These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

Synthesis and biological evaluation of a series of new germanium phthalocyanines incorporated into liposomes--part II: biological evaluation  

NASA Astrophysics Data System (ADS)

The pharmacokinetic and phototherapeutic properties of new phthalocyanines with Ge(IV) or Si(VI) as the central metal ion and cholesterol, cholestan or long-chain fatty acids residues as axial ligands to the central ion have been studied in tumor-bearing mice. The new photosensitizers were selectively taken up by and relatively quickly released from the tumors. Except for Si(IV)-Pc, which showed a comparably high selectivity for tumor versus peritumoral tissue, all Ge(IV)-Pc were less selective than liposomal Zn-Pc (CGP 55847). However, all the new compounds showed excellent phototherapeutic efficiency at very low drug and light doses in studies in Meth-A-sarcoma-bearing mice.

Schieweck, Klaus; Capraro, Hans-Georg; Isele, Ute; Batt, Ernst; Ochsner, Martin; van Hoogevest, Peter; Love, William G.

1994-03-01

2

Enhanced photodynamic leishmanicidal activity of hydrophobic zinc phthalocyanine within archaeolipids containing liposomes  

PubMed Central

In this work, the in vitro anti-Leishmania activity of photodynamic liposomes made of soybean phosphatidylcholine, sodium cholate, total polar archaeolipids (TPAs) extracted from the hyperhalophile archaea Halorubrum tebenquichense and the photosensitizer zinc phthalocyanine (ZnPcAL) was compared to that of ultradeformable photodynamic liposomes lacking TPAs (ZnPcUDLs). We found that while ZnPcUDLs and ZnPcALs (130 nm mean diameter and ?35 mV zeta potential) were innocuous against promastigotes, a low concentration (0.01 ?M ZnPc and 7.6 ?M phospholipids) of ZnPcALs irradiated at a very low-energy density (0.2 J/cm2) eliminated L. braziliensis amastigotes from J774 macrophages, without reducing the viability of the host cells. In such conditions, ZnPcALs were harmless for J774 macrophages, HaCaT keratinocytes, and bone marrow-derived dendritic cells. Therefore, topical photodynamic treatment would not likely affect skin-associated lymphoid tissue. ZnPcALs were extensively captured by macrophages, but ZnPcUDLs were not, leading to 2.5-fold increased intracellular delivery of ZnPc than with ZnPcUDLs. Despite mediating low levels of reactive oxygen species, the higher delivery of ZnPc and the multiple (caveolin- and clathrin-dependent plus phagocytic) intracellular pathway followed by ZnPc would have been the reason for the higher antiamastigote activity of ZnPcALs. The leishmanicidal activity of photodynamic liposomal ZnPc was improved by TPA-containing liposomes. PMID:25045264

Perez, Ana Paula; Casasco, Agustina; Schilrreff, Priscila; Defain Tesoriero, Maria Victoria; Duempelmann, Luc; Altube, Maria Julia; Higa, Leticia; Morilla, Maria Jose; Petray, Patricia; Romero, Eder L

2014-01-01

3

Pharmaceutical development of CGP 55847: a liposomal Zn-phthalocyanine formulation using a controlled organic solvent dilution method  

NASA Astrophysics Data System (ADS)

Liposomes were prepared containing zinc-phthalocyanine (ZnPc). The composition was ZnPc/POPC/OOPS (1:90:10 w/w /w). The phospholipids (PL) were dissolved in t-butanol at 50 degree(s)C under magnetic stirring and mixed with ZnPc, dissolved in NMP for two hours in an ultrasonic bath at 80 degree(s)C. This mixture (50 degree(s)C) was diluted with lactose- NaCl solution (9.475% lactose, 0.027% NaCl) at 4 degree(s)C using a dynamic mixer. The collected liposomal suspension was concentrated first, to 20 mg PL/ml suspension and then the organic solvents were removed by tangential flow filtration (CentrasetteR) against a ten fold volume of lactose-NaCl solution. After sterile filtration the liposomal suspension was freeze-dried for 24 hours.

Isele, Ute; van Hoogevest, Peter; Leuenberger, Hans; Capraro, Hans-Georg; Schieweck, Klaus

1994-03-01

4

CGP 55 847, liposome-delivered zinc(II)-phthalocyanine as a phototherapeutic agent for tumors  

NASA Astrophysics Data System (ADS)

Zinc(II)-phthalocyanine (Zn-Pc) was chosen for development as a second-generation photosensitizer for photodynamic therapy (PDT) of tumors and for benign conditions because of its advantageous chemical and photophysical properties. Zn-Pc displayed good selectivity for malignant tissue in pharmacokinetic studies with Meth-A-sarcoma-bearing BALB/c mice when injected in a dose of 0.125 mg/kg, delivered by CGP 55 847. Intravenous doses of Zn- Pc ranging from 0.032 to 0.375 mg/kg caused tumor necrosis and, subsequently, cure of Meth-A-sarcoma-bearing mice when phototreatment was performed 48 hours after injection of CGP 55 847. Intravenous injection of Zn-Pc into hairless mice in doses ranging from 0.1 to 1.0 mg/kg caused dose- and time-dependent phototoxicity. We conclude that the promising pharmacological properties of liposomally delivered Zn-Pc, along with its advantageous chemical and photophysical properties, warrant the development of CGP 55 847 as a candidate drug for photodynamic therapy of tumors in humans.

Schieweck, Klaus; Capraro, Hans-Georg; Isele, Ute; van Hoogevest, Peter; Ochsner, Martin; Maurer, Thomas; Batt, Ernst

1994-03-01

5

Synthesis and biological evaluation of a series of new germanium phthalocyanines incorporated into liposomes--part I: chemistry  

NASA Astrophysics Data System (ADS)

Germanium-dihydroxy-phthalocyanine GePc(OH2) was synthesized and used as starting material for several new, axially disubstituted derivatives of the general formula GePc[OSi(R2)R']2. The preparation of the monosubstituted silanol side chains HOSi(R)2R' was performed either by Mitsunobu reaction starting from diphenylsilandiol Si(Ph)2(OH)2 followed by direct coupling of the side-chain with GePc(OH)2, or by synthesis from a dichlorosilyl derivative. The new compounds were fully characterized and the chemical and main photophysical properties determined. The absorption maxima of these compounds lie in the range of 675 nm. They were found to possess a high quantum efficiency of singlet-oxygen production and fluorescence. The compounds were incorporated into small, unilamellar liposomes following a technology developed by Ciba-Geigy. The dye-to-lipid ratio was 1:100. The liposomal suspensions were freeze-dried for storage. The new compounds were evaluated for their pharmacokinetic and phototherapeutic properties.

Capraro, Hans-Georg; Schieweck, Klaus; Hilfiker, Rolf; Ochsner, Martin; Isele, Ute; van Hoogevest, Peter; Naef, R.; Baumann, M. E.

1994-03-01

6

Chloroaluminum phthalocyanine tetrasulfonate delivered via acid-labile diplasmenylcholine-folate liposomes: intracellular localization and synergistic phototoxicity.  

PubMed

Folate-diplasmenylcholine (1,2-di-O-(Z-1'-hexadecenyl)-sn-glycero-3-phosphocholine; DPPlsC) liposomes have been shown to greatly enhance the potency of water-soluble antitumor agents via a selective folate-mediated uptake and acid-catalyzed endosomal escape mechanism (Rui et al. J. Am. Chem. Soc., 1998; 120:11213--18). This study describes an adaptation of this strategy for the delivery of chloroaluminum phthalocyanine tetrasulfonate ([AlPcS(4)](4-)), a water-soluble sensitizer used in photodynamic therapy, in a binary targeting scheme designed to enhance both its tumor selectivity and phototoxicity. [AlPcS(4)](4-)/DPPlsC:folate liposomes (9.8 microM bulk concentration, 2.5 mM intraliposomal concentration) were substantially more phototoxic to folate-deficient KB cells than 12.5 microM free [AlPcS(4)](4-) after a 30 min irradiation (630-910 nm). Considerable differences in phototoxicity were observed, however, between the commercially-available AlPcS(4)(4-) and an HPLC purified sample of [AlPcS(4)](4-) due to an increased tendency for the latter to aggregate. Experiments with [AlPcS(4)](4-)/DPPC:folate and folate-free [AlPcS(4)](4-)/DPPlsC liposomes (acid-insensitive and non-targeted controls, respectively) showed significantly reduced phototoxicities under the same illumination conditions. Our results imply that higher concentrations of water-soluble sensitizers can be delivered to target cells using the folate receptor-mediated pathway, which can change both the biodistribution and intracellular localization of the sensitizer when acid-labile DPPlsC liposomes are used as the delivery vehicle. Potential advantages of this approach include the use of lower bulk [AlPcS(4)](4-) concentrations, rapid plasma clearance of free [AlPcS(4)](4-), and better phototoxic responses, due to higher intracellular [AlPcS(4)](4-) concentrations combined with reduced collateral photodamage arising from misguided sensitizer accumulation, thereby enhancing the selective phototoxicity of PDT treatments. PMID:11433404

Qualls, M M; Thompson, D H

2001-08-01

7

Photodynamic therapy of Porphyromonas gingivalis via liposome-encapsulated sensitizers.  

PubMed

Photodynamic therapy exploits the light-activation of a photosensitizer to cause cytotoxicity. Liposomes can be used to deliver hydrophobic photosensitizers to bacteria. Positively charged dioleoyltrimethylammoniumpropane:palmitoyloleoylphosphatidylcholine (1:1) liposomes bound quantitatively to the periodontal pathogen, Porphyromonas gingivalis. Following illumination, free and liposomal zinc phthalocyanine reduced the colony-forming unit (CFU) to 65 percent and 23 percent of controls, respectively. Thus, localization of the photosensitizer at the surface of bacteria via liposome binding enhanced the photodynamic cytotoxicity of zinc phthalocyanine. PMID:24341134

Ko, Alex; Yee, Michael; Skupin-Mrugalska, Paulina; Düzgünes, Nejat

2013-11-01

8

Doped colorimetric assay liposomes  

DOEpatents

The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

Charych, Deborah (Albany, CA); Stevens, Raymond C. (Albany, CA)

2001-01-01

9

Metal phthalocyanine polymers  

NASA Technical Reports Server (NTRS)

Metal 4, 4', 4", 4"'=tetracarboxylic phthalocyanines (MPTC) are prepared by reaction of trimellitic anhydride, a salt or hydroxide of the desired metal (or the metal in powdered form), urea and a catalyst. A purer form of MPTC is prepared than heretofore. These tetracarboxylic acids are then polymerized by heat to sheet polymers which have superior heat and oxidation resistance. The metal is preferably a divalent metal having an atomic radius close to 1.35A.

Achar, B. N.; Fohlen, G. M.; Parker, J. A. (inventors)

1984-01-01

10

Method of solubilizing phthalocyanines and metallophthalocyanines  

DOEpatents

A one-step method of manufacturing soluble phthalocyanines and metallophthalocyanines, like zinc phthalocyanine, by converting a phthalocyanine or a metallophthalocyanine to a trialkylsilyl-substituted derivative is disclosed. The phthalocyanine or metallophthalocyanine is converted to a soluble trialkylsilyl-substituted derivative by interacting the phthalocyanine or metallophthalocyanine with an active metal amide, like lithium 2,2,6,6-tetramethylpiperidide, and a halotrialkylsilane, like chlorotrimethylsilane, to provide a phthalocyanine compound, like phthalocyanine monomers, dimers or polymers, metalated or unmetalated, that are soluble in organic media.

Rathke, Jerome W. (Bolingbrook, IL); Chen, Michael J. (Darien, IL); Fendrick, Carol M. (Downers Grove, IL)

1997-01-01

11

Fluorescence resonance energy transfer measurements as a tool to detect fusion and drug exchange in liposomal suspensions  

NASA Astrophysics Data System (ADS)

Zinc-(II)-phthalocyanine (ZnPc) is a drug that can potentially be used in photodynamic therapy. A promising formulation approach for the strongly hydrophobic ZnPc is to embed the molecule in liposomes. CGP 55847 is such a liposomal ZnPc formulation. From our data, we could conclude that approximately one quarter of the drug molecules were only loosely bound to the liposomes and exchanged between them with a relaxation time of about 15 min. Energy transfer measurements before and after the lyophilization process revealed that the liposomes were stable when suspended in a 10% lactose solution, i.e. no fusion of liposomes took place. In aqueous solution, however, lyophilization induced fusion of liposomes to a small extent with a concomitant increase in size.

Hilfinker, Rolf; Willi, Annette; Isele, Ute; van Hoogevest, Peter

1994-03-01

12

New directions in phthalocyanine pigments  

NASA Technical Reports Server (NTRS)

Phthalocyanines have been used as a pigment in coatings and related applications for many years. These pigments are some of the most stable organic pigments known. The phthalo blue and green pigments have been known to be ultraviolet (UV) stable and thermally stable to over 400 C. These phthalocyanines are both a semiconductor and photoconductor, exhibiting catalytic activity and photostabilization capability of polymers. Many metal free and metallic phthalocyanine derivatives have been prepared. Development of the new classes of phthalocyanine pigment could be used as coating on NASA spacecraft material such as glass to decrease the optical degradation from UV light, the outside of the space station modules for UV protection, and coating on solar cells to increase lifetime and efficiency.

Trinh, Diep VO

1994-01-01

13

Liposomes as nanomedical devices  

PubMed Central

Since their discovery in the 1960s, liposomes have been studied in depth, and they continue to constitute a field of intense research. Liposomes are valued for their biological and technological advantages, and are considered to be the most successful drug-carrier system known to date. Notable progress has been made, and several biomedical applications of liposomes are either in clinical trials, are about to be put on the market, or have already been approved for public use. In this review, we briefly analyze how the efficacy of liposomes depends on the nature of their components and their size, surface charge, and lipidic organization. Moreover, we discuss the influence of the physicochemical properties of liposomes on their interaction with cells, half-life, ability to enter tissues, and final fate in vivo. Finally, we describe some strategies developed to overcome limitations of the “first-generation” liposomes, and liposome-based drugs on the market and in clinical trials.

Bozzuto, Giuseppina; Molinari, Agnese

2015-01-01

14

21 CFR 73.3124 - Phthalocyanine green.  

Code of Federal Regulations, 2011 CFR

... Phthalocyanine green. (a) Identity. The color additive is phthalocyanine green (CAS Reg. No. 1328-53-6), Colour Index No. 74260. (b) Uses and restrictions. (1) The substance listed in paragraph (a) of this section may...

2011-04-01

15

Liposomal Vasoactive Intestinal Peptide  

Microsoft Academic Search

Liposomes have been investigated as drug carriers since first discovered in the 1960s. However, the first-generation, so-called classic liposomes found relatively limited therapeutic utility. Nonetheless, the advent in the 1980s of the second-generation sterically stabilized liposomes (SSL) that evade uptake by the host's reticuloendothelial system greatly enhanced their utility as drug carriers because of their prolonged circulation half-life and passive

Varun Sethi; Hayat Önyüksel; Israel Rubinstein

2005-01-01

16

Liposomes in investigative dermatology.  

PubMed

Liposomes are microscopic spheres, usually composed of amphiphilic phospholipids. They may be useful without skin penetration if they simply protect or sequester compounds that would otherwise be unstable in the formulation. Liposomes that remain on the skin surface are useful as light-absorbers, agents to deliver color or sunscreens, or as depots for timed-release. Liposomes that penetrate the stratum corneum have the potential to interact with living tissue. Topically applied liposomes can either mix with the stratum corneum lipid matrix or penetrate the stratum corneum by exploiting the lipid-water interface of the intercellular matrix. There are at least four major routes of entry into the skin: pores, hair follicles, columnular spaces and the lipid:water matrix between squames. A major force driving liposome penetration is the water gradient, and flexible liposomes are best able to exploit these delivery opportunities. Some liposomes release their contents extracellularly. Topical application of photosensitizers may be enhanced by encapsulation in liposomes. Higher and longer-lasting drug concentrations may be produced in localized areas of skin, particularly at disease sites where the stratum corneum and the skin barrier function are disrupted. The liposome membrane should be designed to capture lipophilic drugs in the membrane or hydrophilic drugs in the interior. Other types of liposomes can be engineered to be taken up by cells. Once inside cells, the lysosomal sac and clatherin-coated pit are the dead-end destinations for liposomes unless an escape path has been engineered into the liposome. A novel method has been developed to allow delivery into cells of the skin, by escape from the lysosomal sac. These liposomes have been used to topical deliver active DNA repair enzymes from liposomes into epidermal cells and to enhance DNA repair of UV-irradiated skin. From these studies a tremendous amount has been learned about the relationship of DNA damage and skin cancer. Both mutations and immunosuppression appear to be essential to skin cancer and both are induced by DNA damage. DNA damage produces immediate effects by inducing the expression of cytokines, which means that DNA damage can induce signaling in neighboring, undamaged cells. The repair of only a fraction of the DNA damage has a disproportionate effect on the biological responses, clearly demonstrating that not all DNA damage is equivalent. This technology demonstrates that biologically active proteins can be delivered into the cells of skin, and opens up a new field of correcting or enhancing skin cell metabolism to improve human health. PMID:11555329

Yarosh, D B

2001-10-01

17

Liposomal spherical nucleic acids.  

PubMed

A novel class of metal-free spherical nucleic acid nanostructures was synthesized from readily available starting components. These particles consist of 30 nm liposomal cores, composed of an FDA-approved 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) lipid monomer. The surface of the liposomes was functionalized with DNA strands modified with a tocopherol tail that intercalates into the phospholipid layer of the liposomal core via hydrophobic interactions. The spherical nucleic acid architecture not only stabilizes these constructs but also facilitates cellular internalization and gene regulation in SKOV-3 cells. PMID:24983505

Banga, Resham J; Chernyak, Natalia; Narayan, Suguna P; Nguyen, SonBinh T; Mirkin, Chad A

2014-07-16

18

Copper phthalocyanine and metal free phthalocyanine bulk heterojunction photodetector  

NASA Astrophysics Data System (ADS)

In this study we present the dependence of electrical properties of copper phthalocyanine (CuPc) and metal free phthalocyanine (H2Pc) bulk heterojunction structure under different illumination levels. To fabricate the device on ITO coated glass substrate the bulk heterojunction thin film of CuPc and H2Pc with thickness varying from 100 nm to 300 nm are deposited by thermal evaporator. Aluminum thin film was deposited by thermal evaporation as a top contact. The optical properties of the fabricated device are investigated using UV-vis spectroscopy. The current-voltage characteristics in dark and under illumination show that the device is sensitive towards visible light. The absorption spectrum describes its photo sensitivity in the range of wavelength from 200 nm to 850 nm. Simulation of current-intensity of light curve is carried out and experimental results are found in good agreement with simulated ones.

Farooq, Amjad; Karimov, Kh. S.; Ahmed, Nisar; Ali, Taimoor; Khalid Alamgir, M.; Usman, Muhammad

2015-01-01

19

Phthalocyanine Blends Improve Bulk Heterojunction Solar Cells  

PubMed Central

A core phthalocyanine platform allows engineering the solubility properties the band gap; shifting the maximum absorption toward the red. A simple method to increase the efficiency of heterojunction solar cells uses a self-organized blend of the phthalocyanine chromophores fabricated by solution processing. PMID:20136126

Varotto, Alessandro; Nam, Chang-Yong; Radivojevic, Ivana; Tomé, Joao; Cavaleiro, José A.S.; Black, Charles T.; Drain, Charles Michael

2010-01-01

20

Liposomal formulations of cytotoxic drugs  

Microsoft Academic Search

Liposomes are microscopic particles of lipid bilayer membrane that enclose aqueous internal compartments. These drug-delivery systems offer a very interesting opportunity for delivering cytotoxic drugs with equal or improved clinical efficacy and reduced toxicity. The most important clinical application of liposomes until now has been the inclusion of amphotericin B. At the same dose level, liposomal amphotericin B is as

Robert Janknegt

1996-01-01

21

Viscoelasticity measurements inside liposomes  

NASA Astrophysics Data System (ADS)

Microrheology, the study of the behavior of fluids on the microscopic scale, has been and continues to be one of the most important subjects that can be applied to characterize the behavior of biological fluids. It is extremely difficult to make rapid measurement of the viscoelastic properties of the interior of living cells. Liposomes are widely used as model system for studying different aspects of cell biology. We propose to develop a microrheometer, based on real-time control of optical tweezers, in order to investigate the viscoelastic properties of the fluid inside liposomes. This will give greater understanding of the viscoelastic properties of the fluids inside cells. In our experiment, the liposomes are prepared by different methods to find out both a better way to make GUVs and achieve efficient encapsulation of particle. By rotating the vaterite inside a liposome via spin angular momentum, the optical torque can be measured by measuring the change of polarization of the transmitted light, which allows the direct measurement of viscous drag torque since the optical torque is balanced by the viscous drag. We present an initial feasibility demonstration of trapping and manipulation of a microscopic vaterite inside the liposome. The applied method is simple and can be extended to sensing within the living cells.

Zhang, Shu; Gibson, Lachlan; Preece, Daryl; Nieminen, Timo A.; Rubinsztein-Dunlop, Halina

2014-09-01

22

Binding to and photo-oxidation of cardiolipin by the phthalocyanine photosensitizer Pc 4  

NASA Astrophysics Data System (ADS)

Cardiolipin is a unique phospholipid of the mitochondrial inner membrane. Its peroxidation correlates with release of cytochrome c and induction of apoptosis. The phthalocyanine photosensitizer Pc 4 binds preferentially to the mitochondria and endoplasmic reticulum. Earlier Förster resonance energy transfer studies showed colocalization of Pc 4 and cardiolipin, which suggests cardiolipin as a target of photodynamic therapy (PDT) with Pc 4. Using liposomes as membrane models, we find that Pc 4 binds to cardiolipin-containing liposomes similarly to those that do not contain cardiolipin. Pc 4 binding is also studied in MCF-7c3 cells and those whose cardiolipin content was reduced by treatment with palmitate. Decreased levels of cardiolipin are quantified by thin-layer chromatography. The similar level of binding of Pc 4 to cells, irrespective of palmitate treatment, supports the lack of specificity of Pc 4 binding. Thus, factors other than cardiolipin are likely responsible for the preferential localization of Pc 4 in mitochondria. Nonetheless, cardiolipin within liposomes is readily oxidized by Pc 4 and light, yielding apparently mono- and dihydroperoxidized cardiolipin. If similar products result from exposure of cells to Pc 4-PDT, they could be part of the early events leading to apoptosis following Pc 4-PDT.

Rodriguez, Myriam E.; Kim, Junhwan; Delos Santos, Grace B.; Azizuddin, Kashif; Berlin, Jeffrey; Anderson, Vernon E.; Kenney, Malcolm E.; Oleinick, Nancy L.

2010-09-01

23

Adsorption of ammonia on multilayer iron phthalocyanine  

SciTech Connect

The adsorption of ammonia on multilayers of well-ordered, flat-lying iron phthalocyanine (FePc) molecules on a Au(111) support was investigated by x-ray photoelectron spectroscopy. We find that the electron-donating ammonia molecules coordinate to the metal centers of iron phthlalocyanine. The coordination of ammonia induces changes of the electronic structure of the iron phthalocyanine layer, which, in particular, lead to a modification of the FePc valence electron spin.

Isvoranu, Cristina; Knudsen, Jan; Ataman, Evren; Andersen, Jesper N.; Schnadt, Joachim [Division of Synchrotron Radiation Research, Department of Physics, Lund University, Box 118, 221 00 Lund (Sweden); Schulte, Karina [MAX-lab, Lund University, Box 118, 221 00 Lund (Sweden); Wang Bin; Bocquet, Marie-Laure [Laboratoire de chimie, Ecole normale superieure de Lyon, 46, Allee d'Italie, 69364 Lyon Cedex 07 (France)

2011-03-21

24

Effect of axial ligation and delivery system on the tumour-localising and -photosensitising properties of Ge(IV)-octabutoxy-phthalocyanines.  

PubMed Central

Four Ge(IV)-octabutoxy-phthalocyanines (GePcs) bearing two alkyl-type axial ligands were assayed for their pharmacokinetic properties and phototherapeutic efficiency in Balb/c mice bearing an intramuscularly transplanted MS-2 fibrosarcoma. The GePcs were i.v. injected at a dose of 0.35 mumol kg-1 body weight after incorporation into either Cremophor emulsions or small unilamellar liposomes of dipalmitoyl-phosphatidylcholine (DPPC). Both the nature of the delivery system and the chemical structure of the phthalocyanine were found to affect the behaviour of the GePcs in vivo. Thus, Cremophor-administered GePcs invariably yielded a more prolonged serum retention and a larger association with low-density lipoproteins (LDLs) as compared with the corresponding liposome-delivered phthalocyanines. This led to a greater efficiency and selectivity of tumour targeting. These effects were more pronounced for those GePcs having relatively long alkyl chains (hexyl to decyl) in the axial ligands. Maximal tumour accumulation (0.67 nmol per g of tissue) was found for Ge-Pc(hexyl)2 at 24 h after injection. Consistently, the Ge-Pc(hexyl)2, administered via Cremophor, showed the highest phototherapeutic activity towards MS-2 fibrosarcoma. PMID:7710936

Soncin, M.; Polo, L.; Reddi, E.; Jori, G.; Kenney, M. E.; Cheng, G.; Rodgers, M. A.

1995-01-01

25

Ligation Strategies for Targeting Liposomal Nanocarriers  

PubMed Central

Liposomes have been exploited for pharmaceutical purposes, including diagnostic imaging and drug and gene delivery. The versatility of liposomes as drug carriers has been demonstrated by a variety of clinically approved formulations. Since liposomes were first reported, research of liposomal formulations has progressed to produce improved delivery systems. One example of this progress is stealth liposomes, so called because they are equipped with a PEGylated coating of the liposome bilayer, leading to prolonged blood circulation and improved biodistribution of the liposomal carrier. A growing research area focuses on the preparation of liposomes with the ability of targeting specific tissues. Several strategies to prepare liposomes with active targeting ligands have been developed over the last decades. Herein, several strategies for the functionalization of liposomes are concisely summarized, with emphasis on recently developed technologies for the covalent conjugation of targeting ligands to liposomes. PMID:25126543

Marqués-Gallego, Patricia; de Kroon, Anton I. P. M.

2014-01-01

26

Ligation strategies for targeting liposomal nanocarriers.  

PubMed

Liposomes have been exploited for pharmaceutical purposes, including diagnostic imaging and drug and gene delivery. The versatility of liposomes as drug carriers has been demonstrated by a variety of clinically approved formulations. Since liposomes were first reported, research of liposomal formulations has progressed to produce improved delivery systems. One example of this progress is stealth liposomes, so called because they are equipped with a PEGylated coating of the liposome bilayer, leading to prolonged blood circulation and improved biodistribution of the liposomal carrier. A growing research area focuses on the preparation of liposomes with the ability of targeting specific tissues. Several strategies to prepare liposomes with active targeting ligands have been developed over the last decades. Herein, several strategies for the functionalization of liposomes are concisely summarized, with emphasis on recently developed technologies for the covalent conjugation of targeting ligands to liposomes. PMID:25126543

Marqués-Gallego, Patricia; de Kroon, Anton I P M

2014-01-01

27

Liposome: classification, preparation, and applications  

PubMed Central

Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s. Today, they are a very useful reproduction, reagent, and tool in various scientific disciplines, including mathematics and theoretical physics, biophysics, chemistry, colloid science, biochemistry, and biology. Since then, liposomes have made their way to the market. Among several talented new drug delivery systems, liposomes characterize an advanced technology to deliver active molecules to the site of action, and at present, several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles to ‘second-generation liposomes’, in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability and regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents. PMID:23432972

2013-01-01

28

Liposome: classification, preparation, and applications  

NASA Astrophysics Data System (ADS)

Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s. Today, they are a very useful reproduction, reagent, and tool in various scientific disciplines, including mathematics and theoretical physics, biophysics, chemistry, colloid science, biochemistry, and biology. Since then, liposomes have made their way to the market. Among several talented new drug delivery systems, liposomes characterize an advanced technology to deliver active molecules to the site of action, and at present, several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles to `second-generation liposomes', in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability and regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents.

Akbarzadeh, Abolfazl; Rezaei-Sadabady, Rogaie; Davaran, Soodabeh; Joo, Sang Woo; Zarghami, Nosratollah; Hanifehpour, Younes; Samiei, Mohammad; Kouhi, Mohammad; Nejati-Koshki, Kazem

2013-02-01

29

Photoconductivity in thin films of phthalocyanine  

Microsoft Academic Search

The photocurrent and electrolyte electromodulation (EEM) spectra of thin films of metal-free phthalocyanine (H2Pc) and of copper phthalocyanine (CuPc) were investigated. The modulation spectra yielded three distinct features around 1·61,\\u000a 2·30 and 2·93 eV for H2Pc and around 1·63, 2·04 and 3·20 eV for CuPc. The spectral dependence maxima of photoconductivity correspond to the modulation\\u000a spectra. These features are interpreted

Francis P Xavier; George J Goldsmith

1995-01-01

30

Oxygen doping of iron phthalocyanine films  

NASA Astrophysics Data System (ADS)

Capacitance measurements of oxygen doped films of ? or ? iron phthalocyanine particles dispersed in a binder polymer polycarbonate (MK), with mixed (Al, Au) electrodes are studied. The capacitance of the cells changes in accordance with the morphological forms. A complete study of the space charge density as a function of temperature is carried out. The results obtained are in accordance with the model proposed for the dopant, oxygen. The low conductivity of the ? iron phthalocyanine is due in large part to deep trap carriers presented in this phase.

Abdel-Malik, T. G.; Motaweh, H. A.

2006-08-01

31

Liposomal vasoactive intestinal peptide.  

PubMed

Liposomes have been investigated as drug carriers since first discovered in the 1960s. However, the first-generation, so-called classic liposomes found relatively limited therapeutic utility. Nonetheless, the advent in the 1980s of the second-generation sterically stabilized liposomes (SSL) that evade uptake by the host's reticuloendothelial system greatly enhanced their utility as drug carriers because of their prolonged circulation half-life and passive targeting to injured and cancerous tissues. Over the past decade, our work focused on exploiting the bioactivity of vasoactive intestinal peptide (VIP), a ubiquitous 28-amino acid, amphipathic and pleiotropic mammalian neuropeptide, as a drug. To this end, the peptide expresses distinct and unique innate bioactivity that could be harnessed to treat several human diseases that represent unmet medical needs, such as pulmonary hypertension, stroke, Alzheimer's disease, sepsis, female sexual arousal dysfunction, acute lung injury, and arthritis. Unfortunately, the bioactive effects of VIP last only a few minutes due to its rapid degradation and inactivation by enzymes, catalytic antibodies, and spontaneous hydrolysis in biological fluids. Hence, our goal was to develop and test stable, long-acting formulations of VIP using both classic and SSL as platform technologies. We found that spontaneous association of VIP with phospholipid bilayers leads to a transition in the conformation of the peptide from random coil in an aqueous environment to alpha-helix, the preferred conformation for ligand-receptor interactions, in the presence of lipids. This process, in turn, protects VIP from degradation and inactivation and amplifies its bioactivity in vivo. Importantly, we discovered that the film rehydration and extrusion technique is the most suitable to passively load VIP onto SSL at room temperature and yields the most consistent results. Collectively, these attributes indicate that VIP on SSL represents a suitable formulation that could be tested in human disease. PMID:15721392

Sethi, Varun; Onyüksel, Hayat; Rubinstein, Israel

2005-01-01

32

40 CFR 721.9674 - Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic).  

Code of Federal Regulations, 2010 CFR

...false Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic...9674 Sulfonated-copper phthalocyanine salt of a triarylmethane dye (generic...generically as sulfonated-copper phthalocyanine salt of a triarylmethane dye (PMN...

2010-07-01

33

Lighting porphyrins and phthalocyanines for molecular photovoltaics.  

PubMed

The field of organic photovoltaics (OPV) represents one of the most promising technological areas. Porphyrins and phthalocyanines are perfectly suited for their integration in light energy conversion systems. These colored macrocycles exhibit very attractive physical properties, particularly very high extinction coefficients in the visible and near IR regions, where the maximum of the solar photon flux occurs, that is necessary for efficient photon harvesting, besides a rich redox chemistry, as well as photoinduced electron transfer and semiconducting capabilities. PMID:20835465

Martínez-Díaz, M Victoria; de la Torre, Gema; Torres, Tomás

2010-10-14

34

Relaxivity of liposomal paramagnetic MRI contrast agents  

Microsoft Academic Search

Paramagnetic liposomes, spherical particles formed by a lipid bilayer, are able to accommodate a high payload of Gd-containing lipid and therefore can serve as a highly potent magnetic resonance imaging contrast agent. In this paper the relaxation properties of paramagnetic liposomes were studied as a function of composition, temperature and magnetic field strength. The pegylated liposomes with a diameter of

G. J. Strijkers; W. J. M. Mulder; R. B. van Heeswijk; P. M. Frederik; PHH Bomans; P. C. M. M. Magusin; K Nicolaij

2005-01-01

35

Preparation and characterization of gemcitabine liposome injections.  

PubMed

Gemcitabine liposome injection (stealth liposomes) has facilitated the targeting of gemcitabine for cancer treatment. We systemically review liposome-based drug-delivery systems, which can improve pharmacokinetics, reduce side effects and potentially increase tumor uptake, for pancreatic cancer therapy. A novel liposomal formulation, which allows for higher tumor targeting efficiencies and can be used in current clinical trials to treat this challenging disease, has gained great popularity and attention. In this study, since extrusion technology was used to make sterile preparation of liposomes, the process included aseptic production process and sterile filtration. During the preparation, it has been found that the lipid concentration, emulsification speed and time, the homogenization times and pattern, the lipid solution temperature are all critical parameters for the character of the gemcitabine liposome injection. The particle size method and zeta potential method to characterize a PEGylated liposomal drug formulation of the anti-cancer agent gemcitabine was developed. The methods are specific, precise, reproducible and sensitive, therefore they are suitable for the determination of particle size and zeta potential of gemcitabine liposome injection. Negative staining technology of transmission electron microscopy revealed that gemcitabine liposome injection has a typical morphology, which enables liposomal surfaces could be seen so additional visual information on the stealth liposome can be routinely obtained in a fast and reliable manner. Moreover, the above three methods are simple, fast and would be used for continuous quality control of gemcitabine liposome injection when it moves to cGMP production scale. PMID:23136718

Zhou, Qinmei; Liu, Liucheng; Zhang, Dengshan; Fan, Xingfeng

2012-10-01

36

Soluble phthalocyanines as optical gas sensing materials  

NASA Astrophysics Data System (ADS)

A novel soluble phthalocyanine compound, i.e zinc phthalocyanine (sulfonamide) has been synthesized by chemical substitution of zinc phthalocyanine and used to produce thin solid films by means of the spin coating technique. The chemical structure of the spin coated films has been investigated by FT-IR analysis. Atomic Force Microscopy (AFM) has been used to characterize the film morphology and to measure the film thickness. The spin coated films have been tested as optical sensing materials of volatile organic compounds such as methanol, ethanol and 2-propanol. The change of optical reflectance of the films upon exposure to alcohol-vapour-containing atmospheres has been measured versus alcohol concentration and exposure time. The films exhibit a fast and reproducible response, with a complete and fast recovery in methanol and ethanol-containing atmospheres, while diffusion-driven effects appear during exposure to 2-propanol. The response and sensitivity of the films to ethanol vapour is higher than to methanol and 2-propanol.

Severova, Katerina; Maggioni, Gianluigi; Nespurek, Stanislav; Carturan, Sara; Milan, Riccardo; Tonezzer, Michele; Della Mea, Gianantonio

2007-05-01

37

NLO properties of chiral phthalocyanine films  

NASA Astrophysics Data System (ADS)

We studied linear and nonlinear optical properties of four different phthalocyanines: vanadyl and copper phthalocyanines substituted with chiral branched side chains, (S)(OMeBu)8VOPc, (S)(OMeBu)8CuPc; a racemic analogue (R,S)(OMeBu)8VOPc; vanadyl phthalocyanine substituted with linear side chains, (OBu)8VOPc. We investigate the molecule packing and their third-order nonlinear optical response in terms of chirality, planarity, and side chain structures. Molecular arrangement of (S)(OMeBu)8VOPc in the thin films was determined to be a columnar phase with rectangular 2D crystals by X-ray diffraction studies. The thin films of (S)(OMeBu)8VOPc diplayed CD activity. While, a chloroform solution of this compound did not show any CD. Therefore, we conclude that the CD in the films must result from the chiral aggregation of the molecules. The ?(3) value of the flims of (S)(OMeBu)8VOPc was determined for 6.7×10-11 esu by third harmonic generation at 1.907 ?m and this value was larger than those of (R,S)(OMeBu)8VOPc, (R,S)(OMeBu)8CuPc, and (OBu)8VOPc.

Muto, Tsuyoshi; Wada, Tatsuo; Sassa, Takafumi; Kimura, Mutsumi; Shirai, Hirofusa

2003-11-01

38

Environment-Responsive Multifunctional Liposomes  

PubMed Central

Liposomal nanocarriers modified with cell-penetrating peptide and a pH-sensitive PEG shield demonstrate simultaneously a better systemic circulation and site-specific exposure of the cell-penetrating peptide. PEG chains were incorporated into the liposome membrane via the PEG-attached phosphatidylethanolamine (PE) residue with PEG and PE being conjugated with the lowered pH-degradable hydrazone bond (PEG-HZ-PE), while cell-penetrating peptide (TATp) was added as TATp-PEG-PE conjugate. Under normal conditions, liposome-grafted PEG “shielded” liposome-attached TATp moieties, since the PEG spacer for TATp attachment (PEG(1000)) was shorter than protective PEG(2000). PEGylated liposomes accumulate in targets via the EPR effect, but inside the “acidified” tumor or ischemic tissues lose their PEG coating because of the lowered pH-induced hydrolysis of HZ and penetrate inside cells via the now-exposed TATp moieties. pH-responsive behavior of these constructs is successfully tested in cell cultures in vitro as well as in tumors in experimental mice in vivo. These nanocarriers also showed enhanced pGFP transfection efficiency upon intratumoral administration in mice, compared to control pH nonsensitive counterpart. These results can be considered as an important step in the development of tumor-specific stimuli-sensitive drug and gene delivery systems. PMID:20072884

Kale, Amit A.; Torchilin, Vladimir P.

2012-01-01

39

Room temperature ferromagnetism in a phthalocyanine based carbon material  

SciTech Connect

We report on a simple method to fabricate a magnetic carbon material that contains nitrogen-coordinated transition metals and has a large magnetic moment. Highly chlorinated iron phthalocyanine was used as building blocks and potassium as a coupling reagent to uniformly disperse nitrogen-coordinated iron atoms on the phthalocyanine based carbon material. The iron phthalocyanine based carbon material exhibits ferromagnetic properties at room temperature and the ferromagnetic phase transition occurs at T{sub c}?=?490?±?10?K. Transmission electron microscopy observation, X-ray diffraction analysis, and the temperature dependence of magnetization suggest that the phthalocyanine molecules form three-dimensional random networks in the iron phthalocyanine based carbon material.

Honda, Z., E-mail: honda@fms.saitama-u.ac.jp; Sato, K.; Sakai, M.; Fukuda, T.; Kamata, N. [Graduate School of Science and Engineering, Saitama University, 255 Shimo-Okubo, Sakura-ku, Saitama 338-8570 (Japan); Hagiwara, M.; Kida, T. [KYOKUGEN (Center for Quantum Science and Technology under Extreme Conditions), Osaka University, 1-3 Machikaneyama, Toyonaka, Osaka 560-8531 (Japan)

2014-02-07

40

Liposome-like Nanostructures for Drug Delivery  

PubMed Central

Liposomes are a class of well-established drug carriers that have found numerous therapeutic applications. The success of liposomes, together with recent advancements in nanotechnology, has motivated the development of various novel liposome-like nanostructures with improved drug delivery performance. These nanostructures can be categorized into five major varieties, namely: (1) polymer-stabilized liposomes, (2) nanoparticle-stabilized liposomes, (3) core-shell lipid-polymer hybrid nanoparticles, (4) natural membrane-derived vesicles, and (5) natural membrane coated nanoparticles. They have received significant attention and have become popular drug delivery platforms. Herein, we discuss the unique strengths of these liposome-like platforms in drug delivery, with a particular emphasis on how liposome-inspired novel designs have led to improved therapeutic efficacy, and review recent progress made by each platform in advancing healthcare. PMID:24392221

Gao, Weiwei; Hu, Che-Ming J.; Fang, Ronnie H.; Zhang, Liangfang

2013-01-01

41

Capacious and programmable multi-liposomal carriers  

NASA Astrophysics Data System (ADS)

Spherical polycationic brushes (SPBs) were synthesized by grafting polycationic chains onto 100 nm polystyrene particles. These particles were exposed to unilamellar egg-lecithin (EL) liposomes with a mean diameter of 40 nm that had been rendered anionic via the presence of 10 molar% of phosphatidylserine (PS1-). The liposomes also contained 30 mole% of a morpholinocyclohexanol-based lipid (MOCH) that undergoes a conformational flip when the pH is decreased from 7.0 to 5.0. Mixtures of SPBs and liposomes at pH 7 gave an electrostatically-driven complex possessing, on average, about 40 liposomes for each SPB particle. It was found that the bound liposomes rapidly release much of their contents when the pH is reduced from 7.0 to 5.0 owing mostly to a MOCH conformational change that creates defects in the bilayer membrane. The drop in pH does not, however, induce a separation of the liposomes from the SPBs. Around 50-60% of the liposome contents escape before, it is reasoned, lateral and transmembrane motion of the membrane components heals the defects and prevents further release. Remarkably, the liposomes complexed with SPB release their cargo much faster than the identical but non-complexed liposomes.Spherical polycationic brushes (SPBs) were synthesized by grafting polycationic chains onto 100 nm polystyrene particles. These particles were exposed to unilamellar egg-lecithin (EL) liposomes with a mean diameter of 40 nm that had been rendered anionic via the presence of 10 molar% of phosphatidylserine (PS1-). The liposomes also contained 30 mole% of a morpholinocyclohexanol-based lipid (MOCH) that undergoes a conformational flip when the pH is decreased from 7.0 to 5.0. Mixtures of SPBs and liposomes at pH 7 gave an electrostatically-driven complex possessing, on average, about 40 liposomes for each SPB particle. It was found that the bound liposomes rapidly release much of their contents when the pH is reduced from 7.0 to 5.0 owing mostly to a MOCH conformational change that creates defects in the bilayer membrane. The drop in pH does not, however, induce a separation of the liposomes from the SPBs. Around 50-60% of the liposome contents escape before, it is reasoned, lateral and transmembrane motion of the membrane components heals the defects and prevents further release. Remarkably, the liposomes complexed with SPB release their cargo much faster than the identical but non-complexed liposomes. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr06037g

Yaroslavov, Alexander A.; Sybachin, Andrey V.; Zaborova, Olga V.; Migulin, Vasiliy A.; Samoshin, Vyacheslav V.; Ballauff, Matthias; Kesselman, Ellina; Schmidt, Judith; Talmon, Yeshayahu; Menger, Fredric M.

2015-01-01

42

Phthalocyanines: from outstanding electronic properties to emerging applications.  

PubMed

This review paper gives a brief overview on how the outstanding chemical and physical properties of phthalocyanines and phthalocyanine derivatives are being studied and employed in order to construct state-of-the-art technological devices. In a first instance, a short account on how the nature of the phthalocyanine structure and its organization in condensed phases play an important role in their conducting and ultraviolet-visible absorption properties is presented. Consequently, these basic electronic and photophysical features of phthalocyanines allow us to explain why phthalocyanine-based multicomponent covalent or noncovalent donor-acceptor systems may give rise to very interesting photophysical properties, in particular in terms of their ability to generate very long-lived photoinduced charge-separated states. A concise survey on the organization of these multifunctional systems shows how a profound understanding of the morphology at the nanometer-scale of these phthalocyanine-based molecular materials is needed in order to control their physical properties in condensed phases. All the previously mentioned chemical and physical features combined together led us to the description of the latest attempts at incorporating phthalocyanines into photovoltaic devices for solar energy conversion and onto quantum dots for photodynamic therapy or quantum computing. PMID:18366105

Claessens, Christian G; Hahn, Uwe; Torres, Tomás

2008-01-01

43

Essential oils encapsulated in liposomes: a review.  

PubMed

In the recent years there has been an increased interest toward the biological activities of essential oils. However, essential oils are unstable and susceptible to degradation in the presence of oxygen, light and temperature. So, attempts have been made to preserve them through encapsulation in various colloidal systems such as microcapsules, microspheres, nanoemulsions and liposomes. This review focuses specifically on encapsulation of essential oils into liposomes. First, we present the techniques used to prepare liposomes encapsulating essential oils. The effects of essential oils and other factors on liposome characteristics such as size, encapsulation efficiency and thermal behavior of lipid bilayers are then discussed. The composition of lipid vesicles membrane, especially the type of phospholipids, cholesterol content, the molar ratio of essential oils to lipids, the preparation method and the kind of essential oil may affect the liposome size and the encapsulation efficiency. Several essential oils can decrease the size of liposomes, homogenize the liposomal dispersions, increase the fluidity and reduce the oxidation of the lipid bilayer. Moreover, liposomes can protect the fluidity of essential oils and are stable at 4-5?°C for 6 months at least. The applications of liposomes incorporating essential oils are also summarized in this review. Liposomes encapsulating essential oils are promising agents that can be used to increase the anti-microbial activity of the essential oils, to study the effect of essential oils on cell membranes, and to provide alternative therapeutic agents to treat several diseases. PMID:23879218

Sherry, Mirna; Charcosset, Catherine; Fessi, Hatem; Greige-Gerges, Hélène

2013-12-01

44

Deformable liposomes for dermal administration of methotrexate.  

PubMed

Deformable liposomes were prepared to investigate the effectiveness of dermal administration of methotrexate (MTX). The phospholipids used to prepare the liposomes were soybean lecithin (PC) or hydrogenated lecithin (HPC) and dipotassium glycyrrhizinate (KG) as surfactant. The lipid/KG ratio (w/w) was 2:1 and 4:1. Liposomes size, entrapment efficiency and MTX release through dialysis membrane were determined and the interaction between MTX and liposomes was investigated using differential scanning calorimetry. The MTX amount permeated through pig skin were three- to four-fold higher using liposomes containing KG compared to those from water solution or normal liposomes. No significant differences were observed between PC-KG liposomes and HPC-KG liposomes. At the end of the skin permeation assay using deformable liposomes, up to 50% of the administered dose was found in the skin. This capability depends on the self-regulating carrier deformability. These results suggest that liposomes containing KG may be of value for the topical administration of MTX in the treatment of psoriasis. PMID:14726128

Trotta, Michele; Peira, Elena; Carlotti, Maria Eugenia; Gallarate, Marina

2004-02-11

45

Lung specific stealth liposomes: stability, biodistribution and toxicity of liposomal antitubercular drugs in mice  

Microsoft Academic Search

Liposomes with enhanced affinity towards lung tissue were prepared for the development of more effective chemotherapy against tuberculosis. Modification of surface of stealth liposomes by tagging O-stearylamylopectin (O-SAP) resulted in the increased affinity of these liposomes towards lung tissue of mice. Liposomes containing egg phosphatidylcholine (ePC), cholesterol (CH), dicetylphosphate (DCP), O-SAP and monosialogangliosides (GM1)\\/distearylphosphatidylethanolamine-poly(ethylene glycol) 2000 (DSPE-PEG 2000) were found

Parampal Deol; G. K Khuller

1997-01-01

46

Microfluidic Methods for Production of Liposomes  

PubMed Central

Liposomes are composed of lipid bilayer membranes that encapsulate an aqueous volume. A major challenge in the development of liposomes for drug delivery is the control of size and size distribution. In conventional methods, lipids are spontaneously assembled into heterogeneous bilayers in a bulk phase. Additional processing by extrusion or sonication is required to obtain liposomes with small size and a narrow size distribution. Microfluidics is an emerging technology for liposome synthesis, because it enables precise control of the lipid hydration process. Here, we describe a number of microfluidic methods that have been reported to produce micro/nanosized liposomes with narrower size distribution in a reproducible manner, focusing on the use of continuous-flow microfluidics. The advantages of liposome formation using the microfluidic approach over traditional bulk-mixing approaches are discussed. PMID:19913165

Yu, Bo; Lee, Robert J.; Lee, L. James

2013-01-01

47

Liposomal encapsulated anthracyclines: new therapeutic horizons  

Microsoft Academic Search

After two decades of work in liposomal formulations for clinical use, two preparations containing doxorubicin (Doxil, ALZA,\\u000a Pablo Alto, CA; and Evacet [TLC D-99], The Liposome Company, Princeton, NJ), and one containing daunorubicin (DaunoXome; Gilead\\u000a Sciences, Foster City, CA) have been undergoing widespread clinical study. Results have lived up to the promise that liposomal\\u000a encapsulation may lead to toxicity attenuation,

Franco M. Muggia

2001-01-01

48

Deformable Liposomes as Topical Formulations Containing ??Tocopherol  

Microsoft Academic Search

Several deformable liposomes were formulated using hydrogenated soya lecithin and sodium cholate, polisorbate 80, dipotassium glycyrrhizinate, or saccharose monopalmitate. The lipid:surfactant w\\/w ratio necessary to obtain elastic vesicles depended on the O\\/W surfactant and ranged from 4?1 to 20?1. The liposomes obtained were able to entrap ??tocopherol and tocopheryl acetate up to 0.17% w\\/w.Elastic liposomes, whose deformability was confirmed by

Marina Gallarate; Daniela Chirio; Michele Trotta; M. Eugenia Carlotti

2006-01-01

49

Tumor targeting using liposomal antineoplastic drugs  

PubMed Central

During the last years, liposomes (microparticulate phospholipid vesicles) have been used with growing success as pharmaceutical carriers for antineoplastic drugs. Fields of application include lipid-based formulations to enhance the solubility of poorly soluble antitumor drugs, the use of pegylated liposomes for passive targeting of solid tumors as well as vector-conjugated liposomal carriers for active targeting of tumor tissue. Such formulation and drug targeting strategies enhance the effectiveness of anticancer chemotherapy and reduce at the same time the risk of toxic side-effects. The present article reviews the principles of different liposomal technologies and discusses current trends in this field of research. PMID:18488413

Huwyler, Jörg; Drewe, Jürgen; Krähenbühl, Stephan

2008-01-01

50

Capacious and programmable multi-liposomal carriers.  

