liposomal irinotecan and liposome co-loaded with two drugs enhanced antitumor activity in PC12-bearing mouse.

    PubMed

    Maitani, Yoshie; Saito, Hiroshi; Seishi, Yuki; Iwase, Yuko; Yamauchi, Takayasu; Higashiyama, Kimio; Sugino, Takashi

    2012-12-01

    Pheochromocytomas are highly angiogenic neuroendocrine tumors. The side effects of treatment with cytotoxic agents frequently outweigh the benefits. Neuroendocrine tumors are highly angiogenic, dependent on vascular endothelial growth factor and receptor (VEGFR) activation. Sunitinib has antitumor and antiangiogenic activities that target VEGFRs. We investigated the antitumor activity of liposomal sunitinib and irinotecan alone and in combination. Liposomal sunitinib and irinotecan, and liposomes co-loaded with both drugs were prepared, and antitumor activity and biodistribution were examined in nude mice bearing PC12 tumors. Liposomal sunitinib increased in life span (ILS, 14.3%) compared with free sunitinib (-17.1% ILS) with moderate tumor growth suppression, whereas liposomal irinotecan suppressed tumor growth significantly without a survival benefit compared with free irinotecan (-21.7 and -13.3% ILSs, respectively). The combination of liposomal sunitinib plus liposomal irinotecan, and liposomes co-loaded with both drugs, induced significant inhibition of tumor growth and increased life-span more than the combination of free drugs. Accumulation of irinotecan in tumors by the combination of the two liposomal drugs and liposomes co-loaded with both drugs was significantly increased compared with the combination of free drugs. This study provides novel formulations of sunitinib and irinotecan in combination for the treatment of pheochromocytoma. PMID:23050928

  11. Light-Activated Content Release from Liposomes

    PubMed Central

    Leung, Sarah J.; Romanowski, Marek

    2012-01-01

    Successful integration of diagnostic and therapeutic actions at the level of individual cells requires new materials that combine biological compatibility with functional versatility. This review focuses on the development of liposome-based functional materials, where payload release is activated by light. Methods of sensitizing liposomes to light have progressed from the use of organic molecular moieties to the use of metallic plasmon resonant structures. This development has facilitated application of near infrared light for activation, which is preferred for its deep penetration and low phototoxicity in biological tissues. Presented mechanisms of light-activated liposomal content release enable precise in vitro manipulation of minute amounts of reagents, but their use in clinical diagnostic and therapeutic applications will require demonstration of safety and efficacy. PMID:23139729

  12. Dehydration resistance of liposomes containing trehalose glycolipids

    NASA Astrophysics Data System (ADS)

    Nyberg, Kendra; Goulding, Morgan; Parthasarathy, Raghuveer

    2010-03-01

    The pathogen, Mycobacterium tuberculosis, has an unusual outer membrane containing trehalose glycolipids that may contribute to its ability to survive freezing and dehydration. Based on our recent discovery that trehalose glycolipids confer dehydration resistance to supported lipid monolayers (Biophys. J. 94: 4718-4724 (2008); Langmuir 25: 5193-5198, (2009)), we hypothesized that liposomes containing synthetic trehalose glycolipids may be dehydration-resistant as well. To test this, we measured the leakage of encapsulated fluorophores and larger macromolecular cargo from such liposomes subject to freeze drying. Both leakage assays and size measurements show that the liposomes are dehydration-resistant. In addition to demonstrating a possibly technologically useful encapsulation platform, our results corroborate the view that encapsulation in a trehalose-glycolipid-rich membrane is a biophysically viable route to protection of mycobacteria from environmental stresses.

  13. Bioavailability of Polyphenol Liposomes: A Challenge Ahead

    PubMed Central

    Mignet, Nathalie; Seguin, Johanne; Chabot, Guy G.

    2013-01-01

    Dietary polyphenols, including flavonoids, have long been recognized as a source of important molecules involved in the prevention of several diseases, including cancer. However, because of their poor bioavailability, polyphenols remain difficult to be employed clinically. Over the past few years, a renewed interest has been devoted to the use of liposomes as carriers aimed at increasing the bioavailability and, hence, the therapeutic benefits of polyphenols. In this paper, we review the causes of the poor bioavailability of polyphenols and concentrate on their liposomal formulations, which offer a means of improving their pharmacokinetics and pharmacodynamics. The problems linked to their development and their potential therapeutic advantages are reviewed. Future directions for liposomal polyphenol development are suggested. PMID:24300518

  14. Thermally-Gated Liposomes: A Closer Look

    PubMed Central

    Petrov, Ravil R.; Chen, Wen-Hua; Regen, Steven L.

    2009-01-01

    A homologous series of pore-forming amphiphiles (PFAs), derived from cholic acid, lysine and spermine, have been used as “thermal-gates” for releasing sucrose from liposomes made from 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and 1,2-dipalmitoyl-sn-glycero-e-[phospho-rac(1-glycerol)] (sodium salt) [DPPG]. Binding measurements have established that these PFAs are fully bound to these liposomes in their gel state, and that their transfer to fluid phase membranes is negligible. Release experiments have shown that thermal-gating is sensitive to both the size and the concentration of the PFA that is used. Increases in the extent of release of sucrose with increasing temperature that have been found in the gel/fluid coexistence region indicate the existence of heterogeneity among the liposomes. PMID:19374405

  15. Frontispiece: unsymmetrical pyrene-fused phthalocyanine derivatives: synthesis, structure, and properties.

    PubMed

    Pan, Houhe; Chen, Chao; Wang, Kang; Li, Wenjun; Jiang, Jianzhuang

    2015-02-16

    Unsymmetrical Pyrene-Fused Phthalocyanine In the Communication on page?3168?ff., J. Jiang et?al. present novel pyrene-fused unsymmetrical phthalocyanine derivatives, which were isolated and characterized by a wide range of spectroscopic and electrochemical methods for the first time. In particular, the pyrene-fused phthalocyanine structure was unambiguously revealed on the basis of single crystal X-ray diffraction analysis of the monopyrene-fused phthalocyaninato zinc derivative, representing the first structurally characterized phthalocyanine derivative fused with an aromatic moiety larger than benzene. PMID:25656398

  16. Accumulation, internalization and therapeutic efficacy of neuropilin-1-targeted liposomes

    PubMed Central

    Paoli, Eric E.; Ingham, Elizabeth S.; Zhang, Hua; Mahakian, Lisa M.; Fite, Brett Z.; Gagnon, M. Karen; Tam, Sarah; Kheirolomoom, Azadeh; Cardiff, Robert D.; Ferrara, Katherine W.

    2014-01-01

    Advancements in liposomal drug delivery have produced long circulating and very stable drug formulations. These formulations minimize systemic exposure; however, unfortunately, therapeutic efficacy has remained limited due to the slow diffusion of liposomal particles within the tumor and limited release or uptake of the encapsulated drug. Here, the carboxyl-terminated CRPPR peptide, with affinity for the receptor neuropilin-1 (NRP), which is expressed on both endothelial and cancer cells, was conjugated to liposomes to enhance the tumor accumulation. Using a pH sensitive probe, liposomes were optimized for specific NRP binding and subsequent cellular internalization using in vitro cellular assays. Liposomes conjugated with the carboxyl-terminated CRPPR peptide (termed C-LPP liposomes) bound to the NRP-positive primary prostatic carcinoma cell line (PPC-1) but did not bind to the NRP-negative PC-3 cell line, and binding was observed with liposomal peptide concentrations as low as 0.16 mol%. Binding of the C-LPP liposomes was receptor-limited, with saturation observed at high liposome concentrations. The identical peptide sequence bearing an amide terminus did not bind specifically, accumulating only with a high (2.5 mol%) peptide concentration and adhering equally to NRP positive and negative cell lines. The binding of C-LPP liposomes conjugated with 0.63 mol% of the peptide was 83-fold greater than liposomes conjugated with the amide version of the peptide. Cellular internalization was also enhanced with C-LPP liposomes, with 80% internalized following 3hr incubation. Additionally, fluorescence in the blood pool (~40% of the injected dose) was similar for liposomes conjugated with 0.63 mol% of carboxyl-terminated peptide and non-targeted liposomes at 24 hr after injection, indicating stable circulation. Prior to doxorubicin treatment, in vivo tumor accumulation and vascular targeting were increased for peptide-conjugated liposomes compared to non-targeted liposomes based on confocal imaging of a fluorescent cargo, and the availability of the vascular receptor was confirmed with ultrasound molecular imaging. Finally, over a 4-week course of therapy, tumor knockdown resulting from doxorubicin-loaded, C-LPP liposomes was similar to non-targeted liposomes in syngeneic tumor-bearing FVB mice and C-LPP liposomes reduced doxorubicin accumulation in the skin and heart and eliminated skin toxicity. Taken together, our results demonstrate that a carboxyl-terminated RXXR peptide sequence, conjugated to liposomes at a concentration of 0.63 mol%, retains long circulation but enhances binding and internalization, and reduces toxicity. PMID:24434424

  17. Sterically Stabilized Liposomes: Improvements in Pharmacokinetics and Antitumor Therapeutic Efficacy

    NASA Astrophysics Data System (ADS)

    Papahadjopoulos, D.; Allen, T. M.; Gabizon, A.; Mayhew, E.; Matthay, K.; Huang, S. K.; Lee, K.-D.; Woodle, M. C.; Lasic, D. D.; Redemann, C.; Martin, F. J.

    1991-12-01

    The results obtained in this study establish that liposome formulations incorporating a synthetic polyethylene glycol-derivatized phospholipid have a pronounced effect on liposome tissue distribution and can produce a large increase in the pharmacological efficacy of encapsulated antitumor drugs. This effect is substantially greater than that observed previously with conventional liposomes and is associated with a more than 5-fold prolongation of liposome circulation time in blood, a marked decrease in uptake by tissues such as liver and spleen, and a corresponding increased accumulation in implanted tumors. These and other properties described here have expanded considerably the prospects of liposomes as an effective carrier system for a variety of pharmacologically active macromolecules.

  18. Recent Trends of Polymer Mediated Liposomal Gene Delivery System

    PubMed Central

    Lee, Sang-Soo; George Priya Doss, C.; Yagihara, Shin; Kim, Do-Young

    2014-01-01

    Advancement in the gene delivery system have resulted in clinical successes in gene therapy for patients with several genetic diseases, such as immunodeficiency diseases, X-linked adrenoleukodystrophy (X-ALD) blindness, thalassemia, and many more. Among various delivery systems, liposomal mediated gene delivery route is offering great promises for gene therapy. This review is an attempt to depict a portrait about the polymer based liposomal gene delivery systems and their future applications. Herein, we have discussed in detail the characteristics of liposome, importance of polymer for liposome formulation, gene delivery, and future direction of liposome based gene delivery as a whole. PMID:25250340

  19. Mechanical properties of a giant liposome studied using optical tweezers

    NASA Astrophysics Data System (ADS)

    Shitamichi, Yoko; Ichikawa, Masatoshi; Kimura, Yasuyuki

    2009-09-01

    The mechanical properties of a micrometer-sized giant liposome are studied by deforming it from the inside using dual-beam optical tweezers. As the liposome is extended, its shape changes from a sphere to a lemon shape, and finally, a tubular part is generated. The surface tension ? and the bending rigidity ? of the lipid membrane are obtained from the measured force-extension curve. In a one-phase liposome, it was found that ? increases as the charged component increases but ? remains approximately constant. In a two-phase liposome, the characteristic deformation and the force-extension curve differ from those observed for the one-phase liposome.

  20. Liposomes for Use in Gene Delivery

    PubMed Central

    Balazs, Daniel A.; Godbey, WT.

    2011-01-01

    Liposomes have a wide array of uses that have been continuously expanded and improved upon since first being observed to self-assemble into vesicular structures. These arrangements can be found in many shapes and sizes depending on lipid composition. Liposomes are often used to deliver a molecular cargo such as DNA for therapeutic benefit. The lipids used to form such lipoplexes can be cationic, anionic, neutral, or a mixture thereof. Herein physical packing parameters and specific lipids used for gene delivery will be discussed, with lipids classified according to overall charge. PMID:21490748

  1. Development of liposomal amphotericin B formulation.

    PubMed

    Gulati, M; Bajad, S; Singh, S; Ferdous, A J; Singh, M

    1998-01-01

    A considerable effort has been spent in the past three decades to investigate various aspects of liposomes as novel drug delivery systems. In 1990, the first amphotericin B (AmB) liposomal preparation (L-AmB) under the brand name AmBisome was introduced into the market by Vestar. The successful marketing of the product moved liposomes out of the stage of experimental obscurity to the realistic stage of clinical utility. The launch of AmBisome sparked off the introduction of other lipid-based AmB products marketed by Liposome Technology (Amphocil) and The Liposome Co. (Abelcet). The drive behind the development of a modified formulation of AmB was to improve the therapeutic index of this drug with respect to its major drawback associated with both acute and chronic toxic effects. In a 30-year-long experience with AmB, several reports were recorded in the literature of acute adverse effects, such as fever, rigors, vomiting, cardiotoxicity and hypotension occurring during infusion; while long-term therapy was reported to be associated with hypokalemia, renal dysfunction and hematological abnormalities. Another serious problem encountered with the drug had been the poor response obtained in immunocompromised patients like those with AIDS, neutropenia and cancer patients on chemotherapy. The encapsulation of amphotericin B in liposomal vesicles was hence targeted not only to obtain an improvement in the therapeutic index but also to see if it was useful in eradicating deep-seated fungal infections in immunocompromised patients. The liposomal AmB was found to have a better therapeutic index and lower toxicity than the commercial AmB preparations. The LD50 of AmBisome in mouse was 175 mg/kg compared with 3.7 mg/kg for Fungizone, the commercial preparation of AmB. Additionally, L-AmB has prolonged circulation time, and extravasates into the site of infection and delivers the drug directly to the site, with no nephrotoxicity and neurotoxicity as experienced with AmB. This review traces the course of development of L-AmB and discusses the rationale behind the development of its liposomal preparation. The results in in vitro, in vivo and clinical studies, mechanism of action, biodistribution, and formulation considerations of L-AmB are described. The clinical experience with the marketed preparation is reviewed. PMID:9532520

  2. Overcoming cellular and tissue barriers to improve liposomal drug delivery

    NASA Astrophysics Data System (ADS)

    Kohli, Aditya G.

    Forty years of liposome research have demonstrated that the anti-tumor efficacy of liposomal therapies is, in part, driven by three parameters: 1) liposome formulation and lipid biophysics, 2) accumulation and distribution in the tumor, and 3) release of the payload at the site of interest. This thesis outlines three studies that improve on each of these delivery steps. In the first study, we engineer a novel class of zwitterlipids with an inverted headgroup architecture that have remarkable biophysical properties and may be useful for drug delivery applications. After intravenous administration, liposomes accumulate in the tumor by the enhanced permeability and retention effect. However, the tumor stroma often limits liposome efficacy by preventing distribution into the tumor. In the second study, we demonstrate that depletion of hyaluronan in the tumor stroma improves the distribution and efficacy of DoxilRTM in murine 4T1 tumors. Once a liposome has distributed to the therapeutic site, it must release its payload over the correct timescale. Few facile methods exist to quantify the release of liposome therapeutics in vivo. In the third study, we outline and validate a simple, robust, and quantitative method for tracking the rate and extent of release of liposome contents in vivo. This tool should facilitate a better understanding of the pharmacodynamics of liposome-encapsulated drugs in animals. This work highlights aspects of liposome behavior that have prevented successful clinical translation and proposes alternative approaches to improve liposome drug delivery.

  3. [Characterization and cytotoxicity of mixed PEG-DSG modified liposomes].

    PubMed

    Sadzuka, Yasuyuki; Tsuruda, Tomoko; Sonobe, Takashi

    2005-01-01

    It is known that polyethyleneglycol (PEG) modification of the liposome surface leads to the formation of a fixed aqueous layer around the liposomes due to interaction between the PEG polymer and water molecules, which prevents the attraction of opsonins. When a combination of PEG-distearolyglycerol (PEG-DSG) whose characteristics are remarkably different is used, interaction between molecules occurs, leading to increased fixed aqueous layer thickness (FALT). From this speculation, we studied the effect of both modification of PEG900-DSG and PEG2000-DSG modified liposome on FALT, cell uptake and biodistribution. The FALT of mixed PEG modified liposome increased, compared to that of each single PEG modified liposome. In this mixed modification, maximum FALT was shown at liposome modified by added PEG-2000:PEG-900=2:1. This most suitable additional ratio was equal to actual incorporated ratio. On the other hand, cell uptake of mixed modified liposome containing doxorubicin (DOX) was similar with that of PEG2000 modified liposome. Furthermore, mixed PEG modification of liposome was tendency to increase cytotoxicity, compared to that of other modifications. After DOX contained liposome treatment, DOX distribution in the tumor and antitumor activity of DOX increase by mixed PEG modification. In conclusion, it was suggested that mixed PEG liposome (PEG-2000:PEG-900=2:1) was useful for cancer chemotherapy. PMID:15635286

  4. Liposomes as signal amplification reagents for bioassays in microfluidic channels.

    PubMed

    Locascio, Laurie E; Hong, Jennifer S; Gaitan, Michael

    2002-03-01

    Liposomes with encapsulated carboxyfluorescein were used in an affinity-based assay to provide signal amplification for small-volume fluorescence measurements. Microfluidic channels were fabricated by imprinting in a plastic substrate material, poly(ethylene terephthalate glycol) (PETG), using a silicon template imprinting tool. Streptavidin was linked to the surface through biotinylated-protein for effective immobilization with minimal nonspecific adsorption of the liposome reagent. Lipids derivatized with biotin were incorporated into the liposome membrane to make the liposomes reactive for affinity assays. Specific binding of the liposomes to microchannel walls, dependence of binding on incubation time, and nonspecific adsorption of the liposome reagent were evaluated. The results of a competitive assay employing liposomes in the microchannels are presented. PMID:11891714

  5. Reconstructed human skin as model for liposome-skin interaction.

    PubMed

    Zellmer, S; Reissig, D; Lasch, J

    1998-11-13

    Reconstructed human skin was prepared from human keratinoblasts. After 1 week of cultivation at the air-liquid interface a stratified layer developed, similar to native human epidermis. Liposomes with an average diameter of 50 nm, made of phosphatidylcholine (PC), phosphatidylserine (PS) and human stratum corneum lipids (hSCL) were applied on top of this culture system. The rate of penetration through the reconstructed human epidermis was 1.38, 0.55 and 0.013 ng lipidh-1cm-2 for PC, hSCL and PS liposomes, respectively. Electron microscopy and confocal laser scanning microscopy showed that PS and hSCL liposomes aggregated at the skin surface, while PC liposomes remained homogeneously dispersed. Fluorescence measurements demonstrated that vesicles, made of native human stratum corneum lipids rapidly mixed with PS liposomes, weakly with hSCL liposomes and did not mix with PC liposomes. PMID:9795080

  6. Effective prodrug liposome and conversion to active metabolite.

    PubMed

    Sadzuka, Y

    2000-07-01

    Some antitumor agents encapsulated in liposomes have been used clinically. However, the usefulness of liposomes is limited to the liposomalization of active compounds. Irinotecan hydrochloride (CPT-11) is a prodrug of closed lactone ring form of SN-38, which is an active metabolite with antitumor and side toxicity. The plasma concentrations of closed CPT-11 and SN-38 increased with the liposomalization, and their blood circulation was prolonged by the polyethyleneglycol (PEG) modification. The antitumor activity of CPT-11 increased due to the elevated tumor distribution of closed CPT-11 and SN-38 levels by the PEG-modified liposomes. In the tumor, CPT-11 was converted to SN-38. Thus, it is considered that passive targeting to the tumor by liposomalization elevated the SN-38 level in the tumor especially and increased the antitumor activity of CPT-11. The closed/total ratio of SN-38 in the tumors of the liposomes group was greater than that of the CPT-11 solution group. Namely, SN-38 was thought to be generated in intact liposomes containing CPT-11. The generation of SN-38 in the liposomal membrane was shown after the incubation of liposome containing CPT-11 with carboxylesterase. It is therefore considered that part of CPT-11 is converted to SN-38 in intact liposomes. Furthermore, intestinal disorder, a side toxicity of CPT-11, decreased to depend on the closed SN-38 concentrations in the bile by liposomalization. Although the liposomes induce the improved tissue distribution of the prodrug, the tissue distribution of active metabolites do not always improve. However, CPT-11 entrapped liposome was useful. PMID:11467079

  7. GMP PRODUCTION OF LIPOSOMES PRODUCTION OF LIPOSOMES - - A NEW INDUSTRIAL APPROACH A NEW INDUSTRIAL APPROACH

    Microsoft Academic Search

    Passive entrapment of rh-Cu\\/Zn-SOD: The liposomes are produced with the multiple injection mode. The 33kDa and hydrophilic rh-Cu\\/Zn-SOD, which is produced in E.coli is passively entrapped in liposomes consisting of DPPC, cholesterol and stearylamine. The protein solution was pumped from vessel A to vessel B passing the crossflow injection module, where the ethanol\\/ lipid solution is injected into the protein

  8. Development of monodispersed and functional magnetic polymeric liposomes via simple liposome method

    Microsoft Academic Search

    Xiaofei Liang; Hanjie Wang; Xinguo Jiang; Jin Chang

    2010-01-01

    \\u000a Abstract  We are reporting a simple and rapid method to prepare superparamagnetic, controlled size, and monodispersed magnetic cationic\\u000a polymeric liposomes (MCPL) by octadecyl quaternized carboxymethyl chitosan (OQCMC) and cholesterol. The whole process is only\\u000a about 25 min with simple thin-film dispersion and solvent evaporation method. Hydrophilic magnetic nanoparticles (LM) and\\u000a hydrophobic magnetic nanoparticles (BM) can be encapsulated into these cationic polymeric liposomes,

  9. Recognition and clearance of liposomes containing phosphatidylserine are mediated by serum opsonin

    Microsoft Academic Search

    Dexi Liu; Feng Liu; Young K. Song

    1995-01-01

    Liver uptake of liposomes containing phosphatidylserine was studied in a single pass liver perfusion system and found to be serum dependent. The effectiveness of serum in mediating liposome uptake by the liver depends on liposome size. Large liposomes appeared to be opsonized more efficiently and, therefore, taken up more by the liver than the smaller ones. The effects of liposome

  10. Preparation and nonlinear optical properties of phthalocyanine nanocrystals

    NASA Astrophysics Data System (ADS)

    Nitschke, Christian; O'Flaherty, Sean M.; Kroell, Michael; Strevens, Adam; Maier, Stefanie; Ruether, Manuel G.; Blau, Werner J.

    2003-07-01

    Zinc-2, 9,16,23 -tetra- tert-butyl-29H, 31H -phthalocyanines and Zinc-2, 9,16,23-tetrakis-(phenylthio)-29H, 31H-phthalocyanines were recrystallized from an acetone solution to give regular shaped spherical particles of 50nm diameter, confirmed by transmission electron microscopy (TEM) and atomic force microscopy (AFM). A peak broadening of the Q-Band and a shift of the B-Band in the UV-Visible absorption spectrum combined with a significant fluorescence quenching was observed. The z-scan technique was used to investigate the non-linear optical properties and an increase of approximately 200% in the ratio of excited to ground state absorption cross sections in the crystal state was observed indicative of a significant increase in the optical limiting response of the crystals compared to the monomers.

  11. Optical limiting in solutions of metallo-phthalocyanines and naphthalocyanines

    NASA Technical Reports Server (NTRS)

    Coulter, Daniel R.; Miskowski, Vincent M.; Perry, Joseph W.; Wei, Tai-Huei; Van Stryland, Eric W.

    1989-01-01

    Optical limiting measurements have been made on solutions of several metal containing phthalocyanines and naphthalocyanines. Measurements at 532nm using nanosecond pulses from a Q-switched Nd:YAG laser show limiting throughputs of 1-10 millijoules with mild focussing in alcohol solutions with nominal transmissions of 30-70 percent. Measurements on chloro-aluminum-phthalocyanine solutions utilizing individual 30 psec pulses or trains (spanning about 100nsec) of modelocked pulses have shown even lower limiting throughputs. Thus, the dynamic range of the limiting behavior has been shown to cover at least three orders of magnitude. Prompt limiting is attributed to strong singlet-singlet (S1-Sn) absorption, whereas the longer time limiting behavior is postulated to result from strong triplet-triplet (T1-Tn) absorption. In addition to these studies, efforts have been underway to identify materials with reduced limiting throughput and improved optical transmission characteristics.

  12. Electrical Field Effects in Phthalocyanine Film Growth by Vapor Deposition

    NASA Technical Reports Server (NTRS)

    Banks, Curtis E.; Zhu, Shen; Frazier, Donald O.; Penn, Benjamin; Abdeldayem, Hossin; Hicks, Roslin; Sarkisov, Sergey

    1999-01-01

    Phthalocyanine, an organic material, is a very good candidate for non-linear optical application, such as high-speed switching and optical storage devices. Phthalocyanine films have been synthesized by vapor deposition on quartz substrates. Some substrates were coated with a very thin gold film for introducing electrical field. These films have been characterized by surface morphology, material structure, chemical and thermal stability, non-linear optical parameters, and electrical behaviors. The films have excellent chemical and optical stability. However, the surface of these films grown without electrical field shows flower-like morphology. When films are deposited under an electrical field ( an aligned structure is revealed on the surface. A comparison of the optical and electrical properties and the growth mechanism for these films grown with and without an electrical field will be discussed.

  13. Decorating graphene nanosheets with electron accepting pyridyl-phthalocyanines.

    PubMed

    Wibmer, Leonie; Lourenço, Leandro M O; Roth, Alexandra; Katsukis, Georgios; Neves, Maria G P M S; Cavaleiro, José A S; Tomé, João P C; Torres, Tomás; Guldi, Dirk M

    2015-03-19

    We describe herein the preparation of novel exfoliated graphene-phthalocyanine nanohybrids, and the investigation of their photophysical properties. Pyridyl-phthalocyanines (Pcs) are presented as novel electron accepting building blocks of variable strengths with great potential for the exfoliation of graphite via their immobilization onto the basal plane of graphene in dimethylformamide (DMF) affording single layered and turbostratic graphene based . were fully characterized (AFM, TEM, Raman, steady-state and pump probe transient absorption spectroscopy) and were studied in terms of electron donor-acceptor interactions in the ground and excited states. In this context, electron transfer upon photoexcitation from graphene to the electron accepting Pcs with dynamics, for example, in of <1 and 330 ± 50 ps for charge separation and charge recombination, respectively, was corroborated in a series of steady-state and time-resolved spectroscopy experiments. PMID:25740090

  14. Nanocomposite liposomes containing quantum dots and anticancer drugs for bioimaging and therapeutic delivery: a comparison of cationic, PEGylated and deformable liposomes

    NASA Astrophysics Data System (ADS)

    Wen, Chih-Jen; Sung, Calvin T.; Aljuffali, Ibrahim A.; Huang, Yu-Jie; Fang, Jia-You

    2013-08-01

    Multifunctional liposomes loaded with quantum dots (QDs) and anticancer drugs were prepared for simultaneous bioimaging and drug delivery. Different formulations, including cationic, PEGylated and deformable liposomes, were compared for their theranostic efficiency. We had evaluated the physicochemical characteristics of these liposomes. The developed liposomes were examined using experimental platforms of cytotoxicity, cell migration, cellular uptake, in vivo melanoma imaging and drug accumulation in tumors. The average size of various nanocomposite liposomes was found to be 92-134 nm. Transmission electron microscopy confirmed the presence of QDs within liposomal bilayers. The incorporation of polyethylene glycol (PEG) and Span 20 into the liposomes greatly increased the fluidity of the bilayers. The liposomes provided sustained release of camptothecin and irinotecan. The cytotoxicity and cell migration assay demonstrated superior activity of cationic liposomes compared with other carriers. Cationic liposomes also showed a significant fluorescence signal in melanoma cells after internalization. The liposomes were intratumorally administered to a melanoma-bearing mouse. Cationic liposomes showed the brightest fluorescence in tumors, followed by classical liposomes. This signal could last for up to 24 h for cationic nanosystems. Intratumoral accumulation of camptothecin from free control was 35 nmol g-1 it could be increased to 50 nmol g-1 after loading with cationic liposomes. However, encapsulation of irinotecan into liposomes did not further increase intratumoral drug accumulation. Cationic liposomes were preferable to other liposomes as nanocarriers in both bioimaging and therapeutic approaches.

  15. Nanocomposite liposomes containing quantum dots and anticancer drugs for bioimaging and therapeutic delivery: a comparison of cationic, PEGylated and deformable liposomes.

    PubMed

    Wen, Chih-Jen; Sung, Calvin T; Aljuffali, Ibrahim A; Huang, Yu-Jie; Fang, Jia-You

    2013-08-16

    Multifunctional liposomes loaded with quantum dots (QDs) and anticancer drugs were prepared for simultaneous bioimaging and drug delivery. Different formulations, including cationic, PEGylated and deformable liposomes, were compared for their theranostic efficiency. We had evaluated the physicochemical characteristics of these liposomes. The developed liposomes were examined using experimental platforms of cytotoxicity, cell migration, cellular uptake, in vivo melanoma imaging and drug accumulation in tumors. The average size of various nanocomposite liposomes was found to be 92–134 nm. Transmission electron microscopy confirmed the presence of QDs within liposomal bilayers. The incorporation of polyethylene glycol (PEG) and Span 20 into the liposomes greatly increased the fluidity of the bilayers. The liposomes provided sustained release of camptothecin and irinotecan. The cytotoxicity and cell migration assay demonstrated superior activity of cationic liposomes compared with other carriers. Cationic liposomes also showed a significant fluorescence signal in melanoma cells after internalization. The liposomes were intratumorally administered to a melanoma-bearing mouse. Cationic liposomes showed the brightest fluorescence in tumors, followed by classical liposomes. This signal could last for up to 24 h for cationic nanosystems. Intratumoral accumulation of camptothecin from free control was 35 nmol g(?1); it could be increased to 50 nmol g(?1) after loading with cationic liposomes. However, encapsulation of irinotecan into liposomes did not further increase intratumoral drug accumulation. Cationic liposomes were preferable to other liposomes as nanocarriers in both bioimaging and therapeutic approaches. PMID:23867977

  16. Ultrasonic Activation of Thermally Sensitive Liposomes

    Microsoft Academic Search

    Eleonora Mylonopouloua; Costas D. Arvanitisa; Miriam Bazan-Peregrinoa; Manish Arora; Constantin C. Coussios

    2010-01-01

    Cancerous cells are known to be more vulnerable to mild hyperthermia than healthy cells, which can survive temperatures above 43° C for brief periods of time. Currently in phase III clinical trials for liver cancer, ThermoDox® (Celsion Corporation) is a drug delivery system containing doxorubicin, a common anti-cancer agent, encapsulated within a thermally sensitive liposome designed to release its contents

  17. Bone marrow-targeted liposomal carriers

    PubMed Central

    Sou, Keitaro; Goins, Beth; Oyajobi, Babatunde O.; Travi, Bruno L.; Phillips, William T.

    2011-01-01

    Introduction Bone marrow targeted drug delivery systems appear to offer a promising strategy for advancing diagnostic, protective, and/or therapeutic medicine for the hematopoietic system. Liposome technology can provide a drug delivery system with high bone marrow targeting that is mediated by specific phagocytosis in bone marrow. Area covered This review focuses on a bone marrow specific liposome formulation labeled with technetium-99m (99mTc). Interspecies differences in bone marrow distribution of the bone marrow targeted formulation are emphasized. This review provides a liposome technology to target bone marrow. In addition, the selection of proper species for the investigation of bone marrow targeting is suggested. Expert opinion It can be speculated that the bone marrow macrophages have a role in the delivery of lipids to the bone marrow as a source of energy and for membrane biosynthesis or in the delivery of fat soluble vitamins for hematopoiesis. This homeostatic system offers a potent pathway to deliver drugs selectively into bone marrow tissues from blood. High selectivity of the present BMT-liposome formulation for bone marrow suggests the presence of an active and specific mechanism, but specific factors affecting the uptake of the bone marrow MPS are still unknown. Further investigation of this mechanism will increase our understanding of factors required for effective transport of agents to the bone marrow, and may provide an efficient system for bone marrow delivery for therapeutic purposes. PMID:21275831

  18. Triggerable plasmalogen liposomes: improvement of system efficiency

    Microsoft Academic Search

    David H. Thompson; Oleg V. Gerasimov; Jefferey J. Wheeler; Yuanjin Rui; Valerie C. Anderson

    1996-01-01

    A photoactivated liposome release system that is generally applicable for triggered release of encapsulated hydrophilic materials is described. This approach to phototriggered release, derived from the known effects of plasmalogen photooxidation on membrane permeability in whole cells and model membrane systems, relies on producing a lamellar phase change or increase in permeability upon cleaving its constitutive lipids to single-chain surfactants

  19. Ambipolar copper phthalocyanine transistors with carbon nanotube array electrodes

    Microsoft Academic Search

    Fabio Cicoira; Nicola Coppedé; Salvatore Iannotta; Richard Martel

    2011-01-01

    We report on organic thin film transistors (OTFTs) based on copper phthalocyanine (CuPc) having electrodes consisting of isolated carbon nanotube (CNT) arrays embedded in the organic layer. CuPc OTFT with CNT array electrodes show p-type behavior with Ohmic hole injection, high hole mobility, and enhanced switching characteristics at low voltage. The p-type devices are converted to ambipolar OTFT by vacuum

  20. Schottky diode solar cells based on copper phthalocyanine nanowires

    Microsoft Academic Search

    Vijay P. Singh; Suresh Rajaputra; Goutam Chintakula; Gayatri Sagi; Sovannary Phok

    2008-01-01

    Copper phthalocyanine (CuPc) nanowires were electrodeposited in the pores of anodized aluminum oxide (AAO) templates. CuPc-Al Schottky diodes were formed on these nanowires and their materials and electro-optical characteristics were compared with Schottky diodes made from CuPc films electrodeposited on planar ITO-glass substrates. CuPc nanowires and the electrodeposited CuPc films (as prepared) had the preferred crystallite orientation of the ?-phase.

  1. Origin of electronic transport of lithium phthalocyanine iodine crystal

    SciTech Connect

    Koike, Noritake; Oda, Masato; Shinozuka, Yuzo [Department of Materials Science and Chemistry, Wakayama University, 930 Sakaedani, Wakayama (Japan)

    2013-12-04

    The electronic structures of Lithium Phthalocyanine Iodine are investigated using density functional theory. Comparing the band structures of several model crystals, the metallic conductivity of highly doped LiPcI{sub x} can be explained by the band of doped iodine. These results reveal that there is a new mechanism for electronic transport of doped organic semiconductors that the dopant band plays the main role.

  2. Metal phthalocyanine intermediates for the preparation of polymers

    NASA Technical Reports Server (NTRS)

    Achar, B. N.; Fohlen, G. M.; Parker, J. A.

    1985-01-01

    Metal 4, 4', 4"",-tetracarboxylic phthalocyanines (MPTC) are prepared by reaction of trimellitic anhydride, a salt or hydroxide of the desired metal (or the metal in powdered form), urea and a catalyst. A purer form of MPTC is prepared than heretofore. These tetracarboxylic acids are then polymerized by heat to sheet polymers which have superior heat and oxidation resistance. The metal is preferably a divalent metal having an atomic radius close to 1.35A.

  3. The production of copper phthalocyanine and/or its derivatives

    NASA Technical Reports Server (NTRS)

    Segawa, T.; Matsuzaki, K.; Sawada, H.; Ninomiya, R.; Suyama, M.

    1984-01-01

    This document discusses the production of copper phthalocyanine and/or its derivatives, which are useful for dye pigments. The method described uses urea, a copper compound and/or a catalyst which have been suspended in an inert reaction medium. The copper compound, catalyst and urea fused and the reaction is performed by using the obtained fusion. The advantages of the invention are listed.

  4. The first excited states of platinum phthalocyanine in magnetic fields

    Microsoft Academic Search

    Wen-Hsiung Chen; Klaus E. Rieckhoff; Eva-Maria Voigt

    1986-01-01

    A Zeeman study of platinum phthalocyanine in Shpol'skii matrices was performed in the temperature range of 25-77 K with magnetic fields up to ˜6·3 Tesla (T). The general phosphorescence region (950-945 nm) exhibited only one principal peak whose position is not affected by the field. An extremely weak structure that is energetically about 26 cm-1 lower than the principal peak

  5. Decorating graphene nanosheets with electron accepting pyridyl-phthalocyanines

    NASA Astrophysics Data System (ADS)

    Wibmer, Leonie; Lourenço, Leandro M. O.; Roth, Alexandra; Katsukis, Georgios; Neves, Maria G. P. M. S.; Cavaleiro, José A. S.; Tomé, João P. C.; Torres, Tomás; Guldi, Dirk M.

    2015-03-01

    We describe herein the preparation of novel exfoliated graphene-phthalocyanine nanohybrids, and the investigation of their photophysical properties. Pyridyl-phthalocyanines (Pcs) 1-3 are presented as novel electron accepting building blocks of variable strengths with great potential for the exfoliation of graphite via their immobilization onto the basal plane of graphene in dimethylformamide (DMF) affording single layered and turbostratic graphene based G1-G3. G1-G3 were fully characterized (AFM, TEM, Raman, steady-state and pump probe transient absorption spectroscopy) and were studied in terms of electron donor-acceptor interactions in the ground and excited states. In this context, electron transfer upon photoexcitation from graphene to the electron accepting Pcs with dynamics, for example, in G2 of <1 and 330 +/- 50 ps for charge separation and charge recombination, respectively, was corroborated in a series of steady-state and time-resolved spectroscopy experiments.We describe herein the preparation of novel exfoliated graphene-phthalocyanine nanohybrids, and the investigation of their photophysical properties. Pyridyl-phthalocyanines (Pcs) 1-3 are presented as novel electron accepting building blocks of variable strengths with great potential for the exfoliation of graphite via their immobilization onto the basal plane of graphene in dimethylformamide (DMF) affording single layered and turbostratic graphene based G1-G3. G1-G3 were fully characterized (AFM, TEM, Raman, steady-state and pump probe transient absorption spectroscopy) and were studied in terms of electron donor-acceptor interactions in the ground and excited states. In this context, electron transfer upon photoexcitation from graphene to the electron accepting Pcs with dynamics, for example, in G2 of <1 and 330 +/- 50 ps for charge separation and charge recombination, respectively, was corroborated in a series of steady-state and time-resolved spectroscopy experiments. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05719h

  6. Gas Sensing Properties of bis-Phthalocyanine Thin Film

    NASA Astrophysics Data System (ADS)

    Dumludag, Fatih; Kilic, Pinar; Odabas, Zafer; Altindal, Ahmet; Bekaroglu, Ozer

    2010-01-01

    In this study, response of the cofacial bis- phthalocyanine film to vapor of Volatile Organic Compounds (VOCs) was investigated. Test gases were vapors of acetone, toluene, ethanol and ammonia. Measurements were carried out between the temperatures of 293 K-423 K. Bis-phthalocyanine was dissolved in chloroform. Thin film of bis-phthalocyanine was deposited by spraying method on glass substrate patterned with Interdigital Transducer (IDT). During the measurements 0.5 volts were applied to the IDT. Response characteristics of the film were determined by means of change in dc conductivity as a function of gas concentration and temperature. Gas concentrations were controlled by mass flow controller. Dry nitrogen was used as carrier gas. Vapor pressure of the VOCs was calculated using Antoine equation. Response characteristics of the film were determined in a wide range of gas concentration (0.25%-18%). The film showed good sensitivity to the VOCs vapors in the measurement range. The responses of the film were reversible. All the measurement system was computerized.

  7. Internalization of paramagnetic phosphatidylserine-containing liposomes by macrophages

    PubMed Central

    2012-01-01

    Background Inflammation plays an important role in many pathologies, including cardiovascular diseases, neurological conditions and oncology, and is considered an important predictor for disease progression and outcome. In vivo imaging of inflammatory cells will improve diagnosis and provide a read-out for therapy efficacy. Paramagnetic phosphatidylserine (PS)-containing liposomes were developed for magnetic resonance imaging (MRI) and confocal microscopy imaging of macrophages. These nanoparticles also provide a platform to combine imaging with targeted drug delivery. Results Incorporation of PS into liposomes did not affect liposomal size and morphology up to 12 mol% of PS. Liposomes containing 6 mol% of PS showed the highest uptake by murine macrophages, while only minor uptake was observed in endothelial cells. Uptake of liposomes containing 6 mol% of PS was dependent on the presence of Ca2+ and Mg2+. Furthermore, these 6 mol% PS-containing liposomes were mainly internalized into macrophages, whereas liposomes without PS only bound to the macrophage cell membrane. Conclusions Paramagnetic liposomes containing 6 mol% of PS for MR imaging of macrophages have been developed. In vitro these liposomes showed specific internalization by macrophages. Therefore, these liposomes might be suitable for in vivo visualization of macrophage content and for (visualization of) targeted drug delivery to inflammatory cells. PMID:22929153

  8. Evaluation of percutaneous absorption of naproxen from different liposomal formulations.

    PubMed

    Puglia, Carmelo; Bonina, Francesco; Rizza, Luisa; Cortesi, Rita; Merlotti, Elena; Drechsler, Markus; Mariani, Paolo; Contado, Catia; Ravani, Laura; Esposito, Elisabetta

    2010-06-01

    The present study concerns the percutaneous absorption of naproxen (NPX), as model anti-inflammatory drug, included in liposome formulations constituted of different lipids: stratum corneum lipids (SCL) and phosphatidylcholine/cholesterol (PC/CHOL). Liposome dispersions were produced using two different methods: reverse-phase evaporation (REV) and thin layer evaporation (TLE). Morphology and dimensions of the disperse phase were characterized by cryo-transmission electron microscopy (cryo-TEM) and photon correlation spectroscopy, respectively. X-ray diffraction was employed to determine the structural organization of the vesicles. In vitro diffusion was studied by Franz cell on liposome dispersions viscosized by carbomer. Tape stripping was performed to investigate in vivo the performance of differently composed liposomes as NPX delivery system. Cryo-TEM showed spherical vesicles and bigger irregular elongated nanoparticles for TLE SCL liposomes. REV resulted in spherical and elongated multilamellar vesicles. Also X-ray diffraction evidenced L alpha or L beta multilamellar vesicles for PC/CHOL and SCL liposome respectively. The in vitro study showed a lower NPX flux for SCL with respect to PC/CHOL liposome. Tape stripping corroborate the in vitro findings regarding SCL, suggesting that liposomes create a drug reservoir mixing with SC lipids, whilst PC/CHOL liposome promoted NPX permeation through the skin. Liposome lipid composition seems to affect NPX permeation through the skin. PMID:20039387

  9. Bladder Uptake of Liposomes after Intravesical Administration Occurs by Endocytosis

    PubMed Central

    Rajaganapathy, Bharathi Raja; Chancellor, Michael B.; Nirmal, Jayabalan; Dang, Loan; Tyagi, Pradeep

    2015-01-01

    Liposomes have been used therapeutically and as a local drug delivery system in the bladder. However, the exact mechanism for the uptake of liposomes by bladder cells is unclear. In the present study, we investigated the role of endocytosis in the uptake of liposomes by cultured human UROtsa cells of urothelium and rat bladder. UROtsa cells were incubated in serum-free media with liposomes containing colloidal gold particles for 2 h either at 37°C or at 4°C. Transmission Electron Microscopy (TEM) images of cells incubated at 37°C found endocytic vesicles containing gold inside the cells. In contrast, only extracellular binding was noticed in cells incubated with liposomes at 4°C. Absence of liposome internalization at 4°C indicates the need of energy dependent endocytosis as the primary mechanism of entry of liposomes into the urothelium. Flow cytometry analysis revealed that the uptake of liposomes at 37°C occurs via clathrin mediated endocytosis. Based on these observations, we propose that clathrin mediated endocytosis is the main route of entry for liposomes into the urothelial layer of the bladder and the findings here support the usefulness of liposomes in intravesical drug delivery. PMID:25811468

  10. Langmuir–Blodgett film and carbon paste electrodes based on phthalocyanines as sensing units for taste

    Microsoft Academic Search

    A. Arrieta; M. L. Rodriguez-Mendez; J. A. de Saja

    2003-01-01

    In this work, the possibility of using voltammetric electrodes based on phthalocyanine compounds as the sensing units of an electronic tongue has been investigated. Sensors based on monophthalocyanines (including cobalt and copper phthalocyanines) and lanthanide bisphthalocyanines (comprising europium, gadolinium and lutetium bisphthalocyanines and the octa-tertbutyl substituted praseodymium bisphthalocyanine) have been prepared using two different methods: the Langmuir–Blodgett (LB) technique and

  11. Catalytic properties of cobalt complexes with tetrapyrazino porphyrazine and phthalocyanine derivatives

    NASA Astrophysics Data System (ADS)

    Vashurin, A. S.; Kuzmin, I. A.; Litova, N. A.; Petrov, O. A.; Pukhovskaya, S. G.; Golubchikov, O. A.

    2014-12-01

    The catalytic activity of cobalt complexes with octaphenyltetrapyrazinoporphyrazine and phthalocyanine derivatives containing branched peripheral substituents is studied in heterogeneous catalysis of the oxidation of sodium diethyldithiocarbamate (SDC) with atmospheric oxygen. Cobalt phthalocyanines are shown to display higher catalytic activity than cobalt complexes with octaphenyltetrapyrazinoporphyrazine. The highest efficiency of heterogeneous catalysts is attained at temperatures of 298-303 K.

  12. Nano Res. 2012, 5(4): 248257248 Theoretical Investigation of the C60/Copper Phthalocyanine

    E-print Network

    Wang, Wei Hua

    Nano Res. 2012, 5(4): 248­257248 Theoretical Investigation of the C60/Copper Phthalocyanine Organic, such as the one based on copper phthalocyanine (CuPc) and carbon fullerene (C60) molecules, are commonly employed in enhancing the performance of OPV Nano Res. 2012, 5(4): 248­257 ISSN 1998-0124 DOI 10.1007/s12274

  13. Determination of liposome partitioning of ionizable drugs by titration.

    PubMed

    Balon, K; Riebesehl, B U; Müller, B W

    1999-08-01

    Drug partitioning to liposomes has been suggested as a model for partitioning to biomembranes but has been lacking a rapid analytical assay useful for drug screening. A fast pH-metric titration method for the determination of liposome partitioning of ionizable drugs using small unilamellar phosphatidylcholine vesicles prepared by sonic homogenization has been successfully developed, enabling the use of high lipid-to-drug ratios. Liposome-water partition coefficients of diclofenac and propranolol were determined to study the impact of varying titration parameters, temperature, equilibration time, lipid, and liposome types on the partitioning. To validate this method, the results were compared to literature values generated with different techniques and to pH-metric titration results with large unilamellar vesicles. The rapid pH-metric assay gave liposome partitioning data for the two model compounds which were consistent with other analytical techniques and liposome types. PMID:10430546

  14. Investigating the Stability of eLiposomes at Elevated Temperatures.

    PubMed

    Husseini, Ghaleb A; Pitt, William G; Javadi, Marjan

    2014-09-26

    eLiposomes encapsulate a perfluorocarbon nanoemulsion droplet inside a liposome. Ultrasound is then used as a trigger mechanism to vaporize the perfluorocarbon, break the liposome, and release the desired drug to the tumor tissue. The purpose of this research is to show that eLiposomes synthesized using perfluoropentane are stable above the normal boiling point of the perfluoropentane and at body temperature and thus has potential for use in vivo. Experiments involving the release of fluorescent calcein molecules were performed on eLiposomes to measure the release of calcein at various temperatures in the absence of ultrasound. Results showed that eLiposomes are stable at body temperatures and that as the temperature increases above 40°C, calcein release from these novel nanocarriers increases. PMID:25261070

  15. In Vivo Monitoring of Tissue Pharmacokinetics of Liposome/Drug Using MRI: Illustration of Targeted

    E-print Network

    delivery, and 2) provide a means to select patients most likely to benefit from this liposomal drug words: hyperthermia; chemotherapy; pharmacokinetics; liposomes Effective cancer chemotherapy depends

  16. Formulation of Liposome for topical delivery of arbutin

    Microsoft Academic Search

    Ai-Hua Wen; Min-Koo Choi; Dae-Duk Kim

    2006-01-01

    The aims of this study were to encapsulate arbutin (AR) in liposome to enhance the skin-whitening activity, and to investigate\\u000a the effect of liposome formulation on the entrapment efficiency (EE%), skin permeation rate and skin deposition. The liposomes\\u000a were prepared by a film dispersion method with several different formulations and were separated from the solution by using\\u000a the gel-filtration method.

  17. Fusion of cationic liposomes with mammalian cells occurs after endocytosis

    Microsoft Academic Search

    Iwona Wrobel; David Collins

    1995-01-01

    The interaction of cationic liposomes prepared using either dioleoyltrimethylammonium propane (DOTAP) or 3?-(N-(N? ,N?-dimethylaminoethane)carbamoyl)cholesterol (DC-CHOL) with model membranes and with cultured mammalian cells was examined using an assay developed for monitoring virus-cell fusion (Stegmann et al. (1993) Biochemistry 32, 11330–11337). Lipid mixing between cationic liposomes and liposomes composed of DOPE\\/dioleoylphosphatidylglycerol (DOPG) or dioleoylphosphatidylcholine (DOPC)\\/DOPG was insensitive to pH in the

  18. Pesticide detection with a liposome-based nano-biosensor

    Microsoft Academic Search

    Vicky Vamvakaki; Nikos A. Chaniotakis

    2007-01-01

    Monitoring of the organophosphorus pesticides dichlorvos and paraoxon at very low levels has been achieved with liposome-based nano-biosensors. The enzyme acetylcholinesterase was effectively stabilized within the internal nano-environment of the liposomes. Within the liposomes, the pH sensitive fluorescent indicator pyranine was also immobilized for the optical transduction of the enzymatic activity. Increasing amounts of pesticides lead to the decrease of

  19. Biodistribution of liposomes of terbutaline sulfate in guinea pigs.

    PubMed

    Palakurthi, S; Govardhanachary, M; Vyas, S P; Diwan, P V

    2000-10-01

    A series of liposomes was prepared with various lipid (egg phosphatidyl choline [egg PC], phosphatidyl glycerol [PG], dipalmitoyl phosphatidyl choline [DPPC], distearoyl phosphatidyl choline [DSPC], dipalmitoyl phosphatidyl glycerol [DPPG], phosphatidyl ethanolamine [PE], cholesterol [CH], and stearylamine [SA]) compositions, such as egg PC:PG:CH (55:5:40), DPPC:PG:CH (55:5:40), DSPC:DSPG:CH (55:5:40) egg PC:SA:CH (55:5:40), DSPE:DSPG:CH (55:5:40) in molar ratio. Liposomal formulations were administered to guinea pigs intravenously; 3 hr after the treatment, serum samples and various organs (e.g., liver, spleen, lung) were removed and analyzed for drug concentration by a high-performance liquid chromatographic (HPLC) method. Based on the above study, a liposomal preparation with better lung specificity was selected, and the time profile of these liposomes was determined in guinea pigs. Three hours postadministration, a significant difference in blood levels was observed between free terbutaline sulfate and the various liposomal formulations. Localization of the drug in the lungs increased considerably when encapsulated drug was used, and the highest percentage localization was observed with DSPC:DSPG:CH (55:5:40) liposomes. The percentage recovery of the drug in the lungs with egg PC:CH:SA (55:40:5) liposomes did not change significantly when compared with egg PC:CH:PG (55:40:5) liposomes. To establish the time course of disposition of the liposomes, DSPC:DSPG:CH (55:5:40) liposomes were selected. Terminal half-life t1/2 of the drug in blood with free drug solution was about 12 hr, whereas with liposomes, a twofold increase in t1/2 was observed. The disposition data indicated that the clearance of the drug was delayed by 1.5 times when incorporated into liposomes. PMID:11028225

  20. Studies on pectin coating of liposomes for drug delivery.

    PubMed

    Nguyen, Sanko; Alund, Siv Jorunn; Hiorth, Marianne; Kjøniksen, Anna-Lena; Smistad, Gro

    2011-12-01

    The present study investigated the surface coating of charged liposomes by three different types of pectin (LM, HM and amidated pectin) by particle size determinations and zeta potential measurements. The pectins and the pectin coated liposomes were visualized by atomic force microscopy. The adsorption of pectin onto positive liposomes yielded a reproducible increase in particle size and a shift of the zeta potential from positive to negative side for all three pectin types, whereas the adsorption of pectin onto negative liposomes did not render any significant changes probably due to electrostatic repulsion. The positive liposomes coated with HM-pectin gave the largest pectin coated particles with the least negative zeta potential, while the opposite was observed for the LM-pectin coated positive liposomes. Furthermore, results from dynamic light scattering revealed narrow size distributions, indicating that the degree of aggregation was low for the pectin coated liposomes. As liposomes are able to encapsulate drugs and pectin has been found to be mucoadhesive, these pectin coated liposomes may be potential drug delivery systems. PMID:21862293

  1. Factors Affecting Ultrasonic Release from eLiposomes.

    PubMed

    Lattin, James R; Pitt, William G

    2015-04-01

    Liposomes containing emulsion droplets (eLiposomes) were studied as ultrasound-responsive liposomal drug carriers. This paper presents the effects of temperature, eLiposome size, and ultrasound parameters on the ultrasonically actuated release of calcein, to test hypotheses concerning the physics of acoustic droplet vaporization with regard to vapor pressure and Laplace pressure. Small (200 nm) eLiposomes containing 100-nm emulsion droplets were formed and compared with large (800 nm) eLiposomes containing 100- or 450-nm droplets. Calcein release was quantified by spectroscopic methods. Various experiments examined the influence of perfluorocarbon (PFC) droplet size, vesicle size, temperature, PFC composition and vapor pressure, insonation time, and insonation frequency. Results showed that eLiposome samples released significantly more calcein than their conventional liposome counterparts. Surprisingly, temperature (which directly controls vapor pressure) did not have a strong effect on ultrasound-induced calcein release. In general, calcein release decreased with decreasing droplet size, as hypothesized based on Laplace pressure. Release decreased with increased ultrasound frequency if the pressure amplitude and exposure time were maintained constant, indicating that the gas-phase nucleation rate may have an important role in rupture of eLiposomes. Interestingly, when ultrasound of the same mechanical index was applied at two frequencies, the amount of release correlated strongly with the mechanical index. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association J Pharm Sci 104:1373-1384, 2015. PMID:25641709

  2. Increased Liposome Extravasation in Selected Tissues: Effect of Substance P

    NASA Astrophysics Data System (ADS)

    Rosenecker, Joseph; Zhang, Weiming; Hong, Keelung; Lausier, James; Geppetti, Pierangelo; Yoshihara, Shigemi; Papahadjopoulos, Demetrios; Nadel, Jay A.

    1996-07-01

    We have used a pharmacologic mediator to open intercellular connections in selected vessels to allow liposomes to escape from the blood stream and to extravasate into tissues that have appropriate receptors. We have examined the effects of substance P (SP), a peptide known to increase vascular permeability in selected tissues, such as trachea, esophagus, and urinary bladder in rats. We used quantitative fluorescence analysis of tissues to measure two fluorescent markers, one attached to the lipid (rhodamine-phosphatidylethanolamine) and another, doxorubicin (an antitumor drug), encapsulated within the aqueous interior. We have also examined the deposition of liposomes microscopically by the use of encapsulated colloidal gold and silver enhancement. Analysis of the biochemical and morphological observations indicate the following: (i) Injection of SP produces a striking increase in both liposome labels, but only in tissues that possess receptors for SP in postcapillary venules; (ii) liposome material in these tissues has extravasated and is found extracellularly near a variety of cells beyond the endothelial layer over the first few hours; (iii) 24 h following injection of liposomes and SP, liposome material is found in these tissues, localized intracellularly in both endothelial cells and macrophages. We propose that appropriate application of tissue-specific mediators can result in liposome extravasation deep within tissues that normally do not take up significant amounts of liposomes from the blood. Such liposomes are able to carry a variety of pharmacological agents that can be released locally within selected target tissues for therapeutic purposes.

  3. Modifying the release properties of liposomes toward personalized medicine.

    PubMed

    Cipolla, David; Wu, Huiying; Gonda, Igor; Eastman, Simon; Redelmeier, Tom; Chan, Hak-Kim

    2014-06-01

    Surfactant-liposome interactions have historically been investigated as a simplified model of solubilization and breakdown of biological membranes by surfactants. In contrast, our goal was to utilize surfactants to modify the encapsulation and release properties of liposomes. The ability to manufacture one liposomal formulation, which could be modified by the addition of a surfactant to support a wide range of release profiles, would provide greater flexibility than manufacturing multiple batches of liposomes, each differing in composition and with its own specific release profile. A liposomal ciprofloxacin formulation was modified by the addition of various surfactants. These formulations were characterized in terms of liposome structure by cryo-TEM imaging, vesicle size by dynamic light scattering, drug encapsulation by centrifugation-filtration, and in vitro release (IVR) performance. The addition of polysorbate 20 or polysorbate 80 to liposomal ciprofloxacin, in a hypotonic environment, resulted in a concentration-dependent loss of encapsulated drug, and above 0.4% polysorbate 20, or 0.2% polysorbate 80, a modified IVR profile as well. This study demonstrates that the encapsulation and release properties of a liposomal formulation can be modified postmanufacture by the addition of judiciously chosen surfactants in combination with osmotic swelling of the liposomes and may support a personalized approach to treating patients. PMID:24715635

  4. Current trends in the use of liposomes for tumor targeting

    PubMed Central

    Deshpande, Pranali P; Biswas, Swati; Torchilin, Vladimir P

    2013-01-01

    The use of liposomes for drug delivery began early in the history of pharmaceutical nanocarriers. These nanosized, lipid bilayered vesicles have become popular as drug delivery systems owing to their efficiency, biocompatibility, nonimmunogenicity, enhanced solubility of chemotherapeutic agents and their ability to encapsulate a wide array of drugs. Passive and ligand-mediated active targeting promote tumor specificity with diminished adverse off-target effects. The current field of liposomes focuses on both clinical and diagnostic applications. Recent efforts have concentrated on the development of multifunctional liposomes that target cells and cellular organelles with a single delivery system. This review discusses the recent advances in liposome research in tumor targeting. PMID:23914966

  5. Preparation and pH stability of ferrous glycinate liposomes.

    PubMed

    Ding, Baomiao; Xia, Shuqin; Hayat, Khizar; Zhang, Xiaoming

    2009-04-01

    Ferrous glycinate liposomes were prepared by reverse phase evaporation method. The effects of cholesterol, Tween 80, ferrous glycinate concentration, hydrating medium, pH of hydrating medium, and sonication strength on the encapsulation efficiency of liposomes were investigated. Encapsulation efficiency was significantly influenced by the different technique parameters. Ferrous glycinate liposomes might be obtained with high encapsulation efficiency of 84.80% under the conditions of optimized technique parameters. The zeta potential and average particle size of liposomes in the hydrating medium of pH 7.0 were 9.6 mV and 559.2 nm, respectively. The release property of ferrous glycinate liposomes in vitro was investigated in simulated gastrointestinal juice. A small amount of ferrous glycinate was released from liposomes in the first 4 h in simulated gastrointestinal juice. The mean diameters of liposomes increased from 559.2 to 692.9, 677.8, and 599.3 nm after incubation in simulated gastrointestinal juice of pH 1.3, 7.5, and 7.5 in the presence of bile salts, respectively. Results showed that the stability of ferrous glycinate in strong acid environment was greatly improved by encapsulation in liposomes, which protected ferrous glycinate from disrupting the extracapsular environment by lipid bilayer. The bioavailability of ferrous glycinate, as the iron source for biological activity including hemoglobin formation, may be increased. The ferrous glycinate liposomes may be a kind of promising iron fortifier. PMID:19253959

  6. Liposomal drug delivery: a versatile platform for challenging clinical applications.

    PubMed

    Madni, Asadullah; Sarfraz, Muhammad; Rehman, Mubashar; Ahmad, Mahmood; Akhtar, Naveed; Ahmad, Saeed; Tahir, Nayab; Ijaz, Shakeel; Al-Kassas, Raida; Löbenberg, Raimar

    2014-01-01

    Liposomes are lipid based vesicular systems that offer novel platform for versatile drug delivery to target cell. Liposomes were first reported by Bangham and his co-workers in 1964 (1). Since then, liposomes have undergone extensive research with the prime aim to optimize encapsulation, stability, circulation time and target specific drug delivery. Manipulation of a liposome's lipid bilayer and surface decoration with selective ligands has transformed conventional liposomes into adaptable and multifunctional liposomes. Development of liposomes with target specificity provide the prospect of safe and effective therapy for challenging clinical applications. Bioresponsive liposomes offer the opportunity to release payload in response to tissue specific microenvironment. Incorporation of novel natural and synthetic materials has extended their application from stable formulations to controlled release targeted drug delivery systems. Integration and optimization of multiple features into one system revolutionized research in the field of cancer, gene therapy, immunotherapy and infectious diseases. After 50 years since the first publication, this review is aimed to highlight next generation of liposomes, their preparation methods and progress in clinical applications. PMID:25224351

  7. Ultrasound enhanced antitumor activity of liposomal doxorubicin in mice.

    PubMed

    Hagtvet, Eirik; Evjen, Tove J; Olsen, Dag Rune; Fossheim, Sigrid L; Nilssen, Esben A

    2011-09-01

    Liposomal encapsulation of doxorubicin (DXR) improves tumor accumulation and reduces adverse effects. One possible strategy for further optimization of this delivery technology would be to design the liposome carrier to release its content within the tumor tissue in response to specific stimuli such as ultrasound (US). In this study, the tumor uptake properties and therapeutic efficacy of 1,2 distearoyl-sn-glycero-3-phosphatidylethanolamine-based liposomes containing DXR were investigated in nude mice bearing tumor xenografts. The liposomal DXR formulation alone showed no inhibitory effect on tumor growth. However, upon exposure to low frequency US in situ inhibition of tumor growth was demonstrated. PMID:21524240

  8. Liposomes in tissue engineering and regenerative medicine

    PubMed Central

    Monteiro, Nelson; Martins, Albino; Reis, Rui L.; Neves, Nuno M.