PubMed

Spherical polycationic brushes (SPBs) were synthesized by grafting polycationic chains onto 100 nm polystyrene particles. These particles were exposed to unilamellar egg-lecithin (EL) liposomes with a mean diameter of 40 nm that had been rendered anionic via the presence of 10 molar% of phosphatidylserine (PS(1-)). The liposomes also contained 30 mole% of a morpholinocyclohexanol-based lipid (MOCH) that undergoes a conformational flip when the pH is decreased from 7.0 to 5.0. Mixtures of SPBs and liposomes at pH 7 gave an electrostatically-driven complex possessing, on average, about 40 liposomes for each SPB particle. It was found that the bound liposomes rapidly release much of their contents when the pH is reduced from 7.0 to 5.0 owing mostly to a MOCH conformational change that creates defects in the bilayer membrane. The drop in pH does not, however, induce a separation of the liposomes from the SPBs. Around 50-60% of the liposome contents escape before, it is reasoned, lateral and transmembrane motion of the membrane components heals the defects and prevents further release. Remarkably, the liposomes complexed with SPB release their cargo much faster than the identical but non-complexed liposomes. PMID:25554444

Yaroslavov, Alexander A; Sybachin, Andrey V; Zaborova, Olga V; Migulin, Vasiliy A; Samoshin, Vyacheslav V; Ballauff, Matthias; Kesselman, Ellina; Schmidt, Judith; Talmon, Yeshayahu; Menger, Fredric M

2015-01-22

51

An interaction of helicid with liposome biomembrane  

NASA Astrophysics Data System (ADS)

An interaction of helicid with phosphatidylcholine liposome biomembrane was studied by transmission electron microscopy, UV-vis, fluorescence, Raman and 31P NMR spectra. The results indicate that most of helicid molecules associate with liposomes at their surface and some of them penetrate the liposomes and locate in the hydrophobic regions of the membrane. The distribution coefficient KD between liposome phases and aqueous phases is 13.5. The liposome becomes more dispersive and stable in the presence of helicid. The microenvironmental micropolarity and the microhydrophobicity of liposome membrane decrease with the increase of helicid concentration. The interaction of helicid molecules with liposome results in a slight decrease of the membrane longitudinal order, and an increase of the membrane lateral order. A model for the interaction of helicid with liposome biomembrane is proposed on the basis of the change of microenvironment parameters of liposome including the micropolarity, microhydrophobicity and membrane order. The change of microenvironment parameters results mainly from hydrogen bonding interaction between the hydroxyl groups of the pyranoside rings of helicid molecules and the polar head groups of phosphatidylcholine.

Fan, Rong; Gan, Lihua; Liu, Mingxian; Zhu, Dazhang; Chen, Liuhua; Xu, Zijie; Hao, Zhixian; Chen, Longwu

2011-01-01

52

Syntheses of Octasubstituted Metal Phthalocyanines for Nonlinear Optics  

NASA Technical Reports Server (NTRS)

Many organic materials can be used as nonlinear optical media. Phthalocyanines are of special interest because they show an unusually large third order nonlinear response, they are thermally and photochemically stable and they can be formed into oriented thin films (Langmuir-Blodgett films). They also can be easily complexed by a large variety of metals, which place them at the interface between organics and organometallics, and allows for fine tuning of the macro cycle electronic properties by the coordinated metal and substituent groups. A series of 1,4,8,11,15,18,22,25-octaalkoxy metal-free and metal phthalocyanines and 2,3,9,10,16,17,23,24-octaalkoxy metal phthalocyanines has been synthesized. Their nonlinear optical properties have been measured. The physical properties of all the phthalocyanines synthesized in this work are subject to both acid and solvent effects.

Guo, Huaisong; Townsend, Cheryl; Sanghadasa, Mohan; Amai, Robert L. S.; Clark, Ronald D.; Penn, Benjamin

1998-01-01

53

Topical photodynamic therapy using transfersomal aluminum phthalocyanine tetrasulfonate: in vitro and in vivo study.  

PubMed

The efficacy of transfersomes (flexible liposomes) as a novel technique for topical delivery of the hydrophilic tetra-anionic photodynamic sensitizer aluminum (III) phthalocyanine tetrasulfonate (AlPcS4) was investigated, on mammalian fibroblasts and on Balb/c mice dorsal skin. AlPcS4 was loaded in transfersomes composed of phosphatidylcholine/sodium deoxycholate (5:1, 10:1, and 15:1?w/w, ratios), resulting in 110-, 160-, and 200-nm mean size vesicles with encapsulation efficiencies of 16, 25, and 30 %, respectively. In vitro studies on baby hamster kidney-21 fibroblasts revealed twofold enhancement of the photocytotoxicity of AlPcS4 loaded in transfersomes (Trans-AlPcS4), compared to free AlPcS4 dissolved in culture medium. The photocytotoxicity of Trans-AlPcS4 was less dependent on the incubation time with cells, compared to free AlPcS4. Topical application on the dorsal skin of Balb/c mice revealed that both free AlPcS4 and Trans-AlPcS4 exhibited evident photosensitization towards mice skin, but acquiring different regions of skin. PMID:23291878

Kassab, Kawser; El Fadeel, Doaa Abd; Fadel, Maha

2013-09-01

54

Serum albumin as a vehicle for zinc phthalocyanine: photodynamic activities in solid tumour models.  

PubMed Central

Zinc phthalocyanine (ZnPc) is a second-generation photosensitiser for the photodynamic therapy (PDT) of cancer. Unsubstituted ZnPc is, however, highly insoluble in most common solvents, and for clinical applications the material needs to be incorporated in liposomes. We report a simple, alternative procedure to formulate ZnPc through non-covalent binding to bovine serum albumin (BSA). Intravenous administration of ZnPc-BSA preparations, at a molar ratio of 11:1 and at a ZnPc dose equivalent to 0.5 mol kg-1, to tumour-bearing mice followed 24 h later by PDT was shown to provide tumour control in two different models, the EMT-6 tumour in Balb/c mice and the human colon T380 carcinoma in nude mice. Analysis of serum fractions from treated animals showed that ZnPc readily redistributes over the serum high-density lipoprotein (HDL) fraction. We also demonstrated the absence of hepatic toxicity of the ZnPc-BSA preparation by monitoring the hepatic cytochrome P450 activity in treated animals and the viability of human cultured hepatocytes. PMID:8980386

Larroque, C.; Pelegrin, A.; Van Lier, J. E.

1996-01-01

55

Controlled Molecular Alignment in Phthalocyanine Thin Films on Stepped Sapphire Surfaces**  

E-print Network

Controlled Molecular Alignment in Phthalocyanine Thin Films on Stepped Sapphire Surfaces** By J of the growth and structure of thin films of copper hexadecafluoro- phthalocyanine (F16CuPc) on A-plane sapphire

Schreiber, Frank

56

Recent advances with liposomes as pharmaceutical carriers  

Microsoft Academic Search

Liposomes — microscopic phospholipid bubbles with a bilayered membrane structure — have received a lot of attention during the past 30 years as pharmaceutical carriers of great potential. More recently, many new developments have been seen in the area of liposomal drugs — from clinically approved products to new experimental applications, with gene delivery and cancer therapy still being the

Vladimir P. Torchilin

2005-01-01

57

Liposomal Nanocapsules in Food Science and Agriculture  

Microsoft Academic Search

Liposomes, spherical bilayer vesicles from dispersion of polar lipids in aqueous solvents, have been widely studied for their ability to act as drug delivery vehicles by shielding reactive or sensitive compounds prior to release. Liposome entrapment has been shown to stabilize encapsulated, bioactive materials against a range of environmental and chemical changes, including enzymatic and chemical modification, as well as

T. Matthew Taylor; Jochen Weiss; P. Michael Davidson; Barry D. Bruce

2005-01-01

58

Liposomal nanocapsules in food science and agriculture.  

PubMed

Liposomes, spherical bilayer vesicles from dispersion of polar lipids in aqueous solvents, have been widely studied for their ability to act as drug delivery vehicles by shielding reactive or sensitive compounds prior to release. Liposome entrapment has been shown to stabilize encapsulated, bioactive materials against a range of environmental and chemical changes, including enzymatic and chemical modification, as well as buffering against extreme pH, temperature, and ionic strength changes. Liposomes have been especially useful to researchers in studies of various physiological processes as models of biological membranes in both eukaryotes and prokaryotes. Industrial applications include encapsulation of pharmaceuticals and therapeutics, cosmetics, anti-cancer and gene therapy drugs. In the food industry, liposomes have been used to deliver food flavors and nutrients and more recently have been investigated for their ability to incorporate food antimicrobials that could aid in the protection of food products against growth of spoilage and pathogenic microorganisms. In this review we briefly introduce key physicochemical properties of liposomes and review competing methods for liposome production. A survey of non-agricultural and food applications of liposomes are given. Finally, a detailed up-to-date summary of the emerging usage of liposomes in the food industry as delivery vehicles of nutrients, nutraceuticals, food additives, and food antimicrobials is provided. PMID:16371329

Taylor, T Matthew; Davidson, P Michael; Bruce, Barry D; Weiss, Jochen

2005-01-01

59

Povidone-iodine liposomes--an overview.  

PubMed

In recent years, liposomes have been increasingly explored as novel drug delivery systems, and several liposome-based drug products have been approved in Europe, the USA and Japan. Depending on size, composition and surface characteristics, liposomes interact specifically with biological structures. Liposomal drug products provide a topical activity at the desired locus of action and are deemed more effective and less toxic than conventional drug formulations. The combination of povidone-iodine (PVP-I) and liposomes unites the exceptional microbicidal activity of the antiseptic substance with the excellent tolerability and lack of immunogenicity of liposomes; in addition, liposomes provide a moist molecular film for the wound environment. The multilamellar vesicles act as microreservoirs hence prolonging the release of the active ingredient. Although no commercial product for repeated application on the eye is currently available, PVP-I has been used in ophthalmology not only for pre- and postoperative antisepsis, but also for the treatment of bacterial and viral conjunctivitis and for prophylaxis against ophthalmia neonatorum. For these indications, liposomal formulations with 2.5 and 5.0% PVP-I were developed. These eye drops are isotonic with tear fluid at pH 6. First in vitro tests demonstrated an excellent antimicrobial efficacy, and a placebo-controlled clinical study on volunteers showed a very good local tolerability. A study on rabbits demonstrated positive results of the PVP-I liposome eye drops compared to placebo and the broadspectrum antibiotic Polyspectran in a standardized model of Staphylococcus aureus deep eye infection. The other aim is a well-tolerated liposomal PVP-I hydrogel for improved antiseptic wound treatment with moisturizer. It has been reported that liposomes are enriched at the wound bottom for direct action against infection and support of wound healing. An animal study on the efficacy and tolerability of different formulations of a hydrogel with PVP-I liposomes in deep dermal burn wounds has indicated an outstanding quality of wound healing with smooth granulation tissue, less inflammation, less wound contraction and no hyperkeratotic reactivity, especially with the 3% PVP-I liposome formulation. PMID:9403264

Reimer, K; Fleischer, W; Brögmann, B; Schreier, H; Burkhard, P; Lanzendörfer, A; Gümbel, H; Hoekstra, H; Behrens-Baumann, W

1997-01-01

60

Temoporfin-loaded liposomes: physicochemical characterization.  

PubMed

Temoporfin (mTHPC) is a potent but highly hydrophobic second-generation photosensitizer and has been approved for the palliative treatment of patients with advanced head and neck cancer by photodynamic therapy. Liposome formulations have been evaluated as carrier system for this drug to overcome some problems associated with the commercial formulation Foscan where the drug is dissolved in a mixture of water-free ethanol and propylene glycol. The present study focuses on the physicochemical characterization of different liposome formulations with special emphasis on the influence of drug incorporation on the thermal phase behavior of the liposomes. In addition to conventional liposomes, pegylated lipids were used for the preparation of "stealth" liposomes. The dispersions as well as freeze-dried formulations were characterized by photon correlation spectroscopy, differential scanning calorimetry and cryo-electron microscopy. Incorporation of temoporfin resulted in a distinct concentration dependent decrease of the main phase transition of the liposomes. In case of liposomes based on dipalmitoylphosphatidylcholine/-glycerol, phase transition was close or even below body temperature. In contrast, if phospholipids with longer fatty acid chains (distearoylphosphatidylcholine/-glycerol) were used, phase transitions were well above body temperature even at high drug load. Size and thermal behavior were not distinctly influenced by the addition of pegylated lipids but cryo-electron microscopic investigations indicate the presence of micellar structures in addition to vesicles. Lyophilization and reconstitution led to an alteration in the morphology but had overall no distinct influence on the colloidal stability. PMID:20412853

Kuntsche, Judith; Freisleben, Ines; Steiniger, Frank; Fahr, Alfred

2010-07-11

61

Liposomes in Double-Emulsion Globules  

PubMed Central

Tubular liposomes containing a hydrophilic model compound (fluorescein sodium salt, FSS) were entrapped inside the internal aqueous phase (W1) of water-in-oil-in-water (W1/O/W2) double-emulsion globules. Our hypothesis was that the oil membrane of double emulsions can function as a layer of protection to liposomes and their contents and thus better control their release. Liposomes were prepared in bulk, and their release was observed microscopically from individual double-emulsion globules. The liposomes containing FSS were released through external coalescence, and the behavior of this system was monitored visually by capillary video microscopy. Double-emulsion globules were stabilized with Tween 80 as the water-soluble surfactant, with Span 80 as the oil-soluble surfactant, while the oil phase (O) was n-hexadecane. The lipids in the tubular liposomes consist of l-?-phosphatidylcholine and Ceramide-VI. Variations of Tween 80 concentration in the external aqueous phase (W2) and Span 80 concentration in the O phase controlled the release of liposomes from the W1 phase to the W2 phase. The major finding of this work is that the sheer presence of liposomes in the W1 phase is by itself a stabilizing factor for double-emulsion globules. PMID:19958007

Wang, Qing; Tan, Grace; Lawson, Louise B.; John, Vijay T.; Papadopoulos, Kyriakos D.

2010-01-01

62

A comparative photophysicochemical study of phthalocyanines encapsulated in core-shell silica nanoparticles  

NASA Astrophysics Data System (ADS)

This work presents the synthesis and characterization of a new zinc phthalocyanine complex tetrasubstituted with 3-carboxyphenoxy in the peripheral position. The photophysical properties of the new complex are compared with those of phthalocyanines tetra substituted with 3-carboxyphenoxy or 4-carboxyphenoxy at non-peripheral positions. Three phthalocyanine complexes were encapsulated within silica matrix to form a core shell and the hybrid nanoparticles particles obtained were spherical and mono dispersed. When encapsulated within the silica shell nanoparticles, phthalocyanines showed improved triplet quantum yields and singlet oxygen quantum yields than surface grafted derivatives. The improvements observed could be attributed to the protection provided for the phthalocyanine complexes by the silica matrix.

Fashina, Adedayo; Amuhaya, Edith; Nyokong, Tebello

2015-02-01

63

Frontispiece: synthesis, structures, and properties of crystalline salts with radical anions of metal-containing and metal-free phthalocyanines.  

PubMed

Anionic Phthalocyanines In their Full Paper on page?1014?ff., D.?V. Konarev et al. show that insoluble metal phthalocyanines can be dissolved in anionic form in non-polar solvents under reduction. They have also developed a simple method to obtain radical anion salts of different metal phthalocyanines as single crystals. The proposed approach makes it possible to prepare anionic metal phthalocyanines as crystals with different organic and organometallic cations to develop magnetic and conducting phthalocyanine assemblies in future. PMID:25565092

Konarev, Dmitri V; Kuzmin, Alexey V; Faraonov, Maxim A; Ishikawa, Manabu; Khasanov, Salavat S; Nakano, Yoshiaki; Otsuka, Akihiro; Yamochi, Hideki; Saito, Gunzi; Lyubovskaya, Rimma N

2015-01-12

64

The Role of Cavitation in Liposome Formation  

PubMed Central

Liposome size is a vital parameter of many quantitative biophysical studies. Sonication, or exposure to ultrasound, is used widely to manufacture artificial liposomes, yet little is known about the mechanism by which liposomes are affected by ultrasound. Cavitation, or the oscillation of small gas bubbles in a pressure-varying field, has been shown to be responsible for many biophysical effects of ultrasound on cells. In this study, we correlate the presence and type of cavitation with a decrease in liposome size. Aqueous lipid suspensions surrounding a hydrophone were exposed to various intensities of ultrasound and hydrostatic pressures before measuring their size distribution with dynamic light scattering. As expected, increasing ultrasound intensity at atmospheric pressure decreased the average liposome diameter. The presence of collapse cavitation was manifested in the acoustic spectrum at high ultrasonic intensities. Increasing hydrostatic pressure was shown to inhibit the presence of collapse cavitation. Collapse cavitation, however, did not correlate with decreases in liposome size, as changes in size still occurred when collapse cavitation was inhibited either by lowering ultrasound intensity or by increasing static pressure. We propose a mechanism whereby stable cavitation, another type of cavitation present in sound fields, causes fluid shearing of liposomes and reduction of liposome size. A mathematical model was developed based on the Rayleigh-Plesset equation of bubble dynamics and principles of acoustic microstreaming to estimate the shear field magnitude around an oscillating bubble. This model predicts the ultrasound intensities and pressures needed to create shear fields sufficient to cause liposome size change, and correlates well with our experimental data. PMID:17766335

Richardson, Eric S.; Pitt, William G.; Woodbury, Dixon J.

2007-01-01

65

Photosensitizing Efficiencies Of Poryphyrins, Chlorins, And Phthalocyanines.  

NASA Astrophysics Data System (ADS)

A Clark-type microelectrode is used to measure oxygen consumption rates in laser-irradiated solutions of photosensitizer and photosensitizer-containing cells. The presence of a singlet oxygen-specific acceptor molecule, furfuryl alcohol, permits indirect determination of relative singlet oxygen generation efficiencies from oxygen consumption data. Solution and cell measurements are performed which compare photosensitizing efficiency of Photofrin-II (PII), tetraphenylporphine tetrasulfonate (TPPS4), mono-L-aspartyl chlorin e6 (MACE), and chloroaluminum sulfonated phthalocyanine (CASPc). Relative singlet oxygen generating efficiency, per-unit-weight and per-absorbed-photon, were determined to be: MACE > CASPc > TPPS4 > PII and TPPS4 > MACE > PII > CASPc, respectively. When these results are compared to oxygen consumption in photosensitizer-containing cells, differences in the order and magnitude of photosensitizing efficiencies are observed. The relative oxygen consumption rate in cells was: PII CASPc > MACE TPPS4. Additional information concerning cell killing efficiency is derived from clongenicity assays. These data indicate that consideration of singlet oxygen generating ability in solution must be considered in conjuntion with cellular assays in order to provide an in vitro estimate of photosensitizer efficacy.

Tromberg, Bruce J.; Kimel, Sol; Roberts, Walter G.; Berns, Michael W.

1989-06-01

66

Asymmetric grain distribution in phthalocyanine thin films  

SciTech Connect

Many electronic and optical properties of organic thin films depend on the precise morphology of grains. Iron phthalocyanine thin films are grown on sapphire substrates at different temperatures to study the effect of grain growth kinematics and to experimentally quantify the grain size distribution in organic thin films. The grain size is measured with an atomic force microscope and the data is processed and analyzed with well-known image segmentation algorithms. For relevant statistics, over 3000 grains are evaluated for each sample. The data show pronounced asymmetric grain growth with increasing deposition temperature from almost spherical grains at room temperature to elongated needlelike shapes at 260 deg. C. The average size along the major axis increases from 35 to 200 nm and along the minor axis from 25 to 90 nm. The distribution is almost symmetric at low-deposition temperatures, but becomes lognormal at higher temperatures. Strikingly, the major axis and minor axis of the elliptically shaped grains have different distributions at all temperatures due to the planar asymmetry of the molecule.

Gentry, K. Paul; Gredig, Thomas; Schuller, Ivan K. [Department of Physics and Astronomy, California State University-Long Beach, 1250 Bellflower Boulevard, Long Beach, California 90840 (United States); Department of Physics and Astronomy, University of California-San Diego, 9500 Gilman Drive, La Jolla, California 92093 (United States)

2009-11-01

67

Efficient passivated phthalocyanine-quantum dot solar cells.  

PubMed

The power conversion efficiency of CdSe and CdS quantum dot sensitized solar cells is enhanced by passivation with asymmetrically substituted phthalocyanines. The introduction of the phthalocyanine dye increases the efficiency up to 45% for CdSe and 104% for CdS. The main mechanism causing this improvement is the quantum dot passivation. This study highlights the possibilities of a new generation of dyes designed to be directly linked to QDs instead of the TiO2 electrodes. PMID:25519050

Blas-Ferrando, Vicente M; Ortiz, Javier; González-Pedro, Victoria; Sánchez, Rafael S; Mora-Seró, Iván; Fernández-Lázaro, Fernando; Sastre-Santos, Ángela

2015-01-15

68

Nonphospholipid fluid liposomes with switchable photocontrolled release.  

PubMed

We created novel nonphospholipid photosensitive liposomes from a mixture of a monoacylated azobenzene amphiphile (AzoC10N(+)) and cholesterol sulfate (Schol). This system belongs to the family of sterol-enriched nonphospholipid liposomes that were shown to form stable large unilamellar vesicles (LUVs) with enhanced impermeability. Fluid bilayers were successfully prepared from AzoC10N(+)/Schol (25/75 molar ratio) mixtures, and LUVs could be derived at room temperature using standard extrusion methods. The isomerization process of the bilayer-inserted AzoC10N(+) was characterized. Leakage from these liposomes could be induced by the photoconversion of AzoC10N(+) from its trans form to its cis form. This photocontrolled release from fluid liposomes contrasts with the case of phospholipid-based azo-containing liposomes, which are generally required to be in the gel phase to be photosensitive. It is proposed that the very high degree of conformational order of the monoalkylated amphiphile and the tight packing of the hydrophobic core of the AzoC10N(+)/Schol liposomes make them responsive to the presence of the bulky cis azo isomer. Interestingly, the liposome impermeability could be fully restored by the photoisomerization of the cis form back to the trans form, providing a sharp on-and-off control of payload release. In addition, these nonphospholipid liposomes display a very limited passive release. Therefore, it is shown that AzoC10N(+)/Schol LUVs can be used as nanocontainers, whose content can be released by light in a controlled and switchable manner. PMID:25149436

Cui, Zhong-Kai; Phoeung, Thida; Rousseau, Pierre-Antoine; Rydzek, Gaulthier; Zhang, Qian; Bazuin, C Geraldine; Lafleur, Michel

2014-09-16

69

Resistive-pulse detection of multilamellar liposomes.  

PubMed

The resistive-pulse method was used to monitor the pressure-driven translocation of multilamellar liposomes with radii between 190 and 450 nm through a single conical nanopore embedded in a glass membrane. Liposomes (0% and 5% 1,2-dioleoyl-sn-glycero-3-phospho-l-serine (sodium salt) in 1,2-dilauroyl-sn-glycero-3-phosphocholine or 0%, 5%, and 9% 1,2-dipalmitoyl-sn-glycero-3-phospho(1'-rac-glycerol) (sodium salt) in 1,2-dipalmitoyl-sn-glycero-3-phosphocholine) were prepared by extrusion through a polycarbonate membrane. Liposome translocation through a glass nanopore was studied as a function of nanopore size and the temperature relative to the lipid bilayer transition temperature, T(c). All translocation events through pores larger than the liposome, regardless of temperature, show translocation times between 30 and 300 ?s and current pulse heights between 0.2% and 15% from the open pore baseline. However, liposomes at temperatures below the T(c) were captured at the pore orifice when translocation was attempted through pores of smaller dimensions, but squeezed through the same pores when the temperature was raised above T(c). The results provide insights into the deformation and translocation of individual liposomes through a porous material. PMID:22530770

Holden, Deric A; Watkins, John J; White, Henry S

2012-05-15

70

Silicon phthalocyanine 4 phototoxicity in Trichophyton rubrum.  

PubMed

Trichophyton rubrum is the leading pathogen that causes long-lasting skin and nail dermatophyte infections. Currently, topical treatment consists of terbinafine for the skin and ciclopirox for the nails, whereas systemic agents, such as oral terbinafine and itraconazole, are also prescribed. These systemic drugs have severe side effects, including liver toxicity. Topical therapies, however, are sometimes ineffective. This led us to investigate alternative treatment options, such as photodynamic therapy (PDT). Although PDT is traditionally recognized as a therapeutic option for treating a wide range of medical conditions, including age-related macular degeneration and malignant cancers, its antimicrobial properties have also received considerable attention. However, the mechanism(s) underlying the susceptibility of dermatophytic fungi to PDT is relatively unknown. As a noninvasive treatment, PDT uses a photosensitizing drug and light, which, in the presence of oxygen, results in cellular destruction. In this study, we investigated the mechanism of cytotoxicity of PDT in vitro using the silicon phthalocyanine (Pc) 4 [SiPc(OSi(CH3)2(CH2)3N(CH3)2)(OH)] in T. rubrum. Confocal microscopy revealed that Pc 4 binds to cytoplasmic organelles, and upon irradiation, reactive oxygen species (ROS) are generated. The impairment of fungal metabolic activities as measured by an XTT (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxyanilide inner salt) assay indicated that 1.0 ?M Pc 4 followed by 670 to 675 nm light at 2.0 J/cm(2) reduced the overall cell survival rate, which was substantiated by a dry weight assay. In addition, we found that this therapeutic approach is effective against terbinafine-sensitive (24602) and terbinafine-resistant (MRL666) strains. These data suggest that Pc 4-PDT may have utility as a treatment for dermatophytosis. PMID:24614382

Lam, Minh; Dimaano, Matthew L; Oyetakin-White, Patricia; Retuerto, Mauricio A; Chandra, Jyotsna; Mukherjee, Pranab K; Ghannoum, Mahmoud A; Cooper, Kevin D; Baron, Elma D

2014-06-01

71

Selective Detection of Vapor Phase Hydrogen Peroxide with Phthalocyanine Chemiresistors  

E-print Network

Selective Detection of Vapor Phase Hydrogen Peroxide with Phthalocyanine Chemiresistors Forest I and toxicity (OSHA PEL ) 1 ppm), vapor phase monitoring of hydrogen peroxide (H2O2) is also an important, California 92093 Received November 14, 2007; E-mail: wtrogler@ucsd.edu Vapor phase monitoring of peroxides

Kummel, Andrew C.

72

Synthesis of an oligo(phenylenevinylene)-bridged phthalocyanine dimer  

Microsoft Academic Search

As a model compound for corresponding PPV polymers containing phthalocyanine (Pc) subunits a phenylenevinylene-bridged nickel Pc dimer is synthesized. The synthesis route includes a modified Pc-monoaldehyde, which furnishes with 0.5 equivalents of p-xylylene bis(triphenylphosphonium)bromide in a Wittig reaction the Pc dimer.

Reiner Jung; Karl-Heinz Schweikart; Michael Hanack

2000-01-01

73

Dynamics of phthalocyanine Al accumulation in stomach cancer photodynamic therapy  

NASA Astrophysics Data System (ADS)

Methods of stomach cancer photodynamic therapy with the use of Kr laser and photosensitizer-phthalocyanine (Al-Pc) are discussed. The level of preparation accumulation in the tumor and surrounding tissues has been investigated with the use of laser spectroanalyzer LESA-4 (`Biospec'). Dynamics of (Al-Pc) accumulation investigated depend on different types of tumors and different parameters of laser irradiation.

Kharnas, Sergey S.; Loschenov, Victor B.; Stratonnikov, Alexander A.; Kramarenko, T. A.; Artemjeva, O. V.; Bakonin, V. P.; Kuzin, M. I.; Zavodnov, Victor Y.; Steiner, Rudolf W.

1995-01-01

74

Submonolayer growth of H2-phthalocyanine on Ag(111)  

NASA Astrophysics Data System (ADS)

We present a comprehensive study of structural and electronic properties of the adsorbate system H2-phthalocyanine (H2Pc) on Ag(111). A comparison with copper-phthalocyanine (CuPc) on Ag(111) allows us to elucidate the impact of the central metal atom in the molecule on the adsorbate-substrate interaction. This metal atom is one fundamental parameter which can be changed in order to modify the properties of phthalocyanine molecules, and therefore its influence on the adsorption behavior is highly relevant. From high-resolution electron diffraction, we obtained a phase diagram for submonolayer coverages which turns out to be similar to that of CuPc/Ag(111). The most striking difference is a higher stability of a commensurate phase, indicating a stronger and more adsorption site-specific bonding of the H2Pc molecules. Furthermore, ultraviolet photoelectron spectroscopy and x-ray standing waves prove chemisorptive interaction between molecules and substrate and a significant bending of the molecules with the nitrogen atoms approaching the surface. We conclude that the attractive interaction of metal-phthalocyanine molecules with Ag(111) is mainly mediated by the aromatic body of the molecule (the tetraazaporphyrin ring in particular) rather than by the central metallic atom which (in the case of CuPc) already shows Pauli repulsion.

Kröger, Ingo; Bayersdorfer, Patrick; Stadtmüller, Benjamin; Kleimann, Christoph; Mercurio, Giuseppe; Reinert, Friedrich; Kumpf, Christian

2012-11-01

75

Encapsulated liposomes for long-term drug delivery  

NSDL National Science Digital Library

Solve the steady-state radial diffusion equation in a sphere to calculate the resistance to drug diffusion through a liposome encapsulant; then compare to resistance to transport through the liposome membrane and determine the limiting step.

Powell, Adam C., IV

2004-08-11

76

Synthesis of transferrin (Tf) conjugated liposomes via Staudinger ligation  

PubMed Central

Staudinger ligation was evaluated as a strategy for synthesizing receptor targeted liposomes. First, an activated lipid derivative was synthesized by reacting dioleoyl phosphatidylethanolamine (DOPE) and 2-(diphenylphosphino) terephthalic acid 1-methyl 4-penta-fluorophenyldiester. Second, transferrin (Tf) was activated with p-azidophenyl isothiocyanate. Third, liposomes containing the activated lipid were prepared and then coupled to the activated Tf via the Staudinger reaction. These liposomes were evaluated in KB cells for cellular uptake and cytotoxicity, and in mice for pharmacokinetic properties. Tf-derivatized liposomes encapsulating calcein prepared by this conjugation method effectively targeted Tf receptor expressing KB cells. In addition, the Tf-targeted liposomes entrapping doxorubicin showed greatly enhanced in vitro cytotoxicity relative to non-targeted control liposomes. Pharmacokinetic parameters indicated that these liposomes retained long circulating properties relative to the free drug. In summary, Staudinger ligation is an effective method for the synthesis of receptor targeted liposomes. PMID:21056642

Xu, Songlin; Liu, Ying; Tai, Heng-Chiat; Zhu, Jing; Ding, Hong; Lee, Robert J.

2010-01-01

77

A Review on Composite Liposomal Technologies for Specialized Drug Delivery  

PubMed Central

The combination of liposomes with polymeric scaffolds could revolutionize the current state of drug delivery technology. Although liposomes have been extensively studied as a promising drug delivery model for bioactive compounds, there still remain major drawbacks for widespread pharmaceutical application. Two approaches for overcoming the factors related to the suboptimal efficacy of liposomes in drug delivery have been suggested. The first entails modifying the liposome surface with functional moieties, while the second involves integration of pre-encapsulated drug-loaded liposomes within depot polymeric scaffolds. This attempts to provide ingenious solutions to the limitations of conventional liposomes such as short plasma half-lives, toxicity, stability, and poor control of drug release over prolonged periods. This review delineates the key advances in composite technologies that merge the concepts of depot polymeric scaffolds with liposome technology to overcome the limitations of conventional liposomes for pharmaceutical applications. PMID:21490759

Mufamadi, Maluta S.; Pillay, Viness; Choonara, Yahya E.; Du Toit, Lisa C.; Modi, Girish; Naidoo, Dinesh; Ndesendo, Valence M. K.

2011-01-01

78

Detection of liposomes in portal blood following oral administration  

Microsoft Academic Search

125Iodine-labeled human immunoglobulin G-encapsulated dipalmitoyl phosphatidylcholine liposomes were prepared with or without asialoganglioside. Distribution of radioactivity following the oral administration of these liposomes in rats was checked in liver and in blood of the portal vein and heart. Gel filtration of plasma from the portal vein showed the presence of intact liposomes and protein. In contrast, neither liposomes nor protein

N. Das; M. K. Das; B. K. Bachhawat

1984-01-01

79

[Property of liposomal fusion induced by acid-sensitive polymer].  

PubMed

The fusion between liposome-liposome, liposome-biomembarnes induced by acid-sensitive polymers has been systematically investigated. The polymer-liposomes were constructed by post-insertion method with the poly (2-ethylacrylic acid) (PEAA) alkylamide derivatives. The liposomal fusion was studied by use of fluorescence resonance energy transfer assay, particle size, fluorescent-photometer. The results indicated that the poly (2-ethylacrylic acid)-liposomes has very strong acidic induced fusion capability. Under acidic conditions, acid-sensitive polymer liposomes fused each other, the fusion closely related to the molecular weight of acid sensitivity polymer on the surface of liposomes. The acidic fusion of polymer-liposomes was dependent upon the lipids composition, the degree of fusion was reversely related to the cholesterol contents. Acid-en ci-nsitive polymer liposomes fused with erythrocyte ghosts. The liposomal fusion induced by acid-sensitive polymer associated with the increase of membrane permeability. The good acid-sensitivity of PEAA has been further demonstrated by membrane fusion in current experiments, and the liposomes prepared with lipid anchored-poly (2-ethylacrylic acid) were developeds s a potential pH sensitive delivery system. PMID:19048789

Wang, Ru-tao; Chen, Tao; Wang, Zhao; Hui, Min-quan; Fu, Jing-guo

2008-09-01

80

Development of novel topical tranexamic acid liposome formulations.  

PubMed

The aims of this study were to develop novel liposome formulations for tranexamic acid (TA) from various lipid compositions [neutral (hydrogenated soya phosphatidylcholine and cholesterol), positive (stearylamine) or negative (dicetyl phosphate) charged lipid], and to investigate the effects of concentrations of TA (5 and 10% in DI water) and charges on the physicochemical properties of liposomes. Liposomes were prepared by chloroform film method with sonication. The physical (appearance, pH, size, morphology) and chemical (drug encapsulation efficiency, transition temperature, enthalpy of transition) properties of liposomes were characterized. The TA contents were determined spectrophotometrically at 415 nm, following derivatization with 2,4,6-trinitrobenzosulfonic acid. The charged liposomes demonstrated better physical stability than the neutral liposomes. The percentages of TA entrapped in all liposome formulations varied between 13.2 and 15.6%, and were independent of TA concentrations and charges of liposomes. Charges affected the physical stability, pH and size of liposomes. The particle sizes of negative blank and positive liposomes (with and without the entrapped drug) were approximately 10 times larger than the negative liposome with the entrapped TA. The multilamellar 7:2:1 molar ratio of hydrogenated soy phosphatidylcholine/cholesterol/dicetyl phosphate entrapped with 10% TA liposome (10%TA,-) was selected for further release study, due to its high physical stability, small particle size and relatively high drug encapsulation efficiency. PMID:11879740

Manosroi, A; Podjanasoonthon, K; Manosroi, J

2002-03-20

81

Development of novel topical tranexamic acid liposome formulations  

Microsoft Academic Search

The aims of this study were to develop novel liposome formulations for tranexamic acid (TA) from various lipid compositions {neutral (hydrogenated soya phosphatidylcholine and cholesterol), positive (stearylamine) or negative (dicetyl phosphate) charged lipid}, and to investigate the effects of concentrations of TA (5 and 10% in DI water) and charges on the physicochemical properties of liposomes. Liposomes were prepared by

A. Manosroi; K. Podjanasoonthon; J. Manosroi

2002-01-01

82

Liposomal Encapsulated Rhodomyrtone: A Novel Antiacne Drug  

PubMed Central

Rhodomyrtone isolated from the leaves of Rhodomyrtus tomentosa possesses antibacterial, anti-inflammatory, and anti-oxidant activities. Since rhodomyrtone is insoluble in water, it is rather difficult to get to the target sites in human body. Liposome exhibited ability to entrap both hydrophilic and hydrophobic compounds and easily penetrate to the target site. The present study aimed to develop a novel liposomal encapsulated rhodomyrtone formulations. In addition, characterization of liposome, stability profiles, and their antiacne activity were performed. Three different formulations of total lipid concentrations 60, 80, and 100??mol/mL were used. Formulation with 60??mol/mL total lipid (phosphatidylcholine from soybean and cholesterol from lanolin in 4?:?1, w/w) exhibited the highest rhodomyrtone encapsulation efficacy (65.47 ± 1.7%), average particle size (209.56 ± 4.8?nm), and ?-potential (–41.19 ± 1.3?mV). All formulations demonstrated good stability when stored for 2 months in dark at 4°C as well as room temperature. Minimal inhibitory concentration and minimal bactericidal concentration values of liposomal formulation against 11 clinical bacterial isolates and reference strains ranged from 1 to 4 and from 4 to 64??g/mL, respectively, while those of rhodomyrtone were 0.25–1 and 0.5–2??g/mL, respectively. The MIC and MBC values of liposome formulation were more effective than topical drugs against Staphylococcus aureus and Staphylococcus epidermidis. PMID:23762104

Chorachoo, Julalak; Amnuaikit, Thanaporn; Voravuthikunchai, Supayang P.

2013-01-01

83

Liposomal encapsulated rhodomyrtone: a novel antiacne drug.  

PubMed

Rhodomyrtone isolated from the leaves of Rhodomyrtus tomentosa possesses antibacterial, anti-inflammatory, and anti-oxidant activities. Since rhodomyrtone is insoluble in water, it is rather difficult to get to the target sites in human body. Liposome exhibited ability to entrap both hydrophilic and hydrophobic compounds and easily penetrate to the target site. The present study aimed to develop a novel liposomal encapsulated rhodomyrtone formulations. In addition, characterization of liposome, stability profiles, and their antiacne activity were performed. Three different formulations of total lipid concentrations 60, 80, and 100? ? mol/mL were used. Formulation with 60? ? mol/mL total lipid (phosphatidylcholine from soybean and cholesterol from lanolin in 4?:?1, w/w) exhibited the highest rhodomyrtone encapsulation efficacy (65.47 ± 1.7%), average particle size (209.56 ± 4.8?nm), and ? -potential (-41.19 ± 1.3?mV). All formulations demonstrated good stability when stored for 2 months in dark at 4°C as well as room temperature. Minimal inhibitory concentration and minimal bactericidal concentration values of liposomal formulation against 11 clinical bacterial isolates and reference strains ranged from 1 to 4 and from 4 to 64? ? g/mL, respectively, while those of rhodomyrtone were 0.25-1 and 0.5-2? ? g/mL, respectively. The MIC and MBC values of liposome formulation were more effective than topical drugs against Staphylococcus aureus and Staphylococcus epidermidis. PMID:23762104

Chorachoo, Julalak; Amnuaikit, Thanaporn; Voravuthikunchai, Supayang P

2013-01-01

84

Treatment of Digital Ischemia with Liposomal Bupivacaine  

PubMed Central

Objective. This report describes a case in which the off-label use of liposomal bupivacaine (Exparel) in a peripheral nerve block resulted in marked improvement of a patient's vasoocclusive symptoms. The vasodilating and analgesic properties of liposomal bupivacaine in patients with ischemic symptoms are unknown, but our clinical experience suggests a role in the management of patients suffering from vasoocclusive disease. Case Report. A 45-year-old African American female was admitted to the hospital with severe digital ischemic pain. She was not a candidate for any vascular surgical or procedural interventions. Two continuous supraclavicular nerve blocks were placed with modest clinical improvement. These effects were also short-lived, with the benefits resolving after the discontinuation of the peripheral nerve blocks. She continued to report severe pain and was on multiple anticoagulant medications, so a decision was made to perform an axillary nerve block using liposomal bupivacaine (Exparel) given the compressibility of the site as well as the superficial nature of the target structures. Conclusions. This case report describes the successful off-label usage of liposomal bupivacaine (Exparel) in a patient with digital ischemia. Liposomal bupivacaine (Exparel) is currently FDA approved only for wound infiltration use at this time. PMID:24653844

Raul Soberón, José; Duncan, Scott F.; Sternbergh, W. Charles

2014-01-01

85

Surface Engineering of Liposomes for Stealth Behavior  

PubMed Central

Liposomes are used as a delivery vehicle for drug molecules and imaging agents. The major impetus in their biomedical applications comes from the ability to prolong their circulation half-life after administration. Conventional liposomes are easily recognized by the mononuclear phagocyte system and are rapidly cleared from the blood stream. Modification of the liposomal surface with hydrophilic polymers delays the elimination process by endowing them with stealth properties. In recent times, the development of various materials for surface engineering of liposomes and other nanomaterials has made remarkable progress. Poly(ethylene glycol)-linked phospholipids (PEG-PLs) are the best representatives of such materials. Although PEG-PLs have served the formulation scientists amazingly well, closer scrutiny has uncovered a few shortcomings, especially pertaining to immunogenicity and pharmaceutical characteristics (drug loading, targeting, etc.) of PEG. On the other hand, researchers have also begun questioning the biological behavior of the phospholipid portion in PEG-PLs. Consequently, stealth lipopolymers consisting of non-phospholipids and PEG-alternatives are being developed. These novel lipopolymers offer the potential advantages of structural versatility, reduced complement activation, greater stability, flexible handling and storage procedures and low cost. In this article, we review the materials available as alternatives to PEG and PEG-lipopolymers for effective surface modification of liposomes. PMID:24300562

Nag, Okhil K.; Awasthi, Vibhudutta

2013-01-01

86

Highly Unquenched Orbital Moment In Fe Phthalocyanine  

NASA Astrophysics Data System (ADS)

Metal-Phthalocyanine molecules (MPc) form a family of compounds with a wide range of commercial application such as catalysts or dyes, and more recently in thin film technology. In an early work we found that in the ?-phase of FePc, where the FePc molecules are stacked in a herringbone structure, the Fe atoms are strongly magnetically coupled into ferromagnetic Ising chains with very weak antiferromagnetic interchain coupling. The chains achieve 3D long range ordering at TN=10 K, and strong irreversibility (slow relaxation) below 5K. The Fe(II) is in a S=1 state and the hyperfine field in the ordered phase reaches a record value in Fe(II) of Bhf=66.2 T. This result is consistent with a large, unquenched orbital moment. It has been measured directly in a X-ray Magnetic Circular Dichroism (XMCD) spectroscopic study on FePc thin films deposited parallel on a Au surface predeposited on a Si substrate. The XMCD spectra at the L3 and L2 edges were measured as a function of incident angle ?. The orbital moment is | mL |=0.53±0.04?B and the isotropic spin component is mS=0.64±0.05?B. The origin of this unusually high orbital moment is the incompletely filled eg level lying close to the Fermi energy. The ferromagnetically coupled Fe moments show strong, in-plane anisotropy [1]. Angular dependent measurements at the Fe K-edge also show strong quadrupolar excitations associated to a strong orbital moment, confirming the above result of the existence of a large, unquenched orbital moment in this molecule. Submonolayer FePc thin films deposited on Au, recently studied my XAS and XMCD have shown that there is charge transfer from the substrate to the Fe atom, modifying the electronic structure and magnetic properties [2] [4pt] [1] J. Bartolom'e et al., Phys. Rev. B 81, 195405 (2010) [0pt] [2] S. Stepanow et al., Phys. Rev. B 83, 220401(R) (2011).

Bartolome, Juan

2012-02-01

87

Targeting of the photocytotoxic compound AlPcS4 to Hela cells by transferrin conjugated PEG-liposomes.  

PubMed

Photodynamic therapy has attracted increasing interest over the last few years, whereby the activation of photosensitizers by light causes the production of reactive oxygen species (ROS), such as singlet oxygen, which are cytotoxic. The goal of our study was to enhance the photodynamic activity of the photosensitizer aluminum phthalocyanine tetrasulfonate (AlPcS4) through its specific delivery to tumor cells. Since many tumor cells, among which are HeLa cells, overexpress the transferrin receptor, we synthesized transferrin conjugated PEG-liposomes that contained AlPcS4 that could be internalized by receptor mediated endocytosis. The antiproliferative activity of the targeted liposomes was evaluated and compared to the native AlPcS4 and the non-targeted liposome. These findings were supplemented with data on intracellular concentration of the photo-active compounds. The accumulation together with ROS production after irradiation was visualized by using confocal microscopy to confirm the data found in the antiproliferative and accumulation assay. Tf-Lip-AlPcS4 was 10 times more photocytotoxic (IC(50), 0.63 microM) than free AlPcS4 at a light dose of 45 kJ/m whereas Lip-AlPcS4 displayed no photocytotoxicity at all. The high photocytotoxicity of Tf-Lip-AlPcS4 was shown to be the result of a high intracellular concentration (136.5 microM) in HeLa cells, which could be lowered dramatically by incubating the conjugate with a competing transferrin concentration. The images of intracellular accumulation and ROS production matched the accumulation and photocytotoxicity profile of the different photo-active compounds. The photodynamic activity of the Tf-Lip-AlPcS4 conjugate on HeLa cells is much more potent than free AlPcS4 as a result of selective transferrin receptor mediated uptake. PMID:12209592

Gijsens, Antoon; Derycke, Annelies; Missiaen, Ludwig; De Vos, Dirk; Huwyler, Jörg; Eberle, Alex; de Witte, Peter

2002-09-01

88

Laser-induced release of liposome-encapsulated dye to monitor tissue temperature: study of different liposome compositions  

Microsoft Academic Search

This study aimed to evaluate the interest of several liposome compositions (DPPC, DSPC, DPPA) to control specific ranges of temperature and to assess the possible use of temperature sensitive liposomes in an established model such as the liver as a new approach to monitor tissue temperature under laser irradiation. Temperature sensitive liposomes (DPPC or DSPC or DPPA) loaded with carboxy-fluorescein

Thomas Desmettre; Serge R. Mordon; Jean-Marie Devoisselle; Sylvie Soulie

1995-01-01

89

Bioavailability of Polyphenol Liposomes: A Challenge Ahead  

PubMed Central

Dietary polyphenols, including flavonoids, have long been recognized as a source of important molecules involved in the prevention of several diseases, including cancer. However, because of their poor bioavailability, polyphenols remain difficult to be employed clinically. Over the past few years, a renewed interest has been devoted to the use of liposomes as carriers aimed at increasing the bioavailability and, hence, the therapeutic benefits of polyphenols. In this paper, we review the causes of the poor bioavailability of polyphenols and concentrate on their liposomal formulations, which offer a means of improving their pharmacokinetics and pharmacodynamics. The problems linked to their development and their potential therapeutic advantages are reviewed. Future directions for liposomal polyphenol development are suggested. PMID:24300518

Mignet, Nathalie; Seguin, Johanne; Chabot, Guy G.

2013-01-01

90

Microfluidic-Enabled Liposomes Elucidate Size-Dependent Transdermal Transport  

PubMed Central

Microfluidic synthesis of small and nearly-monodisperse liposomes is used to investigate the size-dependent passive transdermal transport of nanoscale lipid vesicles. While large liposomes with diameters above 105 nm are found to be excluded from deeper skin layers past the stratum corneum, the primary barrier to nanoparticle transport, liposomes with mean diameters between 31–41 nm exhibit significantly enhanced penetration. Furthermore, multicolor fluorescence imaging reveals that the smaller liposomes pass rapidly through the stratum corneum without vesicle rupture. These findings reveal that nanoscale liposomes with well-controlled size and minimal size variance are excellent vehicles for transdermal delivery of functional nanoparticle drugs. PMID:24658111

Junqueira, Mariana; Vreeland, Wyatt N.; Quezado, Zenaide; Finkel, Julia C.; DeVoe, Don L.

2014-01-01

91

Mechanical properties of a giant liposome studied using optical tweezers  

NASA Astrophysics Data System (ADS)

The mechanical properties of a micrometer-sized giant liposome are studied by deforming it from the inside using dual-beam optical tweezers. As the liposome is extended, its shape changes from a sphere to a lemon shape, and finally, a tubular part is generated. The surface tension ? and the bending rigidity ? of the lipid membrane are obtained from the measured force-extension curve. In a one-phase liposome, it was found that ? increases as the charged component increases but ? remains approximately constant. In a two-phase liposome, the characteristic deformation and the force-extension curve differ from those observed for the one-phase liposome.

Shitamichi, Yoko; Ichikawa, Masatoshi; Kimura, Yasuyuki

2009-09-01

92

Recent Trends of Polymer Mediated Liposomal Gene Delivery System  

PubMed Central

Advancement in the gene delivery system have resulted in clinical successes in gene therapy for patients with several genetic diseases, such as immunodeficiency diseases, X-linked adrenoleukodystrophy (X-ALD) blindness, thalassemia, and many more. Among various delivery systems, liposomal mediated gene delivery route is offering great promises for gene therapy. This review is an attempt to depict a portrait about the polymer based liposomal gene delivery systems and their future applications. Herein, we have discussed in detail the characteristics of liposome, importance of polymer for liposome formulation, gene delivery, and future direction of liposome based gene delivery as a whole. PMID:25250340

Lee, Sang-Soo; George Priya Doss, C.; Yagihara, Shin; Kim, Do-Young

2014-01-01

93

Liposomes for Use in Gene Delivery  

PubMed Central

Liposomes have a wide array of uses that have been continuously expanded and improved upon since first being observed to self-assemble into vesicular structures. These arrangements can be found in many shapes and sizes depending on lipid composition. Liposomes are often used to deliver a molecular cargo such as DNA for therapeutic benefit. The lipids used to form such lipoplexes can be cationic, anionic, neutral, or a mixture thereof. Herein physical packing parameters and specific lipids used for gene delivery will be discussed, with lipids classified according to overall charge. PMID:21490748

Balazs, Daniel A.; Godbey, WT.

2011-01-01

94

Overcoming cellular and tissue barriers to improve liposomal drug delivery  

NASA Astrophysics Data System (ADS)

Forty years of liposome research have demonstrated that the anti-tumor efficacy of liposomal therapies is, in part, driven by three parameters: 1) liposome formulation and lipid biophysics, 2) accumulation and distribution in the tumor, and 3) release of the payload at the site of interest. This thesis outlines three studies that improve on each of these delivery steps. In the first study, we engineer a novel class of zwitterlipids with an inverted headgroup architecture that have remarkable biophysical properties and may be useful for drug delivery applications. After intravenous administration, liposomes accumulate in the tumor by the enhanced permeability and retention effect. However, the tumor stroma often limits liposome efficacy by preventing distribution into the tumor. In the second study, we demonstrate that depletion of hyaluronan in the tumor stroma improves the distribution and efficacy of DoxilRTM in murine 4T1 tumors. Once a liposome has distributed to the therapeutic site, it must release its payload over the correct timescale. Few facile methods exist to quantify the release of liposome therapeutics in vivo. In the third study, we outline and validate a simple, robust, and quantitative method for tracking the rate and extent of release of liposome contents in vivo. This tool should facilitate a better understanding of the pharmacodynamics of liposome-encapsulated drugs in animals. This work highlights aspects of liposome behavior that have prevented successful clinical translation and proposes alternative approaches to improve liposome drug delivery.

Kohli, Aditya G.

95

Preparation of novel apigenin-enriched, liposomal and non-liposomal, antiinflammatory topical formulations as substitutes for corticosteroid therapy.  

PubMed

Two oil-in-water formulations, containing equal amounts of apigenin-enriched chamomile flower extracts, for potential use as topical antiinflammatory agents, were prepared and their physicochemical properties evaluated. A pilot clinical study was then carried out to assess patient acceptability and efficacy. The creams were either non-liposomal or liposomal. The liposomal formulations were more viscous, thus producing superior release characteristics in vitro. The clinical study also showed that the liposomal creams were, as antiinflammatory agents, slightly more effective in vivo than the non-liposomal formulations. These results suggest that there is scope for the further development of even more effective and safer alternatives to corticosteroids. PMID:20641055

Arsi?, Ivana; Tadi?, Vanja; Vlaovi?, Djordje; Homšek, Irena; Vesi?, Sonja; Isailovi?, Gorana; Vuleta, Gordana

2011-02-01

96

Liposomal delivery and polyethylene glycol-liposomal oxaliplatin for the treatment of colorectal cancer (Review)  

PubMed Central

Oxaliplatin is effective for the treatment of advanced colorectal cancer; however, its application is restricted due to its dose-limiting toxicity. Liposomes are sphere-shaped vesicles consisting of one or more phospholipid bilayers. Liposomes as drug carriers are characterized by delayed release, lesion targeting and may be used as a drug-delivery system to decrease the side effects of cytotoxic drugs. Active targeting modification of liposomes may change the biological distribution of the anticancer agents, reduce or reverse multidrug resistance of tumor cells and enhance the effects of anticancer therapy. Based on the characteristics mentioned above, the aim of the present review was to demonstrate that polyethylene glycol-liposomes containing oxaliplatin may offer advantages for the treatment of colorectal cancer in clinical practice. PMID:24748970

YANG, CHUANG; FU, ZHONG-XUE

2014-01-01

97

Femtosecond phase spectroscopy of multi-level systems: Phthalocyanines  

NASA Astrophysics Data System (ADS)

A femtosecond frequency-domain interferometer is applied to metal-free and vanadyl phthalocyanine (H2Pc and VOPc) thin films to measure time-resolved difference phase and transmission spectra simultaneously. For both samples, the phase-change dynamics is different from the transmission-change dynamics at 620 nm, reflecting that the phthalocyanines (Pc) cannot be modeled with a two-level system but by a multi-level or inhomogeneously broadened system, in which each level pair exhibits different relaxation dynamics. Because of this dynamical difference, a phase-change measurement is required to correct distortion of the transient spectra due to induced phase modulation of probe pulses. Near zero time delay, the phase and transmission changes show different growth behavior. This behavior is explained by antisymmetric amplitude and phase gratings which are produced by coherent coupling between frequency-chirped pump and probe pulses.

Tokunaga, E.; Terasaki, A.; Wada, T.; Sasabe, H.; Kobayashi, T.

1996-09-01

98

Recognition and clearance of liposomes containing phosphatidylserine are mediated by serum opsonin  

Microsoft Academic Search

Liver uptake of liposomes containing phosphatidylserine was studied in a single pass liver perfusion system and found to be serum dependent. The effectiveness of serum in mediating liposome uptake by the liver depends on liposome size. Large liposomes appeared to be opsonized more efficiently and, therefore, taken up more by the liver than the smaller ones. The effects of liposome

Dexi Liu; Feng Liu; Young K. Song

1995-01-01

99

Investigation of Single-Drug-Encapsulating Liposomes using the Nano-Impact Method.  

PubMed

Encapsulating liposomes are widely used for controlled drug delivery. We report the use of nano-impact experiments for the electrochemical attomolar quantification of the liposome load, uniquely at the single liposome level, using vitamin?C encapsulated liposomes as a model. The size of the liposomes and their picomolar concentration are also determined in biological buffer in real time. PMID:25302622

Cheng, Wei; Compton, Richard G

2014-12-01

100

Physico-chemical characterization of liposomes and drug substance-liposome interactions in pharmaceutics using capillary electrophoresis and electrokinetic chromatography.  

PubMed

Liposomes are self-assembled phospholipid vesicles and have numerous research and therapeutic applications. In the pharmaceutical and biomedical sciences liposomes find use as models of biological membranes, partitioning medium and as drug carriers. The present review addresses the use of capillary electrophoresis and liposome electrokinetic chromatography for the characterization of liposomes in a pharmaceutical context. Capillary electrophoretic techniques have been used for the measurement of electrophoretic mobility, which provides information on liposome surface charge, size and membrane permeability of liposomes. The use of liposome electrokinetic chromatography and capillary electrophoresis for determination of liposome/water partitioning and characterization of drug-liposome interactions is reviewed. A number of studies indicate that capillary electrophoresis may have a role in the characterization of liposome drug delivery systems, e.g., for the investigation of encapsulation efficiency and drug leakage. The well-known characteristics of capillary electrophoresis, i.e., low sample volume requirement, high separation efficiency in aqueous media without a stationary phase, minimal sample preparation, and a high degree of automation, makes it an attractive approach in liposome research. PMID:22824223

Franzen, Ulrik; Østergaard, Jesper

2012-12-01

101

Metal phthalocyanine intermediates for the preparation of polymers  

NASA Technical Reports Server (NTRS)

Metal 4, 4', 4"",-tetracarboxylic phthalocyanines (MPTC) are prepared by reaction of trimellitic anhydride, a salt or hydroxide of the desired metal (or the metal in powdered form), urea and a catalyst. A purer form of MPTC is prepared than heretofore. These tetracarboxylic acids are then polymerized by heat to sheet polymers which have superior heat and oxidation resistance. The metal is preferably a divalent metal having an atomic radius close to 1.35A.

Achar, B. N.; Fohlen, G. M.; Parker, J. A.

1985-01-01

102

ORIGINAL PAPER Electrochemical reduction of oxygen with iron phthalocyanine  

E-print Network

H, and the reaction is mainly controlled by FeII /FeIII redox couple. This behaviour gives us new insight applications in neutral media. Keywords Microbial fuel cells Á Oxygen reduction Á Iron phthalocyanine Á Redox-electron reaction pathways, which can be expressed as: OHOHO KK 2 3 22 2 2 K1 K4 E. H. Yu (&) Á K. Scott School

103

Electronic structure of cobalt phthalocyanine: A charge density study  

Microsoft Academic Search

A charge density study of cobalt(II) phthalocyanine based upon 12,163 unique reflections within a (sin \\/theta\\/)\\/\\/lambda\\/ range 0-10.8 nm\\/sup \\/minus\\/1\\/, collected by X-ray diffraction at 115 K, was performed. The data was modeled by a conventional multipole analysis as well as by a valence orbital population analysis. When the latter approach was used and data was employed to a (sin

B. N. Figgis; E. S. Kucharski; P. A. Reynolds

1989-01-01

104

Optical electronic nose based on porphyrin and phthalocyanine thin films  

Microsoft Academic Search

The classification of product quality based on an optical electronic nose is becoming an instrument of much interest in beverage industry. The optical electronic nose is composed of a molecular sensing layer, UV-Vis spectrophotometer and a data analysis unit. The sensing layer was fabricated from 3 types of organic compounds, namely Zinc-2,9,16,23- tetra- tert- butyl- 29H,31H- phthalocyanine (ZnTTBPc), Zinc-5,10,15,20-tetraphenyl- 21H,23H-porphyrin

Sumana Kladsomboon; Sirapat Pratontep; Teerakiat Kerdcharoen

2010-01-01

105

The production of copper phthalocyanine and/or its derivatives  

NASA Technical Reports Server (NTRS)

This document discusses the production of copper phthalocyanine and/or its derivatives, which are useful for dye pigments. The method described uses urea, a copper compound and/or a catalyst which have been suspended in an inert reaction medium. The copper compound, catalyst and urea fused and the reaction is performed by using the obtained fusion. The advantages of the invention are listed.

Segawa, T.; Matsuzaki, K.; Sawada, H.; Ninomiya, R.; Suyama, M.

1984-01-01

106

Q-band splitting and relaxation of aluminum phthalocyanine tetrasulfonate  

NASA Astrophysics Data System (ADS)

The doublet band structure evident in the fluorescence excitation and absorption spectra of aluminum phthalocyanine tetrasulfonate in various hyperquenched glassy solvents is attributed to splitting of the Q-band transition into x and y components. The splitting is caused by the ligation of water molecules to the aluminum atom which decreases the molecular symmetry. Picosecond relaxation from the Q y band to the Q x band is evident in the hole burned spectra.

Reinot, T.; Hayes, J. M.; Small, G. J.; Zerner, M. C.

1999-01-01

107

Nanostructured copper phthalocyanine-sensitized multiwall carbon nanotube films.  

PubMed

We report a detailed study of the interaction between surface-oxidized multiwall carbon nanotubes (o-MWCNTs) and the molecular semiconductor tetrasulfonate copper phthalocyanine (TS-CuPc). Concentrated dispersions of o-MWCNT in aqueous solutions of TS-CuPc are stable toward nanotube flocculation and exhibit spontaneous nanostructuring upon rapid drying. In addition to hydrogen-bonding interactions, the compatibility between the two components is shown to result from a ground-state charge-transfer interaction with partial charge transfer from o-MWCNT to TS-CuPc molecules orientated such that the plane of the macrocycle is parallel to the nanotube surface. The electronegativity of TS-CuPc as compared to unsubsubtituted copper phthalocyanine is shown to result from the electron-withdrawing character of the sulfonate substituents, which increase the molecular ionization potential and promote cofacial molecular aggregation upon drying. Upon spin casting to form uniform thin films, the experimental evidence is consistent with an o-MWCNT scaffold decorated with phthalocyanine molecules self-assembled into extended aggregates reminiscent of 1-D linearly stacked phthalocyanine polymers. Remarkably, this self-organization occurs in a fraction of a second during the spin-coating process. To demonstrate the potential utility of this hybrid material, it is successfully incorporated into a model organic photovoltaic cell at the interface between a poly(3-hexylthiophene):[6,6]-phenyl-C61 butyric acid methyl ester bulk heterojunction layer and an indium-tin oxide-coated glass electrode to increase the light-harvesting capability of the device and facilitate hole extraction. The resulting enhancement in power conversion efficiency is rationalized in terms of the electronic, optical, and morphological properties of the nanostructured thin film. PMID:17439261

Hatton, Ross A; Blanchard, Nicholas P; Stolojan, Vlad; Miller, Anthony J; Silva, S Ravi P

2007-05-22

108

Reactive oxygen species produced by irradiation of some phthalocyanine derivatives  

Microsoft Academic Search

A comparative study of the reliability of methods used for the determination of singlet oxygen was carried out. The water iodide method, as well as the methods using 9,10-dimethylanthracene (DMA) and 1,3-diphenylisobenzofuran (DPIBF) in dimethylformamide (DMF) solutions, was used for the detection of singlet oxygen 1O2 production in eight phthalocyanine photosensitizers. The iodide method is not only selective for the

Ji?í ?erný; Marie Karásková; Jan Rakušan; Stanislav Nešp?rek

2010-01-01

109

Gas Sensing Properties of bis-Phthalocyanine Thin Film  

NASA Astrophysics Data System (ADS)

In this study, response of the cofacial bis- phthalocyanine film to vapor of Volatile Organic Compounds (VOCs) was investigated. Test gases were vapors of acetone, toluene, ethanol and ammonia. Measurements were carried out between the temperatures of 293 K-423 K. Bis-phthalocyanine was dissolved in chloroform. Thin film of bis-phthalocyanine was deposited by spraying method on glass substrate patterned with Interdigital Transducer (IDT). During the measurements 0.5 volts were applied to the IDT. Response characteristics of the film were determined by means of change in dc conductivity as a function of gas concentration and temperature. Gas concentrations were controlled by mass flow controller. Dry nitrogen was used as carrier gas. Vapor pressure of the VOCs was calculated using Antoine equation. Response characteristics of the film were determined in a wide range of gas concentration (0.25%-18%). The film showed good sensitivity to the VOCs vapors in the measurement range. The responses of the film were reversible. All the measurement system was computerized.

Dumludag, Fatih; Kilic, Pinar; Odabas, Zafer; Altindal, Ahmet; Bekaroglu, Ozer

2010-01-01

110

Properties of liposomal membranes containing lysolecithin.  

PubMed

Liposomes have been prepared with lysolecithin (1-acyl-sn-3-glycerylphosphorylcholine), egg lecithin (3-sn-phosphatidylcholine), dicetyl phosphate, and cholesterol. The ability to function as a barrier to the diffusion of glucose marker and the sensitivities of the liposomes to hypotonic treatment and other reagents which modified the permeability were examined. Generally, lysolecithin incorporation decreased the effectiveness of the membranes as a barrier to glucose and made the membranes more "osmotically fragile." Cholesterol incorporation counteracted the effect of incorporated lysolecithin. The more cholesterol incorporated into liposomes, the more lysolecthin could be incorporated into the membrane without loss of function as a barrier. With more than 50 mole% of colesterol, lysolecithin alone could form membranes which were practically impermeable to glucose. The hemolytic activity of lysolecithin was affected by mixing with various lecithins or cholesterol. Liposomes containing lysolecithin, which have the ability to trap glucose marker, showed poor hemolytic activity, while lipid micelles with lysolecithin (which could trap little glucose) showed almost the same hemolytic activity as lysolecithin itself. There seems to be a close correlation between hemolytic activity and barrier function of lipid micelles. PMID:986392

Kitagawa, T; Inoue, K; Nojima, S

1976-06-01

111

Ultrasonic Activation of Thermally Sensitive Liposomes  

Microsoft Academic Search

Cancerous cells are known to be more vulnerable to mild hyperthermia than healthy cells, which can survive temperatures above 43° C for brief periods of time. Currently in phase III clinical trials for liver cancer, ThermoDox® (Celsion Corporation) is a drug delivery system containing doxorubicin, a common anti-cancer agent, encapsulated within a thermally sensitive liposome designed to release its contents

Eleonora Mylonopouloua; Costas D. Arvanitisa; Miriam Bazan-Peregrinoa; Manish Arora; Constantin C. Coussios

2010-01-01

112

First example of a hexadentate bicyclic phthalocyanine analogue containing a divalent metal center.  

PubMed

A reaction of 1,2-dicyanobenzene and lithium methoxide at 70 °C in methanol yielded the half-phthalocyanine intermediate, which coordinates to a cadmium(II) ion in the subsequent reaction step to give the first example of a six-coordinate phthalocyanine analogue containing a divalent metal ion at the center. PMID:24132381

Fukuda, Takamitsu; Shigeyoshi, Natsuko; Fuyuhiro, Akira; Ishikawa, Naoto

2013-12-21

113

Incorporation of phthalocyanines by cationic and anionic clays via ion exchange and direct synthesis  

Microsoft Academic Search

Phthalocyanines (Pc) and metallophthalocyanines were incorporated into the galleries of anionic and cationic clays via ion exchange and in situ crystallization of the synthetic clay layers. Intercalation compounds between the layered magnesium silicate clay hectorite and cationic phthalocyanines were directly prepared by refluxing for 2 days aqueous solutions of silica sol, magnesium hydroxide, lithium flouride, and either alcian blue dyes

K. A. Carrado; R. E. Botto; R. E. Winans; J. E. Forman

1993-01-01

114

Elastic liposomes for skin delivery of dipotassium glycyrrhizinate.  

PubMed

The aim of this study was to evaluate the possibility of using liposomes for skin delivery of dipotassium glycyrrhizinate (KG), an anti-inflammatory agent employed in treating acute and chronic dermatitis, and of formulating such liposomes in an oil-in-water emulsion (O/W). KG had emulsifying properties and the possibility of producing elastic liposomes was verified. Liposomes containing soya lecithin (PC) or hydrogenated soya lecithin (HPC) mixed with KG in w/w ratios of 2:1, 4:1 or 8:1 were prepared by the solvent evaporation method and then passed through a high pressure homogeniser. Liposome size and entrapment efficiency were determined and the interaction between KG and HPC was investigated using differential scanning calorimetry (DSC). Transepidermal permeation through intact pig skin and skin deposition of KG from liposomes and O/W emulsion containing liposomes were assessed and compared with values for aqueous control solutions. No marked differences were observed between PC and HPC liposomes. Liposome sizes ranged from 90 to 120 nm. Entrapment efficiency depended on the lipid:KG ratio; the maximum efficiency was obtained at 4:1 w/w. KG interacted with liposomes disrupting and fluidising the lipid bilayer, forming elastic liposomes able to penetrate through membrane pores of diameter much smaller than their own diameter. The liposome structure was maintained when dispersed in an O/W emulsion. The skin fluxes were less than the HPLC detection limit for all systems, while skin deposition increased 4.5-fold compared with aqueous solutions when KG was formulated in liposomes. PMID:12100859

Trotta, M; Peira, E; Debernardi, F; Gallarate, M

2002-07-25

115

Endocytosis and intracellular processing accompanying transfection mediated by cationic liposomes  

Microsoft Academic Search

Cationic liposomes mediate efficient transfection of mammalian cells, but the manner in which cells internalize and process cationic liposome-DNA complexes has not been well characterized. We exposed several cell types, including human and murine erythroleukemia cells, African green monkey kidney cells (CV-1), isolated rat alveolar type II cells and alveolar macrophages to DNA-cationic liposome complexes containing N-(1-2,3-dioleyloxypropyl)-N,N,N-triethylammonium (DOTMA) and Dioleylphosphatidylethanolamine

Daniel S Friend; Demetrios Papahadjopoulos; Robert J Debs

1996-01-01

116

Prevention of Chronic Doxorubicin Cardiotoxicity in Beagles by Liposomal Encapsulation  

Microsoft Academic Search

Antitumor drugs such as doxorubicin have been encapsulated into liposomes as a means of enhancing activity and reducing toxicity. The present study was initiated to determine whether chronically administered liposome-encapsulated doxorubicin would be less toxic than the free drug. Doxorubicin was prepared in positively charged cardiolipin liposomes, and 1.75 mg\\/kg was given i.v. to each of five beagles. A second

E. H. Herman; A. Rahman; V. J. Ferrans; J. A. Vick; P. S. Schein

117

Liposome targeting to tumors using vitamin and growth factor receptors  

Microsoft Academic Search

Liposome-encapsulated anticancer drugs reveal their potential for increased therapeutic efficacy and decreased nonspecific toxicities due to their ability to enhance the delivery of chemotherapeutic agents to solid tumors. Advances in liposome technology have resulted in the development of ligand-targeted liposomes capable of selectively increasing the efficacy of carried agents against receptor-bearing tumor cells. Receptors for vitamins and growth factors have

Daryl C. Drummond; Keelung Hong; John W. Park; Christopher C. Benz; Dmitri B. Kirpgtin

2000-01-01

118

Paramagnetic Liposome Nanoparticles for Cellular and Tumour Imaging  

PubMed Central

In this review we discuss the development of paramagnetic liposomes incorporating MRI contrast agents and show how these are utilized in cellular imaging in vitro. Bi-functional, bi-modal imaging paramagnetic liposome systems are also described. Next we discuss the upgrading of paramagnetic liposomes into bi-modal imaging neutral nanoparticles for in vivo imaging applications. We discuss the development of such systems and show how paramagnetic liposomes and imaging nanoparticles could be developed as platforms for future multi-functional, multi-modal imaging theranostic nanodevices tailor-made for the combined imaging of early stage disease pathology and functional drug delivery. PMID:20480040

Kamaly, Nazila; Miller, Andrew D.

2010-01-01

119

Stability and release of topical tranexamic acid liposome formulations.  

PubMed

Tranexamic acid (TA) has been claimed to have whitening effects. The effects of TA contents (5% and 10%) and charges on the stability and release of TA entrapped in hydrogenated soya phosphatidylcholine/cholesterol/charged lipid [dicetyl phosphate (-) or stearylamine (+)] liposomes at molar ratios of 7:2:1(-) and 7:2:1 (+) were investigated. The TA contents were determined spectrophotometrically at 415 nm, following derivatization with 2,4,6-trinitrobenzosulfonic acid. Stability and leakage of TA from liposomes were characterized at 4 degrees, 30 degrees and 45 degrees C for 90 days. The leakage rates of TA in negative liposomes were lower than those in positive liposomes. The TA in all liposome formulations was relatively stable, as > 90% of total drug remained after up to two months. The release of TA from liposomes was examined using vertical Franz diffusion cells at 37 degrees C for 24 h. The release rates of TA from all liposome formulations were approximately 3 times lower than those from solutions. Charges appeared to affect the physical stability, leakage, and shelf life of TA in liposomes, whereas TA concentrations seemed to affect the release of TA. The 7:2:1 (10% TA,-) liposome was the best formulation, due to its small size, low leakage, high stability, and prolonged and sustained release profile. PMID:12512014

Manosroi, A; Podjanasoonthon, K; Manosroi, J

2002-01-01

120

Tissue reaction after intramuscular injection of liposomes in mice.  

PubMed

Liposomes are effective carrier systems for prolonged drug release. As all other drug formulations for parenteral use, the safety of liposomal formulations should be established before clinical application. In this study, some safety aspects of intramuscularly injected (single dose) "gel-state" type liposomes and the ability of liposome encapsulation to diminish irritating effects of intramuscularly applied drugs were studied by histopathological analysis over a period of 14 days in mice. Injection of saline solution showed no tissue reaction at the injection site. Intramuscular injection of liposomes alone showed an infiltrative reaction consisting of a population of macrophages. Within this population fat cells were present. In time, the population of macrophages present at the injection site was largely replaced by loose connective tissue. Novaminsulfon (NS) injected intramuscularly in "free" form is a strongly irritating drug, causing hemorrhage, cell necrosis, inflammatory reactions and eventually fibrosis. However, NS being encapsulated in liposomes was hardly more irritating than liposomes alone. The same was true for liposome-encapsulated chloroquine and free chloroquine. When sustained-release of a drug is therapeutically desirable, the parenteral application of a liposome-encapsulated formulation can be considered for drugs, in particular for those drugs causing tissue injury at the injection site. PMID:1446954

Kadir, F; Eling, W M; Abrahams, D; Zuidema, J; Crommelin, D J

1992-10-01

121

Liposomal nanoparticles encapsulating iloprost exhibit enhanced vasodilation in pulmonary arteries  

PubMed Central

Prostacyclin analogues are standard therapeutic options for vasoconstrictive diseases, including pulmonary hypertension and Raynaud’s phenomenon. Although effective, these treatment strategies are expensive and have several side effects. To improve drug efficiency, we tested liposomal nanoparticles as carrier systems. In this study, we synthesized liposomal nanoparticles tailored for the prostacyclin analogue iloprost and evaluated their pharmacologic efficacy on mouse intrapulmonary arteries, using a wire myograph. The use of cationic lipids, stearylamine, or 1,2-di-(9Z-octadecenoyl)-3-trimethylammonium-propane (DOTAP) in liposomes promoted iloprost encapsulation to at least 50%. The addition of cholesterol modestly reduced iloprost encapsulation. The liposomal nanoparticle formulations were tested for toxicity and pharmacologic efficacy in vivo and ex vivo, respectively. The liposomes did not affect the viability of human pulmonary artery smooth muscle cells. Compared with an equivalent concentration of free iloprost, four out of the six polymer-coated liposomal formulations exhibited significantly enhanced vasodilation of mouse pulmonary arteries. Iloprost that was encapsulated in liposomes containing the polymer polyethylene glycol exhibited concentration-dependent relaxation of arteries. Strikingly, half the concentration of iloprost in liposomes elicited similar pharmacologic efficacy as nonencapsulated iloprost. Cationic liposomes can encapsulate iloprost with high efficacy and can serve as potential iloprost carriers to improve its therapeutic efficacy. PMID:25045260

Jain, Pritesh P; Leber, Regina; Nagaraj, Chandran; Leitinger, Gerd; Lehofer, Bernhard; Olschewski, Horst; Olschewski, Andrea; Prassl, Ruth; Marsh, Leigh M

2014-01-01

122

Liposomes and MTT cell viability assay: An incompatible affair.  

PubMed

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay is commonly used to evaluate the cytotoxicity potential of drugs vehicled by liposomes. However, liposome delivering drugs could produce inconsistent values of MTT absorbance. On the basis of previous experiments demonstrating the MTT affinity for lipid droplets, this paper aims to show that empty-liposomes interfere, per se, on MTT assay due to its lipidic nature. This brings into question the use of MTT testing cytotoxicity when liposomes are involved in delivering drugs. PMID:25481524

Angius, Fabrizio; Floris, Alice

2015-03-01

123

Increased Liposome Extravasation in Selected Tissues: Effect of Substance P  

NASA Astrophysics Data System (ADS)

We have used a pharmacologic mediator to open intercellular connections in selected vessels to allow liposomes to escape from the blood stream and to extravasate into tissues that have appropriate receptors. We have examined the effects of substance P (SP), a peptide known to increase vascular permeability in selected tissues, such as trachea, esophagus, and urinary bladder in rats. We used quantitative fluorescence analysis of tissues to measure two fluorescent markers, one attached to the lipid (rhodamine-phosphatidylethanolamine) and another, doxorubicin (an antitumor drug), encapsulated within the aqueous interior. We have also examined the deposition of liposomes microscopically by the use of encapsulated colloidal gold and silver enhancement. Analysis of the biochemical and morphological observations indicate the following: (i) Injection of SP produces a striking increase in both liposome labels, but only in tissues that possess receptors for SP in postcapillary venules; (ii) liposome material in these tissues has extravasated and is found extracellularly near a variety of cells beyond the endothelial layer over the first few hours; (iii) 24 h following injection of liposomes and SP, liposome material is found in these tissues, localized intracellularly in both endothelial cells and macrophages. We propose that appropriate application of tissue-specific mediators can result in liposome extravasation deep within tissues that normally do not take up significant amounts of liposomes from the blood. Such liposomes are able to carry a variety of pharmacological agents that can be released locally within selected target tissues for therapeutic purposes.

Rosenecker, Joseph; Zhang, Weiming; Hong, Keelung; Lausier, James; Geppetti, Pierangelo; Yoshihara, Shigemi; Papahadjopoulos, Demetrios; Nadel, Jay A.

1996-07-01

124

Liposomes in tissue engineering and regenerative medicine  

PubMed Central

Liposomes are vesicular structures made of lipids that are formed in aqueous solutions. Structurally, they resemble the lipid membrane of living cells. Therefore, they have been widely investigated, since the 1960s, as models to study the cell membrane, and as carriers for protection and/or delivery of bioactive agents. They have been used in different areas of research including vaccines, imaging, applications in cosmetics and tissue engineering. Tissue engineering is defined as a strategy for promoting the regeneration of tissues for the human body. This strategy may involve the coordinated application of defined cell types with structured biomaterial scaffolds to produce living structures. To create a new tissue, based on this strategy, a controlled stimulation of cultured cells is needed, through a systematic combination of bioactive agents and mechanical signals. In this review, we highlight the potential role of liposomes as a platform for the sustained and local delivery of bioactive agents for tissue engineering and regenerative medicine approaches. PMID:25401172

Monteiro, Nelson; Martins, Albino; Reis, Rui L.; Neves, Nuno M.

2014-01-01

125

Water-soluble platinum phthalocyanines as potential antitumor agents.  

PubMed

Breast cancer represents the second cause of death in the European female population. The lack of specific therapies together with its high invasive potential are the major problems associated to such a tumor. In the last three decades platinum-based drugs have been considered essential constituents of many therapeutic strategies, even though with side effects and frequent generation of drug resistance. These drugs have been the guide for the research, in last years, of novel platinum and ruthenium based compounds, able to overcome these limitations. In this work, ruthenium and platinum based phthalocyanines were synthesized through conventional techniques and their antiproliferative and/or cytotoxic actions were tested. Normal mammary gland (MCF10A) and several models of mammarian carcinoma at different degrees of invasiveness (BT474, MCF-7 and MDA-MB-231) were used. Cells were treated with different concentrations (5-100 ?M) of the above reported compounds, to evaluate toxic concentration and to underline possible dose-response effects. The study included growth curves made by trypan blue exclusion test and scratch assay to study cellular motility and its possible negative modulation by phthalocyanine. Moreover, we investigated cell cycle and apoptosis through flow cytometry and AMNIS Image Stream cytometer. Among all the tested drugs, tetrasulfonated phthalocyanine of platinum resulted to be the molecule with the best cytostatic action on neoplastic cell lines at the concentration of 30 ?M. Interestingly, platinum tetrasulfophtalocyanine, at low doses, had no antiproliferative effects on normal cells. Therefore, such platinum complex, appears to be a promising drug for mammarian carcinoma treatment. PMID:24699848

Bologna, Giuseppina; Lanuti, Paola; D'Ambrosio, Primiano; Tonucci, Lucia; Pierdomenico, Laura; D'Emilio, Carlo; Celli, Nicola; Marchisio, Marco; d'Alessandro, Nicola; Santavenere, Eugenio; Bressan, Mario; Miscia, Sebastiano

2014-06-01

126

Sterilization of Liposomes by Heat Treatment  

Microsoft Academic Search

Autoclaving of liposomes composed of egg phospholipids or saturated phospholipids, the latter sometimes combined with cholesterol, was performed in an isotonic acetate buffer (pH 4.0) or Hepes buffer (pH 7.4). After a standard autoclaving cycle (15 min, 121°C), no change could be observed in pH, size, and extent of oxidation. Dependent on the experimental conditions, a minor or substantial increase

Nicolaas J. Zuidam; Stephen S. L. Lee; Daan J. A. Crommelin

1993-01-01

127

Photoluminescence of nitro-substituted europium (III) phthalocyanines  

SciTech Connect

Europium monophthalocyanine Eu(acac)Pc, europium monotetranitrophthalocyanine Eu(acac)Pc(NO{sub 2}){sub 4}, and heteroleptic europium tetranitrobisphthalocyanine Eu(Pc)(Pc(NO{sub 2}){sub 4}) are synthesized. The spectral characteristics of the phthalocyanine complexes in the visible and near-infrared regions are studied. The photoluminescence spectra are recorded. The luminescence bands are detected in the regions 450-500 nm (S{sub 2} {yields} S{sub 0}) and 670-730 nm (S{sub 1} {yields} S{sub 0}). The peaks are attributed to electronic transitions in the organic ligands.

Ziminov, A. V., E-mail: ziminov@inbox.ru; Polevaya, Yu. A.; Jourre, T. A.; Ramsh, S. M. [St. Petersburg State Institute of Technology (Technical University) (Russian Federation); Mezdrogina, M. M. [Russian Academy of Sciences, Ioffe Physical Technical Institute (Russian Federation); Poletaev, N. K. [St. Petersburg State Institute of Technology (Technical University) (Russian Federation)

2010-08-15

128

Conduction processes in tin- and silicon-phthalocyanine thin films  

SciTech Connect

Electronic conduction studies have been carried out on evaporated tin- and silicon-phthalocyanine thin films. The samples showed carrier excitation via a field-lowering mechanism with a logJ{alpha}V {sup 1/2} plot and the current density-voltage (J-V) characteristics were studied. Both polarities showed two characteristic regions in the J-V plots at low and high voltages respectively leading to the conclusion that electrical conduction proceeds via Schottky and Poole-Frenkel emission.

Flores Gracia, F. [Centro de Investigaciones en Dispositivos Semiconductores, Instituto de Ciencias, Benemerita Universidad Autonoma de Puebla, A. P. 1651, Puebla, Pue. 72000 Mexico (Mexico)]. E-mail: fjflor@siu.buap.mx; Sosa Sanchez, A. [Centro de Investigaciones en Dispositivos Semiconductores, Instituto de Ciencias, Benemerita Universidad Autonoma de Puebla, A. P. 1651, Puebla, Pue. 72000 (Mexico); Sosa Sanchez, J. Luis [Centro de Investigaciones en Dispositivos Semiconductores, Instituto de Ciencias, Benemerita Universidad Autonoma de Puebla, A. P. 1651, Puebla, Pue. 72000 (Mexico)

2007-08-15

129

Spectroscopic and microscopic investigations of phthalocyanine aggregates on Gold(111)  

NASA Astrophysics Data System (ADS)

Self-assembled organic pi systems are of interest because of their potential applications in light harvesting and electron transfer. Phthalocyanines (Pc) demonstrate desirable photonic and electronic properties, thus making them excellent candidates for functional nanostructures. The specific focus of this research has been the nanoscale aggregation of a metal-free organic dye, tetrasulfonic acid phthalocyanine (TSPc) and includes the use of UV-visible Spectroscopy, Resonance Light Scattering Spectroscopy (RLS), X-ray Photoelectron Spectroscopy (XPS), Atomic Force Microscopy (AFM) and ambient and ultra-high-vacuum Scanning Tunneling Microscopy (STM) and Scanning Tunneling Spectroscopy (STS). The UV-visible absorption studies show that TSPc aggregates upon dissolution in water and obeys Beer's Law within the concentration range of 10 -7M to 10-4M, indicating that TSPc concentration has no further effect on aggregation in aqueous solution. In addition, both ionic strength in NaCl and pH changes in the presence of NaOH, HCl or acetic acid (HAc) do affect aggregation. The RSL studies confirm these effects of pH only in the presence of HAc. The XPS studies show that the ratio of non-protonated to protonated nitrogens does not change with decreasing solution pH. STM images of TSPc deposited from pH<1 solutions reveal ordered branched web-like assemblies hundreds of nanometers in length, generally 2 nm tall and having variable widths. STM imaging shows TSPc aggregates decrease in order as pH increases. STM images of TSPc deposited from solutions with pH>10 show monolayer coverage of TSPc in salt form. High-resolution UHV-STM images of TSPc aggregates deposited from pH 0 solution on Au(111) reveal detailed coherent columnar architecture with the phthalocyanine macrocycles orientated parallel to the substrate surface. OMTS was used to identify the HOMO and LUMO of the TSPc aggregates and the results are contrasted with the same molecular states in unsubstituted metallated phthalocyanines (MPc). The positions of the filled and the empty states of the TSPc are comparable to those of other unsubstituted MPc's indicating that the electronegative sulfonate substituents have minimal effect on the electronic properties of the macrocycle. The HOMO-LUMO separation of TSPc is slightly above 2 eV, a value consistent with the literature assignments for the Pc ring band gap.

Nishida, Krista Rachel Akiko

130

Structural study of monolayer cobalt phthalocyanine adsorbed on graphite  

E-print Network

We present microscopic investigations on the two-dimensional arrangement of cobalt phthalocyanine molecules on a graphite (HOPG) substrate in the low coverage regime. The initial growth and ordering of molecular layers is revealed in high resolution scanning tunneling microscopy (STM). On low coverages single molecules orient mostly along one of the substrate lattice directions, while they form chains at slightly higher coverage. Structures with two different unit cells can be found from the first monolayer on. A theoretical model based on potential energy calculations is presented, which relates the two phases to the driving ordering forces.

Scheffler, M; Baumann, D; Schlegel, R; Hänke, T; Toader, M; Büchner, B; Hietschold, M; Hess, C

2014-01-01

131

Origin of the band dispersion in a metal phthalocyanine crystal  

NASA Astrophysics Data System (ADS)

Understanding the crystal structure and electronic states of the organic semiconductor is of fundamental importance for developing the materials for the organic electronics. However, the theoretical treatment of organic semiconductors remains challenging, as the semilocal density functional theory fails to describe the dispersion forces accurately. We use van der Waals inclusive density functionals to study the zinc phthalocyanine polymorphs. It is found that the structure and energetics are well described with the van der Waals density functional, and as a result, the electronic band structure is nicely reproduced. Furthermore, we reveal that the distance between the molecules and the molecule tilt angle are important factors that determine the electronic band dispersion.

Yanagisawa, Susumu; Yamauchi, Kunihiko; Inaoka, Takeshi; Oguchi, Tamio; Hamada, Ikutaro

2014-12-01

132

Influence of Quil A on liposomal membranes.  

PubMed

Quil A is the purified saponin fraction extracted from the bark of Quillaja saponaria Molina. Besides its utilisation as a surfactant, it is commonly used in a pseudo-ternary system with cholesterol and phospholipid to form colloidal structures known as ISCOMs (immunostimulating complexes). Their appropriateness as immune stimulating drug carriers has been widely demonstrated, albeit the evaluation of physico-chemical properties of the ISCOM matrix still draws a heterogeneous picture. The aim of our study was to elucidate the effects of Quil A on liposomal phosphatidylcholine/cholesterol dispersions as this interaction is regarded as the major step for the formation of the ISCOM matrix. Transmission electron microscopy was applied to observe structural changes of liposomal dispersions upon addition of Quil A. A formation of ISCOM matrices readily out of the liposomal membrane was proven. The entrapment efficiency (EE) of Arsenazo III as well as differential thermal analysis (DSC) also demonstrated an interaction between the components above a critical concentration of Quil A. To further clarify the effects of interaction, Langmuir trough experiments of insoluble monolayers of both cholesterol and PC and their interaction with Quil A were performed. Measurable effects even below the critical concentration of Quil A (derived from DSC and EE) were shown. Cholesterol had a major impact on the formation and stabilisation of the ISCOM matrix. PMID:25107288

Paepenmüller, T; Müller-Goymann, C C

2014-11-20

133

Phototriggerable Liposomes: Current Research and Future Perspectives  

PubMed Central

The field of cancer nanomedicine is considered a promising area for improved delivery of bioactive molecules including drugs, pharmaceutical agents and nucleic acids. Among these, drug delivery technology has made discernible progress in recent years and the areas that warrant further focus and consideration towards technological developments have also been recognized. Development of viable methods for on-demand spatial and temporal release of entrapped drugs from the nanocarriers is an arena that is likely to enhance the clinical suitability of drug-loaded nanocarriers. One such approach, which utilizes light as the external stimulus to disrupt and/or destabilize drug-loaded nanoparticles, will be the discussion platform of this article. Although several phototriggerable nanocarriers are currently under development, I will limit this review to the phototriggerable liposomes that have demonstrated promise in the cell culture systems at least (but not the last). The topics covered in this review include (i) a brief summary of various phototriggerable nanocarriers; (ii) an overview of the application of liposomes to deliver payload of photosensitizers and associated technologies; (iii) the design considerations of photoactivable lipid molecules and the chemical considerations and mechanisms of phototriggering of liposomal lipids; (iv) limitations and future directions for in vivo, clinically viable triggered drug delivery approaches and potential novel photoactivation strategies will be discussed. PMID:24662363

Puri, Anu

2013-01-01

134

Liposomal nanoparticles as a drug delivery vehicle against osteosarcoma  

NASA Astrophysics Data System (ADS)

The delivery of curcumin, a broad-spectrum anticancer drug, has been explored in the form of liposomal nanoparticles to treat osteosarcoma (OS). Curcumin is water insoluble and an effective delivery route is through encapsulation in cyclodextrins followed by a second encapsulation in liposomes. Liposomal curcumin's potential was evaluated against cancer models of mesenchymal (OS) and epithelial origin (breast cancer). The resulting 2-Hydroxypropyl-gamma-cyclodextrin/curcumin - liposome complex shows promising anticancer potential both in vitro and in vivo against KHOS OS cell line and MCF-7 breast cancer cell line. An interesting aspect is that liposomal curcumin initiates the caspase cascade that leads to apoptotic cell death in vitro in comparison with DMSO-curcumin induced autophagic cell death. In addition, the efficiency of the liposomal curcumin formulation was confirmed in vivo using a xenograft OS model. Curcumin-loaded gamma-cyclodextrin liposomes indicate significant potential as delivery vehicles for the treatment of cancers of different tissue origin. The second part of this study examines the anti-tumor potential of curcumin and C6 ceramide (C6) against osteosarcoma cell lines when both are encapsulated in the bilayer of liposomal nanoparticles. Curcumin in combination with C6 showed 1.5 times enhanced cytotoxic effect in the case of MG-63 and KHOS OS cell lines, in comparison with systems with curcumin alone. Interestingly, C6-curcumin liposomes were found to be less toxic on untransformed human cells in comparison to OS cell lines. In addition, cell cycle assays on a KHOS cell line after treatment revealed that curcumin only liposomes induced G 2/M arrest by upregulation of cyclin B1, while C6 only liposomes induced G1 arrest by downregulation of cyclin D1. C6-curcumin liposomes induced G2/M arrest and showed a combined effect in the expression levels of cyclin D1 and cyclin B1. Using pegylated liposomes to increase the plasma half-life and tagging with folate for targeted delivery in vivo, a significant reduction in tumor size was observed with C6-curcumin-folate liposomes. The encapsulation of two water insoluble drugs, curcumin and C6, in the lipid bilayer of liposomes enhances the cytotoxic effect and validates the potential of combined drug therapy.

Dhule, Santosh Subhashrao

135

Binding of Diphtheria Toxin to Phospholipids in Liposomes  

NASA Astrophysics Data System (ADS)

Diphtheria toxin bound to the phosphate portion of some, but not all, phospholipids in liposomes. Liposomes consisting of dimyristoyl phosphatidylcholine and cholesterol did not bind toxin. Addition of 20 mol% (compared to dimyristoyl phosphatidylcholine) of dipalmitoyl phosphatidic acid, dicetyl phosphate, phosphatidylinositol phosphate, cardiolipin, or phosphatidylserine in the liposomes resulted in substantial binding of toxin. Inclusion of phosphatidylinositol in dimyristol phosphatidylcholine / cholesterol liposomes did not result in toxin binding. The calcium salt of dipalmitoyl phosphatidic acid was more effective than the sodium salt, and the highest level of binding occurred with liposomes consisting only of dipalmitoyl phosphatidic acid (calcium salt) and cholesterol. Binding of toxin to liposomes was dependent on pH, and the pattern of pH dependence varied with liposomes having different compositions. Incubation of diphtheria toxin with liposomes containing dicetyl phosphate resulted in maximal binding at pH 3.6, whereas binding to liposomes containing phosphatidylinositol phosphate was maximal above pH 7. Toxin did not bind to liposomes containing 20 mol% of a free fatty acid (palmitic acid) or a sulfated lipid (3-sulfogalactosylceramide). Toxin binding to dicetyl phosphate or phosphatidylinositol phosphate was inhibited by UTP, ATP, phosphocholine, or p-nitrophenyl phosphate, but not by uracil. We conclude that (a) diphtheria toxin binds specifically to the phosphate portion of certain phospholipids, (b) binding to phospholipids in liposomes is dependent on pH, but is not due only to electrostatic interaction, and (c) binding may be strongly influenced by the composition of adjacent phospholipids that do not bind toxin. We propose that a minor membrane phospholipid (such as phosphatidylinositol phosphate or phosphatidic acid), or that some other phosphorylated membrane molecule (such as a phosphoprotein) may be important in the initial binding of diphtheria toxin to cells.

Alving, Carl R.; Iglewski, Barbara H.; Urban, Katharine A.; Moss, Joel; Richards, Roberta L.; Sadoff, Jerald C.

1980-04-01

136

Modification of liposomes by addition of HCO60. I. Targeting of liposomes to liver by addition of HCO60 to liposomes.  

PubMed

The influence of HCO60 on the blood clearance and tissue distribution of soybean phosphatidylcholine (PC) liposomes, encapsulating alpha-tocopherol as a marker, was studied in rats. The liposomes were prepared by the hydration method from a lipid film containing different amounts of HCO60, and by extrusion through a 0.1 micron polycarbonate membrane filter. The blood clearance and liver uptake of alpha-tocopherol after i.v. administration increased with increasing the amount of HCO60 the liposome contained. With 80 wt% HCO60 liposomes, the accumulation of alpha-tocopherol in the liver was approximately three-fold that of the 100% PC liposomes. The uptake by lungs, spleen and kidneys did not change with the addition of HCO60. The findings obtained in a gel-filtration study suggested that alpha-tocopherol is not removed from the liposomes, with or without HCO60, by rat plasma proteins and the HCO60 micelle may form a complex with rat plasma proteins. Our findings suggest that liposomes containing large amounts of HCO60 (more than 60 wt%) will be useful for delivering drug to the liver. PMID:8287045

Kato, Y; Watanabe, K; Hosokawa, T; Hayakawa, E; Ito, K

1993-10-01

137

Elastic liposomes-in-vehicle formulations destined for skin therapy: the synergy between type of liposomes and vehicle.  

PubMed

Abstract Objective: The present study is focused on optimization of elastic liposomes-in-vehicle formulations in respect to drug release and formulation properties. By combining penetration potential of elastic liposomes containing high ratio of entrapped drug and physicochemical properties of vehicles, both affecting the release and texture properties, optimal formulation could be achieved. Materials and methods: Deformable, propylene glycol-containing or conventional liposomes with hydrophilic model drug (diclofenac sodium) were incorporated into the following vehicles appropriate for skin application: a hydrogel, a cream base and derma membrane structure base cream (DMS base). Each formulation was assessed for in vitro drug release and mechanical properties. Results and discussion: The composition and type of both liposomes and the vehicle affected the rate and amount of the released drug. The cream base exhibited the slowest release, followed by the hydrogel and DMS base. Similar release profiles were achieved with both types of elastic vesicles (deformable and propylene glycol liposomes); the slowest release was observed for conventional liposomes, regardless of the vehicle used. The drug release profiles from different liposomes-in-vehicle formulations were in agreement with the physicochemical properties of the formulations. All of the liposomes were found to be compatible with the hydrogel preserving its original textures, whereas a significant decrease in all texture parameters was observed for liposomes-in-DMS base, regardless of liposome type. Conclusion: Propylene glycol liposomes-in-hydrogel is considered as the optimal formulation for improving skin delivery of hydrophilic drug. Further investigations involving in vivo animal studies are necessary to confirm its applicability in skin therapy. PMID:25019501

Palac, Zora; Hurler, Julia; Skalko-Basnet, Nataša; Filipovi?-Gr?i?, Jelena; Vani?, Zeljka

2014-07-14

138

The first excited states of platinum phthalocyanine in magnetic fields  

NASA Astrophysics Data System (ADS)

A Zeeman study of platinum phthalocyanine in Shpol'skii matrices was performed in the temperature range of 25-77 K with magnetic fields up to ˜6·3 Tesla (T). The general phosphorescence region (950-945 nm) exhibited only one principal peak whose position is not affected by the field. An extremely weak structure that is energetically about 26 cm-1 lower than the principal peak and which originally was attributed to a different crystal site turned out to be a genuine field dependent collective response of weakly radiating spin-levels. The weakness of the radiation from these levels and the size of the subsequently confirmed zero field splitting D parameter are a unique case among all porphyrins and phthalocyanines studied to date in magnetic fields. For the first time the coefficients of the 5d (zx and yz) AO of PtPc in the egx LCAO MO were experimentally determined to be about 0·18. The Zeeman effect of the first ?-?* absorption, in terms of phosphorescence excitation, was also investigated in approximately the same temperature and field range. An apparent angular momentum of ?' ? 3.6? was deduced from the Zeeman energy in the components of the 1Eu state lifted by the crystal field. ?', in turn, gives rise to an orbital reduction factor q ? 0·9 which implies a fairly weak Jahn-Teller coupling, similar to but weaker than that found earlier in PdPc.

Chen, Wen-Hsiung; Rieckhoff, Klaus E.; Voigt, Eva-Maria

139

Rational design of a zinc phthalocyanine binding protein.  

PubMed

Phthalocyanines have long been used as primary donor molecules in synthetic light-powered devices due to their superior properties when compared to natural light activated molecules such as chlorophylls. Their use in biological contexts, however, has been severely restricted due to their high degree of self-association, and its attendant photoquenching, in aqueous environments. To this end we report the rational redesign of a de novo four helix bundle di-heme binding protein into a heme and Zinc(II) phthalocyanine (ZnPc) dyad in which the ZnPc is electronically and photonically isolated. The redesign required transformation of the homodimeric protein into a single chain four helix bundle and the addition of a negatively charge sulfonate ion to the ZnPc macrocycle. To explore the role of topology on ZnPc binding two constructs were made and the resulting differences in affinity can be explained by steric interference of the newly added connecting loop. Singular binding of ZnPc was verified by absorption, fluorescence, and magnetic circular dichroism spectroscopy. The engineering guidelines determined here, which enable the simple insertion of a monomeric ZnPc binding site into an artificial helical bundle, are a robust starting point for the creation of functional photoactive nanodevices. PMID:23827257

Mutter, Andrew C; Norman, Jessica A; Tiedemann, Michael T; Singh, Sunaina; Sha, Sha; Morsi, Sara; Ahmed, Ismail; Stillman, Martin J; Koder, Ronald L

2014-02-01

140

Electrophoretic deposition of phthalocyanine in organic solutions containing trifluoroacetic acid.  

PubMed

The absorption spectra of copper phthalocyanine (CuPc) 1,2-dichloroethane (DCE) solutions containing trifluoroacetic acid (TFAA) shows that the number of protons coordinating to the CuPc molecule was 1 and 2 for the first and second proton adducts, respectively, which indicates the formations of CuPcH(+) and CuPcH(2)(2+). This CuPc molecule may act as a catalyst to dissociate TFAA into trifluoroacetate anion (A(-)) and H(+) and form the proton adducts. The electrical conductivity dependence of the solution on CuPc concentration also supports this mechanism. A dense film of CuPc was deposited on an indium tin oxide cathode plate by electrophoresis of the solution. Similar dense films of a wide variety of phthalocyanines (MPc; M = Cu, H(2), Fe, Ni, Zn, Pb, VO) were also deposited using this method. Similar films of CuPc were also formed using dichloromethane (DCM) and 1,1,1-trichloroethane (TCE) in place of DCE. Depositions are ascribed to the migration of positively charged monomers (i.e., protonated MPc). Scanning electron microscopy revealed that these films are composed of fibrous crystallites, size of which was found to increase with the electrophoresis time, the strength of the applied electrical field and the concentration of CuPc in the bath. The influence of the dielectric constant of the organic solvent on the film growth is discussed. PMID:20886893

Shrestha, Nabeen K; Kohn, Hideki; Imamura, Mitsuharu; Irie, Kazunobu; Ogihara, Hitoshi; Saji, Tetsuo

2010-11-16

141

Hydrophobic drug concentration affects the acoustic susceptibility of liposomes.  