    2014-01-01

    Liposomes are vesicular structures made of lipids that are formed in aqueous solutions. Structurally, they resemble the lipid membrane of living cells. Therefore, they have been widely investigated, since the 1960s, as models to study the cell membrane, and as carriers for protection and/or delivery of bioactive agents. They have been used in different areas of research including vaccines, imaging, applications in cosmetics and tissue engineering. Tissue engineering is defined as a strategy for promoting the regeneration of tissues for the human body. This strategy may involve the coordinated application of defined cell types with structured biomaterial scaffolds to produce living structures. To create a new tissue, based on this strategy, a controlled stimulation of cultured cells is needed, through a systematic combination of bioactive agents and mechanical signals. In this review, we highlight the potential role of liposomes as a platform for the sustained and local delivery of bioactive agents for tissue engineering and regenerative medicine approaches. PMID:25401172

  9. Secretory Phospholipase A2 Responsive Liposomes

    PubMed Central

    ZHU, GUODONG; MOCK, JASON N.; ALJUFFALI, IBRAHIM; CUMMINGS, BRIAN S.; ARNOLD, ROBERT D.

    2011-01-01

    Secretory phospholipase A2 (sPLA2) expression is increased in several cancers and has been shown to trigger release from some lipid carriers. This study used electrospray ionization mass spectrometry (ESI-MS) and release of 6-carboxyfluorescein (6-CF) to determine the effects of sPLA2 on various liposome formulations. Different combinations of zwitterionic [1,2-dipalmitoyl-sn-glycero-3-phosphatidylcholine, 1,2-distearoyl-sn-glycero-3-phosphatidylcholine, and 1,2- distearoyl-sn-glycero-3-phosphatidylethanolamine (DSPE)] and anionic [1,2-distearoyl-sn-glycero-3-phosphatidic acid, 1,2-distearoyl-sn-glycero-3-phosphatidylglycerol (DSPG), 1,2-distearoyl-sn-glycero-3-phosphatidylserine, and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine–N-poly(ethylene glycol) 2000 (DSPE–PEG)] phospholipids were examined. DSPG and DSPE were most susceptible to sPLA2-mediated degradation compared with other phospholipids. Increased 6-CF release was observed after inclusion of 10 mol % DSPE and anionic lipids into different liposome formulations. Group IIa sPLA2-mediated 6-CF release was less than Group III and relatively insensitive to cholesterol (Chol), whereas Chol reduced sPLA2-mediated release. Inclusion of DSPE–PEG increased sPLA2-mediated 6-CF release, whereas serum reduced lipid degradation and 6-CF release significantly. These data demonstrate that ESI-MS and 6-CF release were useful in determining the selectivity of sPLA2 and release from liposomes, that differences in the activity of different sPLA2 isoforms exist, and that DSPE–PEG enhanced sPLA2-mediated release of liposomal constituents. These findings will aid in the selection of lipids and optimization of the kinetics of drug release for the treatment of cancers and diseases of inflammation in which sPLA2 expression is increased. PMID:21455978

  10. Phototriggerable Liposomes: Current Research and Future Perspectives

    PubMed Central

    Puri, Anu

    2013-01-01

    The field of cancer nanomedicine is considered a promising area for improved delivery of bioactive molecules including drugs, pharmaceutical agents and nucleic acids. Among these, drug delivery technology has made discernible progress in recent years and the areas that warrant further focus and consideration towards technological developments have also been recognized. Development of viable methods for on-demand spatial and temporal release of entrapped drugs from the nanocarriers is an arena that is likely to enhance the clinical suitability of drug-loaded nanocarriers. One such approach, which utilizes light as the external stimulus to disrupt and/or destabilize drug-loaded nanoparticles, will be the discussion platform of this article. Although several phototriggerable nanocarriers are currently under development, I will limit this review to the phototriggerable liposomes that have demonstrated promise in the cell culture systems at least (but not the last). The topics covered in this review include (i) a brief summary of various phototriggerable nanocarriers; (ii) an overview of the application of liposomes to deliver payload of photosensitizers and associated technologies; (iii) the design considerations of photoactivable lipid molecules and the chemical considerations and mechanisms of phototriggering of liposomal lipids; (iv) limitations and future directions for in vivo, clinically viable triggered drug delivery approaches and potential novel photoactivation strategies will be discussed. PMID:24662363

  11. Liposomes as lubricants: beyond drug delivery.

    PubMed

    Goldberg, Ronit; Klein, Jacob

    2012-05-01

    In this paper we review recent work (Goldberg et al., 2011a,b) on a new use for phosphatidylcholine liposomes: as ultra-efficient boundary lubricants at up to the highest physiological pressures. Using a surface force balance, we have measured the normal and shear interactions as a function of surface separation between layers of hydrogenated soy phophatidylcholine (HSPC) small unilamellar vesicles (SUVs) adsorbed from dispersion, at both pure water and physiologically high salt concentrations of 0.15 M NaNO(3). Cryo-Scanning Electron Microscopy shows each surface to be coated by a close-packed HSPC-SUV layer with an over-layer of liposomes on top. The shear forces reveal strikingly low friction coefficients down to 2×10(-5) in pure water system or 6×10(-4) in the 150 mM salt system, up to contact pressures of at least 12 MPa (pure water) or 6 MPa (high salt), comparable with those in the major joints. This low friction is attributed to the hydration lubrication mechanism arising from rubbing of the highly hydrated phosphocholine-headgroup layers exposed at the outer surface of each liposome, and provides support for the conjecture that phospholipids may play a significant role in biological lubrication. PMID:22119851

  12. Peritoneal retention of liposomes: Effects of lipid composition, PEG coating and liposome charge.

    PubMed

    Dadashzadeh, S; Mirahmadi, N; Babaei, M H; Vali, A M

    2010-12-01

    In the treatment of peritoneal carcinomatosis, systemic chemotherapy is not quite effective due to the poor penetration of cytotoxic agents into the peritoneal cavity, whereas intraperitoneal administration of chemotherapeutic agents is generally accompanied by quick absorption of the free drug from the peritoneum. Local delivery of drugs with controlled-release delivery systems like liposomes could provide sustained, elevated drug levels and reduce local and systemic toxicity. In order to achieve an ameliorated liposomal formulation that results in higher peritoneal levels of the drug and retention, vesicles composed of different phospholipid compositions (distearoyl [DSPC]; dipalmitoyl [DPPC]; or dimiristoylphosphatidylcholine [DMPC]) and various charges (neutral; negative, containing distearoylphosphatidylglycerol [DSPG]; or positive, containing dioleyloxy trimethylammonium propane [DOTAP]) were prepared at two sizes of 100 and 1000nm. The effect of surface hydrophilicity was also investigated by incorporating PEG into the DSPC-containing neutral and charged liposomes. Liposomes were labeled with (99m)Tc and injected into mouse peritoneum. Mice were then sacrificed at eight different time points, and the percentage of injected radiolabel in the peritoneal cavity and the tissue distribution in terms of the percent of the injected dose/gram of tissue (%ID/g) were obtained. The ratio of the peritoneal AUC to the free label ranged from a minimum of 4.95 for DMPC/CHOL (cholesterol) 100nm vesicles to a maximum of 24.99 for DSPC/CHOL/DOTAP 1000nm (DOTAP 1000) vesicles. These last positively charged vesicles had the greatest peritoneal level; moreover, their level remained constant at approximately 25% of the injected dose from 2 to 48h. Among the conventional (i.e., without PEG) 100nm liposomes, the positively charged vesicles again showed the greatest retention. Incorporation of PEG at this size into the lipid structures augmented the peritoneal level, particularly for negatively charged liposomes. The positively charged PEGylated vesicles (DOTAP/PEG 100) had the second-greatest peritoneal level after DOTAP 1000; however, their peritoneal-to-blood AUC ratio was low (3.05). Overall, among the different liposomal formulations, the positively charged conventional liposomes (100 and 1000nm) provided greater peritoneal levels and retention. DOTAP/PEG100 may also be a more efficient formulation because this formulation can provide a high level of anticancer drug into the peritoneal cavity and also can passively target the primary tumor. PMID:20800629

  13. Liposomal nanoparticles as a drug delivery vehicle against osteosarcoma

    NASA Astrophysics Data System (ADS)

    Dhule, Santosh Subhashrao

    The delivery of curcumin, a broad-spectrum anticancer drug, has been explored in the form of liposomal nanoparticles to treat osteosarcoma (OS). Curcumin is water insoluble and an effective delivery route is through encapsulation in cyclodextrins followed by a second encapsulation in liposomes. Liposomal curcumin's potential was evaluated against cancer models of mesenchymal (OS) and epithelial origin (breast cancer). The resulting 2-Hydroxypropyl-gamma-cyclodextrin/curcumin - liposome complex shows promising anticancer potential both in vitro and in vivo against KHOS OS cell line and MCF-7 breast cancer cell line. An interesting aspect is that liposomal curcumin initiates the caspase cascade that leads to apoptotic cell death in vitro in comparison with DMSO-curcumin induced autophagic cell death. In addition, the efficiency of the liposomal curcumin formulation was confirmed in vivo using a xenograft OS model. Curcumin-loaded gamma-cyclodextrin liposomes indicate significant potential as delivery vehicles for the treatment of cancers of different tissue origin. The second part of this study examines the anti-tumor potential of curcumin and C6 ceramide (C6) against osteosarcoma cell lines when both are encapsulated in the bilayer of liposomal nanoparticles. Curcumin in combination with C6 showed 1.5 times enhanced cytotoxic effect in the case of MG-63 and KHOS OS cell lines, in comparison with systems with curcumin alone. Interestingly, C6-curcumin liposomes were found to be less toxic on untransformed human cells in comparison to OS cell lines. In addition, cell cycle assays on a KHOS cell line after treatment revealed that curcumin only liposomes induced G 2/M arrest by upregulation of cyclin B1, while C6 only liposomes induced G1 arrest by downregulation of cyclin D1. C6-curcumin liposomes induced G2/M arrest and showed a combined effect in the expression levels of cyclin D1 and cyclin B1. Using pegylated liposomes to increase the plasma half-life and tagging with folate for targeted delivery in vivo, a significant reduction in tumor size was observed with C6-curcumin-folate liposomes. The encapsulation of two water insoluble drugs, curcumin and C6, in the lipid bilayer of liposomes enhances the cytotoxic effect and validates the potential of combined drug therapy.

  14. Nanostructured copper phthalocyanine-sensitized multiwall carbon nanotube films

    Microsoft Academic Search

    Ross A. Hatton; Nicholas P. Blanchard; Vlad Stolojan; Anthony J. Miller; S. Ravi P. Silva

    2007-01-01

    We report a detailed study of the interaction between surface-oxidized\\u000a multiwall carbon nanotubes (o-MWCNTs) and the molecular semiconductor\\u000a tetrasulfonate copper phthalocyanine (TS-CuPc). Concentrated dispersions\\u000a of o-MWCNT in aqueous solutions of TS-CuPc are stable toward nanotube\\u000a flocculation and exhibit spontaneous nanostructuring upon rapid drying.\\u000a In addition to hydrogen-bonding interactions, the compatibility between\\u000a the two components is shown to result from a

  15. Magnetic interaction in oxygenated alpha Fe-phthalocyanines

    SciTech Connect

    Kuzmann, Ern?, E-mail: kuzmann@caesar.elte.hu; Homonnay, Zoltán; Horváth, Attila [Institute of Chemistry, Eötvös Loránd University, P.O. Box 32, 1512 Budapest (Hungary); Pechousek, Jiri; Cuda, Jan; Machala, Libor; Zoppellaro, Giorgio; Zboril, Radek [Regional Centre of Advanced Technologies and Materials, Departments of Experimental Physics and Physical Chemistry, Faculty of Science Palacky University, 17. Listopadu 1192/12, 771 46 Olomouc (Czech Republic); Yin, Houping; Wei, Yen [Department of Chemistry, Drexel University, Philadelphia, PA 19104 (United States); Klencsár, Zoltán [Research Centre for Natural Sciences, Hungarian Academy of Sciences, Budapest, 1117 (Hungary); Kubuki, Shiro [Department of Chemistry, Graduate School of Science and Engineering, Tokyo Metropolitan University, 1-1 Minami-Osawa, Hachi-Oji, Tokyo 192-0397 (Japan); Nath, Amar [Department of Chemistry, University of North Carolina, Asheville, NC 28804 (United States)

    2014-10-27

    Alpha iron phthalocyanines (?-FePc) oxygenated at low temperatures were investigated with the help of {sup 57}Fe Mössbauer spectroscopy, magnetization measurements (SQUID) and X-ray diffractometry (XRD). Mössbauer spectroscopy revealed that upon oxygenation of ?-FePc, new species were formed which could be associated with Fe{sup III}Pc oxygen adducts. Unexpectedly, magnetically split spectrum of oxygenated ?-FePc was observed below 20 K. In-field Mössbauer spectra in a 5 T external magnetic field at 5K and magnetization measurements indicate antiferromagnetic coupling in oxygenated ?-FePc.

  16. Photoluminescence of nitro-substituted europium (III) phthalocyanines

    SciTech Connect

    Ziminov, A. V., E-mail: ziminov@inbox.ru; Polevaya, Yu. A.; Jourre, T. A.; Ramsh, S. M. [St. Petersburg State Institute of Technology (Technical University) (Russian Federation); Mezdrogina, M. M. [Russian Academy of Sciences, Ioffe Physical Technical Institute (Russian Federation); Poletaev, N. K. [St. Petersburg State Institute of Technology (Technical University) (Russian Federation)

    2010-08-15

    Europium monophthalocyanine Eu(acac)Pc, europium monotetranitrophthalocyanine Eu(acac)Pc(NO{sub 2}){sub 4}, and heteroleptic europium tetranitrobisphthalocyanine Eu(Pc)(Pc(NO{sub 2}){sub 4}) are synthesized. The spectral characteristics of the phthalocyanine complexes in the visible and near-infrared regions are studied. The photoluminescence spectra are recorded. The luminescence bands are detected in the regions 450-500 nm (S{sub 2} {yields} S{sub 0}) and 670-730 nm (S{sub 1} {yields} S{sub 0}). The peaks are attributed to electronic transitions in the organic ligands.

  17. Magnetic interaction in oxygenated alpha Fe-phthalocyanines

    NASA Astrophysics Data System (ADS)

    Kuzmann, Ern?; Pechousek, Jiri; Cuda, Jan; Yin, Houping; Wei, Yen; Homonnay, Zoltán; Klencsár, Zoltán; Horváth, Attila; Machala, Libor; Kubuki, Shiro; Zoppellaro, Giorgio; Zboril, Radek; Nath, Amar

    2014-10-01

    Alpha iron phthalocyanines (?-FePc) oxygenated at low temperatures were investigated with the help of 57Fe Mössbauer spectroscopy, magnetization measurements (SQUID) and X-ray diffractometry (XRD). Mössbauer spectroscopy revealed that upon oxygenation of ?-FePc, new species were formed which could be associated with FeIIIPc oxygen adducts. Unexpectedly, magnetically split spectrum of oxygenated ?-FePc was observed below 20 K. In-field Mössbauer spectra in a 5 T external magnetic field at 5K and magnetization measurements indicate antiferromagnetic coupling in oxygenated ?-FePc.

  18. Polymeric gated organic field effect transistor using magnesium phthalocyanine

    NASA Astrophysics Data System (ADS)

    Rajesh, K. R.; Menon, C. S.

    2014-10-01

    An organic thin film transistor has been fabricated using evaporated Magnesium Phthalocyanine as active layer. Parylene film prepared by chemical vapour deposition has been used as the organic gate insulator. Annealing of the samples is performed at 120 °C for 3 hrs. At room temperature, these transistors exhibit the p-type conductivity with field-effect mobility ranging from 0.009 - 0.021 cm2/Vs and ( I on/I off) ratio ~103. The effect of annealing on the transistor characteristics is discussed.

  19. Origin of the band dispersion in a metal phthalocyanine crystal

    NASA Astrophysics Data System (ADS)

    Yanagisawa, Susumu; Yamauchi, Kunihiko; Inaoka, Takeshi; Oguchi, Tamio; Hamada, Ikutaro

    2014-12-01

    Understanding the crystal structure and electronic states of the organic semiconductor is of fundamental importance for developing the materials for the organic electronics. However, the theoretical treatment of organic semiconductors remains challenging, as the semilocal density functional theory fails to describe the dispersion forces accurately. We use van der Waals inclusive density functionals to study the zinc phthalocyanine polymorphs. It is found that the structure and energetics are well described with the van der Waals density functional, and as a result, the electronic band structure is nicely reproduced. Furthermore, we reveal that the distance between the molecules and the molecule tilt angle are important factors that determine the electronic band dispersion.

  20. Magnetism and multiplets in metal-phthalocyanine molecules

    NASA Astrophysics Data System (ADS)

    Kitaoka, Y.; Sakai, T.; Nakamura, K.; Akiyama, T.; Ito, T.

    2013-05-01

    Magnetism and multiplets for metal-phthalocyanine (MPc) molecules with transition-metals (M) of Mn and Co were investigated based on the constraint density functional theory calculations by imposing density matrix constraint on the d-orbital occupation numbers. For the MnPc, the ground state is found to be the 4Eg state with the perpendicular magnetic anisotropy with respect to the molecular plane, while for the CoPc, the ground state is the 2A1g state with a planar magnetic anisotropy.

  1. Magnetism and multiplets in metal-phthalocyanine molecules

    PubMed Central

    Kitaoka, Y.; Sakai, T.; Nakamura, K.; Akiyama, T.; Ito, T.

    2013-01-01

    Magnetism and multiplets for metal-phthalocyanine (MPc) molecules with transition-metals (M) of Mn and Co were investigated based on the constraint density functional theory calculations by imposing density matrix constraint on the d-orbital occupation numbers. For the MnPc, the ground state is found to be the 4Eg state with the perpendicular magnetic anisotropy with respect to the molecular plane, while for the CoPc, the ground state is the 2A1g state with a planar magnetic anisotropy. PMID:23606755

  2. Magnetism and multiplets in metal-phthalocyanine molecules.

    PubMed

    Kitaoka, Y; Sakai, T; Nakamura, K; Akiyama, T; Ito, T

    2013-05-01

    Magnetism and multiplets for metal-phthalocyanine (MPc) molecules with transition-metals (M) of Mn and Co were investigated based on the constraint density functional theory calculations by imposing density matrix constraint on the d-orbital occupation numbers. For the MnPc, the ground state is found to be the (4)Eg state with the perpendicular magnetic anisotropy with respect to the molecular plane, while for the CoPc, the ground state is the (2)A1g state with a planar magnetic anisotropy. PMID:23606755

  3. The toxicity of phthalocyanines to the aquatic plant Lemna minor (duckweed) - testing of 31 compounds.

    PubMed

    Jan?ula, Daniel; Maršálek, Blahoslav

    2012-08-01

    Phthalocyanines are prospective chemicals that have applications in industry, medicine and biology due especially to their architectural flexibility and production of reactive oxygen species. Although they are used in so many areas of human activities nowadays, there is still little knowledge of their ecotoxicity. Here we present the first observation of their toxic effects on representatives of the aquatic plants Lemna minor. The tested phthalocyanines possess a wide spectrum of phytotoxicity ranging from seldom (>50 mg L(-1)) to highly toxic 0.11 mg L(-1). Moreover, the potential of phthalocyanines to be used as selective cyanocides or herbicides is discussed as well. PMID:22497786

  4. Titanium and Ruthenium Phthalocyanines for NO2 Sensors: A Mini-Review

    PubMed Central

    Paoletti, Anna Maria; Pennesi, Giovanna; Rossi, Gentilina; Generosi, Amanda; Paci, Barbara; Albertini, Valerio Rossi

    2009-01-01

    This review presents studies devoted to the description and comprehension of phenomena connected with the sensing behaviour towards NO2 of films of two phthalocyanines, titanium bis-phthalocyanine and ruthenium phthalocyanine. Spectroscopic, conductometric, and morphological features recorded during exposure to the gas are explained and the mechanisms of gas-molecule interaction are also elucidated. The review also shows how X-ray reflectivity can be a useful tool for monitoring morphological parameters such as thickness and roughness that are demonstrated to be sensitive variables for monitoring the exposure of thin films of sensor materials to NO2 gas. PMID:22346697

  5. Dye-sensitized solar cells based on axially ligated phosphorus-phthalocyanine dyes

    NASA Astrophysics Data System (ADS)

    Hayat, Azwar; Shivashimpi, Gururaj M.; Nishimura, Terumi; Fujikawa, Naotaka; Ogomi, Yuhei; Yamaguchi, Yoshihiro; Pandey, Shyam S.; Ma, Tingli; Hayase, Shuzi

    2015-04-01

    Dye-sensitized solar cells with axially anchored phosphorous-phthalocyanine dyes were fabricated for the first time. Although the phosphorus-phthalocyanine dyes do not have a conventional anchoring group (–COOH), these dyes could be absorbed on a TiO2 semiconductor surface. After the optimization of energy levels, a 24% incident photon-to-current efficiency (IPCE) was observed at 710 nm with an IPCE curve edge of 800 nm. The efficiency was 2.67%, which was higher than those of previously reported dye-sensitized solar cells with axially anchored phthalocyanine dyes (less than 1%).

  6. ORIGINAL PAPER Encapsulation of ascorbic acid in liposomes prepared

    E-print Network

    Paris-Sud XI, Université de

    The production of nanoliposomes is considered to be an effective technology for the encapsulation and controlledORIGINAL PAPER Encapsulation of ascorbic acid in liposomes prepared with milk fat globule membrane, and to evaluate their encapsulation behavior using ascorbic acid as a model biomolecule. Liposomes prepared

  7. Safety and efficacy studies of liposomes in specific immunotherapy

    Microsoft Academic Search

    Sylvie Galvain; Claude André; Christine Vatrinet; Bertrand Villet

    1999-01-01

    Liposomes are lipid vesicles that have been extensively investigated because of their immunoadjuvant properties and their capacity to transport a variety of therapeutic agents. This article reports the results of 4 safety and efficacy studies of multilamellar liposomes used to incorporate an allergen extract in specific immunotherapy. The first study showed that cutaneous tolerance of encapsulated allergen extracts (5 grass

  8. Development of liposome encapsulated clindamycin for treatment of acne vulgaris

    Microsoft Academic Search

    Lidija Honzak; Marjeta Šentjurc

    2000-01-01

    The enhancement of topical delivery of hydrophilic substances by use of multilammelar liposomes was measured ex vivo on pig ear skin and in vivo on hairless mice by electron paramagnetic resonance method (EPR). Multilamellar liposomes with different lipid composition (final concentration of membrane components is 48 mg\\/ml) were loaded with a hydrophilic spin probe GluSL, which does not penetrate the

  9. Antibacterial Efficacy of Benzoyl Peroxide in Phospholipid Liposomes

    Microsoft Academic Search

    J. W. Fluhr; O. Barsom; W. Gehring; M. Gloor

    1999-01-01

    Background: Literature reports indicate that phospholipid liposomes facilitate the accumulation of active agents in the infundibulum. Objective: The study hypothesis of an improved antibacterial efficacy of benzoyl peroxide (BPO) in phospholipid liposomes was tested in comparison with a commercial and a pharmacopoeial BPO preparation. Methods: The infundibular bacterial samples were obtained with the Permabond technique from 20 acne patients who

  10. Hydrogel Containing Nanoparticle-Stabilized Liposomes for Topical Antimicrobial Delivery

    PubMed Central

    2015-01-01

    Adsorbing small charged nanoparticles onto the outer surfaces of liposomes has become an effective strategy to stabilize liposomes against fusion prior to “seeing” target bacteria, yet allow them to fuse with the bacteria upon arrival at the infection sites. As a result, nanoparticle-stabilized liposomes have become an emerging drug delivery platform for treatment of various bacterial infections. To facilitate the translation of this platform for clinical tests and uses, herein we integrate nanoparticle-stabilized liposomes with hydrogel technology for more effective and sustained topical drug delivery. The hydrogel formulation not only preserves the structural integrity of the nanoparticle-stabilized liposomes, but also allows for controllable viscoeleasticity and tunable liposome release rate. Using Staphylococcus aureus bacteria as a model pathogen, we demonstrate that the hydrogel formulation can effectively release nanoparticle-stabilized liposomes to the bacterial culture, which subsequently fuse with bacterial membrane in a pH-dependent manner. When topically applied onto mouse skin, the hydrogel formulation does not generate any observable skin toxicity within a 7-day treatment. Collectively, the hydrogel containing nanoparticle-stabilized liposomes hold great promise for topical applications against various microbial infections. PMID:24483239

  11. Stability and transdermal absorption of topical amphotericin B liposome formulations.

    PubMed

    Manosroi, A; Kongkaneramit, L; Manosroi, J

    2004-02-11

    The aim os this study was to characterize the stability and transdermal absorption of amphotericin B (AMB: 0.05 mg/mg lipid) in hydrogenated soya phosphatidylcholine/cholesterol/charged lipid [dicetyl phosphate (-) or stearylamine (+)] liposomes at molar ratios of 1:1:0, 7:2:0, 7:2:1(-) and 7:2:1(+). The AmB contents in liposomes were determined by HPLC with UV detection at 382 nm. Stabilities of AmB in liposome formulations were compared with those in solution and powder forms, during storage at 4, 30 and 45 degrees C for 90 days. Absorption studies of AmB across the rat skin were conducted, using vertical Franz diffusion cells at 37 degrees C for 24 h. The slowest degradation was observed in the positive liposome (7:2:1(+)AmB), with shelf life of approximately 1 year (30 degrees C). In comparison, the shelf lives of AmB in solution and powder were 4 and 14 days, respectively. AmB in positive liposomes seemed to demonstrate the highest flux in stratum corneum (58 ng/cm(2)/h), while the highest flux in viable epidermis (23 ng/cm(2)/h) was observed in negative liposomes. AmB entrapped in charged liposomes showed sustained skin absorption. The positively charged liposome might be the best formulation for AmB, due to its higher stability than other formulations. PMID:14726142

  12. Structural properties of liposomes from digital holographic microscopy

    NASA Astrophysics Data System (ADS)

    Di Maio, Isabelle L.; Carl, Daniel; Langehanenberg, Patrik; Valenzuela, Stella M.; Battle, Andrew R.; Al Khazaaly, Sabah; Killingsworth, Murray; Kemper, Bjorn; von Bally, Gert; Martin, Donald K.

    2006-01-01

    We have constructed liposomes from L alpha Phosphatidylcholine (PC) lipids, which are biomimetic lipids similar to those present in the membranes of mammalian cells. We propose an advance in the use of liposomes, such as for drug delivery, to incorporate into the liposomal membranes transport proteins that have been extracted from the lipid membranes of mammalian cells. In this paper, we describe the usage of a novel optical microscope to characterize the nanomechanical properties of these liposomes. We have applied the technique of digital holographic microscopy, using an instrument recently developed at the University of Münster, Germany. This system enabled us to measure quantitatively the structural changes in liposomes. We have investigated the deformations of these biomimetic lipids comprising these liposomes by applying osmotic stresses, in order to gain insight into the membrane environment prior to incorporation of cloned membrane transport proteins. This control of the nanomechanical properties is important in the stresses transmitted to mechanosensitive ion channels that we have incorporated into the liposomal membranes. These liposomes provide transporting vesicles that respond to mechanical stresses, such as those that occur during implantation.

  13. Treatment of visceral leishmaniasis in children with liposomal amphotericin B

    Microsoft Academic Search

    Lucio di Martino; Robert N. Davidson; Raffella Giacchino; Silvestro Scotti; Francesco Raimondi; Elio Castagnola; Loredana Tasso; Antonio Cascio; Luigi Gradoni; Marina Gramiccia; Massimo Pettoello-Mantovani; Anthony D. M. Bryceson

    1997-01-01

    We used liposomal amphotericin B as first-choice treatment of visceral leishmaniasis in 106 immunocompetent children who acquired the infection in a temperate region of southern Europe (Italy) where Leishmania infantum visceral leishmaniasis is endemic. The aim of the study was to identify the minimum total dose of liposomal amphotericin B needed to cure the infection in children and reduce the

  14. Heat-activated liposome targeting to streptavidin-coated surfaces.

    PubMed

    Jing, Yujia; Trefná, Hana Dobší?ek; Persson, Mikael; Svedhem, Sofia

    2015-06-01

    There is a great need of improved anticancer drugs and corresponding drug carriers. In particular, liposomal drug carriers with heat-activated release and targeting functions are being developed for combined hyperthermia and chemotherapy treatments of tumors. The aim of this study is to demonstrate the heat-activation of liposome targeting to biotinylated surfaces, in model experiments where streptavidin is used as a pretargeting protein. The design of the heat-activated liposomes is based on liposomes assembled in an asymmetric structure and with a defined phase transition temperature. Asymmetry between the inside and the outside of the liposome membrane was generated through the enzymatic action of phospholipase D, where lipid head groups in the outer membrane leaflet, i.e. exposed to the enzyme, were hydrolyzed. The enzymatically treated and purified liposomes did not bind to streptavidin-modified surfaces. When activation heat was applied, starting from 22°C, binding of the liposomes occurred once the temperature approached 33±0.5°C. Moreover, it was observed that the asymmetric structure remained stable for at least 2weeks. These results show the potential of asymmetric liposomes for the targeted binding to cell membranes in response to (external) temperature stimulus. By using pretargeting proteins, this approach can be further developed for personalized medicine, where tumor-specific antibodies can be selected for the conjugation of pretargeting agents. PMID:25732026

  15. Hydrophobic drug concentration affects the acoustic susceptibility of liposomes.

    PubMed

    Nguyen, An T; Lewin, Peter A; Wrenn, Steven P

    2015-04-01

    The purpose of this study was to investigate the effect of encapsulated hydrophobic drug concentration on ultrasound-mediated leakage from liposomes. Studies have shown that membrane modifications affect the acoustic susceptibility of liposomes, likely because of changes in membrane packing. An advantage of liposome as drug carrier is its ability to encapsulate drugs of different chemistries. However, incorporation of hydrophobic molecules into the bilayer may cause changes in membrane packing, thereby affecting the release kinetics. Liposomes containing calcein and varying concentrations of papaverine, a hydrophobic drug, were exposed to 20kHz, 2.2Wcm(-2) ultrasound. Papaverine concentration was observed to affect calcein leakage although the effects varied widely based on liposome phase. For example, incorporation of 0.5mg/mL papaverine into Ld liposomes increased the leakage of hydrophilic encapsulants by 3× within the first minute (p=0.004) whereas the same amount of papaverine increased leakage by only 1.5× (p<0.0001). Papaverine was also encapsulated into echogenic liposomes and its concentration did not significantly affect calcein release rates, suggesting that burst release from echogenic liposomes is predictable regardless of encapsulants chemistry and concentration. PMID:25450487

  16. Liposomes remain intact when complexed with polycationic brushes.

    PubMed

    Yaroslavov, Alexander A; Sybachin, Andrei V; Schrinner, Marc; Ballauff, Matthias; Tsarkova, Larisa; Kesselman, Ellina; Schmidt, Judith; Talmon, Yeshayahu; Menger, Fredric M

    2010-05-01

    Anionic liposomes adsorb onto the surface of spherical polymer particles bearing grafted linear cationic macromolecules. The size, shape, and encapsulation ability of the liposomes remain unchanged upon adsorption, thus providing immobilized self-organizing containers that have potential applications in the biomedical field. PMID:20387892

  17. The release and detection of endotoxin from liposomes.

    PubMed

    Harmon, P; Cabral-Lilly, D; Reed, R A; Maurio, F P; Franklin, J C; Janoff, A

    1997-08-01

    Incorporation of lipopolysaccharide (LPS) into liposomes dramatically reduces its ability to coagulate Limulus amebocyte lysate (LAL). The coagulation of LAL is commonly used to signal the presence of endotoxin in vitro. This study demonstrates a simple method to release masked endotoxin from liposomal dispersions using moderate amounts of detergent to form mixed micelles containing lipid, detergent, and LPS. Several parameters were found to affect the degree of liposome solubilization and/or the sensitivity of the LAL assay. These included detergent type and concentration, temperature for solubilization, lipid composition, liposome morphology, and time for test incubation. The nonionic detergent polyoxyethylene 10 lauryl ether (C12E10) proved to be unique in its ability to solubilize liposomes and minimally interfere with endotoxin detection. The LAL endotoxin detection limit for samples dispersed in C12E10 varied with the phospholipid component; the sensitivity decreased in the order DSPC > DPPC = EPC > DMPC. Cholesterol lowered the solubility limit of the liposomes, but did not appear to affect the LAL assay sensitivity once the liposomes were completely solubilized. The presence of negatively charged phospholipids, DSPG and Pops, also lowered the solubility limit. Pops, but not DSPG, at 10 mol% further decreased the LAL endotoxin detection limit. This detergent-solubilization method should be useful in liposomal LPS immunological studies or in other situations where accurate determination of endotoxin concentration is important. PMID:9245430

  18. Liposomes in the treatment of malignancy: a clinical perspective.

    PubMed

    Sugarman, S M; Perez-Soler, R

    1992-01-01

    Technological advances in liposomal preparation and efficient drug entrapment, along with supportive preclinical studies, have led to a number of recent clinical trials utilizing liposomes as drug carriers in the treatment of human malignancy. Although the results of these trials must be considered preliminary, it is clear that liposomal delivery of chemotherapeutic agents is safe at the doses administered. Aside from minor constitutional symptoms, virtually all toxicity could be attributed to release of the incorporated drug. Myelosuppression tends to be the dose-limiting toxicity with free drug, whereas constitutional symptoms are more likely to occur with encapsulated biologic therapy. Prior to human trials, there was fear that intravenous injection of liposomes could result in pulmonary emboli. No cases of pulmonary embolism secondary to liposome therapy have been recorded. The objective response rate in the patients studied appears to be minimal. This is not surprising, since the overwhelming majority of patients studied had disease that was advanced and previously shown to be refractory to therapy. Subgroups of patients that appear to benefit most include those with breast cancer who were treated with liposomal doxorubicin and those with advanced melanoma treated with liposomal tumor vaccines. Additional phase II and III clinical trials will better define the effectiveness of treatment modalities incorporating liposomes. VI-A. Future directions One of the earliest applications of liposomes may be in the amelioration of drug toxicity. Although not yet proven, the clinical studies reviewed suggest that liposomal delivery of doxorubicin reduces cardiotoxicity without sacrificing antitumor effect. Although similar claims have been made in support of continuous infusion doxorubicin [11], one can avoid unnecessary hospitalization or the bulk and expense of portable infusion devices by a single administration of the liposomal preparation. Liposome encapsulation can markedly alter the biodistribution and pharmacokinetics of well-known chemotherapeutic agents. The effectiveness of liposomal drug delivery in human trials thus far has probably been more closely related to altered pharmacokinetics rather than enhanced drug delivery to tumor or increased tumor responsiveness. As demonstrated by Gabizon [19], increased liposome circulating time in the murine model can be achieved by using small unilamellar vesicles containing a phosphatidylcholine of high phase-transition temperature and a small molar fraction of monosialoganglioside or hydrogenated phosphatidylinositol.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:1497823

  19. Recent Applications of Liposomes in Ophthalmic Drug Delivery

    PubMed Central

    Mishra, Gyan P.; Bagui, Mahuya; Tamboli, Viral; Mitra, Ashim K.

    2011-01-01

    Liposomal formulations were significantly explored over the last decade for the ophthalmic drug delivery applications. These formulations are mainly composed of phosphatidylcholine (PC) and other constituents such as cholesterol and lipid-conjugated hydrophilic polymers. Liposomes are biodegradable and biocompatible in nature. Current approaches for topical delivery of liposomes are focused on improving the corneal adhesion and permeation by incorporating various bioadhesive and penetration enhancing polymers. In the case of posterior segment disorders improvement in intravitreal half life and targeted drug delivery to the retina is achieved by liposomes. In this paper we have attempted to summarize the applications of liposomes in the field of ophthalmic drug delivery by citing numerous investigators over the last decade. PMID:21490757

  20. Shrinkage of pegylated and non-pegylated liposomes in serum

    PubMed Central

    Wolfram, Joy; Suri, Krishna; Yang, Yong; Shen, Jianliang; Celia, Christian; Fresta, Massimo; Zhao, Yuliang; Shen, Haifa; Ferrari, Mauro

    2013-01-01

    An essential requisite for the design of nanodelivery systems is the ability to characterize the size, homogeneity and zeta potential of nanoparticles. Such properties can be tailored in order to create the most efficient drug delivery platforms. An important question is whether these characteristics change upon systemic injection. Here, we have studied the behavior of phosphatidylcholine/cholesterol liposomes exposed to serum proteins. The results reveal a serum-induced reduction in the size and homogeneity of both pegylated and non-pegylated liposomes, implicating the possible role of osmotic forces. In addition, changes to zeta-potential were observed upon exposing liposomes to serum. The liposomes with polyethylene glycol expressed different characteristics than their non-polymeric counterparts, suggesting the potential formation of a denser protein corona around the non-pegylated liposomes. PMID:24216620

  1. Assembly and Targeting of Liposomal Nanoparticles Encapsulating Quantum Dots

    PubMed Central

    Mukthavaram, Rajesh; Wrasidlo, Wolf; Hall, David; Kesari, Santosh; Makale, Milan

    2011-01-01

    Quantum dots (QDs) are attracting intense interest as fluorescence labeling agents for biomedical imaging because biocompatible coatings and relatively non-toxic rare earth metal QDs have emerged as possible options. QD photoemissions are bright, of narrow wavelength range, and very stable. We sought to encapsulate QDs within targeted PEGylated liposomes to reduce their propensity for liver uptake and to amplify the already strong QD emission signal. A novel lipid-QD conjugate initialized a process by which lipids in solution coalesced around the QDs. The liposomal structure was confirmed with size measurements, SEM, and IR spectroscopy. PEGylated QD liposomes injected into a xenograft tumor model largely cleared from the body within 24 hours. Residual liver labeling was low. Targeted QD liposomes exhibited robust tumor labeling compared with controls. This study highlights the potential of these near IR emitting QD liposomes for preclinical/clinical applications. PMID:21786821

  2. Gadolinium chloride-induced shifts in intrahepatic distributions of liposomes.

    PubMed

    Lázár, G; van Galen, M; Scherphof, G L

    1989-05-10

    Intravenously administered gadolinium chloride caused only a slight decrease in the rate of elimination of small unilamellar liposomes from the blood and had no influence on the total hepatic uptake of these vesicles, but did alter their intrahepatic distribution substantially. Uptake by the non-parenchymal cells was substantially decreased, whereas uptake by the parenchymal cells showed a concomitant increase. Our earlier observations (Roerdink et al. (1981) Biochim. Biophys. Acta 677, 79-89) on the effect of lanthanides on the in vivo distribution of multilamellar liposomes have been extended, in that we demonstrate, in addition to the drop in elimination rate from the blood and in the over-all hepatic uptake, a shift of liposome distribution within the Kupffer cell population. While the larger Kupffer cells, which normally take up a major fraction of an injected liposome dose, were strongly inhibited in liposome uptake, the more numerous small macrophages showed a 3-4-fold increase in uptake. PMID:2713404

  3. Electromagnetic field triggered drug and chemical delivery via liposomes

    DOEpatents

    Liburdy, Robert P. (1820 Mountain View Rd., Tiburon, CA 94920)

    1993-01-01

    The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release said chemical agent from the liposomes at a temperature of between about +10 and 65.degree. C. The invention further relates to the use of said liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.

  4. Shrinkage of pegylated and non-pegylated liposomes in serum.

    PubMed

    Wolfram, Joy; Suri, Krishna; Yang, Yong; Shen, Jianliang; Celia, Christian; Fresta, Massimo; Zhao, Yuliang; Shen, Haifa; Ferrari, Mauro

    2014-02-01

    An essential requisite for the design of nanodelivery systems is the ability to characterize the size, homogeneity and zeta potential of nanoparticles. Such properties can be tailored in order to create the most efficient drug delivery platforms. An important question is whether these characteristics change upon systemic injection. Here, we have studied the behavior of phosphatidylcholine/cholesterol liposomes exposed to serum proteins. The results reveal a serum-induced reduction in the size and homogeneity of both pegylated and non-pegylated liposomes, implicating the possible role of osmotic forces. In addition, changes to zeta-potential were observed upon exposing liposomes to serum. The liposomes with polyethylene glycol expressed different characteristics than their non-polymeric counterparts, suggesting the potential formation of a denser protein corona around the non-pegylated liposomes. PMID:24216620

  5. Electromagnetic field triggered drug and chemical delivery via liposomes

    DOEpatents

    Liburdy, R.P.

    1993-03-02

    The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release the chemical agent from the liposomes at a temperature of between about +10 and 65 C. The invention further relates to the use of the liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.

  6. Cell penetrating peptide conjugated liposomes as transdermal delivery system of Polygonumaviculare L. extract.

    PubMed

    Kwon, Soon Sik; Kim, Sun Young; Kong, Bong Ju; Kim, Kyeong Jin; Noh, Geun Young; Im, Na Ri; Lim, Ji Won; Ha, Ji Hoon; Kim, Junoh; Park, Soo Nam

    2015-04-10

    In this study, Polygonum aviculare L. extract, which has superior antioxidative and cellular membrane protective activity, was loaded onto cell penetrating peptide (CPP) conjugated liposomes to enhance transdermal delivery. The physical characteristics of typical liposomes and CPP-conjugated liposomes containing P. aviculare extract were evaluated. The particle sizes of both liposomes were approximately 150nm. Whereas the zeta potential of typical liposomes was -45mV, that of CPP-conjugated liposomes was +42mV. The loading efficiency of P. aviculare extract in both liposomes was calculated to be about 83%. Fluorescent-labeled liposomes were prepared to evaluate cellular uptake and skin permeation efficiency. Using flow cytometry, we found that CPP-conjugated liposomes improved cellular uptake of the fluorescent dye as compared with the typical liposomes. In addition, the skin permeation of CPP-conjugated liposomes was proved higher than that of typical liposomes by confocal laser scanning microscopy studies and Franz diffusion cell experiments. The improved cellular uptake and skin permeation of the CPP-conjugated liposomes were due to the cationic arginine-rich peptide. In vivo studies also determined that the CPP-conjugated liposomes were more effective in depigmentation and anti-wrinkle studies than typical liposomes. These results indicate that the CPP-conjugated liposomes could be effective for transdermal drug delivery of antioxidant and anti-aging therapeutics. PMID:25623491

  7. Association of hydrophobically-modified poly(ethylene glycol) with fusogenic liposomes

    E-print Network

    Auguste, Debra T.

    Association of hydrophobically-modified poly(ethylene glycol) with fusogenic liposomes Debra T. Fusogenic liposomes prepared from N-C12-DOPE:DOPC 7:3 (mol:mol) were equilibrated with HMPEGs. Affinity: Fusogenic liposome; Hydrophobically modified PEG; Liposome protection; Complement assay; Comb-graft; Protein

  8. Pharmacotherapy by intracellular delivery of drugs using fusogenic liposomes: application to vaccine development

    Microsoft Academic Search

    Jun Kunisawa; Shinsaku Nakagawa; Tadanori Mayumi

    2001-01-01

    We prepared fusogenic liposomes by fusing conventional liposomes with an ultra-violet inactivated Sendai virus. Fusogenic liposomes can deliver encapsulated contents into the cytoplasm directly in a Sendai virus fusion-dependent manner. Based on the high delivery rates into the cytoplasm, we originally planned to apply the fusogenic liposomes to cancer chemotherapy and gene therapy. We have recently also examined the use

  9. Rational Design of a Zinc Phthalocyanine Binding Protein

    PubMed Central

    Mutter, Andrew C.; Norman, Jessica A.; Tiedemann, Michael T.; Singh, Sunaina; Sha, Sha; Morsi, Sara; Ahmed, Ismail; Stillman, Martin J.; Koder, Ronald L.

    2014-01-01

    Phthalocyanines have long been used as primary donor molecules in synthetic light-powered devices due to their superior properties when compared to natural light activated molecules such as chlorophylls. Their use in biological contexts, however, has been severely restricted due to their high degree of self-association, and its attendant photoquenching, in aqueous environments. To this end we report the rational redesign of a de novo four helix bundle di-heme binding protein into a heme and Zinc(II) phthalocyanine (ZnPc) dyad in which the ZnPc is electronically and photonically isolated. The redesign required transformation of the homodimeric protein into a single chain four helix bundle and the addition of a negatively charge sulfonate ion to the ZnPc macrocycle. To explore the role of topology on ZnPc binding two constructs were made and the resulting differences in affinity can be explained by steric interference of the newly added connecting loop. Singular binding of ZnPc was verified by absorption, fluorescence, and magnetic circular dichroism spectroscopy. The engineering guidelines determined here, which enable the simple insertion of a monomeric ZnPc binding site into an artificial helical bundle, are a robust starting point for the creation of functional photoactive nanodevices. PMID:23827257

  10. New drug delivery nanosystem combining liposomal and dendrimeric technology (liposomal locked-in dendrimers) for cancer therapy.

    PubMed

    Gardikis, Konstantinos; Hatziantoniou, Sophia; Bucos, Madalina; Fessas, Dimitrios; Signorelli, Marco; Felekis, Theodoros; Zervou, Maria; Screttas, Constantinos G; Steele, Barry R; Ionov, Maksim; Micha-Screttas, Maria; Klajnert, Barbara; Bryszewska, Maria; Demetzos, Costas

    2010-08-01

    Liposomal locked-in dendrimers (LLDs), the combination of liposomes and dendrimers in one formulation, represents a relatively new term in the drug carrier technology. LLDs undergone appropriate physicochemical investigation can merge the benefits of liposomal and dendrimeric nanocarriers. In this study generation 1 and 2 hydroxy-terminated dendrimers were synthesized and were then "locked" in liposomes consisting of DOPC/DPPG. The anticancer drug doxorubicin (Dox) was loaded into pure liposomes or LLDs and the final products were subjected to lyophilization. The loading of Dox as well as its in vitro release rate from all systems was determined and the interaction of liposomes with dendrimers was assessed by thermal analysis and fluorescence spectroscopy. The results were very promising in terms of drug encapsulation and release rate, factors that can alter the therapeutic profile of a drug with low therapeutic index such as Dox. Physicochemical methods revealed a strong, generation dependent, interaction between liposomes and dendrimers that probably is the basis for the higher loading and slower drug release from the LLDs comparing to pure liposomes. PMID:20564386

  11. Continuous release of interleukin-2 from liposomal IL-2 (mixture of interleukin-2 and liposomes) after subcutaneous administration to mice.

    PubMed

    Kanaoka, Eri; Takahashi, Kouji; Yoshikawa, Takayoshi; Jizomoto, Hiroaki; Nishihara, Yoshitaka; Hirano, Koichiro

    2003-11-01

    Recombinant interleukin-2 (IL-2) was strongly and almost completely adsorbed onto small and hydrophobic liposomes by simple mixing under optimal conditions (liposome: DSPC-DSPG; molar ratio, 10:1; 30-50 nm in size, ratio of IL-2 to liposome: 4.0 JRU/nmol lipid). This liposomal IL-2 displayed better distribution after intravenous administration in mice and improved therapeutic effect against experimental M5076 metastases, as reported previously. In this study, the elimination of IL-2 from the dosing area was investigated when the liposomal IL-2 was administered to mice subcutaneously. The results suggest that the release of IL-2 from this liposome was continuous and almost complete. The mean residence time (MRT) of IL-2 in the dosing area was 11.0 +/- 1.65 hr. This resulted in the 8-fold times enhancement of MRT in the systemic circulation by the presence of liposomes, and IL-2 was detected in the serum for 2 days. Using this liposomal IL-2 is expected to have the potential to decrease the number of injections and enhance the efficacy of IL-2 in immunotherapies and therapies against tumor. PMID:14677775

  12. Destruction thresholds of echogenic liposomes with clinical diagnostic ultrasound.

    PubMed

    Smith, Denise A B; Porter, Tyrone M; Martinez, Janet; Huang, Shaoling; MacDonald, Robert C; McPherson, David D; Holland, Christy K

    2007-05-01

    Echogenic liposomes (ELIP) are submicron-sized phospholipid vesicles that contain both gas and fluid. With antibody conjugation and drug incorporation, these liposomes can be used as novel targeted diagnostic and therapeutic ultrasound contrast agents. The utility of liposomes for contrast depends upon their stability in an acoustic field, whereas the use of liposomes for drug delivery requires the liberation of encapsulated gas and drug payload at the desired treatment site. The objective of this study was twofold: (1) to characterize the stability of liposome echogenicity after reconstitution and (2) to quantitate the acoustic destruction thresholds of liposomes as a function of peak rarefactional pressure (P(r)), pulse duration (PD) and pulse repetition frequency (PRF). The liposomes were insonified in an anechoic sample chamber using a Philips HDI 5000 diagnostic ultrasound scanner with a L12-5 linear array. Liposome stability was evaluated with 6.9-MHz fundamental and 4.5-MHz harmonic B-mode pulses at various P(r) at a fixed PRF. Liposome destruction thresholds were determined using 6.0-MHz Doppler pulses, by varying the PD with a fixed PRF of 1.25 kHz and by varying the PRF with a fixed PD of 3.33 micros. Videos or freeze-captured images were acquired during each insonation experiment and analyzed for echogenicity in a fixed region of interest as a function of time. An initial increase in echogenicity was observed for fundamental and harmonic B-mode imaging pulses. The threshold for acoustically driven diffusion of gas out of the liposomes using 6.0-MHz Doppler pulses was weakly dependent upon PRF and PD. The rapid fragmentation thresholds, however, were highly dependent upon PRF and PD. The quantification of acoustic destruction thresholds of ELIP is an important first step in their development as diagnostic and drug delivery agents. PMID:17412486

  13. Light induced cytosolic drug delivery from liposomes with gold nanoparticles.

    PubMed

    Lajunen, Tatu; Viitala, Lauri; Kontturi, Leena-Stiina; Laaksonen, Timo; Liang, Huamin; Vuorimaa-Laukkanen, Elina; Viitala, Tapani; Le Guével, Xavier; Yliperttula, Marjo; Murtomäki, Lasse; Urtti, Arto

    2015-04-10

    Externally triggered drug release at defined targets allows site- and time-controlled drug treatment regimens. We have developed liposomal drug carriers with encapsulated gold nanoparticles for triggered drug release. Light energy is converted to heat in the gold nanoparticles and released to the lipid bilayers. Localized temperature increase renders liposomal bilayers to be leaky and triggers drug release. The aim of this study was to develop a drug releasing system capable of releasing its cargo to cell cytosol upon triggering with visible and near infrared light signals. The liposomes were formulated using either heat-sensitive or heat- and pH-sensitive lipid compositions with star or rod shaped gold nanoparticles. Encapsulated fluorescent probe, calcein, was released from the liposomes after exposure to the light. In addition, the pH-sensitive formulations showed a faster drug release in acidic conditions than in neutral conditions. The liposomes were internalized into human retinal pigment epithelial cells (ARPE-19) and human umbilical vein endothelial cells (HUVECs) and did not show any cellular toxicity. The light induced cytosolic delivery of calcein from the gold nanoparticle containing liposomes was shown, whereas no cytosolic release was seen without light induction or without gold nanoparticles in the liposomes. The light activated liposome formulations showed a controlled content release to the cellular cytosol at a specific location and time. Triggering with visual and near infrared light allows good tissue penetration and safety, and the pH-sensitive liposomes may enable selective drug release in the intracellular acidic compartments (endosomes, lysosomes). Thus, light activated liposomes with gold nanoparticles are an attractive option for time- and site-specific drug delivery into the target cells. PMID:25701610

  14. Liposomes tethered to a biopolymer film through the hydrophobic effect create a highly effective lubricating surface.

    PubMed

    Zheng, R; Arora, J; Boonkaew, B; Raghavan, S R; Kaplan, D L; He, J; Pesika, N S; John, V T

    2014-12-14

    Liposomal coatings are formed on films of a biopolymer, hydrophobically modified chitosan (hm-chitosan), containing dodecyl groups as hydrophobes along the polymer backbone. The alkyl groups insert themselves into the liposome bilayer through hydrophobic interactions and thus tether liposomes, leading to a densely packed liposome layer on the film surface. Such liposomal surfaces exhibit effective lubrication properties due to their high degree of hydration, and reduce the coefficient of friction to the biologically-relevant range. The compliancy and robustness of these tethered liposomes allow retention on the film surface upon repeated applications of shear. Such liposome coated films have potential applications in biolubrication. PMID:25315119

  15. Clearance and localization of intravitreal liposomes in the aphakic vitrectomized eye

    SciTech Connect

    Stern, W.H.; Heath, T.D.; Lewis, G.P.; Guerin, C.J.; Erickson, P.A.; Lopez, N.G.; Hong, K.L.

    1987-05-01

    The authors have examined the fate of intravitreally injected liposomes in the aphakic, vitrectomized eye of the rabbit. Liposomes labelled with /sup 125/(I)-p-hydroxybenzimidylphosphatidylethanolamine were eliminated rapidly from the intraocular fluid. Nonetheless, a significant fraction of these liposomes were found to bind to various ocular tissues including the retina, iris, sclera, and cornea. Ultrastructural studies with gold colloid-loaded liposomes revealed that retinal bound liposomes were attached to the inner limiting lamina but did not penetrate to the internal cells of the retina. Epiretinal cells bound and internalized gold colloid-loaded liposomes suggesting that these cells may be very sensitive to liposome mediated drug delivery.

  16. Photo-induced electron transfer between a dendritic zinc(II) phthalocyanine and methyl viologen

    NASA Astrophysics Data System (ADS)

    Wang, Yuhua; Chen, Jiangxu; Huang, Lishan; Xie, Shusen; Yang, Hongqin; Peng, Yiru

    2013-01-01

    The intermolecular electron transfer between the carboxylic dendritic zinc(II) phthalocyanines [G1-ZnPc( and G2-ZnPc(] and methyl viologen (MV) is studied by steady-state fluorescence and UV/Vis absorption spectroscopic method. The effect of dendron generation of this series of dendritic phthalocyanines on intermolecular electron transfer is investigated. The results show that the fluorescence emission of these dendritic phthalocyanines could be greatly quenched by MV upon excitation at 610 nm. The Stern-Volmer constant (KSV) of electron transfer is decreased with increasing dendron generations. Our study suggests that these dendritic phthalocyanines are an effective new electron donor and transmission complex and could be used as a potential artificial photosynthesis system.

  17. Heteroleptic naphthalo-phthalocyaninates of lutetium: synthesis and spectral and conductivity properties.

    PubMed

    Dubinina, Tatiana V; Kosov, Anton D; Petrusevich, Elizaveta F; Maklakov, Sergey S; Borisova, Nataliya E; Tomilova, Larisa G; Zefirov, Nikolay S

    2015-04-21

    Novel heteroleptic naphthalo-phthalocyaninates of lutetium possessing a symmetrical substituted naphthalocyanine deck were synthesized on the basis of two preformed synthetic blocks: naphthalocyanine ligand and lutetium phthalocyaninates. The compounds obtained were characterized by (1)H NMR and high-resolution MALDI-TOF/TOF mass spectrometry. The correlation between the nature of the substituents and the spectral properties of the target complexes was determined by the introduction of electron-donating (aryl-, aryloxy-) or electron-withdrawing (chloro-) substituents into the phthalocyanine deck. In addition, the nature of peripheral substituents was shown not to affect drastically the phthalocyanine conductivity and activation energy. Conductivity properties depend on thin film morphology which, in turn, relies on intermolecular ?-? interactions. PMID:25826576

  18. Spectroscopic insights on imidazole substituted phthalocyanine photosensitizers: Fluorescence properties, triplet state and singlet oxygen generation

    NASA Astrophysics Data System (ADS)

    Zhang, Xian-Fu; Lin, Yong; Guo, Wenfeng; Zhu, Jingzhong

    2014-12-01

    Imidazole substituted metal phthalocyanine (Pc) complexes were synthesized. UV-vis absorption, steady state and time-resolved fluorescence, as well as laser flash photolysis were used to measure the photophysical and photosensitizing properties. All the imidazole-phthalocyanine conjugates show high ?T (quantum yield of excited triplet formation), high ?? (singlet oxygen formation yield, >0.50) and good fluorescence properties (quantum yield ?f > 0.20 and lifetime ?f > 3.0 ns). Compared to the unsubstituted Pc, both ?- and ?-imidazole substitutions result in the remarkable decrease in ?f and ?f, but the ?-substitution is stronger. The imidazole substitution, on the other hand, causes the increase of ?T, ?T, and ?? values. Magnesium phthalocyanine (MgPc) is more susceptible to the substitution than zinc phthalocyanine (ZnPc). The mechanism responsible for the result is suggested based on the involvement of intramolecular photoinduced electron transfer. The high ?? and appropriate fluorescence properties make the Pcs good candidate for PDT photosensitizers.

  19. Spectroscopic insights on imidazole substituted phthalocyanine photosensitizers: fluorescence properties, triplet state and singlet oxygen generation.

    PubMed

    Zhang, Xian-Fu; Lin, Yong; Guo, Wenfeng; Zhu, Jingzhong

    2014-12-10

    Imidazole substituted metal phthalocyanine (Pc) complexes were synthesized. UV-vis absorption, steady state and time-resolved fluorescence, as well as laser flash photolysis were used to measure the photophysical and photosensitizing properties. All the imidazole-phthalocyanine conjugates show high ?T (quantum yield of excited triplet formation), high ?? (singlet oxygen formation yield, >0.50) and good fluorescence properties (quantum yield ?f>0.20 and lifetime ?f>3.0 ns). Compared to the unsubstituted Pc, both ?- and ?-imidazole substitutions result in the remarkable decrease in ?f and ?f, but the ?-substitution is stronger. The imidazole substitution, on the other hand, causes the increase of ?T, ?T, and ?? values. Magnesium phthalocyanine (MgPc) is more susceptible to the substitution than zinc phthalocyanine (ZnPc). The mechanism responsible for the result is suggested based on the involvement of intramolecular photoinduced electron transfer. The high ?? and appropriate fluorescence properties make the Pcs good candidate for PDT photosensitizers. PMID:24997445

  20. Influence of different peripheral substituents on the nonlinear optical properties of cobalt phthalocyanine core

    SciTech Connect

    Derkowska, B.; Wojdyla, M.; Bala, W.; Jaworowicz, K.; Karpierz, M.; Grote, James G.; Krupka, O.; Kajzar, F.; Sahraoui, B. [Institute of Physics, N. Copernicus University, GrudziaPdzka 5/7, 87-100 Torun (Poland); Optics Division, Faculty of Physics, Warsaw University of Technology, Koszykowa 75, 00-681 Warsaw (Poland); Air Force Research Laboratory Materials and Manufacturing Directorate, Wright-Patterson Air Force Base, 3005 Hobson Way, Dayton, Ohio 45433-7707 (United States); Laboratory POMA, UMR CNRS 6136, University of Angers, 2 Boulevard Lavoisier, 49045 Angers (France)

    2007-04-15

    In this article, we show how the substituting different peripheral substituents around the cobalt phthalocyanine core correlate with nonlinear optical properties. We present the results on nonlinear optical properties of solution of cobalt phthalocyanine (CoPc), cobalt phthalocyanine with DNA-CTMA surfactant complex (CoPc-DNA-CTMA), and cobalt phthalocyanine with liquid crystal (CoPc-LC) measured by degenerate four-wave mixing (DFWM) method at the 532 nm wavelength region. We found that the values of third-order nonlinear optical susceptibility ({chi}{sup <3>}) of CoPc-LC and CoPc-DNA-CTMA increase in comparison with the value of the third-order nonlinear optical susceptibilities of CoPc. We supposed that this is caused by increase of the charge-transfer effects and of the dipole moments of the molecule with the increase of the chain length.

  1. Laser-induced damage to stained liposomes Dégats induite par l'action du laser sur les liposomes tachées

    NASA Astrophysics Data System (ADS)

    Jamasbi, Nooshin; Mohebi, Mehrdad; Rivera Hernandez, Martha O.

    1998-12-01

    In this work we have studied the damaging effect of laser light on cell membranes using single bilayer liposomes as a model system. Liposomes, because of their structural similarities to membranes of biological cells, are the best model systems used for the investigation of the effect of laser radiation on biomembranes. Samples of liposomes were routinely prepared and stained in our laboratory. For efficient localized heating of the membrane by laser light, we stained liposomes with a membrane dye with strong absorption at the laser wavelength. Irradiated by the laser beam, the membrane breakdown occurred at a particular laser power for samples of stained liposomes. The laser-induced damage was detected with the use of a photon correlation technique. The power threshold for this damage was measured.

  2. Aluminum phthalocyanine chloride\\/C 60 organic photovoltaic cells with high open-circuit voltages

    Microsoft Academic Search

    Do Young Kim; Franky So; Yongli Gao

    2009-01-01

    Small molecule organic planar and bulk heterojunction photovoltaic cells were fabricated using aluminum phthalocyanine chloride (AlPcCl) or copper phthalocyanine (CuPc) as a donor. While both AlPcCl and CuPc cells have similar short-circuit current, the power conversion efficiency of the AlPcCl cells is about 1.8 times higher than that of the CuPc cells because of the higher open-circuit voltage in the

  3. Sulfonamide-substituted iron phthalocyanine: design, solubility range, stability and oxidation of olefins.

    PubMed

    I?ci, Umit; Caner, Celal; Zorlu, Yunus; Gürek, Ay?e Gül; Dumoulin, Fabienne; Ahsen, Vefa

    2014-12-28

    4-tert-Butylbenzenesulfonamide was used as a substituent of tetra peripherally substituted Fe(ii) phthalocyanine, taking into account several parameters crucial for the design of potential oxidation catalysts such as solubility and stability. The resulting phthalocyanine exhibits a remarkable stability under oxidative conditions. The main product of the oxidation of cyclohexene using H2O2 as the oxidant is the allylic ketone, 2-cyclohexen-1-one. Styrene oxidation led mainly to the formation of benzaldehyde. PMID:25355136

  4. Communication: Influence of graphene interlayers on the interaction between cobalt phthalocyanine and Ni(111)

    SciTech Connect

    Uihlein, Johannes; Peisert, Heiko; Glaser, Mathias; Polek, Malgorzata; Adler, Hilmar; Petraki, Fotini; Chasse, Thomas [Universitaet Tuebingen, Institut fuer Physikalische und Theoretische Chemie, Auf der Morgenstelle 18, 72076 Tuebingen (Germany); Ovsyannikov, Ruslan; Bauer, Maximilian [Helmholtz Zentrum Berlin fuer Materialien und Energie GmbH, Elektronenspeicherring BESSY II, Albert-Einstein-Str. 15, 12489 Berlin (Germany)

    2013-02-28

    The influence of graphene interlayers on electronic interface properties of cobalt phthalocyanine on Ni(111) is studied using both photoemission and X-ray absorption spectroscopy. A charge transfer associated with a redistribution of the d-electrons at the Co-atom of the phthalocyanine occurs at the interface to Ni(111). Even a graphene buffer layer cannot prevent the charge transfer at the interface to Ni(111); however, the detailed electronic situation is different.

  5. Analysis of individual lipoproteins and liposomes

    SciTech Connect

    Robbins, D.L.; Keller, R.A.; Nolan, J.P. [and others

    1997-08-01

    We describe the application of single molecule detection (SMD) technologies for the analysis of natural (serum lipoproteins) and synthetic (liposomes) transport systems. The need for advanced analytical procedures of these complex and important systems is presented with the specific enhancements afforded by SMD with flowing sample streams. In contrast to bulk measurements which yield only average values, measurement of individual species allows creation of population histograms from heterogeneous samples. The data are acquired in minutes and the analysis requires relatively small sample quantities. Preliminary data are presented from the analysis of low density lipoprotein, and multilamellar and unilamellar vesicles.

  6. Rapid release of liposomal contents upon photoinitiated destabilization with UV exposure

    Microsoft Academic Search

    Tony Spratt; Bruce Bondurant; David F. O'Brien

    2003-01-01

    The use of liposomes for the delivery of therapeutic agents to tumor sites took a major step forward with the introduction of sterically stabilized liposomes (polyethylene glycol [PEG]-liposomes). Several research groups reported the increased localization of PEG-liposomes at tumor sites. Once PEG-liposomes reach these sites, it can be desirable to increase the rate of release of encapsulated compound(s). The use

  7. Phthalocyanine photosensitizers as contrast agents for in vivo photoacoustic tumor imaging

    PubMed Central

    Attia, Amalina Bte Ebrahim; Balasundaram, Ghayathri; Driessen, Wouter; Ntziachristos, Vasilis; Olivo, Malini

    2015-01-01

    There is a need for contrast agents for non-invasive diagnostic imaging of tumors. Herein, Multispectral Optoacoustic Tomography (MSOT) was employed to evaluate phthalocyanines commonly used in photodynamic therapy as photoacoustic contrast agents. We studied the photoacoustic activity of three water-soluble phthalocyanine photosensitizers: phthalocyanine tetrasulfonic acid (PcS4), Zn(II) phthalocyanine tetrasulfonic acid (ZnPcS4) and Al(III) phthalocyanine chloride tetrasulfonic acid (AlPcS4) in phantom and in tumor-bearing mice to investigate the biodistribution and fate of the phthalocyanines in the biological tissues. PcS4 was observed to grant good contrast between the different reticuloendothelial organs and accumulate in the tumor within an hour of post-administration. ZnPcS4 and AlPcS4 offered little contrast in photoacoustic signals between the organs. PcS4 is a promising photoacoustic contrast agent and can be exploited as a photodiagnostic agent. PMID:25780748

  8. Anti-fibrillogenic properties of phthalocyanines: effect of the out-of-plane ligands.

    PubMed

    Kovalska, V; Cherepanov, V; Losytskyy, M; Chernii, S; Senenko, A; Chernii, V; Tretyakova, I; Yarmoluk, S; Volkov, S

    2014-12-15

    The axially-coordinated phthalocyanines were previously reported as agents possessing strong anti-fibrillogenic properties. In the presented study we used the atomic force microscopy to investigate the intermediates and the products of insulin aggregation reaction formed in the presence of Zr and Hf phthalocyanine complexes that contain out-of-plane ligands of different size and nature. It is shown that while phthalocyanine-free insulin generated mostly amyloid fibrils with a diameter of 2-8nm and a length of up to 5?m, the presence of phthalocyanines with spatial bulky ligands (PcZrDbm2) leads to the redirection of the fibrillization reaction to the formation of the spherical oligomer aggregates with a diameter of 4-12nm. At the same time the phthalocyanine complex PcHfCl2 having the small-volume ligands induces the formation of large size insulin aggregates with a height of about 100nm that are supposed to be amorphous species. The study of the aggregation intermediates showed the certain similarity of the reaction passing for phthalocyanine-free insulin and insulin in the presence of PcZrDbm2. The large-size amorphous species were observed at the beginning of reaction, later they dissociated, leading to the formation and growth of the smaller size particles. The amyloid-sensitive cyanine dye 7519 demonstrates the strong fluorescent response both in the presence of fibrils and spherical oligomers, while it is non-sensitive to amorphous aggregates. PMID:25456081

  9. Photophysical property of a polymeric nanoparticle loaded with an aryl benzyl ester silicon (IV) phthalocyanine

    NASA Astrophysics Data System (ADS)

    Pan, Sujuan; Ma, Dongdong; Chen, Xiuqin; Wang, Yuhua; Yang, Hongqin; Peng, Yiru

    2014-09-01

    Because of their excellent near-infrared (NIR) optical properties, phthalocyanines (Pcs) have been regarded as promising therapy agents for fluorescence image-guided drug delivery and noninvasive treatment of tumors by photodynamic therapy (PDT). Nevertheless, phthalocyanines are substantially limited in clinical applications owing to their poor solubility, aggregation and insufficient selectivity for cancer cells. To address these issues, we have developed a novel dendrimer-based theranostic nanoparticle for tumor-targeted delivery of phthalocyanine. The preparation procedure involved the modification of the silicon (IV) phthalocyanine molecule with a dendritic axially substitution, which significantly enhances their photophysical property. In order to improve biocompatibility and tumor-targeted delivery, the hydrophobic dendritic phthalocyanine was encapsulated by diblock amphiphilic copolymer poly (ethylene glycol)-poly (Epsilon-caprolactone) (MPEG-PCL) to form a polymeric nanoparticle. The polymeric nanoparticle is spherical with a diameter at about 90 nm. The photophysical property of the polymeric nanoparticle was studied by UV/Vis and fluorescence spectroscopic methods. Compared with the free dendritic phthalocyanine, the Q band of the polymeric nanoparticle was red-shifted, and the fluorescence intensity decreased. Furthermore, the polymeric nanoparticle has a relatively high loading amount and encapsulation rate. Therefore, the polymeric nanoparticle would be a promising third-generation photosensitizer (PS) for PDT.

  10. Phthalocyanine photosensitizers as contrast agents for in vivo photoacoustic tumor imaging.

    PubMed

    Attia, Amalina Bte Ebrahim; Balasundaram, Ghayathri; Driessen, Wouter; Ntziachristos, Vasilis; Olivo, Malini

    2015-02-01

    There is a need for contrast agents for non-invasive diagnostic imaging of tumors. Herein, Multispectral Optoacoustic Tomography (MSOT) was employed to evaluate phthalocyanines commonly used in photodynamic therapy as photoacoustic contrast agents. We studied the photoacoustic activity of three water-soluble phthalocyanine photosensitizers: phthalocyanine tetrasulfonic acid (PcS4), Zn(II) phthalocyanine tetrasulfonic acid (ZnPcS4) and Al(III) phthalocyanine chloride tetrasulfonic acid (AlPcS4) in phantom and in tumor-bearing mice to investigate the biodistribution and fate of the phthalocyanines in the biological tissues. PcS4 was observed to grant good contrast between the different reticuloendothelial organs and accumulate in the tumor within an hour of post-administration. ZnPcS4 and AlPcS4 offered little contrast in photoacoustic signals between the organs. PcS4 is a promising photoacoustic contrast agent and can be exploited as a photodiagnostic agent. PMID:25780748

  11. Spectroscopic studies of alpha tocopherol interaction with a model liposome and its influence on oxidation dynamics

    NASA Astrophysics Data System (ADS)

    Krilov, Dubravka; Kosovi?, Marin; Serec, Kristina

    2014-08-01

    The influence of ?-tocopherol on the surface conformation of liposome, as a model component of lipoproteins, and its role in oxidation process were studied. FT-IR spectra from suspensions of neat liposome, mixtures of liposome and ?-tocopherol and liposome with incorporated ?-tocopherol were analyzed. When ?-tocopherol was incorporated into liposome, intensities of some bands were decreased or increased in comparison with the spectra of liposome and ?-tocopherol mixture. These changes reflect the different localization of ?-tocopherol in two types of liposome suspensions. The oxidation of liposome suspensions was initiated by addition of cupric ions. After prolonged oxidation, the differences in FT-IR spectra of oxidized samples were recorded. Differences were observed in comparison with spectra of native and oxidized liposomes were analyzed. The rate of oxidation was measured by EPR oximetry. Oxidation was generally very slow, but faster in liposome without ?-tocopherol, indicating the protective role of ?-tocopherol against liposome oxidation. On the other hand, liposome suspensions with EDTA in the buffer were not oxidized at all, while those with ?-tocopherol and liposome mixture were only slightly oxidized. In this case the consumption of oxygen was the result of liposome oxidation supported by ?-tocopherol. These results reflect the ambivalent role of ?-tocopherol in liposome oxidation, similarly to findings in studies of lipoprotein oxidation.

  12. Inhalation Treatment of Pulmonary Fibrosis by Liposomal Prostaglandin E2

    PubMed Central

    Ivanova, Vera; Garbuzenko, Olga B.; Reuhl, Kenneth R.; Reimer, David C.; Pozharov, Vitaly P.; Minko, Tamara

    2013-01-01

    Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and often fatal form of interstitial lung disease. We hypothesized that the local pulmonary delivery of prostaglandin E2 (PGE2) by liposomes can be used for the effective treatment of IPF. To test this hypothesis, we used a murine model of bleomycin-induced IPF to evaluate liposomes which carries PGE2 topically to the lungs. Animal survival, body weight, hydroxyproline content in the lungs, lung histology, mRNA and protein expression were studied. After inhalation delivery, liposomes accumulated predominately in the lungs. In contrast, intravenous administration led to the accumulation of liposomes mainly in kidney, liver, and spleen. Liposomal PGE2 prevented the disturbances in the expression of many genes associated with the development of IPF, substantially restricted inflammation and fibrotic injury in the lung tissues, prevented decrease in body weight, limited hydroxyproline accumulation in the lungs and virtually eliminated mortality of animals after intratracheal instillation of bleomycin. In summary, our data provide evidence that pulmonary fibrosis can be effectively treated by the inhalation administration of liposomal form of PGE2 into the lungs. The results of the present investigations make the liposomal form of PGE2 an attractive drug for the effective inhalation treatment of idiopathic pulmonary fibrosis. PMID:23228437

  13. Effect of iron liposomes on anemia of inflammation.

    PubMed

    Yuan, Li; Geng, Lina; Ge, Lan; Yu, Peng; Duan, Xianglin; Chen, Jun; Chang, Yanzhong

    2013-09-15

    Supplementation with iron-fortified foods is an effective method for treating iron deficiency diseases. However, traditional iron agents used to treat anemia of inflammation (AI) have little effect. In this study, two types of iron liposomes, heme liposomes (HEME-LIP) and ferric citrate liposomes (FAC-LIP), were prepared by the rotary-evaporated film-ultrasonication method, and the encapsulation efficiencies, microstructures, size distributions and zeta potentials were assessed. Both types of iron liposomes showed stable physical characteristics. When used to treat rat models of AI, FAC-LIP and HEME-LIP could increase serum iron levels by 119% and 54% higher than did ferric citrate (FAC) and heme, respectively. Furthermore, the hepcidin, a key regulator of iron homeostasis was up-regulated by these iron liposomes, especially by HEME-LIP. These results indicate that the absorption of iron liposomes was improved over that of unencapsulated iron agents. Thus, iron liposomes may be used to fortify food in treating iron deficiency diseases, especially AI. PMID:23850818

  14. Heparin octasaccharide decoy liposomes inhibit replication of multiple viruses.

    PubMed

    Hendricks, Gabriel L; Velazquez, Lourdes; Pham, Serena; Qaisar, Natasha; Delaney, James C; Viswanathan, Karthik; Albers, Leila; Comolli, James C; Shriver, Zachary; Knipe, David M; Kurt-Jones, Evelyn A; Fygenson, Deborah K; Trevejo, Jose M; Wang, Jennifer P; Finberg, Robert W

    2015-04-01

    Heparan sulfate (HS) is a ubiquitous glycosaminoglycan that serves as a cellular attachment site for a number of significant human pathogens, including respiratory syncytial virus (RSV), human parainfluenza virus 3 (hPIV3), and herpes simplex virus (HSV). Decoy receptors can target pathogens by binding to the receptor pocket on viral attachment proteins, acting as 'molecular sinks' and preventing the pathogen from binding to susceptible host cells. Decoy receptors functionalized with HS could bind to pathogens and prevent infection, so we generated decoy liposomes displaying HS-octasaccharide (HS-octa). These decoy liposomes significantly inhibited RSV, hPIV3, and HSV infectivity in vitro to a greater degree than the original HS-octa building block. The degree of inhibition correlated with the density of HS-octa displayed on the liposome surface. Decoy liposomes with HS-octa inhibited infection of viruses to a greater extent than either full-length heparin or HS-octa alone. Decoy liposomes were effective when added prior to infection or following the initial infection of cells in vitro. By targeting the well-conserved receptor-binding sites of HS-binding viruses, decoy liposomes functionalized with HS-octa are a promising therapeutic antiviral agent and illustrate the utility of the liposome delivery platform. PMID:25637710

  15. Giant Liposome Preparation for Imaging and Patch-Clamp Electrophysiology

    PubMed Central

    Collins, Marcus D.; Gordon, Sharona E.

    2013-01-01

    The reconstitution of ion channels into chemically defined lipid membranes for electrophysiological recording has been a powerful technique to identify and explore the function of these important proteins. However, classical preparations, such as planar bilayers, limit the manipulations and experiments that can be performed on the reconstituted channel and its membrane environment. The more cell-like structure of giant liposomes permits traditional patch-clamp experiments without sacrificing control of the lipid environment. Electroformation is an efficient mean to produce giant liposomes >10 ?m in diameter which relies on the application of alternating voltage to a thin, ordered lipid film deposited on an electrode surface. However, since the classical protocol calls for the lipids to be deposited from organic solvents, it is not compatible with less robust membrane proteins like ion channels and must be modified. Recently, protocols have been developed to electroform giant liposomes from partially dehydrated small liposomes, which we have adapted to protein-containing liposomes in our laboratory. We present here the background, equipment, techniques, and pitfalls of electroformation of giant liposomes from small liposome dispersions. We begin with the classic protocol, which should be mastered first before attempting the more challenging protocols that follow. We demonstrate the process of controlled partial dehydration of small liposomes using vapor equilibrium with saturated salt solutions. Finally, we demonstrate the process of electroformation itself. We will describe simple, inexpensive equipment that can be made in-house to produce high-quality liposomes, and describe visual inspection of the preparation at each stage to ensure the best results. PMID:23851612

  16. Liposomalization of SN-38 as active metabolite of CPT-11.

    PubMed

    Sadzuka, Yasuyuki; Takabe, Hiroyuki; Sonobe, Takashi

    2005-11-28

    Although many drugs have been developed for the treatment of disease, some drugs have complications such as adverse effects, and antitumor agents should target tumors or cells more selectively. It is therefore necessary to develop drug delivery systems, and liposomes are reportedly useful as an effective drug carrier. An antitumor agent, CPT-11, inhibits DNA synthesis by the inhibition of topoisomerase1 and has a strong antitumor activity. SN-38 is converted from CPT-11 as an active metabolite by carboxylesterase in the liver. As SN-38 is insoluble, it has not been applied at the clinical stage as an injection. It is expected that SN-38 liposomalization may increase its usefulness in cancer chemotherapy. Our purpose is to have a clinical application of SN-38 by a novel method of liposomalization to expand the application for the other insolubility drugs. As SN-38 is hydrophobic, SN-38-trapped liposome preparation was attempted using the Bangham method, which is effective for general preparation. However, a high ratio of SN-38 trapped in liposome was not achieved, and this was not improved by the freezing-thawing method or the freeze-drying method. On the other hand, the ratio of SN-38 trapped in liposome by the modified remote loading method was about 4 times that by the Bangham method, and the ratio by the film loading method, novel method of liposomal preparation, reached 2 times and 8 times that by the modified remote loading method and Bangham method, respectively, showing a remarkable increase. In conclusion, it was suggested that the preparation of SN-38 liposome using the film loading method effectively entraps SN-38. Thus, it is expected that SN-38 liposome can be applied as an injection. This preparation method is useful if application is possible in the other insolubility drugs. PMID:16182400

  17. Liposomes to Target Peripheral Neurons and Schwann Cells

    PubMed Central

    Lee, Sooyeon; Ashizawa, Ana Tari; Kim, Kwang Sik; Falk, Darin J.; Notterpek, Lucia

    2013-01-01

    While a wealth of literature for tissue-specific liposomes is emerging, optimal formulations to target the cells of the peripheral nervous system (PNS) are lacking. In this study, we asked whether a novel formulation of phospholipid-based liposomes could be optimized for preferential uptake by microvascular endothelia, peripheral neurons and Schwann cells. Here, we report a unique formulation consisting of a phospholipid, a polymer surfactant and cholesterol that result in enhanced uptake by targeted cells. Using fluorescently labeled liposomes, we followed particle internalization and trafficking through a distinct route from dextran and escape from degradative compartments, such as lysosomes. In cultures of non-myelinating Schwann cells, liposomes associate with the lipid raft marker Cholera toxin, and their internalization is inhibited by disruption of lipid rafts or actin polymerization. In contrast, pharmacological inhibition of clathrin-mediated endocytosis does not significantly impact liposome entry. To evaluate the efficacy of liposome targeting in tissues, we utilized myelinating explant cultures of dorsal root ganglia and isolated diaphragm preparations, both of which contain peripheral neurons and myelinating Schwann cells. In these models, we detected preferential liposome uptake into neurons and glial cells in comparison to surrounding muscle tissue. Furthermore, in vivo liposome administration by intramuscular or intravenous injection confirmed that the particles were delivered to myelinated peripheral nerves. Within the CNS, we detected the liposomes in choroid epithelium, but not in myelinated white matter regions or in brain parenchyma. The described nanoparticles represent a novel neurophilic delivery vehicle for targeting small therapeutic compounds, biological molecules, or imaging reagents into peripheral neurons and Schwann cells, and provide a major advancement toward developing effective therapies for peripheral neuropathies. PMID:24244347

  18. Droplet-Based Production of Liposomes

    NASA Technical Reports Server (NTRS)

    Ackley, Donald E.; Forster, Anita

    2009-01-01

    A process for making monodisperse liposomes having lipid bilayer membranes involves fewer, simpler process steps than do related prior methods. First, a microfluidic, cross junction droplet generator is used to produce vesicles comprising aqueous solution droplets contained in single layer lipid membranes. The vesicles are collected in a lipid-solvent mix that is at most partially soluble in water and is less dense than is water. A layer of water is dispensed on top of the solvent. By virtue of the difference in densities, the water sinks to the bottom and the solvent floats to the top. The vesicles, which have almost the same density as that of water, become exchanged into the water instead of floating to the top. As there are excess lipids in the solvent solution, in order for the vesicles to remain in the water, the addition of a second lipid layer to each vesicle is energetically favored. The resulting lipid bilayers present the hydrophilic ends of the lipid molecules to both the inner and outer membrane surfaces. If lipids of a second kind are dissolved in the solvent in sufficient excess before use, then asymmetric liposomes may be formed.

  19. Targeted drug delivery and enhanced intracellular release using functionalized liposomes

    NASA Astrophysics Data System (ADS)

    Garg, Ashish

    The ability to target cancer cells using an appropriate drug delivery system can significantly reduce the associated side effects from cancer therapies and can help in improving the overall quality of life, post cancer survival. Integrin alpha5beta1 is expressed on several types of cancer cells, including colon cancer and plays an important role in tumor growth and metastasis. Thus, the ability to target the integrin alpha 5beta1 using an appropriate drug delivery nano-vector can significantly help in inhibiting tumor growth and reducing tumor metastasis. The work in this thesis focuses on designing and optimizing, functionalized stealth liposomes (liposomes covered with polyethylene glycol (PEG)) that specifically target the integrin alpha5beta1. The PEG provides a steric barrier allowing the liposomes to circulate in the blood for longer duration and the functionalizing moiety, PR_b peptide specifically recognizes and binds to integrin alpha5beta1 expressing cells. The work demonstrates that by optimizing the amount of PEG and PR_b on the liposomal interface, nano-vectors can be engineered that bind to CT26.WT colon cancer cells in a specific manner and internalize through alpha 5beta1-mediated endocytosis. To further improve the efficacy of the system, PR_b functionalized pH-sensitive stealth liposomes that exhibit triggered release under mild acidic conditions present in endocytotic vesicles were designed. The study showed that PR_b functionalized pH-sensitive stealth liposomes, undergo destabilization under mildly acidic conditions and incorporation of the PR_b peptide does not significantly affect the pH-sensitivity of the liposomes. PR_b functionalized pH-sensitive stealth liposomes bind to CT26.WT colon carcinoma cells that express integrin alpha5beta 1, undergo cellular internalization, and release their load intracellularly in a short period of time as compared to other formulations. PR_b-targeted pH-sensitive stealth liposomes encapsulating 5-fluorouracil (5-FU) show significantly higher cytotoxicity than the PR_b-targeted inert stealth liposomes and the non-targeted stealth liposomes (both pH-sensitive and inert). The studies demonstrated that optimized PR_b functionalized pH sensitive liposomes have the potential to deliver a payload, such as chemotherapeutic agents, directly to colon cancer cells in an efficient and specific manner.

  20. Liposomal Drug Products: A Quality by Design Approach

    NASA Astrophysics Data System (ADS)

    Xu, Xiaoming

    Quality by Design (QbD) principles has been applied to the development of two liposomal formulations, containing a hydrophilic small molecule therapeutic (Tenofovir) and a protein therapeutic (superoxide dismutase). The goal of the research is to provide critical information on 1) how to reduce the preparation variability in liposome formulations, and 2) how to increase drug encapsulation inside liposomes to reduce manufacturing cost. Most notably, an improved liposome preparation method was developed which increased the encapsulation efficiency of hydrophilic molecules. In particular, this method allows for very high encapsulation efficiency. For example, encapsulation efficiencies of up to 50% have been achieved, whereas previously only 20% or less have been reported. Another significant outcome from this research is a first principle mathematical model to predict the encapsulation efficiency of hydrophilic drugs in unilamellar liposomes. This mathematical model will be useful in: formulation development to rapidly achieve optimized formulations; comparison of drug encapsulation efficiencies of liposomes prepared using different methods; and assisting in the development of suitable process analytical technologies to achieve real-time monitoring and control of drug encapsulation during manufacturing. A novel two-stage reverse dialysis in vitro release testing method has also been developed for passively targeted liposomes, which uses the first stage to mimic the circulation of liposomes in the body and the second stage to imitate the drug release process at the target. The developed in vitro release testing method can be used to distinguish formulations with varied compositions for quality control testing purposes. This developed method may pave the way to the development of more biorelevant quality control testing methods for liposomal drug products in the future. The QbD case studies performed in this research are examples of how this approach can be used to obtain design space for liposome products to achieve the desired in vivo product performance criteria. From an industrial perspective, this study provides an in-depth understanding of the parameters (risks) involved in liposome formulation and processing. From a regulatory perspective, the development of QbD principles for liposomal drug products will facilitate their regulation assuring safety and efficacy of these complex delivery systems.

  1. In vivo and in vitro evaluation of octyl methoxycinnamate liposomes

    PubMed Central

    Varjão Mota, Aline de Carvalho; Faria de Freitas, Zaida Maria; Júnior, Eduardo Ricci; Dellamora-Ortiz, Gisela Maria; Santos-Oliveira, Ralph; Ozzetti, Rafael Antonio; Vergnanini, André Luiz; Ribeiro, Vanessa Lira; Silva, Ronald Santos; dos Santos, Elisabete Pereira

    2013-01-01

    Solar radiation causes damage to human skin, and photoprotection is the main way to prevent these harmful effects. The development of sunscreen formulations containing nanosystems is of great interest in the pharmaceutical and cosmetic industries because of the many potential benefits. This study aimed to develop and evaluate an octyl methoxycinnamate (OMC) liposomal nanosystem (liposome/OMC) to obtain a sunscreen formulation with improved safety and efficacy by retaining OMC for longer on the stratum corneum. Methods The liposome/OMC nanostructure obtained was tested for enzymatic hydrolysis with lipase from Rhizomucor miehei and biodistribution with liposomes labeled with technetium-99m. The liposome/OMC formulation was then incorporated in a gel formulation and tested for ocular irritation using the hen’s egg test-chorio-allantoic membrane (HET-CAM) assay, in vitro and in vivo sun protection factor, in vitro release profile, skin biometrics, and in vivo tape stripping. Results The liposome/OMC nanosystem was not hydrolyzed from R. miehei by lipase. In the biodistribution assay, the liposome/OMC formulation labeled with technetium-99m had mainly deposited in the skin, while for OMC the main organ was the liver, showing that the liposome had higher affinity for the skin than OMC. The liposome/OMC formulation was classified as nonirritating in the HET-CAM test, indicating good histocompatibility. The formulation containing liposome/OMC had a higher in vivo solar photoprotection factor, but did not show increased water resistance. Inclusion in liposomes was able to slow down the release of OMC from the formulation, with a lower steady-state flux (3.9 ± 0.33 ?g/cm2/hour) compared with the conventional formulation (6.3 ± 1.21 ?g/cm2/hour). The stripping method showed increased uptake of OMC in the stratum corneum, giving an amount of 22.64 ± 7.55 ?g/cm2 of OMC, which was higher than the amount found for the conventional formulation (14.57 ± 2.30 ?g/cm2). Conclusion These results indicate that liposomes are superior carriers for OMC, and confer greater safety and efficacy to sunscreen formulations. PMID:24376350

  2. Meta-analysis of inter-patient pharmacokinetic variability of liposomal and non-liposomal anticancer agents

    PubMed Central

    Schell, Ryan F.; Sidone, Brian J.; Caron, Whitney P.; Walsh, Mark D.; Zamboni, Beth A.; Ramanathan, Ramesh K.; Zamboni, William C.

    2013-01-01

    Purpose A meta-analysis was conducted to evaluate the inter-patient pharmacokinetic (PK) variability of liposomal and small molecule (SM) anticancer agents. Methods Inter-patient PK variability of 9 liposomal and SM formulations of the same drug were evaluated. PK variability was measured as coefficient of variance (CV%) of area under the plasma concentration versus time curve (AUC) and the fold-difference between AUCmax and AUCmin (AUC range). Results CV% of AUC and AUC ranges were 2.7-fold (P<0.001) and 16.7-fold (P=0.13) greater, respectively, for liposomal compared with SM drugs. There was an inverse linear relationship between the clearance (CL) of liposomal agents and PK variability with a lower CL associated with greater PK variability (R2 = 0.39). PK variability of liposomal agents was greater when evaluated from 0–336 h compared with 0–24 h. Conclusion PK variability of liposomes is significantly greater than SM. The factors associated with the PK variability of liposomal agents needs to be evaluated. PMID:23891988

  3. Anomalous photoelectric emission from Ag on zinc-phthalocyanine film

    SciTech Connect

    Tanaka, Senku, E-mail: senku@ele.kindai.ac.jp [Department of Electric and Electronic Engineering, Faculty of Science and Engineering, Kinki University, Higashiosaka 577-8502 (Japan); Otani, Tomohiro; Fukuzawa, Ken; Hiromitsu, Ichiro [Department of Physics and Materials Science, Graduate School of Science and Engineering, Shimane University, Matsue 690-8504 (Japan); Ogawa, Koji; Azuma, Junpei; Yamamoto, Isamu; Takahashi, Kazutoshi; Kamada, Masao [Synchrotron Light Application Center, Saga University, Saga 840-8502 (Japan)

    2014-05-12

    Photoelectric emission from organic and metal thin films is generally observed with irradiation of photon energy larger than 4?eV. In this paper, however, we report photoelectric emission from Ag on a zinc-phthalocyanine (ZnPc) layer at a photon energy of 3.4?eV. The threshold energy for this photoelectric emission is much smaller than the work function of Ag estimated by conventional photoelectron spectroscopy. The photoelectric emission by low-energy photons is significant for Ag thicknesses of less than 1?nm. Photoelectron spectroscopy and morphological study of the Ag/ZnPc suggest that the anomalous photoelectric emission from the Ag surface is caused by a vacuum level shift at the Ag/ZnPc interface and by surface plasmons of the Ag nanoparticles.

  4. Charge dependent photodynamic activity of alanine based zinc phthalocyanines.

    PubMed

    Wang, Ao; Li, Yejing; Zhou, Lin; Yuan, Linxin; Lu, Shan; Lin, Yun; Zhou, Jiahong; Wei, Shaohua

    2014-12-01

    In this paper, to minimize the effects of different structure, three alanine-based zinc phthalocyanines (Pcs) of differing charges were engineered and synthesized with the same basic structure. On this premise, the relationship between nature of charge and photodynamic activity was studied. Besides, further verification and explanation of some inconsistent results were also carried out. The results showed that charge can influence the aggregation state, singlet oxygen generation ability and cellular uptake of Pcs, thereby affecting their photodynamic activity. In addition, the biomolecules inside cells may interact with Pcs of differing charges, which can also influence the aggregation state and singlet oxygen generation of the Pcs, and then influence the relationship between nature of charge and photodynamic activity. PMID:25305750

  5. Nonlinear Optothermal Properties of Metal-Free Phthalocyanine

    NASA Technical Reports Server (NTRS)

    Abdeldayem, Hossin A.; Frazier, Donald O.; Penn, Benjamin G.; Smith, David D.; Banks, Curtis E.

    1998-01-01

    The nonlinear optical properties of metal-free phthalocyanine (MFPC) thin films were examined using the second harmonic at 532 nm from a pulsed Nd:YAG laser, and the cw He-Ne , and Ar+ lasers. The He-Ne laser transmission at fixed input intensity was found to increase temporally within a time scale of twelve hours. The origin of this temporal change of transmission is discussed. The third order nonlinear susceptibilities (chi (exp(3))) by four-wave mixing were measured for films of different thickness. The saturation intensity of MFPC, and its absorption cross section, at 633 nm from a He-Ne laser, are reported. An optical bistability was recorded using a He-Ne laser. An AND logic gate was also demonstrated in the system. These phenomena in the system are attributed to refractive index modulation by thermal excitations.

  6. Optical limiting processes in derivatized fullerenes and porphyrins/phthalocyanines

    SciTech Connect

    Kohlman, R.; Klimov, V.; Shi, X. [and others

    1998-07-01

    The authors review their results from spectral studies of the ultrafast excited-state absorption in fullerenes and derivatized fullerenes. These results allow determination of both the spectral response of reverse saturable absorption (RSA) nonlinearities such as optical limiting (OL) in fullerenes, and the dynamical response for different morphologies. The authors have investigated the effects of thin film and various sol-gel glass environments on the nanosecond OL and femtosecond dynamics of derivatized fullerenes. These data provide evidence of decay pathways which compete with the intersystem crossing to a triplet from the initial singlet states. With appropriate processing, however, the OL response of derivatized-fullerene sol-gel glasses can be enhanced to approach that of the same molecule in solution, while significantly enhancing the optical damage threshold. The optical limiting of these derivatized fullerenes is compared with that of various porphyrin and phthalocyanine molecules.

  7. Phthalocyanines as photosensitizing agents for tumors--mechanism of action

    NASA Astrophysics Data System (ADS)

    Ben-Hur, Ehud

    1994-03-01

    Aluminum phthalocyanine (AlPc) is a second-generation photosensitizer under study for photodynamic therapy (PDT) of cancer. Its mechanism of action is not known. Fluoride appears to be a powerful probe for the mechanistic study of AlPc derivatives. F- forms a complex with the Al ligand, resulting in drastically reduced AlPc-induced phototoxicity. This is due to a modified binding of AlPc with certain target proteins, resulting in inhibition of electron transfer reactions (type I) but not singlet oxygen reactions (type II). In Chinese hamster ovary (CHO) cell membranes, Na+/K+-ATPase activity is selectively protected by F- from photosensitized inhibition by AlPc, suggesting that this enzyme may be a critical target for AlPc-PDT. Another cellular response, not interfered with by F-, is a transient increase of cytoplasmic free Ca2+ after AlPc-PDT. This increase was shown to trigger the induction of a recovery process.

  8. Hybrid Structures of Polycationic aluminum phthalocyanines and quantum dots.

    PubMed

    Maksimov, E G; Gvozdev, D A; Strakhovskaya, M G; Paschenko, V Z

    2015-03-01

    Semiconductor nanocrystals (CdSe/ZnS quantum dots, QDs) were used as inorganic focusing antenna, allowing for the enhancement of fluorescence and photosensitizing activity of polycationic aluminum phthalocyanines (PCs). It was found that QDs form stable complexes with PCs in aqueous solutions due to electrostatic interactions. In such hybrid complexes, we observed highly efficient nonradiative energy transfer from QD to PC, leading to a sharp increase in the effective absorption cross section of PC in the absorption bands of the CdSe/ZnS quantum dots. When hybrid complexes are excited within these bands, the intensity of PC fluorescence and the rate of photosensitized singlet oxygen generation increases significantly (up to 500 and 350%, correspondingly) compared to free PC at the same concentration. The observed effect is of interest for modeling primary stages of photosynthesis and increasing photosensitizing activity of dyes used in photodynamic therapy. PMID:25761686

  9. Galactodendritic Phthalocyanine Targets Carbohydrate-Binding Proteins Enhancing Photodynamic Therapy

    PubMed Central

    Pereira, Patrícia M. R.; Silva, Sandrina; Cavaleiro, José A. S.; Ribeiro, Carlos A. F.; Tomé, João P. C.; Fernandes, Rosa

    2014-01-01

    Photosensitizers (PSs) are of crucial importance in the effectiveness of photodynamic therapy (PDT) for cancer. Due to their high reactive oxygen species production and strong absorption in the wavelength range between 650 and 850 nm, where tissue light penetration is rather high, phthalocyanines (Pcs) have been studied as PSs of excellence. In this work, we report the evaluation of a phthalocyanine surrounded by a carbohydrate shell of sixteen galactose units distributed in a dendritic manner (PcGal16) as a new and efficient third generation PSs for PDT against two bladder cancer cell lines, HT-1376 and UM-UC-3. Here, we define the role of galacto-dendritic units in promoting the uptake of a Pc through interaction with GLUT1 and galectin-1. The photoactivation of PcGal16 induces cell death by generating oxidative stress. Although PDT with PcGal16 induces an increase on the activity of antioxidant enzymes immediately after PDT, bladder cancer cells are unable to recover from the PDT-induced damage effects for at least 72 h after treatment. PcGal16 co-localization with galectin-1 and GLUT1 and/or generation of oxidative stress after PcGal16 photoactivation induces changes in the levels of these proteins. Knockdown of galectin-1 and GLUT1, via small interfering RNA (siRNA), in bladder cancer cells decreases intracellular uptake and phototoxicity of PcGal16. The results reported herein show PcGal16 as a promising therapeutic agent for the treatment of bladder cancer, which is the fifth most common type of cancer with the highest rate of recurrence of any cancer. PMID:24763311

  10. Percutaneous permeation measurement of topical phthalocyanine by photoacoustic technique

    NASA Astrophysics Data System (ADS)

    Silva, Emanoel P. O.; Barja, Paulo R.; Cardoso, Luiz E.; Beltrame, Milton

    2012-11-01

    This investigation have studied photoacoustic (PA) technique to percutaneous permeation of topical hydroxy-(29H,31H-phthalocyaninate) aluminum (PcAlOH) on pig ear skin. The PcAlOH was incorporated in an emulsion (O/W) (1 mg/dl) with assessed stability parameters of: pH, short and long term stability tests (in the several conditions). The skin was prepared through a heat separation technique, and with a scalpel, the outer skin of the cartilage was removed. The skins were then cut into 4 cm2 pieces and treated with sodium bromide 2 mol/L for 6 h at 37 °C. The epidermis layer was washed with purified water, dried, and stored under reduced pressure until use. The skin permeation kinetics was determined by photoacoustic technique in an open photoacoustic cell. Short (after preparation) and long-term stability tests showed no phase separation. The emulsion developed pH 7.6 and after incorporating the pH was unchanged. The typical times for percutaneous permeation of the emulsion base and emulsion + PcAlOH were 182 (±6) and 438 (±3) s, respectively. This study indicated that the formulations containing PcAlOH have stabile characteristics and show promising results in absorption into the skin. The presence of the photosensitive agent in the formulation contributed significantly to the greater absorption time than observed in the base formulation. The used photoacoustic technical to examine the penetration kinetics of PcAlOH in pig ear skin was adequate and may be employed in the determination of the percutaneous permeation of phthalocyanines.

  11. The modulation of the permeability and the cellular uptake of liposome by stable anchoring of lipid-conjugated pluronic on liposome.

    PubMed

    Kim, Jong Chul; Chungt, Yong-Il; Kim, Young Ha; Tae, Giyoong

    2014-01-01

    Controlling the permeability of liposome is important to modulate the release behavior of drug from the liposome. Pluronic F127 (PF127) is a biocompatible tri-block copolymer, which can interact with lipid bilayer of liposomes and make leakages that allow the release of hydrophilic substance from liposome interior. However, the interaction between unmodified PF127 and lipid bilayer is not very strong and the incorporated PF127 is easily desorbed from the liposomes in an infinite reservoir condition. In this paper, we conjugated lipid molecule (1,2-distearoyl-sn-glycero-3-phosphoethanolamine [DSPE]) at the both ends of PF127 to increase the interaction between polymer and liposome. This lipid-conjugated PF127 was incorporated into the liposomes and it remained stably without desorption from liposomes in an infinite reservoir condition. The stably bound PF127 increased the release rate of hydrophilic drug from liposomes in a dose-dependent manner. Moreover, the lipid-conjugated PF127 changed the surface property of liposomes and inhibited its cellular uptake when the incorporated amount was above 2.5 wt%. In conclusion, the lipid-conjugated PF127 could function as a stable anchor on the lipid bilayer of liposomes to control the permeability as well as provide the hydrophilic surface of liposomes in an open system like an in vivo situation. PMID:24724502

  12. Microencapsulated liposomes in controlled drug delivery: strategies to modulate drug release and eliminate the burst effect.

    PubMed

    Dhoot, Nikhil O; Wheatley, Margaret A

    2003-03-01

    The release of fluorescein isothiocyanate labeled bovine serum albumin (FITC-BSA) from alginate-microencapsulated liposomes was studied to evaluate the properties of this system for controlled drug delivery. Liposomes composed of phosphatidylcholine (PC) and cholesterol (Chol) (molar ratio 7:3) and of PC, phosphatidylglycerol (PG), and cholesterol (6:1:3) were encapsulated in alginate (Alg) crosslinked with Ca(2+) (Ca-Alg), Al(3+) (Al-Alg), and Ba(2+) (Ba-Alg). Capsules were coated with poly(l-ornithine) followed by a final alginate coat. A rapid initial burst of protein release was observed from liposomes encapsulated in Ca-Alg and Al-Alg. No burst was observed when liposomes were encapsulated in Ba-Alg, indicating that the crosslinking ions could significantly affect the release of entrapped protein. Also, the release from encapsulated liposomes varied significantly with liposome composition, especially with Ca-Alg as observed with encapsulation of PC, dioleoylphosphatidylcholine (DOPC), and DOPC/Chol liposomes. Cholesterol increased the leakiness of the liposomes after encapsulation. In all cases, the release from microencapsulated liposomes was much faster than that from free liposomes suggesting an interaction between the liposomes and the alginate. Differential scanning calorimetry supports the hypothesis that alginate was inserted into the lipid bilayer resulting in a rapid release of protein from microencapsulated liposomes. Moreover, it was observed that the degree of interaction between liposomes and alginate varied with liposome composition. PMID:12587129

  13. Nano-liposomes of entrapment lidocaine hydrochloride on in vitro permeability of narcotic.

    PubMed

    Sun, Nenghong; Zhu, Yanyan; Yuan, Lei; Lang, Bao

    2015-01-01

    In order to explore two kinds of nano-liposomes in lidocaine hydrochloride nano-liposomes on in vitro permeability of drug, and conduct comparison and analysis, this paper investigates cumulative infiltration situation of lidocaine hydrochloride flexible nano-liposomes and ordinary nano-liposomes by using modified Franz diffusion pool on mice vitro skin. Cumulative osmotic quantity of lidocaine hydrochloride flexible nano-liposomes for 9h was higher than ordinary nano-liposomes.tmax(Maximum osmotic quantity time) of lidocaine hydrochloride flexible nano-liposomes and ordinary nano-liposomes in mice skin was 5 and 60min, the former Cmax (maximum dosage time) was 1.2 times of the latter. Drug was not found in mice plasma of ordinary nano-liposomes group, traces of drugs was detected in 0.5 and 1h in flexible nano-liposomes group, but the concentration was lower than the effective concentration. Compared with the classic skin transparent promoter and ordinary liposome, flexible nano-liposomes have more advantages, but its stability is less than ordinary nano-liposomes because of the addition of surface active substance. Flexible nano-liposomes have great development potential as a carrier of transdermal drug delivery field. PMID:25631510

  14. Cholesterol Derivatives Based Charged Liposomes for Doxorubicin Delivery: Preparation, In Vitro and In Vivo Characterization

    PubMed Central

    Nie, Yu; Ji, Li; Ding, Hong; Xie, Li; Li, Li; He, Bin; Wu, Yao; Gu, Zhongwei

    2012-01-01

    Cholesterol plays a critical role in liposome composition. It has great impact on the behavior of liposome in vitro and in vivo. In order to verify the possible effects from cholesterol charge, surface shielding and chemical nature, two catalogs of liposomes with charged and PEGylated cholesterols were synthesized. Anionic liposomes (AL) and cationic liposomes (CL) were prepared, with charges from hemisuccinate and lysine in cholesterol derivatives, respectively. Characteristics of different formulated liposomes were investigated after doxorubicin encapsulation, using neutral liposomes (NL) as control. Results showed that after PEGylation, AL and CL liposomes displayed prolonged retention release profile, while kept similar size distribution, encapsulation efficiency, low cytotoxicity and hemolysis comparing with NL. Confocal laser scanning microscopy and flow cytometry experiments confirmed the significantly higher cell uptake from AL and CL vesicles than the NL in mouse breast carcinoma and melanoma cells, human epithelial carcinoma and hepatoma cells. It was in accordance with our corresponding cellular mortality studies of DOX-loaded liposomes. The in vivo anti-tumor effect experiments from charged liposomes also presented much higher tumor inhibition effect (70% vs 45%, p < 0.05) than NL liposomes. This is the first time reporting anti-cancer effect from charged cholesterol liposome with/without PEGylation. It may give deeper understanding on the liposome formulation which is critical for liposome associated drug research and development. PMID:23227125

  15. Effects of the liposomal formulation on the behavior and physical characteristics of acoustic liposomes

    NASA Astrophysics Data System (ADS)

    Sax, Nicolas; Horie, Sachiko; Li, Li; Sakamoto, Maya; Mori, Shiro; Kodama, Tetsuya

    2012-09-01

    Ultrasound contrast agents (UCAs) are nano/microbubbles that contain air or a highmolecular-weight, low-solubility gas encapsulated in a lipid or albumin shell. Previous studies have developed acoustic liposomes (ALs), liposomes that encapsulate perfluoropropane (C3F8) gas. These ALs can be used as just UCAs, for early diagnostic or observation of angiogenesis. They can also be used for drug delivery, through their ultrasound-induced destruction leading to permeabilization of the neighboring cells. However, the echogenicity of ALs decreases within minutes, raising the need for more stable preparations. Here we show that the in vitro stability of ALs is affected by fluidity changes in the bilayer, the presence of anionic phospholipids and the density of the PEG coating layer. These results allowed the preparation of "optimized" ALs displaying a 50% enhanced detection time in vitro. We anticipate their stability to be enhanced in a similar manner, in vivo. Further research aims at further improvement of the stability of gas encapsulation by surface modification and coating of the liposomes, and in vivo characterization of the optimized ALs.

  16. Hydration of polyethylene glycol-grafted liposomes.

    PubMed Central

    Tirosh, O; Barenholz, Y; Katzhendler, J; Priev, A

    1998-01-01

    This study aimed to characterize the effect of polyethylene glycol of 2000 molecular weight (PEG2000) attached to a dialkylphosphatidic acid (dihexadecylphosphatidyl (DHP)-PEG2000) on the hydration and thermodynamic stability of lipid assemblies. Differential scanning calorimetry, densitometry, and ultrasound velocity and absorption measurements were used for thermodynamic and hydrational characterization. Using a differential scanning calorimetry technique we showed that each molecule of PEG2000 binds 136 +/- 4 molecules of water. For PEG2000 covalently attached to the lipid molecules organized in micelles, the water binding increases to 210 +/- 6 water molecules. This demonstrates that the two different structural configurations of the PEG2000, a random coil in the case of the free PEG and a brush in the case of DHP-PEG2000 micelles, differ in their hydration level. Ultrasound absorption changes in liposomes reflect mainly the heterophase fluctuations and packing defects in the lipid bilayer. The PEG-induced excess ultrasound absorption of the lipid bilayer at 7.7 MHz for PEG-lipid concentrations over 5 mol % indicates the increase in the relaxation time of the headgroup rotation due to PEG-PEG interactions. The adiabatic compressibility (calculated from ultrasound velocity and density) of the lipid bilayer of the liposome increases monotonically with PEG-lipid concentration up to approximately 7 mol %, reflecting release of water from the lipid headgroup region. Elimination of this water, induced by grafted PEG, leads to a decrease in bilayer defects and enhanced lateral packing of the phospholipid acyl chains. We assume that the dehydration of the lipid headgroup region in conjunction with the increase of the hydration of the outer layer by grafting PEG in brush configuration are responsible for increasing thermodynamic stability of the liposomes at 5-7 mol % of PEG-lipid. At higher PEG-lipid concentrations, compressibility and partial volume of the lipid phase of the samples decrease. This reflects the increase in hydration of the lipid headgroup region (up to five additional water molecules per lipid molecule for 12 mol % PEG-lipid) and the weakening of the bilayer packing due to the lateral repulsion of PEG chains. PMID:9512033

  17. Remote loading of preencapsulated drugs into stealth liposomes

    PubMed Central

    Sur, Surojit; Fries, Anja C.; Kinzler, Kenneth W.; Zhou, Shibin; Vogelstein, Bert

    2014-01-01

    Loading drugs into carriers such as liposomes can increase the therapeutic ratio by reducing drug concentrations in normal tissues and raising their concentrations in tumors. Although this strategy has proven advantageous in certain circumstances, many drugs are highly hydrophobic and nonionizable and cannot be loaded into liposomes through conventional means. We hypothesized that such drugs could be actively loaded into liposomes by encapsulating them into specially designed cyclodextrins. To test this hypothesis, two hydrophobic drugs that had failed phase II clinical trials because of excess toxicity at deliverable doses were evaluated. In both cases, the drugs could be remotely loaded into liposomes after their encapsulation (preloading) into cyclodextrins and administered to mice at higher doses and with greater efficacy than possible with the free drugs. PMID:24474802

  18. Evaluation of asymmetric liposomal nanoparticles for encapsulation of polynucleotides.

    PubMed

    Whittenton, Jeremiah; Harendra, Sivaram; Pitchumani, Ramanan; Mohanty, Kishore; Vipulanandan, Cumaraswamy; Thevananther, Sundararajah

    2008-08-19

    Conventional lipid bilayer liposomes have similar inner and outer leaflet compositions; asymmetric liposomes have different lipid leaflet compositions. The goal of this work is to place cationic lipids in the inner leaflet to encapsulate negatively charged polynucleotides and to place neutral/anionic lipids on the outer leaflet to decrease nonspecific cellular uptake/toxicity. Inverse emulsion particles have been developed with a single lipid leaflet of cationic and neutral lipids surrounding an aqueous core containing a negatively charged 21-mer DNA oligo. The particles are accelerated through an oil-water interface, entrapping a second neutral lipid to form oligo encapsulated unilamellar liposome nanoparticles. Inverse emulsion particles can be consistently produced to encapsulate an aqueous environment containing negatively charged oligo. The efficiency of encapsulated liposome formation is low and depends on the hydrocarbon used as the oil phase. Dodecane, mineral oil, and squalene were tested, and squalene, a branched hydrocarbon, yielded the highest efficiency. PMID:18597508

  19. Remote loading of preencapsulated drugs into stealth liposomes.

    PubMed

    Sur, Surojit; Fries, Anja C; Kinzler, Kenneth W; Zhou, Shibin; Vogelstein, Bert

    2014-02-11

    Loading drugs into carriers such as liposomes can increase the therapeutic ratio by reducing drug concentrations in normal tissues and raising their concentrations in tumors. Although this strategy has proven advantageous in certain circumstances, many drugs are highly hydrophobic and nonionizable and cannot be loaded into liposomes through conventional means. We hypothesized that such drugs could be actively loaded into liposomes by encapsulating them into specially designed cyclodextrins. To test this hypothesis, two hydrophobic drugs that had failed phase II clinical trials because of excess toxicity at deliverable doses were evaluated. In both cases, the drugs could be remotely loaded into liposomes after their encapsulation (preloading) into cyclodextrins and administered to mice at higher doses and with greater efficacy than possible with the free drugs. PMID:24474802

  20. Liposomes with polyribonucleotides as model of precellular systems

    NASA Technical Reports Server (NTRS)

    Baeza, Isabel; Ibanez, Miguel; Santiago, Carlos; Lazcano, Antonio; Arguello, Carlos

    1987-01-01

    Three types of liposomes were prepared under anoxic conditions: from dipalmitoyl phosphatidyl choline (DPPC), from egg yolk phosphatidyl choline (PC), and from PC with cholesterol (PC:Chol). These were used for encapsulation of poly(U) and poly(C). It was found that 36 to 70 percent of the available liposome lipids and 2 to 5 percent of the polyribonucleotides could be entrapped. An enhanced encapsulation of poly(U) and poly(C) by all three types of liposomes was observed in the presence of 0.001 to 0.01 M Zn(2+), with the effect being greatest with DPPC. The presence of 1.0 M urea inhibited the formation of PC liposomes.

  1. Atmospheric-pressure guided streamers for liposomal membrane disruption

    SciTech Connect

    Svarnas, P.; Aleiferis, Sp. [High Voltage Laboratory, Department of Electrical and Computer Engineering, University of Patras, Rion 26504 (Greece); Matrali, S. H. [Pharmaceutical Technology Laboratory, Department of Pharmacy, University of Patras, Rion 26504 (Greece); Gazeli, K. [High Voltage Laboratory, Department of Electrical and Computer Engineering, University of Patras, Rion 26504 (Greece); IPREM-LCABIE, Plasmas et Applications, UPPA, 64000 Pau (France); Clement, F. [IPREM-LCABIE, Plasmas et Applications, UPPA, 64000 Pau (France); Antimisiaris, S. G. [Pharmaceutical Technology Laboratory, Department of Pharmacy, University of Patras, Rion 26504 (Greece); Institute of Chemical Engineering Sciences (ICES)-FORTH, Rion 26504 (Greece)

    2012-12-24

    The potential to use liposomes (LIPs) as a cellular model in order to study interactions of cold atmospheric-pressure plasma with cells is herein investigated. Cold atmospheric-pressure plasma is formed by a dielectric-barrier discharge reactor. Large multilamellar vesicle liposomes, consisted of phosphatidylcholine and cholesterol, are prepared by the thin film hydration technique, to encapsulate a small hydrophilic dye, i.e., calcein. The plasma-induced release of calcein from liposomes is then used as a measure of liposome membrane integrity and, consequently, interaction between the cold atmospheric plasma and lipid bilayers. Physical mechanisms leading to membrane disruption are suggested, based on the plasma characterization including gas temperature calculation.

  2. Potential utility of liposome bupivacaine in orthopedic surgery.

    PubMed

    Lonner, Jess H; Scuderi, Giles R; Lieberman, Jay R

    2015-03-01

    Management of postsurgical analgesia is an important consideration in orthopedic procedures, including joint arthroplasty. Inadequate postsurgical analgesia is associated with increased hospital length of stay, delayed ambulation, and reduced exercise capacity. In this article, we review the potential contribution of a prolonged-release liposomal formulation of bupivacaine as part of a multimodal analgesic regimen after orthopedic surgery. Controlled studies across multiple surgical settings have demonstrated that, compared with placebo and bupivacaine HCl, liposome bupivacaine in a single administration provides postsurgical analgesia for up to 72 hours, delays use of rescue medication, and reduces postsurgical opioid consumption. Liposome bupivacaine has been well tolerated in clinical studies and has had a low rate of treatment-related adverse events. To date, there has been no signal of cardiac toxicity, chondrolysis, or delayed wound healing associated with liposome bupivacaine. PMID:25750943

  3. Bioreactor droplets from liposome-stabilized all-aqueous emulsions

    NASA Astrophysics Data System (ADS)

    Dewey, Daniel C.; Strulson, Christopher A.; Cacace, David N.; Bevilacqua, Philip C.; Keating, Christine D.

    2014-08-01

    Artificial bioreactors are desirable for in vitro biochemical studies and as protocells. A key challenge is maintaining a favourable internal environment while allowing substrate entry and product departure. We show that semipermeable, size-controlled bioreactors with aqueous, macromolecularly crowded interiors can be assembled by liposome stabilization of an all-aqueous emulsion. Dextran-rich aqueous droplets are dispersed in a continuous polyethylene glycol (PEG)-rich aqueous phase, with coalescence inhibited by adsorbed ~130-nm diameter liposomes. Fluorescence recovery after photobleaching and dynamic light scattering data indicate that the liposomes, which are PEGylated and negatively charged, remain intact at the interface for extended time. Inter-droplet repulsion provides electrostatic stabilization of the emulsion, with droplet coalescence prevented even for submonolayer interfacial coatings. RNA and DNA can enter and exit aqueous droplets by diffusion, with final concentrations dictated by partitioning. The capacity to serve as microscale bioreactors is established by demonstrating a ribozyme cleavage reaction within the liposome-coated droplets.

  4. Effect of internal wool lipid liposomes on skin repair.

    PubMed

    de Pera, M; Coderch, L; Fonollosa, J; de la Maza, A; Parra, J L

    2000-01-01

    Intercellular lipids of the stratum corneum (SC) play a crucial role in keeping an optimal skin barrier function and in regulating the water-holding capacity. Recently, the internal lipids have been extracted from wool fibre. This lipid extract has a composition similar to that of the SC lipids. Two parameters were used to test the effect of topically applied internal wool lipids (IWL), structured as liposomes, on the water barrier functions of disturbed and intact skin: transepidermal water loss and skin capacitance. Liposomes made up of lipids that simulate the composition of the SC were also applied for comparison. The single application of the IWL liposomes on disturbed skin resulted in an accelerated recovery of water barrier functions. Daily application of these liposomes on intact skin for 5 days reinforced the skin barrier and increased the water-holding capacity. The repairing effect of the IWL enhances their suitability in the treatment, prevention and care of skin. PMID:10859538

  5. Formation of homogeneous unilamellar liposomes from an interdigitated matrix

    E-print Network

    Gruner, Sol M.

    fusogenic liposomes comprised of the novel negatively charged N-acyl-phosphatidylethanolamine (NAPE) mixed, Cation-dependent fusogenicity of an N-acyl phosphatidylethanolamine, Biochim. Biophys. Acta 1368 (1998

  6. Electronic structure at transition metal phthalocyanine-transition metal oxide interfaces: Cobalt phthalocyanine on epitaxial MnO films

    NASA Astrophysics Data System (ADS)

    Glaser, Mathias; Peisert, Heiko; Adler, Hilmar; Aygül, Umut; Ivanovic, Milutin; Nagel, Peter; Merz, Michael; Schuppler, Stefan; Chassé, Thomas

    2015-03-01

    The electronic structure of the interface between cobalt phthalocyanine (CoPc) and epitaxially grown manganese oxide (MnO) thin films is studied by means of photoemission (PES) and X-ray absorption spectroscopy (XAS). Our results reveal a flat-lying adsorption geometry of the molecules on the oxide surface which allows a maximal interaction between the ?-system and the substrate. A charge transfer from MnO, in particular, to the central metal atom of CoPc is observed by both PES and XAS. The change of the shape of N-K XAS spectra at the interface points, however, to the involvement of the Pc macrocycle in the charge transfer process. As a consequence of the charge transfer, energetic shifts of MnO related core levels were observed, which are discussed in terms of a Fermi level shift in the semiconducting MnO films due to interface charge redistribution.

  7. Electronic structure at transition metal phthalocyanine-transition metal oxide interfaces: Cobalt phthalocyanine on epitaxial MnO films.

    PubMed

    Glaser, Mathias; Peisert, Heiko; Adler, Hilmar; Aygül, Umut; Ivanovic, Milutin; Nagel, Peter; Merz, Michael; Schuppler, Stefan; Chassé, Thomas

    2015-03-14

    The electronic structure of the interface between cobalt phthalocyanine (CoPc) and epitaxially grown manganese oxide (MnO) thin films is studied by means of photoemission (PES) and X-ray absorption spectroscopy (XAS). Our results reveal a flat-lying adsorption geometry of the molecules on the oxide surface which allows a maximal interaction between the ?-system and the substrate. A charge transfer from MnO, in particular, to the central metal atom of CoPc is observed by both PES and XAS. The change of the shape of N-K XAS spectra at the interface points, however, to the involvement of the Pc macrocycle in the charge transfer process. As a consequence of the charge transfer, energetic shifts of MnO related core levels were observed, which are discussed in terms of a Fermi level shift in the semiconducting MnO films due to interface charge redistribution. PMID:25770507

  8. Effect of PovidoneIodine Liposome Hydrogel on Colonic Anastomosis

    Microsoft Academic Search

    S. Ustek; K. Kismet; M. A. Akkus; A. H. Ozcan; A. Aydogan; N. Renda

    2005-01-01

    Background: To evaluate the effectof povidone-iodine liposome hydrogel on colonic anastomosis. Methods: 70 Wistar-Albino male rats were randomly divided into seven groups. The left colon was transected and end-to-end anastomosis was performed. PVP-I liposome hydrogel was applied around the anastomoses in groups 2 and 5. Colonic bursting pressures and tissue hydroxyproline contents were measured on postoperative days 3 and 7.

  9. Liposomes as nanocarriers for anti-HIV therapy.

    PubMed

    Chopra, Shruti; Venkatesan, Natarajan; Betageri, Guru V

    2013-10-01

    Globally, in the last three decades of medical research, the use of liposomes as carrier for anti-HIV/AIDS drugs is gaining prominence. These potential anti-HIV nanocarriers are concentric lipid bilayers which can be fabricated to protect molecules and to target the drugs to specific sites, which is the reason behind their popularity in the antiretroviral drug delivery. The development of an effective drug delivery system such as liposomes presents an opportunity to circumvent the many challenges associated with antiretroviral drug therapy. The physiochemical properties of liposomes such as size, charge, and lipid composition significantly affect the liposomal efficiency. These nanocarriers offer advantages such as drug loading both in aqueous region and within the bilayer of the vesicles, act as solubilizing agents, protect drug from degradation in the body, allow modification of the pharmacokinetic and tissue distribution patterns of the drug, provide drug targeting, and have low immunogenicity, biocompatibility, and cell specificity. Different types of liposome-based delivery systems, such as cationic, anionic, sterically stabilized, and immunoliposomes, have been studied for the anti-HIV/AIDS drug delivery. Liposomes, however, face challenges with regard to their use in antiretroviral drug delivery such as limited hydrophilic drug-loading capacity, issues related to physical and biologic stability, poor scale-up, cost, short shelf life, and toxicity. Numerous patented strategies have been granted in the USA and around the world related to these anti-HIV nanocarriers. In the present article, we have discussed the general physiological aspects of the HIV infection, relevance of the nanocarrier, liposomes, in the treatment of this disease and some recently awarded US patents and patent applications of these liposomal delivery systems for anti-HIV drugs. PMID:25788354

  10. Development of a liposomal nanodelivery system for nevirapine

    PubMed Central

    2010-01-01

    Background The treatment of AIDS remains a serious challenge owing to high genetic variation of Human Immunodeficiency Virus type 1 (HIV-1). The use of different antiretroviral drugs (ARV) is significantly limited by severe side-effects that further compromise the quality of life of the AIDS patient. In the present study, we have evaluated a liposome system for the delivery of nevirapine, a hydrophobic non-nucleoside reverse transcriptase inhibitor. Liposomes were prepared from egg phospholipids using thin film hydration. The parameters of the process were optimized to obtain spherical liposomes below 200 nm with a narrow polydispersity. The encapsulation efficiency of the liposomes was optimized at different ratios of egg phospholipid to cholesterol as well as drug to total lipid. The data demonstrate that encapsulation efficiency of 78.14% and 76.25% were obtained at egg phospholipid to cholesterol ratio of 9:1 and drug to lipid ratio of 1:5, respectively. We further observed that the size of the liposomes and the encapsulation efficiency of the drug increased concomitantly with the increasing ratio of drug and lipid and that maximum stability was observed at the physiological pH. Thermal analysis of the drug encapsulated liposomes indicated the formation of a homogenous drug-lipid system. The magnitude of drug release from the liposomes was examined under different experimental conditions including in phosphate buffered saline (PBS), Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum or in the presence of an external stimulus such as low frequency ultrasound. Within the first 20 minutes 40, 60 and 100% of the drug was released when placed in PBS, DMEM or when ultrasound was applied, respectively. We propose that nevirapine-loaded liposomal formulations reported here could improve targeted delivery of the anti-retroviral drugs to select compartments and cells and alleviate systemic toxic side effects as a consequence. PMID:20624325

  11. Lipid peroxidation of liposome induced by glucosone.

    PubMed

    Nakayama, T; Yamada, M; Osawa, T; Kawakishi, S

    1992-08-01

    Lipid peroxidation of liposome made of egg lecithin was induced by glucosone (D-arabino-hexos-2-ulose), a secondary product of Maillard reaction or glycation of protein. Lipid peroxidation was assessed with measurement of TBARS (thiobarbituric acid reacting substances), POV (peroxide value), and HPLC measurement of MDA (malondialdehyde). EDTA and DTPA (diethylenetriamine-pentaacetic acid) inhibited the lipid peroxidation assessed by each method described above, indicating involvement of metal ions. The observed reduction of Fe3+ to Fe2+ by glucosone might be a critical step of the lipid peroxidation. Our findings suggest a possible role of lipid peroxidation of low-density lipoproteins (LDL) induced by glucosone in atherosis caused by diabetes mellitus. PMID:1291643

  12. Rapid Spontaneous Assembly of Single Component Liposomes

    E-print Network

    P. Sunthar; Sopan M. Phapal

    2015-01-28

    Can single component bilayer forming surfactants spontaneously assemble to form unilamellar vesicles of a definite size ? Although possible by Helfrich's theory, this has not been observed without external forcing. We show two variants of a method where this is possible without any input of external energy, with the time of synthesis reduced to as less as 15 minutes. It is shown that the average diameter of the liposomes formed is intrinsic and depends only on the temperature and the lipid type, eliminating kinetic effects normally observed. This thus can be a candidate mechanism for vesicle size selection in pre-biotic conditions. The method may also be suitable to study time-resolved studies of micelle to vesicle transition.