PubMed

The purpose of this study was to investigate the effect of encapsulated hydrophobic drug concentration on ultrasound-mediated leakage from liposomes. Studies have shown that membrane modifications affect the acoustic susceptibility of liposomes, likely because of changes in membrane packing. An advantage of liposome as drug carrier is its ability to encapsulate drugs of different chemistries. However, incorporation of hydrophobic molecules into the bilayer may cause changes in membrane packing, thereby affecting the release kinetics. Liposomes containing calcein and varying concentrations of papaverine, a hydrophobic drug, were exposed to 20kHz, 2.2Wcm(-2) ultrasound. Papaverine concentration was observed to affect calcein leakage although the effects varied widely based on liposome phase. For example, incorporation of 0.5mg/mL papaverine into Ld liposomes increased the leakage of hydrophilic encapsulants by 3× within the first minute (p=0.004) whereas the same amount of papaverine increased leakage by only 1.5× (p<0.0001). Papaverine was also encapsulated into echogenic liposomes and its concentration did not significantly affect calcein release rates, suggesting that burst release from echogenic liposomes is predictable regardless of encapsulants chemistry and concentration. PMID:25450487

Nguyen, An T; Lewin, Peter A; Wrenn, Steven P

2015-04-01

142

Structural properties of liposomes from digital holographic microscopy  

NASA Astrophysics Data System (ADS)

We have constructed liposomes from L alpha Phosphatidylcholine (PC) lipids, which are biomimetic lipids similar to those present in the membranes of mammalian cells. We propose an advance in the use of liposomes, such as for drug delivery, to incorporate into the liposomal membranes transport proteins that have been extracted from the lipid membranes of mammalian cells. In this paper, we describe the usage of a novel optical microscope to characterize the nanomechanical properties of these liposomes. We have applied the technique of digital holographic microscopy, using an instrument recently developed at the University of Münster, Germany. This system enabled us to measure quantitatively the structural changes in liposomes. We have investigated the deformations of these biomimetic lipids comprising these liposomes by applying osmotic stresses, in order to gain insight into the membrane environment prior to incorporation of cloned membrane transport proteins. This control of the nanomechanical properties is important in the stresses transmitted to mechanosensitive ion channels that we have incorporated into the liposomal membranes. These liposomes provide transporting vesicles that respond to mechanical stresses, such as those that occur during implantation.

Di Maio, Isabelle L.; Carl, Daniel; Langehanenberg, Patrik; Valenzuela, Stella M.; Battle, Andrew R.; Al Khazaaly, Sabah; Killingsworth, Murray; Kemper, Bjorn; von Bally, Gert; Martin, Donald K.

2006-01-01

143

Enhanced efficacy of anti-tumor liposomal doxorubicin by hyperthermia  

Microsoft Academic Search

The efficiency of novel tumor chemotherapeutics could be increased using targeted drug delivery by hyperthermia. In this paper, the 3D liposomal doxorubicin distribution in the tumor tissue enhanced by local hyperthermia was quantitatively studied in real time using laser confocal microscopy. Results showed that the thermally induced liposomal doxorubicin extravasation was non-uniform and more excessive in the peripheral region than

Ping Liu; Lisa Xuemin Xu; Aili Zhang

2006-01-01

144

Review article Impact of liposomes as delivery systems  

E-print Network

that make them an almost ideal delivery system. They are biodegra- dable, with few side effects, can deliver, and cancer. They have also been proven useful as immunoadjuvants and vaccines. Liposomes are used in certain avian vaccines. The possible uses of liposomes and their impact in veterinary medicine in the treatment

Paris-Sud XI, Université de

145

Development of liposome encapsulated clindamycin for treatment of acne vulgaris.  

PubMed

The enhancement of topical delivery of hydrophilic substances by use of multilammelar liposomes was measured ex vivo on pig ear skin and in vivo on hairless mice by electron paramagnetic resonance method (EPR). Multilamellar liposomes with different lipid composition (final concentration of membrane components is 48 mg/ml) were loaded with a hydrophilic spin probe GluSL, which does not penetrate the liposome membrane easily. They were characterized with respect to their stability, entrapped volume and enhancement characteristics. We observed significant differences in the properties of different types of liposomes with respect to their stability when in contact with the skin and their penetration into the skin. The results measured in vivo are consistent with those obtained ex vivo. On the basis of these findings the liposomes with appropriate stability and intradermal penetration characteristics were chosen for the development of liposome-encapsulated 1% clindamycin preparation for therapy of acne vulgaris. A double-blind clinical study was conducted to assess the safety and efficiency of liposome-encapsulated 1% clindamycin solution versus 1% clindamycin solution (Klimicin T, Lek). On the basis of the clinical trial it may be concluded that liposome-encapsulated 1% clindamycin solution was therapeutically superior over conventional 1% clindamycin solution in the treatment of acne vulgaris. PMID:11005607

Honzak, L; Sentjurc, M

2000-01-01

146

Nanoengineered Structures for Holding and Manipulating Liposomes and Cells  

E-print Network

Nanoengineered Structures for Holding and Manipulating Liposomes and Cells Clyde F. Wilson, Garth J exceptional stability in capturing, transporting, and releasing single cells and liposomes 1-12 µm in diameter incorporated into individual cells by elec- troporation, after which nearly all the medium (hundreds

Zare, Richard N.

147

Hydrogel Containing Nanoparticle-Stabilized Liposomes for Topical Antimicrobial Delivery  

PubMed Central

Adsorbing small charged nanoparticles onto the outer surfaces of liposomes has become an effective strategy to stabilize liposomes against fusion prior to “seeing” target bacteria, yet allow them to fuse with the bacteria upon arrival at the infection sites. As a result, nanoparticle-stabilized liposomes have become an emerging drug delivery platform for treatment of various bacterial infections. To facilitate the translation of this platform for clinical tests and uses, herein we integrate nanoparticle-stabilized liposomes with hydrogel technology for more effective and sustained topical drug delivery. The hydrogel formulation not only preserves the structural integrity of the nanoparticle-stabilized liposomes, but also allows for controllable viscoeleasticity and tunable liposome release rate. Using Staphylococcus aureus bacteria as a model pathogen, we demonstrate that the hydrogel formulation can effectively release nanoparticle-stabilized liposomes to the bacterial culture, which subsequently fuse with bacterial membrane in a pH-dependent manner. When topically applied onto mouse skin, the hydrogel formulation does not generate any observable skin toxicity within a 7-day treatment. Collectively, the hydrogel containing nanoparticle-stabilized liposomes hold great promise for topical applications against various microbial infections. PMID:24483239

2015-01-01

148

Liposomal drug delivery systems: from concept to clinical applications.  

PubMed

The first closed bilayer phospholipid systems, called liposomes, were described in 1965 and soon were proposed as drug delivery systems. The pioneering work of countless liposome researchers over almost 5 decades led to the development of important technical advances such as remote drug loading, extrusion for homogeneous size, long-circulating (PEGylated) liposomes, triggered release liposomes, liposomes containing nucleic acid polymers, ligand-targeted liposomes and liposomes containing combinations of drugs. These advances have led to numerous clinical trials in such diverse areas as the delivery of anti-cancer, anti-fungal and antibiotic drugs, the delivery of gene medicines, and the delivery of anesthetics and anti-inflammatory drugs. A number of liposomes (lipidic nanoparticles) are on the market, and many more are in the pipeline. Lipidic nanoparticles are the first nanomedicine delivery system to make the transition from concept to clinical application, and they are now an established technology platform with considerable clinical acceptance. We can look forward to many more clinical products in the future. PMID:23036225

Allen, Theresa M; Cullis, Pieter R

2013-01-01

149

Liposomal resiquimod for the treatment of Leishmania donovani infection  

PubMed Central

Objectives The imidazoquinoline family of drugs are Toll-like receptor 7/8 agonists that have previously been used in the treatment of cutaneous leishmaniasis. Because of the hydrophobic nature of imidazoquinolines, they are traditionally not administered systemically for the treatment of visceral leishmaniasis. We formulated liposomal resiquimod, an imidazoquinoline, for the systemic treatment of visceral leishmaniasis. Methods By using lipid film hydration with extrusion, we encapsulated resiquimod in liposomes. These liposomes were then injected intravenously to treat BALB/c mice infected with Leishmania donovani. Results Treatment with liposomal resiquimod significantly decreased the parasite load in the liver, spleen and bone marrow. In addition, resiquimod treatment increased interferon-? and interleukin-10 production in an antigen recall assay. Resiquimod was shown to be non-toxic in histology and in vitro culture experiments. Conclusions FDA-approved resiquimod, in a liposomal formulation, displays promising results in treating visceral leishmaniasis. PMID:23956375

Peine, Kevin J.; Gupta, Gaurav; Brackman, Deanna J.; Papenfuss, Tracey L.; Ainslie, Kristy M.; Satoskar, Abhay R.; Bachelder, Eric M.

2014-01-01

150

Shrinkage of pegylated and non-pegylated liposomes in serum  

PubMed Central

An essential requisite for the design of nanodelivery systems is the ability to characterize the size, homogeneity and zeta potential of nanoparticles. Such properties can be tailored in order to create the most efficient drug delivery platforms. An important question is whether these characteristics change upon systemic injection. Here, we have studied the behavior of phosphatidylcholine/cholesterol liposomes exposed to serum proteins. The results reveal a serum-induced reduction in the size and homogeneity of both pegylated and non-pegylated liposomes, implicating the possible role of osmotic forces. In addition, changes to zeta-potential were observed upon exposing liposomes to serum. The liposomes with polyethylene glycol expressed different characteristics than their non-polymeric counterparts, suggesting the potential formation of a denser protein corona around the non-pegylated liposomes. PMID:24216620

Wolfram, Joy; Suri, Krishna; Yang, Yong; Shen, Jianliang; Celia, Christian; Fresta, Massimo; Zhao, Yuliang; Shen, Haifa; Ferrari, Mauro

2013-01-01

151

Recent Developments in Liposome-Based Veterinary Therapeutics  

PubMed Central

Recent advances in nanomedicine have been studied in the veterinary field and have found a wide variety of applications. The past decade has witnessed a massive surge of research interest in liposomes for delivery of therapeutic substances in animals. Liposomes are nanosized phospholipid vesicles that can serve as delivery platforms for a wide range of substances. Liposomes are easily formulated, highly modifiable, and easily administered delivery platforms. They are biodegradable and nontoxic and have long in vivo circulation time. This review focuses on recent and ongoing research that may have relevance for veterinary medicine. By examining the recent developments in liposome-based therapeutics in animal cancers, vaccines, and analgesia, this review depicts the current significance and future directions of liposome-based delivery in veterinary medicine. PMID:24222862

2013-01-01

152

Shrinkage of pegylated and non-pegylated liposomes in serum.  

PubMed

An essential requisite for the design of nanodelivery systems is the ability to characterize the size, homogeneity and zeta potential of nanoparticles. Such properties can be tailored in order to create the most efficient drug delivery platforms. An important question is whether these characteristics change upon systemic injection. Here, we have studied the behavior of phosphatidylcholine/cholesterol liposomes exposed to serum proteins. The results reveal a serum-induced reduction in the size and homogeneity of both pegylated and non-pegylated liposomes, implicating the possible role of osmotic forces. In addition, changes to zeta-potential were observed upon exposing liposomes to serum. The liposomes with polyethylene glycol expressed different characteristics than their non-polymeric counterparts, suggesting the potential formation of a denser protein corona around the non-pegylated liposomes. PMID:24216620

Wolfram, Joy; Suri, Krishna; Yang, Yong; Shen, Jianliang; Celia, Christian; Fresta, Massimo; Zhao, Yuliang; Shen, Haifa; Ferrari, Mauro

2014-02-01

153

Electromagnetic field triggered drug and chemical delivery via liposomes  

DOEpatents

The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release the chemical agent from the liposomes at a temperature of between about +10 and 65 C. The invention further relates to the use of the liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.

Liburdy, R.P.

1993-03-02

154

Electromagnetic field triggered drug and chemical delivery via liposomes  

DOEpatents

The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release said chemical agent from the liposomes at a temperature of between about +10 and 65.degree. C. The invention further relates to the use of said liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.

Liburdy, Robert P. (1820 Mountain View Rd., Tiburon, CA 94920)

1993-01-01

155

Enhanced antitumor effect of novel dual-targeted paclitaxel liposomes  

NASA Astrophysics Data System (ADS)

A novel dual-targeted peptide containing an alpha V integrins specific ligand and a neuropilin-1 specific motif was developed which showed an increased specific targeting affinity to tumors. Active dual-targeted liposomes were then produced with this peptide and exhibited greater binding activity than single-targeted liposomes in vitro. Paclitaxel entrapped in this formulation greatly increased the uptake of paclitaxel in the targeting cells and significantly suppressed the growth of HUVEC and A549 cells compared with general paclitaxel injections (Taxol) and single-targeted paclitaxel liposomes. The treatment of tumor xenograft models with dual-targeted paclitaxel liposomes also resulted in better tumor growth inhibition than any other treatment groups. Therefore, the dual-targeted paclitaxel liposomes prepared in the present study might be a more promising drug for cancer treatment. Furthermore, the dual-targeting approach may produce synergistic effects that can be applied in the development of new targeted drug delivery systems.

Meng, Shuyan; Su, Bo; Li, Wei; Ding, Yongmei; Tang, Liang; Zhou, Wei; Song, Yin; Li, Heyan; Zhou, Caicun

2010-10-01

156

Ligand-targeted liposome design: challenges and fundamental considerations.  

PubMed

Nanomedicine, particularly liposomal drug delivery, has expanded considerably over the past few decades, and several liposomal drugs are already providing improved clinical outcomes. Liposomes have now progressed beyond simple, inert drug carriers and can be designed to be highly responsive in vivo, with active targeting, increased stealth, and controlled drug-release properties. Ligand-targeted liposomes (LTLs) have the potential to revolutionize the treatment of cancer. However, these highly engineered liposomes generate new problems, such as accelerated clearance from circulation, compromised targeting owing to non-specific serum protein binding, and hindered tumor penetration. This article highlights recent challenges facing LTL strategies and describes the advanced design elements used to circumvent them. PMID:24210498

Noble, Gavin T; Stefanick, Jared F; Ashley, Jonathan D; Kiziltepe, Tanyel; Bilgicer, Basar

2014-01-01

157

Influence of liposome charge and composition on their interaction with human blood serum proteins  

Microsoft Academic Search

Lipid composition and specially their electrostatic properties, were found to greatly influence the stability of liposomes in human blood serum. The amount and type of serum proteins bound to the liposomes were also clearly influenced by lipid composition and charge of liposomes. a good correlation was found between the amount of serum proteins adsorbed to a given type of liposome

Trinidad Hernfindez-Caselles; José Villalaín; Juan C. Gómez-Fernández

1993-01-01

158

Comparative study of novel ultradeformable liposomes: menthosomes, transfersomes and liposomes for enhancing skin permeation of meloxicam.  

PubMed

In the present study, novel ultradeformable liposomes (menthosomes; MTS), deformable liposomes (transfersomes; TFS) and conventional liposomes (CLP) were compared in their potential for transdermal delivery of meloxicam (MX). MTS, TFS and CLP were investigated for size, size distribution, zeta potential, elasticity, entrapment efficiency and stability. In vitro skin permeation using hairless mice skin was evaluated. Vesicular morphology was observed under freeze-fractured transmission electron microscopy (FF-TEM). Intrinsic thermal properties were performed using differential scanning calorimetry (DSC) and X-ray diffraction. The skin permeation mechanism was characterized using confocal laser scanning microscopy (CLSM). The results indicated that the difference in physicochemical characteristics of MTS, TFS and CLP affected the skin permeability. MTS and TFS showed higher flux of MX than CLP. CLSM image showed deformable vesicles mechanism for delivery of MX across the hairless mice skin. Our study suggested that ultradeformable and deformable liposomes (MTS and TFS) had a potential to use as transdermal drug delivery carriers for MX. PMID:24225259

Duangjit, Sureewan; Obata, Yasuko; Sano, Hiromu; Onuki, Yoshinori; Opanasopit, Praneet; Ngawhirunpat, Tanasait; Miyoshi, Tsubasa; Kato, Satoru; Takayama, Kozo

2014-01-01

159

Spectroscopic insights on imidazole substituted phthalocyanine photosensitizers: fluorescence properties, triplet state and singlet oxygen generation.  

PubMed

Imidazole substituted metal phthalocyanine (Pc) complexes were synthesized. UV-vis absorption, steady state and time-resolved fluorescence, as well as laser flash photolysis were used to measure the photophysical and photosensitizing properties. All the imidazole-phthalocyanine conjugates show high ?T (quantum yield of excited triplet formation), high ?? (singlet oxygen formation yield, >0.50) and good fluorescence properties (quantum yield ?f>0.20 and lifetime ?f>3.0 ns). Compared to the unsubstituted Pc, both ?- and ?-imidazole substitutions result in the remarkable decrease in ?f and ?f, but the ?-substitution is stronger. The imidazole substitution, on the other hand, causes the increase of ?T, ?T, and ?? values. Magnesium phthalocyanine (MgPc) is more susceptible to the substitution than zinc phthalocyanine (ZnPc). The mechanism responsible for the result is suggested based on the involvement of intramolecular photoinduced electron transfer. The high ?? and appropriate fluorescence properties make the Pcs good candidate for PDT photosensitizers. PMID:24997445

Zhang, Xian-Fu; Lin, Yong; Guo, Wenfeng; Zhu, Jingzhong

2014-12-10

160

New drug delivery nanosystem combining liposomal and dendrimeric technology (liposomal locked-in dendrimers) for cancer therapy.  

PubMed

Liposomal locked-in dendrimers (LLDs), the combination of liposomes and dendrimers in one formulation, represents a relatively new term in the drug carrier technology. LLDs undergone appropriate physicochemical investigation can merge the benefits of liposomal and dendrimeric nanocarriers. In this study generation 1 and 2 hydroxy-terminated dendrimers were synthesized and were then "locked" in liposomes consisting of DOPC/DPPG. The anticancer drug doxorubicin (Dox) was loaded into pure liposomes or LLDs and the final products were subjected to lyophilization. The loading of Dox as well as its in vitro release rate from all systems was determined and the interaction of liposomes with dendrimers was assessed by thermal analysis and fluorescence spectroscopy. The results were very promising in terms of drug encapsulation and release rate, factors that can alter the therapeutic profile of a drug with low therapeutic index such as Dox. Physicochemical methods revealed a strong, generation dependent, interaction between liposomes and dendrimers that probably is the basis for the higher loading and slower drug release from the LLDs comparing to pure liposomes. PMID:20564386

Gardikis, Konstantinos; Hatziantoniou, Sophia; Bucos, Madalina; Fessas, Dimitrios; Signorelli, Marco; Felekis, Theodoros; Zervou, Maria; Screttas, Constantinos G; Steele, Barry R; Ionov, Maksim; Micha-Screttas, Maria; Klajnert, Barbara; Bryszewska, Maria; Demetzos, Costas

2010-08-01

161

Ultrasound, liposomes, and drug delivery: principles for using ultrasound to control the release of drugs from liposomes.  

PubMed

Ultrasound is used in many medical applications, such as imaging, blood flow analysis, dentistry, liposuction, tumor and fibroid ablation, and kidney stone disruption. In the past, low frequency ultrasound (LFUS) was the main method to downsize multilamellar (micron range) vesicles into small (nano scale) unilamellar vesicles. Recently, the ability of ultrasound to induce localized and controlled drug release from liposomes, utilizing thermal and/or mechanical effects, has been shown. This review, deals with the interaction of ultrasound with liposomes, focusing mainly on the mechanical mechanism of drug release from liposomes using LFUS. The effects of liposome lipid composition and physicochemical properties, on one hand, and of LFUS parameters, on the other, on liposomal drug release, are addressed. Acoustic cavitation, in which gas bubbles oscillate and collapse in the medium, thereby introducing intense mechanical strains, increases release substantially. We suggest that the mechanism of release may involve formation and collapse of small gas nuclei in the hydrophobic region of the lipid bilayer during exposure to LFUS, thereby inducing the formation of transient pores through which drugs are released. Introducing PEG-lipopolymers to the liposome bilayer enhances responsivity to LFUS, most likely due to absorption of ultrasonic energy by the highly hydrated PEG headgroups. The presence of amphiphiles, such as phospholipids with unsaturated acyl chains, which destabilize the lipid bilayer, also increases liposome susceptibility to LFUS. Application of these principles to design highly LFUS-responsive liposomes is discussed. PMID:19703435

Schroeder, Avi; Kost, Joseph; Barenholz, Yechezkel

2009-11-01

162

Modeling the interactions of phthalocyanines in water: From the Cu(II)-tetrasulphonate to the metal-free phthalocyanine  

NASA Astrophysics Data System (ADS)

A quantum and statistical study on the effects of the ions Cu^{2+} and SO3- in the solvent structure around the metal-free phthalocyanine (H2Pc) is presented. We developed an ab initio interaction potential for the system CuPc-H2O based on quantum chemical calculations and studied its transferability to the H2Pc-H2O and [CuPc(SO3)4]^{4-}-H2O interactions. The use of the molecular dynamics technique allows the determination of energetic and structural properties of CuPc, H2Pc, and [CuPc(SO3)4]^{4-} in water and the understanding of the keys for the different behaviors of the three phthalocyanine (Pc) derivatives in water. The inclusion of the Cu^{2+} cation in the Pc structure reinforces the appearance of two axial water molecules and second-shell water molecules in the solvent structure, whereas the presence of SO3{}^- anions implies a well defined hydration shell of about eight water molecules around them making the macrocycle soluble in water. Debye-Waller factors for axial water molecules have been obtained in order to examine the potential sensitivity of the extended x-ray absorption fine structure technique to detect the axial water molecules.

Martín, Elisa I.; Martínez, Jose M.; Marcos, Enrique Sánchez

2011-01-01

163

Theranostic liposomes for cancer diagnosis and treatment: current development and pre-clinical success.  

PubMed

Liposomes are one of the effective drug delivery systems that are developed based on the nanotechnology concept. Liposomal formulation is the first nanomedicine approved by the US FDA for clinical application. Recently, the marketed liposomes and stealth liposomes have made impact for cancer therapy. In addition, a few receptor-targeted liposome products have been in different phases of clinical trials, which are yet to be marketed. In the present editorial, the advantages of vitamin E TPGS-coated liposomes over the currently available PEG-coated liposomes will be described and their great potentials for nanotheranostics for cancer imaging and therapy will be covered. PMID:23061654

Muthu, Madaswamy S; Feng, Si-Shen

2013-02-01

164

Liposomes tethered to a biopolymer film through the hydrophobic effect create a highly effective lubricating surface.  

PubMed

Liposomal coatings are formed on films of a biopolymer, hydrophobically modified chitosan (hm-chitosan), containing dodecyl groups as hydrophobes along the polymer backbone. The alkyl groups insert themselves into the liposome bilayer through hydrophobic interactions and thus tether liposomes, leading to a densely packed liposome layer on the film surface. Such liposomal surfaces exhibit effective lubrication properties due to their high degree of hydration, and reduce the coefficient of friction to the biologically-relevant range. The compliancy and robustness of these tethered liposomes allow retention on the film surface upon repeated applications of shear. Such liposome coated films have potential applications in biolubrication. PMID:25315119

Zheng, R; Arora, J; Boonkaew, B; Raghavan, S R; Kaplan, D L; He, J; Pesika, N S; John, V T

2014-12-14

165

Communication: Influence of graphene interlayers on the interaction between cobalt phthalocyanine and Ni(111)  

SciTech Connect

The influence of graphene interlayers on electronic interface properties of cobalt phthalocyanine on Ni(111) is studied using both photoemission and X-ray absorption spectroscopy. A charge transfer associated with a redistribution of the d-electrons at the Co-atom of the phthalocyanine occurs at the interface to Ni(111). Even a graphene buffer layer cannot prevent the charge transfer at the interface to Ni(111); however, the detailed electronic situation is different.

Uihlein, Johannes; Peisert, Heiko; Glaser, Mathias; Polek, Malgorzata; Adler, Hilmar; Petraki, Fotini; Chasse, Thomas [Universitaet Tuebingen, Institut fuer Physikalische und Theoretische Chemie, Auf der Morgenstelle 18, 72076 Tuebingen (Germany); Ovsyannikov, Ruslan; Bauer, Maximilian [Helmholtz Zentrum Berlin fuer Materialien und Energie GmbH, Elektronenspeicherring BESSY II, Albert-Einstein-Str. 15, 12489 Berlin (Germany)

2013-02-28

166

Photophysical property of a polymeric nanoparticle loaded with an aryl benzyl ester silicon (IV) phthalocyanine  

NASA Astrophysics Data System (ADS)

Because of their excellent near-infrared (NIR) optical properties, phthalocyanines (Pcs) have been regarded as promising therapy agents for fluorescence image-guided drug delivery and noninvasive treatment of tumors by photodynamic therapy (PDT). Nevertheless, phthalocyanines are substantially limited in clinical applications owing to their poor solubility, aggregation and insufficient selectivity for cancer cells. To address these issues, we have developed a novel dendrimer-based theranostic nanoparticle for tumor-targeted delivery of phthalocyanine. The preparation procedure involved the modification of the silicon (IV) phthalocyanine molecule with a dendritic axially substitution, which significantly enhances their photophysical property. In order to improve biocompatibility and tumor-targeted delivery, the hydrophobic dendritic phthalocyanine was encapsulated by diblock amphiphilic copolymer poly (ethylene glycol)-poly (Epsilon-caprolactone) (MPEG-PCL) to form a polymeric nanoparticle. The polymeric nanoparticle is spherical with a diameter at about 90 nm. The photophysical property of the polymeric nanoparticle was studied by UV/Vis and fluorescence spectroscopic methods. Compared with the free dendritic phthalocyanine, the Q band of the polymeric nanoparticle was red-shifted, and the fluorescence intensity decreased. Furthermore, the polymeric nanoparticle has a relatively high loading amount and encapsulation rate. Therefore, the polymeric nanoparticle would be a promising third-generation photosensitizer (PS) for PDT.

Pan, Sujuan; Ma, Dongdong; Chen, Xiuqin; Wang, Yuhua; Yang, Hongqin; Peng, Yiru

2014-09-01

167

Evaluation of antibacterial properties of novel phthalocyanines against Escherichia coli--comparison of analytical methods.  

PubMed

We analyzed antibacterial effects of several novel phthalocyanines against Escherichia coli and evaluated the suitability of flow cytometry for the detection of antibacterial effects of phthalocyanines in comparison with routinely used cultivation. After 3h of exposure under cool white light eight cationic phthalocyanines showed very high antibacterial activity in the concentration of 2.00 mg L(-1) and four of them were even efficient in the concentration of 0.20 mg L(-1). Antibacterial activity of neutral and anionic compounds was considerably lower or even negligible. No antibacterial effect was detected when bacteria were exposed without illumination. Binding affinity to bacterial cells was found to represent an important parameter influencing phthalocyanine antibacterial activity that can be modified by total charge of peripheral substituents and by the presence of suitable functional groups inside them. Agglomeration of cells observed in suspensions treated with a higher concentration of certain cationic phthalocyanines (the strongest binders to bacterial membrane) affected cytometric measurements of total cell counts, thus without appropriate pretreatment of the sample before analysis this parameter seems not to be fully valid in the evaluation of phthalocyanine antibacterial activity. Cytometric measurement of cell membrane integrity appears to be a suitable and even more sensitive parameter than cultivation. PMID:24993083

Mikula, Premysl; Kalhotka, Libor; Jancula, Daniel; Zezulka, Stepan; Korinkova, Radka; Cerny, Jiri; Marsalek, Blahoslav; Toman, Petr

2014-09-01

168

Liposomes loaded with histone deacetylase inhibitors for breast cancer therapy.  

PubMed

Histone deacetylase (HDAC) inhibitors (HDACi) of the class I trichostatin A (TSA), CG1521 (CG), and PXD101 (PXD) were incorporated at a high rate (approximately 1mM) in liposomes made of egg phosphatidylcholine/cholesterol/distearoylphosphoethanolamine-polyethylenglycol(2000) (64:30:6). Physicochemical parameters (size, zeta potential, loading, stability, release kinetics) of these HDACi-loaded pegylated liposomes were optimized and their cytotoxicity (MTT test) was measured in MCF-7, T47-D, MDA-MB-231 and SkBr3 breast cancer cell lines. In MCF-7 cells, TSA and PXD were efficient inducers of proteasome-mediated estradiol receptor alpha degradation and they both affected estradiol-induced transcription (TSA>PXD) contrary to CG. Moreover, TSA most efficiently altered breast cancer cell viability as compared to the free drug, CG-liposomes being the weakest, while unloaded liposomes had nearly no cytotoxicity. Pegylated liposomes loaded with TSA or PXD remained stable in size, charge and biological activity for one month when stored at 4 degrees C. All HDACi-loaded liposomes released slowly the encapsulated drug in vitro, CG-loaded liposomes showed the slowest release kinetic. These formulations could improve the efficacy of HDACi not only in breast cancers but also in other solid tumors because most of these drugs are poor water soluble and unstable in vivo, and their administration remains a challenge. PMID:20603204

Urbinati, Giorgia; Marsaud, Véronique; Plassat, Vincent; Fattal, Elias; Lesieur, Sylviane; Renoir, Jack-Michel

2010-09-15

169

Liposomes as drug delivery vehicles for boron agents.  

PubMed

The successful treatment of cancer by boron neutron capture therapy (BNCT) requires the selective concentration of boron-10 within malignant tumors. The potential of liposomes to deliver boron-rich compounds to tumors has been assessed by examination of the biodistribution of boron delivered by liposomes in tumor-bearing mice. Small unilamellar vesicles have been found to stably encapsulate high concentrations of water-soluble ionic boron compounds. Alternatively, lipophilic boron-containing species have been embedded within the phospholipid bilayer of liposomes, and both hydrophilic and lipophilic boron compounds have been incorporated within the same liposome formulation. The biodistribution of boron was determined at several time points over 48 hr after i.v. injection of liposomal suspensions in BALB/c mice bearing EMT6 tumors. The tumor-selective delivery of boron by the liposomes was demonstrated as tumor-boron concentrations increased for several hours post-injection. Even at the low injected doses employed (6-18 mg boron/kg body weight) therapeutic tumor boron concentrations were observed (> 30 micrograms boron/g tissue) and high tumor/blood ratios were achieved (> 5). The most favorable results were obtained with the polyhedral borane Na3[a2-B20H1-NH2CH2CH2NH2]. Liposomes encapsulating this species produced a tumor boron concentration of 45 micrograms/g tissue at 30 hr post-injection, at which time the tumor/blood boron ratio was 9.3. PMID:9151223

Hawthorne, M F; Shelly, K

1997-05-01

170

Ultrasonic gene and drug delivery using eLiposomes.  

PubMed

eLiposomes are liposomes encapsulating emulsions and therapeutics for targeted delivery. By applying ultrasound to eLiposomes, emulsion droplets can transform from liquid to gas and rupture the lipid bilayer of the eLiposome to release a drug or plasmid. In this study, perfluoropentane (PFC5) emulsions were encapsulated inside folated eLiposomes carrying a model drug (calcein) or a model GFP plasmid to examine the effects of a folate ligand, PFC5 emulsion and various ultrasonic acoustic parameters in drug delivery and gene transfection into HeLa cells. Confocal microscopy was used to quantify drug delivery and the level of plasmid transfection into HeLa cells. The results showed that drug delivery or transfection was minimal without incorporation of internal PFC5 emulsions and folate ligand on the eLiposome surface. It was also shown that application of ultrasound greatly enhanced the drug delivery and plasmid transfection. Delivery of these therapeutics appears to be to the cytosol, indicating that the expansion of the emulsion droplets disrupted both the eLiposomes and the endosomes. PMID:23352908

Javadi, Marjan; Pitt, William G; Tracy, Christopher M; Barrow, Jeffery R; Willardson, Barry M; Hartley, Jonathan M; Tsosie, Naakaii H

2013-04-10

171

The effect of intercalants on the host liposome.  

PubMed

When phospholipids are vigorously dispersed in water, liposomes are formed. In the present study, we have explored the effect of intercalant concentration on various properties of unilamellar liposomes. Liposomes were sonically intercalated with vitamin E acetate (VitEAc) and hypericin (Hy) until no difference in light transmission was observed, which reflects the formation of liposomes of minimal diameter. Our studies indicate that the intercalant structure and concentration have an influence on the liposome diameter, which could be directly measured by cryogenic transmittance electronic microscopy. Thus, intercalated VitEAc substantially decreased the diameter of unilamellar dimyristoylphosphatidylcholine liposomes, whereas Hy did not. In addition, we followed peak intensities in the absorbance and fluorescence spectra of Hy as a function of intercalant concentration in the liposomal solution. Initially, the fluorescence intensity increased linearly with concentration; however, the curve then arched asymptotically, followed by a decrease in fluorescence at yet higher concentrations. Because the Hy monomer is the only species that emits fluorescence, we believe that the decrease of fluorescence intensity is the result of Hy aggregation. PMID:22799604

Cohen, Yael; Weitman, Hana; Afri, Michal; Yanus, Rinat; Rudnick, Safra; Talmon, Yeshayahu; Schmidt, Judith; Aped, Pinchas; Shatz, Smadar; Ehrenberg, Benjamin; Frimer, Aryeh A

2012-12-01

172

Sterically stabilized liposomes as a potent carrier for shikonin.  

PubMed

The ability of pegylated liposomes (sterically stabilized liposomes-SSL) to localize in solid tumors via the enhanced permeability and retention (EPR) effect, partly depends on their long circulating properties which can be achieved by grafting polyethylene glycol (PEG) to the liposomes' surface. Alkannin and shikonin (A/S) are naturally occurring hydroxynaphthoquinones with a well-established spectrum of wound healing, antimicrobial, anti-inflammatory, antioxidant, and recently established antitumor activity. The purpose of this work was to prepare and characterize shikonin-loaded pegylated liposomes as a new drug carrier for shikonin, as a continuation of authors' previous work on conventional shikonin-loaded liposomal formulations. Three new pegylated liposomal formulations of shikonin (DSPC-PEG2000, EPC-PEG2000, and DPPC-PEG2000) were prepared and characterized in terms of physicochemical characteristics, pharmacokinetics, and stability (at 4?°C, for 28?d) and compared with the corresponding conventional ones. Particle size distribution, ?-potential, entrapment efficiency, and release profile of the entrapped drug were measured. Results indicated the successful incorporation of shikonin into liposomes alongside with their good physicochemical characteristics, high entrapment efficiency, satisfactory in vitro release profile, and good physical stability. The results are considered promising and could be used as a road map for designing further in vivo experiments. PMID:24597496

Kontogiannopoulos, K N; Tsermentseli, S K; Assimopoulou, A N; Papageorgiou, V P

2014-09-01

173

Anomalous photoelectric emission from Ag on zinc-phthalocyanine film  

SciTech Connect

Photoelectric emission from organic and metal thin films is generally observed with irradiation of photon energy larger than 4?eV. In this paper, however, we report photoelectric emission from Ag on a zinc-phthalocyanine (ZnPc) layer at a photon energy of 3.4?eV. The threshold energy for this photoelectric emission is much smaller than the work function of Ag estimated by conventional photoelectron spectroscopy. The photoelectric emission by low-energy photons is significant for Ag thicknesses of less than 1?nm. Photoelectron spectroscopy and morphological study of the Ag/ZnPc suggest that the anomalous photoelectric emission from the Ag surface is caused by a vacuum level shift at the Ag/ZnPc interface and by surface plasmons of the Ag nanoparticles.

Tanaka, Senku, E-mail: senku@ele.kindai.ac.jp [Department of Electric and Electronic Engineering, Faculty of Science and Engineering, Kinki University, Higashiosaka 577-8502 (Japan); Otani, Tomohiro; Fukuzawa, Ken; Hiromitsu, Ichiro [Department of Physics and Materials Science, Graduate School of Science and Engineering, Shimane University, Matsue 690-8504 (Japan); Ogawa, Koji; Azuma, Junpei; Yamamoto, Isamu; Takahashi, Kazutoshi; Kamada, Masao [Synchrotron Light Application Center, Saga University, Saga 840-8502 (Japan)

2014-05-12

174

High-? field-effect transistor with copper-phthalocyanine  

NASA Astrophysics Data System (ADS)

The use of SrTiO3 dielectrics as high-permittivity insulator in organic thin-film field-effect transistors (FET) is evaluated. FETs with sputtered SrTiO3 and copper-phthalocyanine (CuPc) as semiconducting layer were fabricated. The device preparation was performed in situ in an ultra-high-vacuum chamber system. The dielectric in the transistors had a permittivity of up to 200 which led to low driving voltages of 3 V. The FETs were p-type and reached mobilities of about ? = 1.5 × 10-3 cm2 V-1 s-1 and an on/off ratio of 103. These properties are compared to devices based on other dielectric materials.

Roth, F.; Huth, M.

2011-09-01

175

Giant Liposome Preparation for Imaging and Patch-Clamp Electrophysiology  

PubMed Central

The reconstitution of ion channels into chemically defined lipid membranes for electrophysiological recording has been a powerful technique to identify and explore the function of these important proteins. However, classical preparations, such as planar bilayers, limit the manipulations and experiments that can be performed on the reconstituted channel and its membrane environment. The more cell-like structure of giant liposomes permits traditional patch-clamp experiments without sacrificing control of the lipid environment. Electroformation is an efficient mean to produce giant liposomes >10 ?m in diameter which relies on the application of alternating voltage to a thin, ordered lipid film deposited on an electrode surface. However, since the classical protocol calls for the lipids to be deposited from organic solvents, it is not compatible with less robust membrane proteins like ion channels and must be modified. Recently, protocols have been developed to electroform giant liposomes from partially dehydrated small liposomes, which we have adapted to protein-containing liposomes in our laboratory. We present here the background, equipment, techniques, and pitfalls of electroformation of giant liposomes from small liposome dispersions. We begin with the classic protocol, which should be mastered first before attempting the more challenging protocols that follow. We demonstrate the process of controlled partial dehydration of small liposomes using vapor equilibrium with saturated salt solutions. Finally, we demonstrate the process of electroformation itself. We will describe simple, inexpensive equipment that can be made in-house to produce high-quality liposomes, and describe visual inspection of the preparation at each stage to ensure the best results. PMID:23851612

Collins, Marcus D.; Gordon, Sharona E.

2013-01-01

176

Signal-enhancing thermosensitive liposomes for highly sensitive immunosensor development.  

PubMed

Liposomes are potential candidates as nanovesicles for the development of detection systems with improved sensitivity and detection limits, due to their capacity to encapsulate diverse types of signal enhancing molecules. An amperometric immunosensor exploiting enzyme encapsulating thermosensitive liposomes for the ultrasensitive detection of carcinoembryonic antigen (CEA) is reported. Five different bioconjugation methods to link an anti-CEA antibody to horseradish peroxidase (HRP) encapsulating liposomes were studied and compared to HRP-Ab conjugate. ?-Potential measurements of liposomes before and after each modification method as well as following incubation with CEA were used as a tool to monitor the success of modification and probe the affinity of the liposome linked antibodies. The use of different lysing conditions (temperature vs detergent) was evaluated, with the application of temperature providing an extremely effective means of liposome lysis. Finally, thermosensitive liposomes modified using biotin-streptavidin and N-succinimidyl-S-acetylthioacetate (SATA)/sulfosuccinimidyl 4-(N-maleimidomethyl) cyclohexane-1-1-carboxylate (Sulfo-SMCC) chemistries were used to detect CEA and compared in terms of their stability, background signal, and limit of detection. Detection limits of 2 orders of magnitude lower than that obtained with the HRP-antibody reporter conjugate were obtained (0.080 ng CEA/mL and 0.0113 ng CEA/mL), with 11-fold and 9-fold amplification of signal, for the biotin-streptavidin and SATA/Sulfo-SMCC modified liposomes respectively, clearly demonstrating the powerful potential of enzyme encapsulating liposomes as signal enhancement tools. PMID:21155541

Genç, Rükan; Murphy, Deirdre; Fragoso, Alex; Ortiz, Mayreli; O'Sullivan, Ciara K

2011-01-15

177

Droplet-Based Production of Liposomes  

NASA Technical Reports Server (NTRS)

A process for making monodisperse liposomes having lipid bilayer membranes involves fewer, simpler process steps than do related prior methods. First, a microfluidic, cross junction droplet generator is used to produce vesicles comprising aqueous solution droplets contained in single layer lipid membranes. The vesicles are collected in a lipid-solvent mix that is at most partially soluble in water and is less dense than is water. A layer of water is dispensed on top of the solvent. By virtue of the difference in densities, the water sinks to the bottom and the solvent floats to the top. The vesicles, which have almost the same density as that of water, become exchanged into the water instead of floating to the top. As there are excess lipids in the solvent solution, in order for the vesicles to remain in the water, the addition of a second lipid layer to each vesicle is energetically favored. The resulting lipid bilayers present the hydrophilic ends of the lipid molecules to both the inner and outer membrane surfaces. If lipids of a second kind are dissolved in the solvent in sufficient excess before use, then asymmetric liposomes may be formed.

Ackley, Donald E.; Forster, Anita

2009-01-01

178

Liposomal anthracycline treatment for ovarian cancer.  

PubMed

Platinum/taxane regimens induce high response rates and prolong survival in women with ovarian cancer. After recurrence, however, response to second-line chemotherapy is limited. Pegylated liposomal doxorubicin (Doxil/Caelyx [PLD]), is the only liposomal anthracycline indicated for second-line treatment of platinum- and paclitaxel-refractory ovarian cancer. Response rates ranged from 14% to 20% in nonrandomized trials of this patient population. In a large phase 3 randomized trial, single-agent PLD and topotecan had similar efficacy overall in response rates, but PLD-treated patients had significantly improved overall survival compared with topotecan with a pronounced advantage in platinum-sensitive patients. Another randomized trial reported that PLD and paclitaxel were comparable with regards to response rate, progression-free survival, and overall survival, regardless of the degree of platinum sensitivity. Additional nonrandomized trials of PLD in combination with other active agents resulted in response rates ranging from 20% to 76%. PLD is generally well tolerated and its side-effect profile compares favorably with other commonly used chemotherapeutic agents in this clinical setting. Proper dosing and monitoring may further enhance tolerability while preserving the efficacy of this versatile agent for ovarian cancer. PMID:15717739

Markman, Maurie; Gordon, Alan N; McGuire, William P; Muggia, Franco M

2004-12-01

179

Galactodendritic Phthalocyanine Targets Carbohydrate-Binding Proteins Enhancing Photodynamic Therapy  

PubMed Central

Photosensitizers (PSs) are of crucial importance in the effectiveness of photodynamic therapy (PDT) for cancer. Due to their high reactive oxygen species production and strong absorption in the wavelength range between 650 and 850 nm, where tissue light penetration is rather high, phthalocyanines (Pcs) have been studied as PSs of excellence. In this work, we report the evaluation of a phthalocyanine surrounded by a carbohydrate shell of sixteen galactose units distributed in a dendritic manner (PcGal16) as a new and efficient third generation PSs for PDT against two bladder cancer cell lines, HT-1376 and UM-UC-3. Here, we define the role of galacto-dendritic units in promoting the uptake of a Pc through interaction with GLUT1 and galectin-1. The photoactivation of PcGal16 induces cell death by generating oxidative stress. Although PDT with PcGal16 induces an increase on the activity of antioxidant enzymes immediately after PDT, bladder cancer cells are unable to recover from the PDT-induced damage effects for at least 72 h after treatment. PcGal16 co-localization with galectin-1 and GLUT1 and/or generation of oxidative stress after PcGal16 photoactivation induces changes in the levels of these proteins. Knockdown of galectin-1 and GLUT1, via small interfering RNA (siRNA), in bladder cancer cells decreases intracellular uptake and phototoxicity of PcGal16. The results reported herein show PcGal16 as a promising therapeutic agent for the treatment of bladder cancer, which is the fifth most common type of cancer with the highest rate of recurrence of any cancer. PMID:24763311

Pereira, Patrícia M. R.; Silva, Sandrina; Cavaleiro, José A. S.; Ribeiro, Carlos A. F.; Tomé, João P. C.; Fernandes, Rosa

2014-01-01

180

Percutaneous permeation measurement of topical phthalocyanine by photoacoustic technique  

NASA Astrophysics Data System (ADS)

This investigation have studied photoacoustic (PA) technique to percutaneous permeation of topical hydroxy-(29H,31H-phthalocyaninate) aluminum (PcAlOH) on pig ear skin. The PcAlOH was incorporated in an emulsion (O/W) (1 mg/dl) with assessed stability parameters of: pH, short and long term stability tests (in the several conditions). The skin was prepared through a heat separation technique, and with a scalpel, the outer skin of the cartilage was removed. The skins were then cut into 4 cm2 pieces and treated with sodium bromide 2 mol/L for 6 h at 37 °C. The epidermis layer was washed with purified water, dried, and stored under reduced pressure until use. The skin permeation kinetics was determined by photoacoustic technique in an open photoacoustic cell. Short (after preparation) and long-term stability tests showed no phase separation. The emulsion developed pH 7.6 and after incorporating the pH was unchanged. The typical times for percutaneous permeation of the emulsion base and emulsion + PcAlOH were 182 (±6) and 438 (±3) s, respectively. This study indicated that the formulations containing PcAlOH have stabile characteristics and show promising results in absorption into the skin. The presence of the photosensitive agent in the formulation contributed significantly to the greater absorption time than observed in the base formulation. The used photoacoustic technical to examine the penetration kinetics of PcAlOH in pig ear skin was adequate and may be employed in the determination of the percutaneous permeation of phthalocyanines.

Silva, Emanoel P. O.; Barja, Paulo R.; Cardoso, Luiz E.; Beltrame, Milton

2012-11-01

181

Photodynamic and sonodynamic treatment by phthalocyanine on cancer cell lines.  

PubMed

Photodynamic therapy is a modality of treatment for tumors. The photochemical interactions of sensitizer, light and molecular oxygen produce reactive oxygen species (ROS) such as singlet oxygen, peroxide, hydroxyl radical and superoxide ion. The tumor is destroyed either by the formation of highly reactive singlet oxygen (type II mechanism) or by the formation of radical products (type 1 mechanism) generated in an energy transfer reaction. The resulting damage to organelles within malignant cells leads to tumor ablation. The cellular effects include membrane damage, mitochondrial damage and DNA damage. A new treatment modality called sonodynamic therapy has been developed, in which the ultrasound-induced cytotoxicity of sonochemical sensitizers inhibits tumor growth. In this study, the promising new generation of sensitizers - phthalocyanines - were used to induce the photodamage. In addition, we applied an ultrasound treatment to support the photodynamic effect. We report on the production of ROS in G361 melanoma cells. Light-emitting diodes were used to evoke the photodynamic effect. Changes in cells were evaluated using fluorescence microscope and atomic force microscopy. The quantitative ROS production changes in relation to sensitizer concentration, irradiation doses and ultrasound intensity were proved by a fluororeader. Our results showed the highest generation of ROS within G361 melanoma cells was achieved at an irradiation dose of 15 Jcm(-2) followed by ultrasound treatment at intensity of 2 Wcm(-2) and frequency of 1 MHz in the presence of 100 muM chloroaluminum phthalocyanine disulfonate (ClAlPcS2). These results suggest that ClAlPcS2 is a potential photosensitizer and sonosensitizer for sonodynamic or photodynamic treatment of cancer. PMID:19515482

Kolarova, Hana; Tomankova, Katerina; Bajgar, Robert; Kolar, Petr; Kubinek, Roman

2009-08-01

182

Galactodendritic phthalocyanine targets carbohydrate-binding proteins enhancing photodynamic therapy.  

PubMed

Photosensitizers (PSs) are of crucial importance in the effectiveness of photodynamic therapy (PDT) for cancer. Due to their high reactive oxygen species production and strong absorption in the wavelength range between 650 and 850 nm, where tissue light penetration is rather high, phthalocyanines (Pcs) have been studied as PSs of excellence. In this work, we report the evaluation of a phthalocyanine surrounded by a carbohydrate shell of sixteen galactose units distributed in a dendritic manner (PcGal16) as a new and efficient third generation PSs for PDT against two bladder cancer cell lines, HT-1376 and UM-UC-3. Here, we define the role of galacto-dendritic units in promoting the uptake of a Pc through interaction with GLUT1 and galectin-1. The photoactivation of PcGal16 induces cell death by generating oxidative stress. Although PDT with PcGal16 induces an increase on the activity of antioxidant enzymes immediately after PDT, bladder cancer cells are unable to recover from the PDT-induced damage effects for at least 72 h after treatment. PcGal16 co-localization with galectin-1 and GLUT1 and/or generation of oxidative stress after PcGal16 photoactivation induces changes in the levels of these proteins. Knockdown of galectin-1 and GLUT1, via small interfering RNA (siRNA), in bladder cancer cells decreases intracellular uptake and phototoxicity of PcGal16. The results reported herein show PcGal16 as a promising therapeutic agent for the treatment of bladder cancer, which is the fifth most common type of cancer with the highest rate of recurrence of any cancer. PMID:24763311

Pereira, Patrícia M R; Silva, Sandrina; Cavaleiro, José A S; Ribeiro, Carlos A F; Tomé, João P C; Fernandes, Rosa

2014-01-01

183

Targeted drug delivery and enhanced intracellular release using functionalized liposomes  

NASA Astrophysics Data System (ADS)

The ability to target cancer cells using an appropriate drug delivery system can significantly reduce the associated side effects from cancer therapies and can help in improving the overall quality of life, post cancer survival. Integrin alpha5beta1 is expressed on several types of cancer cells, including colon cancer and plays an important role in tumor growth and metastasis. Thus, the ability to target the integrin alpha 5beta1 using an appropriate drug delivery nano-vector can significantly help in inhibiting tumor growth and reducing tumor metastasis. The work in this thesis focuses on designing and optimizing, functionalized stealth liposomes (liposomes covered with polyethylene glycol (PEG)) that specifically target the integrin alpha5beta1. The PEG provides a steric barrier allowing the liposomes to circulate in the blood for longer duration and the functionalizing moiety, PR_b peptide specifically recognizes and binds to integrin alpha5beta1 expressing cells. The work demonstrates that by optimizing the amount of PEG and PR_b on the liposomal interface, nano-vectors can be engineered that bind to CT26.WT colon cancer cells in a specific manner and internalize through alpha 5beta1-mediated endocytosis. To further improve the efficacy of the system, PR_b functionalized pH-sensitive stealth liposomes that exhibit triggered release under mild acidic conditions present in endocytotic vesicles were designed. The study showed that PR_b functionalized pH-sensitive stealth liposomes, undergo destabilization under mildly acidic conditions and incorporation of the PR_b peptide does not significantly affect the pH-sensitivity of the liposomes. PR_b functionalized pH-sensitive stealth liposomes bind to CT26.WT colon carcinoma cells that express integrin alpha5beta 1, undergo cellular internalization, and release their load intracellularly in a short period of time as compared to other formulations. PR_b-targeted pH-sensitive stealth liposomes encapsulating 5-fluorouracil (5-FU) show significantly higher cytotoxicity than the PR_b-targeted inert stealth liposomes and the non-targeted stealth liposomes (both pH-sensitive and inert). The studies demonstrated that optimized PR_b functionalized pH sensitive liposomes have the potential to deliver a payload, such as chemotherapeutic agents, directly to colon cancer cells in an efficient and specific manner.

Garg, Ashish

184

Liposomal Drug Products: A Quality by Design Approach  

NASA Astrophysics Data System (ADS)

Quality by Design (QbD) principles has been applied to the development of two liposomal formulations, containing a hydrophilic small molecule therapeutic (Tenofovir) and a protein therapeutic (superoxide dismutase). The goal of the research is to provide critical information on 1) how to reduce the preparation variability in liposome formulations, and 2) how to increase drug encapsulation inside liposomes to reduce manufacturing cost. Most notably, an improved liposome preparation method was developed which increased the encapsulation efficiency of hydrophilic molecules. In particular, this method allows for very high encapsulation efficiency. For example, encapsulation efficiencies of up to 50% have been achieved, whereas previously only 20% or less have been reported. Another significant outcome from this research is a first principle mathematical model to predict the encapsulation efficiency of hydrophilic drugs in unilamellar liposomes. This mathematical model will be useful in: formulation development to rapidly achieve optimized formulations; comparison of drug encapsulation efficiencies of liposomes prepared using different methods; and assisting in the development of suitable process analytical technologies to achieve real-time monitoring and control of drug encapsulation during manufacturing. A novel two-stage reverse dialysis in vitro release testing method has also been developed for passively targeted liposomes, which uses the first stage to mimic the circulation of liposomes in the body and the second stage to imitate the drug release process at the target. The developed in vitro release testing method can be used to distinguish formulations with varied compositions for quality control testing purposes. This developed method may pave the way to the development of more biorelevant quality control testing methods for liposomal drug products in the future. The QbD case studies performed in this research are examples of how this approach can be used to obtain design space for liposome products to achieve the desired in vivo product performance criteria. From an industrial perspective, this study provides an in-depth understanding of the parameters (risks) involved in liposome formulation and processing. From a regulatory perspective, the development of QbD principles for liposomal drug products will facilitate their regulation assuring safety and efficacy of these complex delivery systems.

Xu, Xiaoming

185

Studies on precellular evolution - The encapsulation of polyribonucleotides by liposomes  

NASA Technical Reports Server (NTRS)

Liposomes have been suggested as possible models of precellular systems formed in the early Archean earth from lipids of nonenzymatic origin. Since it is generally accepted that RNA molecules preceded double-stranded DNA molecules as genetic material, the encapsulation of polyribonucleotides within liposomes (made from dipalmitoyl phosphatidylcholine and from egg yolk phosphatidylcholine) was studied. Quantitative determinations show that approximately 50 percent of the available lipids form liposomes, and that up to 5 percent of the polyribonucleotides can be entrapped by them. Also studied was the encapsulation of polyribonucleotides in the presence of urea and cyanamide and of Zn(2+) and Pb(2+).

Baeza, I.; Ibanez, M.; Santiago, J. C.; Wong, C.; Lazcano, A.

1986-01-01

186

The modulation of the permeability and the cellular uptake of liposome by stable anchoring of lipid-conjugated pluronic on liposome.  

PubMed

Controlling the permeability of liposome is important to modulate the release behavior of drug from the liposome. Pluronic F127 (PF127) is a biocompatible tri-block copolymer, which can interact with lipid bilayer of liposomes and make leakages that allow the release of hydrophilic substance from liposome interior. However, the interaction between unmodified PF127 and lipid bilayer is not very strong and the incorporated PF127 is easily desorbed from the liposomes in an infinite reservoir condition. In this paper, we conjugated lipid molecule (1,2-distearoyl-sn-glycero-3-phosphoethanolamine [DSPE]) at the both ends of PF127 to increase the interaction between polymer and liposome. This lipid-conjugated PF127 was incorporated into the liposomes and it remained stably without desorption from liposomes in an infinite reservoir condition. The stably bound PF127 increased the release rate of hydrophilic drug from liposomes in a dose-dependent manner. Moreover, the lipid-conjugated PF127 changed the surface property of liposomes and inhibited its cellular uptake when the incorporated amount was above 2.5 wt%. In conclusion, the lipid-conjugated PF127 could function as a stable anchor on the lipid bilayer of liposomes to control the permeability as well as provide the hydrophilic surface of liposomes in an open system like an in vivo situation. PMID:24724502

Kim, Jong Chul; Chungt, Yong-Il; Kim, Young Ha; Tae, Giyoong

2014-01-01

187

Nano-liposomes of entrapment lidocaine hydrochloride on in vitro permeability of narcotic.  

PubMed

In order to explore two kinds of nano-liposomes in lidocaine hydrochloride nano-liposomes on in vitro permeability of drug, and conduct comparison and analysis, this paper investigates cumulative infiltration situation of lidocaine hydrochloride flexible nano-liposomes and ordinary nano-liposomes by using modified Franz diffusion pool on mice vitro skin. Cumulative osmotic quantity of lidocaine hydrochloride flexible nano-liposomes for 9h was higher than ordinary nano-liposomes.tmax(Maximum osmotic quantity time) of lidocaine hydrochloride flexible nano-liposomes and ordinary nano-liposomes in mice skin was 5 and 60min, the former Cmax (maximum dosage time) was 1.2 times of the latter. Drug was not found in mice plasma of ordinary nano-liposomes group, traces of drugs was detected in 0.5 and 1h in flexible nano-liposomes group, but the concentration was lower than the effective concentration. Compared with the classic skin transparent promoter and ordinary liposome, flexible nano-liposomes have more advantages, but its stability is less than ordinary nano-liposomes because of the addition of surface active substance. Flexible nano-liposomes have great development potential as a carrier of transdermal drug delivery field. PMID:25631510

Sun, Nenghong; Zhu, Yanyan; Yuan, Lei; Lang, Bao

2015-01-01

188

Liposomes for targeting hepatocellular carcinoma: Use of conjugated arabinogalactan as targeting ligand.  

PubMed

Present study investigates the potential of chemically modified (Shah et al., 2013) palmitoylated arabinogalactan (PAG) in guiding liposomal delivery system and targeting asialoglycoprotein receptors (ASGPR) which are expressed in hepatocellular carcinoma (HCC). PAG was incorporated in liposomes during preparation and doxorubicin hydrochloride was actively loaded in preformed liposomes with and without PAG. The liposomal systems with or without PAG were evaluated for in vitro release, in vitro cytotoxicity, in vitro cell uptake on ASGPR(+) cells, in vivo pharmacokinetic study, in vivo biodistribution study, and in vivo efficacy study in immunocompromised mice. The particle size for all the liposomal systems was below 200nm with a negative zeta potential. Doxorubicin loaded PAG liposomes released significantly higher amount of doxorubicin at pH 5.5 as compared to pH 7.4, providing advantage for targeted tumor therapy. Doxorubicin in PAG liposomes showed superior cytotoxicity on ASGPR(+) HepG2 cells as compared to ASGPR(-), MCF7, A549, and HT29 cells. Superior uptake of doxorubicin loaded PAG liposomes as compared to doxorubicin loaded conventional liposomes was evident in confocal microscopy studies. Higher AUC in pharmacokinetic study and higher deposition in liver was observed for PAG liposomes compared to conventional liposomes. Significantly higher tumor suppression was noted in immunocompromised mice for mice treated with PAG liposomes as compared to the conventional liposomes. Targeting ability and superior activity of PAG liposomes is established pre-clinically suggesting potential of targeted delivery system for improved treatment of HCC. PMID:25311181

Shah, Sanket M; Goel, Peeyush N; Jain, Ankitkumar S; Pathak, Pankaj O; Padhye, Sameer G; Govindarajan, Srinath; Ghosh, Sandipto S; Chaudhari, Pradip R; Gude, Rajiv P; Gopal, Vijaya; Nagarsenker, Mangal S

2014-12-30

189

Bioreactor droplets from liposome-stabilized all-aqueous emulsions  

NASA Astrophysics Data System (ADS)

Artificial bioreactors are desirable for in vitro biochemical studies and as protocells. A key challenge is maintaining a favourable internal environment while allowing substrate entry and product departure. We show that semipermeable, size-controlled bioreactors with aqueous, macromolecularly crowded interiors can be assembled by liposome stabilization of an all-aqueous emulsion. Dextran-rich aqueous droplets are dispersed in a continuous polyethylene glycol (PEG)-rich aqueous phase, with coalescence inhibited by adsorbed ~130-nm diameter liposomes. Fluorescence recovery after photobleaching and dynamic light scattering data indicate that the liposomes, which are PEGylated and negatively charged, remain intact at the interface for extended time. Inter-droplet repulsion provides electrostatic stabilization of the emulsion, with droplet coalescence prevented even for submonolayer interfacial coatings. RNA and DNA can enter and exit aqueous droplets by diffusion, with final concentrations dictated by partitioning. The capacity to serve as microscale bioreactors is established by demonstrating a ribozyme cleavage reaction within the liposome-coated droplets.

Dewey, Daniel C.; Strulson, Christopher A.; Cacace, David N.; Bevilacqua, Philip C.; Keating, Christine D.

2014-08-01

190

Elastic liposomes containing benzophenone-3 for sun protection factor enhancement.  

PubMed

This work was focused on the loading of benzophenone-3 in elastic liposomes composed of egg phosphatidylcholine and cholesterol, prepared by the Bangham method. Samples were characterized in terms of particle size, polydispersity index (PI), zeta potential, encapsulation efficiency and in vitro photoprotection properties. The extrusion of liposomes loading benzophenone-3 produced reduced-size (100 nm) elastic liposomes with a PI of 0.2. The active was loaded with a concentration of 20.34% (m/m) revealing changes in the ultraviolet properties after loading. On the basis of these results, it can be anticipated that liposomes are able to improve sun protector factor in vitro compared the free active. PMID:21563987

Severino, Patrícia; Moraes, Lívia Faria; Zanchetta, Beatriz; Souto, Eliana B; Santana, Maria H A

2012-01-01

191

Remote loading of preencapsulated drugs into stealth liposomes  

PubMed Central

Loading drugs into carriers such as liposomes can increase the therapeutic ratio by reducing drug concentrations in normal tissues and raising their concentrations in tumors. Although this strategy has proven advantageous in certain circumstances, many drugs are highly hydrophobic and nonionizable and cannot be loaded into liposomes through conventional means. We hypothesized that such drugs could be actively loaded into liposomes by encapsulating them into specially designed cyclodextrins. To test this hypothesis, two hydrophobic drugs that had failed phase II clinical trials because of excess toxicity at deliverable doses were evaluated. In both cases, the drugs could be remotely loaded into liposomes after their encapsulation (preloading) into cyclodextrins and administered to mice at higher doses and with greater efficacy than possible with the free drugs. PMID:24474802

Sur, Surojit; Fries, Anja C.; Kinzler, Kenneth W.; Zhou, Shibin; Vogelstein, Bert

2014-01-01

192

Atmospheric-pressure guided streamers for liposomal membrane disruption  

SciTech Connect

The potential to use liposomes (LIPs) as a cellular model in order to study interactions of cold atmospheric-pressure plasma with cells is herein investigated. Cold atmospheric-pressure plasma is formed by a dielectric-barrier discharge reactor. Large multilamellar vesicle liposomes, consisted of phosphatidylcholine and cholesterol, are prepared by the thin film hydration technique, to encapsulate a small hydrophilic dye, i.e., calcein. The plasma-induced release of calcein from liposomes is then used as a measure of liposome membrane integrity and, consequently, interaction between the cold atmospheric plasma and lipid bilayers. Physical mechanisms leading to membrane disruption are suggested, based on the plasma characterization including gas temperature calculation.

Svarnas, P.; Aleiferis, Sp. [High Voltage Laboratory, Department of Electrical and Computer Engineering, University of Patras, Rion 26504 (Greece); Matrali, S. H. [Pharmaceutical Technology Laboratory, Department of Pharmacy, University of Patras, Rion 26504 (Greece); Gazeli, K. [High Voltage Laboratory, Department of Electrical and Computer Engineering, University of Patras, Rion 26504 (Greece); IPREM-LCABIE, Plasmas et Applications, UPPA, 64000 Pau (France); Clement, F. [IPREM-LCABIE, Plasmas et Applications, UPPA, 64000 Pau (France); Antimisiaris, S. G. [Pharmaceutical Technology Laboratory, Department of Pharmacy, University of Patras, Rion 26504 (Greece); Institute of Chemical Engineering Sciences (ICES)-FORTH, Rion 26504 (Greece)

2012-12-24

193

Liposomes with polyribonucleotides as model of precellular systems  

NASA Technical Reports Server (NTRS)

Three types of liposomes were prepared under anoxic conditions: from dipalmitoyl phosphatidyl choline (DPPC), from egg yolk phosphatidyl choline (PC), and from PC with cholesterol (PC:Chol). These were used for encapsulation of poly(U) and poly(C). It was found that 36 to 70 percent of the available liposome lipids and 2 to 5 percent of the polyribonucleotides could be entrapped. An enhanced encapsulation of poly(U) and poly(C) by all three types of liposomes was observed in the presence of 0.001 to 0.01 M Zn(2+), with the effect being greatest with DPPC. The presence of 1.0 M urea inhibited the formation of PC liposomes.

Baeza, Isabel; Ibanez, Miguel; Santiago, Carlos; Lazcano, Antonio; Arguello, Carlos

1987-01-01

194

A disulfide-linked conjugate of ferrocenyl chalcone and silicon(IV) phthalocyanine as an activatable photosensitiser.  

PubMed

A novel bis(ferrocenyl chalcone) silicon(IV) phthalocyanine has been prepared in which the disulfide linker can be cleaved by dithiothreitol. The separation of the ferrocenyl quencher and the phthalocyanine core greatly enhances the fluorescence emission, singlet oxygen production and in vitro photocytotoxicity. PMID:23135340

Lau, Janet T F; Jiang, Xiong-Jie; Ng, Dennis K P; Lo, Pui-Chi

2013-05-14

195

Group 3 LEA protein model peptides protect liposomes during desiccation.  

PubMed

We investigated whether a model peptide for group 3 LEA (G3LEA) proteins we developed in previous studies can protect liposomes from desiccation damage. Four different peptides were compared: 1) PvLEA-22, which consists of two tandem repeats of the 11-mer motif characteristic of LEA proteins from the African sleeping chironomid; 2) a peptide with amino acid composition identical to that of PvLEA-22, but with its sequence scrambled; 3) poly-l-glutamic acid; and 4) poly-l-lysine. Peptides 1) and 2) protected liposomes composed of 1-palmitoyl 2-oleoyl-sn-glycero-3-phosphatidylcholine (POPC) against fusion caused by desiccation, as revealed by particle size distribution measurements with dynamic light scattering. Indeed, liposomes maintain their pre-stress size distribution when these peptides are added at a peptide/POPC molar ratio of more than 0.5. Interestingly, peptide 1) achieved the comparable or higher retention of a fluorescent probe inside liposomes than did several native LEA proteins published previously. In contrast, the other peptides exhibited less protective effects. These results demonstrate that the synthetic peptide derived from the G3LEA protein sequence can suppress desiccation-induced liposome fusion. Fourier transform infrared (FT-IR) spectroscopic measurements were performed for the dried mixture of each peptide and liposome. Based on results for the gel-to-liquid crystalline phase transition temperature of the liposome and the secondary structure of the peptide backbone, we discuss possible underlying mechanisms for the protection effect of the synthetic peptide on dried liposomes. PMID:25037007

Furuki, Takao; Sakurai, Minoru

2014-11-01

196

Liposome-mediated gene transfer to lung isografts  

Microsoft Academic Search

Objectives: Our objectives were to determine the feasibility, efficacy, and safety of in vivo and ex vivo liposome-mediated gene transfer to lung isografts.Methods: Fischer rats were divided into three main groups: (1) Nontransplant setting: Liposome–chloramphenicol acetyl transferase cDNA was intravenously injected, and lungs were harvested at different time points: 2, 6, 12, and 24 hours; 2, 5, 8, and 21

Carlos H. R. Boasquevisque; Teng C. Lee; Bassem N. Mora; David Peterson; William O. Osburn; Matthew Bernstein; Wei Zhang; Jennifer B. Nietupski; Ronald K. Scheule; Joel D. Cooper; Mitchell D. Botney; G. Alexander Patterson

1997-01-01

197

Development of a liposomal nanodelivery system for nevirapine  

PubMed Central

Background The treatment of AIDS remains a serious challenge owing to high genetic variation of Human Immunodeficiency Virus type 1 (HIV-1). The use of different antiretroviral drugs (ARV) is significantly limited by severe side-effects that further compromise the quality of life of the AIDS patient. In the present study, we have evaluated a liposome system for the delivery of nevirapine, a hydrophobic non-nucleoside reverse transcriptase inhibitor. Liposomes were prepared from egg phospholipids using thin film hydration. The parameters of the process were optimized to obtain spherical liposomes below 200 nm with a narrow polydispersity. The encapsulation efficiency of the liposomes was optimized at different ratios of egg phospholipid to cholesterol as well as drug to total lipid. The data demonstrate that encapsulation efficiency of 78.14% and 76.25% were obtained at egg phospholipid to cholesterol ratio of 9:1 and drug to lipid ratio of 1:5, respectively. We further observed that the size of the liposomes and the encapsulation efficiency of the drug increased concomitantly with the increasing ratio of drug and lipid and that maximum stability was observed at the physiological pH. Thermal analysis of the drug encapsulated liposomes indicated the formation of a homogenous drug-lipid system. The magnitude of drug release from the liposomes was examined under different experimental conditions including in phosphate buffered saline (PBS), Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum or in the presence of an external stimulus such as low frequency ultrasound. Within the first 20 minutes 40, 60 and 100% of the drug was released when placed in PBS, DMEM or when ultrasound was applied, respectively. We propose that nevirapine-loaded liposomal formulations reported here could improve targeted delivery of the anti-retroviral drugs to select compartments and cells and alleviate systemic toxic side effects as a consequence. PMID:20624325

2010-01-01

198

Technology of Liposomal Tiosens, Cifelin and Lysomustin for Industrial Purposes  

NASA Astrophysics Data System (ADS)

This work is devoted to the development of national antineoplastic drug (Tiosens, Cifelin, Lysomustin) liposomal dosage form (LDF) circuit technology and their manufacturing technology. In modern oncology liposomes, which are hollow phospholipid vesicles, are used as delivery systems protected drugs from biodegradation, and healthy cells from the toxic effect of chemotherapeutic agents. The technology of their production is stretching and multistage. It is also necessary to give consideration a lot of factors that influence on the finished product quality.

Sanarova, E. V.; Kotova, E. A.; Lantsova, A. V.

2012-02-01

199

Atrioventricular block related to liposomal amphotericin B.  

PubMed

Atrioventricular block can occur in normal children, young adults or athletes. It is also associated with underlying heart disease or occurs as a drug adverse effect. Amphotericin B is used in the treatment of invasive fungal infections. Cardiac toxicity is a rare adverse reaction. We report the case of a 9-month girl, admitted in the paediatric intensive care unit with cytomegalovirus pneumonitis. During hospitalisation the patient developed a systemic fungic infection and was medicated with liposomal amphotericin B. On the third day of treatment she began repeated episodes of bradycardia with spontaneous reversion. The investigation revealed a second-degree atrioventricular block. We excluded the misplacement of the central catheter, myocarditis or structural cardiomyopathy and suspended amphotericin. After 8?days, the bradycardia episodes ceased what was consistent with the drug's half-life. Amphotericin cardiotoxic mechanism is still unclear. It may be related with alteration of myocardial membrane depolarisation. PMID:24907206

Sanches, Bruno Fernandes; Nunes, Pedro; Almeida, Helena; Rebelo, Mónica

2014-01-01

200

Evaluation of electrostatic binding of PAMAM dendrimers and charged phthalocyanines by fluorescence correlation spectroscopy.  

PubMed

We have assessed host-guest interactions between PAMAM dendrimers and charged phthalocyanine probes by Fluorescence Correlation Spectroscopy (FCS). Our results show strong binding in water at low ionic strength with an affinity that decreases from KB ? 10(9) to 10(8) M(-1) upon decreasing the phthalocyanine charge of z = -4, -2 and -1. The binding affinity also decreases significantly upon salt addition leading to KB values of ca. 10(5)-10(6) M(-1). The changes of binding affinity probed by varying the phthalocyanine charge, and by changing the ionic strength or pH conditions, allowed us to evaluate the electrostatic contribution (Kel) in dendrimer-phthalocyanine interactions. In particular, this approach afforded values of electrostatic potential for PAMAM dendrimers in water at low ionic strength and at dendrimer concentrations in the nanomolar range. The electrostatic potential of PAMAM generations 4 and 7 are around 50 mV in close agreement with theoretical estimates using the Poisson-Boltzmann cell model. Interestingly, the nonelectrostatic binding is significant and contributes even more than electrostatic binding to dendrimer-phthalocyanine interactions. The nonelectrostatic binding contributes to an affinity of KB above 10(5) M(-1), as measured under conditions of low dendrimer charge and high ionic strength, which makes these dendrimers promising hosts as drug carriers. PMID:25574969

Garcia-Fernandez, Emilio; Paulo, Pedro M R; Costa, Sílvia M B

2015-01-28

201

Liposomal cisplatin: a new cisplatin formulation.  

PubMed

Over the last three decades, cisplatin has been one of the most effective cytotoxic agents, but its administration has been hindered by its nephrotoxicity, neurotoxicity and myelo toxicity. Recently, liposomal cisplatin, lipoplatin, has been formulated and tested thoroughly in preclinical (in vitro) and phase I, II and III trials, as documented in the literature. Experiments in animals showed that lipoplatin is less toxic than cisplatin and that it produces tumour reduction. The histological examination of treated tumours from mouse xenografts was consistent with apoptosis in the tumour cells in a mechanism similar to that of cisplatin. Lipoplatin infusion in patients and measurements of platinum levels in tumour specimens showed 10-50 times higher levels in tumours and metastases than in the adjacent normal specimens. A phase I-II study using a combination of lipoplatin and gemcitabine in pretreated patients (with disease progression or stable disease) with advanced pancreatic cancer was conducted. No nephrotoxicity was observed. With lipoplatin monotherapy the dose-limiting toxicity was determined to be 350 mg/m and the maximum tolerated dose 300 mg/m; when used in combination with paclitaxel the dose-limiting toxicity for lipoplatin was 250 mg/m and for paclitaxel 175 mg/m, and the maximum tolerated dose was 200 and 175 mg/m, respectively. In two phase II randomized studies comparing the lipoplatin combination versus the cisplatin combination, it was found that the former was statistically significantly less toxic than the latter, whereas the response rate and survival were similar. Up to now, the data on lipoplatin treatment in malignant tumours are quite impressive, because of the negligible toxicity and because it is equal if not superior to cisplatin with regard to response rate. This review aims to chronologically document publications relevant to liposomal cisplatin to date. PMID:20671511

Stathopoulos, George P

2010-09-01

202

Kinetics of proton transfer from tetra(4-nitro-5- tert-butyl)phthalocyanine to nitrogen-containing bases in benzene  

NASA Astrophysics Data System (ADS)

The acid-basic interaction between tetra(4-nitro-5- tert-butyl)phthalocyanine and pyridine, 2-methylpyridine, morpholine, piperidine, n-butylamine, diethylamine, and triethylamine in benzene is studied. It is found that the intermolecular transfer of protons of NH groups from tetra(4-nitro-5- tert-butyl)phthalocyanine to morpholine and diethylamine is characterized by unusually low values of the reaction constant rates. The effect of the structure of tetra(4-nitro-5- tert-butyl)phthalocyanine and tetra(3-nitro-5- tert-butyl)phthalocyanine, and of the nature of the base on the kinetic parameters of acid-base interaction is demonstrated. A structure is proposed for complexes with the transfer of displaced phthalocyanines' protons. It is found that they undergo decomposition over time.

Petrov, O. A.; Kuzmina, E. L.; Maizlish, V. E.; Rodionov, A. V.

2014-01-01

203

Stealth liposomes: review of the basic science, rationale, and clinical applications, existing and potential  

PubMed Central

Among several promising new drug-delivery systems, liposomes represent an advanced technology to deliver active molecules to the site of action, and at present several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles (“first-generation liposomes”) to “second-generation liposomes”, in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. A significant step in the development of long-circulating liposomes came with inclusion of the synthetic polymer poly-(ethylene glycol) (PEG) in liposome composition. The presence of PEG on the surface of the liposomal carrier has been shown to extend blood-circulation time while reducing mononuclear phagocyte system uptake (stealth liposomes). This technology has resulted in a large number of liposome formulations encapsulating active molecules, with high target efficiency and activity. Further, by synthetic modification of the terminal PEG molecule, stealth liposomes can be actively targeted with monoclonal antibodies or ligands. This review focuses on stealth technology and summarizes pre-clinical and clinical data relating to the principal liposome formulations; it also discusses emerging trends of this promising technology. PMID:17717971

Immordino, Maria Laura; Dosio, Franco; Cattel, Luigi

2006-01-01

204

Synthesis of conjugated helical polymers, cyclophanes, metal complexes and phthalocyanines  

NASA Astrophysics Data System (ADS)

Pd(0) catalyzed reactions of 2,15-diethynyl (6) helicene with derivatives of p- and o-diiodobenzene give, respectively, polymers and cyclophanes, in which helicenes are linked by diethynylbenzenes. The molar rotation of polymer is greater than that of a monomeric analogue, and peaks in its UV and CD spectra at wavelengths greater than 350 nm are shifted to the red of the monomer. A cyclophane which contains two helicene rings could be isolated in pure form. (7) Helicenebisquinones can be made easily and in quantity by reacting the silyl enol ethers of a 9,10-dialkoxy-, or a 9,10-disiloxy-, 3,6-diacetylphenanthrene with p-benzoquinone. If an ethyl enol ether is used, the transformation proceeds in much lower yield. The (7) helicenes are efficiently resolved into their enantiomers, and absolute configurations are assigned. The synthesis of molecules that have copper and nickel phthalocyanine cores fused to four non-racemic (7) helicenes, is described. CD and UV-vis absorption spectroscopy show that these compounds aggregate in 75% EtOH in CHClsb3. The UV-vis absorption spectra of films of the nickel phthalocyanine are similar to those of solutions of the aggregated molecules, suggesting that the aggregates have similar structures in the neat samples and in solution. A calculation shows that the energy is minimized when the molecules stack in a chiral superstructure with a core to core distance of ca 3.4 A. Atomic Force Microscopy shows that on mica the molecules assemble into isolated stacks in which the axis of stacking is perpendicular to the surface of the substrate. Combining 1,2-phenylenediamine with a nonracemic (6) helicene-bisquinone and heating the resulting product in acetic acid gives an (8) helicene. The structure of the (8) helicene in solution is shown to be that of a vinylogous lactam. Methods are described that transform it into an (8) helicenebis-o-quinone, and this, in turn, into a helical ligand.

Fox, Joseph Michael

205

Electronic structure of cobalt phthalocyanine: A charge density study  

SciTech Connect

A charge density study of cobalt(II) phthalocyanine based upon 12,163 unique reflections within a (sin /theta/)//lambda/ range 0-10.8 nm/sup /minus/1/, collected by X-ray diffraction at 115 K, was performed. The data was modeled by a conventional multipole analysis as well as by a valence orbital population analysis. When the latter approach was used and data was employed to a (sin /theta/)//lambda/ limit of 8.2 nm/sup /minus/1/, a value of 0.031 was obtained for R/sub w/(I) and 0.015 for R(F). The deformation density maps show bond-centered peaks and lone-pair peaks of ca. 500 e nm/sup /minus/3/ within the phthalocyanine ligand molecule, such as are typical of most good light-atom charge density studies. The rearrangement of the electron density around the cobalt atom is substantial, both in angular function and in radial extent, and suggests a depletion and contraction of the 3d orbitals, combined with a population of more diffuse cobalt-based functions. The valence orbital population analysis quantifies the suggestion, giving a total 3d population of 4.9 (1)e with a radius reduced 35% from the free ion value and a diffuse population (modeled as 4p) of 2.6 (1)e. Those populations are strongly anisotropic: 3d/sub x/sup 2/-y/sup 2///sup 0.0/3d/sub xz,yz//sup 2.4/3d/sub z/sup 2///sup 0.8/3d/sub xy//sup 1.8/4p/sub z//sup 1.1/4p/sub xy//sup 1.4/. There seems to be little charge flow from the ligand to the metal atom (0.5 (1)e), but the bonding is obviously quite covalent in character. This is manifest in the distribution of charge between the 3d /pi/ and /sigma/ systems and the diffuse outer regions of the cobalt atom.

Figgis, B.N.; Kucharski, E.S.; Reynolds, P.A.

1989-03-01

206

Interaction of iron phthalocyanine with the graphene/Ni(111) system  

PubMed Central

Summary Graphene grown on crystalline metal surfaces is a good candidate to act as a buffer layer between the metal and organic molecules that are deposited on top, because it offers the possibility to control the interaction between the substrate and the molecules. High-resolution angular-resolved ultraviolet photo electron spectroscopy (ARPES) is used to determine the interaction states of iron phthalocyanine molecules that are adsorbed onto graphene on Ni(111). The iron phthalocyanine deposition induces a quenching of the Ni d surface minority band and the appearance of an interface state on graphene/Ni(111). The results have been compared to the deposition of iron phthalocyanine on graphene/Ir(111), for which a higher decoupling of the organic molecule from the underlying metal is exerted by the graphene buffer layer. PMID:24778953

Lisi, Simone; Pacilè, Daniela; Mariani, Carlo; Betti, Maria Grazia

2014-01-01

207

Clinical development of liposome-based drugs: formulation, characterization, and therapeutic efficacy  

PubMed Central

Research on liposome formulations has progressed from that on conventional vesicles to new generation liposomes, such as cationic liposomes, temperature sensitive liposomes, and virosomes, by modulating the formulation techniques and lipid composition. Many research papers focus on the correlation of blood circulation time and drug accumulation in target tissues with physicochemical properties of liposomal formulations, including particle size, membrane lamellarity, surface charge, permeability, encapsulation volume, shelf time, and release rate. This review is mainly to compare the therapeutic effect of current clinically approved liposome-based drugs with free drugs, and to also determine the clinical effect via liposomal variations in lipid composition. Furthermore, the major preclinical and clinical data related to the principal liposomal formulations are also summarized. PMID:22275822

Chang, Hsin-I; Yeh, Ming-Kung

2012-01-01

208

Behaviour of liposomes loaded with bovine serum albumin during in vitro digestion.  

PubMed

This study examined the stability of liposomes loaded with negatively charged protein (bovine serum albumin, BSA) during in vitro digestion. Zeta-potential and morphology measurements confirmed that BSA-loaded liposomes were successfully prepared, with an encapsulation efficiency of around 34%. The encapsulated BSA and the integrity of the liposomes remained unchanged with time when the liposomes were digested in a simulated gastric environment, suggesting that the liposomal membrane protected the entrapped BSA from pepsin hydrolysis. BSA-loaded liposomes exhibited lower stability in simulated intestinal fluid, as shown by damaged membranes and the release of free fatty acids. Also, lipolysis kinetics revealed that bile salts and ionic strength could facilitate a high level of free fatty acid release. This work further supplemented our knowledge about the effects of gastrointestinal digestion conditions on liposomal properties and provided valuable information for the design of liposome formulations for the food and health care industries. PMID:25577045

Liu, Weilin; Ye, Aiqian; Liu, Wei; Liu, Chengmei; Han, Jianzhong; Singh, Harjinder

2015-05-15

209

Preparation and evaluation of cyclodextrin polypseudorotaxane with PEGylated liposome as a sustained release drug carrier  

PubMed Central

Summary Cyclodextrins (CDs) can form polypseudorotaxanes (PPRXs) with drugs or drug carriers possessing linear polymers such as polyethylene glycol (PEG). On the other hand, PEGylated liposomes have been utilized as a representative anticancer drug carrier. However, little is known about the formation of CD PPRX with PEGylated liposome. In the present study, we first report the formation of CD PPRX with PEGylated liposome and evaluate it as a sustained release drug carrier. PEGylated liposome encapsulating doxorubicin was disrupted by the addition of ?-CD. Meanwhile, ?-CD included two PEG chains and/or one bending PEG chain of PEGylated liposome and formed PPRX without the disruption of the membrane integrity of the PEGylated liposome. Moreover, the release of doxorubicin and/or PEGylated liposome encapsulating doxorubicin from the PPRX was prolonged in accordance with the matrix type release mechanism. These findings suggest the potential of ?-CD PPRX as sustained release carriers for PEGylated liposome products. PMID:25550741

Hayashida, Kayoko; Higashi, Taishi; Kono, Daichi; Motoyama, Keiichi; Wada, Koki

2014-01-01

210

Kinetic and equilibrium studies of bile salt-liposome interactions.  

PubMed

Abstract Research has suggested that exposure to sub-micellar concentrations of bile salts (BS) increases the permeability of lipid bilayers in a time-dependent manner. In this study, incubation of soy phosphatidylcholine small unilamellar vesicles (liposomes) with sub-micellar concentrations of cholate (C), deoxycholate (DC), 12-monoketocholate (MKC) or taurocholate (TC) in pH 7.2 buffer increased membrane fluidity and negative zeta potential in the order of increasing BS liposome-pH 7.2 buffer distribution coefficients (MKC?liposomes labeled with the dithionite-sensitive fluorescent lipid N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)phosphatidylethanolamine (NBD-PE) in both leaflets and equilibrated with sub-micellar concentrations of BS, fluorescence decline during continuous exposure to dithionite was biphasic involving a rapid initial phase followed by a slower second phase. Membrane permeability to dithionite as measured by the rate of the second phase increased in the order control?liposomes labeled with NBD-PE in the inner leaflet only and incubated with the same concentrations of C, DC and MKC, membrane permeability to dithionite initially increased very rapidly in the order MKC?liposomes incubated with TC, membrane permeability to dithionite was only slightly increased and the decline in fluorescence was mainly the result of NBD-PE flip-flop. These results provide evidence that BS interact with lipid bilayers in a time-dependent manner that is different for conjugated and unconjugated BS. MKC appears to cause least disturbance to liposomal membranes but, when the actual MKC concentration in liposomes is taken into account, MKC is actually the most disruptive. PMID:24960448

Yang, Lin; Feng, Feifei; Paul Fawcett, J; Tucker, Ian G

2015-03-01

211

Preclinical evaluation of zinc phthalocyanine tetrasulfonate-based PDT  

NASA Astrophysics Data System (ADS)

Photodynamic therapy (PDT) involves the light activation of a drug within a tumor causing selective tumor cell death. Unfortunately, some photosensitizing drugs have been associated with adverse reactions in veterinary patients. Zinc phthalocyanine tetrasulfonate (ZnPcS4) is a promising second-generation photosensitizer for use in veterinary medicine, however, it cannot be applied clinically until safety and efficacy data are available. ZnPcS4 was given to Swiss Webster mice to assess acute toxicity. Doses >100 mg/kg were associated with acute toxicity and mortality, and doses >100 mg/kg resulted in renal tubular nephrosis, suggesting that the minimum toxic dose is approximately 100 mg/kg. Based on these data, a Phase I clinical trial of ZnPcS4-based PDT in tumor-bearing dogs is underway, with ZnPcS4 doses up to 2 mg/kg producing no apparent toxicity. Tumor response has been observed after ZnPcS4-based PDT using doses as low as 0.25 mg/kg, suggesting that conventional phase I clinical trials may not be appropriate for PDT protocols.

Borgatti-Jeffreys, Antonella; Hooser, Stephen B.; Miller, Margaret A.; Thomas, Rose M.; deGortari, Amalia; Lucroy, Michael D.

2005-04-01

212

Dimer formation in phthalocyanine-doped sol-gel materials  

NASA Astrophysics Data System (ADS)

A number of different organic molecules have been used as optical probes of the sol-gel process. There is relatively little information, however, as to whether these molecules remain well isolated within the sol-gel structure or if they tend to form dimers or higher aggregates within the network. This issue is particularly important for doped sol-gel optical materials as dimer formation can exert a significant influence on the optical properties of dyes. The present paper uses the optical absorption characteristics of copper phthalocyanine tetrasulfonate (CuPcts) to determine how the state of the dye is affected by the chemical changes during the sol-gel process. The absorption spectra of CuPcts indicate that the dye molecules are dimerized in acid-catalyzed silica xerogels prepared from TMOS. The dimerization is largely controlled by the chemical environment inside the pores. By using appropriate reference solutions, we are able to identify the factors which cause dimerization and the stages of the sol-gel-xerogel transformation when the dimers form. These factors include the quantity of solvent remaining in the pores, the alcohol/water content of the solvent and its acidity. It is shown that by modifying the sol-gel processing conditions and the solvent chemistry within the pores, it is possible to reduce significantly dimer formation in silica xerogels.

Fuqua, Peter D.; Dunn, Bruce S.; Zink, Jeffrey I.

1994-10-01

213

Photodynamic Therapy with the Phthalocyanine Photosensitizer Pc 4  

PubMed Central

Photodynamic therapy (PDT) is emerging as a promising non-invasive treatment for cancers. PDT involves either local or systemic administration of a photosensitizing drug, which preferentially localizes within the tumor, followed by illumination of the involved organ with light, usually from a laser source. Here, we provide a selective overview of our experience with PDT at Case Western Reserve University, specifically with the silicon phthalocyanine photosensitizer Pc 4. We first review our in-vitro studies evaluating the mechanism of cell killing by Pc 4-PDT. Then we briefly describe our clinical experience in a Phase I trial of Pc 4-PDT and our preliminary translational studies evaluating the mechanisms behind tumor responses. Preclinical work identified (a) cardiolipin and the anti-apoptotic proteins Bcl-2 and Bcl-xL as targets of Pc 4-PDT, (b) the intrinsic pathway of apoptosis, with the key participation of caspase-3, as a central response of many human cancer cells to Pc 4-PDT, (c) signaling pathways that could modify apoptosis, and (d) a formulation by which Pc 4 could be applied topically to human skin and penetrate at least through the basal layer of the epidermis. Clinical-translational studies enabled us to develop an immunohistochemical assay for caspase-3 activation, using biopsies from patients treated with topical Pc 4 in a Phase I PDT trial for cutaneous T-cell lymphoma. Results suggest that this assay may be used as an early biomarker of clinical response. PMID:17397888

Miller, Janine D.; Baron, Elma D.; Scull, Heather; Hsia, Andrew; Berlin, Jeffrey C.; McCormick, Thomas; Colussi, Valdir; Kenney, Malcolm E.; Cooper, Kevin D.; Oleinick, Nancy L.

2007-01-01

214

Influence of film thickness and air exposure on the transport gap of manganese phthalocyanine  

SciTech Connect

The interface formation between manganese phthalocyanine (MnPc) and cobalt was investigated combining ultraviolet photoelectron spectroscopy and inverse photoelectron spectroscopy. The transport band gap of the MnPc increases with the film thickness up to a value of (1.2 {+-} 0.3) eV while the optical band gap as determined from spectroscopic ellipsometry amounts to 0.5 eV. The gap values are smaller compared to other phthalocyanines due to metallic Mn 3d states close to the Fermi level. The transport band gap was found to open upon air exposure as a result of the disappearance of the occupied 3d electronic states.

Haidu, F.; Fechner, A.; Salvan, G.; Gordan, O. D.; Fronk, M.; Zahn, D. R. T. [Semiconductor Physics, Chemnitz University of Technology, D-09107 Chemnitz (Germany); Lehmann, D. [Semiconductor Physics, Chemnitz University of Technology, D-09107 Chemnitz (Germany); INNOVENT Technology Development, D-07745 Jena (Germany); Mahns, B.; Knupfer, M. [Electronic and Optical Properties Department, IFW Dresden, D-01171 Dresden (Germany)

2013-06-15

215

Interaction of targeted liposomes with primary cultured hepatic stellate cells: involvement of multiple receptor systems  

Microsoft Academic Search

Abstract Background\\/Aims: For designing a versatile liposomal drug carrier to hepatic stellate cells (HSC), the interaction of mannose 6-phosphate human serum albumin (M6P-HSA) liposomes with cultured cells was studied. Methods: M6P-HSA was covalently coupled to the liposomal surface and the uptake and binding of 3H-labelled M6P-HSA liposomes by primary rat HSC and liver endothelial cells was determined. The targeting ability

Joanna E. Adrian; Klaas Poelstra; Gerrit L. Scherphof; Grietje Molema; Dirk K. F. Meijer; Catharina Reker-Smit; Henriëtte W. M. Morselt; Jan A. A. M. Kamps

2006-01-01

216

Curcumin-loaded ?-cyclodextrin liposomal nanoparticles as delivery vehicles for osteosarcoma  

Microsoft Academic Search

The delivery of curcumin, a broad-spectrum anticancer drug, has been explored in the form of liposomal nanoparticles to treat osteosarcoma (OS). Curcumin is water insoluble and an effective delivery route is through encapsulation in cyclodextrins followed by a second encapsulation in liposomes. Liposomal curcumin's potential was evaluated against cancer models of mesenchymal (OS) and epithelial origin (breast cancer). The resulting

Santosh S. Dhule; Patrice Penfornis; Trivia Frazier; Ryan Walker; Joshua Feldman; Grace Tan; Jibao He; Alina Alb; Vijay John; Radhika Pochampally

217

Light- and temperature-responsive liposomes incorporating cinnamoyl Pluronic F127.  

PubMed

Light- and temperature-responsive liposomes were prepared by immobilizing cinnamoyl Pluronic F127 (CP F127) on the surface of egg phosphatidylcholine liposomes. CP F127 was prepared by a condensation reaction, and the molar ratio of cinnamoyl group to Pluronic F127 was calculated to be 1:1.4 on (1)H NMR spectrum. The cinnamoyl group of CP F127 was readily dimerized under the irradiation of a UV light (254 nm, 6 W). CP F127 decreased the absolute value of the zeta potential of liposome possibly because it can shift the hydrodynamic plane away from the liposome surface. The size of liposome decorated with CP F127, measured on a dynamic light scattering machine and observed on a TEM, was larger than that of bare liposome. The liposome bearing CP F127 seemed to fuse and aggregate each other. The liposome released calcein, a fluorescence dye, in response to a UV irradiation, possibly because the photo-dimerization of cinnamoyl group perturbs the liposomal membrane. Moreover, the liposome released the dye in response to a temperature change, possible due to the phase transition of Pluronic F127 layer on the liposomal surface or the hydrophobic interaction of the polymer with liposomal membrane. PMID:24709213

Wang, MinHui; Kim, Jin-Chul

2014-07-01

218

In Vitro Gene Delivery Mediated by Asialofetuin-Appended Cationic Liposomes Associated with ?-Cyclodextrin into Hepatocytes  

PubMed Central

The purpose of this study is to evaluate in vitro gene delivery mediated by asialofetuin-appended cationic liposomes (AF-liposomes) associating cyclodextrins (CyD/AF-liposomes) as a hepatocyte-selective nonviral vector. Of various CyDs, AF-liposomes associated with plasmid DNA (pDNA) and ?-cyclodextrin (?-CyD) (pDNA/?-CyD/AF-liposomes) showed the highest gene transfer activity in HepG2 cells without any significant cytotoxicity. In addition, ?-CyD enhanced the encapsulation ratio of pDNA with AF-liposomes, and also increased gene transfer activity as the entrapment ratio of pDNA into AF-liposomes was increased. ?-CyD stabilized the liposomal membrane of AF-liposomes and inhibited the release of calcein from AF-liposomes. The stabilizing effect of ?-CyD may be, at least in part, involved in the enhancing gene transfer activity of pDNA/?-CyD/AF-liposomes. Therefore, these results suggest the potential use of ?-CyD for an enhancer of transfection efficiency of AF-liposomes. PMID:21490752

Motoyama, Keiichi; Nakashima, Yoshihiro; Aramaki, Yukihiko; Hirayama, Fumitoshi; Uekama, Kaneto; Arima, Hidetoshi

2011-01-01

219

Effect of formulation design and freeze-drying on properties of fluconazole multilamellar liposomes  

PubMed Central

Fluconazole-entrapped multilamellar liposomes were prepared using the thin-film hydration method. The effects of cholesterol molar ratio, charge-inducing agents, and ?-tocopherol acetate on encapsulation efficiency values and in vitro drug release of multilamellar liposomes were studied. Freeze-dried liposomal products were prepared with or without cryoprotectants. Results showed that incorporation of stearylamine resulted in an increased entrapment of fluconazole, whereas incorporation of dicetyl phosphate decreased the drug entrapment efficiency. The incorporation of ?-tocopherol acetate into fluconazole multilamellar liposomes resulted in the increase of entrapment efficiency of fluconazole liposomes. In vitro release studies revealed that incorporation of cholesterol into multilamellar liposomal formulations decreased drug permeability from formulations. Positively charged fluconazole multilamellar liposomes gave rise to a slow release rate compared to neutral liposomes whereas negatively charged fluconazole liposomes showed a rapid release rate. Physical stability studies showed that lyophilized cake of liposomes without cryoprotectants was compact and difficult to reconstitute compared to fluffy easily reconstituted cakes upon using cryoprotectants. Fluconazole retained in freeze-dried liposomes without cryoprotectants was 63.452% compared to 91.877% using three grams of trehalose as a cryoprotectant per gram lipid in positively charged multilamellar liposomes. Physical stability studies showed superior potentials of the lyophilized product after reconstitution in comparison with those of a solution product. PMID:23960730

El-Nesr, Ola H.; Yahiya, Soad A.; El-Gazayerly, Omaima N.

2010-01-01

220

Liposome-encapsulated ursolic acid increases ceramides and collagen in human skin cells  

Microsoft Academic Search

Skin wrinkling and xerosis associated with aging result from decreases in dermal collagen and stratum corneum ceramide content. This study demonstrated that ursolic acid incorporated into liposomes (URA liposomes) increases both the ceramide content of cultured normal human epidermal keratinocytes (NHEK), and the collagen content of cultured normal human dermal fibroblasts. In addition, URA liposomes increased the ceramide content of

Dawn M. Both; Karina Goodtzova; Daniel B. Yarosh; David A. Brown

2002-01-01

221

Liposome encapsulated vitamin A compounds exhibit greater stability and diminished toxicity  

Microsoft Academic Search

Absorption and fluorescence studies of retinol vitamin A alcohol and retinol palmitate vitamin A palmitate . intercalated in phosphatidylcholine PC liposomes show that these compounds are bound to the lipid bilayer. It is further found that retinol binds liposomes with greater affinity as compared to retinol palmitate. In addition, the delivery of liposome-incorporated retinoids to the blood has also been

Anil K. SinghU; Joydip Das

222

Enrichment of Artemia nauplii in vitamin A, vitamin C and methionine using liposomes  

Microsoft Academic Search

Several types of liposomes were used to enrich Artemia nauplii in vitamin A, vitamin C and free methionine. In a first experiment, unilamellar liposomes formulated with krill phospholipid extract and retinyl palmitate demonstrated their capability to enhance the retinol content of Artemia nauplii. Furthermore, the increase in retinol was related to the amount of retinyl palmitate included in the liposomes

Óscar Monroig; Juan Carlos Navarro; Francisco Amat; Francisco Hontoria

2007-01-01

223

A Plackett–Burnam screening design directs the efficient formulation of multicomponent DRV liposomes  

Microsoft Academic Search

A computer-based technique was applied for the optimization of recently described multicomponent protective liposomal formulations. These formulations contain riboflavin in either free form or complexed with ?-cyclodextrin as a model drug, sensitive to photochemical degradation, as well as various light absorbers and antioxidants incorporated into the lipid bilayer and\\/or the aqueous phase of liposomes. During the liposomal preparation, a series

Yannis L Loukas

2001-01-01

224

Liposome encapsulated vitamin A compounds exhibit greater stability and diminished toxicity  

Microsoft Academic Search

Absorption and fluorescence studies of retinol (vitamin A alcohol) and retinol palmitate (vitamin A palmitate) intercalated in phosphatidylcholine (PC) liposomes show that these compounds are bound to the lipid bilayer. It is further found that retinol binds liposomes with greater affinity as compared to retinol palmitate. In addition, the delivery of liposome-incorporated retinoids to the blood has also been studied

Anil K Singh; Joydip Das

1998-01-01

225

Structure of drug delivery DPPA and DPPC liposomes with ligands and their permeability through cells.  

PubMed

Abstract Dipalmitoylphosphatidylcholine (DPPC) and 1,2-palmitoyl-phosphatidic acid (DPPA) liposomes, prepared by conventional rotary evaporation method, have similar structural organization, though they have significant differences. The similarity is that both types of lipids create standard bilayer liposomes with strong hydrophobic forces between lipids tails and with homogeneous bonds of hydrogen and electrostatic nature between hydrophilic lipids heads. By the calorimetric method, it has been shown that hydrophobic bonds break but liposomes' destruction does not occur by heating till 150?°C. As for bonds between lipid heads in liposomes, their cooperative destruction takes place at 41?°C for DPPC and 66?°C for DPPA liposomes. In the case of thermal distraction of DPPC liposomes, two so-called pre transitions peaks were observed before the main transition peak, which indicates that DPPC liposomes' structure is multilamellar. DPPA liposomes have one cooperative heat absorption peak, which points to a unilamellar structure of such liposomes. Substances of hydrophobic/hydrophilic nature, incorporated into the liposomes, are placed in hydrophobic or hydrophilic parts of liposomes, which lead to a change in calorimetric peak shapes and thermodynamic parameters. It has been shown that gold nanoparticles, incorporated into the DPPC liposomes, are able to enter Caco-2 cells. In contrast, these nanoparticles do not enter red blood cells. PMID:24766638

Khvedelidze, Mariam; Mdzinarashvili, Tamaz; Shekiladze, Eka; Schneider, Marc; Moersdorf, Daniel; Bernhardt, Ingolf

2015-03-01

226

Effect of anions on the cation selectivity of gramicidin-containing liposomes  

Microsoft Academic Search

Summary An osmotic method was used to study the salt permeability induced by gramicidin A in liposomes. Sequences of cation permeation were obtained for iodide, salycilate, acetate und formate salts in liposomes below and above their transition temperature. Salycilate and formate salts, unlike acetate and iodide salts, exhibit the same sequences for cation selectivity in liposomes below and above their

B. Eleazar Cohen

1982-01-01

227

Enhanced localization of anticancer drug in tumor tissue using polyethylenimine-conjugated cationic liposomes  

NASA Astrophysics Data System (ADS)

Liposome-based drug delivery systems hold great potential for cancer therapy. However, to enhance the localization of payloads, an efficient method of systemic delivery of liposomes to tumor tissues is required. In this study, we developed cationic liposomes composed of polyethylenimine (PEI)-conjugated distearoylglycerophosphoethanolamine (DSPE) as an enhanced local drug delivery system. The particle size of DSPE-PEI liposomes was 130 ± 10 nm and the zeta potential of liposomes was increased from -25 to 30 mV by the incorporation of cationic PEI onto the liposomal membrane. Intracellular uptake of DSPE-PEI liposomes by tumor cells was 14-fold higher than that of DSPE liposomes. After intratumoral injection of liposomes into tumor-bearing mice, DSPE-PEI liposomes showed higher and sustained localization in tumor tissue compared to DSPE liposomes. Taken together, our findings suggest that DSPE-PEI liposomes have the potential to be used as effective drug carriers for enhanced intracellular uptake and localization of anticancer drugs in tumor tissue through intratumoral injection.