  13. Molecule-Substrate Coupling between Metal Phthalocyanines and Epitaxial Graphene Grown on Ru(0001) and Pt(111)

    E-print Network

    Gao, Hongjun

    Molecule-Substrate Coupling between Metal Phthalocyanines and Epitaxial Graphene Grown on Ru(0001 Academy of Sciences, Beijing 100190, China ABSTRACT: Self-assembly of metal phthalocyanine (MPc) molecules- temperature scanning tunneling microscopy. At low coverage, dispersive single molecules, dispersive molecular

  14. Modification of wool surface by liposomes for dyeing with weld.

    PubMed

    Montazer, Majid; Zolfaghari, Alireza; Toliat, Taibeh; Moghadam, Mohammad Bameni

    2009-01-01

    In this research work, wool surface has been modified by liposome to investigate its effects on dyeing with weld, a yellow natural dye. To do this, samples were first treated with aluminium sulphate and afterward with different concentrations of liposomes at various temperatures for 30 minutes and, finally, dyed with weld at 75, 85, and 95 degrees C for 30, 45, and 60 minutes. K/S values of fabric samples were calculated and washing, light and rub fastness properties of the samples were indicated. The results proposed that the sample treated with 1% liposomes and dyed at 75 degrees C for 60 min has the highest K/S value. The central composite design (CCD) used for the experimental plan with three variables on the results of color strength and statistical analysis confirms the optimum conditions obtained by the experimental results. It was also found that washing, light, wet, and dry rub fastness properties of samples dyed with weld, including liposomes, have not significantly changed. The results of water drop absorption indicated that the hydrophobicity is higher for the samples pretreated with liposomes. The SEM picture of wool sample treated with mordant and liposomes and finally dyed with weld shows a coated layer on the fiber surface. PMID:19552578

  15. Influence of the fluidity of liposome compositions on percutaneous absorption.

    PubMed

    Pérez-Cullell, N; Coderch, L; de la Maza, A; Parra, J L; Estelrich, J

    2000-01-01

    The penetration into the stratum corneum of fluorescein, as the acid form or as a sodium salt, encapsulated in liposomes formed by liquid- or gel-state phospholipids, with or without cholesterol, was investigated in humans by the stripping method. Liposomes prepared by extrusion were applied to the forearms of healthy human volunteers and 30 min later, strippings were performed. Fluorescein was extracted and determined by spectrofluorimetry. The skin penetration of sodium fluorescein was higher from fluid liposomes (phosphatidylcholine) than from rigid liposomes (hydrogenated phosphatidylcholine), but it was independent of the content of cholesterol. It seems that the liquid-crystalline state of the lipids is the main aspect involved in the fluidity of the liposome bilayer itself as well as in the interaction with the lipids of the stratum corneum. The similar enhanced penetration behavior obtained for unsaturated liposomes containing sodium or acid fluorescein seems to support the hypothesis of a previous destruction of the vesicles during its passage through the lipid intercellular pathway in the stratum corneum. PMID:10895414

  16. Aspects of the mechanics of lobed liposomes.

    PubMed

    Pamplona, D C; Calladine, C R

    1996-11-01

    Hotani has studied, by means of dark-field light microscopy, morphological transformations which unilamellar liposomes undergo when their interior volume decreases steadily with time as a consequence of osmosis. In a previous paper, we made a theoretical study of the initial buckling of an originally spherical vesicle into the observed oblate spheroidal shape; and we argued that some in-plane shear elastic stiffness is required-in addition to the well-known flexural stiffness of the lipid bilayer-in order to explain the observed phenomena. In the present paper, we consider a later stage in the chain of morphological transitions observed by Hotani, when a series of cudgel-shaped lobes have sprung out of a previously axisymmetric, biconcave-shaped vesicle. Specifically, we compare the observed shapes of such lobes with half of a series of "peanut"-shaped vesicles that are an equilibrium conformation of an initially spherical liposome under reduced internal volume. We find that the shapes do not match well. On the other hand, the observed lobe forms do match satisfactorily portions of "undulating tube" shapes which evolve from a hypothetical cylindrical vesicle, according to some simple calculations. In view of this agreement, we are led to propose that the formation of cudgel-shaped lobes requires some sliding of one lipid monolayer over another. This conflicts, of course, with the Love-Kirchhoff hypothesis which is normally invoked at the outset of analyses of lipid vesicles by means of classical thin-shell theory; but it is in accord with previous suggestions in the context of more obviously severe distortion of the lipid bilayer. PMID:8950651

  17. Ultrasonic Activation of Thermally Sensitive Liposomes

    NASA Astrophysics Data System (ADS)

    Mylonopouloua, Eleonora; Arvanitisa, Costas D.; Bazan-Peregrinoa, Miriam; Arora, Manish; Coussios, Constantin C.

    2010-03-01

    Cancerous cells are known to be more vulnerable to mild hyperthermia than healthy cells, which can survive temperatures above 43° C for brief periods of time. Currently in phase III clinical trials for liver cancer, ThermoDox® (Celsion Corporation) is a drug delivery system containing doxorubicin, a common anti-cancer agent, encapsulated within a thermally sensitive liposome designed to release its contents above 39.5° C. Activation of such an agent with the use of HIFU, which can generate localized heating non-invasively, would combine the benefits of targeted chemotherapy and hyperthermia while minimizing undesirable systemic side-effects. To that end, the resolution and reliability with which HIFU-induced hyperthermia can achieve Thermodox® release was investigated using a novel agar-based gel embedding liposomes at clinically relevant concentrations (0.02 mg/ml). The gel was exposed to 1.15 MHz HIFU (Sonic Concepts H102) using a range of clinically relevant pressure amplitudes (0-6 MPa peak rarefactional), duty cycles (10-100%) and exposure durations to identify optimal insonation conditions for complete doxorubicin release. The corresponding temperature profiles were mapped with 0.5 mm spatial resolution using an embedded needle thermocouple; drug release was quantified using fluorimetry. Complete release over the HIFU focal area was obtained for 6-s continuous wave exposure at 5.2 MPa peak rarefactional pressure, i.e. under exposure conditions for which the temperature exceeded 43° C throughout the focal volume. For a given HIFU energy input, both the final temperature reached and the rate of heating were found to affect release significantly. However, ThermoDox® release was achieved only due to thermal effects of HIFU, and not by other ultrasound effects, such as cavitation without heating, showing robustness of HIFU-induced hyperthermia as a release mechanism.

  18. Kinetics of proton transfer from tetra(4-nitro-5- tert-butyl)phthalocyanine to nitrogen-containing bases in benzene

    NASA Astrophysics Data System (ADS)

    Petrov, O. A.; Kuzmina, E. L.; Maizlish, V. E.; Rodionov, A. V.

    2014-01-01

    The acid-basic interaction between tetra(4-nitro-5- tert-butyl)phthalocyanine and pyridine, 2-methylpyridine, morpholine, piperidine, n-butylamine, diethylamine, and triethylamine in benzene is studied. It is found that the intermolecular transfer of protons of NH groups from tetra(4-nitro-5- tert-butyl)phthalocyanine to morpholine and diethylamine is characterized by unusually low values of the reaction constant rates. The effect of the structure of tetra(4-nitro-5- tert-butyl)phthalocyanine and tetra(3-nitro-5- tert-butyl)phthalocyanine, and of the nature of the base on the kinetic parameters of acid-base interaction is demonstrated. A structure is proposed for complexes with the transfer of displaced phthalocyanines' protons. It is found that they undergo decomposition over time.

  19. Evaluation of electrostatic binding of PAMAM dendrimers and charged phthalocyanines by fluorescence correlation spectroscopy.

    PubMed

    Garcia-Fernandez, Emilio; Paulo, Pedro M R; Costa, Sílvia M B

    2015-02-14

    We have assessed host-guest interactions between PAMAM dendrimers and charged phthalocyanine probes by Fluorescence Correlation Spectroscopy (FCS). Our results show strong binding in water at low ionic strength with an affinity that decreases from KB ? 10(9) to 10(8) M(-1) upon decreasing the phthalocyanine charge of z = -4, -2 and -1. The binding affinity also decreases significantly upon salt addition leading to KB values of ca. 10(5)-10(6) M(-1). The changes of binding affinity probed by varying the phthalocyanine charge, and by changing the ionic strength or pH conditions, allowed us to evaluate the electrostatic contribution (Kel) in dendrimer-phthalocyanine interactions. In particular, this approach afforded values of electrostatic potential for PAMAM dendrimers in water at low ionic strength and at dendrimer concentrations in the nanomolar range. The electrostatic potential of PAMAM generations 4 and 7 are around 50 mV in close agreement with theoretical estimates using the Poisson-Boltzmann cell model. Interestingly, the nonelectrostatic binding is significant and contributes even more than electrostatic binding to dendrimer-phthalocyanine interactions. The nonelectrostatic binding contributes to an affinity of KB above 10(5) M(-1), as measured under conditions of low dendrimer charge and high ionic strength, which makes these dendrimers promising hosts as drug carriers. PMID:25574969

  20. Elaboration of ammonia gas sensors based on electrodeposited polypyrrole--cobalt phthalocyanine hybrid films.

    PubMed

    Patois, Tilia; Sanchez, Jean-Baptiste; Berger, Franck; Fievet, Patrick; Segut, Olivier; Moutarlier, Virginie; Bouvet, Marcel; Lakard, Boris

    2013-12-15

    The electrochemical incorporation of a sulfonated cobalt phthalocyanine (sCoPc) in conducting polypyrrole (PPy) was done, in the presence or absence of LiClO4, in order to use the resulting hybrid material for the sensing of ammonia. After electrochemical deposition, the morphological features and structural properties of polypyrrole/phthalocyanine hybrid films were investigated and compared to those of polypyrrole films. A gas sensor consisting in platinum microelectrodes arrays was fabricated using silicon microtechnologies, and the polypyrrole and polypyrrole/phthalocyanine films were electrochemically deposited on the platinum microelectrodes arrays of this gas sensor. When exposed to ammonia, polymer-based gas sensors exhibited a decrease in conductance due to the electron exchange between ammonia and sensitive polymer-based layer. The characteristics of the gas sensors (response time, response amplitude, reversibility) were studied for ammonia concentrations varying from 1 ppm to 100 ppm. Polypyrrole/phthalocyanine films exhibited a high sensitivity and low detection limit to ammonia as well as a fast and reproducible response at room temperature. The response to ammonia exposition of polypyrrole films was found to be strongly enhanced thanks to the incorporation of the phthalocyanine in the polypyrrole matrix. PMID:24209308

  1. Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA

    NASA Astrophysics Data System (ADS)

    Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

    2013-11-01

    Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

  2. Effects of triglycerides on the hydrophobic drug loading capacity of saturated phosphatidylcholine-based liposomes.

    PubMed

    Hong, Soon-Seok; Kim, So Hee; Lim, Soo-Jeong

    2015-04-10

    A high drug-loading capacity is a critical factor for the clinical development of liposomal formulations. The accommodation of hydrophobic drugs within the liposomal membrane is often limited in saturated phosphatidylcholine (PC)-based liposomes owing to the rigidity of the lipid acyl chain. In the current study, we explored the possibility of improving the hydrophobic drug loading capacity of liposomes by incorporating triglyceride into liposomal membranes. Incorporation of Captex 300, a medium chain triglyceride, into liposomes composed of dimyristoylphosphatidylcholine and cholesterol greatly increased the fluidity and lamellarity of the resultant liposomes. Liposomal incorporation of medium or long chain, but not short chain, triglycerides greatly enhanced the concentration of loaded paclitaxel (PTX) in saturated PC-based liposomes. The enhancing effect of triglyceride saturated at a triglyceride content corresponding to the amount required to fluidize the liposome structure. In addition, the enhancing effect was not observed in unsaturated PC-based liposomes and was not associated with the solubility of PTX in each triglyceride. Triglycerides also enhanced the loading of docetaxel, another hydrophobic drug. Taken together, our results suggest that triglyceride incorporation in saturated PC-based liposomes provide an improved dosage form that enables increased hydrophobic drug loading by altering the fluidity and structure of liposomal membranes. PMID:25667981

  3. Stealth liposomes: review of the basic science, rationale, and clinical applications, existing and potential

    PubMed Central

    Immordino, Maria Laura; Dosio, Franco; Cattel, Luigi

    2006-01-01

    Among several promising new drug-delivery systems, liposomes represent an advanced technology to deliver active molecules to the site of action, and at present several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles (“first-generation liposomes”) to “second-generation liposomes”, in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. A significant step in the development of long-circulating liposomes came with inclusion of the synthetic polymer poly-(ethylene glycol) (PEG) in liposome composition. The presence of PEG on the surface of the liposomal carrier has been shown to extend blood-circulation time while reducing mononuclear phagocyte system uptake (stealth liposomes). This technology has resulted in a large number of liposome formulations encapsulating active molecules, with high target efficiency and activity. Further, by synthetic modification of the terminal PEG molecule, stealth liposomes can be actively targeted with monoclonal antibodies or ligands. This review focuses on stealth technology and summarizes pre-clinical and clinical data relating to the principal liposome formulations; it also discusses emerging trends of this promising technology. PMID:17717971

  4. Synthesis of phthalocyanine doped sol-gel materials

    NASA Technical Reports Server (NTRS)

    Dunn, Bruce

    1993-01-01

    The synthesis of sol-gel silica materials doped with three different types of metallophthalocyanines has been studied. Homogeneous materials of good optical quality were prepared and the first optical limiting measurements of dyes in sol-gel hosts were carried out. The properties of these solid state limiters are similar to limiters based on phthalocyanine (Pc) in solution. Sol-gel silica materials containing copper, tin and germanium phthalocyanines were investigated. The initial step in all cases was to prepare silica sols by the sonogel method using tetramethoxy silane (TMOS), HCl and distilled water. Thereafter, the synthesis depended upon the specific Pc and its solubility characteristics. Copper phthalocyanine tetrasulfonic acid tetra sodium salt (CuPc4S) is soluble in water and various doping levels (1 x 10 (exp -4) M to 1 x 10 (exp -5) M) were added to the sol. The group IV Pc's, SnPc(OSi(n-hexyl)3)2 and GePc(OSi(n-hexyl)3)2, are insoluble in water and the process was changed accordingly. In these cases, the compounds were dissolved in THF and then added to the sol. The Pc concentration in the sol was 2 x 10(exp -5)M. The samples were then aged and dried in the standard method of making xerogel monoliths. Comparative nanosecond optical limiting experiments were performed on silica xerogels that were doped with the different metallophthalocyanines. The ratio of the net excited state absorption cross section (sigma(sub e)) to the ground state cross section (sigma(sub g)) is an important figure of merit that is used to characterize these materials. By this standard the SnPc sample exhibits the best limiting for the Pc doped sol-gel materials. Its cross section ratio of 19 compares favorably with the value of 22 that was measured in toluene. The GePc materials appear to not be as useful as those containing SnPc. The GePc doped solids exhibit a higher onset energy (2.5 mj and lower cross section ratio, 7. The CuPc4S sol-gel material has a still lower cross section ratio, 4, however, the tetrasulfonate groups make the dye soluble in water which greatly facilitates its incorporation into the sol-gel matrix. The nonlinear transmission of CuPc4S in a pH 2 buffer solution and in a silica xerogel were compared. It is evident that the CuPc4S preserves its optical limiting behavior in the sol-gel matrix, indicating that the fundamental excited state absorption process is essentially the same for a molecule in solution or in the solid state. Although the spectroscopic details of energy level lifetimes are unknown, the significance is that passive optical limiting has been achieved in the solid state via incorporation of a dye into an inorganic host. The only compromise occurs at the extremely high energy regime where photobleaching is observed. This is a result of the limited mobility of the dye molecules in the solid silica host relative to a liquid host. The effects of photodegradation in the xerogel are additive, whereas the solution provides a supply of fresh molecules that are free to enter the active volume between pulses.

  5. Lipid Segregation in Membranes of Anionic Liposomes Adsorbed onto Polycationic Brushes.

    PubMed

    Yaroslavov, Alexander A; Sybachin, Andrey V; Zaborova, Olga V; Orlov, Viktor N; Ballauff, Matthias; Talmon, Yeshayahu; Menger, Fredric M

    2013-10-01

    Two-phased: Complexation of liposomes to spherical polycationic brushes induces lipid segregation in the liposomal membrane. The greater the initial anionic lipid content in the membrane, the more the electroneutral lipid dilutes the induced anionic clusters. PMID:24092540

  6. Etoposide Incorporated into Camel Milk Phospholipids Liposomes Shows Increased Activity against Fibrosarcoma in a Mouse Model

    PubMed Central

    Maswadeh, Hamzah M.; Aljarbou, Ahmad N.; Alorainy, Mohammed S.; Alsharidah, Mansour S.; Khan, Masood A.

    2015-01-01

    Phospholipids were isolated from camel milk and identified by using high performance liquid chromatography and gas chromatography-mass spectrometry (GC/MS). Anticancer drug etoposide (ETP) was entrapped in liposomes, prepared from camel milk phospholipids, to determine its activity against fibrosarcoma in a murine model. Fibrosarcoma was induced in mice by injecting benzopyrene (BAP) and tumor-bearing mice were treated with various formulations of etoposide, including etoposide entrapped camel milk phospholipids liposomes (ETP-Cam-liposomes) and etoposide-loaded DPPC-liposomes (ETP-DPPC-liposomes). The tumor-bearing mice treated with ETP-Cam-liposomes showed slow progression of tumors and increased survival compared to free ETP or ETP-DPPC-liposomes. These results suggest that ETP-Cam-liposomes may prove to be a better drug delivery system for anticancer drugs.

  7. Preparation and evaluation of cyclodextrin polypseudorotaxane with PEGylated liposome as a sustained release drug carrier

    PubMed Central

    Hayashida, Kayoko; Higashi, Taishi; Kono, Daichi; Motoyama, Keiichi; Wada, Koki

    2014-01-01

    Summary Cyclodextrins (CDs) can form polypseudorotaxanes (PPRXs) with drugs or drug carriers possessing linear polymers such as polyethylene glycol (PEG). On the other hand, PEGylated liposomes have been utilized as a representative anticancer drug carrier. However, little is known about the formation of CD PPRX with PEGylated liposome. In the present study, we first report the formation of CD PPRX with PEGylated liposome and evaluate it as a sustained release drug carrier. PEGylated liposome encapsulating doxorubicin was disrupted by the addition of ?-CD. Meanwhile, ?-CD included two PEG chains and/or one bending PEG chain of PEGylated liposome and formed PPRX without the disruption of the membrane integrity of the PEGylated liposome. Moreover, the release of doxorubicin and/or PEGylated liposome encapsulating doxorubicin from the PPRX was prolonged in accordance with the matrix type release mechanism. These findings suggest the potential of ?-CD PPRX as sustained release carriers for PEGylated liposome products. PMID:25550741

  8. Behaviour of liposomes loaded with bovine serum albumin during in vitro digestion.

    PubMed

    Liu, Weilin; Ye, Aiqian; Liu, Wei; Liu, Chengmei; Han, Jianzhong; Singh, Harjinder

    2015-05-15

    This study examined the stability of liposomes loaded with negatively charged protein (bovine serum albumin, BSA) during in vitro digestion. Zeta-potential and morphology measurements confirmed that BSA-loaded liposomes were successfully prepared, with an encapsulation efficiency of around 34%. The encapsulated BSA and the integrity of the liposomes remained unchanged with time when the liposomes were digested in a simulated gastric environment, suggesting that the liposomal membrane protected the entrapped BSA from pepsin hydrolysis. BSA-loaded liposomes exhibited lower stability in simulated intestinal fluid, as shown by damaged membranes and the release of free fatty acids. Also, lipolysis kinetics revealed that bile salts and ionic strength could facilitate a high level of free fatty acid release. This work further supplemented our knowledge about the effects of gastrointestinal digestion conditions on liposomal properties and provided valuable information for the design of liposome formulations for the food and health care industries. PMID:25577045

  9. Clinical development of liposome-based drugs: formulation, characterization, and therapeutic efficacy

    PubMed Central

    Chang, Hsin-I; Yeh, Ming-Kung

    2012-01-01

    Research on liposome formulations has progressed from that on conventional vesicles to new generation liposomes, such as cationic liposomes, temperature sensitive liposomes, and virosomes, by modulating the formulation techniques and lipid composition. Many research papers focus on the correlation of blood circulation time and drug accumulation in target tissues with physicochemical properties of liposomal formulations, including particle size, membrane lamellarity, surface charge, permeability, encapsulation volume, shelf time, and release rate. This review is mainly to compare the therapeutic effect of current clinically approved liposome-based drugs with free drugs, and to also determine the clinical effect via liposomal variations in lipid composition. Furthermore, the major preclinical and clinical data related to the principal liposomal formulations are also summarized. PMID:22275822

  10. Solvent-stabilized photoconductive metal phthalocyanine nanoparticles: preparation and application in single-layered photoreceptors.

    PubMed

    Wang, Yuan; Liang, Dejian

    2010-04-01

    This article features solvent-stabilized nanoparticles of photoconductive metal phthalocyanines (MPcs) with small particle sizes and narrow size distributions, which are tractable building blocks for photoelectric devices. The preparation and stabilization mechanism of 1,2-dichloroethane (DCE)-stabilized oxovanadium phthalocyanine (VOPc) and oxotitanium phthalocyanine (TiOPc) nanoparticles are discussed. It is found for the first time that the DCE-stabilized TiOPc and VOPc nanoparticles are positively charged with zeta potentials of about +66 mV, which is ascribed to the electron transfer from the nanoparticles to DCE molecules. The excellent xerographic properties of the single-layered photoreceptors based on TiOPc or VOPc nanoparticles and the charge transport mechanism of these photoreceptors are discussed. The strategy for further improving the xerographic properties of single-layered photoreceptors is proposed. PMID:20437502

  11. Interaction of iron phthalocyanine with the graphene/Ni(111) system.

    PubMed

    Massimi, Lorenzo; Lisi, Simone; Pacilè, Daniela; Mariani, Carlo; Betti, Maria Grazia

    2014-01-01

    Graphene grown on crystalline metal surfaces is a good candidate to act as a buffer layer between the metal and organic molecules that are deposited on top, because it offers the possibility to control the interaction between the substrate and the molecules. High-resolution angular-resolved ultraviolet photo electron spectroscopy (ARPES) is used to determine the interaction states of iron phthalocyanine molecules that are adsorbed onto graphene on Ni(111). The iron phthalocyanine deposition induces a quenching of the Ni d surface minority band and the appearance of an interface state on graphene/Ni(111). The results have been compared to the deposition of iron phthalocyanine on graphene/Ir(111), for which a higher decoupling of the organic molecule from the underlying metal is exerted by the graphene buffer layer. PMID:24778953

  12. Cellular fusion and whitening effect of a chitosan derivative coated liposome

    Microsoft Academic Search

    Yang-Wei Wang; Chi-Hsiung Jou; Chia-Chun Hung; Ming-Chien Yang

    In this study, a derivative of chitosan, N-(2-hydroxyl) propyl-3-trimethyl ammonium chitosan chloride (HTCC), was coated onto the liposomes made of cholesterol and 1,2-palmitoyl-sn-glycero-3-phosphatidylcholine (DPPC). These coated liposomes were loaded with kojic acid for skin whitening. The appearance of liposome was examined using transmission electron microscope (TEM), and the coating of HTCC to the liposome was confirmed by infrared spectroscopy. By

  13. Laser-Induced Release of Liposome-Encapsulated Dye: A New Diagnostic Tool

    Microsoft Academic Search

    S. Mordon; J. M. Devoisselle; S. Begu; T. Desmettre

    1998-01-01

      This paper reviews applications of laser-induced release of liposome-encapsulated dye as a diagnostic tool. The technique\\u000a consists of encapsulating a fluorescent dye into liposomes at high concentration. Before injection, liposomes are not fluorescent.\\u000a After systemic liposome injection, a laser beam is used to increase the temperature at a specific site (blood vessel, biological\\u000a structures, etc.). This increase of temperature causes

  14. Phototoxicity of coproporphyrin as a novel photodynamic therapy was enhanced by liposomalization

    Microsoft Academic Search

    Yasuyuki Sadzuka; Fumiaki Iwasaki; Ikumi Sugiyama; Kentaro Horiuchi; Toru Hirano; Hidechika Ozawa; Naohiro Kanayama; Naoto Oku

    2008-01-01

    This study attempted the liposomalization of coproporphyrin I (CPI) with hydrophobic properties. Liposomalization of CPI was not successful at any pH when using lactate buffer. In contrast, when using 9% sucrose\\/10mM phosphate buffer (pH 7.8), CPI liposomes (Lipo-CPI) and polyethyleneglycol (PEG) modified liposomes (PEG-CPI) were prepared with a high entrapment ratio of CPI and small particle size. Plasma CPI concentration

  15. Anisotropic exciton relaxation in nanostructured metal (Zn and F16Zn)-phthalocyanine.

    PubMed

    Ahn, Hyeyoung; Liou, Wei-Hyun; Chen, Huang-Ming Philip; Hsu, Chia-Hung

    2015-02-01

    We report ultrafast excited state dynamics of zinc phthalocyanine and zinc hexadecafluoro phthalocyanine thin films which have nanorod-like structures. Excitons in the singlet states undergo multi-exponential relaxation processes to the ground state and the singlet lifetime within a few tens of picoseconds is attributed to the diffusion-limited exciton annihilation process. Diffusive migration of the singlet excitons shows the anisotropic lifetimes depending on the polarization of probe beam. Similar anisotropy is observed in the X-ray diffraction data which exhibits long-range alignment of molecular columns along the long axis of nanorod, whereas disordered arrangement in lateral direction to the axis of nanorod. PMID:25836181

  16. Influence of film thickness and air exposure on the transport gap of manganese phthalocyanine

    SciTech Connect

    Haidu, F.; Fechner, A.; Salvan, G.; Gordan, O. D.; Fronk, M.; Zahn, D. R. T. [Semiconductor Physics, Chemnitz University of Technology, D-09107 Chemnitz (Germany); Lehmann, D. [Semiconductor Physics, Chemnitz University of Technology, D-09107 Chemnitz (Germany); INNOVENT Technology Development, D-07745 Jena (Germany); Mahns, B.; Knupfer, M. [Electronic and Optical Properties Department, IFW Dresden, D-01171 Dresden (Germany)

    2013-06-15

    The interface formation between manganese phthalocyanine (MnPc) and cobalt was investigated combining ultraviolet photoelectron spectroscopy and inverse photoelectron spectroscopy. The transport band gap of the MnPc increases with the film thickness up to a value of (1.2 {+-} 0.3) eV while the optical band gap as determined from spectroscopic ellipsometry amounts to 0.5 eV. The gap values are smaller compared to other phthalocyanines due to metallic Mn 3d states close to the Fermi level. The transport band gap was found to open upon air exposure as a result of the disappearance of the occupied 3d electronic states.

  17. Self-assembling porphyrins and phthalocyanines for photoinduced charge separation and charge transport.

    PubMed

    Imahori, Hiroshi; Umeyama, Tomokazu; Kurotobi, Kei; Takano, Yuta

    2012-04-28

    Large ?-conjugated compounds are promising building blocks for organic thin-film electronics such as organic light-emitting diodes, organic field-effect transistors, and organic photovoltaics. Utilization of porphyrins and phthalocyanines for this purpose is highly fascinating because of their excellent electric, photophysical, and electrochemical properties as well as intense self-assembling abilities arising from ?-? stacking interactions. This paper focuses on fundamental aspects of self-assembled structures that have been obtained from porphyrin and phthalocyanine building blocks and more complex composites for photoinduced charge separation and charge transport toward the potential applications to organic thin-film electronics. PMID:22430327

  18. Fluorinated copper-phthalocyanine/cobalt-phthalocyaine organic heterojunctions: Charge transport and Kelvin probe studies

    NASA Astrophysics Data System (ADS)

    Debnath, A. K.; Kumar, Arvind; Samanta, S.; Prasad, R.; Singh, A.; Chauhan, A. K.; Veerender, P.; Singh, S.; Basu, S.; Aswal, D. K.; Gupta, S. K.

    2012-04-01

    Organic heterojunctions comprising of n-type fluorinated copper-phthalocyanine (F16CuPc) and p-type cobalt-phthalocyanine (CoPc) layers were prepared on (001) LaAlO3 substrates. In the entire temperature range of 300-30 K, F16CuPc/CoPc heterojunctions showed an ohmic conduction with three order of magnitude lower resistivity than the individual layers. This indicates formation of a charge accumulation layer at the interface. Kelvin probe studies showed that charge accumulation layer is ˜10 nm thick on both the sides of the interface.

  19. Enhanced localization of anticancer drug in tumor tissue using polyethylenimine-conjugated cationic liposomes

    NASA Astrophysics Data System (ADS)

    Han, Hee Dong; Byeon, Yeongseon; Jeon, Hat Nim; Shin, Byung Cheol

    2014-05-01

    Liposome-based drug delivery systems hold great potential for cancer therapy. However, to enhance the localization of payloads, an efficient method of systemic delivery of liposomes to tumor tissues is required. In this study, we developed cationic liposomes composed of polyethylenimine (PEI)-conjugated distearoylglycerophosphoethanolamine (DSPE) as an enhanced local drug delivery system. The particle size of DSPE-PEI liposomes was 130 ± 10 nm and the zeta potential of liposomes was increased from -25 to 30 mV by the incorporation of cationic PEI onto the liposomal membrane. Intracellular uptake of DSPE-PEI liposomes by tumor cells was 14-fold higher than that of DSPE liposomes. After intratumoral injection of liposomes into tumor-bearing mice, DSPE-PEI liposomes showed higher and sustained localization in tumor tissue compared to DSPE liposomes. Taken together, our findings suggest that DSPE-PEI liposomes have the potential to be used as effective drug carriers for enhanced intracellular uptake and localization of anticancer drugs in tumor tissue through intratumoral injection.

  20. In Vitro Gene Delivery Mediated by Asialofetuin-Appended Cationic Liposomes Associated with ?-Cyclodextrin into Hepatocytes

    PubMed Central

    Motoyama, Keiichi; Nakashima, Yoshihiro; Aramaki, Yukihiko; Hirayama, Fumitoshi; Uekama, Kaneto; Arima, Hidetoshi

    2011-01-01

    The purpose of this study is to evaluate in vitro gene delivery mediated by asialofetuin-appended cationic liposomes (AF-liposomes) associating cyclodextrins (CyD/AF-liposomes) as a hepatocyte-selective nonviral vector. Of various CyDs, AF-liposomes associated with plasmid DNA (pDNA) and ?-cyclodextrin (?-CyD) (pDNA/?-CyD/AF-liposomes) showed the highest gene transfer activity in HepG2 cells without any significant cytotoxicity. In addition, ?-CyD enhanced the encapsulation ratio of pDNA with AF-liposomes, and also increased gene transfer activity as the entrapment ratio of pDNA into AF-liposomes was increased. ?-CyD stabilized the liposomal membrane of AF-liposomes and inhibited the release of calcein from AF-liposomes. The stabilizing effect of ?-CyD may be, at least in part, involved in the enhancing gene transfer activity of pDNA/?-CyD/AF-liposomes. Therefore, these results suggest the potential use of ?-CyD for an enhancer of transfection efficiency of AF-liposomes. PMID:21490752

  1. Enhanced localization of anticancer drug in tumor tissue using polyethylenimine-conjugated cationic liposomes

    PubMed Central

    2014-01-01

    Liposome-based drug delivery systems hold great potential for cancer therapy. However, to enhance the localization of payloads, an efficient method of systemic delivery of liposomes to tumor tissues is required. In this study, we developed cationic liposomes composed of polyethylenimine (PEI)-conjugated distearoylglycerophosphoethanolamine (DSPE) as an enhanced local drug delivery system. The particle size of DSPE-PEI liposomes was 130?±?10 nm and the zeta potential of liposomes was increased from -25 to 30 mV by the incorporation of cationic PEI onto the liposomal membrane. Intracellular uptake of DSPE-PEI liposomes by tumor cells was 14-fold higher than that of DSPE liposomes. After intratumoral injection of liposomes into tumor-bearing mice, DSPE-PEI liposomes showed higher and sustained localization in tumor tissue compared to DSPE liposomes. Taken together, our findings suggest that DSPE-PEI liposomes have the potential to be used as effective drug carriers for enhanced intracellular uptake and localization of anticancer drugs in tumor tissue through intratumoral injection. PMID:24855464

  2. Electrochromic lutetium phthalocyanine films for in situ detection of NADH

    NASA Astrophysics Data System (ADS)

    Basova, Tamara; Gürek, Ay?e Gül; Ahsen, Vefa; Ray, Asim

    2013-01-01

    A simple and sensitive method for the detection of NADH on a glass substrate modified with spin coated electrochromic [(C6H13S)8Pc]2Lu is presented. The modification of a [(C6H13S)8Pc]2Lu sensing layer was achieved chemically. The functionalized layer shows an efficient activity towards the NADH at conc. as low as 1 × 10-5 M. The in situ UV-Vis and Raman measurements were carried out to study the interaction of oxidized films with NADH. The electrochromic behaviour of [(C6H13S)8Pc]2Lu thin films was examined in detail under various conditions. The spin coated films deposited on glass substrate were chemically oxidized and were found to change the colour. The oxidized films were believed to be reduced to its natural form on interaction with NADH. The colour of the film changed from green to brownish-purple after interaction with NADH. Reversible electrochromism was observed, leading reusable sensor film. The transformation of the oxidised phthalocyanine films into neutral form was monitored by both in situ UV-Vis and Raman techniques.

  3. Photodynamic Therapy with the Phthalocyanine Photosensitizer Pc 4

    PubMed Central

    Miller, Janine D.; Baron, Elma D.; Scull, Heather; Hsia, Andrew; Berlin, Jeffrey C.; McCormick, Thomas; Colussi, Valdir; Kenney, Malcolm E.; Cooper, Kevin D.; Oleinick, Nancy L.

    2007-01-01

    Photodynamic therapy (PDT) is emerging as a promising non-invasive treatment for cancers. PDT involves either local or systemic administration of a photosensitizing drug, which preferentially localizes within the tumor, followed by illumination of the involved organ with light, usually from a laser source. Here, we provide a selective overview of our experience with PDT at Case Western Reserve University, specifically with the silicon phthalocyanine photosensitizer Pc 4. We first review our in-vitro studies evaluating the mechanism of cell killing by Pc 4-PDT. Then we briefly describe our clinical experience in a Phase I trial of Pc 4-PDT and our preliminary translational studies evaluating the mechanisms behind tumor responses. Preclinical work identified (a) cardiolipin and the anti-apoptotic proteins Bcl-2 and Bcl-xL as targets of Pc 4-PDT, (b) the intrinsic pathway of apoptosis, with the key participation of caspase-3, as a central response of many human cancer cells to Pc 4-PDT, (c) signaling pathways that could modify apoptosis, and (d) a formulation by which Pc 4 could be applied topically to human skin and penetrate at least through the basal layer of the epidermis. Clinical-translational studies enabled us to develop an immunohistochemical assay for caspase-3 activation, using biopsies from patients treated with topical Pc 4 in a Phase I PDT trial for cutaneous T-cell lymphoma. Results suggest that this assay may be used as an early biomarker of clinical response. PMID:17397888

  4. New approaches to photodynamic therapy of tumors with Al phthalocyanine

    NASA Astrophysics Data System (ADS)

    Vakoulovskaya, Elena G.; Chental, V. V.; Kuvshinov, Yury P.; Poddubny, Boris K.

    1999-12-01

    The aim of the study was to determine the efficacy of photodynamic therapy (PDT) of tumors of different localization and histology with new photosensitizer aluminum sulfonated phthalocyanine (Photosense, Russia). PDT have been provided in 106 patients with different tumors. The initial dose (2.0 - 2.5 mg/kg) of PHS was significantly reduced till 0.5 - 0.8 mg/kg during clinical trials because of phototoxicity. The results of PDT, side effects and ways of their correction and prevention, as well as possibility to work out less toxic regimes of PDT with photosense, choice of laser and type of irradiation are discussed. Efficacy of PDT depended on tumor size and it's histological type. Using low doses of PHS we've reduced the phototoxicity of sensitizer with the same direct effectiveness of treatment. Undesirable changes in plasma content of antioxidants by means of high pressure liquid chromatography have been found in patients after PHS injection. Influence of short-term and long-term supplementation with beta- carotene and vitamin E on this parameters are discussed.

  5. Regiospecific synthesis of tetrasubstituted phthalocyanines and their liquid crystalline order.

    PubMed

    Apostol, Petru; Bentaleb, Ahmed; Rajaoarivelo, Mbolotiana; Clérac, Rodolphe; Bock, Harald

    2015-03-10

    Metal-free and metal(ii) all-endo-tetraalkoxy-phthalocyanines of C4h symmetry are synthesised regiospecifically from 3-(2-butyloctyloxy)phthalonitrile with lithium octanolate and subsequent metal ion exchange. The voluminous, yet not overly large, and racemically disordered alkoxy substituent not only renders the cyclotetramerisation regiospecific, but also leads to liquid crystalline self-assembly with attainable clearing temperatures and persisting columnar organisation at room temperature. A rare hexagonal mesophase with twelve columns per hexagonal unit cell is found in the metal-free homologue, whereas the metal complexes show rectangular mesophases. The clearing temperature increases with increasing axial component of the metal ion coordination sphere. At low temperature, significant antiferromagnetic exchange between magnetic centres is observed for the Co(II) homologue, whereas the magnetic centres are magnetically independent in the Cu(II) derivative, in line with the observed higher clearing temperature in the Co(II) case that testifies of stronger interdisk interactions. PMID:25697075

  6. Liposome dependent delivery of S-adenosyl methionine to cells by liposomes: a potential treatment for liver disease.

    PubMed

    Wagner, Eric J; Krugner-Higby, Lisa; Heath, Timothy D

    2009-02-01

    The present study demonstrates that the nutritional supplement S-adenosyl methionine (SAMe), the primary methyl donor in mammalian cells, is delivered selectively to cells by anionic liposomes, and is, therefore, a liposome dependent drug. Contrary to our expectations, free SAMe chloride was growth inhibitory in cultured cells. The growth inhibitory potency of SAMe chloride in anionic liposomes composed of distearoylphosphatidylglycerol/cholesterol 2:1 was fivefold greater than that of free SAMe. Neutral liposomes composed of distearoylphosphatidylcholine and cholesterol did not increase the potency of the drug. An improved anionic liposome SAMe formulation was produced by use of the 1,4-butanedisulfonate salt (SD4), adding a metal chelator (EDTA), and lowering the buffer pH from pH 7.0 to pH 4.0. This formulation was 15-fold more potent than free SD4, and was active after more than 28 days at 4 degrees C. SAMe and its potential degradation products were screened for toxicity. Formaldehyde was determined to have potency similar to that of free SAMe chloride in CV1-P cells, suggesting that the growth inhibitory effects of SAMe may partly arise from the formation of formaldehyde. The cytotoxic effects of formaldehyde and the less stable forms of SAMe, (SAMe chloride and SAMe tosylate) were decreased in the presence of 3 mM GSH (IC(50) approximately 0.44 mM). The cytotoxic effects of SD4 were not reduced by GSH, suggesting that this more stable form of SAMe is not toxic through the production of formaldehyde. SD4 in anionic DSPG liposomes stimulated murine IL-6 production in RAW 264 cells at concentrations 25- to 30-fold lower than free drug. This increase in potency for IL-6 production was in keeping with the increase in potency observed in our growth inhibition experiments. These results suggest that SD4 in liposomes may be a potential treatment for acute or chronic liver failure. PMID:18642386

  7. Design considerations for liposomal vaccines: Influence of formulation parameters on antibody and cell-mediated immune responses to liposome associated antigens

    PubMed Central

    Watson, Douglas S.; Endsley, Aaron N.; Huang, Leaf

    2012-01-01

    Liposomes (phospholipid bilayer vesicles) are versatile and robust delivery systems for induction of antibody and T lymphocyte responses to associated subunit antigens. In the last 15 years, liposome vaccine technology has matured and now several vaccines containing liposome-based adjuvants have been approved for human use or have reached late stages of clinical evaluation. Given the intensifying interest in liposome-based vaccines, it is important to understand precisely how liposomes interact with the immune system and stimulate immunity. It has become clear that the physicochemical properties of liposomal vaccines – method of antigen attachment, lipid composition, bilayer fluidity, particle charge, and other properties – exert dramatic effects on the resulting immune response. Here, we present a comprehensive review of the physicochemical properties of liposomal vaccines and how they influence immune responses. A discussion of novel and emerging immunomodulators that are suitable for inclusion in liposomal vaccines is also presented. Through a comprehensive analysis of the body of liposomal vaccine literature, we enumerate a series of principles that can guide the rational design of liposomal vaccines to elicit immune responses of a desired magnitude and quality. We also identify major unanswered questions in the field, pointing the direction for future study. PMID:22306376

  8. Application of Liposomes in Treatment of Rheumatoid Arthritis: Quo Vadis

    PubMed Central

    Singh, Sachin Kumar; Gulati, Monica

    2014-01-01

    The most common treatments for rheumatoid arthritis include nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids, disease modifying antirheumatic drugs (DMARDs), and some biological agents. However, none of the treatments available is able to achieve the ultimate goal of treatment, that is, drug-free remission. This limitation has shifted the focus of treatment to delivery strategies with an ability to deliver the drugs into the synovial cavity in the proper dosage while mitigating side effects to other tissues. A number of approaches like microemulsions, microspheres, liposomes, microballoons, cocrystals, nanoemulsions, dendrimers, microsponges, and so forth, have been used for intrasynovial delivery of these drugs. Amongst these, liposomes have proven to be very effective for retaining the drug in the synovial cavity by virtue of their size and chemical composition. The fast clearance of intra-synovially administered drugs can be overcome by use of liposomes leading to increased uptake of drugs by the target synovial cells, which in turn reduces the exposure of nontarget sites and eliminates most of the undesirable effects associated with therapy. This review focuses on the use of liposomes in treatment of rheumatoid arthritis and summarizes data relating to the liposome formulations of various drugs. It also discusses emerging trends of this promising technology. PMID:24688450

  9. Thermosensitive liposomal drug delivery systems: state of the art review

    PubMed Central

    Kneidl, Barbara; Peller, Michael; Winter, Gerhard; Lindner, Lars H; Hossann, Martin

    2014-01-01

    Thermosensitive liposomes are a promising tool for external targeting of drugs to solid tumors when used in combination with local hyperthermia or high intensity focused ultrasound. In vivo results have demonstrated strong evidence that external targeting is superior over passive targeting achieved by highly stable long-circulating drug formulations like PEGylated liposomal doxorubicin. Up to March 2014, the Web of Science listed 371 original papers in this field, with 45 in 2013 alone. Several formulations have been developed since 1978, with lysolipid-containing, low temperature-sensitive liposomes currently under clinical investigation. This review summarizes the historical development and effects of particular phospholipids and surfactants on the biophysical properties and in vivo efficacy of thermosensitive liposome formulations. Further, treatment strategies for solid tumors are discussed. Here we focus on temperature-triggered intravascular and interstitial drug release. Drug delivery guided by magnetic resonance imaging further adds the possibility of performing online monitoring of a heating focus to calculate locally released drug concentrations and to externally control drug release by steering the heating volume and power. The combination of external targeting with thermosensitive liposomes and magnetic resonance-guided drug delivery will be the unique characteristic of this nanotechnology approach in medicine. PMID:25258529

  10. Thermosensitive liposomal drug delivery systems: state of the art review.

    PubMed

    Kneidl, Barbara; Peller, Michael; Winter, Gerhard; Lindner, Lars H; Hossann, Martin

    2014-01-01

    Thermosensitive liposomes are a promising tool for external targeting of drugs to solid tumors when used in combination with local hyperthermia or high intensity focused ultrasound. In vivo results have demonstrated strong evidence that external targeting is superior over passive targeting achieved by highly stable long-circulating drug formulations like PEGylated liposomal doxorubicin. Up to March 2014, the Web of Science listed 371 original papers in this field, with 45 in 2013 alone. Several formulations have been developed since 1978, with lysolipid-containing, low temperature-sensitive liposomes currently under clinical investigation. This review summarizes the historical development and effects of particular phospholipids and surfactants on the biophysical properties and in vivo efficacy of thermosensitive liposome formulations. Further, treatment strategies for solid tumors are discussed. Here we focus on temperature-triggered intravascular and interstitial drug release. Drug delivery guided by magnetic resonance imaging further adds the possibility of performing online monitoring of a heating focus to calculate locally released drug concentrations and to externally control drug release by steering the heating volume and power. The combination of external targeting with thermosensitive liposomes and magnetic resonance-guided drug delivery will be the unique characteristic of this nanotechnology approach in medicine. PMID:25258529

  11. Liposomes as carriers for verbascoside: stability and skin permeation studies.

    PubMed

    Sinico, C; Caddeo, C; Valenti, D; Fadda, A M; Bilia, A R; Vincieri, F F

    2008-01-01

    In this study the influence of liposomal incorporation on both the stability and the in vitro (trans) dermal delivery of verbascoside was evaluated. The effect of drug entrapment into vesicles on its radical scavenging activity was also studied. Liposomes were obtained from soy phosphatidylcholine and cholesterol according to the film hydration method. Stability of verbascoside-loaded vesicles was studied over 6 months. Results showed that verbascoside can be incorporated in liposomes (E% = 57-66%), preventing its degradation. Stability studies (dynamic lager light scattering [DLLS] measurements and transmission electron microscopy [TEM] visualization) pointed out that vesicles were stable for 90 days and neither verbascoside leakage nor vesicle size alteration occurred during this period. The effects of vesicular incorporation on verbascoside diffusion through skin were investigated in vitro using newborn pig skin. Results showed that liposomes promoted drug accumulation into the stratum corneum but they did not give rise to any significant transdermal verbascoside delivery. Finally, results obtained from a 1, 1-diphenyl-2-pierylhydrazyl (DPPH) radical assay demonstrated that liposomes did not interfere with the radical scavenging activity of verbascoside. PMID:18348074

  12. Liposomes as alternative vehicles for sun filter formulations.

    PubMed

    Ramón, E; Alonso, C; Coderch, L; de la Maza, A; López, O; Parra, J L; Notario, J

    2005-01-01

    The aim of our study was to determine the influence of several types of liposomes with a different lipid composition on the percutaneous absorption of one conventional sun filter with a lipophilic character (ethyl hexyl methoxycinnamate) using both in vitro and in vivo methodologies. Three different liposomes were prepared with unsaturated and saturated phosphatidylcholine (PC, HPC), and with a wool lipid mixture (IWL) with a composition similar to that of the stratum corneum lipids. Results showed that the liquid crystalline state associated with PC liposomes plays a key role in enhancing skin penetration. when liposomes with a composition and structural organization similar to that of the stratum corneum lipids (HPC and IWL) are used, the skin penetration is retarded, suggesting a certain reinforcement of the stratum corneum barrier. These two types of liposomes could be regarded as alternatives to conventional oil/water emulsions in the formulations of lipidic sun filters. Finally, an acceptable correlation was obtained using both in vitro and in vivo methodologies to evaluate the corresponding skin absorption profile. PMID:15824033

  13. The effect of liposomes on skin barrier structure.

    PubMed

    Coderch, L; de Pera, M; Perez-Cullell, N; Estelrich, J; de la Maza, A; Parra, J L

    1999-01-01

    The present work deals with the 'in vivo' stripping technique to evaluate the percutaneous absorption of sodium fluorescein (NaFl) vehiculized in two different liposome preparations formed by phosphatidylcholine (PC) and lipids mimicking the stratum corneum (SC; ceramides, cholesterol, palmitic acid and cholesteryl sulphate), respectively. Furthermore, the possible effect of these vesicles on the SC lipid alkyl chain conformational order were evaluated at different depths of SC by non-invasive biophysical techniques: Corneometer, Tewameter and especially ATR-FTIR. The results of NaFl percutaneous absorption indicate the highest penetration in the case of incorporation in PC liposomes, which could be related to the increase in SC lipid disorder detected by ATR-FTIR, i.e. a decrease in skin barrier function. On the other hand, SC lipid liposomes have been shown to have a higher affinity for SC owing to the high amount of NaFl found in this layer, suggesting a greater reservoir capacity of SC when similar lipid composition formulation is applied. A lipid order increase is observed by infrared spectroscopy, when these types of liposomes are topically applied, resulting in a strong barrier effect. These results could be useful in designing specific liposomal topical applications. PMID:10461092

  14. Coating of negatively charged liposomes by polylysine: drug release study.

    PubMed

    Volodkin, Dmitry; Mohwald, Helmuth; Voegel, Jean-Claude; Ball, Vincent

    2007-01-22

    The present work describes surface coating of carboxyfluorescein(CF)-loaded liposomes with poly-l-lysine (PLL) and liposome membrane permeability. The vesicles were prepared from synthetic or natural lipids. Interaction between PLL and the liposomes leads to the formation of complexes - either single PLL-coated vesicles or vesicle aggregates. Formation of the complexes is strongly affected by PLL/lipid molar ratio and the molecular mass of the PLL chains. Liposome permeability depends strongly on the lipid phase state - vesicles in the solid state retained the entrapped dye for a long time, but continuous CF release was registered for "fluid" vesicles. Crossing the transition temperature leads to intensive dye leakage because of the appearance of leaky interfacial domains between the coexisting solid and liquid phases and also because of a reversible change in the vesicle size upon the solid-liquid state phase transition. PLL coverage does not cause permeabilization of "solid" liposomes, but increases the permeability of "fluid" vesicles. At the same time, the results of differential scanning calorimetry and vesicle fusion suggest that PLL adsorption occurs exclusively on the vesicular surface and that the lipidic organization is not significantly disturbed. Moreover, PLL does not prevent lipid exchange between vesicles induced by temperature change. PMID:17169458

  15. Liposomes self-assembled from electrosprayed composite microparticles

    NASA Astrophysics Data System (ADS)

    Yu, Deng-Guang; Yang, Jun-He; Wang, Xia; Tian, Feng

    2012-03-01

    Composite microparticles, consisting of polyvinylpyrrolidone (PVP), naproxen (NAP) and lecithin (PC), have been successfully prepared using an electrospraying process and exploited as templates to manipulate molecular self-assembly for the synthesis of liposomes in situ. Field emission scanning electron microscope (FESEM) and transmission electron microscope (TEM) observations demonstrate that the microparticles have an average diameter of 960 ± 140 nm and a homogeneous structure. X-ray diffraction (XRD) patterns, differential scanning calorimetry (DSC) and attenuated total reflectance-Fourier transform infrared (ATR-FTIR) results verify that the building blocks NAP and PC are scattered in the polymer matrix in a molecular way owing to the very fast drying of the electrospraying process and the favorable secondary interactions among the components. FESEM, scanning probe microscope (SPM) and TEM observations demonstrate that the liposomes can be achieved through molecular self-assembly in situ when the microparticles contact water thanks to ‘like prefers like’ and by means of the confinement effect of the microparticles. The liposomes have an encapsulation rate of 91.3%, and 80.7% of the drug in the liposomes can be freed into the dissolution medium in a sustained way and by a diffusion mechanism over a period of 24 h. The developed strategy not only provides a new, facile, and effective method to assemble and organize molecules of multiple components into liposomes with electrosprayed microparticles as templates, but also opens a new avenue for nanofabrication in a step-by-step and controllable way.

  16. Development and Characterization of Liposomal Doxorubicin Hydrochloride with Palm Oil

    PubMed Central

    Sabeti, Bahareh; Noordin, Mohamed Ibrahim; Mohd, Shaharuddin; Hashim, Rosnani; Akbari Javar, Hamid

    2014-01-01

    The usage of natural products in pharmaceuticals has steadily seen improvements over the last decade, and this study focuses on the utilization of palm oil in formulating liposomal doxorubicin (Dox). The liposomal form of Dox generally minimizes toxicity and enhances target delivery actions. Taking into account the antiproliferative and antioxidant properties of palm oil, the aim of this study is to design and characterize a new liposomal Dox by replacing phosphatidylcholine with 5% and 10% palm oil content. Liposomes were formed using the freeze_thaw method, and Dox was loaded through pH gradient technique and characterized through in vitro and ex vivo terms. Based on TEM images, large lamellar vesicles (LUV) were formed, with sizes of 438 and 453?nm, having polydispersity index of 0.21 ± 0.8 and 0.22 ± 1.3 and zeta potentials of about ?31 and ?32?mV, respectively. In both formulations, the entrapment efficiency was about 99%, and whole Dox was released through 96 hours in PBS (pH = 7.4) at 37°C. Comparing cytotoxicity and cellular uptake of LUV with CaelyxR on MCF7 and MDA-MBA 231 breast cancer cell lines indicated suitable uptake and lower IC50 of the prepared liposomes. PMID:24795894

  17. Crosslinked Multilamellar Liposomes for Controlled Delivery of Anticancer Drugs

    PubMed Central

    Joo, Kye-Il; Xiao, Liang; Liu, Shuanglong; Liu, Yarong; Lee, Chi-Lin; Conti, Peter S.; Wong, Michael K.; Li, Zibo; Wang, Pin

    2014-01-01

    Liposomes constitute one of the most popular nanocarriers for the delivery of cancer therapeutics. However, since their potency is limited by incomplete drug release and inherent instability in the presence of serum components, their poor delivery occurs in certain circumstances. In this study, we address these shortcomings and demonstrate an alternative liposomal formulation, termed crosslinked multilamellar liposome (CML). With its properties of improved sustainable drug release kinetics and enhanced vesicle stability, CML can achieve controlled delivery of cancer therapeutics. CML stably encapsulated the anticancer drug doxorubicin (Dox) in the vesicle and exhibited a remarkably controlled rate of release compared to that of the unilamellar liposome (UL) with the same lipid composition or Doxil-like liposome (DLL). Our imaging study demonstrated that the CMLs were mainly internalized through a caveolin-dependent pathway and were further trafficked through the endosome-lysosome compartments. Furthermore, in vivo experiments showed that the CML-Dox formulation reduced systemic toxicity and significantly improved therapeutic activity in inhibiting tumor growth compared to that of UL-Dox or DLL-Dox. This drug packaging technology may therefore provide a new treatment option to better manage cancer and other diseases. PMID:23375392

  18. Targeted Liposomal Drug Delivery to Monocytes and Macrophages

    PubMed Central

    Kelly, Ciara; Jefferies, Caroline; Cryan, Sally-Ann

    2011-01-01

    As the role of monocytes and macrophages in a range of diseases is better understood, strategies to target these cell types are of growing importance both scientifically and therapeutically. As particulate carriers, liposomes naturally target cells of the mononuclear phagocytic system (MPS), particularly macrophages. Loading drugs into liposomes can therefore offer an efficient means of drug targeting to MPS cells. Physicochemical properties including size, charge and lipid composition can have a very significant effect on the efficiency with which liposomes target MPS cells. MPS cells express a range of receptors including scavenger receptors, integrins, mannose receptors and Fc-receptors that can be targeted by the addition of ligands to liposome surfaces. These ligands include peptides, antibodies and lectins and have the advantages of increasing target specificity and avoiding the need for cationic lipids to trigger intracellular delivery. The goal for targeting monocytes/macrophages using liposomes includes not only drug delivery but also potentially a role in cell ablation and cell activation for the treatment of conditions including cancer, atherosclerosis, HIV, and chronic inflammation. PMID:21512579

  19. Associating oligonucleotides with positively charged liposomes.

    PubMed

    Jurkiewicz, Piotr; Okruszek, Andrzej; Hof, Martin; Langner, Marek

    2003-01-01

    Oligonucleotides (ODNs) are short (up to 30 bases) fragments of single-stranded nucleic acids that are used as sequence specific regulators of gene expression and anti-sense based therapeutics. ODNs are frequently aggregated with particulates in order to improve their pharmacological characteristics. Complexes of ODN and lipid aggregates are among the most commonly mentioned in the literature. In order to control the formation and final properties of such aggregates, a detailed description of how ODN interacts with the lipid surface is needed. In this paper, we present the results of fluorescence measurements regarded an association of 20 base ODN, labelled with fluorescein, and a lipid surface containing various amount of positive charge. Unilamellar lipid vesicles were formed from egg phosphatidylcholine (PC) and various amounts of the cationic lipid 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP). It was found that about 20 mol% of DOTAP in the lipid bilayer suffices to obtain complete ODN association. This result was further confirmed via measurements performed by fluorescence correlation spectroscopy (FCS). These in turn showed that the diffusion time of labelled ODN in the presence of cationic liposomes decreases. Also, the particle number and count rate were reduced, concurring with conclusions derived from steady-state fluorescence spectroscopy results. PMID:12655360

  20. Anti-tumor activity of liposome encapsulated fluoroorotic acid as a single agent and in combination with liposome irinotecan.

    PubMed

    Riviere, Kareen; Kieler-Ferguson, Heidi M; Jerger, Katherine; Szoka, Francis C

    2011-08-10

    To test the hypothesis that co-delivery of synergistic drug combinations in the same liposome provides a better anti-tumor effect than the drugs administered in separate liposomes, fluoroorotic acid (FOA) alone and in combination with irinotecan (IRN) were encapsulated in liposomes and evaluated for their anti-tumor activity in the C26 colon carcinoma mouse model. A new chaotropic loading strategy was devised wherein FOA was dissolved in 7 M urea to increase its solubility. This enabled the passive loading of FOA into liposomes at a high concentration. IRN was remote loaded into liposomes that contained the ammonium salt of the multi-valent 1,2,3,4-butanetetracarboxylic acid with a greater than 90% efficiency and at a drug to lipid ratio of 0.2:1. When the two molecules were loaded into the same liposome, FOA was used to remote load IRN. Modulation of the drug/lipid ratio, temperature, and loading time allowed for consistent co-encapsulation of FOA+IRN at various molar ratios. The anti-tumor activity of L-FOA, L-IRN, L-FOA-IRN (5:1), and the L-FOA+L-IRN mixture (5:1) were examined in the C26 mouse model. The maximum tolerated dose of L-FOA was 10 mg/kg given weekly as compared to 100 mg/kg of the non-encapsulated FOA. Delivering two drugs in the same liposome provided a statistically better anti-tumor effect than delivering the drugs in separate liposomes at the same drug ratio. However, the synergistic activity of the 5:1 ratio of free drugs measured on C26 cells in vitro was not observed in the C26 tumor mouse model. These findings point out the challenges to the design of synergistic treatment protocols based upon results from in vitro cytotoxicity studies. L-FOA at 10 mg/kg as a single agent provided the best anti-tumor efficacy which supports previous suggestions that L-FOA has useful properties as a liposome dependent drug. PMID:21600250

  1. Pulsed-High Intensity Focused Ultrasound and Low Temperature ^ Sensitive Liposomes for Enhanced Targeted Drug Delivery and Antitumor Effect

    Microsoft Academic Search

    Sergio Dromi; Victor Frenkel; Alfred Luk; Monica Bur; Jason Poff; Jianwu Xie; Steven K. Libutti; King C. P. Li; Bradford J. Wood

    Purpose:To determine if pulsed-high intensity focused ultrasound (HIFU) could effectively serve as a source of hyperthermia with thermosensitive liposomes to enhance delivery and efficacy of doxorubicin in tumors. Experimental Design: Comparisons in vitro and in vivo were carried out between non ^ thermosensitive liposomes (NTSL) and low temperature ^ sensitive liposomes (LTSL). Liposomes were incubated in vitro over a range

  2. Apoptosis in phagocytotic cells of lymphoid tissues in rainbow trout ( Oncorhynchus mykiss ) following administration of clodronate liposomes

    Microsoft Academic Search

    A. Espenes; N. Van Rooijen; T. Landsverk

    1997-01-01

    Macrophage function has been studied in vivo by using liposomes that contain dichloromethylene-bisphosphonate (clodronate liposomes) to deplete macrophage subpopulations. In the present study, the effects of intravenously injected clodronate liposomes on the head kidney and spleen of the rainbow trout (Oncorhynchus mykiss) were studied from 1 h to 7 days after injection. The rapid trapping of liposomes in the splenic

  3. Predicting diffusive transport of cationic liposomes in 3-dimensional tumor spheroids.

    PubMed

    Wientjes, Michael G; Yeung, Bertrand Z; Lu, Ze; Wientjes, M Guillaume; Au, Jessie L S

    2014-10-28

    Nanotechnology is widely used in cancer research. Models that predict nanoparticle transport and delivery in tumors (including subcellular compartments) would be useful tools. This study tested the hypothesis that diffusive transport of cationic liposomes in 3-dimensional (3D) systems can be predicted based on liposome-cell biointerface parameters (binding, uptake, retention) and liposome diffusivity. Liposomes comprising different amounts of cationic and fusogenic lipids (10-30mol% DOTAP or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1-20mol% DOPE or 1,2-dioleoyl-3-trimethylammonium-propane, +25 to +44mV zeta potential) were studied. We (a) measured liposome-cell biointerface parameters in monolayer cultures, and (b) calculated effective diffusivity based on liposome size and spheroid composition. The resulting parameters were used to simulate the liposome concentration-depth profiles in 3D spheroids. The simulated results agreed with the experimental results for liposomes comprising 10-30mol% DOTAP and ?10mol% DOPE, but not for liposomes with higher DOPE content. For the latter, model modifications to account for time-dependent extracellular concentration decrease and liposome size increase did not improve the predictions. The difference among low- and high-DOPE liposomes suggests concentration-dependent DOPE properties in 3D systems that were not captured in monolayers. Taken together, our earlier and present studies indicate the diffusive transport of neutral, anionic and cationic nanoparticles (polystyrene beads and liposomes, 20-135nm diameter, -49 to +44mV) in 3D spheroids, with the exception of liposomes comprising >10mol% DOPE, can be predicted based on the nanoparticle-cell biointerface and nanoparticle diffusivity. Applying the model to low-DOPE liposomes showed that changes in surface charge affected the liposome localization in intratumoral subcompartments within spheroids. PMID:24995948

  4. Evaluation of polyethylene glycol coated liposomes labeled with Tc-99m as a blood pool agent

    SciTech Connect

    Phillips, W.T.; Klipper, R.; Goins, B. [Univ. of Texas Health Science Center, San Antonio, TX (United States)

    1994-05-01

    This investigation evaluated Tc-99m liposomes coated with polyethylene glycol (PEG) as a blood pool agent in comparison with Tc-99m liposomes carrying no surface charge (Neutral) and with Tc-99m autologous red cells. Liposomes (135 nm diameter) encapsulating glutathione were labeled with Tc-99m using the lipophilic chelator, HMPAO as previously described. Autologous red cells were labeled using an Ultratag kit. Labeling efficiencies averaged 66%, 52%, and 97% for the PEG liposomes. Neutral liposomes, and red cells, respectively. Rabbits (3-3.5 Kg) were injected IV via ear vein with 2.0 mls of PEG liposomes (2 mCi, 17 mg phospholipid/Kg body weight, n=5). Neutral liposomes (1.3 mCi, 17 mg phospholipid/Kg body weight, n=4), or red cells (2.6 mCi, n=2). Gamma camera images were acquired at 5,22, and 45 minutes, and 2,20,and 44 hours post-injection. Blood samples were obtained at each time point to determine clearance kinetics. Circulation half lives of both Tc-99m liposome formulations were longer than Tc-99m red cells (8 hrs), with the half life of PEG liposomes (35 hrs) 1.6 times longer than Neutral liposomes (22 hrs). In vivo stability of the Tc-99m label was excellent for the liposomes with only 3.5-4% bladder activity at 45 minutes compared to 12% bladder activity for the red cells. Excellent blood pool images were obtained for the PEG liposomes in the rabbit. Heart/liver ratios calculated from region of interest analysis of 45 minutes images were 1.9, 1.5, and 1.7 for PEG liposomes, Neutral liposomes and red cells. This study demonstrates the feasibility of using Tc-99m PEG liposomes to perform gated cardiac blood pool and rapid gastrointestinal bleeding studies.