Han, Hee Dong; Byeon, Yeongseon; Jeon, Hat Nim; Shin, Byung Cheol

2014-05-01

228

In vivo targeting of acoustically reflective liposomes for intravascular and transvascular ultrasonic enhancement  

Microsoft Academic Search

OBJECTIVESThe purpose of this study was to target acoustically reflective liposomes to atherosclerotic plaques in vivo for ultrasound image enhancement.BACKGROUNDWe have previously demonstrated the development of acoustically reflective liposomes that can be conjugated for site-specific acoustic enhancement. This study evaluates the ability of liposomes coupled to antibodies specific for different components of atherosclerotic plaques and thrombi to target and enhance

Sasha M. Demos; Hayat Alkan-Onyuksel; Bonnie J. Kane; Kishin Ramani; Ashwin Nagaraj; Rodney Greene; Melvin Klegerman; David D. McPherson

1999-01-01

229

A new class of pegylated plasmonic liposomes: Synthesis and characterization.  

PubMed

The multifunctional nanoobjects that can be controlled, manipulated and triggered using external stimuli represent very promising candidates for nanoscale therapeutic and diagnostic applications. In this study we report the successful synthesis and characterization of a new class of very stable multifunctional nanoobjects, containing cationic liposomes decorated with PEGylated gold nanoparticles (PEGAuNPs). The multifunctional hybrid nanoobjects (mHyNp) were prepared by taking advantage of the electrostatic interactions between small unilamelar cationic liposomes and negatively charged gold nanoparticles. The mHyNps have been investigated by UV-VIS absorption spectroscopy, Dynamic Light Scattering (DLS), Zeta Potential Measurements and Transmission Electron Microscopy (TEM). The TEM images clearly revealed the attachment of individual gold nanoparticles onto the spherical outer surface of the cationic liposomes which was also confirmed by DLS and UV-VIS data. Furthermore, the plasmonic properties of the hybrid complexes have been evaluated by using the Surface Enhanced Raman Spectroscopy (SERS) technique. It is shown that PEG mediated interaction between the liposomes and the gold nanoparticles enabled the recording of the SER spectra of the liposomes in aqueous environment, thus demonstrating the plasmonic properties of the hybrids. PMID:25310578

Stiufiuc, Rares; Iacovita, Cristian; Stiufiuc, Gabriela; Florea, Adrian; Achim, Marcela; Lucaciu, Constantin M

2015-01-01

230

Application of Liposomes in Treatment of Rheumatoid Arthritis: Quo Vadis  

PubMed Central

The most common treatments for rheumatoid arthritis include nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids, disease modifying antirheumatic drugs (DMARDs), and some biological agents. However, none of the treatments available is able to achieve the ultimate goal of treatment, that is, drug-free remission. This limitation has shifted the focus of treatment to delivery strategies with an ability to deliver the drugs into the synovial cavity in the proper dosage while mitigating side effects to other tissues. A number of approaches like microemulsions, microspheres, liposomes, microballoons, cocrystals, nanoemulsions, dendrimers, microsponges, and so forth, have been used for intrasynovial delivery of these drugs. Amongst these, liposomes have proven to be very effective for retaining the drug in the synovial cavity by virtue of their size and chemical composition. The fast clearance of intra-synovially administered drugs can be overcome by use of liposomes leading to increased uptake of drugs by the target synovial cells, which in turn reduces the exposure of nontarget sites and eliminates most of the undesirable effects associated with therapy. This review focuses on the use of liposomes in treatment of rheumatoid arthritis and summarizes data relating to the liposome formulations of various drugs. It also discusses emerging trends of this promising technology. PMID:24688450

Singh, Sachin Kumar; Gulati, Monica

2014-01-01

231

Development and Characterization of Liposomal Doxorubicin Hydrochloride with Palm Oil  

PubMed Central

The usage of natural products in pharmaceuticals has steadily seen improvements over the last decade, and this study focuses on the utilization of palm oil in formulating liposomal doxorubicin (Dox). The liposomal form of Dox generally minimizes toxicity and enhances target delivery actions. Taking into account the antiproliferative and antioxidant properties of palm oil, the aim of this study is to design and characterize a new liposomal Dox by replacing phosphatidylcholine with 5% and 10% palm oil content. Liposomes were formed using the freeze_thaw method, and Dox was loaded through pH gradient technique and characterized through in vitro and ex vivo terms. Based on TEM images, large lamellar vesicles (LUV) were formed, with sizes of 438 and 453?nm, having polydispersity index of 0.21 ± 0.8 and 0.22 ± 1.3 and zeta potentials of about ?31 and ?32?mV, respectively. In both formulations, the entrapment efficiency was about 99%, and whole Dox was released through 96 hours in PBS (pH = 7.4) at 37°C. Comparing cytotoxicity and cellular uptake of LUV with CaelyxR on MCF7 and MDA-MBA 231 breast cancer cell lines indicated suitable uptake and lower IC50 of the prepared liposomes. PMID:24795894

Sabeti, Bahareh; Noordin, Mohamed Ibrahim; Mohd, Shaharuddin; Hashim, Rosnani; Akbari Javar, Hamid

2014-01-01

232

Liposomes containing drugs for treatment of vaginal infections.  

PubMed

To develop a novel vaginal delivery system, able to effectively deliver entrapped drugs during an extended period of time at the site of action, liposomes made of phosphatidylcholine were prepared by two different methods, namely the polyol dilution method and the proliposome method. Liposomes containing three commonly applied drugs in the treatment of vaginal infections: clotrimazole, metronidazole and chloramphenicol were tested for in vitro stability (in buffers at pH 4.5 and 5.9 representing pre- and postmenopausal vaginal pH). In situ stability (in the presence of cow vaginal mucosa) showed that after 6 h incubation (at 37 degrees C), liposomes retained more than 40% of originally entrapped clotrimazole, 28% of entrapped metronidazole or 37% of entrapped chloramphenicol. In vitro and in situ stability studies confirmed the applicability of liposomes as a carrier system for vaginal delivery. Even after 24 h of incubation in the presence of vaginal mucosa liposomes retained sufficient amounts of entrapped drugs. PMID:10425385

Paveli?, Z; Skalko-Basnet, N; Jalsenjak, I

1999-08-01

233

Crosslinked Multilamellar Liposomes for Controlled Delivery of Anticancer Drugs  

PubMed Central

Liposomes constitute one of the most popular nanocarriers for the delivery of cancer therapeutics. However, since their potency is limited by incomplete drug release and inherent instability in the presence of serum components, their poor delivery occurs in certain circumstances. In this study, we address these shortcomings and demonstrate an alternative liposomal formulation, termed crosslinked multilamellar liposome (CML). With its properties of improved sustainable drug release kinetics and enhanced vesicle stability, CML can achieve controlled delivery of cancer therapeutics. CML stably encapsulated the anticancer drug doxorubicin (Dox) in the vesicle and exhibited a remarkably controlled rate of release compared to that of the unilamellar liposome (UL) with the same lipid composition or Doxil-like liposome (DLL). Our imaging study demonstrated that the CMLs were mainly internalized through a caveolin-dependent pathway and were further trafficked through the endosome-lysosome compartments. Furthermore, in vivo experiments showed that the CML-Dox formulation reduced systemic toxicity and significantly improved therapeutic activity in inhibiting tumor growth compared to that of UL-Dox or DLL-Dox. This drug packaging technology may therefore provide a new treatment option to better manage cancer and other diseases. PMID:23375392

Joo, Kye-Il; Xiao, Liang; Liu, Shuanglong; Liu, Yarong; Lee, Chi-Lin; Conti, Peter S.; Wong, Michael K.; Li, Zibo; Wang, Pin

2014-01-01

234

Liposomes self-assembled from electrosprayed composite microparticles  

NASA Astrophysics Data System (ADS)

Composite microparticles, consisting of polyvinylpyrrolidone (PVP), naproxen (NAP) and lecithin (PC), have been successfully prepared using an electrospraying process and exploited as templates to manipulate molecular self-assembly for the synthesis of liposomes in situ. Field emission scanning electron microscope (FESEM) and transmission electron microscope (TEM) observations demonstrate that the microparticles have an average diameter of 960 ± 140 nm and a homogeneous structure. X-ray diffraction (XRD) patterns, differential scanning calorimetry (DSC) and attenuated total reflectance-Fourier transform infrared (ATR-FTIR) results verify that the building blocks NAP and PC are scattered in the polymer matrix in a molecular way owing to the very fast drying of the electrospraying process and the favorable secondary interactions among the components. FESEM, scanning probe microscope (SPM) and TEM observations demonstrate that the liposomes can be achieved through molecular self-assembly in situ when the microparticles contact water thanks to ‘like prefers like’ and by means of the confinement effect of the microparticles. The liposomes have an encapsulation rate of 91.3%, and 80.7% of the drug in the liposomes can be freed into the dissolution medium in a sustained way and by a diffusion mechanism over a period of 24 h. The developed strategy not only provides a new, facile, and effective method to assemble and organize molecules of multiple components into liposomes with electrosprayed microparticles as templates, but also opens a new avenue for nanofabrication in a step-by-step and controllable way.

Yu, Deng-Guang; Yang, Jun-He; Wang, Xia; Tian, Feng

2012-03-01

235

Targeted Liposomal Drug Delivery to Monocytes and Macrophages  

PubMed Central

As the role of monocytes and macrophages in a range of diseases is better understood, strategies to target these cell types are of growing importance both scientifically and therapeutically. As particulate carriers, liposomes naturally target cells of the mononuclear phagocytic system (MPS), particularly macrophages. Loading drugs into liposomes can therefore offer an efficient means of drug targeting to MPS cells. Physicochemical properties including size, charge and lipid composition can have a very significant effect on the efficiency with which liposomes target MPS cells. MPS cells express a range of receptors including scavenger receptors, integrins, mannose receptors and Fc-receptors that can be targeted by the addition of ligands to liposome surfaces. These ligands include peptides, antibodies and lectins and have the advantages of increasing target specificity and avoiding the need for cationic lipids to trigger intracellular delivery. The goal for targeting monocytes/macrophages using liposomes includes not only drug delivery but also potentially a role in cell ablation and cell activation for the treatment of conditions including cancer, atherosclerosis, HIV, and chronic inflammation. PMID:21512579

Kelly, Ciara; Jefferies, Caroline; Cryan, Sally-Ann

2011-01-01

236

Synthesis of mesogenic phthalocyanine-C60 donor–acceptor dyads designed for molecular heterojunction photovoltaic devices  

PubMed Central

Summary A series of phthalocyanine-C60 dyads 2a–d was synthesized. Key steps in their synthesis are preparation of the low symmetry phthalocyanine intermediate by the statistical condensation of two phthalonitriles, and the final esterification of the fullerene derivative bearing a free COOH group. Structural characterization of the molecules in solution was performed by NMR spectroscopy, UV–vis spectroscopy and cyclic voltammetry. Preliminary studies suggest formation of liquid crystalline (LC) mesophases for some of the prepared dyads. To the best of our knowledge, this is the first example of LC phthalocyanine-C60 dyads. PMID:19936269

Debever, Olivier; Amato, Claire

2009-01-01

237

Acetyl l -carnitine influences the fluidity of brain microsomes and of liposomes made of rat brain microsomal lipid extracts  

Microsoft Academic Search

The fluorescence anisotropy (r) of diphenylhexatriene (DPH) was measured in different preparations (bovine spinal cord phosphatidylserine liposomes, rat brain microsomes, liposomes made with rat brain microsomal lipid having different phospholipid:cholesterol ratios) at temperatures ranging from 10° to 55°C. Phosphatidylserine liposomes exhibited an exponential relationship of rversus temperature, whereas the relationship shown by microsomes and liposomes prepared with microsomal lipid extracts

Giuseppe Arienti; Maria Teresa Ramacci; Franco Maccari; Angela Casu; Lanfranco Corazzi

1992-01-01

238

The organ distribution of liposome-encapsulated and free cobalt in rats. Liposomes decrease the cardiac uptake of the metal  

SciTech Connect

Rats were administered intravenously liposome-encapsulated or free cobalt, and the organ distribution of the metal was explored using Co{sup 57} tracer. Two hours after administration, the cobalt level in the heart was about 40 % of the control when given in sphingomyelin (SM)/cholesterol (CH) (1:1 mole ratio) liposomes. These vesicles also tended to decrease the uptake of cobalt in the kidney and the carcass, and to increase it in the spleen and the bones. Liposomes prepared from soybean phosphatidylcholine (SPC)/CH (1:1) had no effect on the uptake of cobalt in the heart, whereas increased its level in the spleen, liver and lung. The time-course of cobalt deposition in the organs displayed substantial variation with the different preparations. Most importantly, no buildup of cobalt level was observed in the heart when the metal was administered in SM/CH vesicles. While confirming known effects of liposomes on the organ-distribution of entrapped drugs, our findings suggest that administration of cobalt in SM/CH liposome-encapsulated form may result in decreased cardiotoxicity and thus increased safety of cobalt-treatment in some anemias.

Garcia, R.; Eskelson, C.D.; Chvapil, M. (Univ. of Arizona, Tucson (USA)); Szebeni, J. (Univ. of Arizona, Tucson (USA) National Institute of Food Hygiene and Nutrition, Budapest (Hungary))

1989-01-01

239

Liposomal extended-release bupivacaine for postsurgical analgesia  

PubMed Central

When physicians consider which analgesia to use postsurgery, the primary goal is to relieve pain with minimal adverse side effects. Bupivacaine, a commonly used analgesic, has been formulated into an aqueous suspension of multivesicular liposomes that provide long-lasting analgesia for up to 72 hours, while avoiding the adverse side effects of opioids. The increased efficacy of liposomal extended-release bupivacaine, compared to bupivacaine hydrochloride, has promoted its usage in a variety of surgeries including hemorrhoidectomy, bunionectomy, inguinal hernia repair, total knee arthroplasty, and augmentation mammoplasty. However, like other bupivacaine formulations, the liposomal extended-release bupivacaine does have some side effects. In this brief review, we provide an update of the current knowledge in the use of bupivacaine for postsurgical analgesia. PMID:24043932

Lambrechts, Mark; O’Brien, Michael J; Savoie, Felix H; You, Zongbing

2013-01-01

240

Liposomes and nanoparticles: nanosized vehicles for drug delivery in cancer.  

PubMed

Nanoscale drug delivery systems using liposomes and nanoparticles are emerging technologies for the rational delivery of chemotherapeutic drugs in the treatment of cancer. Their use offers improved pharmacokinetic properties, controlled and sustained release of drugs and, more importantly, lower systemic toxicity. The commercial availability of liposomal Doxil and albumin-nanoparticle-based Abraxane has focused attention on this innovative and exciting field. Recent advances in liposome technology offer better treatment of multidrug-resistant cancers and lower cardiotoxicity. Nanoparticles offer increased precision in chemotherapeutic targeting of prostate cancer and new avenues for the treatment of breast cancer. Here we review current knowledge on the two technologies and their potential applications to cancer treatment. PMID:19837467

Malam, Yogeshkumar; Loizidou, Marilena; Seifalian, Alexander M

2009-11-01

241

?-Lactoglobulin improves liposome's encapsulation properties for vitamin E delivery.  

PubMed

Vitamin E (VE) or ?-tocopherol is the major fat-soluble antioxidant in the human body. It is a sensitive, easily oxidized in the air, molecule, so it must be protected from pro-oxidant elements which could affect its physiological benefits. Encapsulation constitutes a promising approach to maintain VE native properties over time and increase its concentration in aqueous media. Liposomes have been studied as sustained delivery systems, being biodegradable, non-toxic and non-immunogenic. A new liposome/?-lactoglobulin (?-Lg) formulation has been developed and characterized as a possible stable delivery system for VE. ?-Lg has been selected due to its property to bind a variety of hydrophobic molecules. The aim of this study was the preparation of ?-Lg-liposome formulation and the determination of VE encapsulation efficiency, in order to develop a new more efficient carrier for VE in aqueous media. PMID:24099174

Rovoli, Magdalini; Gortzi, Olga; Lalas, Stavros; Kontopidis, George

2014-03-01

242

Design of liposomal colloidal systems for ocular delivery of ciprofloxacin  

PubMed Central

Ophthalmic drug bioavailability is limited due to protective mechanisms of the eye which require the design of a system to enhance ocular delivery. In this study several liposomal formulations containing ciprofloxacin (CPX) have been formulated using reverse phase evaporation technique with final dispersion of pH 7.4. Different types of phospholipids including Phosphatidylcholine, Dipalmitoylphosphatidylcholine and Dimyristoyl-sn-glycero-3-phosphocholine were utilized. The effect of formulation factors such as type of phospholipid, cholesterol content, incorporation of positively charging inducing agents and ultrasonication on the properties of the liposomal vesicles was studied. Bioavailability of selected liposomal formulations in rabbit eye aqueous humor has been investigated and compared with that of commercially available CPX eye drops (Ciprocin®). Pharmacokinetic parameters including Cmax, Tmax, elimination rate constant, t1/2, MRT and AUC0–?, were determined. The investigated formulations showed more than three folds of improvement in CPX ocular bioavailability compared with the commercial product. PMID:25061409

Taha, Ehab I.; El-Anazi, Magda H.; El-Bagory, Ibrahim M.; Bayomi, Mohsen A.

2013-01-01

243

Copper phthalocyanine as an efficient dopant in development of solar cells  

SciTech Connect

Organic semiconductors having conjugate bonds, such as phthalocyanines, are well known photoconductors. Phthalocyanines absorb light on either side of blue-green region in the visible spectrum. And polyaniline which has conjugate bonds is photosensitive. When polyaniline thin films are prepared with copper phthalocyanine powder the magnitude of absorption of the films not only increases but also broadens, indicating a wide absorption region between 1.7 and 2.3 eV and above 3.0 eV of the visible spectrum. Thus copper phthalocyanine in preparation of thin films is shown to smooth the broadening effect in absorption of solar cells. Attempts are underway to increase the absorption on either end of the visible spectrum, viz., infrared as well as ultraviolet regions, using suitable dopants. This would ensure the overall efficiency of solar cells made of organic photoconductive materials to absorb solar energy from infrared to ultraviolet regions of the optical spectrum, thereby making them more efficient solar energy converters.

Inigo, A.R.; Xavier, F.P. [Loyola Coll., Madras (India)] [Loyola Coll., Madras (India); Goldsmith, G.J. [Boston Coll., Chestnut Hill, MA (United States). Physics Dept.] [Boston Coll., Chestnut Hill, MA (United States). Physics Dept.

1997-05-01

244

Metal (2) 4,4',4",4'" phthalocyanine tetraamines as curing agents for epoxy resins  

NASA Technical Reports Server (NTRS)

Metal, preferably divalent copper, cobalt or nickel, phthalocyanine tetraamines are used as curing agents for epoxides. The resulting copolymers have high thermal and chemical resistance and are homogeneous. They are useful as binders for laminates, e.g., graphite cloth laminate.

Achar, B. N.; Fohlen, G. M.; Parker, J. A. (inventors)

1985-01-01

245

Intrinsic dielectric properties and charge transport in oligomers of organic semiconductor copper phthalocyanine  

Microsoft Academic Search

Various contributions are distinguished in the experimentally detected dielectric response of organic semiconductor copper phthalocyanine. While a giant dielectric constant of virgin samples is shown to be due to extrinsic effects, the temperature dependence of the intrinsic dielectric constant, being of the order of 10, indicates two structural phase transitions, as well as a dielectric relaxation reflecting the charge carriers'

V. Bobnar; A. Levstik; C. Huang; Q. M. Zhang

2005-01-01

246

WASTES FROM MANUFACTURE OF DYES AND PIGMENTS. VOLUME 8. PHTHALOCYANINE DYES AND PIGMENTS  

EPA Science Inventory

A preliminary study of the manufacture of phthalocyanine dyes and pigments was conducted to determine if process waste streams might contain hazardous material. The study first identifies the dyes and pigments that belong to this segment of the industry, the amounts produced, and...

247

Scanning Electron Microscopic Characterization of Copper (II) Phthalocyanine Nanocrystallites Thin Films Deposited on Technologically Important Substrates  

Microsoft Academic Search

Field Emission Scanning Electron Microscopy (FESEM) demonstrates spectacular changes in the morphology of thin films of copper (II) phthalocyanine (CuPc) deposited on gold coated quartz substrates at different substrate temperatures, and on indium tin oxide (ITO) substrates at room temperature followed by post deposition annealing at various temperatures under normal atmosphere. The nature of substrates, the film deposition as well

Biswanath Mallik; Santanu Karan; Raja S. C. Mullick

248

ELSEVIER Synthetic ~Metals 84 (1997) 733-734 Electrical transport in monolayers of phthalocyanine molecular wires  

E-print Network

ELSEVIER Synthetic ~Metals 84 (1997) 733-734 Electrical transport in monolayers of phthalocyanine for electrical transport studies on single molecular wires. Current-voltage measurements on monolayers of a single molecular wire bridging two closely spaced electrodes. Keywords: electrical transport measurements

Dekker, Cees

249

Metabolism of the phthalocyanine textile dye remazol turquoise blue by Phanerochaete chrysosporium  

Microsoft Academic Search

The ability of a strain of Phanerochaete chrysosporium to decolourise the commercially important copper-phthalocyanine dye Remazol turquoise blue was investigated. The fungus was found to completely decolourise the dye at a concentration of 200 mg l?1 within 7 days. High performance liquid chromatography (HPLC) and polarographic analysis of culture supernatants indicated that degradation of the dye structure was occurring with

A Conneely; W. F Smyth; G McMullan

1999-01-01

250

Small Liposomes Accelerate the Fibrillation of Amyloid ? (1-40).  

PubMed

The deposition of amyloid ? (A?) peptides is a pathological hallmark of Alzheimer disease. A? peptides were previously considered to interact specifically with ganglioside-containing membranes. Several studies have suggested that A? peptides also bind to phosphatidylcholine membranes, which lead to deformation of membranes and fibrillation of A?. Moreover, the role of membrane curvature, one type of deformation produced by binding of proteins to a membrane, in the binding and fibrillation of A? remains unclear. To clearly understand the relationship between the binding, consequent membrane deformation, and fibrillation of A?, we examined the amyloid fibrillation of A?-(1-40) in the presence of liposomes of various sizes. Membrane curvature increased with a decrease in the size of the liposomes. We used liposomes made of 1,2-dioleoyl-sn-glycero-3-phosphocholine to eliminate electrostatic effects. The results obtained showed that liposomes of smaller sizes (?50 nm) significantly accelerated the nucleation step, thereby shortening the lag time of fibrillation. On the other hand, liposomes of larger sizes decreased the amount of fibrils but did not notably affect the lag time. The morphologies of fibrils, which were monitored by total internal reflection fluorescence microscopy, atomic force microscopy, and transmission electron microscopy, revealed that the length of A?-(1-40) fibrils became shorter and the amount of amorphous aggregates became larger as liposomes increased in size. These results suggest that the curvature of membranes coupled with an increase in water-accessible hydrophobic regions is important for binding and concentrating A? monomers, leading to amyloid nucleation. Furthermore, amyloid fibrillation on membranes may compete with non-productive binding to produce amorphous aggregates. PMID:25406316

Terakawa, Mayu S; Yagi, Hisashi; Adachi, Masayuki; Lee, Young-Ho; Goto, Yuji

2015-01-01

251

Factors affecting the pharmacokinetics of pegylated liposomal doxorubicin in patients  

Microsoft Academic Search

Purpose  There is significant inter-patient variability in the pharmacokinetics of pegylated liposomal doxorubicin (PLD). Identification\\u000a of factors affecting the pharmacokinetics of PLD would enable personalization of therapy. We previously reported that age,\\u000a gender, body composition, and monocytes affect the clearance of other liposomal agents. Therefore, we evaluated how these\\u000a factors affect the pharmacokinetics of PLD.\\u000a \\u000a \\u000a \\u000a \\u000a Methods  Pharmacokinetic studies of PLD were performed

Ninh M. La-Beck; Beth A. Zamboni; Alberto Gabizon; Hilary Schmeeda; Michael Amantea; Paola A. Gehrig; William C. Zamboni

252

Liposomal squalenoyl-gemcitabine: formulation, characterization and anticancer activity evaluation  

NASA Astrophysics Data System (ADS)

A new prodrug of gemcitabine, based on the covalent coupling of squalene to gemcitabine (GemSQ), has been designed to enhance the anticancer activity of gemcitabine, a nucleoside analogue active against a wide variety of tumors. In the present study, the feasibility of encapsulating GemSQ into liposomes either PEGylated or non-PEGylated has been investigated. The in vivo anticancer activity of these formulations has been tested on subcutaneous grafted L1210wt leukemia model and compared to that of free gemcitabine. The liposomal GemSQ appears to be a potential delivery system for the effective treatment of tumors.

Pili, Barbara; ReddyCurrent Address: Sanofi-Aventis, 13 Quai Jules-Guesdes, 94403, Vitry-Sur-Seine, France., L. Harivardhan; Bourgaux, Claudie; Lepêtre-Mouelhi, Sinda; Desmaële, Didier; Couvreur, Patrick

2010-08-01

253

Liposomal squalenoyl-gemcitabine: formulation, characterization and anticancer activity evaluation.  

PubMed

A new prodrug of gemcitabine, based on the covalent coupling of squalene to gemcitabine (GemSQ), has been designed to enhance the anticancer activity of gemcitabine, a nucleoside analogue active against a wide variety of tumors. In the present study, the feasibility of encapsulating GemSQ into liposomes either PEGylated or non-PEGylated has been investigated. The in vivo anticancer activity of these formulations has been tested on subcutaneous grafted L1210wt leukemia model and compared to that of free gemcitabine. The liposomal GemSQ appears to be a potential delivery system for the effective treatment of tumors. PMID:20820745

Pili, Barbara; Reddy, L Harivardhan; Bourgaux, Claudie; Lepêtre-Mouelhi, Sinda; Desmaële, Didier; Couvreur, Patrick

2010-08-01

254

Pharmacokinetics of poly(hydroxyethyl- l-asparagine)-coated liposomes is superior over that of PEG-coated liposomes at low lipid dose and upon repeated administration  

Microsoft Academic Search

‘Stealth’ liposomes with a poly(ethylene glycol) (PEG) coating are frequently studied for drug delivery and diagnostic purposes because of their prolonged blood circulation kinetics. However, several recent reports have demonstrated that PEG-liposomes are rapidly cleared at single low lipid doses (<1 ?mol\\/kg) and upon repeated administration (time interval between the injections 5 days–4 weeks). Recently, poly(amino acid)-based stealth liposome coatings have

Birgit Romberg; Christien Oussoren; Cor J. Snel; Myrra G. Carstens; Wim E. Hennink; Gert Storm

2007-01-01

255

Hyaluronic acid derivative-coated nanohybrid liposomes for cancer imaging and drug delivery.  

PubMed

Nanohybrid liposomes coated with amphiphilic hyaluronic acid-ceramide (HACE) was fabricated for targeted delivery of anticancer drug and in vivo cancer imaging. Nanohybrid liposomes including doxorubicin (DOX) and Magnevist, a contrast agent for magnetic resonance (MR) imaging, with 120-130nm mean diameter and a narrow size distribution were developed. DOX release from the developed formulation was improved at acidic pH (pH5.5 and 6.8) versus physiological pH (pH7.4). Cytotoxicity induced by the blank plain liposome was reduced by coating the outer surface of the nanohybrid liposome with HACE. Cellular uptake of DOX from the nanohybrid liposome was enhanced by HA and CD44 receptor interaction, versus the plain liposome. In vivo contrast-enhancing effects revealed that the nanohybrid liposome can be used as a tumor targeting MR imaging probe for cancer diagnosis. In a pharmacokinetic study in rats, in vivo clearance of DOX was decreased in the order DOX solution, plain liposome (F2), and nanohybrid liposome (F3), indicating prolonged circulation of the drug in the blood stream and improved therapeutic efficacy of the nanohybrid liposome (F3). Based on these findings, the nanohybrid liposomal system may be a useful candidate for real-time cancer diagnosis and therapy. PMID:24280260

Park, Ju-Hwan; Cho, Hyun-Jong; Yoon, Hong Yeol; Yoon, In-Soo; Ko, Seung-Hak; Shim, Jae-Seong; Cho, Jee-Hyun; Park, Jae Hyung; Kim, Kwangmeyung; Kwon, Ick Chan; Kim, Dae-Duk

2014-01-28

256

Fluorescent cell-traceable dexamethasone-loaded liposomes for the treatment of inflammatory liver diseases.  

PubMed

Liposomes are routinely used carrier materials for delivering drug molecules to pathological sites. Besides in tumors and inflammatory sites, liposomes also strongly accumulate in liver and spleen. The potential of using liposomes to treat acute and chronic liver disorders, however, has not yet been evaluated. We here explored the therapeutic potential of dexamethasone (Dex)-loaded liposomes for inflammatory liver diseases, using experimental models of acute and chronic liver injury in mice. Fluorescently labeled liposomes predominantly accumulated in hepatic phagocytes, but also in T cells. Importantly, Dex-loaded liposomes reduced T cells in blood and liver, more effectively than free Dex, and endorsed the anti-inflammatory polarization of hepatic macrophages. In experimental chronic liver damage, Dex-loaded liposomes significantly reduced liver injury and liver fibrosis. In immune-mediated acute hepatitis Dex-loaded liposomes, but not free Dex, significantly reduced disease severity. T cells, not macrophages, were significantly depleted by Dex liposomes in liver disease models in vivo, as further supported by mechanistic cell death in vitro studies. Our data indicate that Dex liposomes may be an interesting treatment option for liver diseases, in particular for immune-mediated hepatitis. The depletion of T cells might represent the major mechanism of action of Dex liposomes, rather than their macrophage-polarizing activities. PMID:25453965

Bartneck, Matthias; Scheyda, Katharina M; Warzecha, Klaudia T; Rizzo, Larissa Y; Hittatiya, Kanishka; Luedde, Tom; Storm, Gert; Trautwein, Christian; Lammers, Twan; Tacke, Frank

2014-10-26

257

Liposomal delivery systems for encapsulation of ferrous sulfate: Preparation and characterization.  

PubMed

Liposomal delivery systems for water-soluble bioactives were prepared using the pro-liposome and the microfluidization technologies. Iron, an essential micronutrient as ferrous sulfate and ascorbic acid, as an antioxidant for iron were encapsulated in the liposomes. Liposomes prepared by the microfluidization technology using 6% (w/w) concentration of the lipid encapsulated with ferrous sulfate and ascorbic acid had particle size distributions around 150 to 200 nm, whereas liposomes from the pro-liposome technology resulted in particle sizes of about 5 microm. The encapsulation efficiency of ferrous sulfate was 58% for the liposomes prepared by the microfluidization using 6% (w/w) lipid and 7.5% of ferrous sulfate concentrations, and it was 11% for the liposomes from pro-liposome technology using 1.5% (w/v) lipid and 15% of ferrous-sulfate concentration. Both the liposomes exhibited similar levels of oxidative stability, demonstrating the feasibility of microfluidization-based liposomal delivery systems for large-scale food/nutraceutical applications. PMID:17162577

Kosaraju, Shantha L; Tran, Cindy; Lawrence, Andrew

2006-01-01

258

Liposomal carfilzomib nanoparticles effectively target multiple myeloma cells and demonstrate enhanced efficacy in vivo.  

PubMed

Carfilzomib, a recently FDA-approved proteasome inhibitor, has remarkable anti-myeloma (MM) activity. However, its effectiveness is limited by associated severe side-effects, short circulation half-life, and limited solubility. Here, we report the engineering of liposomal carfilzomib nanoparticles to overcome these problems and enhance the therapeutic efficacy of carfilzomib by increasing tumoral drug accumulation while decreasing systemic toxicity. In our design, carfilzomib was loaded into the bilayer of liposomes to yield stable and reproducible liposomal nanoparticles. Liposomal carfilzomib nanoparticles were efficiently taken up by MM cells, demonstrated proteasome inhibition, induced apoptosis, and exhibited enhanced cytotoxicity against MM cells. In vivo, liposomal carfilzomib demonstrated significant tumor growth inhibition and dramatically reduced overall systemic toxicity compared to free carfilzomib. Finally, liposomal carfilzomib demonstrated enhanced synergy in combination with doxorubicin. Taken together, this study establishes the successful synthesis of liposomal carfilzomib nanoparticles that demonstrates improved therapeutic index and the potential to improve patient outcome in MM. PMID:25312543

Ashley, Jonathan D; Stefanick, Jared F; Schroeder, Valerie A; Suckow, Mark A; Alves, Nathan J; Suzuki, Rikio; Kikuchi, Shohei; Hideshima, Teru; Anderson, Kenneth C; Kiziltepe, Tanyel; Bilgicer, Basar

2014-12-28

259

Development of a new resistant liposome coated with polysaccharide film for cosmetic application.  

PubMed

The aim of our study was to elaborate a resistant liposome that can be used in cosmetic formulations containing high amounts of surfactants and electrolytes. The stability of liposomes was increased via hydrophobized polysaccharide (Stearoyl Inulin) by anchoring its stearic acid tail into liposome bilayer. Coated and noncoated liposomes were prepared under the same conditions and their morphology, size, and resistance to surfactants and electrolytes were evaluated. We established that coated lipbsomes were more resistant to surfactants and electrolytes. It seems that a coating of polysaccharides prevents liposome destabilization in the presence of high amounts of surfactants and electrolytes. Moreover, the ability of coated liposomes to improve the skin delivery of active molecules was evaluated. Coated liposomes increased the efficacy of magnesium chloride by improving its skin availability. PMID:25423742

Belhaj, Nabila; Arnaud, Jean Pierre; Loing, Estelle; Bézivin, Carine

2014-01-01

260

Development of a new resistant liposome coated with polysaccharide film for cosmetic application.  

PubMed

The aim of our study was to elaborate a resistant liposome that can be used in cosmetic formulations containing high amounts of surfactants and electrolytes. The stability of liposomes was increased via hydrophobized polysaccharide (Stearoyl Inulin) by anchoring its stearic acid tail into liposome bilayer. Coated and noncoated liposomes were prepared under the same conditions and their morphology, size, and resistance to surfactants and electrolytes were evaluated. We established that coated lipbsomes were more resistant to surfactants and electrolytes. It seems that a coating of polysaccharides prevents liposome destabilization in the presence of high amounts of surfactants and electrolytes. Moreover, the ability of coated liposomes to improve the skin delivery of active molecules was evaluated. Coated liposomes increased the efficacy of magnesium chloride by improving its skin availability. PMID:25507465

Belhaj, Nabila; Arnaud, Jean Pierre; Loing, Estelle; Bézivin, Carine

2014-01-01

261

Tubular Liposomes with Variable Permeability for Reconstitution of FtsZ Rings  

PubMed Central

We have developed a system for producing tubular multilamellar liposomes that incorporate the protein FtsZ on the inside. We start with a mixture of spherical multilamellar liposomes with FtsZ initially on the outside. Shearing forces generated by applying a coverslip most likely distort some of the spherical liposomes into a tubular shape, and causes some to leak and incorporate FtsZ inside. We describe protocols for liposome preparation, and for preparing membrane-targeted FtsZ that can assemble contractile Z rings inside the tubular liposomes. We also describe the characterization of the multilamellar liposomes in terms of the permeability or leakiness for a small fluorescent dye and larger protein molecules. These liposomes may be useful for reconstitution of other biological systems. PMID:19903547

Osawa, Masaki; Erickson, Harold P.

2012-01-01

262

Ultrastructural effects of two phthalocyanines in CHO-K1 and HeLa cells after laser irradiation.  

PubMed

The effects of Photodynamic Therapy using 2nd generation photosensitizers have been widely investigated aiming clinical application treatment of solid neoplasms. In this work, ultrastructure changes caused by the action of two 2nd generation photosensitizers and laser irradiation on CHO-K1 and HeLa (neoplastic) cells were analyzed by transmission electron microscopy. Aluminum phthalocyanine chloride, aluminum phthalocyanine tetrasulfonate chloride and radiation from a semiconductor laser at a fluency of 0.5 J/cm2 (Power=26 mW; lambda=.670 nm) were used. The results showed induction of apoptosis. Such alterations where observed in HeLa but not in CHO-K1 cells after Aluminum phthalocyanine tetrasulfonate chloride (AlPcS4, photodynamic treatment. The Aluminum phthalocyanine chloride (AlPc) photodynamic treatment induced necrosis on the neoplastic cell line, and cytoplasm and nuclear alterations on the normal cell line. PMID:15002747

de Castro Pazos, Marcelo; Pacheco-Soares, Cristina; Soares da Silva, Newton; DaMatta, Renato Augusto; Pacheco, Marcos Tadeu T

2003-12-01

263

Preparation, characterization and properties of sterically stabilized paclitaxel-containing liposomes.  

PubMed

Paclitaxel (Taxol) is a diterpenoid isolated from Taxus brevifolia, approved by the FDA for the treatment of ovarian and breast cancers. Due to its low solubility in water, it is clinically administered dissolved in Cremophor EL, (polyethoxylated castor oil) and ethanol, which cause serious side effects. Inclusion of paclitaxel in liposomal formulations has proved to be a good approach to eliminating this vehicle and improving the drug's antitumor efficacy. We prepared different conventional and PEGylated liposomes containing paclitaxel and determined encapsulation efficiency, physical stability and drug leakage in human plasma. The best conventional liposome formulation was composed of ePC/PG 9:1, while for PEGylated liposomes the best composition was ePC/PG/CHOL/PEG(5000)-DPPE 9:1:2:0.7. PEGylated liposomes were found to be less stable during storage than the corresponding conventional liposomes and to have lower drug release in human plasma at 37 degrees C. In vitro cytotoxic activities were evaluated on HT-29 human colon adenocarcinoma and MeWo melanoma cell lines. After 2 and 48 h, conventional liposomes had the same cytotoxicity as free paclitaxel, while PEGylated liposomes were as active as free drug, only after 48 h. Pharmacokinetics and biodistribution were evaluated in Balb/c mice after i.v. injection of paclitaxel, formulated in Cremophor EL or in conventional or in PEGylated liposomes. Encapsulation of paclitaxel in conventional liposomes produced marked differences over the free drug pharmacokinetics. PEGylated liposomes were long-circulating liposomes, with an increased t(1/2) beta 48.6 h, against t(1/2) beta 9.27 h of conventional liposomes. Biodistribution studies showed a considerable decrease in drug uptake in MPS-containing organs (liver and spleen) at 0.5 and 3 h after injection with PEGylated compared to conventional liposomes. PMID:10640577

Crosasso, P; Ceruti, M; Brusa, P; Arpicco, S; Dosio, F; Cattel, L

2000-01-01

264

Liposomes as vaccine delivery systems: a review of the recent advances  

PubMed Central

Liposomes and liposome-derived nanovesicles such as archaeosomes and virosomes have become important carrier systems in vaccine development and the interest for liposome-based vaccines has markedly increased. A key advantage of liposomes, archaeosomes and virosomes in general, and liposome-based vaccine delivery systems in particular, is their versatility and plasticity. Liposome composition and preparation can be chosen to achieve desired features such as selection of lipid, charge, size, size distribution, entrapment and location of antigens or adjuvants. Depending on the chemical properties, water-soluble antigens (proteins, peptides, nucleic acids, carbohydrates, haptens) are entrapped within the aqueous inner space of liposomes, whereas lipophilic compounds (lipopeptides, antigens, adjuvants, linker molecules) are intercalated into the lipid bilayer and antigens or adjuvants can be attached to the liposome surface either by adsorption or stable chemical linking. Coformulations containing different types of antigens or adjuvants can be combined with the parameters mentioned to tailor liposomal vaccines for individual applications. Special emphasis is given in this review to cationic adjuvant liposome vaccine formulations. Examples of vaccines made with CAF01, an adjuvant composed of the synthetic immune-stimulating mycobacterial cordfactor glycolipid trehalose dibehenate as immunomodulator and the cationic membrane forming molecule dimethyl dioctadecylammonium are presented. Other vaccines such as cationic liposome–DNA complexes (CLDCs) and other adjuvants like muramyl dipeptide, monophosphoryl lipid A and listeriolysin O are mentioned as well. The field of liposomes and liposome-based vaccines is vast. Therefore, this review concentrates on recent and relevant studies emphasizing current reports dealing with the most studied antigens and adjuvants, and pertinent examples of vaccines. Studies on liposome-based veterinary vaccines and experimental therapeutic cancer vaccines are also summarized. PMID:25364509

2014-01-01

265

Large anti-HER2/neu liposomes for potential targeted intraperitoneal therapy of micrometastatic cancer  

PubMed Central

Effective targeting and killing of intraperitoneally disseminated micrometastases remains a challenge. Objective/Methods In this work, we evaluated the potential of antibody-labeled PEGylated large liposomes as vehicles for direct intraperitoneal (i.p.) drug delivery with the aim to enhance the tumor-to-normal organ ratio and to improve the bioexposure of cancer cells to the delivered therapeutics while shifting the toxicities toward the spleen. These targeted liposomes are designed to combine: (1) specific targeting to and internalization by cancer cells mediated by liposome-conjugated tumor-specific antibodies, (2) slow clearance from the peritoneal cavity, and (3) shift of normal organ toxicities from the liver to the spleen due to their relatively large size. Results Conjugation of anti-HER2/neu antibodies to the surface of large (approximately 600 nm in diameter) PEGylated liposomes results in fast, specific binding of targeted liposomes to cancer cells in vitro, followed by considerable cellular internalization. In vivo, after i.p. administration, these liposomes exhibit fast, specific binding to i.p. cancerous tumors. Large liposomes are slowly cleared from the peritoneal cavity, and they exhibit increased uptake by the spleen relative to the liver, while targeted large liposomes demonstrate specific tumor uptake at early times. Although tissue and tumor uptake are greater for cationic liposomes, the tumor-to-liver and spleen-to-liver ratios are similar for both membrane compositions, suggesting a primary role for the liposome’s size, compared to the liposome’s surface charge. Conclusions The findings of this study suggest that large targeted liposomes administered i.p. could be a potent drug-delivery strategy for locoregional therapy of i.p. micrometastatic tumors. PMID:20070139

Sofou, Stavroula; Enmon, Richard; Palm, Stig; Kappel, Barry; Zanzonico, Pat; McDevitt, Michael R.; Scheinberg, David A.; Sgouros, George

2011-01-01

266

Theoretical study of phthalocyanine–fullerene complex for a high efficiency photovoltaic device using ab initio electronic structure calculation  

Microsoft Academic Search

Many fullerene-based supramolecules have been proposed as potential organic photovoltaic devices, with their electrochemical and photo-electrochemical properties measured under light illumination. Phthalocyanine possesses good electron-donating properties due to its large easily ionised ?-electron system, whereas fullerene is good ?-electron acceptor which can be connected with other organic molecules. A phthalocyanine–fullerene-based supramolecular system is therefore a potential material candidate for a

Hiroshi Mizuseki; Nobuaki Igarashi; Rodion V. Belosludov; Amir A. Farajian; Yoshiyuki Kawazoe

2003-01-01

267

Electronic structure differences between H2-, Fe-, Co-, and Cu-phthalocyanine highly oriented thin films observed using NEXAFS spectroscopy  

NASA Astrophysics Data System (ADS)

Phthalocyanines, a class of macrocyclic, square planar molecules, are extensively studied as semiconductor materials for chemical sensors, dye-sensitized solar cells, and other applications. In this study, we use angular dependent near-edge x-ray absorption fine structure (NEXAFS) spectroscopy as a quantitative probe of the orientation and electronic structure of H2-, Fe-, Co-, and Cu-phthalocyanine molecular thin films. NEXAFS measurements at both the carbon and nitrogen K-edges reveal that phthalocyanine films deposited on sapphire have upright molecular orientations, while films up to 50 nm thick deposited on gold substrates contain prostrate molecules. Although great similarity is observed in the carbon and nitrogen K-edge NEXAFS spectra recorded for the films composed of prostrate molecules, the H2-phthalocyanine exhibits the cleanest angular dependence due to its purely out-of-plane ?* resonances at the absorption onset. In contrast, organometallic-phthalocyanine nitrogen K-edges have a small in-plane resonance superimposed on this ?* region that is due to a transition into molecular orbitals interacting with the 3dx2-y2 empty state. NEXAFS spectra recorded at the metal L-edges for the prostrate films reveal dramatic variations in the angular dependence of specific resonances for the Cu-phthalocyanines compared with the Fe-, and Co-phthalocyanines. The Cu L3,2 edge exhibits a strong in-plane resonance, attributed to its b1g empty state with dx2-y2 character at the Cu center. Conversely, the Fe- and Co- phthalocyanine L3,2 edges have strong out-of-plane resonances; these are attributed to transitions into not only b1g (dz2) but also eg states with dxz and dyz character at the metal center.

Willey, T. M.; Bagge-Hansen, M.; Lee, J. R. I.; Call, R.; Landt, L.; van Buuren, T.; Colesniuc, C.; Monton, C.; Valmianski, I.; Schuller, Ivan K.

2013-07-01

268

Development of a liposomal nanodelivery system for nevirapine  

Microsoft Academic Search

BACKGROUND: The treatment of AIDS remains a serious challenge owing to high genetic variation of Human Immunodeficiency Virus type 1 (HIV-1). The use of different antiretroviral drugs (ARV) is significantly limited by severe side-effects that further compromise the quality of life of the AIDS patient. In the present study, we have evaluated a liposome system for the delivery of nevirapine,

Lakshmi N Ramana; Swaminathan Sethuraman; Udaykumar Ranga; Uma M Krishnan

2010-01-01

269

Stability of a liposomal formulation containing lipoyl or dihydrolipoyl acylglycerides  

Technology Transfer Automated Retrieval System (TEKTRAN)

The acylglycerides of lipoic and dihydrolipoic acids may serve as slow-release sources for cutaneous delivery of these antioxidants when formulated in a liposomal vehicle. Testing was conducted to determine the storage stability of the lipoic derivatives and of the soybean phospholipids in which the...

270

Ex vivo liposome-mediated gene transfer to lung isografts  

Microsoft Academic Search

Objective: Gene therapy is a promising strategy to modify ischemia-reperfusion injury and rejection after transplantation. We evaluated variables that may affect ex vivo gene transfer to rat lung isografts. Methods: Left lungs were harvested and perfused via the pulmonary vein with chloramphenicol acetyltransferase complementary deoxyribonucleic acid complexed with cationic liposomes. Several variables were examined: (1) Influence of temperature: In group

Carlos H. Boasquevisque; Bassem N. Mora; Matthew Bernstein; William O. Osburn; Jennifer Nietupski; Ronald K. Scheule; Joel D. Cooper; Mitchell Botney; G. Alexander Patterson

1998-01-01

271

Functionalization of liposomes: microscopical methods for preformulative screening.  

PubMed

Abstract The development of smart delivery systems able to deliver and target a drug to the site of action is one of the major challenges in the field of pharmaceutical technology. The surface modification of nanocarriers, such as liposomes, is widely investigated either for increasing the blood circulation time (by pegylation) or for interacting with specific tissues or cells (by conjugation of a selective ligand as a monoclonal antibody, mAb). Microscopical analysis thereby is a useful approach to evaluate the morphology and the size owing to resolution and versatility in defining either surface modification or the architecture and the internal structure of liposomes. This contribution aims to connect the outputs obtained by transmission electron (TEM) and atomic force (AFM) microscopical techniques for identifying the modifications on the liposomal surface. To reach this objective, we prepared liposomes applying two different pegylation technologies and further modifying the surface by mAb conjugation. This work demonstrates the feasibility to apply the combined approach (TEM and AFM analysis) in the evaluation of the efficacy of a surface engineering process. PMID:25203607

Belletti, Daniela; Vandelli, Maria Angela; Tonelli, Massimo; Zapparoli, Mauro; Forni, Flavio; Tosi, Giovanni; Ruozi, Barbara

2014-09-01

272

Radiation induced oxidative damage modification by cholesterol in liposomal membrane  

NASA Astrophysics Data System (ADS)

Ionizing radiation induced structural and chemical alterations in egg lecithin liposomal membrane have been studied by measurements of lipid peroxides, conjugated diene and fluorescence polarization. Predominantly unilamellar phospholipid vesicles prepared by sonication procedure were subjected to radiation doses of ?-rays from Co-60 in aerated, buffered aqueous suspensions. The oxidative damage in irradiated lipid molecules of liposomes has been determined spectrophotometrically by diene conjugate formation and thiobarbituric acid reactive (TBAR) method as a function of radiation dose. A correlation was found between the radiation dose applied (0.1-1 kGy) and the consequent lipid oxidation. The damage produced in irradiated liposomal membrane was measured by 1,6-diphenyl-1,3,5-hexatriene (DPH) fluorescence decay and polarization. The observed decrease in DPH fluorescence and increase in polarization was found dependent on the radiation dose suggesting alterations in rigidity or organizational order in phospholipid bilayer after irradiation. Furthermore, irradiated liposome vesicles composed of cholesterol showed marked reduction in observed radiation mediated peroxide formation and significantly affected the DPH fluorescence parameters. The magnitude of these modifying effects were found dependent on the mole fraction of cholesterol. It is concluded that modulation of structural order in unilamellar vesicle membrane by variations in basic molecular components controlled the magnitude of lipid peroxidation and diene conjugate formation. These observations contribute to our understanding of mechanism of radical reaction mediated damage caused by ionizing radiation in phospholipid membrane.

Pandey, B. N.; Mishra, K. P.

1999-05-01

273

Vivid tumor imaging utilizing liposome-carried bimodal radiotracer.  

PubMed

By developing a new bimodal radioactive tracer that emits both luminescence and nuclear signals, a trimodal liposome for optical, nuclear, and magnetic resonance imaging is efficiently prepared. Fast clearance of the radiotracer from reticuloendothelial systems enables vivid tumor imaging with minimum background. PMID:24900846

Kim, Jonghee; Pandya, Darpan N; Lee, Woonghee; Park, Jang Woo; Kim, Youn Ji; Kwak, Wonjung; Ha, Yeong Su; Chang, Yongmin; An, Gwang Il; Yoo, Jeongsoo

2014-04-10

274

pH-sensitive liposomes: characterization and application  

SciTech Connect

It has been demonstrated that liposomes composed of dioleoylphosphatidylethanolamine (DOPE) and palmitoylhomocysteine (PHC) have the ability to fuse with adjacent membranes upon exposure to mildly acid pH. The ability of liposomes to fuse is absolutely dependent on the presence of DOPE and a weakly acidic amphiphile. The acid induced fusion event is a leaky process, but the leakage can be reduced by 50%, with only a small loss of fusion ability, by the inclusion of 40 mole percent cholesterol. Using an established monoclonal antibody targeting system. pH-sensitive immunoliposomes were prepared which successfully delivered entrapped calcein to the cytoplasm of target cells. The addition of chloroquine, which raises the internal pH of cellular vacuoles, blocks the cytoplasmic delivery of the pH-sensitive immunoliposomes. pH-insensitive immunoliposomes delivered calcein only to the endosome/lysosome system and not the cytoplasm. /sup 31/P-NMR and light scattering of DOPE:OA liposomes under acidic conditions demonstrate that the effect of the protons and the divalent cations is to force the DOPE to revert to the hexagonal II configuration. In vivo experiments with DOPE:OA immunoliposomes indicate that the liposomes rapidly aggregate and release their contents upon exposure to plasma. These results indicate that pH-sensitive immunoliposomes are an effective tool for in vitro cytoplasmic delivery but are ineffective for in vivo delivery at this point in development.