  5. The organ distribution of liposome-encapsulated and free cobalt in rats. Liposomes decrease the cardiac uptake of the metal

    SciTech Connect

    Garcia, R.; Eskelson, C.D.; Chvapil, M. (Univ. of Arizona, Tucson (USA)); Szebeni, J. (Univ. of Arizona, Tucson (USA) National Institute of Food Hygiene and Nutrition, Budapest (Hungary))

    1989-01-01

    Rats were administered intravenously liposome-encapsulated or free cobalt, and the organ distribution of the metal was explored using Co{sup 57} tracer. Two hours after administration, the cobalt level in the heart was about 40 % of the control when given in sphingomyelin (SM)/cholesterol (CH) (1:1 mole ratio) liposomes. These vesicles also tended to decrease the uptake of cobalt in the kidney and the carcass, and to increase it in the spleen and the bones. Liposomes prepared from soybean phosphatidylcholine (SPC)/CH (1:1) had no effect on the uptake of cobalt in the heart, whereas increased its level in the spleen, liver and lung. The time-course of cobalt deposition in the organs displayed substantial variation with the different preparations. Most importantly, no buildup of cobalt level was observed in the heart when the metal was administered in SM/CH vesicles. While confirming known effects of liposomes on the organ-distribution of entrapped drugs, our findings suggest that administration of cobalt in SM/CH liposome-encapsulated form may result in decreased cardiotoxicity and thus increased safety of cobalt-treatment in some anemias.

  6. Topical liposome delivery of molecules to hair follicles in mice.

    PubMed

    Li, L; Hoffman, R M

    1997-02-01

    The hair cycle consisting of growing and resting phases, is subject to widespread disease such as androgenic alopecia or loss of pigment which are in need of effective, targeted therapeutics. In order to develop a hair-follicle delivery system we demonstrate here that phosphatidylcholine liposomes entrapping either the fluorescent dye calcein or the pigment melanin can deliver these molecules into the hair follicle and hair shafts of mice when applied topically. Liposomal delivery of these molecules is time dependent. Negligible amounts of delivered molecules enter the dermis, epidermis or blood stream thereby demonstrating the enrichment of follicle delivery. Naked calcein and melanin are trapped in the stratum corneum and are unable to enter the follicle. The potential of the hair-follicle liposome delivery system for therapeutic use for hair disease is discussed. PMID:9039973

  7. Liposomal extended-release bupivacaine for postsurgical analgesia

    PubMed Central

    Lambrechts, Mark; O’Brien, Michael J; Savoie, Felix H; You, Zongbing

    2013-01-01

    When physicians consider which analgesia to use postsurgery, the primary goal is to relieve pain with minimal adverse side effects. Bupivacaine, a commonly used analgesic, has been formulated into an aqueous suspension of multivesicular liposomes that provide long-lasting analgesia for up to 72 hours, while avoiding the adverse side effects of opioids. The increased efficacy of liposomal extended-release bupivacaine, compared to bupivacaine hydrochloride, has promoted its usage in a variety of surgeries including hemorrhoidectomy, bunionectomy, inguinal hernia repair, total knee arthroplasty, and augmentation mammoplasty. However, like other bupivacaine formulations, the liposomal extended-release bupivacaine does have some side effects. In this brief review, we provide an update of the current knowledge in the use of bupivacaine for postsurgical analgesia. PMID:24043932

  8. Recent Trends in Multifunctional Liposomal Nanocarriers for Enhanced Tumor Targeting

    PubMed Central

    Perche, Federico; Torchilin, Vladimir P.

    2013-01-01

    Liposomes are delivery systems that have been used to formulate a vast variety of therapeutic and imaging agents for the past several decades. They have significant advantages over their free forms in terms of pharmacokinetics, sensitivity for cancer diagnosis and therapeutic efficacy. The multifactorial nature of cancer and the complex physiology of the tumor microenvironment require the development of multifunctional nanocarriers. Multifunctional liposomal nanocarriers should combine long blood circulation to improve pharmacokinetics of the loaded agent and selective distribution to the tumor lesion relative to healthy tissues, remote-controlled or tumor stimuli-sensitive extravasation from blood at the tumor's vicinity, internalization motifs to move from tumor bounds and/or tumor intercellular space to the cytoplasm of cancer cells for effective tumor cell killing. This review will focus on current strategies used for cancer detection and therapy using liposomes with special attention to combination therapies. PMID:23533772

  9. Design of liposomal colloidal systems for ocular delivery of ciprofloxacin

    PubMed Central

    Taha, Ehab I.; El-Anazi, Magda H.; El-Bagory, Ibrahim M.; Bayomi, Mohsen A.

    2013-01-01

    Ophthalmic drug bioavailability is limited due to protective mechanisms of the eye which require the design of a system to enhance ocular delivery. In this study several liposomal formulations containing ciprofloxacin (CPX) have been formulated using reverse phase evaporation technique with final dispersion of pH 7.4. Different types of phospholipids including Phosphatidylcholine, Dipalmitoylphosphatidylcholine and Dimyristoyl-sn-glycero-3-phosphocholine were utilized. The effect of formulation factors such as type of phospholipid, cholesterol content, incorporation of positively charging inducing agents and ultrasonication on the properties of the liposomal vesicles was studied. Bioavailability of selected liposomal formulations in rabbit eye aqueous humor has been investigated and compared with that of commercially available CPX eye drops (Ciprocin®). Pharmacokinetic parameters including Cmax, Tmax, elimination rate constant, t1/2, MRT and AUC0–?, were determined. The investigated formulations showed more than three folds of improvement in CPX ocular bioavailability compared with the commercial product. PMID:25061409

  10. Transdermal delivery of butamben using elastic and conventional liposomes.

    PubMed

    Cereda, Cintia Maria Saia; Franz-Montan, Michelle; da Silva, Camila Morais Gonçalves; Casadei, Bruna Renata; Domingues, Cleyton Crepaldi; Tofoli, Giovana Radomille; de Araujo, Daniele Ribeiro; de Paula, Eneida

    2013-09-01

    Gel formulations containing the local anesthetic butamben (BTB) encapsulated in either conventional (BTBLUV) or elastic (BTBLUV-EL) liposomes were prepared and characterized, and then evaluated in terms of their skin permeability. Parameters measured included vesicle size and surface charge, BTB fluorescence anisotropy, encapsulation efficiency, partition coefficient and liposomal membrane organization. Encapsulation efficiencies and membrane/water partition coefficients were determined using a phase separation. The partition coefficients of the elastic and conventional formulations were 2025?±?234 and 1136?±?241, respectively. The sizes of the elastic and conventional liposomes did not change significantly (p?>?0.05) following incorporation of the anesthetic. As expected, the elastic liposomes presented order parameters that were lower than those of the conventional liposomes, as determined by electron paramagnetic resonance with a 5-stearic acid nitroxide probe incorporated into the bilayer. After 8?h, the fluxes into the receiving solution (µg/cm(2)/h) were 6.95?±?1.60 (10% BTB), 23.17?±?6.09 (10% BTBLUV) and 29.93?±?6.54 (10% BTBLUV-EL). The corresponding time lags (h) were 1.90?±?0.48, 1.23?±?0.28 and 1.57?±?0.38, respectively. The permeability coefficients (10(-3?)cm/h) were 1.02?±?0.23, 2.96?±?0.77 and 4.14?±?0.9, for 10% BTB, 10% BTBLUV and 10% BTBLUV-EL, respectively. The results demonstrate that anesthetic access through the skin can be considerably enhanced using liposomal gel formulations, compared to plain gel formulations. PMID:23697904

  11. Liposome functionalization with copper-free "click chemistry".

    PubMed

    Oude Blenke, Erik; Klaasse, Gruson; Merten, Hannes; Plückthun, Andreas; Mastrobattista, Enrico; Martin, Nathaniel I

    2015-03-28

    The modification of liposomal surfaces is of interest for many different applications and a variety of chemistries are available that makes this possible. A major disadvantage of commonly used coupling chemistries (e.g. maleimide-thiol coupling) is the limited control over the site of conjugation in cases where multiple reactive functionalities are present, leading to heterogeneous products and in some cases dysfunctional conjugates. Bioorthogonal coupling approaches such as the well-established copper-catalyzed azide-alkyne cycloaddition (CuAAC) "click" reaction are attractive alternatives as the reaction kinetics are favorable and azide-containing reagents are widely available. In the work described here, we prepared lipids containing a reactive cyclooctyne group and, after incorporation into liposomes, demonstrated successful conjugation of both a small molecule dye (5'-TAMRA-azide) as well as a larger azide-containing model protein based upon a designed ankyrin repeat protein (azido-DARPin). By applying the strain-promoted azido-alkyne cycloaddition (SPAAC) the use of Cu(I) as a catalyst is avoided, an important advantage considering the known deleterious effects associated with copper in cell and protein studies. We demonstrate complete control over the number of ligands coupled per liposome when using a small molecule azide with conjugation occurring at a reasonable reaction rate. By comparison, the conjugation of a larger azide-modified protein occurs more slowly, however the number of protein ligands coupled was found to be sufficient for liposome targeting to cells. Importantly, these results provide a strong proof of concept for the site-specific conjugation of protein ligands to liposomal surfaces via SPAAC. Unlike conventional approaches, this strategy provides for the homogeneous coupling of proteins bearing a single site-specific azide modification and eliminates the chance of forming dysfunctional ligands on the liposome. Furthermore, the absence of copper in the reaction process should also make this approach much more compatible with cell-based and in vivo applications. PMID:25626085

  12. Stabilization of aerosolized IFN-gamma by liposomes.

    PubMed

    Kanaoka, E; Nagata, S; Hirano, K

    1999-10-25

    Aerosolized IFN-gamma is very unstable. We have improved the stability of IFN-gamma in the jet nebulizer by adding small liposomes. Aerosolized IFN-gamma was recovered in PBS solution by bubbling and its concentration was determined. After nebulization for 30 min, aerosolized IFN-gamma was detected only 0.4+/-0.2% of the initial amount in the PBS solution and 3.1+/-0.7% in the reservoir. On the other hand, the addition of small liposomes (HSPC/DSPG=10/1 (molar ratio), 45+/-24 nm) in the nebulizer increased the stability of IFN-gamma, 27.2+/-4.7% of the initial amount in the PBS solution and 25.7+/-12.6% in the reservoir. The present study also examined the effects of composition and concentration of liposomes on the stabilization of aerosolized IFN-gamma. Liposome prepared from distearoyl phosphatidylcholine (DSPC) or hydrogenated soy phosphatidylcholine (HSPC) was very effective for stabilization of aerosolized IFN-gamma (DSPC/DPPG=10/1, HSPC/DSPG=10/1). HSPC/DSPG liposome was efficient at the concentration higher than 12.5 micromols/ml for the stabilization of 5x10(5) JRU/ml of IFN-gamma. In considering the mechanism of this stabilization, the results of gel filtration chromatography suggest that IFN-gamma is inactivated by polymerization or aggregation in nebulization, while the inactivation is suppressed by liposomes due to their adsorption to IFN-gamma. PMID:10518672

  13. Selective killing of T lymphocytes by phototoxic liposomes.

    PubMed Central

    Yemul, S; Berger, C; Estabrook, A; Suarez, S; Edelson, R; Bayley, H

    1987-01-01

    Two-fold specificity in drug delivery obtained through the localized activation of drugs by physical means and the attachment of drugs to proteins that bind to target cells might be used for highly selective cancer chemotherapy or for immunosuppression. Toward this end, a monoclonal antibody against an antigen on the surface of T lymphocytes was covalently attached to liposomes containing a phototoxic drug, pyrene, bound to the lipid bilayer. When unfractionated peripheral blood lymphocytes, or B- and T-cell lines, were irradiated after treatment with these liposomes, T cells were killed while B cells were spared, demonstrating the validity of the approach in a simple in vitro assay. PMID:3491992

  14. Hyaluronic acid derivative-coated nanohybrid liposomes for cancer imaging and drug delivery.

    PubMed

    Park, Ju-Hwan; Cho, Hyun-Jong; Yoon, Hong Yeol; Yoon, In-Soo; Ko, Seung-Hak; Shim, Jae-Seong; Cho, Jee-Hyun; Park, Jae Hyung; Kim, Kwangmeyung; Kwon, Ick Chan; Kim, Dae-Duk

    2014-01-28

    Nanohybrid liposomes coated with amphiphilic hyaluronic acid-ceramide (HACE) was fabricated for targeted delivery of anticancer drug and in vivo cancer imaging. Nanohybrid liposomes including doxorubicin (DOX) and Magnevist, a contrast agent for magnetic resonance (MR) imaging, with 120-130nm mean diameter and a narrow size distribution were developed. DOX release from the developed formulation was improved at acidic pH (pH5.5 and 6.8) versus physiological pH (pH7.4). Cytotoxicity induced by the blank plain liposome was reduced by coating the outer surface of the nanohybrid liposome with HACE. Cellular uptake of DOX from the nanohybrid liposome was enhanced by HA and CD44 receptor interaction, versus the plain liposome. In vivo contrast-enhancing effects revealed that the nanohybrid liposome can be used as a tumor targeting MR imaging probe for cancer diagnosis. In a pharmacokinetic study in rats, in vivo clearance of DOX was decreased in the order DOX solution, plain liposome (F2), and nanohybrid liposome (F3), indicating prolonged circulation of the drug in the blood stream and improved therapeutic efficacy of the nanohybrid liposome (F3). Based on these findings, the nanohybrid liposomal system may be a useful candidate for real-time cancer diagnosis and therapy. PMID:24280260

  15. Liposome Surface Functionalization Based on Different Anchoring Lipids via Staudinger Ligation

    PubMed Central

    Vabbilisetty, Pratima; Sun, Xue-Long

    2014-01-01

    Liposome surface functionalization facilitates enormous potential applications of liposomes, such as enhanced stability, bioactive liposome conjugates, and targeted drug, gene and image agent delivery. Anchoring lipids are needed for grafting ligands of interest and play important roles in ligands grafting density, liposome stability, and liposome chemical and physical characteristics as well. In this report, glyco-functionalized liposome systems based on two kinds of anchoring lipid, phosphatidylethonalamine (PE) and cholesterol (Chol) were prepared by post chemically selective functionalization via Staudinger ligation. The size and stability of the liposomes were confirmed by dynamic light scattering (DLS). Particularly, the impact of anchor lipids on the stability of glyco-functionalized liposomes was investigated by comparing two different anchor lipids, namely Chol-PEG2000-TP and DSPE-PEG2000-TP. In addition, the encapsulation and releasing capacity of the glycosylated liposome based on the two anchoring lipids were investigated by entrapping 5, 6-carboxyfluorescein (CF) dye and monitoring the fluorescence leakage, respectively. Furthermore, the density and accessibility of grafted carbohydrate residues on the liposome surface were evaluated for the two anchoring lipids-derived liposomes with lectin binding, respectively. PMID:24413731

  16. Fluorescent cell-traceable dexamethasone-loaded liposomes for the treatment of inflammatory liver diseases.

    PubMed

    Bartneck, Matthias; Scheyda, Katharina M; Warzecha, Klaudia T; Rizzo, Larissa Y; Hittatiya, Kanishka; Luedde, Tom; Storm, Gert; Trautwein, Christian; Lammers, Twan; Tacke, Frank

    2015-01-01

    Liposomes are routinely used carrier materials for delivering drug molecules to pathological sites. Besides in tumors and inflammatory sites, liposomes also strongly accumulate in liver and spleen. The potential of using liposomes to treat acute and chronic liver disorders, however, has not yet been evaluated. We here explored the therapeutic potential of dexamethasone (Dex)-loaded liposomes for inflammatory liver diseases, using experimental models of acute and chronic liver injury in mice. Fluorescently labeled liposomes predominantly accumulated in hepatic phagocytes, but also in T cells. Importantly, Dex-loaded liposomes reduced T cells in blood and liver, more effectively than free Dex, and endorsed the anti-inflammatory polarization of hepatic macrophages. In experimental chronic liver damage, Dex-loaded liposomes significantly reduced liver injury and liver fibrosis. In immune-mediated acute hepatitis Dex-loaded liposomes, but not free Dex, significantly reduced disease severity. T cells, not macrophages, were significantly depleted by Dex liposomes in liver disease models in vivo, as further supported by mechanistic cell death in vitro studies. Our data indicate that Dex liposomes may be an interesting treatment option for liver diseases, in particular for immune-mediated hepatitis. The depletion of T cells might represent the major mechanism of action of Dex liposomes, rather than their macrophage-polarizing activities. PMID:25453965

  17. Effects of complexation between liposome and poly(malic acid) on aggregation and leakage behaviour.

    PubMed

    Osanai, S; Nakamura, K

    2000-05-01

    The design and development of novel pH-sensitive liposomes were investigated to improve the release of liposome-encapsulated chemicals. Stable liposomes comprising of L-alpha-dipalmitoylphosphatidylcholine (DPPC) and poly(carboxylic acid) were prepared and characterized. Poly(malic acid) (PMLA) was chosen as a fusogen, because of its excellent biodegradability in physiological regions. Octyl groups introduced in the poly(malic acid) worked as anchors at the surface of the liposomes and made a remarkable contribution to complexing. The interaction between the liposomes and the polyacids was studied in terms of the change in size of the liposomes. The influences of molecular weight and amounts of polymer upon their characteristics, especially fusion, were discussed. The influences of pH change with respect to the association behavior of the liposomes such as aggregation and fusion were estimated by the particle size of the liposomes, turbidimetry of the solution and resonance energy transfer assay. From the results of these studies, it was shown that more tightly complexed liposomes aggregated and fused more positively with increasing acidity of the solution. The leakage of calcein entrapped in the inner aqueous phase of the liposomes increased with decreasing pH. The effect of pH on the liposome aggregation in a solution qualitatively paralleled that found in the leakage behavior. PMID:10735463

  18. Ambient induced degradation and chemically activated recovery in copper phthalocyanine thin film transistors

    E-print Network

    Kummel, Andrew C.

    Ambient induced degradation and chemically activated recovery in copper phthalocyanine thin film was unattainable in thick devices subject to ambient aging; however ultrathin devices were significantly less were characterized in ambient air, clean dry air, clean humidified air, and NOx environments to isolate

  19. Hybrid solar cells based on porous Si and copper phthalocyanine derivatives

    E-print Network

    Euler, William B.

    Hybrid solar cells based on porous Si and copper phthalocyanine derivatives I. A. Levitskya 25 October 2004) We demonstrate a solar cell based on n-type nanoporous Si (PSi) filled with copper,5 liquid crystals,6 and car- bon nanotubes7,8 in combination with various heterojunctions (blended, flat

  20. Water-soluble cationic gallium(III) and indium(III) phthalocyanines for photodynamic therapy.

    PubMed

    Durmu?, Mahmut; Ahsen, Vefa

    2010-03-01

    The new tetra-non-peripheral and peripheral 2-mercaptopyridine substituted gallium(III) and indium(III) phthalocyanine complexes (np-GaPc, p-GaPc, np-InPc and p-InPc) and their quaternized derivatives (Qnp-GaPc, Qp-GaPc, Qnp-InPc and Qp-InPc) have been synthesized and characterized. The quaternized complexes show excellent solubility in water, which makes them potential photosensitizer for use in photodynamic therapy (PDT) of cancer. Photophysical and photochemical properties of these phthalocyanines were investigated. General trends are described for quantum yields of photodegradation, fluorescence and fluorescence lifetimes as well as singlet oxygen quantum yields of these compounds. In this study, the effects of the position of the substituents, the nature of the metal ion and quaternization of the substituents on the photophysical and photochemical parameters of the gallium(III) and indium(III) phthalocyanines are also reported. This study also presented the ionic gallium(III) and indium(III) phthalocyanines strongly bind to bovine serum albumin (BSA). PMID:20083308

  1. A glutathione-activated phthalocyanine-based photosensitizer for photodynamic therapy.

    PubMed

    He, Hui; Lo, Pui-Chi; Ng, Dennis K P

    2014-05-19

    A zinc(II) phthalocyanine substituted with a 2,4-dinitrobenzenesulfonate group has been prepared. Its fluorescence emission and reactive oxygen species generation can be greatly enhanced by glutathione in phosphate-buffered saline and inside MCF-7 cells. This compound thus functions as a highly efficient molecular-based activatable photosensitizer. PMID:24737172

  2. Atomic Imaging of the Irreversible Sensing Mechanism of NO2 Adsorption on Copper Phthalocyanine

    E-print Network

    Kummel, Andrew C.

    92093, California, United States *S Supporting Information ABSTRACT: Ambient NO2 adsorption onto copper(II) phthalocyanine (CuPc) monolayers is observed using ultrahigh vacuum (UHV) scanning tunneling microscopy (STM, while the inner carbon atoms have an electron density lower than that of the outer aromatic carbon atoms

  3. Interaction of cationic phthalocyanines with DNA. Importance of the structure of the substituents.

    PubMed

    López Zeballos, N C; Gauna, G A; García Vior, M C; Awruch, J; Dicelio, L E

    2014-07-01

    The interaction of novel zinc (II) cationic phthalocyanines with CT-DNA was studied using absorption and fluorescence spectroscopy, as well as thermal denaturation profiles. Results showed an electrostatic interaction between the phthalocyanines and CT-DNA. The properties of these phthalocyanines were compared taking the structure of the macrocycle peripheral substituents into account. 2,9(10),16(17),23(24)-tetrakis[(N-butyl-N-methylammonium)ethylsulfanyl]phthalocyaninatozinc(II) tetraiodide (Pc6) had a greater affinity for the CT-DNA helix than its bioisoster 2,9(10),16(17),23(24)-tetrakis[(N-dibutyl-N-methylammonium)ethoxy]phthalocyaninatozinc(II) tetraiodide (Pc7). 2,9(10),16(17),23(24)-tetrakis[(2-trimethylammonium)ethyl-sulfanyl]phthalocyaninatozinc(II) tetraiodide (Pc13) also carried a sulfur atom like Pc6, but linked to bulky substituents such as trimethylammonium groups. The planar aromatic region of the cationic phthalocyanines in this study appears to be unable to facilitate their intercalation with CT-DNA. PMID:24838031

  4. Metabolism of the phthalocyanine textile dye remazol turquoise blue by Phanerochaete chrysosporium

    Microsoft Academic Search

    A Conneely; W. F Smyth; G McMullan

    1999-01-01

    The ability of a strain of Phanerochaete chrysosporium to decolourise the commercially important copper-phthalocyanine dye Remazol turquoise blue was investigated. The fungus was found to completely decolourise the dye at a concentration of 200 mg l?1 within 7 days. High performance liquid chromatography (HPLC) and polarographic analysis of culture supernatants indicated that degradation of the dye structure was occurring with

  5. Metal (2) 4,4',4",4'" phthalocyanine tetraamines as curing agents for epoxy resins

    NASA Technical Reports Server (NTRS)

    Achar, B. N.; Fohlen, G. M.; Parker, J. A. (inventors)

    1985-01-01

    Metal, preferably divalent copper, cobalt or nickel, phthalocyanine tetraamines are used as curing agents for epoxides. The resulting copolymers have high thermal and chemical resistance and are homogeneous. They are useful as binders for laminates, e.g., graphite cloth laminate.

  6. Phthalocyanine Derivatives Possessing 2-(Morpholin-4-yl)ethoxy Groups As Potential Agents for Photodynamic Therapy.

    PubMed

    Kucinska, Malgorzata; Skupin-Mrugalska, Paulina; Szczolko, Wojciech; Sobotta, Lukasz; Sciepura, Mateusz; Tykarska, Ewa; Wierzchowski, Marcin; Teubert, Anna; Fedoruk-Wyszomirska, Agnieszka; Wyszko, Eliza; Gdaniec, Maria; Kaczmarek, Mariusz; Goslinski, Tomasz; Mielcarek, Jadwiga; Murias, Marek

    2015-03-12

    Three 2-(morpholin-4-yl)ethoxy substituted phthalocyanines were synthesized and characterized. Phthalocyanine derivatives revealed moderate to high quantum yields of singlet oxygen production depending on the solvent applied (e.g., in DMF ranging from 0.25 to 0.53). Their photosensitizing potential for photodynamic therapy was investigated in an in vitro model using cancer cell lines. Biological test results were found particularly encouraging for the zinc(II) phthalocyanine derivative possessing two 2-(morpholin-4-yl)ethoxy substituents in nonperipheral positions. Cells irradiated for 20 min at 2 mW/cm(2) revealed the lowest IC50 value at 0.25 ?M for prostate cell line (PC3), whereas 1.47 ?M was observed for human malignant melanoma (A375) cells. The cytotoxic activity in nonirradiated cells of novel phthalocyanine was found to be very low. Moreover, the cellular uptake, localization, cell cycle, apoptosis through an ELISA assay, and immunochemistry method were investigated in LNCaP cells. Our results showed that the tested photosensitizer possesses very interesting biological activity, depending on experimental conditions. PMID:25700089

  7. WASTES FROM MANUFACTURE OF DYES AND PIGMENTS. VOLUME 8. PHTHALOCYANINE DYES AND PIGMENTS

    EPA Science Inventory

    A preliminary study of the manufacture of phthalocyanine dyes and pigments was conducted to determine if process waste streams might contain hazardous material. The study first identifies the dyes and pigments that belong to this segment of the industry, the amounts produced, and...

  8. Fabrication and characterization of organic solar cells using metal complex of phthalocyanines

    NASA Astrophysics Data System (ADS)

    Kida, Tomoyasu; Suzuki, Atsushi; Akiyama, Tsuyoshi; Oku, Takeo

    2015-02-01

    Fabrication and characterization of organic solar cells using shuttle-cock-type phthalocyanines were carried out. Photovoltaic properties of the solar cells with inverted structures were investigated by current density-voltage characteristics. Effects of phase transition between H and J aggregates on the photovoltaic and optical properties were investigated. The photovoltaic mechanisms, energy levels and band gap of active layers were discussed.

  9. Spectroscopic fingerprints of work-function-controlled phthalocyanine charging on metal surfaces.

    PubMed

    Borghetti, Patrizia; El-Sayed, Afaf; Goiri, Elizabeth; Rogero, Celia; Lobo-Checa, Jorge; Floreano, Luca; Ortega, Jose Enrique; de Oteyza, Dimas G

    2014-12-23

    The electronic character of a ?-conjugated molecular overlayer on a metal surface can change from semiconducting to metallic, depending on how molecular orbitals arrange with respect to the electrode's Fermi level. Molecular level alignment is thus a key property that strongly influences the performance of organic-based devices. In this work, we report how the electronic level alignment of copper phthalocyanines on metal surfaces can be tailored by controlling the substrate work function. We even show the way to finely tune it for one fixed phthalocyanine-metal combination without the need to intercalate substrate-functionalizing buffer layers. Instead, the work function is trimmed by appropriate design of the phthalocyanine's supramolecular environment, such that charge transfer into empty molecular levels can be triggered across the metal-organic interface. These intriguing observations are the outcome of a powerful combination of surface-sensitive electron spectroscopies, which further reveal a number of characteristic spectroscopic fingerprints of a lifted LUMO degeneracy associated with the partial phthalocyanine charging. PMID:25426520

  10. Incorporation of phthalocyanines by cationic and anionic clays via ion exchange and direct synthesis

    SciTech Connect

    Carrado, K.A.; Botto, R.E.; Winans, R.E. (Argonne National Laboratory, IL (United States)); Forman, J.E. (CalTech, Pasadena, CA (United States))

    1993-04-01

    Phthalocyanines (Pc) and metallophthalocyanines were incorporated into the galleries of anionic and cationic clays via ion exchange and in situ crystallization of the synthetic clay layers. Intercalation compounds between the layered magnesium silicate clay hectorite and cationic phthalocyanines were directly prepared by refluxing for 2 days aqueous solutions of silica sol, magnesium hydroxide, lithium flouride, and either alcian blue dyes (Cu(II)Pc) or 15-crown-5 tetra-substituted phthalocyanine (15C5Pc). The CuPc dyes are tetrapositively charged through peripheral quaternary ammonium groups, whereas the 15C5Pc is electrically neutral. Anionic clays prepared by hydrolysis of mixed solutions of aluminum nitrate, magnesium nitrate, and copper(II) phthalocyaninetetrasulfonic acid, tetrasodium salt (CuPcTs) in sodium hydroxide resulted in crystallization of an intercalation compound between a layered double hydroxide (LDH) and this anionic Pc. The material prepared by ion exchange of CuPcTs into a wet, freshly prepared LDH was superior in crystallinity. The phthalocyanines are oriented parallel to cationic hectorite clay layers (gallery heights 4.5-6.5[angstrom]) and perpendicular to anionic layered double hydroxide clay layers (gallery height 18,2[angstrom]) in correlation with their hosts' respective layer charge densities. 32 refs., 4 figs., 2 tabs.

  11. THE JOURNAL OF CHEMICAL PHYSICS 133, 214703 (2010) Copper-phthalocyanine based metalorganic interfaces: The effect

    E-print Network

    Ortega, Enrique

    THE JOURNAL OF CHEMICAL PHYSICS 133, 214703 (2010) Copper-phthalocyanine based metal, Universidad del Pais Vasco, Pza. Oñate 2, 20018 San Sebastián, Spain 4 Nano-Bio Spectroscopy Group and ETSF; accepted 12 October 2010; published online 3 December 2010) Metal­organic interfaces based on copper

  12. Iron–Phthalocyanine Immobilized on Activated Carbon Black: A Selective Catalyst for Alkane Oxidation

    Microsoft Academic Search

    Rudy F. Parton; Patricia E. Neys; Peter A. Jacobs; Rosario C. Sosa; Paul G. Rouxhet

    1996-01-01

    Carbon black is tested as a support for iron–phthalocyanine within the frame of the oxidation of hydrocarbons witht-butylhydroperoxide as oxygen donor. The increased hydrophobicity of the carrier surface, with respect to zeolite Y, changes the adsorption behavior of the components in the reaction mixture towards the alkane. A major improvement in the oxidation conversion and efficiency of cyclohexane has been

  13. The photodynamic antibacterial effects of silicon phthalocyanine (pc) 4.

    PubMed

    Dimaano, Matthew L; Rozario, Chantal; Nerandzic, Michelle M; Donskey, Curtis J; Lam, Minh; Baron, Elma D

    2015-01-01

    The emergence of antibiotic-resistant strains in facultative anaerobic Gram-positive coccal bacteria, such as methicillin-resistant Staphylococcus aureus (MRSA), is a global health issue. Typically, MRSA strains are found associated with institutions like hospitals but recent data suggest that they are becoming more prevalent in community-acquired infections. It is thought that the incidence and prevalence of bacterial infections will continue to increase as (a) more frequent use of broad-spectrum antibiotics and immunosuppressive medications; (b) increased number of invasive medical procedures; and (c) higher incidence of neutropenia and HIV infections. Therefore, more optimal treatments, such as photodynamic therapy (PDT), are warranted. PDT requires the interaction of light, a photosensitizing agent, and molecular oxygen to induce cytotoxic effects. In this study, we investigated the efficacy and characterized the mechanism of cytotoxicity induced by photodynamic therapy sensitized by silicon phthalocyanine (Pc) 4 on (a) methicillin-sensitive Staphylococcus aureus (MSSA) (ATCC 25923); (b) community acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) (ATCC 43300); and (c) hospital acquired methicillin-resistant Staphylococcus aureus (HA-MRSA) (PFGE type 300). Our data include confocal image analysis, which confirmed that Pc 4 is taken up by all S. aureus strains, and viable cell recovery assay, which showed that concentrations as low as 1.0 ?M Pc 4 incubated for 3 h at 37 °C followed by light at 2.0 J/cm2 can reduce cell survival by 2-5 logs. These results are encouraging, but before PDT can be utilized as an alternative treatment for eradicating resistant strains, we must first characterize the mechanism of cell death that Pc 4-based PDT employs in eliminating these pathogens. PMID:25856680

  14. Liposomal amphotericin B, AmBisome.

    PubMed

    Hay, R J

    1994-05-01

    The unilamellar liposomal formulation of amphotericin B, AmBisome, is composed of hydrogenated soy phosphatidylcholine, distearoyl phosphatidylglycerol and cholesterol. Early studies of its efficacy in an open design showed that remissions could be induced in candidosis and aspergillosis and that doses of up to 5 mg/kg could be used. Adverse events were infrequent, with the main abnormality seen being hypokalaemia in about 18% of patients. Subsequent developments have extended this work. AmBisome has been used in two open studies of patients with invasive aspergillosis; in one of these remission was achieved in 77% of 17 patients with confirmed infection who had failed to respond to conventional amphotericin B. In AIDS patients with cryptococcosis AmBisome given for 6 weeks at 3 mg/kg daily produced mycological remission of meningitis in 67%. Other infections treated with the drug include zygomycete (mucormycosis) and Fusarium infections. AmBisome has also been used as preventative therapy in bone marrow transplant recipients and was found to reduce fungal colonisation rates. There were fewer systemic fungal infections in the treated versus placebo groups although this did not achieve statistical significance. Lack of renal and liver toxicity or anaemia has been confirmed in subsequent studies. In addition febrile reactions to the AmBisome are rare. The drug has also been used effectively in children, including infants, with systemic fungal infections. In visceral leishmaniasis patients, including HIV positive individuals, remissions have been obtained using drug regimens of 1-2 mg/kg of 2.1 days and 3 mg/kg for 10 days. PMID:8077689

  15. Formulation, antileukemia mechanism, pharmacokinetics, and biodistribution of a novel liposomal emodin.

    PubMed

    Wang, Tiechuang; Yin, Xiaodong; Lu, Yaping; Shan, Weiguang; Xiong, Subin

    2012-01-01

    Emodin is a multifunctional Chinese traditional medicine with poor water solubility. D-?-tocopheryl polyethylene glycol 1000 succinate (TPGS) is a pegylated vitamin E derivate. In this study, a novel liposomal-emodin-conjugating TPGS was formulated and compared with methoxypolyethyleneglycol 2000-derivatized distearoyl-phosphatidylethanolamine (mPEG2000-DSPE) liposomal emodin. TPGS improved the encapsulation efficiency and stability of emodin egg phosphatidylcholine/cholesterol liposomes. A high encapsulation efficiency of 95.2% ± 3.0%, particle size of 121.1 ± 44.9 nm, spherical ultrastructure, and sustained in vitro release of TPGS liposomal emodin were observed; these were similar to mPEG2000-DSPE liposomes. Only the zeta potential of -13.1 ± 2.7 mV was significantly different to that for mPEG2000-DSPE liposomes. Compared to mPEG2000-DSPE liposomes, TPGS liposomes improved the cytotoxicity of emodin on leukemia cells by regulating the protein levels of myeloid cell leukemia 1 (Mcl-1), B-cell lymphoma-2 (Bcl-2) and Bcl-2-associated X protein, which was further enhanced by transferrin. TPGS liposomes prolonged the circulation time of emodin in the blood, with the area under the concentration-time curve (AUC) 1.7 times larger than for free emodin and 0.91 times larger than for mPEG2000-DSPE liposomes. In addition, TPGS liposomes showed higher AUC for emodin in the lung and kidney than for mPEG2000-DSPE liposomes, and both liposomes elevated the amount of emodin in the heart. Overall, TPGS is a pegylated agent that could potentially be used to compose a stable liposomal emodin with enhanced therapeutics. PMID:22661889

  16. Liposomes as vaccine delivery systems: a review of the recent advances

    PubMed Central

    2014-01-01

    Liposomes and liposome-derived nanovesicles such as archaeosomes and virosomes have become important carrier systems in vaccine development and the interest for liposome-based vaccines has markedly increased. A key advantage of liposomes, archaeosomes and virosomes in general, and liposome-based vaccine delivery systems in particular, is their versatility and plasticity. Liposome composition and preparation can be chosen to achieve desired features such as selection of lipid, charge, size, size distribution, entrapment and location of antigens or adjuvants. Depending on the chemical properties, water-soluble antigens (proteins, peptides, nucleic acids, carbohydrates, haptens) are entrapped within the aqueous inner space of liposomes, whereas lipophilic compounds (lipopeptides, antigens, adjuvants, linker molecules) are intercalated into the lipid bilayer and antigens or adjuvants can be attached to the liposome surface either by adsorption or stable chemical linking. Coformulations containing different types of antigens or adjuvants can be combined with the parameters mentioned to tailor liposomal vaccines for individual applications. Special emphasis is given in this review to cationic adjuvant liposome vaccine formulations. Examples of vaccines made with CAF01, an adjuvant composed of the synthetic immune-stimulating mycobacterial cordfactor glycolipid trehalose dibehenate as immunomodulator and the cationic membrane forming molecule dimethyl dioctadecylammonium are presented. Other vaccines such as cationic liposome–DNA complexes (CLDCs) and other adjuvants like muramyl dipeptide, monophosphoryl lipid A and listeriolysin O are mentioned as well. The field of liposomes and liposome-based vaccines is vast. Therefore, this review concentrates on recent and relevant studies emphasizing current reports dealing with the most studied antigens and adjuvants, and pertinent examples of vaccines. Studies on liposome-based veterinary vaccines and experimental therapeutic cancer vaccines are also summarized. PMID:25364509

  17. Comparison of polymerically stabilized PEG-grafted liposomes and physically adsorbed carboxymethylchitin and carboxymethyl\\/glycolchitin liposomes for biological applications

    Microsoft Academic Search

    M Mobed; T. M. S Chang

    1998-01-01

    The stabilities of two types of polymerically stabilized liposomes consisting of PEG-grafted (DSPC:CHOL:DSPE-PEG1900, 5:4:1) and physically adsorbed carboxymethylchitin (CMC) and carboxymethyl\\/glycolchitin (CO) are compared. The polyelectrolyte is adsorbed on positive (DSPC:CHOL:DMTAP, 5:4:1) and neutral (DSPC:CHOL, 1:1) liposomes at different molecular weights (Mw). In PBS buffer (I=154mm, pH=7.4) the theoretical stability ratios (W) calculated using the classical DLVO Theory, indicate that

  18. Improved Performance of Phthalocyanine Derivative Field-Effect Transistors by Inserting a Para-Quarterphenyl as the Inducing Layer

    NASA Astrophysics Data System (ADS)

    Dong, Ni; Wu, Xiao-Ming; Dang, Huan-Qin; Liu, Dong-Yue; Zhang, Qiang; Wei, Jun; Yin, Shou-Gen

    2014-05-01

    We investigate the phthalocyanine derivative organic field-effect transistors (OFETs) using a novel para - quaterphenyl (p-4p) as the inducing layer. Compared to the devices without the p-4p inducing layer, the performances of p-type (copper phthalocyanine) and n-type (fluorinated copper phthalocyanine) OFETs with optimized thickness of p-4p thin films are greatly enhanced. Both the field-effect mobility and the on/off ratio of the two-type devices are improved by one order of magnitude compared to those of the control devices. This remarkable improvement is attributed to the introduction of p-4p, which can form a highly oriented and continuous phthalocyanine derivative film with the molecular ?-? stack direction parallel to the substrate.

  19. Features of the spectral dependences of transmittance of organic semiconductors based on tert-butyl substituted lutetium phthalocyanine molecules

    SciTech Connect

    Belogorokhov, I. A., E-mail: jugqwerty@mail.ru [State Research and Project Institute of Rare-Metal Industry GIREDMET (Russian Federation); Tikhonov, E. V. [Moscow State University (Russian Federation); Dronov, M. A. [Russian Academy of Sciences, Prokhorov General Physics Institute (Russian Federation); Belogorokhova, L. I. [Moscow State University (Russian Federation); Ryabchikov, Yu. V. [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation); Tomilova, L. G.; Khokhlov, D. R. [Moscow State University (Russian Federation)

    2011-11-15

    Vibronic properties of organic semiconductors based on tert-butyl substituted phthalocyanine lutetium diphthalocyanine molecules are studied by IR and Raman spectroscopy. It is shown that substitution of several carbon atoms in initial phthalocyanine (Pc) ligands with {sup 13}C isotope atoms causes a spectral shift in the main absorption lines attributed to benzene, isoindol, and peripheral C-H groups. A comparison of spectral characteristics showed that the shift can vary from 3 to 1 cm{sup -1}.

  20. Theoretical study of phthalocyanine–fullerene complex for a high efficiency photovoltaic device using ab initio electronic structure calculation

    Microsoft Academic Search

    Hiroshi Mizuseki; Nobuaki Igarashi; Rodion V. Belosludov; Amir A. Farajian; Yoshiyuki Kawazoe

    2003-01-01

    Many fullerene-based supramolecules have been proposed as potential organic photovoltaic devices, with their electrochemical and photo-electrochemical properties measured under light illumination. Phthalocyanine possesses good electron-donating properties due to its large easily ionised ?-electron system, whereas fullerene is good ?-electron acceptor which can be connected with other organic molecules. A phthalocyanine–fullerene-based supramolecular system is therefore a potential material candidate for a

  1. Improved syntheses of high hole mobility phthalocyanines: A case of steric assistance in the cyclo-oligomerisation of phthalonitriles

    PubMed Central

    Tate, Daniel J; Anémian, Rémi; Nanan, Suwat; Warriner, Stuart L; Whitaker, and Benjamin J

    2012-01-01

    Summary It has been shown that the base-initiated cyclo-oligomerisation of phthalonitriles is favoured by bulky ?-substituents making it possible to obtain the metal-free phthalocyanine directly and in high yield. The phthalocyanine with eight ?-isoheptyl substituents gives a high time-of-flight hole mobility of 0.14 cm2·V?1·s?1 within the temperature range of the columnar hexagonal phase, that is 169–189 °C. PMID:22423280

  2. Hybrid organic\\/inorganic films of conducting polymers modified with phthalocyanines. II. EIS studies and film characterization

    Microsoft Academic Search

    Ahmed Galal; Soher A. Darwish; Rasha A. Ahmed

    2007-01-01

    Conducting polymers were modified with Cu-phthalocyanine or Co-phthalocyanine embedded in a sol–gel matrix. The resulting\\u000a films were characterized using electrochemical impedance spectroscopy, Fourier transform infrared spectroscopy and scanning\\u000a electron microscopy. Electrochemical impedance spectroscopy data showed that the application of the sol–gel layer to the conductive\\u000a polymer caused a noticeable increase in the impedance of the film across the frequency ranges

  3. Electronic structure differences between H2-, Fe-, Co-, and Cu-phthalocyanine highly oriented thin films observed using NEXAFS spectroscopy

    NASA Astrophysics Data System (ADS)

    Willey, T. M.; Bagge-Hansen, M.; Lee, J. R. I.; Call, R.; Landt, L.; van Buuren, T.; Colesniuc, C.; Monton, C.; Valmianski, I.; Schuller, Ivan K.

    2013-07-01

    Phthalocyanines, a class of macrocyclic, square planar molecules, are extensively studied as semiconductor materials for chemical sensors, dye-sensitized solar cells, and other applications. In this study, we use angular dependent near-edge x-ray absorption fine structure (NEXAFS) spectroscopy as a quantitative probe of the orientation and electronic structure of H2-, Fe-, Co-, and Cu-phthalocyanine molecular thin films. NEXAFS measurements at both the carbon and nitrogen K-edges reveal that phthalocyanine films deposited on sapphire have upright molecular orientations, while films up to 50 nm thick deposited on gold substrates contain prostrate molecules. Although great similarity is observed in the carbon and nitrogen K-edge NEXAFS spectra recorded for the films composed of prostrate molecules, the H2-phthalocyanine exhibits the cleanest angular dependence due to its purely out-of-plane ?* resonances at the absorption onset. In contrast, organometallic-phthalocyanine nitrogen K-edges have a small in-plane resonance superimposed on this ?* region that is due to a transition into molecular orbitals interacting with the 3dx2-y2 empty state. NEXAFS spectra recorded at the metal L-edges for the prostrate films reveal dramatic variations in the angular dependence of specific resonances for the Cu-phthalocyanines compared with the Fe-, and Co-phthalocyanines. The Cu L3,2 edge exhibits a strong in-plane resonance, attributed to its b1g empty state with dx2-y2 character at the Cu center. Conversely, the Fe- and Co- phthalocyanine L3,2 edges have strong out-of-plane resonances; these are attributed to transitions into not only b1g (dz2) but also eg states with dxz and dyz character at the metal center.

  4. Association between Cationic Liposomes and Low Molecular Weight Hyaluronic Acid.

    PubMed

    Gasperini, Antonio A M; Puentes-Martinez, Ximena E; Balbino, Tiago Albertini; de Paula Rigoletto, Thais; de Sá Cavalcanti Corrêa, Gabriela; Cassago, Alexandre; Portugal, Rodrigo Villares; de La Torre, Lucimara Gaziola; Cavalcanti, Leide P

    2015-03-24

    This work presents a study of the association between low molecular weight hyaluronic acid (16 kDa HA) and cationic liposomes composed of egg phosphatidylcholine (EPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), and 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP). The cationic liposome/HA complexes were evaluated to determine their mesoscopic structure, average size, zeta potential, and morphology as a function of the amount of HA in the system. Small angle X-ray scattering results revealed that neighboring cationic liposomes either stick together after a partial coating of low concentration HA or disperse completely in excess of HA, but they never assemble as multilamellar vesicles. Cryo-transmission electron microscopy images confirm the existence of unilamellar vesicles and large aggregates of unilamellar vesicles for HA fractions up to 80% (w/w). High concentrations of HA (> 20% w/w) proved to be efficient for coating extruded liposomes, leading to particle complexes with sizes in the nanoscale range and a negative zeta potential. PMID:25730494

  5. Porphyrin-phospholipid liposomes permeabilized by near-infrared light

    NASA Astrophysics Data System (ADS)

    Carter, Kevin A.; Shao, Shuai; Hoopes, Matthew I.; Luo, Dandan; Ahsan, Bilal; Grigoryants, Vladimir M.; Song, Wentao; Huang, Haoyuan; Zhang, Guojian; Pandey, Ravindra K.; Geng, Jumin; Pfeifer, Blaine A.; Scholes, Charles P.; Ortega, Joaquin; Karttunen, Mikko; Lovell, Jonathan F.

    2014-04-01

    The delivery of therapeutic compounds to target tissues is a central challenge in treating disease. Externally controlled drug release systems hold potential to selectively enhance localized delivery. Here we describe liposomes doped with porphyrin-phospholipid that are permeabilized directly by near-infrared light. Molecular dynamics simulations identified a novel light-absorbing monomer esterified from clinically approved components predicted and experimentally demonstrated to give rise to a more stable porphyrin bilayer. Light-induced membrane permeabilization is enabled with liposomal inclusion of 10 molar % porphyrin-phospholipid and occurs in the absence of bulk or nanoscale heating. Liposomes reseal following laser exposure and permeability is modulated by varying porphyrin-phospholipid doping, irradiation intensity or irradiation duration. Porphyrin-phospholipid liposomes demonstrate spatial control of release of entrapped gentamicin and temporal control of release of entrapped fluorophores following intratumoral injection. Following systemic administration, laser irradiation enhances deposition of actively loaded doxorubicin in mouse xenografts, enabling an effective single-treatment antitumour therapy.

  6. Optically Guided Controlled Release from Liposomes With Tunable Plasmonic Nanobubbles

    PubMed Central

    Anderson, Lindsey; Hansen, Eric; Lukianova-Hleb, Ekaterina Y.; Hafner, Jason H.; Lapotko, Dmitri O.

    2010-01-01

    A new method of optically guided controlled release was experimentally evaluated with liposomes containing a molecular load and gold nanoparticles (NPs). NPs were exposed to short laser pulses to induce transient vapor bubbles around the NPs, plasmonic nanobubbles, in order to disrupt the liposome and eject its molecular contents. The release efficacy was tuned by varying the lifetime and size of the nanobubble with the fluence of the laser pulse. Optical scattering by nanobubbles correlated to the molecular release and was used to guide the release. The release of two fluorescent proteins from individual liposomes has been directly monitored by fluorescence microscopy, while the generation of the plasmonic nanobubbles was imaged and measured with optical scattering techniques. Plasmonic nanobubble-induced release was found to be a mechanical, nonthermal process that requires a single laser pulse and ejects of the liposome contents within a millisecond timescale without damage to the molecular cargo and that can be controlled through the fluence of laser pulse. PMID:20156498

  7. The antimicrobial activity of liposomal lauric acids against Propionibacterium acnes

    Microsoft Academic Search

    Darren Yang; Dissaya Pornpattananangkul; Teruaki Nakatsuji; Michael Chan; Dennis Carson; Chun-Ming Huang; Liangfang Zhang

    2009-01-01

    This study evaluated the antimicrobial activity of lauric acid (LA) and its liposomal derivatives against Propionibacterium acnes (P. acnes), the bacterium that promotes inflammatory acne. First, the antimicrobial study of three free fatty acids (lauric acid, palmitic acid and oleic acid) demonstrated that LA gives the strongest bactericidal activity against P. acnes. However, a setback of using LA as a

  8. Porphyrin–phospholipid liposomes permeabilized by near-infrared light

    PubMed Central

    Carter, Kevin A.; Shao, Shuai; Hoopes, Matthew I.; Luo, Dandan; Ahsan, Bilal; Grigoryants, Vladimir M.; Song, Wentao; Huang, Haoyuan; Zhang, Guojian; Pandey, Ravindra K.; Geng, Jumin; Pfeifer, Blaine A.; Scholes, Charles P.; Ortega, Joaquin; Karttunen, Mikko; Lovell, Jonathan F.

    2014-01-01

    The delivery of therapeutic compounds to target tissues is a central challenge in treating disease. Externally controlled drug release systems hold potential to selectively enhance localized delivery. Here we describe liposomes doped with porphyrin–phospholipid that are permeabilized directly by near-infrared light. Molecular dynamics simulations identified a novel light-absorbing monomer esterified from clinically approved components predicted and experimentally demonstrated to give rise to a more stable porphyrin bilayer. Light-induced membrane permeabilization is enabled with liposomal inclusion of 10 molar % porphyrin–phospholipid and occurs in the absence of bulk or nanoscale heating. Liposomes reseal following laser exposure and permeability is modulated by varying porphyrin–phospholipid doping, irradiation intensity or irradiation duration. Porphyrin–phospholipid liposomes demonstrate spatial control of release of entrapped gentamicin and temporal control of release of entrapped fluorophores following intratumoral injection. Following systemic administration, laser irradiation enhances deposition of actively loaded doxorubicin in mouse xenografts, enabling an effective single-treatment antitumour therapy. PMID:24699423

  9. Effect of liposomes and niosomes on skin permeation of enoxacin

    Microsoft Academic Search

    Jia-You Fang; Chi-Tzong Hong; Wen-Ta Chiu; Ying-Yue Wang

    2001-01-01

    The skin permeation and partitioning of a fluorinated quinolone antibacterial agent, enoxacin, in liposomes and niosomes, after topical application, were elucidated in the present study. In vitro percutaneous absorption experi- ments were performed on nude mouse skin with Franz diffusion cells. The influence of vesicles on the physicochemical property and stability of the formulations were measured. The enhanced delivery across

  10. pH-sensitive liposomes: characterization and application

    SciTech Connect

    Connor, J.

    1986-01-01

    It has been demonstrated that liposomes composed of dioleoylphosphatidylethanolamine (DOPE) and palmitoylhomocysteine (PHC) have the ability to fuse with adjacent membranes upon exposure to mildly acid pH. The ability of liposomes to fuse is absolutely dependent on the presence of DOPE and a weakly acidic amphiphile. The acid induced fusion event is a leaky process, but the leakage can be reduced by 50%, with only a small loss of fusion ability, by the inclusion of 40 mole percent cholesterol. Using an established monoclonal antibody targeting system. pH-sensitive immunoliposomes were prepared which successfully delivered entrapped calcein to the cytoplasm of target cells. The addition of chloroquine, which raises the internal pH of cellular vacuoles, blocks the cytoplasmic delivery of the pH-sensitive immunoliposomes. pH-insensitive immunoliposomes delivered calcein only to the endosome/lysosome system and not the cytoplasm. /sup 31/P-NMR and light scattering of DOPE:OA liposomes under acidic conditions demonstrate that the effect of the protons and the divalent cations is to force the DOPE to revert to the hexagonal II configuration. In vivo experiments with DOPE:OA immunoliposomes indicate that the liposomes rapidly aggregate and release their contents upon exposure to plasma. These results indicate that pH-sensitive immunoliposomes are an effective tool for in vitro cytoplasmic delivery but are ineffective for in vivo delivery at this point in development.

  11. Mucoadhesive liposomes as new formulation for vaginal delivery of curcumin.

    PubMed

    Berginc, Katja; Suljakovi?, Sabina; Škalko-Basnet, Nataša; Kristl, Albin

    2014-05-01

    Local delivery to the affected area represents the optimal means by which advantageous pharmacological properties of curcumin may be fully exploited as currently, due to the biopharmaceutical limitations associated with this polyphenol, its full beneficial effects remain limited. Curcumin-containing liposomes coated with bioadhesive polymers of natural and synthetic origin (chitosan and Carbopol) were evaluated in vitro. For these purposes, an in vitro model of vaginal mucus was developed allowing the monitoring of curcumin permeability in the conditions mimicking vaginal environment. The model was optimized by varying the amounts of glycoproteins, as compared to the permeabilities determined through isolated bovine mucus. The strength of bioadhesion was evaluated using the isolated bovine mucosa. Both curcumin solution and non-coated curcumin liposomes served as controls. Bioadhesive polymers enabled significantly higher (p<0.05) curcumin permeability through the artificial and isolated bovine mucus compared to the controls. Polymer coating of liposomes resulted in an increase in their bioadhesiveness. Mucoadhesive liposomes can be considered as potential novel drug delivery systems intended for vaginal administration of curcumin. PMID:24534774

  12. A Novel Vaccine Delivery System Using Immunopotentiating Fusogenic Liposomes

    Microsoft Academic Search

    Akira Hayashi; Tsuyoshi Nakanishi; Jun Kunisawa; Masuo Kondoh; Susumu Imazu; Yasuo Tsutsumi; Keiichi Tanaka; Hiromi Fujiwara; Toshiyuki Hamaoka; Tadanori Mayumi

    1999-01-01

    We previously reported the preparation and characterization of fusogenic liposomes (FLs), which have two highly immunogenic glycoproteins of the Sendai virus on their surface. In this report, we investigated the capacity of FLs to enhance antigen-specific humoral immunity in mice. FLs function as a lymphocyte mitogen with high immunogenicity consistent with viral envelope proteins. Markedly increased levels of anti-ovalbumin (OVA)

  13. Compressibilities and Volume Fluctuations of Archaeal Tetraether Liposomes

    PubMed Central

    Chong, Parkson Lee-Gau; Sulc, Michael; Winter, Roland

    2010-01-01

    Bipolar tetraether lipids (BTLs) are abundant in crenarchaeota, which thrive in both thermophilic and nonthermophilic environments, with wide-ranging growth temperatures (4–108°C). BTL liposomes can serve as membrane models to explore the role of BTLs in the thermal stability of the plasma membrane of crenarchaeota. In this study, we focus on the liposomes made of the polar lipid fraction E (PLFE). PLFE is one of the main BTLs isolated from the thermoacidophilic crenarchaeon Sulfolobus acidocaldarius. Using molecular acoustics (ultrasound velocimetry and densimetry), pressure perturbation calorimetry, and differential scanning calorimetry, we have determined partial specific adiabatic and isothermal compressibility, their respective compressibility coefficients, partial specific volume, and relative volume fluctuations of PLFE large unilamellar vesicles (LUVs) over a wide range of temperatures (20–85°C). The results are compared with those obtained from liposomes made of dipalmitoyl-L-?-phosphatidylcholine (DPPC), a conventional monopolar diester lipid. We found that, in the entire temperature range examined, compressibilities of PLFE LUVs are low, comparable to those found in gel state of DPPC. Relative volume fluctuations of PLFE LUVs at any given temperature examined are 1.6–2.2 times more damped than those found in DPPC LUVs. Both compressibilities and relative volume fluctuations in PLFE LUVs are much less temperature-sensitive than those in DPPC liposomes. The isothermal compressibility coefficient (?Tlipid) of PLFE LUVs changes from 3.59 × 10?10 Pa?1 at 25°C to 4.08 × 10?10 Pa?1 at 78°C. Volume fluctuations of PLFE LUVs change only 0.25% from 30°C to 80°C. The highly damped volume fluctuations and their low temperature sensitivity, echo that PLFE liposomes are rigid and tightly packed. To our knowledge, the data provide a deeper understanding of lipid packing in PLFE liposomes than has been previously reported, as well as a molecular explanation for the low solute permeation and limited membrane lateral motion. The obtained results may help to establish new strategies for rational design of stable BTL-based liposomes for drug/vaccine delivery. PMID:21081080

  14. Hybrid assemblies of fluorescent nanocrystals and membrane proteins in liposomes.

    PubMed

    De Leo, Vincenzo; Catucci, Lucia; Falqui, Andrea; Marotta, Roberto; Striccoli, Marinella; Agostiano, Angela; Comparelli, Roberto; Milano, Francesco

    2014-02-18

    Because of the growing potential of nanoparticles in biological and medical applications, tuning and directing their properties toward a high compatibility with the aqueous biological milieu is of remarkable relevance. Moreover, the capability to combine nanocrystals (NCs) with biomolecules, such as proteins, offers great opportunities to design hybrid systems for both nanobiotechnology and biomedical technology. Here we report on the application of the micelle-to-vesicle transition (MVT) method for incorporation of hydrophobic, red-emitting CdSe@ZnS NCs into the bilayer of liposomes. This method enabled the construction of a novel hybrid proteo-NC-liposome containing, as model membrane protein, the photosynthetic reaction center (RC) of Rhodobacter sphaeroides. Electron microscopy confirmed the insertion of NCs within the lipid bilayer without significantly altering the structure of the unilamellar vesicles. The resulting aqueous NC-liposome suspensions showed low turbidity and kept unaltered the wavelengths of absorbance and emission peaks of the native NCs. A relative NC fluorescence quantum yield up to 8% was preserved after their incorporation in liposomes. Interestingly, in proteo-NC-liposomes, RC is not denatured by Cd-based NCs, retaining its structural and functional integrity as shown by absorption spectra and flash-induced charge recombination kinetics. The outlined strategy can be extended in principle to any suitably sized hydrophobic NC with similar surface chemistry and to any integral protein complex. Furthermore, the proposed approach could be used in nanomedicine for the realization of theranostic systems and provides new, interesting perspectives for understanding the interactions between integral membrane proteins and nanoparticles, i.e., in nanotoxicology studies. PMID:24460372

  15. Lactosylated liposomes for targeted delivery of doxorubicin to hepatocellular carcinoma

    PubMed Central

    Zhou, Xiaoju; Zhang, Mengzi; Yung, Bryant; Li, Hong; Zhou, Chenguang; Lee, L James; Lee, Robert J

    2012-01-01

    Background N-lactosyl-dioleoylphosphatidylethanolamine (Lac-DOPE) was synthesized and evaluated as a liver-specific targeting ligand via asialoglycoprotein receptors for liposomal delivery of doxorubicin. Methods Lactosylated liposomes encapsulating calcein (Lac-L-calcein) or doxorubicin (Lac-L-DOX) composed of egg phosphatidylcholine, cholesterol, monomethoxy polyethylene glycol 2000-distearoyl phosphatidylethanolamine, and Lac-DOPE at 50:35:5:10 (mol/mol) were prepared by polycarbonate membrane extrusion and evaluated in human hepatocellular carcinoma HepG2 cells. Cellular uptake of Lac-L-calcein was monitored by confocal microscopy and by flow cytometry. The cytotoxicity of Lac-L-DOX was evaluated by MTT assay. The pharmacokinetic properties of Lac-L-DOX were studied in normal mice, and its biodistribution and antitumor activity were studied in nude mice with HepG2 xenografts. Results The size of Lac-L-DOX was less than 100 nm and the liposomes demonstrated excellent colloidal stability. In vitro uptake of Lac-L-calcein by HepG2 cells was four times greater than that of non-targeted L-calcein. In the presence of 20 mM lactose, the uptake of Lac-L-calcein was inhibited, suggesting that asialoglycoprotein receptors mediated the observed cellular uptake. Lac-L-DOX exhibited enhanced in vivo cytotoxicity compared with the nontargeted liposomal doxorubicin (L-DOX), and its pharmacokinetic parameters indicate that Lac-L-DOX has a long blood circulation time (t1/2 8.73 hours). Tissue distribution and therapeutic efficacy studies in nude mice bearing HepG2 xenografts show that Lac-L-DOX had significantly stronger tumor inhibitory activity compared with L-DOX and free doxorubicin, along with a higher accumulation of drug within the tumor site and greater cellular uptake by tumor cells. Conclusion These data suggest that lactosylated liposomes are promising drug delivery vehicles for hepatocellular carcinoma. PMID:23093902

  16. Lymph node localization of non-specific antibody-coated liposomes

    SciTech Connect

    Mangat, S.; Patel, H.M.