Connor, J.

1986-01-01

275

Hybrid assemblies of fluorescent nanocrystals and membrane proteins in liposomes.  

PubMed

Because of the growing potential of nanoparticles in biological and medical applications, tuning and directing their properties toward a high compatibility with the aqueous biological milieu is of remarkable relevance. Moreover, the capability to combine nanocrystals (NCs) with biomolecules, such as proteins, offers great opportunities to design hybrid systems for both nanobiotechnology and biomedical technology. Here we report on the application of the micelle-to-vesicle transition (MVT) method for incorporation of hydrophobic, red-emitting CdSe@ZnS NCs into the bilayer of liposomes. This method enabled the construction of a novel hybrid proteo-NC-liposome containing, as model membrane protein, the photosynthetic reaction center (RC) of Rhodobacter sphaeroides. Electron microscopy confirmed the insertion of NCs within the lipid bilayer without significantly altering the structure of the unilamellar vesicles. The resulting aqueous NC-liposome suspensions showed low turbidity and kept unaltered the wavelengths of absorbance and emission peaks of the native NCs. A relative NC fluorescence quantum yield up to 8% was preserved after their incorporation in liposomes. Interestingly, in proteo-NC-liposomes, RC is not denatured by Cd-based NCs, retaining its structural and functional integrity as shown by absorption spectra and flash-induced charge recombination kinetics. The outlined strategy can be extended in principle to any suitably sized hydrophobic NC with similar surface chemistry and to any integral protein complex. Furthermore, the proposed approach could be used in nanomedicine for the realization of theranostic systems and provides new, interesting perspectives for understanding the interactions between integral membrane proteins and nanoparticles, i.e., in nanotoxicology studies. PMID:24460372

De Leo, Vincenzo; Catucci, Lucia; Falqui, Andrea; Marotta, Roberto; Striccoli, Marinella; Agostiano, Angela; Comparelli, Roberto; Milano, Francesco

2014-02-18

276

Interaction of selected anthocyanins with erythrocytes and liposome membranes.  

PubMed

Anthocyanins are one of the main flavonoid groups. They are responsible for, e.g., the color of plants and have antioxidant features and a wide spectrum of medical activity. The subject of the study was the following compounds that belong to the anthocyanins and which can be found, e.g., in strawberries and chokeberries: callistephin chloride (pelargonidin-3-O-glucoside chloride) and ideain chloride (cyanidin-3-O-galactoside chloride). The aim of the study was to determine the compounds' antioxidant activity towards the erythrocyte membrane and changes incurred by the tested anthocyanins in the lipid phase of the erythrocyte membrane, in liposomes composed of erythrocyte lipids and in DPPC, DPPC/cholesterol and egg lecithin liposomes. In particular, we studied the effect of the two selected anthocyanins on red blood cell morphology, on packing order in the lipid hydrophilic phase, on fluidity of the hydrophobic phase, as well as on the temperature of phase transition in DPPC and DPPC/cholesterol liposomes. Fluorimetry with the Laurdan and Prodan probes indicated increased packing density in the hydrophilic phase of the membrane in the presence of anthocyanins. Using the fluorescence probes DPH and TMA-DPH, no effect was noted inside the hydrophobic phase of the membrane, as the lipid bilayer fluidity was not modified. The compounds slightly lowered the phase transition temperature of phosphatidylcholine liposomes. The study has shown that both anthocyanins are incorporated into the outer region of the erythrocyte membrane, affecting its shape and lipid packing order, which is reflected in the increasing number of echinocytes. The investigation proved that the compounds penetrate only the outer part of the external lipid layer of liposomes composed of erythrocyte lipids, DPPC, DPPC/cholesterol and egg lecithin lipids, changing its packing order. Fluorimetry studies with DPH-PA proved that the tested anthocyanins are very effective antioxidants. The antioxidant activity of the compounds was comparable with the activity of Trolox®. PMID:22396139

Bonarska-Kujawa, Dorota; Pruchnik, Hanna; Kleszczy?ska, Halina

2012-06-01

277

Vitamin C-driven epirubicin loading into liposomes.  

PubMed

The encapsulation of anticancer drugs in a liposome structure protects the drug during circulation and increases drug accumulation in the cancer tissue and antitumor activity while decreasing drug toxicity. This paper presents a new method of active drug loading based on a vitamin C pH/ion gradient. Formulations were characterized in terms of the following parameters: optimal external pH, time and drug-to-lipid ratio for the purpose of remote loading, and in vitro stability. In the case of the selected drug, epirubicin (EPI), its coencapsulation increases its anticancer activity through a possibly synergistic effect previously reported by other groups for a free nonencapsulated drug/vitamin C cocktail. The method also has another advantage over other remote-loading methods: it allows faster drug release through liposome destabilization at the tumor site, thanks to the very good solubility of the EPI vitamin C salt, as seen on cryogenic transmission electron microscopy images. This influences the drug-release process and increases the anticancer activity of the liposome formulation. The liposomes are characterized as stable, with very good pharmacokinetics (half-life 18.6 hours). The antitumor activity toward MCF-7 and 4T-1 breast cancer cells was higher in the case of EPI loaded via our gradient than via an ammonium sulfate gradient. Finally, the EPI liposomal formulation and the free drug were tested using the murine 4T-1 breast cancer model. The antitumor activity of the encapsulated drug was confirmed (tumor-growth inhibition over 40% from day 16 until the end of the experiment), and the free drug was shown to have no anticancer activity at the tested dose. PMID:24101870

Lipka, Dominik; Gubernator, Jerzy; Filipczak, Nina; Barnert, Sabine; Süss, Regine; Legut, Mateusz; Kozubek, Arkadiusz

2013-01-01

278

Lymph node localization of non-specific antibody-coated liposomes  

SciTech Connect

Subcutaneously injected small unilamellar liposomes are drained into the lymphatics and localized in the regional lymph nodes, and thus they can be used for the detection of metastatic spread in breast cancer patients and for delivery of drugs to diseased lymph nodes. An aqueous phase marker, (/sup 125/I)-polyvinylpyrrolidone, and a lipid phase marker, (/sup 3/H)-cholesterol, were used to study the lymph node localization of IgG-coated liposomes injected subcutaneously into mouse and rat footpads. The results show that human immunoglobulin G (IgG) coated liposomes are rapidly removed from the site of injection and are localized in the regional lymph nodes to a greater extent than control liposomes (i.e. liposomes without IgG). Free IgG was found to inhibit the uptake of IgG-coated liposomes by the lymph nodes. The localization of IgG-coated liposomes in the regional lymph nodes is influenced by charge of the liposomes. The results presented here suggest that antibody-coated liposomes may provide a more efficient way of delivering therapeutic agents to the lymph nodes in the treatment of diseases such as breast cancer with lymph node involvement. Similarly, monoclonal antibody-coated liposomes containing lymphoscintigraphic material may improve the detection of lymph node metastases. 26 references, 3 figures, 3 tables.

Mangat, S.; Patel, H.M.

1985-05-20

279

Interactions of functionalized dextran-coated liposomes with vascular smooth muscle cells.  

PubMed

Synthetic polymers are commonly used in the medical field as implants, polymeric drugs, or drug delivery systems. Among them, bioactive sulfated polysaccharides such as chemically modified dextrans are described to exhibit various properties including the inhibition of smooth muscle cell (SMC) growth. SMCs are key cellular components involved in the physiopathology of the vascular walls especially in atherosclerosis or after vascular surgeries. Interestingly, binding sites on vascular SMCs were already observed for an antiproliferative functionalized dextran (FDx). In this context, we hypothesized that this bioactive polymer could be used as a targeting moiety on the surface of drug delivery systems. In this work, liposomes constituted of phosphatidylcholine, phosphatidylethanolamine and cholesterol (70/10/20 mol.%) were prepared and coated with FDx hydrophobized by a cholesterol anchor (CholFDx) which penetrates the lipid bilayer during the liposome formation. The liposome interactions with SMCs were then followed using radiolabeled liposomes and fluorolabeled liposomes. Results of radioactivity on SMCs indicated higher interactions with CholFDx-coated liposomes as compared to uncoated liposomes. The fluorescence of cells incubated with fluorolabeled CholFDx-coated liposomes also evidenced the liposome binding on SMC membranes. These data demonstrated that liposomes coated with FDx interacted with vascular SMCs. Consequently, the coating with such bioactive polymers appears promising for the design of new drug delivery systems for the targeting of vascular cells. PMID:10699273

Letourneur, D; Parisel, C; Prigent-Richard, S; Cansell, M

2000-03-01

280

Vitamin E TPGS coated liposomes enhanced cellular uptake and cytotoxicity of docetaxel in brain cancer cells.  

PubMed

The aim of this work was to develop a drug delivery system of liposomes, which are coated with D-alpha-tocopheryl polyethylene glycol 1000 succinate (TPGS), a PEGylated vitamin E, with docetaxel as a model drug for enhanced treatment of brain tumour in comparison with the nude liposomes as well as with the so-called stealth liposomes, i.e. those coated with polyethylene glycol (PEG), which have been intensive investigated in the literature. Docetaxel or coumarin-6 loaded liposomes were prepared by the solvent injection method and characterized for their particle size, polydispersity, zeta potential and drug encapsulation efficiency. C6 glioma cells were employed as an in vitro model to access cellular uptake and cytotoxicity of the drug or coumarin-6 loaded liposomes. The particle size of the PEG or TPGS coated liposomes was ranged between 126 and 191nm. High-resolution field-emission transmission electron microscopy (FETEM) confirmed the coating of TPGS on the liposomes. The IC50 value, which is the drug concentration needed to kill 50% cells in a designated time period, was found to be 37.04±1.05, 31.04±0.75, 7.70±0.22, and 5.93±0.57?g/ml for the commercial Taxotere(®), the nude, PEG coated and TPGS coated liposomes, respectively after 24h culture with C6 glioma cells. The TPGS coated liposomes showed great advantages in vitro than the PEG coated liposomes. PMID:22001537

Muthu, Madaswamy S; Kulkarni, Sneha A; Xiong, Jiaqing; Feng, Si-Shen

2011-12-15

281

Hepatocytes targeting of cationic liposomes modified with soybean sterylglucoside and polyethylene glycol  

PubMed Central

AIM: In this study, a hepatocyte-specific targeting technology was developed by modifying cationic liposomes with soybean sterylglucoside (SG) and polyethylene glycol (PEG) (C/SG/PEG-liposomes). METHODS: The liposomal transfection efficiencies in HepG2 2.2.15 cells were estimated with the use of fluorescein sodium (FS) as a model drug, by flow cytometry. The antisense activity of C/SG/PEG-liposomes entrapped antisense oligonucleotides (ODN) was determined as HBsAg and HBeAg in HepG2 2.2.15 cells by ELISA. The liposome uptake by liver and liver cells in mice was carried out after intravenous injection of 3H-labeled liposomes. RESULTS: C/SG-liposomes entrapped FS were effectively transfected into HepG2 2.2.15 cells in vitro. C/SG/PEG-liposomes entrapped ODN, reduced the secretion of both HBsAg and HBeAg in HepG2 2.2.15 cells when compared to free ODN. After in vivo injection of 3H-labeled C/SG/PEG-liposomes, higher radiation accumulation was observed in the hepatocytes than non-parenchymal cells of the liver. CONCLUSION: C/SG/PEG-liposomes mediated gene transfer to the liver is an effective gene-delivery method for hepatocytes-specific targeting, which appears to have a potential for gene therapy of HBV infections. PMID:16124043

Qi, Xian-Rong; Yan, Wen-Wei; Shi, Jing

2005-01-01

282

A Liposomal Formulation Able to Incorporate a High Content of Paclitaxel and Exert Promising Anticancer Effect  

PubMed Central

A liposome formulation for paclitaxel was developed in this study. The liposomes, composed of naturally unsaturated and hydrogenated phosphatidylcholines, with significant phase transition temperature difference, were prepared and characterized. The liposomes exhibited a high content of paclitaxel, which was incorporated within the segregated microdomains coexisting on phospholipid bilayer of liposomes. As much as 15% paclitaxel to phospholipid molar ratio were attained without precipitates observed during preparation. In addition, the liposomes remained stable in liquid form at 4°C for at least 6 months. The special composition of liposomal membrane which could reduce paclitaxel aggregation could account for such a capacity and stability. The cytotoxicity of prepared paclitaxel liposomes on the colon cancer C-26 cell culture was comparable to Taxol. Acute toxicity test revealed that LD50 for intravenous bolus injection in mice exceeded by 40?mg/kg. In antitumor efficacy study, the prepared liposomal paclitaxel demonstrated the increase in the efficacy against human cancer in animal model. Taken together, the novel formulated liposomes can incorporate high content of paclitaxel, remaining stable for long-term storage. These animal data also demonstrate that the liposomal paclitaxel is promising for further clinical use. PMID:21490755

Kan, Pei; Tsao, Chih-Wan; Wang, Ae-June; Su, Wu-Chou; Liang, Hsiang-Fa

2011-01-01

283

Topical drug delivery to retinal pigment epithelium with microfluidizer produced small liposomes.  

PubMed

Drug delivery from topically instilled eye drops to the posterior segment of the eye has long been one of the greatest challenges of ocular drug development. We developed methods of liposome preparation utilizing a microfluidizer to achieve adjustable nanoparticle size (even less than 80 nm) and high loading capacity of plasmid DNA. The microfluidizing process parameters were shown to affect the size of the liposomes. Higher operating pressures and passage for at least 10 times through the microfluidizer produced small liposomes with narrow size distribution. The liposomes were physically stable for several months at +4°C. In vivo distribution of the optimized liposome formulations in the rat eyes was investigated with confocal microscopy of the histological specimens. Transferrin was used as a targeting ligand directed to retinal pigment epithelium. Size dependent distribution of liposomes to different posterior segment tissues was seen. Liposomes with the diameter less than 80 nm permeated to the retinal pigment epithelium whereas liposomes with the diameter of 100 nm or more were distributed to the choroidal endothelium. Active targeting was shown to be necessary for liposome retention to the target tissue. In conclusion, these microfluidizer produced small liposomes in eye drops are an attractive option for drug delivery to the posterior segment tissues of the eye. PMID:24810393

Lajunen, T; Hisazumi, K; Kanazawa, T; Okada, H; Seta, Y; Yliperttula, M; Urtti, A; Takashima, Y

2014-10-01

284

Lead Ions Encapsulated in Liposomes and Their Effect on Staphylococcus aureus  

PubMed Central

The aim of the study was the preparation of a liposome complex with encapsulated lead ions, which were electrochemically detected. In particular, experiments were focused on the potential of using an electrochemical method for the determination of free and liposome-encapsulated lead and determination of the encapsulation efficiency preventing the lead toxicity. Primarily, encapsulation of lead ions in liposomes and confirmation of successful encapsulation by electrochemical methods was done. Further, the reduction effect of the liposome matrix on the detected electrochemical signal was monitored. Besides encapsulation itself, comparison of toxicity of free lead ions and lead ions encapsulated in liposome was tested. The calculated IC50 values for evaluating the lead cytotoxicity showed significant differences between the lead enclosed in liposomes (28 µM) and free lead ions (237 µM). From the cytotoxicity studies on the bacterial strain of S. aureus it was observed that the free lead ions are less toxic in comparison with lead encapsulated in liposomes. Liposomes appear to be a suitable carrier of various substances through the inner cavity. Due to the liposome structure the lead enclosed in the liposome is more easily accepted into the cell structure and the toxicity of the enclosed lead is higher in comparison to free lead ions. PMID:24317385

Kensova, Renata; Blazkova, Iva; Konecna, Marie; Kopel, Pavel; Chudobova, Dagmar; Zitka, Ondrej; Vaculovicova, Marketa; Hynek, David; Adam, Vojtech; Beklova, Miroslava; Kizek, Rene

2013-01-01

285

Cationic liposomes target angiogenic endothelial cells in tumors and chronic inflammation in mice.  

PubMed Central

This study sought to determine whether angiogenic blood vessels in disease models preferentially bind and internalize cationic liposomes injected intravenously. Angiogenesis was examined in pancreatic islet cell tumors of RIP-Tag2 transgenic mice and chronic airway inflammation in Mycoplasma pulmonis-infected C3H/HeNCr mice. For comparison, physiological angiogenesis was examined in normal mouse ovaries. We found that endothelial cells in all models avidly bound and internalized fluorescently labeled cationic liposomes (1,2-dioleoyl-3-trimethylammonium-propane [DOTAP]/cholesterol or dimethyldioctadecyl ammonium bromide [DDAB]/cholesterol) or liposome-DNA complexes. Confocal microscopic measurements showed that angiogenic endothelial cells averaged 15-33-fold more uptake than corresponding normal endothelial cells. Cationic liposome-DNA complexes were also avidly taken up, but anionic, neutral, or sterically stabilized neutral liposomes were not. Electron microscopic analysis showed that 32% of gold-labeled liposomes associated with tumor endothelial cells were adherent to the luminal surface, 53% were internalized into endosomes and multivesicular bodies, and 15% were extravascular 20 min after injection. Our findings indicate that angiogenic endothelial cells in these models avidly bind and internalize cationic liposomes and liposome-DNA complexes but not other types of liposomes. This preferential uptake raises the possibility of using cationic liposomes to target diagnostic or therapeutic agents selectively to angiogenic blood vessels in tumors and sites of chronic inflammation. PMID:9525983

Thurston, G; McLean, J W; Rizen, M; Baluk, P; Haskell, A; Murphy, T J; Hanahan, D; McDonald, D M

1998-01-01

286

[Preparation of herpetin lyophilized liposome and evaluation on its safety and pharmacodynamics].  

PubMed

In this study, the herpetin (HPT) lyophilized liposome was prepared, and its saftey and pharmacodynamics were evaluated. HPT lyophilized liposome was prepared by thin-film ultrasonication method. The lyoprotectant was optimized using particle size and encapsulation efficiency as indexes. Then, the influencing factors of HPT lyophilized liposome were investigated. In addition, preliminary safety and therapy efficiency of HPT lyophilized liposome to liver injury induced by CCl4 in the mice. The optimal lyoprotectant was 5% sucrose plus 5% lactose and the dispersed HPT lyophilized liposomes were spherical with the mean diameter of (107.0 ± 1.2) nm and the mean encapsulation efficiency of (99.7 ± 0.50)%. The lyophilized powder was sensitive to temperature, humidity and illumination. None of hemolysis, hemagglutination and vein irritation was observed after intravenous injection of HPT lyophilized liposomes into rabbits. HPT lyophilized liposome showed obviously therapy efficiency to liver injury induced by CCl4 in the mice. The improvements of ALT, AST and ALP were better than that in HPT free drug. The obtained HPT lyophilized liposome met the standard of CP with fine particle size and encapsulation efficiency after dispersion. The HPT lyophilized liposome showed good safety and enhanced the treatment efficacy of HPT. The HPT lyophilized liposome should be stored in low temperature, sealed condition far away from light. PMID:25509288

Zhang, Xin; Tan, Rui; Gu, Jian; He, Li-Li; Zhang, Lei; Gong, Pu-Yang

2014-08-01

287

Poly(ethylene glycol)-modified phospholipids prevent aggregation during covalent conjugation of proteins to liposomes.  

PubMed

Liposome aggregation is a major problem associated with the covalent attachment of proteins to liposomes. This report describes a procedure for coupling proteins to liposomes that results in little or no change in liposome size. This is achieved by incorporating appropriate levels of poly(ethylene glycol)-modified lipids into the liposomes. The studies employed thiolated avidin-D coupled to liposomes containing the thio-reactive lipid N-(4-(p-maleimidophenyl)butyryl)dipalmitoyl phosphatidylethanolamine (1 mol % of total lipid) and various amounts of MePEG-S-POPE (monomethoxypoly(ethylene glycol) linked to phosphatidylethanolamine via a succinate linkage). The influence of PEG chain length and density was also assessed. The presence of PEG on the surface of liposomes is shown to provide an effective method of inhibiting aggregation and the corresponding increase in liposome size during the covalent coupling of avidin-D. A balance between the size of the PEG used and the amount of PEG-lipid incorporated into the liposome had to be achieved in order to maintain efficient coupling. Optimal coupling efficiencies in combination with minimal aggregation effects were achieved using 2 mol % MePEG2000-S-POPE (PEG of 2000 MW) or 0.8 mol % MePEG5000-S-POPE (PEG of 5000 MW). At these levels, the presence of PEG did not affect the biotin binding activity of the covalently attached avidin. The ability of the resulting liposomes to specifically target to biotinylated cells is demonstrated. PMID:7599262

Harasym, T O; Tardi, P; Longman, S A; Ansell, S M; Bally, M B; Cullis, P R; Choi, L S

1995-01-01

288

Transient cerebral hypoperfusion assisted intraarterial cationic liposome delivery to brain tissue.  

PubMed

Transient cerebral hypoperfusion (TCH) has empirically been used to assist intraarterial (IA) drug delivery to brain tumors. Transient (<3 min) reduction of cerebral blood flow (CBF) occurs during many neuro- and cardiovascular interventions and has recently been used to better target IA drugs to brain tumors. In the present experiments, we assessed whether the effectiveness of IA delivery of cationic liposomes could be improved by TCH. Cationic liposomes composed of 1:1 DOTAP:PC (dioleoyl-trimethylammonium-propane:phosphatidylcholine) were administered to three groups of Sprague-Dawley rats. In the first group, we tested the effect of blood flow reduction on IA delivery of cationic liposomes. In the second group, we compared TCH-assisted IA liposomal delivery versus intravenous (IV) administration of the same dose. In the third group, we assessed retention of cationic liposomes in brain 4 h after TCH assisted delivery. The liposomes contained a near infrared dye, DilC18(7), whose concentration could be measured in vivo by diffuse reflectance spectroscopy. IA injections of cationic liposomes during TCH increased their delivery approximately fourfold compared to injections during normal blood flow. Optical pharmacokinetic measurements revealed that relative to IV injections, IA injection of cationic liposomes during TCH produced tissue concentrations that were 100-fold greater. The cationic liposomes were retained in the brain tissue 4 h after a single IA injection. There was no gross impairment of neurological functions in surviving animals. Transient reduction in CBF significantly increased IA delivery of cationic liposomes in the brain. High concentrations of liposomes could be delivered to brain tissue after IA injections with concurrent TCH while none could be detected after IV injection. IA-TCH injections were well tolerated and cationic liposomes were retained for at least 4 h after IA administration. These results should encourage development of cationic liposomal formulations of chemotherapeutic drugs and their IA delivery during TCH. PMID:24664370

Joshi, Shailendra; Singh-Moon, Rajinder P; Wang, Mei; Chaudhuri, Durba B; Holcomb, Mark; Straubinger, Ninfa L; Bruce, Jeffrey N; Bigio, Irving J; Straubinger, Robert M

2014-05-01

289

Pre-Targeting and Direct Immunotargeting of Liposomal Drug Carriers to Ovarian Carcinoma  

PubMed Central

Background Epidermal growth factor receptor (EGFR) is overexpressed in many solid tumor types, such as ovarian carcinoma. Immunoliposome based drug targeting has shown promising results in drug delivery to the tumors. However, the ratio of tumor-to-normal tissue concentrations should be increased to minimize the adverse effects of cytostatic drugs. Methodology/Principal Findings We studied the EGFR-targeted doxorubicin immunoliposomes using pre-targeting and local intraperitoneal (i.p.) administration of the liposomes. This approach was used to increase drug delivery to tumors as compared to direct intravenous (i.v.) administration of liposomes. EGFR antibodies were attached on the surface of PEG coated liposomes using biotin-neutravidin binding. Receptor mediated cellular uptake and cytotoxic efficacy of EGFR-targeted liposomes were investigated in human ovarian adenocarcinoma (SKOV-3 and SKOV3.ip1) cells. In vivo distribution of the liposomes in mice was explored using direct and pre-targeting approaches and SPECT/CT imaging. Targeted liposomes showed efficient and specific receptor-mediated binding to ovarian carcinoma cells in vitro, but the difference in cytotoxicity between targeted and non-targeted liposomes remained small. The relatively low cytotoxic efficacy is probably due to insufficient doxorubicin release from the liposomes rather than lack of target binding. Tumor uptake of targeted liposomes in vivo was comparable to that of non-targeted liposomes after both direct and pre-targeting administration. For both EGFR-targeted and non-targeted liposomes, the i.p. administration increased liposome accumulation to the tumors compared to i.v. injections. Conclusions/Significance Intraperitoneal administration of liposomes may be a beneficial approach to treat the tumors in the abdominal cavity. The i.p. pre-targeting method warrants further studies as a potential approach in cancer therapy. PMID:22844475

Lehtinen, Julia; Raki, Mari; Bergström, Kim A.; Uutela, Päivi; Lehtinen, Katariina; Hiltunen, Annukka; Pikkarainen, Jere; Liang, Huamin; Pitkänen, Sari; Määttä, Ann-Marie; Ketola, Raimo A.; Yliperttula, Marjo; Wirth, Thomas; Urtti, Arto

2012-01-01

290

Improved Photodynamic Efficacy of Zn(II) Phthalocyanines via Glycerol Substitution  

PubMed Central

Phthalocyanines are excellent photosensitizers for photodynamic therapy as they have strong absorbance in the near infra-red region which is most relevant for in vivo activation in deeper tissular regions. However, most phthalocyanines present two major challenges, ie, a strong tendency to aggregate and low water-solubility, limiting their effective usage clinically. In the present study, we evaluated the potential enhancement capability of glycerol substitution on the photodynamic properties of zinc (II) phthalocyanines (ZnPc). Three glycerol substituted ZnPc, 1–3, (tetra peripherally, tetra non-peripherally and mono iodinated tri non-peripherally respectively) were evaluated in terms of their spectroscopic properties, rate of singlet oxygen generation, partition coefficient (log P), intracellular uptake, photo-induced cytotoxicity and vascular occlusion efficiency. Tetrasulfonated ZnPc (ZnPcS4) was included as a reference compound. Here, we showed that 1–3 exhibited 10–100 nm red-shifted absorption peaks with higher molar absorptivity, and at least two-fold greater singlet oxygen generation rates compared to ZnPcS4. Meanwhile, phthalocyanines 1 and 2 showed more hydrophilic log P values than 3 consistent with the number of glycerol attachments but 3 was most readily taken up by cells compared to the rest. Both phthalocyanines 2 and 3 exhibited potent phototoxicity against MCF-7, HCT-116 and HSC-2 cancer cell-lines with IC50 ranging 2.8–3.2 µM and 0.04–0.06 µM respectively, while 1 and ZnPcS4 (up to 100 µM) failed to yield determinable IC50 values. In terms of vascular occlusion efficiency, phthalocyanine 3 showed better effects than 2 by causing total occlusion of vessels with diameter <70 µm of the chorioallantoic membrane. Meanwhile, no detectable vascular occlusion was observed for ZnPcS4 with treatment under similar experimental conditions. These findings provide evidence that glycerol substitution, in particular in structures 2 and 3, is able to improve the photodynamic properties of ZnPc. PMID:24840576

Chin, Yunni; Lim, Siang Hui; Zorlu, Yunus; Ahsen, Vefa; Kiew, Lik Voon; Chung, Lip Yong; Dumoulin, Fabienne; Lee, Hong Boon

2014-01-01

291

Computer-aided design of liposomal drugs: in silico prediction and experimental validation of drug candidates for liposomal remote loading  

PubMed Central

Previously we have developed and statistically validated Quantitative Structure Property Relationship (QSPR) models that correlate drugs’ structural, physical and chemical properties as well as experimental conditions with the relative efficiency of remote loading of drugs into liposomes (Cern et al, Journal of Controlled Release, 160(2012) 14–157). Herein, these models have been used to virtually screen a large drug database to identify novel candidate molecules for liposomal drug delivery. Computational hits were considered for experimental validation based on their predicted remote loading efficiency as well as additional considerations such as availability, recommended dose and relevance to the disease. Three compounds were selected for experimental testing which were confirmed to be correctly classified by our previously reported QSPR models developed with Iterative Stochastic Elimination (ISE) and k-nearest neighbors (kNN) approaches. In addition, 10 new molecules with known liposome remote loading efficiency that were not used in QSPR model development were identified in the published literature and employed as an additional model validation set. The external accuracy of the models was found to be as high as 82% or 92%, depending on the model. This study presents the first successful application of QSPR models for the computer-model-driven design of liposomal drugs. PMID:24184343

Cern, Ahuva; Barenholz, Yechezkel; Tropsha, Alexander; Goldblum, Amiram

2014-01-01

292

The PEGylated liposomal doxorubicin improves the delivery and therapeutic efficiency of 188Re-Liposome by modulating phagocytosis in C26 murine colon carcinoma tumor model.  

PubMed

Liposome in delivering radionuclide for cancer therapy has been expansively studied; however, liposome itself can be deliberately entrapped and destroyed by the reticuloendothelial system, causing an insufficiency of the drug delivery, which in turn would restrict the effectiveness of the drug. In this study, mice with subcutaneous implantation of C26 murine colon cancer received an experimental treatment regimen in which mice took delivery of PEGylated liposomal doxorubicin (LipoDox) first, after a three-day interval, of Rhenium-188 encapsulated into PEGylated liposome ((188)Re-Liposome) subsequently and by which suppressed the functioning of reticuloendothelial system for the short term. The data showed that based upon the biodistribution assay and the evaluation of the therapeutic efficacy, (188)Re-Liposome was more sufficiently delivered to tumor sites in mice with this treatment regimen than mice without the regimen, and that cancer mortalities in mice with the treatment regimen were much lower than the mortalities in mice without the regimen. Taken together, a new strategy proposed in this study significantly improved both the (188)Re-Liposome delivery and the effectiveness of (188)Re-Liposome, suggesting that the strategy can be an ideal treatment for cancer. PMID:25027866

Hsu, Wei-Hsin; Liu, Si-Yen; Chang, Ya-Jen; Chang, Chih-Hsien; Ting, Gann; Lee, Te-Wei

2014-10-01

293

Molecular arrangement investigation of copper phthalocyanine grown on hydrogen passivated Si(1 1 1) surfaces  

NASA Astrophysics Data System (ADS)

Chemical, electronic and structural properties of ultra thin films of copper phthalocyanine (CuPc) grown on hydrogen passivated silicon (1 1 1) surfaces were investigated in situ by X-ray photoelectron spectroscopy (XPS), ultraviolet photoemission spectroscopy (UPS), X-ray photoelectron diffraction (XPD) and electron diffraction (LEED). The early stages of copper phthalocyanine adsorption (1-2) were characterized by the saturation of surface defects and by a flat lying disposition on the surface. Upon further CuPc coverage, the passivation of Si surfaces resulted in the molecule taking a standing position in films. The molecular packing deduced from these studies appears very close to the one in the bulk ? phase of CuPc. The work function of the films was found to be decreasing during the growth and was correlated with the molecular orientation.

Arbi, I.; Ben Hamada, B.; Souissi, A.; Menzli, S.; Ben Azzouz, C.; Laribi, A.; Akremi, A.; Chefi, C.

2014-06-01

294

Phthalocyanine identification in paintings by reflectance spectroscopy. A laboratory and in situ study  

NASA Astrophysics Data System (ADS)

The importance of identifying pigments using non invasive (n.i.) analyses has gained increasing importance in the field of spectroscopy applied to art conservation and art studies. Among the large set of pigments synthesized and marketed during 20th century, surely phthalocyanine blue and green pigments occupy an important role in the field of painting (including restoration) and printing, thanks to their characteristics like brightness and fastness. This research focused on the most used phthalocyanine blue (PB15:1 and PB15:3) and green pigments (PG7), and on the possibility to identify these organic compounds using a methodology like reflectance spectroscopy in the UV, visible and near IR range (UV-vis-NIR RS), performed easily through portable instruments. Laboratory tests and three examples carried out on real paintings are discussed.

Poldi, G.; Caglio, S.

2013-06-01

295

Electronic properties and morphology of Cu-phthalocyanine—C{sub 60} composite mixtures  

SciTech Connect

Phthalocyanines in combination with C{sub 60} are benchmark materials for organic solar cells. Here, we have studied the morphology and electronic properties of co-deposited mixtures (blends) of these materials forming a bulk heterojunction as a function of the concentration of the two constituents. For a concentration of 1:1 of Cu-Phthalocyanine (CuPc):C{sub 60}, a phase separation into about 100?nm size domains is observed, which results in electronic properties similar to layered systems. For low C{sub 60} concentrations (10:1 CuPc:C{sub 60}), the morphology, as indicated by Low-Energy Electron Microscopy images, suggests a growth mode characterized by (amorphous) domains of CuPC, whereby the domain boundaries are decorated with C{sub 60}. Despite of these markedly different growth modes, the electronic properties of the heterojunction films are essentially unchanged.

Roth, Friedrich [Center for Free-Electron Laser Science/DESY, Notkestraße 85, D-22607 Hamburg (Germany); Lupulescu, Cosmin [Institute of Optics and Atomic Physics, TU Berlin, Straße des 17. Juni 135, D-10623 Berlin (Germany); Arion, Tiberiu [Center for Free-Electron Laser Science/DESY, Notkestraße 85, D-22607 Hamburg (Germany); Institut für Experimentalphysik, Universität Hamburg, Luruper Chaussee 149, D-22761 Hamburg (Germany); Darlatt, Erik; Gottwald, Alexander [Physikalisch-Technische Bundesanstalt (PTB), Abbestraße 2-12, D-10587 Berlin (Germany); Eberhardt, Wolfgang [Center for Free-Electron Laser Science/DESY, Notkestraße 85, D-22607 Hamburg (Germany); Institute of Optics and Atomic Physics, TU Berlin, Straße des 17. Juni 135, D-10623 Berlin (Germany)

2014-01-21

296

Novel axially carborane-cage substituted silicon phthalocyanine photosensitizer; synthesis, characterization and photophysicochemical properties  

NASA Astrophysics Data System (ADS)

The novel axially dicarborane substituted silicon (IV) (SiPc-DC) phthalocyanine was synthesized by treating silicon phthalocyanine dichloride SiPc(Cl)2 (SiPc) with o-Carborane monool. The compound was characterized by mass spectrometry, UV-Vis, FT-IR, 1H and 11B Nuclear Magnetic Resonance Spectroscopy (NMR). Spectral, photophysical (fluorescence quantum yield) and photochemical (singlet oxygen (??) and photodegradation quantum yield (?d)) properties of the complex were reported in different solutions (Dimethyl sulfoxide (DMSO), Dimethylformamide (DMF) and Toluene). The results of spectral measurements showed that both SiPc and carborane cage can have potential to be used as sensitizers in photodynamic therapy (PDT) and boron neutron capture therapy (BNCT) by their singlet oxygen efficiencies (?? = 0.41, 0.39).

Atmaca, Göknur Ya?a; Dizman, Cemil; Eren, Tar?k; Erdo?mu?, Ali

2015-02-01

297

Dimerization of titanyl phthalocyanine in thin films prepared by surface polymerization by ion-assisted deposition  

SciTech Connect

Surface polymerization by ion-assisted deposition (SPIAD), the simultaneous dosing of hyperthermal ions while depositing an organic oligomer, was used to deposit titanyl phthalocyanine (TiOPc) thin films with 50 and 100 eV acetylene ions. The properties of the SPIAD TiOPc thin films are compared with films of the evaporated TiOPc monomer via examination of the electronic structure, ultraviolet-visible absorbance, and composition. Mass spectrometry, x-ray photoelectron spectroscopy, and other methods were used to determine the film composition, chemical bonding, and to examine the electronic structure. These results showed the formation of TiOPc dimers bound face to face. However, the overall phthalocyanine ring structure otherwise remained intact, except for small amounts of atmospheric oxidation at ion-induced radical sites.

Zachary, Adam M.; Drabik, Martin; Choi, Yongsoo; Bolotin, Igor L.; Biederman, Hynek; Hanley, Luke [Department of Chemistry, University of Illinois at Chicago, Chicago, Illinois 60607-7061 (United States); Faculty of Mathematics and Physics, Department of Macromolecular Physics, Charles University, Prague (Czech Republic); Department of Chemistry, University of Illinois at Chicago, Chicago, Illinois 60607-7061 (United States); Faculty of Mathematics and Physics, Department of Macromolecular Physics, Charles University, Prague (Czech Republic); Department of Chemistry, University of Illinois at Chicago, Chicago, Illinois 60607-7061 (United States)

2008-03-15

298

Design of UV-Vis-NIR panchromatic crown-phthalocyanines with controllable aggregation.  

PubMed

Novel magnesium and zinc phthalocyaninates, bearing four lateral electron-rich 15-crown-5-oxanthrene fragments, were synthesized starting from benzo-15-crown-5. Being almost insoluble in common organic solvents, these complexes could be solubilised by interaction with potassium acetate due to the formation of well-defined cofacial supramolecular dimers. A characteristic feature of these dimers is the presence of additional bands in their UV-Vis spectra, which affords the expansion of light absorption region up to ?750 nm. This new band corresponds to the charge transfer from the peripheral groups to the Pc core, as evidenced by TDDFT calculations. Potassium cations can be reversibly removed from these dimers by [2.2.2]cryptand, resulting in the formation of monodisperse nanoparticles exhibiting absorbances up to 900 nm. This approach can be further used for the fabrication of nanostructured optoelectronic materials based on the synthesized donor-acceptor panchromatic crown-phthalocyanines. PMID:25423480

Safonova, Evgeniya A; Martynov, Alexander G; Zolotarevskii, Viktor I; Nefedov, Sergey E; Gorbunova, Yulia G; Tsivadze, Aslan Yu

2015-01-21

299

In-situ spectro-microscopy on organic films: Mn-Phthalocyanine on Ag(100)  

SciTech Connect

Metal phthalocyanines are attracting significant attention, owing to their potential for applications in chemical sensors, solar cells and organic magnets. As the electronic properties of molecular films are determined by their crystallinity and molecular packing, the optimization of film quality is important for improving the performance of organic devices. Here, we present the results of in situ low-energy electron microscopy / photoemission electron microscopy (LEEM/PEEM) studies of incorporation-limited growth [1] of manganese-phthalocyanine (MnPc) on Ag(100) surfaces. MnPc thin films were grown on both, bulk Ag(100) surface and thin Ag(100)/Fe(100) films, where substrate spin-polarized electronic states can be modified through tuning the thickness of the Ag film [2]. We also discuss the electronic structure and magnetic ordering in MnPc thin films, investigated by angle- and spin-resolved photoemission spectroscopy.

Al-Mahboob A.; Vescovo, E.; Sadowski, J.T.

2013-08-18

300

Enhanced Reverse Saturable Absorption and Optical Limiting in Heavy-Atom Substituted Phthalocyanines  

NASA Technical Reports Server (NTRS)

The reverse saturable absorption and optical limiting response of metal phthalocyaninies can be enhanced by using the heavy-atom effect. Phthalocyanines containing heavy metal atoms, such as In, Sn, and Pb show nearly a factor of two enhancement in the ratio of effective excited-state to ground-state absorption cross sections compared to those containing lighter atoms, such as Al and Si. In an f/8 optical geometry, homogeneous solutions of heavy metal phthalocyanines, at 30% linear transmission, limit 8-ns, 532-nm laser pulses to less than or equal to 3 (micro)J (the energy for 50% probability of eye damage) for incident pulses up to 800 (micro)J.

Perry, J. W.; Mansour, K.; Marder, S. R.; Alvarez, D., Jr.; Perry, K. J.; Choong, I.

1994-01-01

301

ZnO and cobalt phthalocyanine hybridized graphene: efficient photocatalysts for degradation of rhodamine B.  

PubMed

A novel method has been developed to synthesize graphene-ZnO composite as a highly efficient catalyst by reduction of graphite oxide and in situ deposition of ZnO nanoparticles by chemical reduction reaction. The graphene-ZnO catalyst is capable of complete degradation of rhodamine B under exposure to natural sunlight. Further, the catalytic efficiency of graphene-ZnO catalyst was enhanced by sensitizing with cobalt phthalocyanine. The formation of graphene-ZnO photocatalyst and its further sensitization with cobalt phthalocyanine was characterized using UV-vis, ATR-IR and Raman spectroscopy, powder XRD and thermogravimetric analysis. The morphology of both graphene-ZnO and graphene-ZnO-CoPC catalysts was analyzed using scanning and transmission electron microscopes. PMID:24972296

Neelgund, Gururaj M; Oki, Aderemi; Luo, Zhiping

2014-09-15

302

pHLIP®-Mediated Delivery of PEGylated Liposomes to Cancer Cells  

PubMed Central

We develop a method for pH-dependent fusion between liposomes and cellular membranes using pHLIP® (pH Low Insertion Peptide), which inserts into lipid bilayer of membrane only at low pH. Previously we establish the molecular mechanism of peptide action and show that pHLIP can target acidic diseased tissue. Here we investigate how coating of PEGylated liposomes with pHLIP might affect liposomal uptake by cells. The presence of pHLIP on the surface of PEGylated-liposomes enhanced membrane fusion and lipid exchange in a pH dependent fashion, leading to increase of cellular uptake and payload release, and inhibition of cell proliferation by liposomes containing ceramide. A novel type of pH-sensitive, “fusogenic” pHLIP-liposomes was developed, which could be used to selectively deliver various diagnostic and therapeutic agents to acidic diseased cells. PMID:23416366

Yao, Lan; Daniels, Jennifer; Wijesinghe, Dayanjali; Andreev, Oleg A.; Reshetnyak, Yana K.

2013-01-01

303

Fabrication of monodisperse liposomes-in-microgel hybrid microparticles in capillary-based microfluidic devices.  

PubMed

This study introduces a drop-based microfluidic approach to physically immobilize liposomes in microgel (liposomes-in-microgel) particles. For this, we generate a uniform liposomes-in-water-in-oil emulsion in a capillary-based microfluidic device. Basically, we have investigated how the flow rate and flow composition affect generation of emulsion precursor drops in micro-channels. Then, the precursor emulsion drops are solidified by photo-polymerization. From characterization of hydrogel mesh sizes, we have figured out that the mesh size of the liposomes-in-microgel particles is bigger than that of bare microgel particles, since liposomes take space in the hydrogel phase. In our further study on drug releasing, we have observed that immobilization of liposomes in the microgel particles can not only remarkably retard drug releasing, but also enables a sustained release, which stems from the enhanced matrix viscosity of the surrounding hydrogel phase. PMID:25288532

Jeong, Eun Seon; Son, Han Am; Kim, Min Kyung; Park, Kyoung-Ho; Kay, Sechan; Chae, Pil Seok; Kim, Jin Woong

2014-11-01

304

Evaluation of skin viability effect on ethosome and liposome-mediated psoralen delivery via cell uptake.  

PubMed

This study investigated the effect of skin viability on its permeability to psoralen delivered by ethosomes, as compared with liposomes. With decreasing skin viability, the amount of liposome-delivered psoralen that penetrated through the skin increased, whereas skin deposition of psoralen from both ethosomes and liposomes reduced. Psoralen delivery to human-immortalized epidermal cells was more effective using liposomes, whereas delivery to human embryonic skin fibroblast cells was more effective when ethosomes were used. These findings agreed with those of in vivo studies showing that skin psoralen deposition from ethosomes and liposomes first increased and then plateaued overtime, which may indicate gradual saturation of intracellular drug delivery. It also suggested that the reduced deposition of ethosome- or liposome-delivered psoralen in skin with reduced viability may relate to reduced cellular uptake. This work indicated that the effects of skin viability should be taken into account when evaluating nanocarrier-mediated drug skin permeation. PMID:25070929

Zhang, Yong-Tai; Shen, Li-Na; Wu, Zhong-Hua; Zhao, Ji-Hui; Feng, Nian-Ping

2014-10-01

305

Structure of liposome encapsulating proteins characterized by X-ray scattering and shell-modeling  

PubMed Central

Lipid liposomes are promising drug delivery systems because they have superior curative effects owing to their high adaptability to a living body. Lipid liposomes encapsulating proteins were constructed and the structures examined using synchrotron radiation small- and wide-angle X-ray scattering (SR-SWAXS). The liposomes were prepared by a sequential combination of natural swelling, ultrasonic dispersion, freeze-throw, extrusion and spin-filtration. The liposomes were composed of acidic glycosphingolipid (ganglioside), cholesterol and phospholipids. By using shell-modeling methods, the asymmetric bilayer structure of the liposome and the encapsulation efficiency of proteins were determined. As well as other analytical techniques, SR-SWAXS and shell-modeling methods are shown to be a powerful tool for characterizing in situ structures of lipid liposomes as an important candidate of drug delivery systems. PMID:24121330

Hirai, Mitsuhiro; Kimura, Ryota; Takeuchi, Kazuki; Hagiwara, Yoshihiko; Kawai-Hirai, Rika; Ohta, Noboru; Igarashi, Noriyuki; Shimuzu, Nobutaka

2013-01-01

306

Structure of liposome encapsulating proteins characterized by X-ray scattering and shell-modeling.  

PubMed

Lipid liposomes are promising drug delivery systems because they have superior curative effects owing to their high adaptability to a living body. Lipid liposomes encapsulating proteins were constructed and the structures examined using synchrotron radiation small- and wide-angle X-ray scattering (SR-SWAXS). The liposomes were prepared by a sequential combination of natural swelling, ultrasonic dispersion, freeze-throw, extrusion and spin-filtration. The liposomes were composed of acidic glycosphingolipid (ganglioside), cholesterol and phospholipids. By using shell-modeling methods, the asymmetric bilayer structure of the liposome and the encapsulation efficiency of proteins were determined. As well as other analytical techniques, SR-SWAXS and shell-modeling methods are shown to be a powerful tool for characterizing in situ structures of lipid liposomes as an important candidate of drug delivery systems. PMID:24121330

Hirai, Mitsuhiro; Kimura, Ryota; Takeuchi, Kazuki; Hagiwara, Yoshihiko; Kawai-Hirai, Rika; Ohta, Noboru; Igarashi, Noriyuki; Shimuzu, Nobutaka

2013-11-01

307

Optical Properties of 3,4,9,10-perylenetetracarboxylic dianhydride\\/copper phthalocyanine superlattices  

Microsoft Academic Search

Organic superlattices consisting of five alternating layers of 3,4,9,10-perylenetetracarboxylic dianhydride (PTCDA) and copper phthalocyanine (CuPc) were prepared by organic molecular-beam deposition in high vacuum on hydrogen-passivated, (111)-oriented silicon. The substrates were kept at room temperature during the deposition. The optical response of the multilayered structure was investigated by means of spectroscopic ellipsometry in the spectral range from 0.73 to 5

O. D. Gordan; S. Hermann; M. Friedrich; D. R. T. Zahn

2005-01-01

308

Directional growth of copper phthalocyanine crystal by selective chemical vapor deposition method  

NASA Astrophysics Data System (ADS)

Novel deposition behavior was observed when 1,4-dicyanobenzene was sublimed onto copper micropatterns on silicon wafer. On the patterns copper-phthalocyanine whiskers and debris of similar size were formed and preferentially oriented along or perpendicular to the copper lines. The directional growth was confirmed to have nothing to do with crystal axis of the silicon, but was considered to be due to the periodic structure of the copper lines.

Sekiguchi, A.; Uchida, T.; Sugimura, H.; Shimo, N.; Masuhara, H.

1994-09-01

309

Role of a phthalocyanine–fullerene dyad in multilayered organic solar cells  

Microsoft Academic Search

A double-bridged phthalocyanine–fullerene dyad (H2Pc–C60ee) was used as photo-active intramolecular donor–acceptor system in a layered organic solar cell. In this device, a poly(3-hexylthiophene) (PHT) film was used as electron donor, whereas either C60 or perylene tetracarboxylic diimide (PTCDI) film was selected as electron acceptor. The introduction of the dyad layer leads to an enhancement of the power conversion efficiency (?)