    1985-05-20

    Subcutaneously injected small unilamellar liposomes are drained into the lymphatics and localized in the regional lymph nodes, and thus they can be used for the detection of metastatic spread in breast cancer patients and for delivery of drugs to diseased lymph nodes. An aqueous phase marker, (/sup 125/I)-polyvinylpyrrolidone, and a lipid phase marker, (/sup 3/H)-cholesterol, were used to study the lymph node localization of IgG-coated liposomes injected subcutaneously into mouse and rat footpads. The results show that human immunoglobulin G (IgG) coated liposomes are rapidly removed from the site of injection and are localized in the regional lymph nodes to a greater extent than control liposomes (i.e. liposomes without IgG). Free IgG was found to inhibit the uptake of IgG-coated liposomes by the lymph nodes. The localization of IgG-coated liposomes in the regional lymph nodes is influenced by charge of the liposomes. The results presented here suggest that antibody-coated liposomes may provide a more efficient way of delivering therapeutic agents to the lymph nodes in the treatment of diseases such as breast cancer with lymph node involvement. Similarly, monoclonal antibody-coated liposomes containing lymphoscintigraphic material may improve the detection of lymph node metastases. 26 references, 3 figures, 3 tables.

  17. Poly(ethylene glycol)-modified phospholipids prevent aggregation during covalent conjugation of proteins to liposomes.

    PubMed

    Harasym, T O; Tardi, P; Longman, S A; Ansell, S M; Bally, M B; Cullis, P R; Choi, L S

    1995-01-01

    Liposome aggregation is a major problem associated with the covalent attachment of proteins to liposomes. This report describes a procedure for coupling proteins to liposomes that results in little or no change in liposome size. This is achieved by incorporating appropriate levels of poly(ethylene glycol)-modified lipids into the liposomes. The studies employed thiolated avidin-D coupled to liposomes containing the thio-reactive lipid N-(4-(p-maleimidophenyl)butyryl)dipalmitoyl phosphatidylethanolamine (1 mol % of total lipid) and various amounts of MePEG-S-POPE (monomethoxypoly(ethylene glycol) linked to phosphatidylethanolamine via a succinate linkage). The influence of PEG chain length and density was also assessed. The presence of PEG on the surface of liposomes is shown to provide an effective method of inhibiting aggregation and the corresponding increase in liposome size during the covalent coupling of avidin-D. A balance between the size of the PEG used and the amount of PEG-lipid incorporated into the liposome had to be achieved in order to maintain efficient coupling. Optimal coupling efficiencies in combination with minimal aggregation effects were achieved using 2 mol % MePEG2000-S-POPE (PEG of 2000 MW) or 0.8 mol % MePEG5000-S-POPE (PEG of 5000 MW). At these levels, the presence of PEG did not affect the biotin binding activity of the covalently attached avidin. The ability of the resulting liposomes to specifically target to biotinylated cells is demonstrated. PMID:7599262

  18. Cellular fusion and whitening effect of a chitosan derivative coated liposome.

    PubMed

    Wang, Yang-Wei; Jou, Chi-Hsiung; Hung, Chia-Chun; Yang, Ming-Chien

    2012-02-01

    In this study, a derivative of chitosan, N-(2-hydroxyl) propyl-3-trimethyl ammonium chitosan chloride (HTCC), was coated onto the liposomes made of cholesterol and 1,2-palmitoyl-sn-glycero-3-phosphatidylcholine (DPPC). These coated liposomes were loaded with kojic acid for skin whitening. The appearance of liposome was examined using transmission electron microscope (TEM), and the coating of HTCC to the liposome was confirmed by infrared spectroscopy. By labeling with Dil, the fusion of liposome with the cell membrane of L929 fibroblast and B16-F10 melanoma was improved by the coating of HTCC. Based on the results of Franz cell experiment, the penetration of kojic acid (KA) through skin was improved by using HTCC-coating liposomes. Furthermore, the cell proliferation of L929 was not affected by HTCC-coating liposomes, while that of B16-F10 was reduced slightly with the increase of the concentration of HTCC-loading liposome. The degree of skin whitening was determined based on the melanin content in B-16-F10 cells. The results showed that the level of melanin synthesis was lower when KA was delivered using HTCC-coating liposome instead of traditional liposome. PMID:22056083

  19. Topical drug delivery to retinal pigment epithelium with microfluidizer produced small liposomes.

    PubMed

    Lajunen, T; Hisazumi, K; Kanazawa, T; Okada, H; Seta, Y; Yliperttula, M; Urtti, A; Takashima, Y

    2014-10-01

    Drug delivery from topically instilled eye drops to the posterior segment of the eye has long been one of the greatest challenges of ocular drug development. We developed methods of liposome preparation utilizing a microfluidizer to achieve adjustable nanoparticle size (even less than 80 nm) and high loading capacity of plasmid DNA. The microfluidizing process parameters were shown to affect the size of the liposomes. Higher operating pressures and passage for at least 10 times through the microfluidizer produced small liposomes with narrow size distribution. The liposomes were physically stable for several months at +4°C. In vivo distribution of the optimized liposome formulations in the rat eyes was investigated with confocal microscopy of the histological specimens. Transferrin was used as a targeting ligand directed to retinal pigment epithelium. Size dependent distribution of liposomes to different posterior segment tissues was seen. Liposomes with the diameter less than 80 nm permeated to the retinal pigment epithelium whereas liposomes with the diameter of 100 nm or more were distributed to the choroidal endothelium. Active targeting was shown to be necessary for liposome retention to the target tissue. In conclusion, these microfluidizer produced small liposomes in eye drops are an attractive option for drug delivery to the posterior segment tissues of the eye. PMID:24810393

  20. A liposomal formulation able to incorporate a high content of Paclitaxel and exert promising anticancer effect.

    PubMed

    Kan, Pei; Tsao, Chih-Wan; Wang, Ae-June; Su, Wu-Chou; Liang, Hsiang-Fa

    2011-01-01

    A liposome formulation for paclitaxel was developed in this study. The liposomes, composed of naturally unsaturated and hydrogenated phosphatidylcholines, with significant phase transition temperature difference, were prepared and characterized. The liposomes exhibited a high content of paclitaxel, which was incorporated within the segregated microdomains coexisting on phospholipid bilayer of liposomes. As much as 15% paclitaxel to phospholipid molar ratio were attained without precipitates observed during preparation. In addition, the liposomes remained stable in liquid form at 4°C for at least 6 months. The special composition of liposomal membrane which could reduce paclitaxel aggregation could account for such a capacity and stability. The cytotoxicity of prepared paclitaxel liposomes on the colon cancer C-26 cell culture was comparable to Taxol. Acute toxicity test revealed that LD(50) for intravenous bolus injection in mice exceeded by 40?mg/kg. In antitumor efficacy study, the prepared liposomal paclitaxel demonstrated the increase in the efficacy against human cancer in animal model. Taken together, the novel formulated liposomes can incorporate high content of paclitaxel, remaining stable for long-term storage. These animal data also demonstrate that the liposomal paclitaxel is promising for further clinical use. PMID:21490755

  1. Cationic liposomes target angiogenic endothelial cells in tumors and chronic inflammation in mice.

    PubMed Central

    Thurston, G; McLean, J W; Rizen, M; Baluk, P; Haskell, A; Murphy, T J; Hanahan, D; McDonald, D M

    1998-01-01

    This study sought to determine whether angiogenic blood vessels in disease models preferentially bind and internalize cationic liposomes injected intravenously. Angiogenesis was examined in pancreatic islet cell tumors of RIP-Tag2 transgenic mice and chronic airway inflammation in Mycoplasma pulmonis-infected C3H/HeNCr mice. For comparison, physiological angiogenesis was examined in normal mouse ovaries. We found that endothelial cells in all models avidly bound and internalized fluorescently labeled cationic liposomes (1,2-dioleoyl-3-trimethylammonium-propane [DOTAP]/cholesterol or dimethyldioctadecyl ammonium bromide [DDAB]/cholesterol) or liposome-DNA complexes. Confocal microscopic measurements showed that angiogenic endothelial cells averaged 15-33-fold more uptake than corresponding normal endothelial cells. Cationic liposome-DNA complexes were also avidly taken up, but anionic, neutral, or sterically stabilized neutral liposomes were not. Electron microscopic analysis showed that 32% of gold-labeled liposomes associated with tumor endothelial cells were adherent to the luminal surface, 53% were internalized into endosomes and multivesicular bodies, and 15% were extravascular 20 min after injection. Our findings indicate that angiogenic endothelial cells in these models avidly bind and internalize cationic liposomes and liposome-DNA complexes but not other types of liposomes. This preferential uptake raises the possibility of using cationic liposomes to target diagnostic or therapeutic agents selectively to angiogenic blood vessels in tumors and sites of chronic inflammation. PMID:9525983

  2. Functional coating of liposomes using a folate– polymer conjugate to target folate receptors

    PubMed Central

    Watanabe, Kazuo; Kaneko, Makoto; Maitani, Yoshie

    2012-01-01

    Folate-polymer-coated liposomes were developed for targeted chemotherapy using doxorubicin (DXR) as a model drug. Folate-poly(L-lysine) (F–PLL) conjugates with a folate modification degree of 16.7 mol% on epsilon amino groups of PLL were synthesized. DXR-loaded anionic liposomes were coated with F–PLL, and the cellular association of F–PLL-coated liposomes was evaluated by flow cytometry, and confocal microscopy in human nasopharyngeal carcinoma KB cells overexpressing folate receptors (FRs), and human lung adenocarcinoma A549 cells [FR (?)]. The existence of a polymer layer on the surface of F–PLL-coated liposomes was confirmed by zeta potential analysis. The KB cellular association of F–PLL-coated liposomal DXR was increased compared with that of PLL-coated liposomes and was inhibited in the presence of free folic acid. Twofold higher cytotoxicity of F–PLL-coated liposomal DXR was observed compared with that of the PLL-coated liposomal DXR in KB cells, but not in A549 cells, suggesting the presence of FR-mediated endocytosis. These results indicated that folate-targeted liposomes were prepared successfully by coating the folate–polymer conjugate F–PLL. This novel preparation method of folate-targeted liposomes is expected to provide a powerful tool for the development of a folate-targeting drug nanodevice as coating with ligand–polymer conjugates can be applicable to many kinds of particles, as well as to lipid-based particles. PMID:22888227

  3. Local Targeted Therapy of Liver Metastasis from Colon Cancer by Galactosylated Liposome Encapsulated with Doxorubicin

    PubMed Central

    Yuan, Wei; Sui, Chenguang; Zhang, Xinghua; Xia, Guimin; Sun, Hongfang; Ma, Jie

    2013-01-01

    Since regional drug administration enables to maintain a high drug concentration within tumors, we compared the plasma concentration and biodistribution of doxorubicin (Dox) from drug-loaded conventional liposomes by local or systemic administration. The results demonstrated that drug concentration was substantially improved in liver as well as a decrease in blood and other organs by spleen injection mimicking portal vein perfusion (regional administration). To further investigate the targeted therapeutic effect of galactosylated liposome encapsulated doxorubicin (Dox) by regional administration, liver targeting liposomes were prepared by incorporating galactosylated-DPPE to conventional liposomes. Liposome uptake and targeting were verified in vitro and in vivo by fluorescence microscopy and xenogen IVIS imaging system, respectively. The results showed that galactose targeted liposomes presented a stronger specific cell uptake by human hepatocellular carcinoma HepG2 cells compared to the non-targeted liposomes. In vivo fluorescence imaging showed that the intra-hepatic deposition of conventional and galactosylated liposomes via spleen injection was more than that via tail vein administration, and galactosylated liposomes had higher fluorescent intensity over conventional liposomes in the liver post spleen administration. The anti-tumor effect of various drug administration routes for both liposomal formulations was evaluated using a murine liver metastasis model of colon cancer. The results indicated that tumor progression in the liver and mesenteric lymph nodes was significantly suppressed by Dox-loaded galactosylated liposomes via spleen injection, while no significance was observed in non-targeted formulations. Our data indicated that local perfusion of galactosylated liposomal doxorubicin had a great promise for the treatment of liver metastasis from colon cancer. PMID:24040096

  4. Effect of liposomes on the absorption of water-soluble active pharmaceutical ingredients via oral administration.

    PubMed

    Yang, Zhijun; Lu, Aiping; Wong, Blenda Chi Kwan; Chen, Xiaoyu; Bian, Zhaoxiang; Zhao, Zhongzhen; Huang, Wenhua; Zhang, Ge; Chen, Hubiao; Xu, Min

    2013-01-01

    The objective of this study was to investigate the effect of liposomes on the absorption of water-soluble active pharmaceutical ingredients. Salbutamol sulfate (SBS) has been widely used for treatment of bronchospasm in conditions such as asthma. Using SBS as the model drug in this study, we developed SBS-loaded liposomes for oral administration and explored the relationship between their bioavailability and anti-asthmatic efficacy. SBS was entrapped in liposomes with encapsulation efficiency as high as 70%. The in vitro transport profile of SBS across a dialysis membrane for liposome suspension was compared with that for free SBS solution. Oral administration of liposomes labeled with the fluorescent dye 1,1'-dioctadecyltetramethyl indotricarbocyanine iodide (DiR) in a mouse model was assessed by a small animal imaging system. Pharmacokinetic and pharmacodynamic studies on SBS liposome suspension and free SBS solution were performed using animal models via oral administration. The results showed that liposomes could sustain the release of SBS in vitro and decrease the transport rate of SBS across the dialysis membrane. In vivo fluorescence imaging analysis demonstrated DiR liposome distribution in mouse stomach for at least 24 hr. The mean residence time of SBS from liposomes was found to be longer than that of free SBS, suggesting that the relative bioavailability of SBS was higher when liposome delivery was used. The pharmacokinetic data also showed that the drug absorption rate was relatively slower for treatment with liposomal SBS when compared to free SBS. Moreover, SBS liposome suspension was shown to give a prolonged anti-asthmatic effect after oral administration when compared to free SBS solution. Overall, this study demonstrated that use of liposomes as delivery vehicles for sustained drug release and controlled absorption could be a promising approach for improving the therapeutic potency of active pharmaceutical ingredients. PMID:23621538

  5. Preparation, optimization, and characterization of topotecan loaded PEGylated liposomes using factorial design.

    PubMed

    Vali, Amir Masoud; Toliyat, Taiebeh; Shafaghi, Bijan; Dadashzadeh, Simin

    2008-01-01

    This study reports the development of liposomal system for a potent antitumor drug, topotecan. To achieve this goal conventional and PEGylated liposomes were prepared according to a factorial design by hydration method followed by extrusion. Parameters such as type of lipid, percentage of cholesterol, percentage of phosphatidylglycerols, percentage of polyethylene glycol (PEG)-lipids, and drug to lipid molar ratio were considered as important factors for the optimizing the entrapment and retention of topotecan inside the liposomes. The size and zeta-potential of the PEGylated and conventional liposomes were measured by particle size analyzer and zeta-potentiometer, respectively. The stability and release characteristics of PEGylated liposome loaded topotecan were compared with conventional liposomes and free topotecan. The optimized PEGylated [distearoyl phosphatidylcholine (DSPC)/cholesterol/ distearoyl phosphatidylglycerol (DSPG)/ distearoyl phosphatidylethanolamine-PEG(2000) (DSPE-PEG(2000)); 7:7:3:1.28] and related conventional [DSPC/cholesterol/DSPG; 7:7:3] liposomes showed a narrow size distribution with a polydipersity index of 0.15 and 0.10, an average diameter of 103.0 +/- 13.1 and 95.2 +/- 11.10 nm, and with drug loading of 11.44 and 6.21%, respectively. Zeta-potential was -10 +/- 2.3 and -22 +/- 2.8 mV for PEGylated and conventional liposomes, respectively. The results of stability evaluation showed that the lactone ring of topotecan was notably preserved upon liposome encapsulation. PEGylated liposomes containing topotecan showed a significant decrease (P < 0.001) in release rate in comparison with conventional leptosomes. These results indicate the suitability of PEGylated liposomes in controlling topotecan release. The prepared liposomes (especially PEGylated liposomes) as those described here may be clinically useful to stabilize and deliver topotecan for the treatment of cancer. PMID:18214751

  6. The preparation and modification of phthalocyanine containing materials

    NASA Astrophysics Data System (ADS)

    Korth, Bryan D.

    Phthalocyanines (Pcs) are highly conjugated, 18 pi-electron cyclic molecules composed of four isoindoline units that exhibit unique optical, electrical and chemical properties. While originally used as dyes and pigments, the use of Pcs in modern technology has increased dramatically due to improved understanding and processing capabilities. Work in this dissertation outlines a number of methods to prepare Pc-containing materials for use in various applications. Chapter 1 provides a brief review of methods used to prepare Pc-containing polymeric materials from both symmetric and asymmetric macrocycles. Discussion will focus on methods that incorporate symmetric Pcs as the focal point, with particular attention being paid to the influence of the peripheral substitution of the Pc on macromolecular structure and properties. Further discussion will focus on the utilization of asymmetric Pcs as auxiliary functionalities, such as at the terminus or as pendant groups, of larger macromolecular materials. Chapter 2 describes the preparation of linear Pc-containing polymers through ring-opening metathesis polymerization of a Pc monomer. Through proper selection of catalyst, well-defined polymers with Pcs as pendant groups were prepared. Due to the controlled nature of ROMP, polymers of varying architectures, composition, and size were synthesized. The effect of Pc metallation, polymer composition and architecture on the site-isolation of the chromophore was investigated in both solution and condensed-phase thin films. Chapter 3 reports on efforts to prepare linear polymers with companion functionalities for post-polymerization coupling of asymmetric Pcs. Polymers with pendant furan groups were prepared for coupling with asymmetric Pcs through Diels-Alder cycloaddition. Investigation indicated that while coupling was achievable, the presence of the Pc in the resultant polymer promoted undesired crosslinking when stored at ambient conditions in light. Attempts to mitigate this problem through alternation of functionality locations were attempted by placing the furan functionality on the Pc, but degradation of the furan occurred to quickly to perform coupling sufficiently. Chapter 4 discusses the preparation of Pc-containing networks through Diels-Alder cycloaddition of furan and maleimide containing tetrasubstituted Pcs. Following preparation of the various Pcs, network formation in various states was conducted including solution, molded thick films, and patterned assemblies. Chapter 5 summarizes the results presented in Chapters 2-4 and provides an outlook for some future directions based upon the work herein. In addition, some preliminary results of some of these directions will also be presented.

  7. Computer-aided design of liposomal drugs: in silico prediction and experimental validation of drug candidates for liposomal remote loading

    PubMed Central

    Cern, Ahuva; Barenholz, Yechezkel; Tropsha, Alexander; Goldblum, Amiram

    2014-01-01

    Previously we have developed and statistically validated Quantitative Structure Property Relationship (QSPR) models that correlate drugs’ structural, physical and chemical properties as well as experimental conditions with the relative efficiency of remote loading of drugs into liposomes (Cern et al, Journal of Controlled Release, 160(2012) 14–157). Herein, these models have been used to virtually screen a large drug database to identify novel candidate molecules for liposomal drug delivery. Computational hits were considered for experimental validation based on their predicted remote loading efficiency as well as additional considerations such as availability, recommended dose and relevance to the disease. Three compounds were selected for experimental testing which were confirmed to be correctly classified by our previously reported QSPR models developed with Iterative Stochastic Elimination (ISE) and k-nearest neighbors (kNN) approaches. In addition, 10 new molecules with known liposome remote loading efficiency that were not used in QSPR model development were identified in the published literature and employed as an additional model validation set. The external accuracy of the models was found to be as high as 82% or 92%, depending on the model. This study presents the first successful application of QSPR models for the computer-model-driven design of liposomal drugs. PMID:24184343

  8. Improved Photodynamic Efficacy of Zn(II) Phthalocyanines via Glycerol Substitution

    PubMed Central

    Chin, Yunni; Lim, Siang Hui; Zorlu, Yunus; Ahsen, Vefa; Kiew, Lik Voon; Chung, Lip Yong; Dumoulin, Fabienne; Lee, Hong Boon

    2014-01-01

    Phthalocyanines are excellent photosensitizers for photodynamic therapy as they have strong absorbance in the near infra-red region which is most relevant for in vivo activation in deeper tissular regions. However, most phthalocyanines present two major challenges, ie, a strong tendency to aggregate and low water-solubility, limiting their effective usage clinically. In the present study, we evaluated the potential enhancement capability of glycerol substitution on the photodynamic properties of zinc (II) phthalocyanines (ZnPc). Three glycerol substituted ZnPc, 1–3, (tetra peripherally, tetra non-peripherally and mono iodinated tri non-peripherally respectively) were evaluated in terms of their spectroscopic properties, rate of singlet oxygen generation, partition coefficient (log P), intracellular uptake, photo-induced cytotoxicity and vascular occlusion efficiency. Tetrasulfonated ZnPc (ZnPcS4) was included as a reference compound. Here, we showed that 1–3 exhibited 10–100 nm red-shifted absorption peaks with higher molar absorptivity, and at least two-fold greater singlet oxygen generation rates compared to ZnPcS4. Meanwhile, phthalocyanines 1 and 2 showed more hydrophilic log P values than 3 consistent with the number of glycerol attachments but 3 was most readily taken up by cells compared to the rest. Both phthalocyanines 2 and 3 exhibited potent phototoxicity against MCF-7, HCT-116 and HSC-2 cancer cell-lines with IC50 ranging 2.8–3.2 µM and 0.04–0.06 µM respectively, while 1 and ZnPcS4 (up to 100 µM) failed to yield determinable IC50 values. In terms of vascular occlusion efficiency, phthalocyanine 3 showed better effects than 2 by causing total occlusion of vessels with diameter <70 µm of the chorioallantoic membrane. Meanwhile, no detectable vascular occlusion was observed for ZnPcS4 with treatment under similar experimental conditions. These findings provide evidence that glycerol substitution, in particular in structures 2 and 3, is able to improve the photodynamic properties of ZnPc. PMID:24840576

  9. Salidroside liposome formulation enhances the activity of dendritic cells and immune responses.

    PubMed

    Zhao, Xiaojuan; Lu, Yu; Tao, Yang; Huang, Yee; Wang, Deyun; Hu, Yuanliang; Liu, Jiaguo; Wu, Yi; Yu, Yun; Liu, Cui

    2013-12-01

    Salidroside, the important composition, of Rhodiola rosea L. has been reported to have various pharmacological properties. Liposome is known to be effective as drug carriers and immune adjuvant. Therefore, the aim of this study is to investigate immunological adjuvant activity of salidroside liposome. Here we reported the preparation, the effect on DCs in vitro and the immune response in vivo. The immunological adjuvant activity of salidroside liposome formulation was compared with that of salidroside and liposome. The result showed that salidroside liposome formulation not only could promote the maturation of DCs, the stimulation of DCs on MLR proliferation and the antigen presenting ability, but also induced the sustained cellular immune and humoral immune response. Overall, the results showed that salidroside liposome formulation had the potential to act as effective sustained release vaccine delivery systems. PMID:24188805

  10. Formation of liposome by microfluidic flow focusing and its application in gene delivery

    NASA Astrophysics Data System (ADS)

    Wi, Rinbok; Oh, Yeonsu; Chae, Chanhee; Kim, Do Hyun

    2012-06-01

    We report the formation of liposomes in a simple procedure using a microfluidic hydrodynamic flow focusing method for the application in gene delivery. We fabricated microfluidic device using soft lithography and polydimethylsiloxane (PDMS) molding technique. Lipid-containing stream was surrounded by aqueous stream and liposomes were formed at the lipid-water interface. Size distribution of liposomes and zeta potential of liposome dispersion were investigated under various flow rate ratio (FRR) and processing temperature. Size distributions of liposomes were measured by dynamic light scattering (DLS), and zeta potential was measured to quantify the colloidal stability. Prepared liposomes were used as a vehicle for gene delivery, and the successful expression of delivered gene was observed by fluorescent microscope.

  11. Effect of size at the nanoscale and bilayer rigidity on skin diffusion of liposomes.

    PubMed

    Babu, Sundar; Fan, Chenxiang; Stepanskiy, Leonard; Uitto, Jouni; Papazoglou, Elisabeth

    2009-10-01

    This study reports the effect of liposome particle size at the nanoscale and bilayer deformability on the permeation through MatTek human skin equivalents and provides a comparative quantitative measure through calculation of diffusion coefficients. Exploring DOPC and DPPC fluorescent liposomes, our results demonstrate the faster diffusion of 50 nm liposomes compared with 100 and 200 nm liposomes when the lipid bilayer remains the same. Diffusion kinetics of the 50 nm particles appear not to depend on the rigidity of the lipid layer, whereas diffusion of particles larger than 100 nm is significantly affected by the rigidity of the bilayer, and DOPC liposomes diffuse faster than their DDPC equivalents. Our results suggest that liposomes composed of a rigid bilayer can be expected to remain intact after passing through the stratum corneum. PMID:18770522

  12. Structure of liposome encapsulating proteins characterized by X-ray scattering and shell-modeling.

    PubMed

    Hirai, Mitsuhiro; Kimura, Ryota; Takeuchi, Kazuki; Hagiwara, Yoshihiko; Kawai-Hirai, Rika; Ohta, Noboru; Igarashi, Noriyuki; Shimuzu, Nobutaka

    2013-11-01

    Lipid liposomes are promising drug delivery systems because they have superior curative effects owing to their high adaptability to a living body. Lipid liposomes encapsulating proteins were constructed and the structures examined using synchrotron radiation small- and wide-angle X-ray scattering (SR-SWAXS). The liposomes were prepared by a sequential combination of natural swelling, ultrasonic dispersion, freeze-throw, extrusion and spin-filtration. The liposomes were composed of acidic glycosphingolipid (ganglioside), cholesterol and phospholipids. By using shell-modeling methods, the asymmetric bilayer structure of the liposome and the encapsulation efficiency of proteins were determined. As well as other analytical techniques, SR-SWAXS and shell-modeling methods are shown to be a powerful tool for characterizing in situ structures of lipid liposomes as an important candidate of drug delivery systems. PMID:24121330

  13. Treatment of neuroblastoma and rhabdomyosarcoma using RGD-modified liposomal formulations of patupilone (EPO906)

    PubMed Central

    Scherzinger-Laude, Karine; Schönherr, Carina; Lewrick, Felicitas; Süss, Regine; Francese, Giancarlo; Rössler, Jochen

    2013-01-01

    Background Patupilone (EPO906) is a microtubule stabilizer with a potent antitumor effect. Integrin ?V?3-binding (RGD) liposomes were loaded with EPO906, and their antitumor efficacy was evaluated in two pediatric tumor models, ie, neuroblastoma and rhabdomyosarcoma. Methods Integrin ?V?3 gene expression, RGD-liposome cellular association, and the effect of EPO906 and liposomal formulations of EPO906 on cell viability were assessed in vitro in human umbilical vein endothelial cells (HUVEC), in the RH-30 rhabdomyosarcoma cell line, and in the Kelly neuroblastoma cell line. In vivo, mice bearing neuroblastoma or rhabdomyosarcoma tumors were treated with EPO906, EPO906-liposomes, or EPO906-RGD-liposomes. Tumor growth, cumulative survival, and toxicity were monitored. Results Integrin ?V?3 was highly expressed in HUVEC and RH-30, but not in Kelly cells. Accordingly, RGD-liposomes were highly associated with HUVEC and RH-30 cells in vitro, but not with the Kelly cells. EPO906 and its liposomal formulations inhibited HUVEC, RH-30, and Kelly cell viability to the same extent. In vivo, EPO906 1.5 mg/kg and liposomal EPO906 potently inhibited tumor growth in both xenograft models without triggering major toxicity. At this dose, liposomal EPO906 did not enhance the antitumor effect of EPO906 in neuroblastoma, but tended to have an increased antitumor effect in rhabdomyosarcoma. Using a lower dose of EPO906-RGD-liposomes significantly enhanced cumulative survival in rhabdomyosarcoma compared with EPO906 alone. Conclusion EPO906 shows a strong antitumor effect in neuroblastoma and rhabdomyosarcoma, without triggering major side effects. Its liposomal encapsulation does not alter its activity, and enhances cumulative survival when EPO906-RGD-liposomes are used at low dose in rhabdomyosarcoma. PMID:23818777

  14. Liposomal Formulations of Inflammatory Bowel Disease Drugs: Local versus Systemic Drug Delivery in a Rat Model

    Microsoft Academic Search

    Filippos Kesisoglou; Simon Yuji Zhou; Susan Niemiec; Jordan Wing Lee; Ellen M. Zimmermann; David Fleisher

    2005-01-01

    Purpose. Based on adherence to intestinal mucosa, intralumenally administered liposomal formulations of 5-aminosalicylate (5-ASA) and 6-mercaptopurine (6-MP) were studied for their potential to enhance local drug delivery to intestinal tissue for the treatment of inflammatory bowel disease. Methods. 5-ASA was encapsulated in standard phospholipid liposomes while 6-MP required encapsulation in nonphospholipid liposomes to obtain equivalent drug loading. Encapsulation efficiency was

  15. Characterization of CD44-Mediated Cancer Cell Uptake and Intracellular Distribution of Hyaluronan-Grafted Liposomes

    PubMed Central

    Qhattal, Hussaini Syed Sha; Liu, Xinli

    2011-01-01

    Hyaluronan (HA) is a biocompatible and biodegradable linear polysaccharide which is of interest for tumor targeting through cell surface CD44 receptors. HA binds with high affinity to CD44 receptors, which are overexpressed in many tumors and involved in cancer metastasis. In the present study, we investigated the impact of HA molecular weight (MW), grafting density, and CD44 receptor density on endocytosis of HA-grafted liposomes (HA-liposomes) by cancer cells. Additionally, the intracellular localization of the HA-liposomes was determined. HAs of different MWs (5-8, 10-12, 175-350, and 1600 kDa) were conjugated to liposomes with varying degrees of grafting density. HA surface density was quantified using the hexadecyltrimethylammonium bromide turbidimetric method. Cellular uptake and subcellular localization of HA-liposomes were evaluated by flow cytometry and fluorescence microscopy. Mean particle sizes of HA-liposomes ranged from 120 to 180 nm and increased with the bigger size of HA. HA-liposome uptake correlated with HA MW (5-8 < 10-12 < 175-350 kDa), grafting density, and CD44 receptor density and exceeded that obtained with unconjugated plain liposomes. HA-liposomes were taken up into cells via lipid raft-mediated endocytosis, which is both energy- and cholesterol-dependent. Once within cells, HA-liposomes localized primarily to endosomes and lysosomes. The results demonstrate that cellular targeting efficiency of HA-liposomes depends strongly upon HA MW, grafting density, and cell surface receptor CD44 density. The results support a role of HA-liposomes for targeted drug delivery. PMID:21696190

  16. Effect of Surfactants on Preparation and Skin Penetration of Tea Polyphenols Liposomes

    Microsoft Academic Search

    X. Z. Haol; H. F. Zhou; N. Gu

    2007-01-01

    Liposomes appear a promising approach as a drug-carrier system for topical application. The principal of this study was to investigate the influence of surfactants polyoxyethylene (40) stearate (S-40) and Tween 20 on the preparation and skin penetration of tea polyphenols (TP) liposomes. TP liposomes modified by surfactants were prepared by improved inverse-phase evaporation method. The particle size and distribution were

  17. Intratumor administration of fusogenic liposomes containing fragment A of diphtheria toxin suppresses tumor growth

    Microsoft Academic Search

    Hiroyuki Mizuguchi; Tsuyoshi Nakanishi; Mahito Nakanishi; Tetsuhiko Nakagawa; Shinsaku Nakagawa; Tadanori Mayumi

    1996-01-01

    Previously, we reported that experimental i.p. administration of fusogenic liposomes containing fragment A of diphtheria toxin (DTA) completely regressed ascites tumors without any severe side effects. In this study, we examined the therapeutic effects of intratumor injection of fusogenic liposomes using ddY mice implanted with Sarcoma-180 (S-180) cells intradermally. Intratumor injections of fusogenic liposomes containing DTA significantly inhibited the tumor

  18. In-situ observation of the inside-to-outside molecular transport of a liposome.

    PubMed

    Kim, Joon Heon; Kim, Mahn Won

    2008-12-11

    The first in-situ and real-time observation of the molecular transport from inside to outside of a liposome was shown by using the second harmonic generation (SHG) technique. The transport of an organic cationic molecule across the liposome bilayer could be switched on and off using the structural change of the lipid bilayer caused by temperature change. This approach can be helpful for the understanding and control of the molecular transport in the liposome vehicle. PMID:19367900

  19. Na + -permeable channels of human sperm membrane reassembled into giant liposome

    Microsoft Academic Search

    Zhang Guangping; Bai Junping; Shi Yuliang

    2001-01-01

    Previous data showed that a Na+-transmembrane flux was accompanied with acrosome reaction of sperm. However, the electrophysiological recording and characterization\\u000a of Na+ current in human sperm membrane have not been yet reported. In the present investigation, membrane proteins extracted from\\u000a human sperms were reassembled into liposome bilayer, and then the liposomes were fused by dehydration-rehydration into giant\\u000a liposomes with the

  20. Enhanced Reverse Saturable Absorption and Optical Limiting in Heavy-Atom Substituted Phthalocyanines

    NASA Technical Reports Server (NTRS)

    Perry, J. W.; Mansour, K.; Marder, S. R.; Alvarez, D., Jr.; Perry, K. J.; Choong, I.

    1994-01-01

    The reverse saturable absorption and optical limiting response of metal phthalocyaninies can be enhanced by using the heavy-atom effect. Phthalocyanines containing heavy metal atoms, such as In, Sn, and Pb show nearly a factor of two enhancement in the ratio of effective excited-state to ground-state absorption cross sections compared to those containing lighter atoms, such as Al and Si. In an f/8 optical geometry, homogeneous solutions of heavy metal phthalocyanines, at 30% linear transmission, limit 8-ns, 532-nm laser pulses to less than or equal to 3 (micro)J (the energy for 50% probability of eye damage) for incident pulses up to 800 (micro)J.

  1. Solvent-assisted growth of metal phthalocyanine thin films on Au(111)

    SciTech Connect

    Tskipuri, Levan; Shao Qian; Reutt-Robey, Janice [Department of Chemistry and Biochemistry, University of Maryland, College Park, Maryland 20742-4454 (United States)

    2012-05-15

    Thin films of metal phthalocyanine (MPc) are grown on an Au(111) support with a newly developed aerosol molecular beam deposition source and characterized in situ via ultrahigh vacuum scanning tunneling microscopy. MPcs are delivered to Au(111) in a series of N{sub 2}-entrained microsized solvent droplets of variable surface residence time. Phthalocyanine film registration to the herringbone reconstruction of the Au(111) surface, indicative of thermodynamically favored structure, is observed at submonolayer coverages for aromatic solvents with long residence times. Aerosol-deposited monolayer film structures are noncrystalline with tilted MPc orientations and vacancy nanocavities. Upon annealing, MPc molecules adopt flat-lying orientations with respect to the substrate and vacancies are eliminated. Film morphologies indicate solvation-mediated film nucleation and growth, with less long-range ordering that in vapor-generated films.

  2. Numerical analysis on optical limiting performance of a series of phthalocyanines for nanosecond pulses

    NASA Astrophysics Data System (ADS)

    Miao, Quan; Ding, Hong-Juan; Sun, Yu-Ping; Gel'mukhanov, Faris; Wang, Chuan-Kui

    2012-04-01

    The optical limiting properties of a series of peripherally substituted phthalocyanines with different central metals and axial chloride ligand for nanosecond pulses have been studied by solving numerically the two-dimensional paraxial field equation together with the rate equations using the Crank-Nicholson method. It is shown that all of these compounds exhibit good optical limiting behaviour, and phthalocyanines with heavier central metals have better optical limiting performance due to the faster intersystem crossing caused by the enhanced spin-orbit coupling. The major mechanism of optical limiting for long pulses is the sequential (singlet-singlet)×(triplet-triplet) nonlinear absorption. Dynamics of populations is characterized mainly by the effective transfer time of the population from the ground state to the lowest triplet state. The long lifetime of the triplet state is important but not determinant. In addition, the performance of optical limiting strongly depends on the thickness and concentration of the absorber.

  3. ZnO and cobalt phthalocyanine hybridized graphene: efficient photocatalysts for degradation of rhodamine B.

    PubMed

    Neelgund, Gururaj M; Oki, Aderemi; Luo, Zhiping

    2014-09-15

    A novel method has been developed to synthesize graphene-ZnO composite as a highly efficient catalyst by reduction of graphite oxide and in situ deposition of ZnO nanoparticles by chemical reduction reaction. The graphene-ZnO catalyst is capable of complete degradation of rhodamine B under exposure to natural sunlight. Further, the catalytic efficiency of graphene-ZnO catalyst was enhanced by sensitizing with cobalt phthalocyanine. The formation of graphene-ZnO photocatalyst and its further sensitization with cobalt phthalocyanine was characterized using UV-vis, ATR-IR and Raman spectroscopy, powder XRD and thermogravimetric analysis. The morphology of both graphene-ZnO and graphene-ZnO-CoPC catalysts was analyzed using scanning and transmission electron microscopes. PMID:24972296

  4. Electronic properties and morphology of Cu-phthalocyanine—C{sub 60} composite mixtures

    SciTech Connect

    Roth, Friedrich [Center for Free-Electron Laser Science/DESY, Notkestraße 85, D-22607 Hamburg (Germany); Lupulescu, Cosmin [Institute of Optics and Atomic Physics, TU Berlin, Straße des 17. Juni 135, D-10623 Berlin (Germany); Arion, Tiberiu [Center for Free-Electron Laser Science/DESY, Notkestraße 85, D-22607 Hamburg (Germany); Institut für Experimentalphysik, Universität Hamburg, Luruper Chaussee 149, D-22761 Hamburg (Germany); Darlatt, Erik; Gottwald, Alexander [Physikalisch-Technische Bundesanstalt (PTB), Abbestraße 2-12, D-10587 Berlin (Germany); Eberhardt, Wolfgang [Center for Free-Electron Laser Science/DESY, Notkestraße 85, D-22607 Hamburg (Germany); Institute of Optics and Atomic Physics, TU Berlin, Straße des 17. Juni 135, D-10623 Berlin (Germany)

    2014-01-21

    Phthalocyanines in combination with C{sub 60} are benchmark materials for organic solar cells. Here, we have studied the morphology and electronic properties of co-deposited mixtures (blends) of these materials forming a bulk heterojunction as a function of the concentration of the two constituents. For a concentration of 1:1 of Cu-Phthalocyanine (CuPc):C{sub 60}, a phase separation into about 100?nm size domains is observed, which results in electronic properties similar to layered systems. For low C{sub 60} concentrations (10:1 CuPc:C{sub 60}), the morphology, as indicated by Low-Energy Electron Microscopy images, suggests a growth mode characterized by (amorphous) domains of CuPC, whereby the domain boundaries are decorated with C{sub 60}. Despite of these markedly different growth modes, the electronic properties of the heterojunction films are essentially unchanged.

  5. All-atom CHARMM force field and bulk properties of perfluorozinc phthalocyanines.

    PubMed

    Dwyer, Patrick J; Vander Valk, Rory J; Caltaldo, Vito; Demianicz, David; Kelty, Stephen P

    2014-12-11

    Classical force fields within the CHARMM parametrized model are developed for zinc phthalocyanines including the parent per-hydro molecule and per-fluoro-alkyl substituted derivatives. Partial atomic charges, 2-body bond lengths, and 3-body angle parameters were obtained from B3LYP-level density functional calculations. Force constants for 2-, 3-, and 4-body interactions were derived from existing fluoroalkane models and incorporated assuming transferability. The force fields were validated by comparing equilibrium molecular geometries from molecular dynamics simulations with density functional theory (DFT) calculations and, where available, published experimental XRD refinements. The models produce molecular geometries for the target materials within 1-2% of expected values. Intermolecular interaction geometries were also investigated using molecular dynamics simulations. The results provide new insight and predictions of the equilibrium stacking and orientational intermolecular interactions of this novel class of modified phthalocyanines. PMID:25390623

  6. Design of UV-Vis-NIR panchromatic crown-phthalocyanines with controllable aggregation.

    PubMed

    Safonova, Evgeniya A; Martynov, Alexander G; Zolotarevskii, Viktor I; Nefedov, Sergey E; Gorbunova, Yulia G; Tsivadze, Aslan Yu

    2015-01-21

    Novel magnesium and zinc phthalocyaninates, bearing four lateral electron-rich 15-crown-5-oxanthrene fragments, were synthesized starting from benzo-15-crown-5. Being almost insoluble in common organic solvents, these complexes could be solubilised by interaction with potassium acetate due to the formation of well-defined cofacial supramolecular dimers. A characteristic feature of these dimers is the presence of additional bands in their UV-Vis spectra, which affords the expansion of light absorption region up to ?750 nm. This new band corresponds to the charge transfer from the peripheral groups to the Pc core, as evidenced by TDDFT calculations. Potassium cations can be reversibly removed from these dimers by [2.2.2]cryptand, resulting in the formation of monodisperse nanoparticles exhibiting absorbances up to 900 nm. This approach can be further used for the fabrication of nanostructured optoelectronic materials based on the synthesized donor-acceptor panchromatic crown-phthalocyanines. PMID:25423480

  7. Dielectric properties and electronic absorption: a comparison of novel azo- and oxo-bridged phthalocyanines.

    PubMed

    Merve Yüzüak, M; Altun, Selçuk; Alt?ndal, Ahmet; Odaba?, Zafer

    2015-01-21

    The novel two homologous phthalocyanine (Pc) series (azo- and oxo-bridged) substituted with a 5-bromo-2-methoxyphenyl moiety were synthesized and characterized. The physical and chemical properties of the Pcs were compared with each other for the first time. The ac response of the Pcs was also studied by impedance measurements over a temperature range of 300-500 K. The real and imaginary parts of the impedance were found to be dependent on both frequency and temperature. The impedance spectra of the samples displayed semicircular arcs in the complex plane plot at all temperatures, with their centres lying below the real axis at a particular angle of depression indicating the distribution of relaxation times. Measurements showed that the dielectric permittivity of azo-bridged phthalocyanines is significantly higher than that of the oxo-bridged homologs. This result can be attributed to the limited electron delocalization ability of oxo-bridged homologs. PMID:25425444

  8. Metallophthalocyanin-ocenes: scandium phthalocyanines with an ?(5)-bound Cp ring.

    PubMed

    Platel, Rachel H; Teixeira Tasso, Thiago; Zhou, Wen; Furuyama, Taniyuki; Kobayashi, Nagao; Leznoff, Daniel B

    2015-04-01

    A series of new scandium complexes supported by the phthalocyanine (Pc) ligand have been prepared and structurally characterized. Reaction of ScCl3 with phthalonitrile affords a mixture of PcScCl (1) and unreacted ScCl3, which upon addition of LiCH(SiMe3)2 yields THF-soluble PcSc(?-Cl2)Li(THF)2 (2). Metathesis with NaCp or LiCp* generates PcSc(?(5)-C5H5) and PcSc(?(5)-C5Me5), respectively, which represent the first examples of ?(5)-Cp metal phthalocyanines where the Cp fragment sandwiches the metal centre. PMID:25735598

  9. In-situ spectro-microscopy on organic films: Mn-Phthalocyanine on Ag(100)

    SciTech Connect

    Al-Mahboob A.; Vescovo, E.; Sadowski, J.T.

    2013-08-18

    Metal phthalocyanines are attracting significant attention, owing to their potential for applications in chemical sensors, solar cells and organic magnets. As the electronic properties of molecular films are determined by their crystallinity and molecular packing, the optimization of film quality is important for improving the performance of organic devices. Here, we present the results of in situ low-energy electron microscopy / photoemission electron microscopy (LEEM/PEEM) studies of incorporation-limited growth [1] of manganese-phthalocyanine (MnPc) on Ag(100) surfaces. MnPc thin films were grown on both, bulk Ag(100) surface and thin Ag(100)/Fe(100) films, where substrate spin-polarized electronic states can be modified through tuning the thickness of the Ag film [2]. We also discuss the electronic structure and magnetic ordering in MnPc thin films, investigated by angle- and spin-resolved photoemission spectroscopy.

  10. Novel axially carborane-cage substituted silicon phthalocyanine photosensitizer; synthesis, characterization and photophysicochemical properties

    NASA Astrophysics Data System (ADS)

    Atmaca, Göknur Ya?a; Dizman, Cemil; Eren, Tar?k; Erdo?mu?, Ali

    2015-02-01

    The novel axially dicarborane substituted silicon (IV) (SiPc-DC) phthalocyanine was synthesized by treating silicon phthalocyanine dichloride SiPc(Cl)2 (SiPc) with o-Carborane monool. The compound was characterized by mass spectrometry, UV-Vis, FT-IR, 1H and 11B Nuclear Magnetic Resonance Spectroscopy (NMR). Spectral, photophysical (fluorescence quantum yield) and photochemical (singlet oxygen (??) and photodegradation quantum yield (?d)) properties of the complex were reported in different solutions (Dimethyl sulfoxide (DMSO), Dimethylformamide (DMF) and Toluene). The results of spectral measurements showed that both SiPc and carborane cage can have potential to be used as sensitizers in photodynamic therapy (PDT) and boron neutron capture therapy (BNCT) by their singlet oxygen efficiencies (?? = 0.41, 0.39).

  11. Novel axially carborane-cage substituted silicon phthalocyanine photosensitizer; synthesis, characterization and photophysicochemical properties.

    PubMed

    Atmaca, Göknur Ya?a; Dizman, Cemil; Eren, Tar?k; Erdo?mu?, Ali

    2015-02-25

    The novel axially dicarborane substituted silicon (IV) (SiPc-DC) phthalocyanine was synthesized by treating silicon phthalocyanine dichloride SiPc(Cl)2 (SiPc) with o-Carborane monool. The compound was characterized by mass spectrometry, UV-Vis, FT-IR, (1)H and (11)B Nuclear Magnetic Resonance Spectroscopy (NMR). Spectral, photophysical (fluorescence quantum yield) and photochemical (singlet oxygen (??) and photodegradation quantum yield (?d)) properties of the complex were reported in different solutions (Dimethyl sulfoxide (DMSO), Dimethylformamide (DMF) and Toluene). The results of spectral measurements showed that both SiPc and carborane cage can have potential to be used as sensitizers in photodynamic therapy (PDT) and boron neutron capture therapy (BNCT) by their singlet oxygen efficiencies (??=0.41, 0.39). PMID:25222320

  12. Electronic structure of a vapor-deposited metal-free phthalocyanine thin film

    NASA Astrophysics Data System (ADS)

    Alfredsson, Y.; Brena, B.; Nilson, K.; Åhlund, J.; Kjeldgaard, L.; Nyberg, M.; Luo, Y.; Mârtensson, N.; Sandell, A.; Puglia, C.; Siegbahn, H.

    2005-06-01

    The electronic structure of a vapor-sublimated thin film of metal-free phthalocyanine (H2Pc) is studied experimentally and theoretically. An atom-specific picture of the occupied and unoccupied electronic states is obtained using x-ray-absorption spectroscopy (XAS), core- and valence-level x-ray photoelectron spectroscopy (XPS), and density-functional theory (DFT) calculations. The DFT calculations allow for an identification of the contributions from individual nitrogen atoms to the experimental N1s XAS and valence XPS spectra. This comprehensive study of metal-free phthalocyanine is relevant for the application of such molecules in molecular electronics and provides a solid foundation for identifying modifications in the electronic structure induced by various substituent groups.

  13. Structural and electronic properties of porphyrins and phthalocyanines self assembled on conductive surfaces

    NASA Astrophysics Data System (ADS)

    Wiggins, Bryan Cortez

    Phthalocyanine and porphyrin compounds are intensively studied for their important physical and electronic properties. These organic compounds possess semiconductor properties that make them great candidates for several thin film applications such as: photovoltaics devices, organic light emitted diodes (OLED), and sensors. Before these compound can be used to construct devices their structural and electronic properties at the molecular level must be understood. Scanning tunneling microscopy (STM) was used to investigate the geometrical structure of the aggregate and/or monolayer of the compound. X-ray photoelectron spectroscopy (XPS) studies show the chemical formation such as film composition and protonation state of nitrogens in the macrocycle ring. Ultraviolet photoelectron (UPS) and scanning tunneling spectroscopy, more specifically orbital mediated tunneling spectroscopy (OMTS) provided more insight into the electronic structure of these compounds. Three different compounds will be discussed in the following, diacid tetrasulfonatophenylporphine H2(H4TSPP), tetrakis (4-sulfonatophenyl) phthalocyanine (TSPc) and metal free naphthalocaynine (H2Nc).

  14. Electrical Properties of Organic Solids. II. Effects of Added Electron Acceptor on Metal-Free Phthalocyanine

    Microsoft Academic Search

    David R. Kearns; Gordon Tollin; Melvin Calvin

    1960-01-01

    The addition of ortho-chloranil to the surface of films of metal-free phthalocyanine has been found (a) to increase the dark conductivity of such films by as much as 107, (b) to increase the steady-state photoconductivity by as much as 105, and (c) to result in the formation of unpaired electrons whose concentration decreases reversibly as a result of illumination. These

  15. Spectra of porphyrins XI. Absorption and fluorescence spectra of matrix isolated phthalocyanines

    Microsoft Academic Search

    Larry Bajema; Martin Gouterman; Beat Meyer

    1968-01-01

    Absorption and fluorescence spectra of free base and zine phthalocyanines (H2Pc and ZnPc) were studied in matrices of Ar, Kr, Xe, CH4, N2, and SF6 at liquid hydrogen temperature. ZnPc was also studied in CO. The spectra show considerable fine structure whose resolution decreases along the series Ar > CH4 >~ Kr >~ Xe > N2 >~ SF6 > CO.

  16. Peripheral Substitution of a Near-IR-Absorbing Soluble Phthalocyanine Using "Click" Chemistry

    SciTech Connect

    Mayukh, Mayank [Univ. of Arizona, Tucson, AZ (United States); Lu, Chin-Wei [Univ. of Arizona, Tucson, AZ (United States); Hernandez, Edgardo [Univ. of Arizona, Tucson, AZ (United States); McGrath, Dominic V. [Univ. of Arizona, Tucson, AZ (United States)

    2011-07-18

    A series of near-IR-absorbing soluble phthalocyanines (Pcs) with eight alkyne moieties as side chains of the chromophore have been synthesized. One of these Pcs has been used as a scaffold for functional group modification using alkyne–azide click chemistry with various azides. This led to a small library of Pcs with photo and thermal crosslinkable, dendritic, and hydrophilic moieties starting from a single Pc molecule. A patterned thin film was fabricated by photocrosslinking one of these Pc derivatives.

  17. Device Characteristics of Organic Static Induction Transistor Using Copper Phthalocyanine Films and Al Gate Electrode

    Microsoft Academic Search

    Dong Xing Wang; Yasuhiro Tanaka; Masaaki Iizuka; Shigekazu Kuniyoshi; Kazuhiro Kudo; Kuniaki Tanaka

    1999-01-01

    We have fabricated organic static induction transistors (SITs) using copper phthalocyanine (CuPc) films. The organic SITs have a layered structure of Au (drain)\\/CuPc\\/Al (gate)\\/CuPc\\/Au (source)\\/glass. The electrical characteristics of SITs show that the source-drain current is controlled by the bias voltage applied to the Al gate electrode and a typical SIT operation with unsaturated current characteristics is examined. Furthermore, excellent

  18. Complex impedance measurements of capacitor structures on silicon with copper phthalocyanine dielectric

    Microsoft Academic Search

    Rasoul Nowroozi-Esfahani; G. Jordan Maclay

    1990-01-01

    Measurements were made of the capacitance and the conductance of several capacitor structures with a copper phthalocyanine (CuPc) dielectric at different voltages and in the frequency range of 102–106 Hz. A thermally evaporated CuPc film about 1300 A? thick was fabricated in a parallel-plate capacitor between gold and aluminum electrodes (Al‖CuPc‖Au). Two distributions of relaxation times are observed in this

  19. Biodegradation of azo and phthalocyanine dyes by Trametes versicolor and Bjerkandera adusta

    Microsoft Academic Search

    A. Heinfling; M. Bergbauer; U. Szewzyk

    1997-01-01

    Eighteen fungal strains, known for their ability to degrade lignocellulosic material or lignin derivatives, were screened\\u000a for their potential to decolorize commercially used reactive textile dyes. Three azo dyes, Reactive Orange 96, Reactive Violet\\u000a 5 and Reactive Black 5, and two phthalocyanine dyes, Reactive Blue 15 and Reactive Blue 38, were chosen as representatives\\u000a of commercially used reactive dyes. From

  20. Single crystal growth of copper phthalocyanine using exaltation–evaporation growth method

    Microsoft Academic Search

    Wenhai Jiang; Xu Wang; Yuchun Chang; Shukun Yu; Chunyu Ma; Kaiqi Ye; Chuanhui Cheng; Guotong Du

    2006-01-01

    A new method of growing single crystal for ?-form copper phthalocyanine (CuPc) is presented in this paper. Melted anthracene was used as solvent of CuPc. The method, vaporizing the solvent using an automatic exaltation machine, was employed to grow CuPc single crystals. The needle-like single crystals of CuPc up to 11.6mm in length were obtained by applying this method. The

  1. Phthalocyanine-based photoelectrical cells: effect of environment on power conversion efficiency

    Microsoft Academic Search

    Georgij L. Pakhomov; Lev G. Pakhomov; Vlad V. Travkin; Mikhail V. Abanin; Pavlo Y. Stakhira; Vladyslav V. Cherpak

    2010-01-01

    We have fabricated single-layer sandwich cells containing photoactive molecular layer (vanadyl phthalocyanine complex) and\\u000a tested them in various environments. In contrast with dry gases, such as argon, oxygen, and ammonia, which cause the changes\\u000a mainly in the first quadrant of J–V plots, addition of water vapor resulted in appearance of significant dark short-circuit currents and open circuit voltages.\\u000a These values

  2. Interaction of Colistin and Colistin Methanesulfonate with Liposomes: Colloidal Aspects and Implications for Formulation

    PubMed Central

    WALLACE, STEPHANIE J.; LI, JIAN; NATION, ROGER L.; PRANKERD, RICHARD J.; BOYD, BEN J.

    2012-01-01

    Interaction of colistin and colistin methanesulfonate (CMS) with liposomes has been studied with the view to understanding the limitations to the use of liposomes as a more effective delivery system for pulmonary inhalation of this important class of antibiotic. Thus, in this study, liposomes containing colistin or CMS were prepared and characterized with respect to colloidal behavior and drug encapsulation and release. Association of anionic CMS with liposomes induced negative charge on the particles. However, degradation of the CMS to form cationic colistin over time was directly correlated with charge reversal and particle aggregation. The rate of degradation of CMS was significantly more rapid when associated with the liposome bilayer than when compared with the same concentration in aqueous solution. Colistin liposomes carried positive charge and were stable. Encapsulation efficiency for colistin was approximately 50%, decreasing with increasing concentration of colistin. Colistin was rapidly released from liposomes on dilution. Although the studies indicate limited utility of colistin or CMS liposomes for long duration controlled-release applications, colistin liposomes were highly stable and may present a potential opportunity for coformulation of colistin with a second antibiotic to colocalize the two drugs after pulmonary delivery. PMID:22623044

  3. Effective mucoadhesive liposomal delivery system for risedronate: preparation and in vitro/in vivo characterization

    PubMed Central

    Jung, Il-Woo; Han, Hyo-Kyung

    2014-01-01

    In this work, we aimed to develop chitosan-coated mucoadhesive liposomes containing risedronate to improve intestinal drug absorption. Liposomes containing risedronate were prepared with 1,2-distearoryl-sn-glycero-3-phosphocholine and distearoryl-sn-glycero-3-[phospho-rac-(1-glycerol)] using the freeze-drying method, with subsequent coating of the anionic surfaces of the liposomes with chitosan. The in vitro characteristics of the chitosan-coated liposomes were investigated, including their stability, mucoadhesiveness, and Caco-2 cell permeability. This formulation was stable in simulated gastric and intestinal fluids, with the percentage of drug remaining in the liposomes being more than 90% after 24 hours of incubation. Chitosan-coated liposomes also showed strong mucoadhesive properties, implying potential electrostatic interaction with the mucous layer in the gastrointestinal tract. Compared with the untreated drug, chitosan-coated liposomes significantly enhanced the cellular uptake of risedronate, resulting in an approximately 2.1–2.6-fold increase in Caco-2 cells. Further, the chitosan-coated liposomes increased the oral exposure of risedronate by three-fold in rats. Taken together, the results of this study suggest that chitosan-coated liposomes containing risedronate should be effective for improving the bioavailability of risedronate. PMID:24872692

  4. Fate of cationic liposomes and their complex with oligonucleotive in vivo

    Microsoft Academic Search

    David C. Litzinger; Jeffrey M. Brown; Iwona Wala; Stephen A. Kaufman; Gwyneth Y. han; Catherine L. Farrell; David Collins

    1996-01-01

    The present studies vescribe the biodistribution of cationic liposomes and cationic liposome\\/oligonucleotive complex following intravenous injection into mice via the tail vein. 111In-diethylenetriaminepentaacetic acid stearylamive (111In-DTPA-SA) was used as a lipid-phase radiolabel. Inclusion of up to 5 mol% DTPA-SA in liposomes composed of 3?-(N-(N?,N?-dimethylaminoethane)carbomoyl)cholesterol (DC-Chol) and dioleoylphosphatidylethanolamine (DOPE) did not influence liposome formation or size, nor the binding\\/uptake or fusion

  5. Studies on pectin-coated liposomes and their interaction with mucin.

    PubMed

    Klemetsrud, Therese; Jonassen, Helene; Hiorth, Marianne; Kjøniksen, Anna-Lena; Smistad, Gro

    2013-03-01

    Pectin is a polymer with well-known mucoadhesive properties. In this study, liposomes were coated with three different types of pectin. Their properties were characterized and their mucoadhesiveness was estimated by a novel in vitro approach. Two different types of commercially available mucin were investigated in order to choose the best candidate for the method. The effect of pH on the properties of the coated liposomes and the interaction with mucin was also studied. The pectin-coated liposomes and the complexes they formed with mucin were characterized by dynamic light scattering (DLS), zeta potential and turbidity measurements. The zeta potential of the liposomes shifted from positive to negative after coating with pectin. They also exhibited larger diameters, and the liposomes coated with HM-pectin were the largest. After the addition of mucin, the zeta potential shifted to a less negative value and the sizes of the pectin-coated liposomes increased. The complexes formed between mucin and the HM-pectin-coated liposomes were the largest, while the smallest were formed with the LM-pectin-coated liposomes. The pH was found to affect the interaction between the coated liposomes and mucin. DLS was conducted on an ALV goniometer to gain information about the diffusivity of the samples, the relative scattered intensities and to obtain an optimal characterization of the size distributions. The results correlated well with measurements from an automatized light scattering instrument (Zetasizer Nano ZS). PMID:23201733

  6. Optimization on Preparation Conditions of Salidroside Liposome and Its Immunological Activity on PCV-2 in Mice

    PubMed Central

    Feng, Yibo; Zhao, Xiaojuan; Lv, Fang; Zhang, Jinqiu; Deng, Bihua; Zhao, Yanhong; Hu, Yuanliang; Wang, Deyun; Liu, Jiaguo; Lu, Yu; Bo, Ruonan; Liu, Zhenguang

    2015-01-01

    The aim of this study was to optimize the preparation conditions of salidroside liposome with high encapsulation efficiency (EE) and to study the immunological enhancement activity of salidroside liposome as porcine circovirus type 2 virus (PCV-2) vaccine adjuvant. Response surface methodology (RSM) was selected to optimize the conditions for the preparation of salidroside liposome using Design-Expert V8.0.6 software. Three kinds of salidroside liposome adjuvants were prepared to study their adjuvant activity. BALB/c mice were immunized with PCV-2 encapsulated in different kinds of salidroside liposome adjuvants. The PCV-2-specific IgG in immunized mice serum was determined with ELISA. The results showed that when the concentration of ammonium sulfate was 0.26?mol·L?1, ethanol volume 6.5?mL, temperature 43°C, ethanol injection rate 3?mL·min?1, and salidroside liposome could be prepared with high encapsulation efficiency of 94.527%. Salidroside liposome as adjuvant could rapidly induce the production of PCV-2-specific IgG and salidroside liposome I adjuvant proved to provide the best effect among the three kinds of salidroside liposome adjuvants. PMID:25878712

  7. Physical and Oxidative Stability of Uncoated and Chitosan-Coated Liposomes Containing Grape Seed Extract

    PubMed Central

    Gibis, Monika; Rahn, Nina; Weiss, Jochen

    2013-01-01

    Polyphenol-rich grape seed extract (0.1 w/w%) was incorporated in liposomes (1 w/w% soy lecithin) by high pressure homogenization (22,500 psi) and coated with chitosan (0.1 w/w%). Primary liposomes and chitosan-coated secondary liposomes containing grape seed extract showed good physical stability during 98 days of storage. Most of the polyphenols were incorporated in the shell of the liposomes (85.4%), whereas only 7.6% of the polyphenols of grape seed extract were located in the interior of the liposomes. Coating with chitosan did not change the polyphenol content in the liposomes (86.6%). The uncoated liposomes without grape seed extract were highly prone to lipid oxidation. The cationic chitosan coating, however, improved the oxidative stability to some extent, due to its ability to repel pro-oxidant metals. Encapsulated grape seed extract showed high antioxidant activity in both primary and secondary liposomes, which may be attributed to its polyphenol content. In conclusion, the best chemical stability of liposomes can be achieved using a combination of grape seed extract and chitosan. PMID:24300515

  8. Undulating tubular liposomes through incorporation of a synthetic skin ceramide into phospholipid bilayers.

    PubMed

    Xu, Peng; Tan, Grace; Zhou, Jia; He, Jibao; Lawson, Louise B; McPherson, Gary L; John, Vijay T

    2009-09-15

    Nonspherical liposomes were prepared by doping L-alpha-phosphatidylcholine (PC) with ceramide VI (a skin lipid). Cryo-transmission electron microscopy shows the liposome shape changing from spherical to an undulating tubular morphology, when the amount of ceramide VI is increased. The formation of tubular liposomes is energetically favorable and is attributed to the association of ceramide VI with PC creating regions of lower curvature. Since ceramides are the major component of skin lipids in the stratum corneum, tubular liposomes containing ceramide may potentially serve as self-enhanced nanocarriers for transdermal delivery. PMID:19694462

  9. Effect of liposomalization on the antitumor activity, side-effects and tissue distribution of CPT-11.

    PubMed

    Sadzuka, Y; Hirotsu, S; Hirota, S

    1998-05-15

    We have examined the efficacy of liposomalization and polyethyleneglycol (PEG) modification of liposomes on the antitumor activity, side-effects and tissue distribution of irinotecan hydrochloride (CPT-11). PEG-liposome was confirmed to elevate the plasma circulation of CPT-11 and SN-38 (active metabolite) concentrations. The tumor accumulation of CPT-11 and SN-38 was increased by the PEG-modified liposomes. The antitumor activity of CPT-11 increased due to the elevated tumor distribution of CPT-11 and SN-38 levels by the PEG-modified liposomes. In the tumor, CPT-11 was converted to SN-38. Thus, it is considered that passive targeting to the tumor by liposomalization elevated the SN-38 level in the tumor especially and increased the antitumor activity of CPT-11. Furthermore, intestinal disorder, a side toxicity of CPT-11, decreased dependent on the CPT-11 and SN-38 concentrations in the bile by liposomalization. Although the liposomes induce improved tissue distribution of the prodrug, the tissue distribution of active metabolites does not always improve. However, CPT-11-entrapped liposome was useful, as CPT-11 is converted to SN-38 in the tumor. These results suggested that the usefulness of CPT-11 could be extended. PMID:9619864

  10. Intracellular accumulation of ofloxacin-loaded liposomes in human synovial fibroblasts.

    PubMed Central

    Fresta, M; Spadaro, A; Cerniglia, G; Ropero, I M; Puglisi, G; Furneri, P M

    1995-01-01

    In order to incorporate ofloxacin within liposomes, the reverse-phase evaporation technique was carried out. The liposome lipid matrix consisted of dipalmitoylphosphatidylcholine-cholesterol-dihexadecylphosphate (4: 3:4 molar ratio). The liposome formulation presented a mean size of 185 +/- 31 nm and had an encapsulation capacity of 5.3 microliters/mumol. The liposome formulation was able to deliver ofloxacin into McCoy cells in a greater amount (2.6-fold) than the free drug, improving antibiotic accumulation. PMID:7574534

  11. Mechanistic Studies on the Triggered Release of Liposomal Contents by Matrix Metalloproteinase-9

    PubMed Central

    Elegbede, Adekunle I.; Banerjee, Jayati; Hanson, Andrea J.; Tobwala, Shakila; Ganguli, Bratati; Wang, Rongying; Lu, Xiaoning; Srivastava, D. K.; Mallik, Sanku

    2009-01-01

    Matrix metalloproteinases (MMPs) are a class of extracellular matrix degrading enzymes over-expressed in many cancers and contribute to the metastatic ability of the cancer cells. We have recently demonstrated that liposomal contents can be released when triggered by the enzyme MMP-9. Herein, we report our results on the mechanistic studies of the MMP-9 triggered release of the liposomal contents. We synthesized peptides containing the cleavage site for MMP-9 and conjugated them with fatty acids to prepare the corresponding lipopeptides. By employing Circular Dichroism spectroscopy, we demonstrate that the lipopeptides, when incorporated in liposomes, are de-mixed in the lipid bilayers and generate triple helical structures. MMP-9 cleaves the triple helical peptides, leading to the release of the liposomal contents. Other MMPs, which cannot hydrolyze triple helical peptides, failed to release the contents from the liposomes. We also observed that the rate and the extent of release of the liposomal contents depend on the mismatch between acyl chains of the synthesized lipopeptide and phospholipid components of the liposomes. Circular Dichroism spectroscopic studies imply that the observed differences in the release reflect the ability of the liposomal membrane to anneal the defects following the enzymatic cleavage of the liposome-incorporated lipopeptides. PMID:18642903

  12. Liposome-enhanced immunomigration strips for field screening of toxic chemicals

    SciTech Connect

    Roberts, M.A.; Reeves, S.G.; Siebert, S.T.; Durst, R.A. [Cornell Univ., Geneva, NY (United States). Analytical Chemistry Labs.; [Cornell Univ., Ithaca, NY (United States). National Nanofabrication Facility

    1995-12-31

    The use of liposomes containing encapsulated dye to provide instantaneous enhancement of signals generated in competitive immunoassays is described for two model analytes of environmental concern, alachlor and PCBs. The application of this strategy to field assays is demonstrated utilizing two complementary assay designs based on immunomigration along a nitrocellulose test strip. The liposome immunocompetition (LIC) assay involves immobilizing antibodies onto a strip and allowing the sample and analyte-tagged, dye-containing liposomes to migrate through this zone. Liposomes passing through without binding, as a result of competition from the sample analyte, are totally bound in an upper collection region, and the degree of color in this region is proportional to the analyte concentration. The liposome immunoaggregation (LIA) assay detects antibody-liposome association in a homogeneous incubation solution into which a test strip is subsequently placed. Antibody-bound aggregates of liposomes are trapped on the porous nitrocellulose test strip at the level of the meniscus, due to mechanisms that will be discussed. However, sample analyte competitively inhibits antibody-liposome association and, therefore, a proportional amount of unbound liposomes will escape entrapment on the nitrocellulose and can then be collected and quantitated in a measurement zone. This latter technique shows enhanced sensitivity, but involves an extra incubation step. Therefore these two techniques may be used interchangeably depending on the sensitivity and time requirements of a particular project. Prototype assay designs are demonstrated here and emerging detection strategies are discussed.

  13. A novel and simple type of liposome carrier for recombinant interleukin-2.

    PubMed

    Kanaoka, E; Takahashi, K; Yoshikawa, T; Jizomoto, H; Nishihara, Y; Hirano, K

    2001-03-01

    The strong interaction between recombinant interleukin-2 (IL-2) and liposome was characterized and its possible application to drug-delivery control considered. The liposomes were prepared with egg phosphatidylcholine, distearoyl-phosphatidylglycerol (DSPG), dipalmitoyl-phosphatidylcholine, dipalmitoyl-phosphatidylglycerol or distearoyl-phosphatidylcholine (DSPC). Small and hydrophobic liposomes were selected, which were composed of saturated and long-fatty-acid-chain phospholipids. When the composition and the mixture ratio of IL-2 and the liposomewere optimized, morethan 95% ofthe lyophilized IL-2 (Imunace, 350000 JRU) was adsorbed consistently onto the DSPC-DSPG liposome (molar ratio, 10:1; 25 micromol mL(-1); 30 nm in size). Merely mixing IL-2 lyophilized with liposome suspension is convenient pharmaceutically. After intravenous administration to mice, liposomal IL-2 was eliminated half as slowly from the systemic circulation as free IL-2, with more than 13 and 18 times more IL-2 being delivered to the liver and spleen, respectively. After subcutaneous administration of liposomal IL-2 to mice, the mean residence time of IL-2 in the systemic circulation was 8 times that of free IL-2. These results show that IL-2 consistently adsorbs onto the surface of liposomes after optimization of its composition and mixing ratio. Intravenous and subcutaneous administration to mice demonstrates the gradual release of IL-2. Further trials are warranted using these liposomes. PMID:11291744

  14. Accelerated clearance of a second injection of PEGylated liposomes in mice.

    PubMed

    Ishida, Tatsuhiro; Masuda, Kaori; Ichikawa, Takako; Ichihara, Masako; Irimura, Kenji; Kiwada, Hiroshi

    2003-04-14

    We recently reported that the firstly injected PEGylated liposomes dramatically affected the rate of blood clearance of secondly injected PEGylated liposomes in rats in a time interval of injection dependent manner [J. Control. Release (2003)]. Mice are frequently used in evaluations of the therapeutic efficacy of PEGylated liposomal formulations, but the pharmacokinetics of repeatedly injected PEGylated liposomes in mice is not fully understood. In this study, therefore, we examined in mice the effect of the repeated injection of PEGylated liposomes on their pharmacokinetics. An intravenous pretreatment with PEGylated liposomes produced a striking change in the biodistribution of the second dose which was given several days after the first injection. The first dose resulted in a reduction in the circulation half-life of the second dose. The degree of alteration was dependent on the time interval between the injections. The rapid clearance of the second dose was strongly related to hepatic clearance (CLh). This finding suggests that a considerable increase in hepatic accumulation accounts for this phenomenon. But, no liver injury or an increase in the number of Kupffer cells were detected in histopathological evaluations. Collectively, although the multiple injections of the PEGylated liposomes had no obvious physical effects, such as inflammation, their pharmacokinetic behavior was clearly altered in mice. The results obtained here have important implications not only with respect to the design and engineering of liposomes for human use, but for evaluating the therapeutic efficacy of liposomal formulations in experimental animal models as well. PMID:12672612

  15. Toxicity of gamma irradiated liposomes. 1. In vitro interactions with blood components.

    PubMed

    Stensrud, G; Passi, S; Larsen, T; Sandset, P M; Smistad, G; Mönkkönen, J; Karlsen, J

    1999-02-01

    Gamma irradiation is a potential technique for sterilisation of liposome suspensions. Unfortunately, gamma irradiation may result in chemical degradation of the phospholipids and the toxicological aspects have to be considered. The effects of liposome composition and gamma irradiation on the interactions of the liposomes with the hemostatic mechanisms (hemolysis, aggregation and coagulation) were studied. Non-irradiated liposome suspensions showed no hemolysis of erythrocytes. After irradiation, up to 3.1% hemolysis was measured. Least hemolysis was observed with irradiated liposomes composed of unsaturated or charged phospholipids. The negatively charged DSPG-liposomes (both non-irradiated and irradiated) induced aggregation of platelets as observed by the spectrophotometric method. However, no aggregates were seen in the microscope or measured by the aggregometer. Negatively charged liposomes also affected the coagulation cascade where prolonged coagulation times were measured. Irradiation of the liposome suspensions resulted in even longer coagulation times. The prolonged coagulation times correlated to some extent with the measured binding and depletion of calcium from plasma by the negatively charged liposomes. PMID:10205623

  16. Conjugates of phthalocyanines with oligonucleotides as reagents for sensitized or catalytic DNA modification.

    PubMed

    Chernonosov, Alexander A; Koval, Vladimir V; Knorre, Dmitrii G; Chernenko, Alexander A; Derkacheva, Valentina M; Lukyanets, Eugenii A; Fedorova, Olga S

    2006-01-01

    Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2) (-), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)-G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

  17. Metal-phthalocyanine ordered layers on Au(110): Metal-dependent adsorption energy

    SciTech Connect

    Massimi, Lorenzo, E-mail: lorenzo.massimi@uniroma1.it; Angelucci, Marco; Gargiani, Pierluigi; Betti, Maria Grazia [Dipartimento di Fisica, Università di Roma La “Sapienza,” 00185 Roma (Italy); Montoro, Silvia [IFIS Litoral, CONICET-UNL, Laboratorio de Fisica de Superficies e Interfaces, Güemes 3450, Santa Fe (Argentina); Mariani, Carlo, E-mail: carlo.mariani@uniroma1.it [Dipartimento di Fisica, CNISM, Università di Roma La “Sapienza,” 00185 Roma (Italy)

    2014-06-28

    Iron-phthalocyanine and cobalt-phthalocyanine chains, assembled along the Au(110)-(1×2) reconstructed channels, present a strong interaction with the Au metallic states, via the central metal ion. X-ray photoemission spectroscopy from the metal-2p core-levels and valence band high-resolution ultraviolet photoelectron spectroscopy bring to light signatures of the interaction of the metal-phthalocyanine single-layer with gold. The charge transfer from Au to the molecule causes the emerging of a metal-2p core level component at lower binding energy with respect to that measured in the molecular thin films, while the core-levels associated to the organic macrocycle (C and N 1s) are less influenced by the adsorption, and the macrocycles stabilize the interaction, inducing a strong interface dipole. Temperature Programmed Desorption experiments and photoemission as a function of temperature allow to estimate the adsorption energy for the thin-films, mainly due to the molecule-molecule van der Waals interaction, while the FePc and CoPc single-layers remain adsorbed on the Au surface up to at least 820 K.

  18. Oxygen electroreduction on multi-walled carbon nanotube supported metal phthalocyanines and porphyrins in alkaline media.

    PubMed

    Kruusenberg, Ivar; Matisen, Leonard; Tammeveski, Kaido

    2013-01-01

    Metal phthalocyanine and porphyrin modified electrodes were prepared using multi-walled carbon nanotubes (MWCNTs) as a support material. The catalyst materials were heat-treated before electrochemical testing. X-ray photoelectron spectroscopic study was carried out in order to examine the surface composition. The electroreduction of oxygen has been investigated on Fe phthalocyanine/MWCNT, Co phthalocyanine/MWCNT, Fe porphyrin/MWCNT and Co porphyrin/MWCNT catalysts. Electrochemical experiments were carried out in 0.1 M KOH employing the rotating disk electrode (RDE) method. The glassy carbon (GC) disk electrodes were modified with MN4 macrocycle/MWCNT catalysts using Tokuyama AS-4 ionomer. Electrochemical characterization of the materials showed that all the MN4 macrocycle/MWCNT modified GC electrodes are highly active for the reduction of oxygen in alkaline solutions. Particularly high electrocatalytic activity was observed for porphyrin-based electrodes heat-treated at 800 degrees C. The RDE results obtained are significant for the development of alkaline membrane fuel cells. PMID:23646786

  19. Controlling Morphology and Molecular Packing of Alkane Substituted Phthalocyanine Blend Bulk Heterojunction Solar Cells†

    PubMed Central

    Jurow, Matthew J.; Hageman, Brian A.; Nam, Chang-Yong; Pabon, Cesar; Black, Charles T.

    2013-01-01

    Systematic changes in the exocyclic substiution of core phthalocyanine platform tune the absorption properties to yield commercially viable dyes that function as the primary light absorbers in organic bulk heterojunction solar cells. Blends of these complementary phthalocyanines absorb a broader portion of the solar spectrum compared to a single dye, thereby increasing solar cell performance. We correlate grazing incidence small angle x-ray scattering structural data with solar cell performance to elucidate the role of nanomorphology of active layers composed of blends of phthalocyanines and a fullerene derivative. A highly reproducible device architecture is used to assure accuracy and is relevant to films for solar windows in urban settings. We demonstrate that the number and structure of the exocyclic motifs dictate phase formation, hierarchical organization, and nanostructure, thus can be employed to tailor active layer morphology to enhance exciton dissociation and charge collection efficiencies in the photovoltaic devices. These studies reveal that disordered films make better solar cells, short alkanes increase the optical density of the active layer, and branched alkanes inhibit unproductive homogeneous molecular alignment. PMID:23589766

  20. Self-organization of phthalocyanine--[60]fullerene dyads in liquid crystals.

    PubMed

    de la Escosura, Andrés; Martínez-Díaz, M Victoria; Barbera, Joaquín; Torres, Tomas

    2008-02-15

    The use of blends in which a mesogen induces mesomorphism into a non-mesogenic compound has made possible the self-organization of phthalocyanine--[60]fullerene (Pc-C60) dyads into liquid crystals. Pc-C60 dyads 1, 2, or 3, in which two photoactive units are brought together by a phenylenevinylene spacer, have been synthesized through a Heck reaction that links 4-vinylbenzaldehyde to a monoiodophthalocyanine precursor, followed by standard cycloaddition of azomethine ylides--generated from the formylPc derivative and N-methylglycine--to one of the double bonds of C60. The mesomorphic and thermal properties of different mixtures formed by the liquid-crystalline phthalocyanine 4 and dyads 1, 2, or 3 were examined using polarizing optical microscopy (POM), differential scanning calorimetry (DSC), and X-ray diffraction (XRD). DSC diagrams of the blends show clear transitions from the crystalline state to a mesophase, and the measured structural parameters obtained from the powder diffraction experiments are consistent with a discotic hexagonal columnar (Col h) structure. Considering that segregation in domains of separated molecules of Pc-C60 dyad and phthalocyanine 4 would preclude mesomorphism due to the mismatch in the column diameter and to the lack of mesogenic character of the pure dyads, a predominance of alternating stacking is proposed. Additionally, the observed decrease in the calculated density of the blend mesophases relative to the mesophase of pure compound 4 is important evidence in this direction. PMID:18197683

  1. NIR photocleavage of the Si-C bond in axial Si-phthalocyanines.

    PubMed

    Doane, Tennyson; Cheng, Yu; Sodhi, Nipun; Burda, Clemens

    2014-11-13

    The use of light-triggered photolysis provides a powerful tool for unique syntheses and for applications that require remote operation such as drug delivery or molecular switches. Here, we describe the photochemistry of a recently developed alkylsilicon phthalocyanine Pc 227, which undergoes an exchange of the alkyl ligand for a ligand derived from the solvent when the axial Si-C bond is photolyzed in a solvent with low-energy visible light. In this work with methanol as the solvent, we investigate the formation of the methoxy analogue of the therapeutic drug Pc 4, (termed Pc 233) upon irradiation. Using steady-state spectroscopy and characterization of the photoproducts, the competing pathways between direct ligand exchange on the central silicon atom and delocalization of the radical produced by homolysis on the phthalocyanine ring is observed. The delocalized radical intermediate is quite long-lived. At long times this intermediate decomposes without significant formation of Pc 233. The results of this investigation provide insights into recent work utilizing Pc 227 for drug delivery applications and for future work on the use of phthalocyanines as long-wavelength phototriggers. PMID:25153643

  2. Aqueous Speciation and Electrochemical Properties of a Water-Soluble Manganese Phthalocyanine Complex#

    PubMed Central

    Blakemore, James D.; Hull, Jonathan F.

    2012-01-01

    The speciation behavior of a water-soluble manganese(III) tetrasulfonated phthalocyanine complex was investigated with UV-visible and electron paramagnetic resonance (EPR) spectroscopies, as well as cyclic voltammetry. Parallel-mode EPR (in dimethylformamide:pyridine solvent mix) reveals a six-line hyperfine signal, centered at a g-value of 8.8, for the manganese(III) monomer, characteristic of the d4 S=2 system. The color of an aqueous solution containing the complex is dependent upon the pH of the solution; the phthalocyanine complex can exist as a water-bound monomer, a hydroxide-bound monomer, or an oxo-bridged dimer. Addition of coordinating bases such as borate or pyridine changes the speciation behavior by coordinating the manganese center. From the UV-visible spectra, complete speciation diagrams are plotted by global analysis of the pH-dependent UV-visible spectra, and a complete set of pKa values is obtained by fitting the data to a standard pKa model. Electrochemical studies reveal a pH-independent quasi-reversible oxidation event for the monomeric species, which likely involves oxidation of the organic ligand to the radical cation species. Adsorption of the phthalocyanine complex on the carbon working electrode was sometimes observed. The pKa values and electrochemistry data are discussed in the context of the development of mononuclear water-oxidation catalysts. PMID:22585306

  3. Structure and Morphology of Phthalocyanine Films Grown in Electrical Fields by Vapor Deposition

    NASA Technical Reports Server (NTRS)

    Zhu, Shen; Banks, Curtis E.; Frazier, Donald O.; Penn, Benjamin; Abdeldayem, Hossin; Hicks, Roslin

    1999-01-01

    Phthalocyanine is a very stable organic material in the atmosphere and has been used in numerous applications, such as optical switching and optical storage devices. Although this material has already been discovered for several decades and has had extensive studies conducted on it, many properties still need to be better understood, for example, the mechanisms of forming different solid phases and of changing film morphology by external forces. Phthalocyanine has two preferred solid phases (alpha and beta phases) for which the crystal structures, surface morphology and optical properties are different. In order to investigate these phenomena and the relationship among them, phthalocyanine films have been synthesized by vapor deposition on quartz substrates with and without an external electrical field. Some substrates were coated with a very thin gold film for the electrical field. These films have been characterized using x-ray diffraction, scanning electron microscopy, Fourier transfer infrared spectroscopy, and Z-scan technique. The films have excellent chemical and thermal stability. However, the surface of these films grown without the electrical field shows flower-like morphology. When films are deposited under an electrical field (approximately 3000 V/cm), an aligned structure is revealed on the surface. A comparison of the structure, morphology, optical properties, and the growth mechanism for these films with and without an electrical field will be discussed.

  4. Inhomogeneous charge transfer within monolayer zinc phthalocyanine absorbed on TiO2(110).

    PubMed

    Yu, Shun; Ahmadi, Sareh; Sun, Chenghua; Adibi, Pooya Tabib Zadeh; Chow, Winnie; Pietzsch, Annette; Göthelid, Mats

    2012-04-21

    The d-orbital contribution from the transition metal centers of phthalocyanine brings difficulties to understand the role of the organic ligands and their molecular frontier orbitals when it adsorbs on oxide surfaces. Here we use zinc phthalocyanine (ZnPc)/TiO(2)(110) as a model system where the zinc d-orbitals are located deep below the organic orbitals leaving room for a detailed study of the interaction between the organic ligand and the substrate. A charge depletion from the highest occupied molecular orbital is observed, and a consequent shift of N1s and C1s to higher binding energy in photoelectron spectroscopy (PES). A detailed comparison of peak shifts in PES and near-edge X-ray absorption fine structure spectroscopy illustrates a slightly uneven charge distribution within the molecular plane and an inhomogeneous charge transfer screening between the center and periphery of the organic ligand: faster in the periphery and slower at the center, which is different from other metal phthalocyanine, e.g., FePc/TiO(2). Our results indicate that the metal center can substantially influence the electronic properties of the organic ligand at the interface by introducing an additional charge transfer channel to the inner molecular part. PMID:22519339

  5. Inhomogeneous charge transfer within monolayer zinc phthalocyanine absorbed on TiO2(110)

    NASA Astrophysics Data System (ADS)

    Yu, Shun; Ahmadi, Sareh; Sun, Chenghua; Adibi, Pooya Tabib Zadeh; Chow, Winnie; Pietzsch, Annette; Göthelid, Mats

    2012-04-01

    The d-orbital contribution from the transition metal centers of phthalocyanine brings difficulties to understand the role of the organic ligands and their molecular frontier orbitals when it adsorbs on oxide surfaces. Here we use zinc phthalocyanine (ZnPc)/TiO2(110) as a model system where the zinc d-orbitals are located deep below the organic orbitals leaving room for a detailed study of the interaction between the organic ligand and the substrate. A charge depletion from the highest occupied molecular orbital is observed, and a consequent shift of N1s and C1s to higher binding energy in photoelectron spectroscopy (PES). A detailed comparison of peak shifts in PES and near-edge X-ray absorption fine structure spectroscopy illustrates a slightly uneven charge distribution within the molecular plane and an inhomogeneous charge transfer screening between the center and periphery of the organic ligand: faster in the periphery and slower at the center, which is different from other metal phthalocyanine, e.g., FePc/TiO2. Our results indicate that the metal center can substantially influence the electronic properties of the organic ligand at the interface by introducing an additional charge transfer channel to the inner molecular part.

  6. Inhomogeneous charge transfer within monolayer zinc phthalocyanine absorbed on TiO{sub 2}(110)

    SciTech Connect

    Yu Shun; Ahmadi, Sareh; Adibi, Pooya Tabib Zadeh; Chow, Winnie; Goethelid, Mats [Materials Physics, ICT, Royal Institute of Technology, Electrum 229, SE-16440 Stockholm (Sweden); Sun, Chenghua [University of Queensland, ARC Centre of Excellence for Functional Nanomaterials and Centre for Computational Molecular Science, Australia Institute for Bioengineering and Nanotechnology, University of Queensland, Qld 4072 (Australia); Pietzsch, Annette [Max-lab, Lund University, Box 118, SE- 22100 Lund (Sweden)

    2012-04-21

    The d-orbital contribution from the transition metal centers of phthalocyanine brings difficulties to understand the role of the organic ligands and their molecular frontier orbitals when it adsorbs on oxide surfaces. Here we use zinc phthalocyanine (ZnPc)/TiO{sub 2}(110) as a model system where the zinc d-orbitals are located deep below the organic orbitals leaving room for a detailed study of the interaction between the organic ligand and the substrate. A charge depletion from the highest occupied molecular orbital is observed, and a consequent shift of N1s and C1s to higher binding energy in photoelectron spectroscopy (PES). A detailed comparison of peak shifts in PES and near-edge X-ray absorption fine structure spectroscopy illustrates a slightly uneven charge distribution within the molecular plane and an inhomogeneous charge transfer screening between the center and periphery of the organic ligand: faster in the periphery and slower at the center, which is different from other metal phthalocyanine, e.g., FePc/TiO{sub 2}. Our results indicate that the metal center can substantially influence the electronic properties of the organic ligand at the interface by introducing an additional charge transfer channel to the inner molecular part.

  7. In situ metalation of free base phthalocyanine covalently bonded to silicon surfaces

    PubMed Central

    Lupo, Fabio; Tudisco, Cristina; Bertani, Federico; Dalcanale, Enrico

    2014-01-01

    Summary Free 4-undecenoxyphthalocyanine molecules were covalently bonded to Si(100) and porous silicon through thermic hydrosilylation of the terminal double bonds of the undecenyl chains. The success of the anchoring strategy on both surfaces was demonstrated by the combination of X-ray photoelectron spectroscopy with control experiments performed adopting the commercially available 2,3,9,10,16,17,23,24-octakis(octyloxy)-29H,31H-phthalocyanine, which is not suited for silicon anchoring. Moreover, the study of the shape of the XPS N 1s band gave relevant information on the interactions occurring between the anchored molecules and the substrates. The spectra suggest that the phthalocyanine ring interacts significantly with the flat Si surface, whilst ring–surface interactions are less relevant on porous Si. The surface-bonded molecules were then metalated in situ with Co by using wet chemistry. The efficiency of the metalation process was evaluated by XPS measurements and, in particular, on porous silicon, the complexation of cobalt was confirmed by the disappearance in the FTIR spectra of the band at 3290 cm?1 due to –NH stretches. Finally, XPS results revealed that the different surface–phthalocyanine interactions observed for flat and porous substrates affect the efficiency of the in situ metalation process. PMID:25551050

  8. Understanding domain symmetry in vanadium oxide phthalocyanine monolayers on Au (111)

    NASA Astrophysics Data System (ADS)

    Rochford, L. A.; Hancox, I.; Jones, T. S.

    2014-10-01

    Understanding the growth of organic semiconductors on solid surfaces is of key importance for the field of organic electronics. Non planar phthalocyanines have shown great promise in organic photovoltaic (OPV) applications, but little of the fundamental surface characterization to understand their structure and properties has been performed. Acquiring a deeper understanding of the molecule/substrate interaction in small molecule systems is a vital step in controlling structure/property relationships. Here we characterize the vanadium oxide phthalocyanine (VOPc)/Au (111) surface using a combination of low energy electron diffraction (LEED) and scanning tunneling microscopy (STM), obtaining complex diffraction patterns which can be understood using two dimensional fast Fourier transform (2D-FFT) analysis of STM images. These measurements reveal coexistence of three symmetrically equivalent in-plane orientations with respect to the substrate, each of which is imaged simultaneously within a single area. Combining scanning probe and diffraction measurements allows symmetrically related domains to be visualized and structurally analyzed, providing fundamental information useful for the structural engineering of non-planar phthalocyanine interfaces.

  9. Recognition of concanavalin A by cationic glucosylated liposomes.

    PubMed

    Mauceri, Alessandro; Borocci, Stefano; Galantini, Luciano; Giansanti, Luisa; Mancini, Giovanna; Martino, Antonio; Salvati Manni, Livia; Sperduto, Claudio

    2014-09-30

    The specificity of carbohydrate-lectin interaction has been reported as an attractive strategy for drug delivery in cancer therapy because of the high levels of lectins in several human malignancies. A novel cationic glucosylated amphiphile was therefore synthesized, as a model system, to attribute specificity toward d-glucose receptors to liposome formulations. Fluorescence experiments demonstrated that the monomeric glucosylated amphiphile is capable of interacting with fluorescently labeled concanavalin A, a D-glucose specific plant lectin. The interaction of concanavalin A with liposomes composed of a phospholipid and the glucosylated amphiphile was demonstrated by agglutination observed by optical density and dynamic laser light scattering measurements, thus paving the way to the preparation of other glycosilated amphiphiles differing for the length of polyoxyethylenic spacer, the sugar moieties, and/or the length of the hydrophobic chain. PMID:25185719

  10. Coiled coil driven membrane fusion between cyclodextrin vesicles and liposomes.

    PubMed

    Versluis, Frank; Voskuhl, Jens; Vos, Jan; Friedrich, Heiner; Ravoo, Bart Jan; Bomans, Paul H H; Stuart, Marc C A; Sommerdijk, Nico A J M; Kros, Alexander

    2014-12-28

    Controlled fusion events between natural membranes composed of phospholipids with synthetic unnatural membranes will yield valuable fundamental information on the mechanism of membrane fusion. Here, fusion between vastly different phospholipid liposomes and cyclodextrin amphiphile based vesicles (CDVs) controlled by a pair of coiled coil forming lipidated peptides was investigated. Fusion events were characterized using lipid and content mixing assays and the resulting hybrid assemblies were characterized with cryo-TEM imaging. The secondary/quaternary structure of the lipidated peptides at the membrane interface was studied using circular dichroism spectroscopy. This is the first example of targeted fusion between natural and non-natural bilayer membranes and the in situ formation of hybrid CDV-liposome structures is of interest as it yields fundamental information about the mechanism through which fusion proceeds. PMID:25367891

  11. Oxidative stability of polyunsaturated fatty acid in phosphatidylcholine liposomes.

    PubMed

    Araseki, Mina; Yamamoto, Kanako; Miyashita, Kazuo

    2002-12-01

    Synthesized PCs containing docosahexaenoic acid (DHA), arachidonic acid (AA), linoleic acid (LA), and palmitic acid (PA) at known positions in the glycerol moiety were oxidized in liposomes, bulk, and organic solvent. In bulk and organic solvent, the oxidative stability of PC decreased with increasing degrees of unsaturation. However, the degree of unsaturation had little effect on the stability of PC in liposomes. The oxidative stability of PC in liposomes would be affected by the chemical reactivity based on the degree of unsaturation and by the conformation of fatty acyl component in PC bilayers. When the oxidative stability of 1-PA-2-LA-PC or 1-PA-2-AA-PC was compared with that of a 1:1 (mol ratio) mixture of 1,2-diPA-PC + 1,2-diLA-PC, or 1,2-diPA-PC + 1,2-diAA-PC, respectively, the former PC was more oxidatively stable than that of the latter PC mixture in all oxidation systems, although the degree of unsaturation of 1-PA-2-PUFA-PC was the same as that of the corresponding mixture of diPA-PC + diPUFA-PC. The higher oxidative stability of 1-PA-2-PUFA-PC than that of a corresponding mixture of diPA-PC + diPUFA-PC in liposomes was suggested to be due to the different conformation of PC bilayers and the different rate of hydrogen abstraction by free radicals from intermolecular and intramolecular acyl groups. PMID:12596850

  12. Antioxidant activity of grape extracts in a lecithin liposome system

    Microsoft Academic Search

    Ock-Sook Yi; Anne S. Meyer; Edwin N. Frankel

    1997-01-01

    Extracts of 14 different grapes were tested for their antioxidant activities in a copper-catalyzed lecithin liposome oxidation\\u000a assay and analyzed for their phenolic components by high-performance liquid chromatography (HPLC). The total phenolic contents\\u000a of the grape extracts varied from 176 to 1236 mg gallic acid equivalents (GAE)\\/L. Extracts of red wine grape varieties contained\\u000a higher concentrations of phenolics than other

  13. Successful treatment of visceral leishmaniasis with liposomal amphotericin B.

    PubMed

    Lagler, Heimo; Matt, Ulrich; Sillaber, Christian; Winkler, Stefan; Graninger, Wolfgang

    2006-01-01

    We report a case of a 26-year-old female from Kenya who suffered from intermittent fever of unknown origin for one month. The major findings on admission were pancytopenia associated with considerable splenomegaly. The diagnosis was established by visualisation of amastigotes in bone marrow biopsy and by detection of antibodies to Leishmania spp. in blood. The infection was treated intravenously with liposomal amphotericin B for five days. The patient was afebrile after the first infusion. No relapse was reported. PMID:16918063

  14. Applications of Light and Electron Microscopic Techniques in Liposome Research

    Microsoft Academic Search

    A. YEKTA OZER

    Liposomes and some other vesicular systems are widely used as delivery vehicles for bioactive compounds. Successful applications\\u000a of these carrier systems in drug delivery, gene therapy and other health related areas depend on comprehensive understanding\\u000a of their physical properties including polydispersity and morphology. Variations in size and shape of the carrier systems\\u000a are indications of their stability and shelf life

  15. Toxicity of doxorubicin entrapped within long-circulating liposomes

    Microsoft Academic Search

    Toos Daemen; Joke Regts; Maarten Meesters; Marian T Ten Kate; Irma A. J. M Bakker-Woudenberg; Gerrit L Scherphof

    1997-01-01

    We studied the effect of doxorubicin entrapped within long-circulating liposomes (Dox-LCL) on the phagocytic capacity and bacterial blood clearance capacity of rat liver macrophages. Dox-LCL (125 nm in diameter) were composed of egg phosphatidylcholine (PC), cholesterol (CH) and poly(ethyleneglycol)distearoylphosphatidylethanolamine (PEG-PE) (55:45:5 molar ratio; MW PEG 1900), and loaded with doxorubicin by means of a trans-membrane pH gradient. The doxorubicin\\/lipid ratio

  16. Efficient Gene Transfer into Mammalian Cells Using Fusogenic Liposome

    Microsoft Academic Search

    Hiroyuki Mizuguchi; Tetsuhiko Nakagawa; Mahito Nakanishi; Susumu Imazu; Shinsaku Nakagawa; Tadanori Mayumi

    1996-01-01

    Fusogenic liposome (FL) based on Sendai virus constitutes a unique system that delivers the content efficiently into animal cellsin vitroandin vivo.In this study we characterized unilamellar FL as a gene transfer vector in comparison with cationic lipid (CL)-DNA complex. FL transferred genes efficiently into cultured cells even when incubated for as little as 10 min, while CL-DNA complex required at

  17. A new class of rare earth tetrapyrrole sandwich complexes containing corrole and phthalocyanine macrocycles: synthesis, physicochemical characterization and X-ray analysis.

    PubMed

    Lu, Guifen; Yan, Sen; Shi, Mengying; Yu, Wenhan; Li, Jing; Zhu, Weihua; Ou, Zhongping; Kadish, Karl M

    2015-02-11

    The first europium triple-decker tetrapyrrole with mixed corrole and phthalocyanine macrocycles was synthesized and characterized by spectroscopic and electrochemical methods. The molecular structure was characterized by single-crystal X-ray diffraction and showed the corrole to be in the middle of the sandwich with phthalocyanine macrocycles at each extreme. PMID:25563927

  18. UV Spectrophotometric Determination and Validation of Hydroquinone in Liposome

    PubMed Central

    Khoshneviszadeh, Rabea; Fazly Bazzaz, Bibi Sedigheh; Housaindokht, Mohammad Reza; Ebrahim-Habibi, Azadeh; Rajabi, Omid

    2015-01-01

    The method has been developed and validated for the determination of hydroquinone in liposomal formulation. The samples were dissolved in methanol and evaluated in 293 nm. The validation parameters such as linearity, accuracy, precision, specificity, limit of detection (LOD) and limit of quantitation (LOQ) were determined. The calibration curve was linear in 1-50 µg/mL range of hydroquinone analyte with a regression coefficient of 0.9998. This study showed that the liposomal hydroquinone composed of phospholipid (7.8 %), cholesterol (1.5 %), alpha ketopherol (0.17 %) and hydroquinone (0.5 %) did not absorb wavelength of 293 nm if it diluted 500 times by methanol. The concentration of hydroquinone reached 10 µg/mL after 500 times of dilution. Furthermore, various validation parameters as per ICH Q2B guideline were tested and found accordingly. The recovery percentages of liposomal hydroquinone were found 102 ± 0.8, 99 ± 0.2 and 98 ± 0.4 for 80%, 100% and 120% respectively. The relative standard deviation values of inter and intra-day precisions were <%2. LOD and LOQ were 0.24 and 0.72 µg/mL respectively.

  19. Development and in vitro characterisation of a benznidazole liposomal formulation.

    PubMed

    Morilla, M J; Benavidez, P; Lopez, M O; Bakas, L; Romero, E L

    2002-12-01

    The purpose of this study was to find a multilamellar liposomal formulation for the antichagasic drug Benznidazole (BNZ). Different lipid matrices and organic solvents for BNZ were tested in order to obtain the liposomes with the highest g BNZ/100 g total lipid (D/TL) ratio. The best lipid matrices resulted from hydrogenated phosphatidylcholine from soybean (HSPC): Cholesterol (Chol): distearoyl-phosphatidylglycerol (DSPG) (molar ratio 2:2:1) prepared with BNZ dissolved in DMSO. Drug loading of 2 g BNZ/100 g total lipids at a total lipid concentration of 20-30 mM was obtained. Two in vitro assays on the HSPC:Chol:DSPG formulation to predict its in vivo behaviour were performed. In the first experiments, after 60 min at 1-450-fold dilution in buffer at 37 degrees C, the amount of drug associated to liposomes was reduced from 2 to 0.25 g BNZ/100 g total lipids at a rate of 65% (drug lost) min(-1) at the first minute followed by 0.4% (drug lost) min(-1) during the next hour. When incubated in plasma at 37 degrees C, the HSPC:Chol:DSPG formulations bounded a high amount of plasma proteins: r=2400 microg plasma protein per micromol total lipid. PMID:12433437

  20. Correlation of fixed aqueous layer thickness around PEG-modified liposomes with in vivo efficacy of antitumor agent-containing liposomes.

    PubMed

    Sugiyama, Ikumi; Sadzuka, Yasuyuki

    2011-12-01

    Liposomes are recognized as useful drug carriers, but have some problems to overcome. Liposomes are easily opsonized with serum proteins (opsonization) and taken up by the reticuloendothelial system (RES) cells, such as spleen and liver. Polyethyleneglycol (PEG) modification on the liposomal membrane forms a fixed aqueous layer and thus prevents opsonization and uptake by the RES. Our research indicates clearly that the electrical potential distributions near the membrane surfaces were different between doxorubicin (DOX)-containing liposomes with and without a PEG coating. Moreover, the value of the fixed aqueous layer thickness (FALT) around the liposome, formed by PEG modification, correlates with the circulation time and antitumor effect in a murine model. In this review, we introduce the observation that measurement of FALT as a physical characteristics is a useful method for demonstrating the antitumor effect of antitumor agent-containing PEG-modified liposomes. The use of this technique may preclude the performance of certain in vivo experiments. Our approach using FALT enables the rapid and reliable development of PEG-modified liposome formulations. PMID:22034853

  1. A significant enhancement of therapeutic effect against hepatic metastases of M5076 in mice by a liposomal interleukin-2 (mixture).

    PubMed

    Kanaoka, Eri; Takahashi, Kouji; Yoshikawa, Takayoshi; Jizomoto, Hiroaki; Nishihara, Yoshitaka; Uchida, Naomi; Maekawa, Ryuji; Hirano, Koichiro

    2002-08-21

    Recombinant interleukin-2 (IL-2) was strongly and almost completely adsorbed onto small hydrophobic liposomes under optimal conditions (liposome: DSPC-DSPG; molar ratio, 10:1; 30-50 nm in size, ratio of IL-2 to liposome: 4.0 JRU/nmol lipid). This liposomal IL-2 improved the distribution of IL-2 after intravenous administration as reported, previously. Liposomal IL-2 (300-10000 JRU/mouse per day) was significantly more effective than free IL-2 alone for inhibiting against the experimental metastases of M5076 in mice. The inhibitory effect of liposomal IL-2 was greatest in the liver. The ED(50) of liposomal IL-2 and that of free IL-2 in the liver were 1640 and 12500 JRU/mouse per day, respectively. This simple preparation (mixture) using IL-2 and liposome suspension is expected to have potential for increasing therapeutic efficacy against hepatic metastases. PMID:12175736

  2. Optical dispersion parameters based on single-oscillator model and optical absorption of nanocrystalline metal phthalocyanine films: A comparison study

    NASA Astrophysics Data System (ADS)

    Farag, A. A. M.; Yahia, I. S.; AlFaify, S.; Bilgiçli, A.; Kandaz, M.; Yakuphano?lu, F.

    2013-08-01

    Nanocrystalline thin films of {Co(II), Cu(II), Mn(III), Pb(II) and Zn(II)} phthalocyanine complexes were deposited by spin coating sol-gel technique. The surface morphologies of the films are found to be dependable on the type of the metal complex. The absorption spectra of the films show two well defined absorption bands of phthalocyanine molecule; namely Soret (B-band) and Q-bands. The Q-band absorption of the phthalocyanine complexes shifts to longer wavelength with the central metal change. The analysis of the spectral behavior of the absorption coefficient (?) in the absorption region revealed two expected indirect transitions. The refractive index (n) and the absorption index (k) were calculated using the measured data of the transmittance T(?) and reflectance R(?) coefficients. The dispersion parameters such as dispersion energy (Ed), oscillator energy (Eo), high frequency dielectric constant (??), and lattice dielectric constant (?L) were determined using the single oscillator model. The main reason for the change in dispersion parameters of the phthalocyanine complexes may be attributed to the intensity of the metal coordination bonds that are dependent on the bound metal atoms due to their electronegativity change. The founded results of the nano-crystalline metal phthalocyanine thin films can be useful for optoelectronic applications. Discussion of the obtained results and their comparisons with the available published literature were also considered.

  3. Photophysical properties of [60]fullerenes and phthalocyanines embedded in ordered mesoporous silica films annealed at various temperatures.

    PubMed

    Subbiah, Selvaraj; Mokaya, Robert

    2005-03-24

    The photophysical properties of fullerene and/or phthalocyanine dyes embedded in ordered mesoporous silica films and the influence of annealing temperature on the nature of the immobilized dye molecules has been investigated using photoluminescence (PL) and diffuse reflectance (DR) studies. The PL and DR studies show that fullerene (C60) and/or zinc phthalocyanine (ZnPc) molecules incorporated into transparent mesoporous silica films, via either sol-gel or grafting routes, exist predominantly in monomeric form. Careful choice of annealing temperature, between 25 and 225 degrees C, can further enhance monomeric dispersion. For C60-containing films, monomeric dispersion of fullerene was observed for annealing temperatures up to 175 degrees C for sol-gel derived films and 225 degrees C for grafted films. Both sol-gel and grafted ZnPc-containing films showed evidence of monodispersed phthalocyanine for annealing temperatures up to 225 degrees C. In general, annealing temperatures in the range 125-175 degrees C were found to yield optimal monodispersion of the dye molecules. When both C60 and ZnPc were incorporated into the silica films, no evidence of interaction between the dyes, i.e., charge-transfer transitions or the formation of fullerene/phthalocyanine charge-transfer complexes, was observed. This suggests that embedded fullerene and phthalocyanine molecules may be used for the preparation of solid-state optical limiters, based on reverse saturable absorption, where monomeric dispersion of the dye molecules is important. PMID:16863169

  4. Supramolecular tetrad featuring covalently linked bis(porphyrin)-phthalocyanine coordinated to fullerene: construction and photochemical studies.

    PubMed

    K C, Chandra B; Lim, Gary N; Karr, Paul A; D'Souza, Francis

    2014-06-16

    A multimodular donor-acceptor tetrad featuring a bis(zinc porphyrin)-(zinc phthalocyanine) ((ZnP-ZnP)-ZnPc) triad and bis-pyridine-functionalized fullerene was assembled by a "two-point" binding strategy, and investigated as a charge-separating photosynthetic antenna-reaction center mimic. The spectral and computational studies suggested that the mode of binding of the bis-pyridine-functionalized fullerene involves either one of the zinc porphyrin and zinc phthalocyanine (Pc) entities of the triad or both zinc porphyrin entities leaving ZnPc unbound. The binding constant evaluated by constructing a Benesi-Hildebrand plot by using the optical data was found to be 1.17×10(5) M(-1), whereas a plot of "mole-ratio" method revealed a 1:1 stoichiometry for the supramolecular tetrad. The mode of binding was further supported by differential pulse voltammetry studies, in which redox modulation of both zinc porphyrin and zinc phthalocyanine entities was observed. The geometry of the tetrad was deduced by B3LYP/6-31G* optimization, whereas the energy levels for different photochemical events was established by using data from the optical absorption and emission, and electrochemical studies. Excitation of the zinc porphyrin entity of the triad and tetrad revealed ultrafast singlet-singlet energy transfer to the appended zinc phthalocyanine. The estimated rate of energy transfer (k(ENT)) in the case of the triad was found to be 7.5×10(11) s(-1) in toluene and 6.3×10(11) s(-1) in o-dichlorobenzene, respectively. As was predicted from the energy levels, photoinduced electron transfer from the energy-transfer product, that is, singlet-excited zinc phthalocyanine to fullerene was verified from the femtosecond-transient spectral studies, both in o-dichlorobenzene and toluene. Transient bands corresponding to ZnPc(?+) in the 850?nm range and C60(?-) in the 1020?nm range were clearly observed. The rate of charge separation, k(CS), and rate of charge recombination, k(CR), for the (ZnP-ZnP)-ZnPc(?+):Py2C60(?-) radical ion pair (from the time profile of 849?nm peak) were found to be 2.20×10(11) and 6.10×10(8) s(-1) in toluene, and 6.82×10(11) and 1.20×10(9) s(-1) in o-dichlorobenzene, respectively. These results revealed efficient energy transfer followed by charge separation in the newly assembled supramolecular tetrad. PMID:24805781

  5. Accumulation of protein-coated liposomes in an extravascular site: influence of increasing carrier circulation lifetimes.

    PubMed

    Longman, S A; Tardi, P G; Parr, M J; Choi, L; Cullis, P R; Bally, M B

    1995-12-01

    The primary objective of this work was to test whether increased blood levels and circulation lifetimes result in increased passive targeting of protein-coated liposomal drug carriers. The system used to evaluate this was based on i.v. injection of 100 nm of distearoyl phosphatidylcholine/cholesterol liposomes with covalently bound streptavidin. The circulation lifetime of these liposomes was increased by procedures that involved blockade of liposome uptake by phagocytic cells in the liver and/or the incorporation of a poly(ethylene glycol)-modified phospholipid [poly(ethylene glycol)2000-modified distearoyl phosphatidylethanolamine]. Blockade of liver phagocytic cells with a low predose (2 mg/kg of drug) of liposomal doxorubicin increased the circulation half-life of the streptavidin liposomes from less than 1 hr to greater than 3 hr. A further 2-fold increase in circulating half-life (to approximately 7.5 hr) was achieved by using liposomes with 2 mole % of poly(ethylene glycol)2000-modified phosphatidylethanolamine. In combination with RES blockade, the circulation lifetimes of poly(ethylene glycol)phosphatidylethanolamine containing streptavidin liposomes could be increased to greater than 12 hr. The ability of these liposomes to move from the plasma compartment to an extravascular compartment was measured by using the peritoneal cavity as a convenient, accessible, extravascular site. The tendency for liposomes to accumulate in this site was not, however, clearly dependent on circulating blood levels. Comparable levels of liposomes in the peritoneal cavity were achieved when using systems that exhibited significantly different circulation lifetimes. PMID:8531079

  6. Physicochemical characterization of liposomes after ultrasound exposure - mechanisms of drug release.

    PubMed

    Evjen, Tove J; Hupfeld, Stefan; Barnert, Sabine; Fossheim, Sigrid; Schubert, Rolf; Brandl, Martin

    2013-05-01

    Ultrasound is investigated as a novel drug delivery tool within cancer therapy. Non-thermal ultrasound treatment of solid tumours post i.v.-injection of drug-carrying liposomes may induce local drug release from the carrier followed by enhanced intracellular drug uptake. Recently, ultrasound-mediated drug release of liposomes (sonosensitivity) was shown to strongly depend on liposome membrane composition. In the current study the ultrasound-mediated drug release mechanism of liposomes was investigated. The results showed that differences in ultrasound drug release kinetics obtained for different liposomal compositions were caused by distinctive release mechanisms of the carriers. Two types of liposomes composed of 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE) and hydrogenated soy L-?-phosphatidylcholine (HSPC) as main lipids, respectively, were recently shown to vary in sonosensitivity. Here, these liposomes were analyzed prior to and after a given ultrasound-exposure for their mean size, size distribution and morphology. Cryo-transmission electron microscopy, dynamic light scattering and asymmetric flow field-flow fractionation in combination with multi-angle light scattering revealed a significant change in mean size, size distribution and morphology of DOPE-based liposomes after ultrasound, pointing to an irreversible disruption of the vesicles and concomitant drug release. In contrast, the HSPC-based liposomes remained unchanged in size and structure after ultrasound application, indicating pore-mediated release mechanisms. The results show that the release mechanisms and interactions between ultrasound and liposomes depend on the liposome membrane-composition, explaining their sonosensitive properties. PMID:23474811

  7. Formation of biopolymer-coated liposomes by electrostatic deposition of chitosan.

    PubMed

    Laye, C; McClements, D J; Weiss, J

    2008-06-01

    The purpose of this study was to prepare stable biopolymer-coated liposome suspensions using an electrostatic deposition method. Liposome suspensions were produced by homogenizing 1% soy lecithin in acetate buffer (0.1 M, pH 3). Cationic chitosan (Mw approximately 200 kDa) solutions were mixed with anionic liposome suspensions (d approximately 100 and 200 nm), and the effect of phospholipid concentration, chitosan concentration, and liposome size on the properties of the particles formed was determined. The particle size and charge (zeta-potential) were measured using dynamic light scattering and particle electrophoresis. The particle charge changed from -38 mV in the absence of chitosan to +60 mV in the presence of chitosan, indicating complex formation between the anionic liposomes and cationic chitosan molecules. Below a minimum critical chitosan concentration (c(min)), large aggregates were formed that phase separated within minutes, whose origin was attributed to formation of coacervates. On the other hand, above a maximum critical chitosan concentration (c(max)), large flocs were formed that sedimented within hours, whose formation was attributed to depletion flocculation. Minimum and maximum critical chitosan concentrations depended on liposomal concentration and size. At c(min) < c < c(max'), chitosan-coated liposomes were formed that did not aggregate and were stable to sedimentation. Coated liposomes had better stability to aggregation than uncoated liposomes when stored at ambient temperatures for 45 d. This study indicates that chitosan can be used to form biopolymer-coated liposomes with enhanced stability over uncoated liposomes. PMID:18577008

  8. Enhanced cellular uptake of maleimide-modified liposomes via thiol-mediated transport

    PubMed Central

    Li, Tianshu; Takeoka, Shinji

    2014-01-01

    With a small amount of maleimide modification on the liposome surface, enhanced cellular uptake of liposomes and drug-delivery efficiency can be obtained both in vitro and in vivo. Herein, we describe the mechanisms underlying this enhanced cellular uptake. Suppression of the cellular uptake of maleimide-modified liposomes (M-GGLG, composed of 1,5-dihexadecyl N,N-diglutamyl-lysyl-L-glutamate [GGLG]/cholesterol/poly(ethylene glycol) – 1,2-distearoyl-sn-glycero-3-phosphoethanolamine [PEG5000-DSPE]/maleimide [M]-PEG5000-Glu2C18 at a molar ratio of 5:5:0.03:0.03) caused by temperature block and addition of serum was alleviated compared with that of liposomes without maleimide modification (GGLG liposomes, composed of GGLG/cholesterol/PEG5000-DSPE/PEG5000-Glu2C18 at a molar ratio of 5:5:0.03:0.03). When 0.01 nM N-ethylmaleimide was used to pre-block cellular thiols, the cellular uptake of M-GGLG liposomes was decreased to approximately 70% in HeLa, HCC1954, MDA-MB-468, and COS-7 cell lines. Moreover, inhibition of a thiol-related reductase such as protein disulfide isomerase resulted in a 15%–45% inhibition of the cellular uptake of M-GGLG liposomes, whereas GGLG liposomes were not influenced. Further, single and mixed inhibitors of clathrin-mediated endocytosis, caveolae-mediated endocytosis, and macropinocytosis did not efficiently inhibit the cellular uptake of M-GGLG liposomes. Using confocal microscopy, we verified that M-GGLG liposomes were localized partially in lysosomes after inhibition of the mentioned conventional endocytic pathways. Therefore, it was hypothesized that the mechanisms underlying the enhanced cellular uptake of liposomes by maleimide modification was thiol-mediated membrane trafficking, including endocytosis and energy-independent transport. PMID:24940060

  9. Preparation and characterization of liposomes containing the Ca2+-activated photoprotein, obelin.

    PubMed

    Dormer, R L; Newman, G R; Campbell, A K

    1978-01-01

    1. Liposomes bearing different net surface charges have been prepared and their ability to entrap the Ca2+-activated photoprotein, obelin, has been studied 2. Negatively-charged liposomes, composed of egg-yolk lecithin, cholesterol and phosphatidylserine, consistently produced the most homogeneous populations of liposomes after sonication, as shown by electron microscopy after negative staining. These consisted of a large proportion of uni- and bilamellar vesicles within the size range of 20--50 nm, external diameter. 3. Sonicated negatively-charged liposomes had a mean aqueous obelin space of 6.8 +/- 0.8 microliter/mumol of phospholipid compared to a mean space for inulin [14C]carboxylic acid of 5.1 +/- 0.8 microliter/mumol of phospholipid. 4. Sonication reduced the Ca2+ permeability of the negatively-charged liposomes, as measured by the utilization of entrapped obelin. 5. Preparations of uncharged (no phosphatidylserine) and positively-charged (stearylamine instead of phosphatidylserine), sonicated liposomes contained a greater proportion of larger vesicles, which were more permeable to Ca2+ than sonicated, negatively-charged liposomes. 6. Obelin, trapped within sonicated, negatively-charged liposomes, responded to increases in the free Ca2+ concentration within the liposomes caused by the bivalent-cation ionophore A23187 at concentrations as low as 19 nM. 7. The effect of A23187 was inhibited by Mg2+ at a low concentration of Ca2+ (10 muM), but not at 1 mM Ca2+. 8. It was concluded that obelin could be trapped in the aqueous compartment of sonicated liposomes which remained relatively impermeable to Ca2+. Furthermore, trapped obelin could respond to changes in the free Ca2+ concentration within these liposomes. PMID:339958

  10. Plasma stable, pH-sensitive fusogenic polymer-modified liposomes: A promising carrier for mitoxantrone.

    PubMed

    Ghanbarzadeh, Saeed; Arami, Sanam; Pourmoazzen, Zhaleh; Ghasemian-Yadegari, Javad; Khorrami, Arash

    2013-12-11

    pH-sensitive liposomes are designed to undergo acid-triggered destabilization. In the present study, we prepared polymer-modified, plasma stable, pH-sensitive fusogenic mitoxantrone liposomes to increase efficacy and selectivity on cancer cell lines. Conventional liposomes were prepared using cholesterol and dipalmitoyl-sn-glycero-3-phosphatidylethanolamine. Dioleoylphosphatidylethanolamine and a cholesteryl derivative, poly(monomethylitaconate)-co-poly(N,N-dimethylaminoethyl methacrylate) (PMMI-co-PDMAEMA), were used for the preparation of pH-sensitive fusogenic liposomes. Using polyethylene glycol (PEG)-poly(monomethylitaconate)-CholC6 (PEG-PMMI-CholC6) copolymers instead of cholesterol introduced pH-sensitive and plasma stability properties simultaneously in prepared liposomes. All formulations were prepared by thin film hydration method and subsequently, pH-sensitivity and stability in human serum were evaluated. The ability of pH-sensitive fusogenic liposomes to enhance the mitoxantrone cytotoxicity and selectivity in cancerous cell lines was assessed in vitro compared to normal cell line using human breast cancer cell line (MCF-7), human prostate cancer cell line (PC-3), and human umbilical vein endothelial cells line. Results revealed that both PMMI-co-PDMAEMA and PEG-PMMI-CholC6-based formulations showed pH-sensitive property and were found to rapidly release mitoxantrone under mildly acidic conditions. Nevertheless, only the PEG-PMMI-CholC6-based liposomes preserved pH-sensitivity after incubation in plasma. Mitoxantrone loaded-pH-sensitive fusogenic liposomes exhibited a higher cytotoxicity than the control conventional liposomes on MCF-7 and PC-3 cell lines. On the contrary, both pH-sensitive fusogenic liposomes showed lower cytotoxic effect on human umbilical vein endothelial cell line. Plasma stable, pH-sensitive fusogenic liposomes are promising carriers for enhancing the efficiency and selectivity, besides reduction of the side effects of anticancer agents. PMID:24336315

  11. Monoclonal antibody-targeted PEGylated liposome-ICG encapsulating doxorubicin as a potential theranostic agent.

    PubMed

    Lozano, Neus; Al-Ahmady, Zahraa S; Beziere, Nicolas S; Ntziachristos, Vasilis; Kostarelos, Kostas

    2015-03-30

    Indocyanine green (ICG) is an FDA-approved, strongly photo-absorbent/fluorescent probe that has been incorporated into a clinically-relevant PEGylated liposome as a flexible optoacoustic contrast agent platform. This study describes the engineering of targeted PEGylated liposome-ICG using the anti-MUC-1 "humanized" monoclonal antibody (MoAb) hCTM01 as a tumour-specific theranostic system. We aimed to visualise non-invasively the tumour accumulation of these MoAb-targeted liposomes over time in tumour-bearing mice using multispectral optoacoustic tomography (MSOT). Preferential accumulation of targeted PEGylated liposome-ICG was studied after intravenous administration in comparison to non-targeted PEGylated liposome-ICG using both fast growing (4T1) and slow growing (HT-29) MUC-1 positive tumour models. Monitoring liposomal ICG in the tumour showed that both targeted and non-targeted liposome-ICG formulations preferentially accumulated into the tumour models studied. Rapid accumulation was observed for targeted liposomes at early time points mainly in the periphery of the tumour volume suggesting binding to available MUC-1 receptors. In contrast, non-targeted PEGylated liposomes showed accumulation at the centre of the tumour at later time points. In an attempt to take this a step further, we successfully encapsulated the anticancer drug, doxorubicin (DOX) into both targeted and non-targeted PEGylated liposome-ICG. The engineering of DOX-loaded targeted ICG liposome systems present a novel platform for combined tumour-specific therapy and diagnosis. This can open new possibilities in the design of advanced image-guided cancer therapeutics. PMID:25445515

  12. Expression pattern and intensity of protoporphyrin IX induced by liposomal 5-aminolevulinic acid in rat pilosebaceous unit throughout hair cycle

    Microsoft Academic Search

    Insook Han; Mee Sook Jun; Soo-Kyun Kim; Moonkyu Kim; Jung Chul Kim

    2005-01-01

    We have developed liposomal formulation of 5-aminolevulinic acid (ALA) to enhance topical delivery and examined ALA-induced\\u000a protoporpyrin (PpIX) expression in rat pilosebaceous unit throughout hair cycle. Two types of liposomes—glycerol dilaulate\\u000a (GDL) and phosphatidylcholine (PC)—were formulated and both liposomal ALA increased PpIX expression in rat dorsal skin and\\u000a pilosebaceous units when compared with free ALA. However, iontophoresis combined with liposomal

  13. Modulated release from liposomes entrapped in chitosan/gelatin hydrogels.

    PubMed

    Ciobanu, Bogdan C; Cadinoiu, Anca N; Popa, Marcel; Desbrières, Jacques; Peptu, C?t?lina A

    2014-10-01

    The paper describes the preparation of chitosan/gelatin hydrogels, obtained by double crosslinking with glutaraldehyde and sodium sulphate/sodium tripolyphosphate that may be used as matrices for the inclusion of drug loaded liposomes composed of phosphatidylcholine. The main objective was to create a protective layer to stabilize the liposomal surface and to prolong/control the release of drugs from such systems. Therefore, complex systems capable of prolonged drug release and controlled release kinetics were obtained. Samples consisting of different chitosan/gelatin ratios and type/amount of ionic crosslinker have been prepared and characterized. The present study shows that calcein (used as a model hydrophilic drug) release from polymeric hydrogels has been retarded from several days to weeks after calcein inclusion in small unilamellar vesicles (SUVs) and multilamellar vesicles (MLVs) entrapped subsequently in hydrogels with variable composition. The calcein release kinetics of complex systems were compared to simple systems (control hydrogels) and important changes were observed thus proving that the mechanism of the process increases in complexity. Also, it is demonstrated that liposomes' stability can be greatly improved by inclusion in polymeric matrices. Multilamellar liposomes showed a better release behaviour, which indicates that these calcein loaded vesicles remained intact to some extent after release from the matrix, due to their improved stability provided by the multiple layers. When small unilamellar liposomes were tested, calcein have been released from hydrogels predominantly in a free form (due to their unilamellarity related instability even inside the hydrogel) but in a sustained and controllable manner. The main applications of the systems obtained are in the area of drug release for tissue engineering/tissue repair (topical administration of drugs for wound therapy - burns, for example). Hydrogels capable of delivering drugs over prolonged periods of time represent a step forward in wound management and many diseases that request long term and sustained delivery of drugs. These hydrogels could be used as tissue replacement or injectable depot systems in many high risk diseases including cancer. PMID:25175227

  14. Infrared spectra of phthalocyanine and naphthalocyanine in sandwich-type (na)phthalocyaninato and porphyrinato rare earth complexes. Part 3. The effects of substituents and molecular symmetry on the infrared characteristics of phthalocyanine in bis(phthalocyaninato) rare earth complexes

    Microsoft Academic Search

    Fanli Lu; Meng Bao; Changqin Ma; Xianxi Zhang; Dennis P. Arnold; Jianzhuang Jiang

    2003-01-01

    The infra-red (IR) spectroscopic data for a series of 45 homoleptic unsubstituted and substituted bis(phthalocyaninato) rare earth complexes M(Pc)2 and M(Pc*)2 [M=Y, La…Lu except Pm; H2Pc=phthalocyanine; H2Pc*=2,3,9,10,16,17,24,25-octakis(octyloxy)phthalocyanine (H2OOPc) and 2(3),9(10),16(17),24(25)-tetra(tert-butyl)phthalocyanine (H2TBPc)] have been collected with resolution of 2 cm?1. The IR spectra for M(Pc)2 and M(OOPc)2 are much simpler than those of M(TBPc)2, revealing the relatively higher symmetry of the

  15. Novel mucus-penetrating liposomes as a potential oral drug delivery system: preparation, in vitro characterization, and enhanced cellular uptake

    PubMed Central

    Li, Xiuying; Chen, Dan; Le, Chaoyi; Zhu, Chunliu; Gan, Yong; Hovgaard, Lars; Yang, Mingshi

    2011-01-01

    Background The aim of this study was to investigate the intestinal mucus-penetrating properties and intestinal cellular uptake of two types of liposomes modified by Pluronic F127 (PF127). Methods The two types of liposomes, ie, PF127-inlaid liposomes and PF127-adsorbed liposomes, were prepared by a thin-film hydration method followed by extrusion, in which coumarin 6 was loaded as a fluorescence marker. A modified Franz diffusion cell mounted with the intestinal mucus of rats was used to study the diffusion characteristics of the two types of PF127 liposomes. Cell uptake studies were conducted in Caco-2 cells and analyzed using confocal laser scanning microcopy as well as flow cytometry. Results The diffusion efficiency of the two types of PF127-modified liposomes through intestinal rat mucus was 5–7-fold higher than that of unmodified liposomes. Compared with unmodified liposomes, PF127-inlaid liposomes showed significantly higher cellular uptake of courmarin 6. PF127-adsorbed liposomes showed a lower cellular uptake. Moreover, and interestingly, the two types of PF127-modified liposomes showed different cellular uptake mechanisms in Caco-2 cells. Conclusion PF127-inlaid liposomes with improved intestinal mucus-penetrating ability and enhanced cellular uptake might be a potential carrier candidate for oral drug delivery. PMID:22163166

  16. The role of surface charge density in cationic liposome-promoted dendritic cell maturation and vaccine-induced immune responses

    NASA Astrophysics Data System (ADS)

    Ma, Yifan; Zhuang, Yan; Xie, Xiaofang; Wang, Ce; Wang, Fei; Zhou, Dongmei; Zeng, Jianqiang; Cai, Lintao

    2011-05-01

    Cationic liposomes have emerged as a novel adjuvant and antigen delivery system to enhance vaccine efficacy. However, the role of surface charge density in cationic liposome-regulated immune responses has not yet been elucidated. In the present study, we prepared a series of DOTAP/DOPC cationic liposomes with different surface densities by incorporating varying amounts of DOPC (a neutral lipid) into DOTAP (a cationic lipid). The results showed that DOTAP/DOPC cationic liposome-regulated immune responses relied on the surface charge density, and might occur through ROS signaling. The liposomes with a relatively high charge density, such as DOTAP/DOPC 5 : 0 and 4 : 1 liposomes, potently enhanced dendritic cell maturation, ROS generaion, antigen uptake, as well as the production of OVA-specific IgG2a and IFN-?. In contrast, low-charge liposomes, such as DOTAP/DOPC 1 : 4 liposome, failed to promote immune responses even at high concentrations, confirming that the immunoregulatory effect of cationic liposomes is mostly attributable to their surface charge density. Moreover, the DOTAP/DOPC 1 : 4 liposome suppressed anti-OVA antibody responses in vivo. Overall, maintaining an appropriate surface charge is crucial for optimizing the adjuvant effect of cationic liposomes and enhancing the efficacy of liposome-based vaccines.

  17. Enhanced retention and anti-tumor efficacy of liposomes by changing their cellular uptake and pharmacokinetics behavior.

    PubMed

    Li, Yan; Liu, Ruiyuan; Yang, Jun; Shi, Yuanjie; Ma, Guanghui; Zhang, Zhenzhong; Zhang, Xin

    2015-02-01

    Although PEGylated liposome-based drug delivery systems hold great promising applications for cancer therapy due to their prolonged blood circulation time, PEGylation significantly reduces their cellular uptake, which markedly impairs the in vivo tumor retention and antitumor efficiency of drug-loaded liposomes. Most importantly, it has been proved that repeated injections of PEGylated liposomes with cell cycle specific drug such as topotecan (TPT) in the same animal at certain time intervals will induce "accelerated blood clearance" (ABC) phenomenon, which decreases the tumor accumulation of drug-loaded liposomes and presents a tremendous challenge to the clinical use of liposome-based drug delivery systems. Herein, we developed a zwitterionic poly(carboxybetaine) (PCB) modified liposome-based drug delivery system. The presence of PCB could avoid protein adsorption and enhance the stability of liposomes as that for PEG. Quite different from the PEGylated liposomes, the pH-sensitive PCBylated liposomes were internalized into cells via endocytosis with excellent cellular uptake and drug release ability. Furthermore, the PCBylated liposomes would avoid ABC phenomenon, which promoted the tumor accumulation of drug-loaded liposomes in vivo. With higher tumor accumulation and cellular uptake, the PCBylated drug-loaded liposomes significantly inhibited tumor growth and provided a promising approach for cancer therapy. PMID:25522960

  18. Linear DNA Low Efficiency Transfection by Liposome Can Be Improved by the Use of Cationic Lipid as Charge Neutralizer

    E-print Network

    Barbosa, Marcia C. B.

    Linear DNA Low Efficiency Transfection by Liposome Can Be Improved by the Use of Cationic Lipid the efficiency of a liposome-mediated transfection by circular and linear DNA. The results obtained showed a low rate of transfection by linear DNA:liposome complexes. To explore whether the structure

  19. Liposomes containing bile salts as novel ocular delivery systems for tacrolimus (FK506): in vitro characterization and improved corneal permeation.

    PubMed

    Dai, Yikang; Zhou, Rui; Liu, Lin; Lu, Yi; Qi, Jianping; Wu, Wei

    2013-01-01

    The objective of this study was to investigate the potential of liposomes containing bile salts as an ophthalmic delivery system for tacrolimus to improve corneal permeability. Liposomes containing bile salts, including sodium taurocholate, sodium deoxycholate, and sodium glycocholate, were produced by the thin-film dispersion method with a particle size of approximately 100 nm and an entrapment efficiency of more than 90%. Less than 5% tacrolimus was released from conventional liposomes and from liposomes containing sodium taurocholate, sodium deoxycholate, or sodium glycocholate over 12 hours. The cellular uptake of conventional liposomes was significantly higher than that of liposomes containing bile salts. However, liposomes containing bile salts exerted a 3-4-fold increase of tacrolimus in ex vivo corneal transport of tacrolimus compared with conventional liposomes. When rabbit eyes were treated with a DiI perchlorate-loaded liposome suspension, liposomes containing bile salts showed fast and sustained penetration across the cornea. Unfortunately, liposomes containing sodium deoxycholate caused toxicity or irritation to both spontaneously derived human corneal epithelial cells and the rabbit cornea. Therefore, liposomes containing sodium taurocholate and sodium glycocholate are potential carriers in ocular drug delivery systems, given their low toxicity and vastly improved permeability. PMID:23690687

  20. Liposomes containing bile salts as novel ocular delivery systems for tacrolimus (FK506): in vitro characterization and improved corneal permeation

    PubMed Central

    Dai, Yikang; Zhou, Rui; Liu, Lin; Lu, Yi; Qi, Jianping; Wu, Wei

    2013-01-01

    The objective of this study was to investigate the potential of liposomes containing bile salts as an ophthalmic delivery system for tacrolimus to improve corneal permeability. Liposomes containing bile salts, including sodium taurocholate, sodium deoxycholate, and sodium glycocholate, were produced by the thin-film dispersion method with a particle size of approximately 100 nm and an entrapment efficiency of more than 90%. Less than 5% tacrolimus was released from conventional liposomes and from liposomes containing sodium taurocholate, sodium deoxycholate, or sodium glycocholate over 12 hours. The cellular uptake of conventional liposomes was significantly higher than that of liposomes containing bile salts. However, liposomes containing bile salts exerted a 3–4-fold increase of tacrolimus in ex vivo corneal transport of tacrolimus compared with conventional liposomes. When rabbit eyes were treated with a DiI perchlorate-loaded liposome suspension, liposomes containing bile salts showed fast and sustained penetration across the cornea. Unfortunately, liposomes containing sodium deoxycholate caused toxicity or irritation to both spontaneously derived human corneal epithelial cells and the rabbit cornea. Therefore, liposomes containing sodium taurocholate and sodium glycocholate are potential carriers in ocular drug delivery systems, given their low toxicity and vastly improved permeability. PMID:23690687

  1. Liposomes composed of a double-chain cationic amphiphile (Vectamidine) induce their own encapsulation into human erythrocytes

    E-print Network

    Iglic, Ales

    Liposomes composed of a double-chain cationic amphiphile (Vectamidine) induce their own is a liposome-forming double-chain cationic amphiphile. The present work was aimed to microscopically study amphiphiles may transfer from membrane-attached liposomes to the plasma membrane and then translocate

  2. Microfluidic Synthesis of PEG- and Folate-Conjugated Liposomes for One-Step Formation of Targeted Stealth Nanocarriers

    PubMed Central

    Hood, Renee R.; Shao, Chenren; Omiatek, Donna M.; Vreeland, Wyatt N.; DeVoe, Don L.

    2013-01-01

    Purpose A microfluidic hydrodynamic flow focusing technique enabling the formation of small and nearly monodisperse liposomes is investigated for continuous-flow synthesis of poly(ethylene glycol) (PEG)-modified and PEG-folate-functionalized liposomes for targeted drug delivery. Methods Controlled laminar flow in thermoplastic microfluidic devices facilitated liposome self-assembly from initial lipid compositions including lipid/cholesterol mixtures containing PEG-lipid and folate-PEG-lipid conjugates. The relationships between flow conditions, lipid composition, and liposome size were evaluated, and the impact of these parameters on PEG and folate incorporation were determined through a combination of UV-vis absorbance measurements and characterization of liposome zeta potential. Results Both PEG and folate were successfully incorporated into microfluidic-synthesized liposomes over the full range of liposome sizes studied. The efficiency of PEG-lipid incorporation was found to be inversely correlated with liposome diameter. Folate-lipid was also effectively integrated into liposomes at various flow conditions. Conclusions Liposomes incorporating relatively large PEG-modified and folate-PEG-modified lipids were successfully synthesized using the microfluidic flow focusing platform, providing a simple, low cost, rapid method for preparing functionalized liposomes. Relationships between preparation conditions and PEG or folate-PEG functionalization have been elucidated, providing insight into the process and defining paths for optimization of the microfluidic method toward the formation of functionalized liposomes for pharmaceutical applications. PMID:23386106

  3. Towards artificial cell array system: Encapsulation and hydration technologies integrated in liposome array

    Microsoft Academic Search

    Toshihisa Osaki; Koki Kamiya; Ryuji Kawano; Hirotaka Sasaki; Shoji Takeuchi

    2012-01-01

    This work presents two important technologies integrated in our uniform-size liposome array platform (Fig. 1a) to realize an artificial cell array system. One is the effective encapsulation of small objects in the arrayed liposomes (Fig. 1b top), making use of the electrospray deposition technique also used for the lipid patterning. The target nanobeads were selectively patterned on the lipid and

  4. In vivo gene transfection via intravitreal injection of cationic liposome/plasmid DNA complexes in rabbits.

    PubMed

    Kawakami, Shigeru; Harada, Ayaka; Sakanaka, Koji; Nishida, Koyo; Nakamura, Junzo; Sakaeda, Toshiyuki; Ichikawa, Nobuhiro; Nakashima, Mikiro; Sasaki, Hitoshi

    2004-07-01

    To optimize the in vivo ocular transfection efficiency of plasmid DNA (pDNA)/cationic liposome complexes, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA)/dioleoylphosphatidylethanolamine (DOPE) (1:1 molar ratio) liposomes and DOTMA/cholesterol (Chol) (1:1 molar ratio) liposomes were prepared with varying amounts of pDNA. pDNA/cationic liposome complexes were intravitreally injected (100 microL) in rabbits, and luciferase activity in the cornea, aqueous humor, iris-ciliary body, lens, vitreous body, and retina was measured. Transfection efficiency of pDNA alone did not change with pDNA ranging from 40 to 85 mg. In contrast, transfection efficiency of pDNA complexed with DOTMA/Chol liposomes significantly increased with the amount of pDNA ranging from 40 to 85 microg (P < 0.05). pDNA complexed with DOTMA/DOPE liposomes could not be prepared with pDNA greater than 60 microg. Among these experiments, pDNA (85 microg) complexed with DOTMA/Chol liposomes (pDNA:cationic liposome charge ratio (- : +) = 1.0:2.0) showed the highest transfection efficiency in the ocular tissue and its transfection-mediated luciferase activity peaked at 3 days. Among the ocular tissues, the highest gene expression was observed in the aqueous humor. PMID:15196630

  5. Preparation, characterization and in vitro antimicrobial activity of liposomal ceftazidime and cefepime against Pseudomonas aeruginosa strains

    PubMed Central

    Torres, Ieda Maria Sapateiro; Bento, Etiene Barbosa; Almeida, Larissa da Cunha; de Sá, Luisa Zaiden Carvalho Martins; Lima, Eliana Martins

    2012-01-01

    Pseudomonas aeruginosa is an opportunistic microorganism with the ability to respond to a wide variety of environmental changes, exhibiting a high intrinsic resistance to a number of antimicrobial agents. This low susceptibility to antimicrobial substances is primarily due to the low permeability of its outer membrane, efflux mechanisms and the synthesis of enzymes that promote the degradation of these drugs. Cephalosporins, particularty ceftazidime and cefepime are effective against P. aeruginosa, however, its increasing resistance has limited the usage of these antibiotics. Encapsulating antimicrobial drugs into unilamellar liposomes is an approach that has been investigated in order to overcome microorganism resistance. In this study, antimicrobial activity of liposomal ceftazidime and cefepime against P. aeruginosa ATCC 27853 and P. aeruginosa SPM-1 was compared to that of the free drugs. Liposomal characterization included diameter, encapsulation efficiency and stability. Minimum Inhibitory Concentration (MIC) was determined for free and liposomal forms of both drugs. Minimum Bactericidal Concentration (MBC) was determined at concentrations 1, 2 and 4 times MIC. Average diameter of liposomes was 131.88 nm and encapsulation efficiency for cefepime and ceftazidime were 2.29% end 5.77%, respectively. Improved stability was obtained when liposome formulations were prepared with a 50% molar ratio for cholesterol in relation to the phospholipid. MIC for liposomal antibiotics for both drugs were 50% lower than that of the free drug, demonstrating that liposomal drug delivery systems may contribute to increase the antibacterial activity of these drugs. PMID:24031917

  6. Cross-Linkable Liposomes Stabilize a Magnetic Resonance Contrast-Enhancing Polymeric Fastener

    PubMed Central

    2015-01-01

    Liposomes are commonly used to deliver drugs and contrast agents to their target site in a controlled manner. One of the greatest obstacles in the performance of such delivery vehicles is their stability in the presence of serum. Here, we demonstrate a method to stabilize a class of liposomes that load gadolinium, a magnetic resonance (MR) contrast agent, as a model cargo on their surfaces. We hypothesized that the sequential adsorption of a gadolinium-binding chitosan fastener on the liposome surface followed by covalent cross-linking of the lipid bilayer would provide enhanced stability and improved MR signal in the presence of human serum. To investigate this hypothesis, liposomes composed of diyne-containing lipids were assembled and functionalized via chitosan conjugated with a hydrophobic anchor and diethylenetriaminepentaacetic acid (DTPA). This postadsorption cross-linking strategy served to stabilize the thermodynamically favorable association between liposome and polymeric fastener. Furthermore, the chitosan-coated, cross-linked liposomes proved more effective as delivery vehicles of gadolinium than uncross-linked liposomes due to the reduced liposome degradation and chitosan desorption. Overall, this study demonstrates a useful method to stabilize a broad class of particles used for systemic delivery of various molecular payloads. PMID:24635565

  7. In vitro synthesis and stabilization of amorphous calcium carbonate (ACC) nanoparticles within liposomes

    SciTech Connect

    Tester, Chantel C.; Brock, Ryan E.; Wu, Ching-Hsuan; Krejci, Minna R.; Weigand, Steven; Joester, Derk (NWU)

    2012-02-07

    We show that amorphous calcium carbonate (ACC) can be synthesized in phospholipid bilayer vesicles (liposomes). Liposome-encapsulated ACC nanoparticles are stable against aggregation, do not crystallize for at least 20 h, and are ideally suited to investigate the influence of lipid chemistry, particle size, and soluble additives on ACC in situ.

  8. Kinetics of Bile Salt Binding to Liposomes Revealed by Carboxyfluorescein Release and

    E-print Network

    Hinow, Peter

    Kinetics of Bile Salt Binding to Liposomes Revealed by Carboxyfluorescein Release and Mathematical by the binding of different bile salts to the leaflets of the lipid bilayer. We find that the permeability of the liposomal bilayer depends on the difference in the concentrations of bile salt in the inner and outer

  9. Atomic Force Microscopy and Light Scattering of Small Unilamellar Actin-Containing Liposomes

    PubMed Central

    Palmer, Andre F.; Wingert, Philip; Nickels, Jonathan

    2003-01-01

    Three-dimensional networks of filamentous actin (F-actin) encapsulated inside phosphatidylcholine liposomes are currently being used in an effort to model the cytoskeleton and plasma membrane of eukaryotic cells. In this article, unilamellar lipid vesicles consisting of egg yolk-derived phosphatidylcholine encapsulating monomeric actin (G-actin) were made via extrusion in low ionic strength buffer (G-buffer). Vesicle shape and structure in these dispersions was studied using a combination of fluid-tapping atomic force microscopy, and multiangle static light scattering. After subjecting the liposome dispersion to high ionic strength polymerization buffer (F-buffer) containing K+ ions, atomic force microscopy imaging and light scattering of these liposomes indicated the formation of specialized structures, including an overall liposome structure transformation from spherical to torus, disk-shaped geometries and tubular assemblies. Several atomic force microscopy control measurements were made to ascertain that the specialized structures formed were not due to free G-actin and F-actin self-assembling on the sample surface, plain liposomes exposed to G- and F-buffer, or liposomes encapsulating G-actin. Liposomes encapsulating G-actin assumed mostly thin disk shapes and some large irregularly shaped aggregates. In contrast, liposomes encapsulating polymerized actin assumed mostly torus or disk shapes along with some high aspect ratio tubular structures. PMID:12885667

  10. Ag@4ATP-coated liposomes: SERS traceable delivery vehicles for living cells

    NASA Astrophysics Data System (ADS)

    Zhu, Dan; Wang, Zhuyuan; Zong, Shenfei; Chen, Hui; Wu, Xin; Pei, Yuwei; Chen, Peng; Ma, Xueqin; Cui, Yiping

    2014-06-01

    A liposome-Ag nanohybrid has been demonstrated as a SERS traceable intracellular drug nanocarrier. Liposomes have been introduced for their special qualities in drug delivery systems. In essence, 4-aminothiophenol (4ATP) tagged Ag nanoparticles (Ag@4ATP) were adsorbed onto the surfaces of liposomes via electrostatic interactions, in which 4ATP was used as a SERS reporter. In such a nanohybrid, the locations of the carrier can be tracked by SERS signals while those of the drugs can be monitored through their fluorescence, allowing the simultaneous investigation of the intracellular distribution of both the carriers and the drugs. Our experimental results suggest that the reported liposomal system has substantial potential for intracellular drug delivery.A liposome-Ag nanohybrid has been demonstrated as a SERS traceable intracellular drug nanocarrier. Liposomes have been introduced for their special qualities in drug delivery systems. In essence, 4-aminothiophenol (4ATP) tagged Ag nanoparticles (Ag@4ATP) were adsorbed onto the surfaces of liposomes via electrostatic interactions, in which 4ATP was used as a SERS reporter. In such a nanohybrid, the locations of the carrier can be tracked by SERS signals while those of the drugs can be monitored through their fluorescence, allowing the simultaneous investigation of the intracellular distribution of both the carriers and the drugs. Our experimental results suggest that the reported liposomal system has substantial potential for intracellular drug delivery. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr00557k

  11. Influence of microenvironment and liposomal formulation on secondary structure and bilayer interaction of lysozyme.

    PubMed

    Witoonsaridsilp, Wasu; Panyarachun, Busaba; Sarisuta, Narong; Müller-Goymann, Christel C

    2010-02-01

    The conformation of peptide and protein drugs in various microenvironments and the interaction with drug carriers such as liposomes are of considerable interest. In this study the influence of microenvironments such as pH, salt concentration, and surface charge on the secondary structure of a model protein, lysozyme, either in solution or entrapped in liposomes with various molar ratios of phosphatidylcholine (PC):cholesterol (Chol) was investigated. It was found that entrapment efficiency was more pronounced in negatively charged liposomes than in non-charged liposomes, which was independent of Chol content and pH of hydration medium. The occurrence of aggregation, decrease in zeta potential, and alteration of 31P NMR chemical shift of negatively charged lysozyme liposomes compared to blank liposomes suggested that the electrostatic interaction plays a major role in protein-lipid binding. Addition of sodium chloride could impair the neutralizing ability of positively charged lysozyme on negatively charged membrane via chloride counterion binding. Neither lysozyme in various buffer solutions with sodium chloride nor that entrapped in liposomes showed any significant change in their secondary structures. However, significant decrease in alpha-helical content of lysozyme in non-charged liposomes at higher pH and salt concentrations was discovered. PMID:19880295

  12. Cutaneous bioavailability in hairless rats of tretinoin in liposomes or gel.

    PubMed

    Masini, V; Bonte, F; Meybeck, A; Wepierre, J

    1993-01-01

    Topical bioavailability of drugs incorporated in liposomes is not well known. We compared the skin penetration of tretinoin in liposomes and in a classical alcoholic gel. [3H]Phosphatidylcholine dipalmitoyl (DPPC) and [14C]tretinoin (0.14%) were incorporated in the phospholipidic phase of the liposomes, and [14C]tretinoin was incorporated in a gel for comparison. Skin absorption was studied in vitro with Franz cells. In vivo distribution in cutaneous structures was studied according to Schaefer's method. Liposomes impregnated the stratum corneum, with a partial dissociation between tretinoin and phosphatidyl-choline dipalmitoyl. In dermis, tretinoin diffused alone. Tretinoin release seemed to be controlled, and steady state was reached later with liposomes than with gel. This phenomenon was linked with a significantly reduced absorption (1.60% for liposomes versus 3.09% for the gel) and higher retention in epidermis (mainly stratum corneum) and dermis (41 and 13%, respectively, with liposomal form versus 18 and 8%, respectively, with gel form). This study clearly shows that, compared with the gel, the liposome formulation tends to improve the local effect of tretinoin in the skin and decrease the systemic absorption. PMID:8429486

  13. The antibacterial properties of solid supported liposomes on Streptococcus oralis biofilms.

    PubMed

    Catuogno, Christelle; Jones, Malcolm N

    2003-05-12

    A novel system for the delivery of drugs to bacterial biofilms has been developed. The system is based on the use of anionic and cationic liposomes as drug carriers adsorbed on the surface of zinc citrate particles. The adsorption process results in the formation of solid supported vesicles (SSVs) which aids the stabilisation of the liposomes. Anionic liposomes have been prepared by incorporation of phosphatidylinositol (PI) into dipalmitoylphosphatidylcholine (DPPC) liposomes and cationic liposomes have been prepared by incorporation of dioctadecyldimethylammonium bromide (DDAB) into DPPC plus cholesterol liposomes. The liposomes were adsorbed onto zinc citrate particle and targeted to immobilised biofilms of the oral bacterium Streptococcus oralis. The liposomes were used to carry the bactericides, Triclosan, a lipid-soluble agent, and the aqueous-soluble penicillin-G, and their ability to inhibit bacterial growth from immobilised biofilms was accessed. Zinc citrate is itself a bactericide and is used in the formulation of toothpastes. The SSVs carrying the drugs have therapeutic properties. To trace the origin of these properties, each component of the SSV was investigated alone and in combination in binary systems. Some combinations showed synergistic (or additive) antibacterial effects while others showed regressive effects compared with their components. PMID:12711168

  14. The Immunological Enhancement Activity of Propolis Flavonoids Liposome In Vitro and In Vivo

    PubMed Central

    Tao, Yang; Wang, Deqing; Hu, Yuanliang; Huang, Yee; Yu, Yun; Wang, Deyun

    2014-01-01

    The aim of this study was to investigate and assess the effects of propolis flavonoids liposome imposed on the immune system by comparing it to propolis flavonoids and blank liposome. In vitro, the effects of the above drugs on macrophages were assessed by measuring the phagocytic function and cytokine production. In vivo, the immunological adjuvant activity of propolis flavonoids liposome was compared with those of propolis flavonoids and blank liposome. The results showed that in vitro propolis flavonoids liposome can significantly enhance the phagocytic function of macrophages and the release of IL-1?, IL-6, and IFN-?. In addition, subcutaneous administration of propolis flavonoids liposome with ovalbumin to mice could effectively activate the cellular and humoral immune response, including inducing higher level concentrations of IgG, IL-4, and IFN-? in serum and the proliferation rates of splenic lymphocytes. These findings provided valuable information regarding the immune modulatory function of propolis flavonoids liposome and indicated the possibility of use of propolis flavonoids liposome as a potential adjuvant. PMID:25383082

  15. Spermidinium closo-dodecaborate-encapsulating liposomes as efficient boron delivery vehicles for neutron capture therapy.

    PubMed

    Tachikawa, Shoji; Miyoshi, Tatsuro; Koganei, Hayato; El-Zaria, Mohamed E; Viñas, Clara; Suzuki, Minoru; Ono, Koji; Nakamura, Hiroyuki

    2014-10-21

    closo-Dodecaborate-encapsulating liposomes were developed as boron delivery vehicles for neutron capture therapy. The use of spermidinium as a counter cation of closo-dodecaborates was essential not only for the preparation of high boron content liposome solutions but also for efficient boron delivery to tumors. PMID:25182569

  16. AntiTumor Effects From Dendritic Cell-Based Cancer Immunotherapy Using Liposomal Bubbles and Ultrasound

    Microsoft Academic Search

    Yusuke Oda; Ryo Suzuki; Keiichi Hirata; Tetsuya Nomura; Naoki Utoguchi; Kazuo Maruyama

    2011-01-01

    Dendritic cell (DC)-based cancer immunotherapy has the potential to be a minimally invasive therapy that could prevent cancer metastasis and recurrence. Recently, in order to induce effective anti-tumor immunity, we developed a novel antigen delivery system for DCs by the combination of ultrasound (US) and liposomal bubbles (Bubble Liposomes: BLs) with entrapped perfluoropropane gas. In this study, we investigated the

  17. Surface functionalization of liposomes with proteins and carbohydrates for use in anti-cancer applications

    NASA Astrophysics Data System (ADS)

    Platt, Virginia M.

    Liposomes can be used to exploit the altered biology of cancer thereby increasing delivery of liposome-associated anti-cancer drugs. In this dissertation, I explore methods that utilize the unique cancer expression of the polymeric glycosaminoglycan hyaluronan (HA) and the HA receptor CD44 to target liposomes to tumors, using liposomes functionalized with proteins or oligosaccharides on their surface. To make it easier to prepare protein-functionalized liposomes, a non-covalent protein/liposome association method based upon metal chelation/his 6 interaction was devised and characterized. I evaluated non-covalent attachment of the prodrug converting enzyme yeast cytosine deaminase, the far-red fluorescent protein mKate, two antigens ovalbumin and the membrane proximal region of an HIV GAG and hyaluronidase, a HA-degrading enzyme. In Chapter 2, I describe the synthesis of hyaluronan-oligosaccharide (HA-O) lipid conjugates and their incorporation into liposomes to target CD44-overexpressing cancer cells. HA-O ligands of defined-length, up to 10 monosaccharides, were attached to lipids via various linkers by reductive amination. The HA-lipids were easily incorporated into liposomes but did not mediate binding of liposomes to CD44 overexpressing cells. In Chapter 3, I evaluate the capacity of tris-NTA-Ni-lipids incorporated within a liposome bilayer to associate with his6-tagged proteins. Tris-NTA-lipids of differing structures and avidities were used to associate yeast cytosine deaminase and mKate to the surface of liposomes. Two tris-NTA-lipids and a mono-NTA lipid associated his-tagged proteins to a 1:1 molar ratio in solution. The proteins remained active while associated with the liposome surface. When challenged in vitro with fetal calf serum, tris-NTA-containing liposomes retained his-tagged proteins longer than mono-NTA. However, the tris-NTA/his6 interaction was found to be in a dynamic state; free yeast cytosine deaminase rapidly competed with pre-bound mKate for NTA occupancy. In the circulation of mice, his-tagged proteins associated with NTA-liposomes were cleared as rapidly as free protein. In Chapter 4, I study the effect of NTA/his-tag avidity on immune response when NTA-containing liposomes are used as non-covalent, particulate adjuvants. Two his-tagged antigens, ovalbumin and the membrane proximal portion of HIV Gag, were associated with NTA-liposomes containing either mono-NTA or tris-NTA lipids. The immune response to each antigen was compared to control adjuvant formulations in which antigens were admixed with or covalently-conjugated to liposomes. The weaker antigen, the HIV Gag peptide, induced a stronger immune response when associated with NTA-containing liposomes than when admixed with liposomes. Ovalbumin preparations in which the protein was admixed with particles or non-covalently associated with NTA-liposomes elicited a higher immune response than free ovalbumin or ovalbumin admixed with the control adjuvant alum. For both antigens, NTA-liposome responses were less than the response to antigens covalently linked to the liposome. In Chapter 5, I evaluate the potential for hyaluronidase to target conjugated liposomes to tumors or improve liposome motility within hyaluronan-rich tumors. Ovine hyaluronidase was modified using iminothiolane to introduce sulfhydryl groups into the enzyme. The enzyme was attached to liposomes via maleimide lipids or to maleimidehis10 in order to engineer non-covalent NTA-liposome association. Enzyme activity was retained after sulfhydryl addition and after attachment to liposomes. Liposome-conjugated hyaluronidase degraded an HA-gel at the same rate as admixed liposomes. When hyaluronidase-liposomes were injected intravenously in mice, the hyaluronidase conjugated-liposomes experienced faster clearance than control liposomes but slower clearance than free hyaluronidase. As a whole, these studies may help develop universal methods for a range of protein therapeutics and anti-cancer targeting agents.

  18. Use of phospholipase A to compare phospholipid organization in synaptic membranes, myelin, and liposomes.

    PubMed

    Butler, M; Abood, L G

    1982-01-01

    The pattern of fatty acid release from rat synaptic membranes in the presence of phospholipase A2 (Vipera russelli) was compared to that from liposomes comprised of phospholipids. Phospholipase A2 more readily attacked myelin and synaptic membranes than liposomes prepared from total phospholipids derived from myelin. Although hydrolysis of liposomal phospholipids occurred in the absence of added calcium, the presence of 2 mM CaCl2 or 2% bovine serum albumin significantly enhanced the phospholipase attack of liposomes, but not synaptic membranes of myelin. Phospholipase exhibited a marked preference for phospholipids containing docosahexaenoic acid (22:6) in the synaptic membranes, while with liposomes the pattern of released fatty acid reflected the fatty acid composition in the two-position of the phospholipids. Although either calcium or albumin markedly increased the phospholipase hydrolysis of liposomes, neither affected the hydrolysis of synaptic membranes or the pattern of fatty acid release from liposomes. It was concluded that the nonlipid constituents, particularly the proteins, of biomembranes were responsible for the organization of the phospholipids and accounted for the observed differences between liposomes and synaptic membranes with respect to enzymic accessibility. PMID:7069787

  19. Liposomes targeted via two different antibodies: Assay, B-cell binding and cytotoxicity

    Microsoft Academic Search

    Kimberley Laginha; Davis Mumbengegwi; Theresa Allen

    2005-01-01

    The selective toxicity of anticancer drugs can be improved with the use of antibody-targeted liposomes. We hypothesize that liposomes targeted via antibodies against two or more receptor populations will increase the apparent receptor density on the target cells, resulting in improved therapeutic affects. A fluorescent assay was developed, using the fluorophores Alexa Fluor® 350 and 532 to label monoclonal antibodies

  20. Application of Antibody and Fluorophore-Derivatized Liposomes to Heterogeneous Immunoassays for D-dimer

    E-print Network

    Kilpatrick, Peter K.

    Application of Antibody and Fluorophore-Derivatized Liposomes to Heterogeneous Immunoassays for D-type) immunoassay for the detection of thromboembolic disorders by assaying for d-dimer. D-dimer is the final. The immunoassay using liposomes was compared to a conventional immunoassay that uses a fluor-antibody conjugate

  1. Association of acenaphthoporphyrins with liposomes for the photodynamic treatment of leishmaniasis.

    PubMed

    Gardner, Daniel M; Taylor, Viviana M; Cedeño, David L; Padhee, Shruti; Robledo, Sara M; Jones, Marjorie A; Lash, Timothy D; Vélez, Iván D

    2010-01-01

    Acenaphthoporphyrins are potential photosensitizers for photodynamic therapy, but their hydrophobicity limits their potential. Liposomes have been widely investigated as delivery vehicles that can transport hydrophobic drugs in biological systems. Here we study the association of acenaphthoporphyrins with liposomes made up of dimyristoyl phosphatidylcholine (DMPC), and to liposomes made up of a mixture of DMPC, cholesterol (Chol) and distearoyl phosphatidylglycerol (DSPG) in a 2:1:0.8 molar ratio to evaluate how liposome composition affects association constants. In liposomes consisting only of DMPC, the smaller monoacenaphthoporphyrin had the largest association constant of 5.5 x 10(4) m(-1) while the larger adj-diacenaphthoporphyrin and opp-diacenaphthoporphyrin (ODP) had smaller association constants at 1.8 x 10(4) and 1.5 x 10(4) m(-1), respectively. The addition of liposomal Chol and DSPG has little effect on the magnitudes of the association constants. Polarization studies show that the acenaphthoporphyrins are driven far into the lipid bilayer to minimize polar-nonpolar interactions. Confocal microscopy confirms that the DMPC liposomes transport the porphyrins into promastigotes of Leishmania tarentolae. The compounds associated with DMPC:Chol:DSPG liposomes are effective in vitro against axenic and intracellular amastigotes of the pathogenic Leishmania panamensis. The effectiveness of the compounds is enhanced upon exposure of cultures to visible light. PMID:20202163

  2. Delivery of serotonin to the brain by monocytes following phagocytosis of liposomes.

    PubMed

    Afergan, Eyal; Epstein, Hila; Dahan, Rachel; Koroukhov, Nickolay; Rohekar, Keren; Danenberg, Haim D; Golomb, Gershon

    2008-12-01

    Many drugs are not able to enter the brain due to the presence of the blood-brain barrier (BBB) and therefore cannot be used in the treatment of diseases of the brain. Since it is now known that the brain is under immunological surveillance, we hypothesized that phagocytic cells of the innate immune system, mainly neutrophils and monocytes, can be exploited as transporters of drugs to the brain. To target circulating mononuclear phagocytic cells, negatively-charged nano-sized liposomes were formulated encapsulating serotonin, a BBB impermeable neurological drug. Brain uptake, biodistribution, and the mechanism of brain transport were examined in vitro and in rats and rabbits by utilizing double-radiolabeled (3)H (in the membrane) and (14)C-serotonin (in the core), and liposomes with fluorescent markers (membrane and core). The brain uptake of liposomal serotonin was significantly higher (0.138%+/-0.034 and 0.097%+/-0.011, vs. 0.068%+/-0.02 and 0.057%+/-0.01, 4 h and 24 h after IV administration in rats, serotonin liposomes and in solution, respectively). The same brain uptake of both empty and serotonin liposomes, the co-localization in the brain of both markers, and the unchanged ratio of (3)H:(14)C suggest that intact liposomes entered the brain. Since treatment of animals by liposomal alendronate resulted with inhibition of monocytes but not of neutrophils, and with no brain delivery, it is suggested that monocytes are the main transporters of liposomes to the brain. PMID:18805446

  3. Improved oral bioavailability of alendronate via the mucoadhesive liposomal delivery system.

    PubMed

    Han, Hyo-Kyung; Shin, Hyun-Jae; Ha, Dong Hoon

    2012-08-15

    This study aimed to design the chitosan coated liposomes of alendronate and optimize their in vitro/in vivo characteristics to improve the bioavailability as well as potentially to reduce the mucosal irritation of alendronate. Liposomes of alendronate were prepared with DSPC/DSPG by using thin layer film hydration method and then the surface of anionic liposomes was coated by chitosan. In vitro characteristics of liposomes (e.g., stability in various biological media, mucoadhesiveness and cellular uptake profiles) were evaluated along with the pharmacokinetic studies in rats. Lipid vesicles of 200 nm size were obtained with narrow size distribution (PI<0.1) and subsequently coated with chitosan. Chitosan coated liposomes were stable for 24 h without either size change or drug leakage in various biological fluids including simulated gastric fluids and intestinal fluids. Furthermore, it exhibited strong mucoadhesive properties. Compared to the untreated drug (non-liposome), the chitosan coated liposomes indicated significantly (p<0.05) increased cellular uptake of alendronate in Caco-2 cells and also 2.6-fold enhancement in oral bioavailability of alendronate in rats. Taken all together, the mucoadhesive liposomes for the oral delivery of alendronate was prepared by using DSPC and DSPG with narrow size distribution and appeared to be effective to enhance the bioavailability of alendronate in rats. PMID:22522117

  4. Effect of Some Substituents Increasing the Solubility of Zn(II) and Al(III) Phthalocyanines on Their Photophysical Properties

    PubMed Central

    Chernonosov, A. A.; Ermilov, E. A.; Röder, B.; Solovyova, L. I.; Fedorova, O. S.

    2014-01-01

    Water solubility of phthalocyanines (Pcs) usually increases by the introduction of charged or carboxy substituents in the peripheral positions of the macrocycle. As a result, such structural changes influence their photophysical and photochemical properties as photosensitizers. Phthalocyanines substituted with four or eight terminal carboxyl groups and having in some cases additional eight positive charges (water soluble phthalocyanines) were studied in order to evaluate the spectroscopic and photophysical effects of these side residues on the chromophore properties. The quantum yield of singlet oxygen (1O2) generation, the triplet-triplet absorption, and the transient absorption spectra were measured and linked to the structure of the substituents. It was shown that charged substituents did not change the quantum yields of 1O2 generation but decrease its lifetimes. The introduction of the charged substituents not only increases the water solubility but also significantly changes absorption, fluorescence, and transient absorption spectra of water soluble Pcs. PMID:25302061

  5. Phthalocyanine-Aggregated Polymeric Nanoparticles as Tumor-Homing Near-Infrared Absorbers for Photothermal Therapy of Cancer

    PubMed Central

    Lim, Chang-Keun; Shin, Jiyoung; Lee, Yong-Deok; Kim, Jungahn; Oh, Keun Sang; Yuk, Soon Hong; Jeong, Seo Young; Kwon, Ick Chan; Kim, Sehoon

    2012-01-01

    Phthalocyanine-aggregated Pluronic nanoparticles were constructed as a novel type of near-infrared (NIR) absorber for photothermal therapy. Tiny nanoparticles (~ 60 nm, FPc NPs) were prepared by aqueous dispersion of phthalocyanine-aggregated self-assembled nanodomains that were phase-separated from the melt mixture with Pluronic. Under NIR laser irradiation, FPc NPs manifested robust heat generation capability, superior to an individual cyanine dye and cyanine-aggregated nanoparticles. Micro- and macroscopic imaging experiments showed that FPc NPs are capable of internalization into live cancer cells as well as tumor accumulation when intravenously administered into living mice. It is shown here that continuous NIR irradiation of the tumor-targeted FPc NPs can cause phototherapeutic effects in vitro and in vivo through excessive local heating, demonstrating potential of phthalocyanine-aggregated nanoparticles as an all-organic NIR nanoabsorber for hyperthermia. PMID:23082099

  6. Physicochemical properties of Mg-phthalocyanine molecules covalently bonded to the surface of nanopores in a silicate gel matrix

    NASA Astrophysics Data System (ADS)

    Arabei, S. M.; Pavich, T. A.

    2007-09-01

    Molecules of Mg-tetracarboxyphthalocyanine, chemically modified with 3-aminopropyltrimethoxysilane, were immobilized on the surface of the nanopores in a silicate gel matrix by copolymerizing them with tetraethoxysilane monomer. Formation of covalent bonds between the Mg-phthalocyanine molecules and the surface of the nanopores in the silicate xerogel was confirmed by the absence of leaching of the “grafted” pigment from the interior volume of the xerogel to the liquid extraction agent, and also by IR Fourier spectroscopy data. The observed bleaching of the activated silicate xerogel under normal atmospheric conditions is reversible: subsequent heat treatment restores the original absorption spectrum. We hypothesize that two mechanisms are responsible for the observed effect: formation of high order associates of the Mg-phthalocyanine molecules involving water molecules adsorbed from the atmosphere, and/or oxidation of the phthalocyanine macrocycle with disruption of the conjugation chain.

  7. Ammonia adsorption on iron phthalocyanine on Au(111): Influence on adsorbate-substrate coupling and molecular spin

    SciTech Connect

    Isvoranu, Cristina; Ataman, Evren; Knudsen, Jan; Andersen, Jesper N.; Schnadt, Joachim [Division of Synchrotron Radiation Research, Department of Physics, Lund University, Box 118, 221 00 Lund (Sweden); Wang Bin; Bocquet, Marie-Laure [Laboratoire de chimie, Ecole normale superieure de Lyon, 46, Allee d'Italie, 69364 Lyon Cedex 07 (France); Schulte, Karina [MAX-lab, Lund University, Box 118, 221 00 Lund (Sweden)

    2011-03-21

    The adsorption of ammonia on Au(111)-supported monolayers of iron phthalocyanine has been investigated by x-ray photoelectron spectroscopy, x-ray absorption spectroscopy, and density functional theory calculations. The ammonia-induced changes of the x-ray photoemission lines show that a dative bond is formed between ammonia and the iron center of the phthalocyanine molecules, and that the local spin on the iron atom is quenched. This is confirmed by density functional theory, which also shows that the bond between the iron center of the metalorganic complex and the Au(111) substrate is weakened upon adsorption of ammonia. The experimental results further show that additional adsorption sites exist for ammonia on the iron phthalocyanine monolayer.

  8. Efficient preparation of liposomes encapsulating food materials using lecithins by a mechanochemical method.

    PubMed

    Takahashi, Makoto; Inafuku, Kei-ichiro; Miyagi, Takeshi; Oku, Hirosuke; Wada, Koji; Imura, Tomohiro; Kitamoto, Dai

    2006-01-01

    In order to evaluate to the feasibility of using lecithins for nanocapsules including functional food materials, liposomes were prepared from different commercially available lecithins (SLP-WHITE, SLP-PC70 and PL30S) by the Bangham method, and their physicochemical properties were examined by using a confocal laser scanning microscopy (CLSM) and the measurements of trapping efficiency. There was little difference in the trapping efficiency among the three types of liposomes. In all cases, the trapping efficiency clearly increased with an increase of the lecithin concentration up to 10 wt % , and the maximum efficiency reached at approximately 15%. CLSM observation showed the particle size of liposomes prepared from SLP-WHITE is significantly smaller than that prepared from other lecithins. In addition, liposomal solution prepared from SLP-WHITE remained well dispersed for at least 30 days, while two other liposomal solutions showed a phase separation due to aggregation and/or fusion of liposomes. These results indicated that SLP-WHITE is the most appropriate for the preparation of stable liposomes with well dispersed among the lecithins tested. SLP-WHITE liposomes were then prepared by the mechanochemical method using a homogenizer and microfluidizer, aiming at improving the preparation efficiency and liposome stability. The particle size of the prepared SLP-WHITE liposomes decreased with increasing inlet pressure and the number of processed cycles, and reached between 73 and 123 nm based on the measurement using dynamic light scattering. Moreover, freeze-fracture transmission electron microscopy revealed that the prepared liposomes are small unilamellar vesicles (SUV) with a diameter of approximately 100 nm. The extract of Curcuma longa Linn. (Ukon), which contains curcumins as a functional food material, was then subjected to the mechanochemical method with SLP-WHITE to give liposomes including the functional materials. Interestingly, the trapping efficiency of the liposomes for curcumins was found to reach over 85%. From these results, the present mechanochemical method is very likely to allow us to efficiently prepare stable and functional liposomes from the low-cost lecithin. The method may thus have a potential for manufacturing practical nanocapsules, which serves as a novel carrier of functional food materials. PMID:17693697

  9. Cancer Immunotherapy Utilized Bubble Liposomes and Ultrasound as Antigen Delivery System

    NASA Astrophysics Data System (ADS)

    Oda, Yusuke; Otake, Shota; Suzuki, Ryo; Otake, Shota; Nishiie, Norihito; Hirata, Keiichi; Taira, Yuichiro; Utoguchi, Naoki; Maruyama, Kazuo

    2010-03-01

    In dendritic cells (DCs)-based cancer immunotherapy, it is important to present the epitope peptide derived from tumor associated antigens (TAAs) on MHC class I in order to induce tumor specific cytotoxic T lymphocytes (CTLs). However, MHC class I molecules generally present the epitope peptides derived from endogenous antigens for DCs but not exogenous ones such as TAAs. Recently, we developed the novel liposomal bubbles (Bubble liposomes) encapsulating perfluoropropane nanobubbles. In this study, we attempted to establish the novel antigen delivery system to induce MHC class I presentation using the combination of ultrasound and Bubble liposomes. Using ovalbumin (OVA) as model antigen, the combination of Bubble liposomes and ultrasound exposure for the DC could induce MHC class I presentation. In addition, the viability of DCs was more than 80%. These results suggest that Bubble liposomes might be a novel ultrasound enhanced antigen delivery tool in DC-based cancer immunotherapy.

  10. Evaluation of anticancer activity of celastrol liposomes in prostate cancer cells

    PubMed Central

    Wolfram, Joy; Suri, Krishna; Huang, Yi; Molinaro, Roberto; Borsoi, Carlotta; Scott, Bronwyn; Boom, Kathryn; Paolino, Donatella; Fresta, Massimo; Wang, Jianghua; Ferrari, Mauro

    2014-01-01

    Context Celastrol, a natural compound derived from the herb Tripterygium wilfordii, is known to have anticancer activity, but is not soluble in water. Objective Formation of celastrol liposomes, to avoid the use of toxic solubilizing agents. Materials and methods Two different formulations of pegylated celastrol liposomes were fabricated. Liposomal characteristics and serum stability were determined using dynamic light scattering. Drug entrapment efficacy and drug release were measured spectrophotometrically. Cellular internalization and anticancer activity was measured in prostate cancer cells. Results Liposomal celastrol displayed efficient serum stability, cellular internalization and anticancer activity, comparable to that of the free drug reconstituted in dimethyl sulfoxide. Discussion and conclusion Liposomal celastrol can decrease the viability of prostate cancer cells, while eliminating the need for toxic solubilizing agents. PMID:24654943

  11. The Use of Convection-Enhanced Delivery with Liposomal Toxins in Neurooncology

    PubMed Central

    Fiandaca, Massimo S.; Berger, Mitchel S.; Bankiewicz, Krystof S.

    2011-01-01

    Liposomes have long been effective delivery vehicles for transport of toxins to peripheral cancers. The combination of convection-enhanced delivery (CED) with liposomal toxins was originally proposed to circumvent the limited delivery of intravascular liposomes to the central nervous system (CNS) due to the blood-brain-barrier (BBB). CED offers markedly improved distribution of infused therapeutics within the CNS compared to direct injection or via drug eluting polymers, both of which depend on diffusion for parenchymal distribution. This review examines the basis for improved delivery of liposomal toxins via CED within the CNS, and discusses preclinical and clinical experience with these therapeutic techniques. How CED and liposomal technologies may influence future neurooncologic treatments are also considered. PMID:22069714

  12. Tumor targeting and imaging with dual-peptide conjugated multifunctional liposomal nanoparticles

    PubMed Central

    Rangger, Christine; Helbok, Anna; Sosabowski, Jane; Kremser, Christian; Koehler, Gottfried; Prassl, Ruth; Andreae, Fritz; Virgolini, Irene J; von Guggenberg, Elisabeth; Decristoforo, Clemens

    2013-01-01

    Background The significant progress in nanotechnology provides a wide spectrum of nanosized material for various applications, including tumor targeting and molecular imaging. The aim of this study was to evaluate multifunctional liposomal nanoparticles for targeting approaches and detection of tumors using different imaging modalities. The concept of dual-targeting was tested in vitro and in vivo using liposomes derivatized with an arginine-glycine-aspartic acid (RGD) peptide binding to ?v?3 integrin receptors and a substance P peptide binding to neurokinin-1 receptors. Methods For liposome preparation, lipids, polyethylene glycol building blocks, DTPA-derivatized lipids for radiolabeling, lipid-based RGD and substance P building blocks and imaging labels were combined in defined molar ratios. Liposomes were characterized by photon correlation spectroscopy and zeta potential measurements, and in vitro binding properties were tested using fluorescence microscopy. Standardized protocols for radiolabeling were developed to perform biodistribution and micro-single photon emission computed tomography/computed tomography (SPECT/CT) studies in nude mice bearing glioblastoma and/or melanoma tumor xenografts. Additionally, an initial magnetic resonance imaging study was performed. Results Liposomes were radiolabeled with high radiochemical yields. Fluorescence microscopy showed specific cellular interactions with RGD-liposomes and substance P-liposomes. Biodistribution and micro-SPECT/CT imaging of 111In-labeled liposomal nanoparticles revealed low tumor uptake, but in a preliminary magnetic resonance imaging study with a single-targeted RGD-liposome, uptake in the tumor xenografts could be visualized. Conclusion The present study shows the potential of liposomes as multifunctional targeted vehicles for imaging of tumors combining radioactive, fluorescent, and magnetic resonance signaling. Specific in vitro tumor targeting by fluorescence microscopy and radioactivity was achieved. However, biodistribution studies in an animal tumor model revealed only moderate tumor uptake and no additive effect using a dual-targeting approach. PMID:24353415

  13. A Mathematical Model of the Enhanced Permeability and Retention Effect for Liposome Transport in Solid Tumors

    PubMed Central

    Stapleton, Shawn; Milosevic, Michael; Allen, Christine; Zheng, Jinzi; Dunne, Michael; Yeung, Ivan; Jaffray, David A.

    2013-01-01

    The discovery of the enhanced permeability and retention (EPR) effect has resulted in the development of nanomedicines, including liposome-based formulations of drugs, as cancer therapies. The use of liposomes has resulted in substantial increases in accumulation of drugs in solid tumors; yet, significant improvements in therapeutic efficacy have yet to be achieved. Imaging of the tumor accumulation of liposomes has revealed that this poor or variable performance is in part due to heterogeneous inter-subject and intra-tumoral liposome accumulation, which occurs as a result of an abnormal transport microenvironment. A mathematical model that relates liposome accumulation to the underlying transport properties in solid tumors could provide insight into inter and intra-tumoral variations in the EPR effect. In this paper, we present a theoretical framework to describe liposome transport in solid tumors. The mathematical model is based on biophysical transport equations that describe pressure driven fluid flow across blood vessels and through the tumor interstitium. The model was validated by direct comparison with computed tomography measurements of tumor accumulation of liposomes in three preclinical tumor models. The mathematical model was fit to liposome accumulation curves producing predictions of transport parameters that reflect the tumor microenvironment. Notably, all fits had a high coefficient of determination and predictions of interstitial fluid pressure agreed with previously published independent measurements made in the same tumor type. Furthermore, it was demonstrated that the model attributed inter-subject heterogeneity in liposome accumulation to variations in peak interstitial fluid pressure. These findings highlight the relationship between transvascular and interstitial flow dynamics and variations in the EPR effect. In conclusion, we have presented a theoretical framework that predicts inter-subject and intra-tumoral variations in the EPR effect based on fundamental properties of the tumor microenvironment and forms the basis for transport modeling of liposome drug delivery. PMID:24312530

  14. Mechanosensitive liposomes as artificial chaperones for shear-driven acceleration of enzyme-catalyzed reaction.

    PubMed

    Natsume, Tomotaka; Yoshimoto, Makoto

    2014-03-12

    Mechanosensitive liposomes were prepared and applied to continuously accelerate the glucose oxidase (GO) reaction in shear flow. The liposome membrane was composed of a ternary lipid mixture containing 20 mol % negatively charged lipid and 30 mol % cholesterol. The liposomes encapsulating GO and catalase were passed through microtubes with inner diameter of 190 or 380 ?m at 25 °C to induce the catalytic oxidation of 10 mM glucose with simultaneous decomposition of H2O2 produced. The liposomal GO showed significantly low reactivity in the static liquid system because of the permeation resistance of lipid membranes to glucose. On the other hand, the enzyme activity of liposomal GO observed at the average shear rate of 7.8 × 10(3) s(-1) was significantly larger than its intrinsic activity free of mass transfer effect in the static liquid system. The structure of liposomes was highly shear-sensitive as elucidated on the basis of shear rate-dependent physical stability of liposomes and membrane permeability to 5(6)-carboxyfluorescein as well as to GO. Thus, the above shear-driven acceleration of GO reaction was indicated to be caused by the free GO molecules released from the structurally altered liposomes at high shear rates. Moreover, the shear-induced denaturation of free GO was completely depressed by the interaction with the sheared liposomes with the chaperone-like function. The shear-sensitive liposomal GO system can be a unique catalyst that continuously accelerates and also decelerates the oxidation reaction depending on the applied shear rate. PMID:24547684

  15. Efficacy and safety of liposomal clarithromycin and its effect on Pseudomonas aeruginosa virulence factors.

    PubMed

    Alhajlan, Mai; Alhariri, Moayad; Omri, Abdelwahab

    2013-06-01

    We investigated the efficacy and safety of liposomal clarithromycin formulations with different surface charges against clinical isolates of Pseudomonas aeruginosa from the lungs of cystic fibrosis (CF) patients. The liposomal clarithromycin formulations were prepared by the dehydration-rehydration method, and their sizes were measured using the dynamic-light-scattering technique. Encapsulation efficiency was determined by microbiological assay, and the stabilities of the formulations in biological fluid were evaluated for a period of 48 h. The MICs and minimum bactericidal concentrations (MBCs) of free and liposomal formulations were determined with P. aeruginosa strains isolated from CF patients. Liposomal clarithromycin activity against biofilm-forming P. aeruginosa was compared to that of free antibiotic using the Calgary Biofilm Device (CBD). The effects of subinhibitory concentrations of free and liposomal clarithromycin on bacterial virulence factors and motility on agar were investigated on clinical isolates of P. aeruginosa. The cytotoxicities of the liposome preparations and free drug were evaluated on a pulmonary epithelial cell line (A549). The average diameter of the formulations was >222 nm, with encapsulation efficiencies ranging from 5.7% to 30.4%. The liposomes retained more than 70% of their drug content during the 48-h time period. The highly resistant strains of P. aeruginosa became susceptible to liposome-encapsulated clarithromycin (MIC, 256 mg/liter versus 8 mg/liter; P < 0.001). Liposomal clarithromycin reduced the bacterial growth within the biofilm by 3 to 4 log units (P < 0.001), significantly attenuated virulence factor production, and reduced bacterial twitching, swarming, and swimming motilities. The clarithromycin-entrapped liposomes were less cytotoxic than the free drug (P < 0.001). These data indicate that our novel formulations could be a useful strategy to enhance the efficacy of clarithromycin against resistant P. aeruginosa strains that commonly affect individuals with cystic fibrosis. PMID:23545534

  16. Liposomal pemetrexed: formulation, characterization and in vitro cytotoxicity studies for effective management of malignant pleural mesothelioma.

    PubMed

    Essam Eldin, Noha; Elnahas, Hanan Mohamed; Mahdy, Mahmoud Abd-Elghany; Ishida, Tatsuhiro

    2015-01-01

    Pemetrexed (PMX) is a newly developed multi-targeted anti-folate with promising clinical activity in many solid tumors including malignant pleural mesothelioma (MPM). However, PMX does not show sufficient anti-tumor activity in vivo when used alone either due to inefficient delivery of adequate concentrations to tumor tissue or dose-limiting side effects. In order to overcome these problems and to achieve potent anti-tumor activity, PMX was encapsulated into a liposomal delivery system. In the present study, various formulations of liposomal PMX were prepared. The effect of formulation parameters on the encapsulation efficiency of PMX within liposomes was evaluated. In addition, the influence of drug release rate on the in vitro cytotoxicity was investigated. Encapsulation of PMX within liposomes was remarkably increased by the incorporation of cholesterol within liposomal membranes and by increasing the total lipid concentration. Encapsulation efficiency was found to be unaffected by the type of phospholipid used or the inclusion of a cation lipid, DC-6-14. Interestingly, encapsulation of PMX within "fluid" liposomes was found to allow efficient release of PMX from liposomes resulting in a potent in vitro cytotoxicity against MPM MSTO-211H cell line. On the other hand, entrapment of PMX within "solid" liposomes substantially hindered PMX release from liposomes, and thus PMX failed to exert any in vitro cytotoxicity. These results suggest that encapsulation of PMX within "fluid" liposomes might represent a novel strategy to enhance the therapeutic efficacy of PMX while minimizing the side effect encountered by the non selective delivery of free PMX to various body tissues. PMID:25757929

  17. Interactions of antitumour Sialyl Lewis X liposomes with vascular endothelial cells.

    PubMed

    Alekseeva, Anna; Kapkaeva, Marina; Shcheglovitova, Olga; Boldyrev, Ivan; Pazynina, Galina; Bovin, Nicolai; Vodovozova, Elena

    2015-05-01

    Recently, we showed that tetrasaccharide selectin ligand SiaLe(X) provided targeted delivery of liposomes loaded in the bilayer with melphalan lipophilic prodrug to tumour endothelium followed by severe injury of tumour vessels in a Lewis lung carcinoma model. Here, we study the impact of SiaLe(X) ligand on the interactions of liposomes with human umbilical vein endothelial cells (HUVEC) using flow cytometry, spectrofluorimetry and confocal microscopy. Liposomes composed of egg phosphatidylcholine/yeast phosphatidylinositol/1,2-dioleoyl glycerol ester of melphalan, 8:1:1, by mol, and varying percentages of lipophilic SiaLe(X) conjugate were labelled with BODIPY-phosphatidylcholine. The increase in SiaLe(X) content in liposomes led to a proportional increase in their uptake by cytokine-activated cells as opposed to non-activated HUVEC: for 10% SiaLe(X) liposomes, binding avidity and overall accumulation increased 14- and 6-fold, respectively. The early stages of intracellular traffic of targeted liposomes in the activated cells were monitored by co-localisation with the trackers of organelles. Endocytosis of SiaLe(X) liposomes occurred mostly via clathrin-independent pathways, which does not contradict the available literature data on E-selectin localisation in the plasma membrane. Using dual fluorescence labelling, with rhodamine-labelled phospholipid and calcein encapsulated at self-quenching concentrations, we found that SiaLe(X) liposomes undergo rapid (within minutes) internalisation by activated HUVEC accompanied by the disruption of liposomes; non-activated cells consumed a negligible dose of liposomes during at least 1.5h. Our data evidence the selective effect of SiaLe(X) formulations on activated endothelial cells and indicate their potential for intracellular delivery of melphalan lipophilic prodrug. PMID:25646577

  18. Efficacy and Safety of Liposomal Clarithromycin and Its Effect on Pseudomonas aeruginosa Virulence Factors

    PubMed Central

    Alhajlan, Mai; Alhariri, Moayad

    2013-01-01

    We investigated the efficacy and safety of liposomal clarithromycin formulations with different surface charges against clinical isolates of Pseudomonas aeruginosa from the lungs of cystic fibrosis (CF) patients. The liposomal clarithromycin formulations were prepared by the dehydration-rehydration method, and their sizes were measured using the dynamic-light-scattering technique. Encapsulation efficiency was determined by microbiological assay, and the stabilities of the formulations in biological fluid were evaluated for a period of 48 h. The MICs and minimum bactericidal concentrations (MBCs) of free and liposomal formulations were determined with P. aeruginosa strains isolated from CF patients. Liposomal clarithromycin activity against biofilm-forming P. aeruginosa was compared to that of free antibiotic using the Calgary Biofilm Device (CBD). The effects of subinhibitory concentrations of free and liposomal clarithromycin on bacterial virulence factors and motility on agar were investigated on clinical isolates of P. aeruginosa. The cytotoxicities of the liposome preparations and free drug were evaluated on a pulmonary epithelial cell line (A549). The average diameter of the formulations was >222 nm, with encapsulation efficiencies ranging from 5.7% to 30.4%. The liposomes retained more than 70% of their drug content during the 48-h time period. The highly resistant strains of P. aeruginosa became susceptible to liposome-encapsulated clarithromycin (MIC, 256 mg/liter versus 8 mg/liter; P < 0.001). Liposomal clarithromycin reduced the bacterial growth within the biofilm by 3 to 4 log units (P < 0.001), significantly attenuated virulence factor production, and reduced bacterial twitching, swarming, and swimming motilities. The clarithromycin-entrapped liposomes were less cytotoxic than the free drug (P < 0.001). These data indicate that our novel formulations could be a useful strategy to enhance the efficacy of clarithromycin against resistant P. aeruginosa strains that commonly affect individuals with cystic fibrosis. PMID:23545534

  19. Effect of phospholipid composition on pharmacokinetics and biodistribution of epirubicin liposomes.

    PubMed

    Sha, Xianyi; Guo, Jie; Chen, Yanzuo; Fang, Xiaoling

    2012-03-01

    The effects of phospholipid composition on the pharmacokinetics (PK) and biodistribution of epirubicin (EPI) liposomes, as well as the in vitro macrophage uptake of various liposome formulations, were investigated. Three liposome formulations were investigated: HSPC:Chol (L-EPI; 5:4 molar ratio), HSPC:Chol:DSPG (D-EPI; 5:4:1 molar ratio), and HSPC:Chol:DSPG:DSPE-mPEG(2000) (S-EPI; 5:4:1:0.3 molar ratio). Small unilamellar liposomes were prepared by the modified thin-film hydration method with extrusion through polycarbonate filters, and EPI was remote loaded into liposomes by the transmembrane ammonium sulfate gradient method. Macrophages were used to evaluate in vitro the cellular uptake of EPI-loaded liposomes. The following decreasing order of uptake amount was observed: L-EPI>D-EPI>S-EPI. D-EPI showed a relatively low level of uptake, probably because of the steric hindrance provided by the glycerol head group on DSPG, protecting it from the direct recognization by cell-membrane receptors. With the presence of serum, uptake values for all liposome formulations were increased for the activation of the complement system. In the PK study, S-EPI showed significantly prolonged circulating time and reduced clearance. The following increasing order of area under the concentration versus time curve was observed among the various liposome formulations: L-EPIliposomes. The encouraging property of S-EPI, in terms of prolonging circulating time and reducing heart toxicity, might describe a promising perspective toward clinical application, and all the results would support further research into liposome-based drug carriers. PMID:22022836

  20. 1,4,8,11,15,18,22,25-Alkylsulfanyl phthalocyanines: effect of macrocycle distortion on spectroscopic and packing properties.

    PubMed

    Zorlu, Yunus; Kumru, Ufuk; ??ci, Ümit; Divrik, Burcin; Jeanneau, Erwann; Albrieux, Florian; Dede, Yavuz; Ahsen, Vefa; Dumoulin, Fabienne

    2015-03-31

    The effect of phthalocyanine macrocycle distortion on its spectroscopic and packing properties is studied, by comparing two phthalocyanines octa-non-peripherally substituted by alkanethiols of different bulkiness (n-hexyl and tert-butyl). Their X-ray structures evidence their core shape, respectively planar and strongly distorted, inducing a 55 nm shift of their maximum absorption wavelength. Comparison of frontier orbital energies revealed that this distortion decreases the conjugation potency of the benzo rings to the central pyrrolic rings. Also the tert-butyl derivative presents a MOF-like porous crystalline assembly with 22.2% void. PMID:25773864