Paola Vivo; Mikko Ojala; Vladimir Chukharev; Alexander Efimov; Helge Lemmetyinen

2009-01-01

310

Preparation of a graphene oxide–phthalocyanine hybrid through strong ?–? interactions  

Microsoft Academic Search

A phthalocyanine derivative-2,11,20,29-tetra-tert-butyl-2,3-naphthalocyanine (NPc) was immobilized on graphene oxide (GO) to form a GO–NPc hybrid by the ?–? stacking supermolecular method. Spectroscopic measurements showed that intermolecular interactions immediately happened after mixing the two components together and the resultant hybrid was stable even during the dilution process, which were related to the strong ?–? interactions between GO and NPc. Spectroscopic evidence

Xuequan Zhang; Yiyu Feng; Saide Tang; Wei Feng

2010-01-01

311

Phthalocyanine\\/graphene hybrid-materials for gas sensing in bio-medical applications  

Microsoft Academic Search

In this work the fabrication of graphene\\/metal phthalocyanine (MePc) hybrid-materials was investigated. MePcs are biomimetic compounds modelled after the biologically important class of porphyrins (e.g. heme-group). They are widely used in sensing applications, since they exhibit easily detectable physicochemical changes when exposed to analytes frequently found in biology such as alcohols, aldehydes and other hydrocarbons, which makes them potential candidates

Johannes Ph. Mensing; Chakrit Sriprachuabwong; Anurat Wisitsoraat; Teerakiat Kerdcharoen; Adisorn Tuantranont

2011-01-01

312

Low frequency capacitance characterizations on indium\\/x-phase of metal free phthalocyanine solar cells  

Microsoft Academic Search

The low-frequency oscillographic capacitance measurements have been employed to characterize indium\\/x-phase of metal-free phthalocyanine Schottky-barrier solar cells. The capacitance-voltage relationships (1\\/c2 vs V) measured at various frequencies in the dark and under simulated solar illumination can be described by an approximation of two intersecting lines. The slope of these lines showed strong dependence on both frequency and light intensity. The

Y. H. Shing; R. O. Loutfy

1981-01-01

313

Determination of the Voigt constant of phthalocyanines by magneto-optical Kerr-effect spectroscopy  

Microsoft Academic Search

Thin films of organic molecular semiconductors from the class of phthalocyanines are investigated by means of magneto-optical Kerr effect (MOKE) spectroscopy at room temperature. A numerical analysis of the energy dispersion of the real and imaginary part of the complex magneto-optical Kerr rotation angle in the visible to near ultraviolet spectral range allows the first determination of the magneto-optical material

M. Fronk; B. Bräuer; J. Kortus; O. G. Schmidt; D. R. T. Zahn; G. Salvan

2009-01-01

314

Ethanol gas sensors based on copper phthalocyanine thin-film transistors  

Microsoft Academic Search

A bottom contact copper phthalocyanine (CuPc) based organic thin film transistor (OTFT) was fabricated in this paper. CuPc thin film acting both as gas sensing layer and the active layer was formed by vacuum evaporation and was characterized by scanning electron microscope(SEM). The results show that the film is highly ordered and has a polycrystalline morphology. The current-voltage characteristics of

Xian Li; Ya-Dong Jiang; Guang-Zhong Xie; Xiao-Song Du; Hui-Ling Tai; Jian-Fei Yan; Song-Qi Fu

2010-01-01

315

Characterization of CD44-Mediated Cancer Cell Uptake and Intracellular Distribution of Hyaluronan-Grafted Liposomes  

PubMed Central

Hyaluronan (HA) is a biocompatible and biodegradable linear polysaccharide which is of interest for tumor targeting through cell surface CD44 receptors. HA binds with high affinity to CD44 receptors, which are overexpressed in many tumors and involved in cancer metastasis. In the present study, we investigated the impact of HA molecular weight (MW), grafting density, and CD44 receptor density on endocytosis of HA-grafted liposomes (HA-liposomes) by cancer cells. Additionally, the intracellular localization of the HA-liposomes was determined. HAs of different MWs (5-8, 10-12, 175-350, and 1600 kDa) were conjugated to liposomes with varying degrees of grafting density. HA surface density was quantified using the hexadecyltrimethylammonium bromide turbidimetric method. Cellular uptake and subcellular localization of HA-liposomes were evaluated by flow cytometry and fluorescence microscopy. Mean particle sizes of HA-liposomes ranged from 120 to 180 nm and increased with the bigger size of HA. HA-liposome uptake correlated with HA MW (5-8 < 10-12 < 175-350 kDa), grafting density, and CD44 receptor density and exceeded that obtained with unconjugated plain liposomes. HA-liposomes were taken up into cells via lipid raft-mediated endocytosis, which is both energy- and cholesterol-dependent. Once within cells, HA-liposomes localized primarily to endosomes and lysosomes. The results demonstrate that cellular targeting efficiency of HA-liposomes depends strongly upon HA MW, grafting density, and cell surface receptor CD44 density. The results support a role of HA-liposomes for targeted drug delivery. PMID:21696190

Qhattal, Hussaini Syed Sha; Liu, Xinli

2011-01-01

316

Microcalorimetric studies of the effects of artesunate liposomes on the metabolism of Escherichia coli during growth  

Microsoft Academic Search

A thermal dynamic model of nanoformulations entrapped in artesunate liposomes was established and biological thermodynamics\\u000a was applied for investigation of the drug formulations. Effects of artesunate liposomes on the growth metabolism of Escherichia coli were studied by microcalorimetry. The results showed that (1) Comparison of artesunate and artesunate liposomes, the thermogenesis\\u000a curves of E. coli were significant different in the

Shen XuesongWang; Wang Tao; Jin Meihua; Zhao Chunxia; Qin Xuelian; Liu Hanfu; Qiu Zhuangping; Liu Yi

317

Treatment of neuroblastoma and rhabdomyosarcoma using RGD-modified liposomal formulations of patupilone (EPO906)  

PubMed Central

Background Patupilone (EPO906) is a microtubule stabilizer with a potent antitumor effect. Integrin ?V?3-binding (RGD) liposomes were loaded with EPO906, and their antitumor efficacy was evaluated in two pediatric tumor models, ie, neuroblastoma and rhabdomyosarcoma. Methods Integrin ?V?3 gene expression, RGD-liposome cellular association, and the effect of EPO906 and liposomal formulations of EPO906 on cell viability were assessed in vitro in human umbilical vein endothelial cells (HUVEC), in the RH-30 rhabdomyosarcoma cell line, and in the Kelly neuroblastoma cell line. In vivo, mice bearing neuroblastoma or rhabdomyosarcoma tumors were treated with EPO906, EPO906-liposomes, or EPO906-RGD-liposomes. Tumor growth, cumulative survival, and toxicity were monitored. Results Integrin ?V?3 was highly expressed in HUVEC and RH-30, but not in Kelly cells. Accordingly, RGD-liposomes were highly associated with HUVEC and RH-30 cells in vitro, but not with the Kelly cells. EPO906 and its liposomal formulations inhibited HUVEC, RH-30, and Kelly cell viability to the same extent. In vivo, EPO906 1.5 mg/kg and liposomal EPO906 potently inhibited tumor growth in both xenograft models without triggering major toxicity. At this dose, liposomal EPO906 did not enhance the antitumor effect of EPO906 in neuroblastoma, but tended to have an increased antitumor effect in rhabdomyosarcoma. Using a lower dose of EPO906-RGD-liposomes significantly enhanced cumulative survival in rhabdomyosarcoma compared with EPO906 alone. Conclusion EPO906 shows a strong antitumor effect in neuroblastoma and rhabdomyosarcoma, without triggering major side effects. Its liposomal encapsulation does not alter its activity, and enhances cumulative survival when EPO906-RGD-liposomes are used at low dose in rhabdomyosarcoma. PMID:23818777

Scherzinger-Laude, Karine; Schönherr, Carina; Lewrick, Felicitas; Süss, Regine; Francese, Giancarlo; Rössler, Jochen

2013-01-01

318

Viability of mammalian embryos subjected to liposome interaction or centrifugation for gene transfer  

E-print Network

for delivering DNA into embryos it is important to determine the effects of liposome inter actions on embryo viability. Furthermore, agents which enhance liposome transvection, i. e. glycerol and chloroquine, by stimulating plasma membrane endocytosis... of providing the necessary geometr ical relationship between the liposome and the plasma membrane that leads to membrane fusion or vesicle uptake in the presence of polyalcohols which can induce a transient destabilization in the cell membrane (Szoka et al...

Loskutoff, Nadia Mikhail

1985-01-01

319

Chemical coupling of thiolated chitosan to preformed liposomes improves mucoadhesive properties  

PubMed Central

Aim To develop mucoadhesive liposomes by anchoring the polymer chitosan-thioglycolic acid (chitosan-TGA) to the liposomal surface to target intestinal mucosal membranes. Methods Liposomes consisting of phosphatidylcholine (POPC) and a maleimide-functionalized lipid were incubated with chitosan-TGA, leading to the formation of a thioether bond between free SH-groups of the polymer and maleimide groups of the liposome. Uncoated and newly generated thiomer-coated liposomes were characterized according to their size, zeta potential, and morphology using photon correlation spectroscopy and transmission electron microscopy. The release behavior of calcitonin and the fluorophore/quencher-couple ANTS/DPX (8-aminonaphthalene-1,3,6-trisulfonic acid/p-xylene-bis- pyridinium bromide) from coated and uncoated liposomes, was investigated over 24 hours in simulated gastric and intestinal fluids. To test the mucoadhesive properties of thiomer-coated and uncoated liposomes in-vitro, we used freshly excised porcine small intestine. Results Liposomes showed a concentration-dependent increase in size – from approximately 167 nm for uncoated liposomes to 439 nm for the highest thiomer concentration used in this study. Likewise, their zeta potentials gradually increased from about ?38 mV to +20 mV, clearly indicating an effective coupling of chitosan-TGA to the surface of liposomes. As a result of mucoadhesion tests, we found an almost two-fold increase in the mucoadhesion of coupled liposomes relative to uncoupled ones. With fluorescence microscopy, we saw a tight adherence of coated particles to the intestinal mucus. Conclusion Taken together, our current results indicate that thiomer-coated liposomes possess a high potential to be used as an oral drug-delivery system. PMID:22679365

Gradauer, Kerstin; Vonach, Caroline; Leitinger, Gerd; Kolb, Dagmar; Fröhlich, Eleonore; Roblegg, Eva; Bernkop-Schnürch, Andreas; Prassl, Ruth

2012-01-01

320

Folate-mediated tumor cell targeting of liposome-entrapped doxorubicin in vitro  

Microsoft Academic Search

Receptors for the vitamin folic acid are frequently overexpressed on epithelial cancer cells. To examine whether this overexpression might be exploited to specifically deliver liposome-encapsulated drug molecules in vitro, folate-targeted liposomes were prepared by incorporating 0.1 mol% of a folate-polyethyleneglycol-distearoylphosphatidylethanolamine (folate-PEG-DSPE) construct into the lipid bilayer, and were loaded with doxorubicin (DOX), an anti-cancer drug. Uptake of folate-PEG-liposomal DOX by

Robert J Lee; Philip S Low

1995-01-01

321

Improved absorption of salmon calcitonin by ultraflexible liposomes through intranasal delivery  

Microsoft Academic Search

The objective of this work was to explore the potential of ultraflexible liposomes as carriers for improving the absorption of salmon calcitonin (sCT) through intranasal administration. The average diameters of positively charged ultraflexible liposomes ranged from about 73 to 99nm, while those of negatively charged ones were 114 and 157.6nm, respectively. The content of sodium deoxycholate in liposomes markedly affected

Ming Chen; Xin-Ru Li; Yan-Xia Zhou; Ke-Wei Yang; Xing-Wei Chen; Qiu Deng; Yan Liu; Li-Jun Ren

2009-01-01

322

Electronic absorption band broadening and surface roughening of phthalocyanine double layers by saturated solvent vapor treatment  

SciTech Connect

Variations in the electronic absorption (EA) and surface morphology of three types of phthalocyanine (Pc) thin film systems, i.e. copper phthalocyanine (CuPc) single layer, zinc phthalocyanine (ZnPc) single layer, and ZnPc on CuPc (CuPc/ZnPc) double layer film, treated with saturated acetone vapor were investigated. For the treated CuPc single layer film, the surface roughness slightly increased and bundles of nanorods were formed, while the EA varied little. In contrast, for the ZnPc single layer film, the relatively high solubility of ZnPc led to a considerable shift in the absorption bands as well as a large increase in the surface roughness and formation of long and wide nano-beams, indicating a part of the ZnPc molecules dissolved in acetone, which altered their molecular stacking. For the CuPc/ZnPc film, the saturated acetone vapor treatment resulted in morphological changes in mainly the upper ZnPc layer due to the significantly low solubility of the underlying CuPc layer. The treatment also broadened the EA band, which involved a combination of unchanged CuPc and changed ZnPc absorption.

Kim, Jinhyun [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of)] [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of); Yim, Sanggyu, E-mail: sgyim@kookmin.ac.kr [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of)] [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of)

2012-10-15

323

Spectroscopic insights on selfassembly and excited state interactions between rhodamine and phthalocyanine molecules.  

PubMed

The absorption and fluorescence spectra as well as fluorescence lifetimes of tetrasulfonated zinc phthalocyanine ZnPc(SO3Na)4 were measured in the absence and presence of four rhodamine dyes, Rhodamine B (RB), Ethyl rhodamine B (ERB), Rhodamine 6G (R6G), Rhodamine 110 (R110), and Pyronine B (PYB). The ground state complexes of phthalocyanine-(Rhodamine)2 were observed which exhibit new absorption bands. The binding constants are all very large (0.86×10(5)-0.22×10(8)M(-1)), suggesting rhodamine-phthalocyanine pairs are very good combinations for efficient selfassembly. Both the fluorescence intensity and the lifetime values of ZnPc(SO3Na)4 were decreased by the presence of rhodamines. The structural effect of rhodamines on selfassembly is significant. The ground state binding and dynamic quenching capability is PYB>R6G>ERB>RB>R110. The dynamic fluorescence quenching is due to the photoinduced electron transfer (PET). The PET rate constant is very large and in the order of 10(13)M(-1)s(-1), much greater than kf and kic (in the order of 10(8)M(-1)s(-1)), which means that the PET efficiency is almost 100%. Therefore the non-covalent Pc-rhodamine is a very good pair of donor/acceptor for potential efficient solar energy conversion. PMID:25546492

Geng, Hao; Zhang, Xian-Fu

2015-03-15

324

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification  

PubMed Central

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2?, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

2006-01-01

325

In situ metalation of free base phthalocyanine covalently bonded to silicon surfaces  

PubMed Central

Summary Free 4-undecenoxyphthalocyanine molecules were covalently bonded to Si(100) and porous silicon through thermic hydrosilylation of the terminal double bonds of the undecenyl chains. The success of the anchoring strategy on both surfaces was demonstrated by the combination of X-ray photoelectron spectroscopy with control experiments performed adopting the commercially available 2,3,9,10,16,17,23,24-octakis(octyloxy)-29H,31H-phthalocyanine, which is not suited for silicon anchoring. Moreover, the study of the shape of the XPS N 1s band gave relevant information on the interactions occurring between the anchored molecules and the substrates. The spectra suggest that the phthalocyanine ring interacts significantly with the flat Si surface, whilst ring–surface interactions are less relevant on porous Si. The surface-bonded molecules were then metalated in situ with Co by using wet chemistry. The efficiency of the metalation process was evaluated by XPS measurements and, in particular, on porous silicon, the complexation of cobalt was confirmed by the disappearance in the FTIR spectra of the band at 3290 cm?1 due to –NH stretches. Finally, XPS results revealed that the different surface–phthalocyanine interactions observed for flat and porous substrates affect the efficiency of the in situ metalation process. PMID:25551050

Lupo, Fabio; Tudisco, Cristina; Bertani, Federico; Dalcanale, Enrico

2014-01-01

326

Aqueous Speciation and Electrochemical Properties of a Water-Soluble Manganese Phthalocyanine Complex#  

PubMed Central

The speciation behavior of a water-soluble manganese(III) tetrasulfonated phthalocyanine complex was investigated with UV-visible and electron paramagnetic resonance (EPR) spectroscopies, as well as cyclic voltammetry. Parallel-mode EPR (in dimethylformamide:pyridine solvent mix) reveals a six-line hyperfine signal, centered at a g-value of 8.8, for the manganese(III) monomer, characteristic of the d4 S=2 system. The color of an aqueous solution containing the complex is dependent upon the pH of the solution; the phthalocyanine complex can exist as a water-bound monomer, a hydroxide-bound monomer, or an oxo-bridged dimer. Addition of coordinating bases such as borate or pyridine changes the speciation behavior by coordinating the manganese center. From the UV-visible spectra, complete speciation diagrams are plotted by global analysis of the pH-dependent UV-visible spectra, and a complete set of pKa values is obtained by fitting the data to a standard pKa model. Electrochemical studies reveal a pH-independent quasi-reversible oxidation event for the monomeric species, which likely involves oxidation of the organic ligand to the radical cation species. Adsorption of the phthalocyanine complex on the carbon working electrode was sometimes observed. The pKa values and electrochemistry data are discussed in the context of the development of mononuclear water-oxidation catalysts. PMID:22585306

Blakemore, James D.; Hull, Jonathan F.

2012-01-01

327

Understanding domain symmetry in vanadium oxide phthalocyanine monolayers on Au (111)  

NASA Astrophysics Data System (ADS)

Understanding the growth of organic semiconductors on solid surfaces is of key importance for the field of organic electronics. Non planar phthalocyanines have shown great promise in organic photovoltaic (OPV) applications, but little of the fundamental surface characterization to understand their structure and properties has been performed. Acquiring a deeper understanding of the molecule/substrate interaction in small molecule systems is a vital step in controlling structure/property relationships. Here we characterize the vanadium oxide phthalocyanine (VOPc)/Au (111) surface using a combination of low energy electron diffraction (LEED) and scanning tunneling microscopy (STM), obtaining complex diffraction patterns which can be understood using two dimensional fast Fourier transform (2D-FFT) analysis of STM images. These measurements reveal coexistence of three symmetrically equivalent in-plane orientations with respect to the substrate, each of which is imaged simultaneously within a single area. Combining scanning probe and diffraction measurements allows symmetrically related domains to be visualized and structurally analyzed, providing fundamental information useful for the structural engineering of non-planar phthalocyanine interfaces.

Rochford, L. A.; Hancox, I.; Jones, T. S.

2014-10-01

328

Time-gated fluorescence imaging of chloroaluminum phthalocyanine tetrasulfonate in a tissue phantom  

NASA Astrophysics Data System (ADS)

Phthalocyanine derivatives are currently under investigation for use in Photodynamic Therapy, which is a promising treatment for cancer. These materials, which display preferential uptake in cancerous cells, also exhibit high fluorescence yields, and can be used for tumour detection. Problems with steady-state fluorescence techniques such as background autofluorescence can be eliminated by the use of time-resolved techniques. Improved contrast can be obtained with time-resolved techniques because of the differing lifetimes between endogenous and exogenous photosensitisers. An imaging system was constructed using a fast (200 psec) gated CCD camera and a pulsed 635 nm laser diode. A tissue phantom was assembled to test the system by drilling thirty-six wells of varying diameter and depth (10 mm to 1 mm) into a block of polymethyl methacrylate (PMMA). The system was used to record images of chloroaluminum phthalocyanine tetrasulfonate within the wells at differing concentrations in phosphate buffer. A mixture of 1) Intralipid to mimic tissue scatter, 2) Evans blue to mimic tissue absorption, and 3) zinc phthalocyanine tetrasulfonate to mimic healthy tissue autofluorescence of varying depth was placed on top of the PMMA block. These results contribute to the precision of a time-gated imaging system to image living organisms using fluorescence lifetimes.

Gundy, Sarah L.; van der Putten, Wilhelm J. M.; Shearer, Andrew; Buckton, Daniel J.; Ryder, Alan G.; Ball, Michael

2003-03-01

329

Inhomogeneous charge transfer within monolayer zinc phthalocyanine absorbed on TiO{sub 2}(110)  

SciTech Connect

The d-orbital contribution from the transition metal centers of phthalocyanine brings difficulties to understand the role of the organic ligands and their molecular frontier orbitals when it adsorbs on oxide surfaces. Here we use zinc phthalocyanine (ZnPc)/TiO{sub 2}(110) as a model system where the zinc d-orbitals are located deep below the organic orbitals leaving room for a detailed study of the interaction between the organic ligand and the substrate. A charge depletion from the highest occupied molecular orbital is observed, and a consequent shift of N1s and C1s to higher binding energy in photoelectron spectroscopy (PES). A detailed comparison of peak shifts in PES and near-edge X-ray absorption fine structure spectroscopy illustrates a slightly uneven charge distribution within the molecular plane and an inhomogeneous charge transfer screening between the center and periphery of the organic ligand: faster in the periphery and slower at the center, which is different from other metal phthalocyanine, e.g., FePc/TiO{sub 2}. Our results indicate that the metal center can substantially influence the electronic properties of the organic ligand at the interface by introducing an additional charge transfer channel to the inner molecular part.

Yu Shun; Ahmadi, Sareh; Adibi, Pooya Tabib Zadeh; Chow, Winnie; Goethelid, Mats [Materials Physics, ICT, Royal Institute of Technology, Electrum 229, SE-16440 Stockholm (Sweden); Sun, Chenghua [University of Queensland, ARC Centre of Excellence for Functional Nanomaterials and Centre for Computational Molecular Science, Australia Institute for Bioengineering and Nanotechnology, University of Queensland, Qld 4072 (Australia); Pietzsch, Annette [Max-lab, Lund University, Box 118, SE- 22100 Lund (Sweden)

2012-04-21

330

Inhomogeneous charge transfer within monolayer zinc phthalocyanine absorbed on TiO2(110)  

NASA Astrophysics Data System (ADS)

The d-orbital contribution from the transition metal centers of phthalocyanine brings difficulties to understand the role of the organic ligands and their molecular frontier orbitals when it adsorbs on oxide surfaces. Here we use zinc phthalocyanine (ZnPc)/TiO2(110) as a model system where the zinc d-orbitals are located deep below the organic orbitals leaving room for a detailed study of the interaction between the organic ligand and the substrate. A charge depletion from the highest occupied molecular orbital is observed, and a consequent shift of N1s and C1s to higher binding energy in photoelectron spectroscopy (PES). A detailed comparison of peak shifts in PES and near-edge X-ray absorption fine structure spectroscopy illustrates a slightly uneven charge distribution within the molecular plane and an inhomogeneous charge transfer screening between the center and periphery of the organic ligand: faster in the periphery and slower at the center, which is different from other metal phthalocyanine, e.g., FePc/TiO2. Our results indicate that the metal center can substantially influence the electronic properties of the organic ligand at the interface by introducing an additional charge transfer channel to the inner molecular part.

Yu, Shun; Ahmadi, Sareh; Sun, Chenghua; Adibi, Pooya Tabib Zadeh; Chow, Winnie; Pietzsch, Annette; Göthelid, Mats

2012-04-01

331

In Vivo Monitoring of Tissue Pharmacokinetics of Liposome/Drug Using MRI: Illustration of Targeted  

E-print Network

words: hyperthermia; chemotherapy; pharmacokinetics; liposomes Effective cancer chemotherapy depends with hyperthermia by providing individualized monitoring of tissue drug concentration distribu- tion during or after

332

Characterization of heat-induced interaction of neutral liposome with lipid membrane of Streptomyces griseus cell.  

PubMed

The interaction between the neutral 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphatidylcholine (POPC) liposomes and cell membrane of Streptomyces griseus induced by the heat treatment at specific temperature was investigated, focusing on the internalization of the neutral POPC liposomes with S. griseus cells. In an attempt to clarify the modes of liposome internalization, various kinds of inhibitors of endocytotic pathways were used to treat S. griseus cells. The efficiency of the heat treatment on liposome-cell membrane interactions was finally characterized based on the hydrophobic, electrostatic interactions and hydration effect. In fact, the internalization of the neutral liposomes into these cells was found to show higher rate and greater amount at higher temperatures. The kinetic study showed that the maximum amount of the internalized liposomes was, respectively, 469 x 10(5) and 643 x 10(5) liposomes/cell at 37 and 41 degrees C. The internalization of the neutral liposomes induced by the heat treatment was characterized, implying that the endocytosis occurred. The interactions involving the internalization, adsorption, and fusion of these liposomes with S. griseus cells were mainly contributed by the hydrophobic interaction and the unstable hydrogen bonds caused by the loss of water of surface hydration of cell membrane rather than the electrostatic interaction under the specific heat condition. PMID:19592227

Ngo, Kien Xuan; Umakoshi, Hiroshi; Shimanouchi, Toshinori; Kuboi, Ryoichi

2009-10-15

333

Interaction of Colistin and Colistin Methanesulfonate with Liposomes: Colloidal Aspects and Implications for Formulation  

PubMed Central

Interaction of colistin and colistin methanesulfonate (CMS) with liposomes has been studied with the view to understanding the limitations to the use of liposomes as a more effective delivery system for pulmonary inhalation of this important class of antibiotic. Thus, in this study, liposomes containing colistin or CMS were prepared and characterized with respect to colloidal behavior and drug encapsulation and release. Association of anionic CMS with liposomes induced negative charge on the particles. However, degradation of the CMS to form cationic colistin over time was directly correlated with charge reversal and particle aggregation. The rate of degradation of CMS was significantly more rapid when associated with the liposome bilayer than when compared with the same concentration in aqueous solution. Colistin liposomes carried positive charge and were stable. Encapsulation efficiency for colistin was approximately 50%, decreasing with increasing concentration of colistin. Colistin was rapidly released from liposomes on dilution. Although the studies indicate limited utility of colistin or CMS liposomes for long duration controlled-release applications, colistin liposomes were highly stable and may present a potential opportunity for coformulation of colistin with a second antibiotic to colocalize the two drugs after pulmonary delivery. PMID:22623044

WALLACE, STEPHANIE J.; LI, JIAN; NATION, ROGER L.; PRANKERD, RICHARD J.; BOYD, BEN J.

2012-01-01

334

Application of anion-exchange resin to remove lipophilic chelates from liposomes  

SciTech Connect

Lipophilic chelates such as 8-hydroxyquinoline, acetylacetone, and tropolone are useful to load high levels of radioactive cations into the inner aqueous compartments of liposomes for investigating the fate of liposomes by the technique of gamma imaging or gamma-ray perturbed angular correlation measurements. However, if lipophilic chelates are not completely removed from liposomes the very same lipophilic chelates can also cause leakage of the entrapped cations from liposomes. Thus, it is essential to make sure that all the lipophilic chelates are removed from liposomes after the loading process. The results of the present study show that more than 99.85% of acetylacetone in liposomal suspension can be removed by a minicolumn of AG1-X8 (phosphate form) anion exchange resin. Virtually all the 8-hydroxyquinoline and tropolone in liposomal suspension are adsorbed tightly to the resin. The procedure is rapid, and the dilution of liposomes is minimal. For experiments involving high levels of gamma-emitting radionuclides, the cleaning up process of removing lipophilic chelates from liposomes can be conveniently operated behind a lead glass.

Choi, H.O.; Hwang, K.J.

1986-07-01

335

Formation of supported lipid bilayers on silica: relation to lipid phase transition temperature and liposome size.  

PubMed

DPPC liposomes ranging from 90 nm to 160 nm in diameter were prepared and used for studies of the formation of supported lipid membranes on silica (SiO2) at temperatures below and above the gel to liquid-crystalline phase transition temperature (Tm = 41 °C), and by applying temperature gradients through Tm. The main method was the quartz crystal microbalance with dissipation (QCM-D) technique. It was found that liposomes smaller than 100 nm spontaneously rupture on the silica surface when deposited at a temperature above Tm and at a critical surface coverage, following a well-established pathway. In contrast, DPPC liposomes larger than 160 nm do not rupture on the surface when adsorbed at 22 °C or at 50 °C. However, when liposomes of this size are first adsorbed at 22 °C and at a high enough surface coverage, after which they are subject to a constant temperature gradient up to 50 °C, they rupture and fuse to a bilayer, a process that is initiated around Tm. The results are discussed and interpreted considering a combination of effects derived from liposome-surface and liposome-liposome interactions, different softness/stiffness and shape of liposomes below and above Tm, the dynamics and thermal activation of the bilayers occurring around Tm and (for liposomes containing 33% of NaCl) osmotic pressure. These findings are valuable both for preparation of supported lipid bilayer cell membrane mimics and for designing temperature-responsive material coatings. PMID:24651504

Jing, Yujia; Trefna, Hana; Persson, Mikael; Kasemo, Bengt; Svedhem, Sofia

2014-01-01

336

Enhanced antisense oligonucleotide delivery using cationic liposomes incorporating fatty acid-modified polyethylenimine.  

PubMed

Antisense oligonucleotides (ASOs) have promising therapeutic potential in oncotherapy. However, low stability and efficacy limit their application in the clinic. Cationic liposomes have been investigated as delivery vehicles for ASOs. Here, we report the synthesis and evaluation of an ASO delivery vehicle comprising cationic liposomes incorporating fatty acid-modified polyethylenimine. An oleic acid derivative of branched polyethylenimine (PEI-OA) and a linoleic acid derivative of branched polyethylenimine (PEI-LA) were synthesized and incorporated into liposomes. The PEI-modified liposomes were synthesized by an ethanol injection method with composition of PEI-modified lipid/Chol/TPGS. The properties of these liposomes, including cytotoxicity, cellular uptake, ASO target silencing activity, based on mRNA and protein downregulation, were investigated. LOR-2501, an ASOs targeting ribonucleotide reductase R1 subunit (R1) was used as the therapeutic cargo. The PEI-modified liposomes showed relatively compact particle size and excellent colloidal stability for at least 25 days. PEI-modified liposomes effectively delivered LOR-2501 into KB cells and efficiently induced down-regulation of R1 mRNA and protein. Compared with regular cationic liposomes, PEI-modified liposomes was more effective, reducing R1 mRNA and protein by ~10%. PMID:25403516

Guo, Zhihua; Li, Yujing; Fu, Yige; Guo, Tianqi; Li, Xin; Yang, Shuang; Xie, Jing

2014-01-01

337

Nanoparticle-Stabilized Liposomes for pH-Responsive Gastric Drug Delivery  

PubMed Central

We report a novel pH-responsive gold nanoparticle-stabilized liposome system for gastric antimicrobial delivery. By adsorbing small chitosan-modified gold nanoparticles (diameter ~ 10 nm) onto the outer surface of negatively charged phospholipid liposomes (diameter ~ 75 nm), we show that at gastric pH the liposomes have excellent stability with limited fusion ability and negligible cargo releases. However when the stabilized liposomes are present in an environment with neutral pH, the gold stabilizers detach from the liposomes resulting in free liposomes that can actively fuse with bacterial membranes. Using Helicobacter pylori as a model bacterium and doxycycline as a model antibiotic, we demonstrate such pH-responsive fusion activity and drug release profile of the nanoparticle-stabilized liposomes. Particularly, at neutral pH the gold nanoparticles detach and thus the doxycycline-loaded liposomes rapidly fuse with bacteria and cause superior bactericidal efficacy as compared to the free doxycycline counterpart. Our results suggest that the reported liposome system holds a substantial potential for gastric drug delivery; it remains inactive (stable) in the stomach lumen but actively interact with bacteria once reaches the mucus layer of the stomach where the bacteria may reside. PMID:23987129

Thamphiwatana, Soracha; Fu, Victoria; Zhu, Jingying; Lu, Diannan; Gao, Weiwei; Zhang, Liangfang

2014-01-01

338

Liposome-enhanced immunomigration strips for field screening of toxic chemicals  

SciTech Connect

The use of liposomes containing encapsulated dye to provide instantaneous enhancement of signals generated in competitive immunoassays is described for two model analytes of environmental concern, alachlor and PCBs. The application of this strategy to field assays is demonstrated utilizing two complementary assay designs based on immunomigration along a nitrocellulose test strip. The liposome immunocompetition (LIC) assay involves immobilizing antibodies onto a strip and allowing the sample and analyte-tagged, dye-containing liposomes to migrate through this zone. Liposomes passing through without binding, as a result of competition from the sample analyte, are totally bound in an upper collection region, and the degree of color in this region is proportional to the analyte concentration. The liposome immunoaggregation (LIA) assay detects antibody-liposome association in a homogeneous incubation solution into which a test strip is subsequently placed. Antibody-bound aggregates of liposomes are trapped on the porous nitrocellulose test strip at the level of the meniscus, due to mechanisms that will be discussed. However, sample analyte competitively inhibits antibody-liposome association and, therefore, a proportional amount of unbound liposomes will escape entrapment on the nitrocellulose and can then be collected and quantitated in a measurement zone. This latter technique shows enhanced sensitivity, but involves an extra incubation step. Therefore these two techniques may be used interchangeably depending on the sensitivity and time requirements of a particular project. Prototype assay designs are demonstrated here and emerging detection strategies are discussed.

Roberts, M.A.; Reeves, S.G.; Siebert, S.T.; Durst, R.A. [Cornell Univ., Geneva, NY (United States). Analytical Chemistry Labs.; [Cornell Univ., Ithaca, NY (United States). National Nanofabrication Facility

1995-12-31

339

Effective mucoadhesive liposomal delivery system for risedronate: preparation and in vitro/in vivo characterization  

PubMed Central

In this work, we aimed to develop chitosan-coated mucoadhesive liposomes containing risedronate to improve intestinal drug absorption. Liposomes containing risedronate were prepared with 1,2-distearoryl-sn-glycero-3-phosphocholine and distearoryl-sn-glycero-3-[phospho-rac-(1-glycerol)] using the freeze-drying method, with subsequent coating of the anionic surfaces of the liposomes with chitosan. The in vitro characteristics of the chitosan-coated liposomes were investigated, including their stability, mucoadhesiveness, and Caco-2 cell permeability. This formulation was stable in simulated gastric and intestinal fluids, with the percentage of drug remaining in the liposomes being more than 90% after 24 hours of incubation. Chitosan-coated liposomes also showed strong mucoadhesive properties, implying potential electrostatic interaction with the mucous layer in the gastrointestinal tract. Compared with the untreated drug, chitosan-coated liposomes significantly enhanced the cellular uptake of risedronate, resulting in an approximately 2.1–2.6-fold increase in Caco-2 cells. Further, the chitosan-coated liposomes increased the oral exposure of risedronate by three-fold in rats. Taken together, the results of this study suggest that chitosan-coated liposomes containing risedronate should be effective for improving the bioavailability of risedronate. PMID:24872692

Jung, Il-Woo; Han, Hyo-Kyung

2014-01-01

340

Exploring the fate of liposomes in the intestine by dynamic in vitro lipolysis.  

PubMed

Liposomes are generally well tolerated drug delivery systems with a potential use for the oral route. However, little is known about the fate of liposomes during exposure to the conditions in the gastro-intestinal tract (GIT). To gain a better understanding of liposome stability in the intestine, a dynamic in vitro lipolysis model, which so far has only been used for the in vitro characterisation of other lipid-based drug delivery systems, was applied to different liposomal formulations. Liposome size and phospholipid (PL) digestion were determined as two markers for liposome stability. In addition, the effect of PL degradation on the ability to maintain liposomally incorporated danazol in solution during lipolysis was evaluated in order to address the feasibility of liposomes designed for oral administration. Rate and extend of hydrolysis of PLs mediated by pancreatic enzymes was determined by titration and HPLC. Size of liposomes was determined by dynamic light scattering during incubation in lipolysis medium (LM) and during lipolysis. SPC-based (soy phosphatidylcholine) liposomes were stable in LM, whereas for EPC-3-based (hydrated egg phosphatidylcholine) formulations the formation of aggregates of around 1 ?m in diameter was observed over time. After 60 min lipolysis more than 80% of PLs of the SPC-liposomes were digested, but dependent on the liposome concentration only a slight change in size and size distribution could be observed. Although EPC-3 formulations did form aggregates during lipolysis, the lipids exhibited a higher stability compared to SPC and only 30% of the PLs were digested. No direct correlation between liposome integrity assessed by vesicle size and PL digestion was observed. Danazol content in the liposomes was around 5% (mol/mol danazol/total lipid) and hardly any precipitation was detected during the lipolysis assay, despite pronounced lipolytic degradation and change in vesicle size. In conclusion, the tested dynamic in vitro lipolysis model is suitable for the assessment of liposome stability in the intestine. Furthermore, liposomes might be a useful alternative to other lipid based delivery systems for the oral delivery of poorly soluble drugs. PMID:22939968

Parmentier, Johannes; Thomas, Nicky; Müllertz, Anette; Fricker, Gert; Rades, Thomas

2012-11-01

341

Delivery of Suramin as an Antiviral Agent through Liposomal Systems.  

PubMed

Norovirus RNA-dependent RNA polymerase (RdRp) is a promising target enzyme for the development of new antiviral drugs. Starting from the crystal structure of norovirus RdRp, we had previously performed an in silico docking search using a library of low-molecular-weight compounds that enabled us to select molecules with predicted enzyme inhibitory activity. Among these, the polysulfonated naphthylurea suramin proved to inhibit in vitro both murine and human norovirus polymerases, with IC50 values in the low micromolar range. The negatively charged inhibitor, however, displayed poor cell permeability in cell-based experiments. Therefore, we produced different suramin-loaded liposome formulations and evaluated their activities in cell-based assays using murine norovirus cultivated in RAW 264.7 macrophages, as a model for norovirus genus. The results obtained show that suramin, when delivered through liposomes, can effectively inhibit murine norovirus replication. PMID:24616282

Mastrangelo, Eloise; Mazzitelli, Stefania; Fabbri, Jacopo; Rohayem, Jacques; Ruokolainen, Janne; Nykänen, Antti; Milani, Mario; Pezzullo, Margherita; Nastruzzi, Claudio; Bolognesi, Martino

2014-05-01

342

Antioxidant activity of quercetin and myricetin in liposomes.  

PubMed

The antioxidant activity during storage at 30 degrees C of quercetin, myricetin and alpha-tocopherol in small unilamellar liposomes has been investigated. Myricetin was more effective than alpha-tocopherol as an antioxidant in liposomes under all conditions studied. At pH 5.4 with a concentration of 10(-2) mol/mol phospholipid, myricetin has been shown to be the strongest antioxidant followed by quercetin and alpha-tocopherol. Cupric chloride and ferric chloride strongly reduced the antioxidant activity of myricetin and quercetin with cupric chloride causing a stronger reduction in activity than ferric chloride. At a pH of 7.4, quercetin was less effective than alpha-tocopherol at a concentration of 10(-2) mol/mol phospholipid, but it's activity increased more strongly with concentration and it was very effective at a concentration of 5 x 10(-2) mol/mol phospholipid. PMID:10081150

Gordon, M H; Roedig-Penman, A

1998-12-01

343

The activity of Triton X-100 soluble chlorophyllase in liposomes.  

PubMed

Chlorophyllase (chlorophyll-chlorophyllidohydrolase, EC 3.1.1.14) was isolated and purified from Phaseolus vulgaris L. chloroplasts and etioplasts dissolved in 1% Triton X-100 and 10% glycerol. A 100 and 40-fold purification, respectively, was achieved. Enzyme preparations from both sources had similar affinities for chlorophyll a when assayed in a Triton X-100 medium. When electrophoresed in sodium dodecyl sulphate polyacrylamide gels the major band in both preparations migrated as a peptide of 30,000 daltons. Chlorophyll containing liposomes were also used as a substrate for chlorophyllase. The rate of hydrolysis did not follow Michaelis-Menten kinetics. When chlorophyllide a or methyl chlorophyllide a was incorporated in the liposomes, then in the presence of phytol dissolved in methanol, methylchlorophyllide a and chlorophyll a were shown to be synthesized. Apparently the purified enzyme in the presence of lipids, is endowed with both synthetic and hydrolytic activity. PMID:24414364

Moll, W A; Stegwee, D

1978-01-01

344

Self-assembled liposomal nanoparticles in photodynamic therapy  

PubMed Central

Photodynamic therapy (PDT) employs the combination of non-toxic photosensitizers (PS) together with harmless visible light of the appropriate wavelength to produce reactive oxygen species that kill unwanted cells. Because many PS are hydrophobic molecules prone to aggregation, numerous drug delivery vehicles have been tested to solubilize these molecules, render them biocompatible and enhance the ease of administration after intravenous injection. The recent rise in nanotechnology has markedly expanded the range of these nanoparticulate delivery vehicles beyond the well-established liposomes and micelles. Self-assembled nanoparticles are formed by judicious choice of monomer building blocks that spontaneously form a well-oriented 3-dimensional structure that incorporates the PS when subjected to the appropriate conditions. This self-assembly process is governed by a subtle interplay of forces on the molecular level. This review will cover the state of the art in the preparation and use of self-assembled liposomal nanoparticles within the context of PDT. PMID:24348377

Sadasivam, Magesh; Avci, Pinar; Gupta, Gaurav K.; Lakshmanan, Shanmugamurthy; Chandran, Rakkiyappan; Huang, Ying-Ying; Kumar, Raj; Hamblin, Michael R.

2013-01-01

345

Coiled coil driven membrane fusion between cyclodextrin vesicles and liposomes.  

PubMed

Controlled fusion events between natural membranes composed of phospholipids with synthetic unnatural membranes will yield valuable fundamental information on the mechanism of membrane fusion. Here, fusion between vastly different phospholipid liposomes and cyclodextrin amphiphile based vesicles (CDVs) controlled by a pair of coiled coil forming lipidated peptides was investigated. Fusion events were characterized using lipid and content mixing assays and the resulting hybrid assemblies were characterized with cryo-TEM imaging. The secondary/quaternary structure of the lipidated peptides at the membrane interface was studied using circular dichroism spectroscopy. This is the first example of targeted fusion between natural and non-natural bilayer membranes and the in situ formation of hybrid CDV-liposome structures is of interest as it yields fundamental information about the mechanism through which fusion proceeds. PMID:25367891

Versluis, Frank; Voskuhl, Jens; Vos, Jan; Friedrich, Heiner; Ravoo, Bart Jan; Bomans, Paul H H; Stuart, Marc C A; Sommerdijk, Nico A J M; Kros, Alexander

2014-11-19

346

Recognition of concanavalin A by cationic glucosylated liposomes.  

PubMed

The specificity of carbohydrate-lectin interaction has been reported as an attractive strategy for drug delivery in cancer therapy because of the high levels of lectins in several human malignancies. A novel cationic glucosylated amphiphile was therefore synthesized, as a model system, to attribute specificity toward d-glucose receptors to liposome formulations. Fluorescence experiments demonstrated that the monomeric glucosylated amphiphile is capable of interacting with fluorescently labeled concanavalin A, a D-glucose specific plant lectin. The interaction of concanavalin A with liposomes composed of a phospholipid and the glucosylated amphiphile was demonstrated by agglutination observed by optical density and dynamic laser light scattering measurements, thus paving the way to the preparation of other glycosilated amphiphiles differing for the length of polyoxyethylenic spacer, the sugar moieties, and/or the length of the hydrophobic chain. PMID:25185719

Mauceri, Alessandro; Borocci, Stefano; Galantini, Luciano; Giansanti, Luisa; Mancini, Giovanna; Martino, Antonio; Salvati Manni, Livia; Sperduto, Claudio

2014-09-30

347

[Drug and gene delivery by "bubble liposomes" and ultrasound].  

PubMed

Gene therapy has a potentiality for treatment of cancer and diseases from genomic defects. It is important to select a vector which has good potency in terms of gene transduction efficiency, and is safe and easy to apply. Many researchers have attempted to develop an effective gene delivery carrier. Recently, it was reported that microbubbles, which are ultrasound (US) contrast agents, improved the transfection efficiency by cavitation with US exposure. However, microbubbles had problems with stability and targeting ability. To solve these problems, we focused on liposomes that had many advantages such as being stable and safe in vivo and easily modifying targeting ligand. We succeeded in preparing the liposomes ("Bubble liposomes" (BLs)) entrapping perfluoropropane gas which was utilized for contrast enhancement in ultrasonography. In this study, we assessed the feasibility of BLs as gene delivery carrier utilized cavitation by US exposure. BLs could deliver plasmid DNA to various cell types in vitro by combining with US without cytotoxicity. To evaluate the ability of BLs to in vivo gene delivery, we attempted to deliver plasmid DNA into the femoral artery. The gene expression at this artery treated with BLs and US combination was higher than with US only, BLs without US or Lipofectamine 2000. This result suggested that Bubble liposomes could quickly deliver plasmid DNA into the artery even under conditions of short contact time between BLs and the endothelial cells and the existence of the bloodstream and serum. These results suggested that BLs might be a non-invasive and effective carrier for gene delivery. PMID:17473519

Maruyama, Kazuo; Suzuki, Ryo; Takizawa, Tomoko; Utoguchi, Naoki; Negishi, Yoichi

2007-05-01

348

Aldehyde-encapsulating liposomes impair marine grazer survivorship.  

PubMed

In the last decade, there has been an increased awareness that secondary metabolites produced by marine diatoms negatively impact the reproductive success of their principal predators, the copepods. Several oxylipins, products of the enzymatic oxidation of fatty acids, are produced when these unicellular algae are damaged, as occurs during grazing. In the past, the dinoflagellate Prorocentrum minimum, which does not produce the oxylipin 2-trans,4-trans-decadienal (DD), has been used as a live carrier to calculate daily ingestion rates of this molecule by copepod crustaceans. However, since the interaction between oxylipins and live carriers is unknown, the question as to how much and for how long ingestion of these molecules affects copepod reproduction remains a critical point to understanding the functional role of such compounds at sea. In the investigation presented here we used giant liposomes ( approximately 7 mum) as a delivery system for the oxylipin DD, prepared in the same size range as copepod food and containing known amounts of DD. The aim of this work was to relate the ingestion of DD to the reproductive failure of the copepods Temora stylifera and Calanus helgolandicus. Liposomes were very stable over time and after 10 days of feeding, liposomes encapsulating DD reduced egg hatching success and female survival with a concomitant appearance of apoptosis in both copepod embryos and female tissues. Concentrations of DD inducing blockage were one order of magnitude lower that those used in classical feeding experiments demonstrating that liposomes are a useful tool to quantitatively analyze the impact of toxins on copepods. PMID:18424676

Buttino, Isabella; De Rosa, Giuseppe; Carotenuto, Ylenia; Mazzella, Marialuisa; Ianora, Adrianna; Esposito, Francesco; Vitiello, Valentina; Quaglia, Fabiana; La Rotonda, Maria Immacolata; Miralto, Antonio

2008-05-01

349

The p10 FAST protein fusion peptide functions as a cystine noose to induce cholesterol-dependent liposome fusion without liposome tubulation.  

PubMed

The reovirus p10 fusion-associated small transmembrane (FAST) proteins are the smallest known membrane fusion proteins, and evolved specifically to mediate cell-cell, rather than virus-cell, membrane fusion. The 36-40-residue ectodomains of avian reovirus (ARV) and Nelson Bay reovirus (NBV) p10 contain an essential intramolecular disulfide bond required for both cell-cell fusion and lipid mixing between liposomes. To more clearly define the functional, biochemical and biophysical features of this novel fusion peptide, synthetic peptides representing the p10 ectodomains of ARV and NBV were analyzed by solution-state NMR spectroscopy, circular dichroism spectroscopy, fluorescence spectroscopy-based hydrophobicity analysis, and liposome binding and fusion assays. Results indicate that disulfide bond formation promotes exposure of hydrophobic residues, as indicated by bis-ANS binding and time-dependent peptide aggregation under aqueous conditions, implying the disulfide bond creates a small, geometrically constrained, cystine noose. Noose formation is required for peptide partitioning into liposome membranes and liposome lipid mixing, and electron microscopy revealed that liposome-liposome fusion occurs in the absence of liposome tubulation. In addition, p10 fusion peptide activity, but not membrane partitioning, is dependent on membrane cholesterol. PMID:25450808

Key, Tim; Sarker, Muzaddid; de Antueno, Roberto; Rainey, Jan K; Duncan, Roy

2015-02-01

350

Liposomal siRNA nanocarriers for cancer therapy.  

PubMed

Small interfering RNAs (siRNA) have recently emerged as a new class of therapeutics with a great potential to revolutionize the treatment of cancer and other diseases. A specifically designed siRNA binds and induces post-transcriptional silencing of target genes (mRNA). Clinical applications of siRNA-based therapeutics have been limited by their rapid degradation, poor cellular uptake, and rapid renal clearance following systemic administration. A variety of synthetic and natural nanoparticles composed of lipids, polymers, and metals have been developed for siRNA delivery, with different efficacy and safety profiles. Liposomal nanoparticles have proven effective in delivering siRNA into tumor tissues by improving stability and bioavailability. While providing high transfection efficiency and a capacity to form complexes with negatively charged siRNA, cationic lipids/liposomes are highly toxic. Negatively charged liposomes, on the other hand, are rapidly cleared from circulation. To overcome these problems we developed highly safe and effective neutral lipid-based nanoliposomes that provide robust gene silencing in tumors following systemic (intravenous) administration. This delivery system demonstrated remarkable antitumor efficacy in various orthotopic human cancer models in animals. Here, we briefly overview this and other lipid-based approaches with preclinical applications in different tumor models for cancer therapy and potential applications as siRNA-nanotherapeutics in human cancers. PMID:24384374

Ozpolat, Bulent; Sood, Anil K; Lopez-Berestein, Gabriel

2014-02-01

351

Effective in vitro and in vivo gene delivery by the combination of liposomal bubbles (bubble liposomes) and ultrasound exposure.  

PubMed

Gene delivery with a physical mechanism using ultrasound (US) and nano/microbubbles is expected as an ideal system in terms of delivering plasmid DNA noninvasively into a specific target site. We developed novel liposomal bubbles (Bubble liposomes (BLs)) containing the lipid nanobubbles of perfluoropropane which were utilized for contrast enhancement in ultrasonography. BLs were smaller in diameter than conventional microbubbles and induced cavitation upon exposure ultrasound. In addition, when coupled with US exposure, BLs could deliver plasmid DNA into various types of cells in vitro and in vivo. The transfection efficiency with BLs and US was higher than that with conventional lipofection method. Therefore, the combination of BLs and US might be an efficient and novel nonviral gene delivery system. PMID:20072902

Suzuki, Ryo; Maruyama, Kazuo

2010-01-01

352

Electrochemistry and spectroelectrochemistry of tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine, Lu 2Pc 4 and dimeric lutetium(III) phthalocyanine, Lu 2Pc 2(OAc) 2  

NASA Astrophysics Data System (ADS)

In this study, electrochemical, electrochromic and spectroelectrochemical properties of a tert-butylcalix[4]arene bridged bis double-decker lutetium(III) phthalocyanine (Lu 2Pc 42) were investigated explicitly as compared with a tert-butylcalix[4]arene bridged dimeric lutetium(III) phthalocyanine [Lu 2Pc 2(OAc) 21]. Distinctive differences between electrochemical and electrochromic properties of 1 and 2 were detected. Moreover, the properties of 1 and 2 were compared with previously reported S 4(CH 2) 4 bridged Lu 2Pc 2(OAc) 2 and Lu 2Pc 4. The calixarene bridged phthalocyanine (Pc) compounds, 1 and 2 showed well-defined electrochromic behaviour with green-blue and blue-purple colour transitions. The enhanced electrochromic properties of 2, as compared to 1, were attributed to its double-decker structure, probably allowing the formation of suitable ion channels for the counter ion movement in the solid film.

Koca, At?f; Ceyhan, Tanju; Erbil, Mehmet K.; Özkaya, Ali R?za; Bekaro?lu, Özer

2007-11-01

353

Infrared spectra of phthalocyanine and naphthalocyanine in sandwich-type (na)phthalocyaninato and porphyrinato rare earth complexes. Part 3. The effects of substituents and molecular symmetry on the infrared characteristics of phthalocyanine in bis(phthalocyaninato) rare earth complexes  

Microsoft Academic Search

The infra-red (IR) spectroscopic data for a series of 45 homoleptic unsubstituted and substituted bis(phthalocyaninato) rare earth complexes M(Pc)2 and M(Pc*)2 [M=Y, La…Lu except Pm; H2Pc=phthalocyanine; H2Pc*=2,3,9,10,16,17,24,25-octakis(octyloxy)phthalocyanine (H2OOPc) and 2(3),9(10),16(17),24(25)-tetra(tert-butyl)phthalocyanine (H2TBPc)] have been collected with resolution of 2 cm?1. The IR spectra for M(Pc)2 and M(OOPc)2 are much simpler than those of M(TBPc)2, revealing the relatively higher symmetry of the

Fanli Lu; Meng Bao; Changqin Ma; Xianxi Zhang; Dennis P. Arnold; Jianzhuang Jiang

2003-01-01

354

Effective anti-tumor activity of oxaliplatin encapsulated in transferrin-PEG-liposome.  

PubMed

Oxaliplatin (trans-L-diaminocyclohexane oxalatoplatinum, L-OHP) is a novel cisplatin derivative that can improve the side effects of cisplatin such as toxicity to the kidneys and peripheral nerve system. However, L-OHP is effective only when combined with 5-Fluorouracil (5-FU) and Leucovorin. The relatively low anti-tumor index of L-OHP alone is because low levels accumulate in tumor tissues due to high partitioning to erythrocytes in vivo. A successful outcome of cancer therapy using L-OHP requires the selective delivery of a relatively high concentration of the drug to tumors. The present study examines tumor-selective delivery of L-OHP using liposomes modified with transferrin-conjugated polyethyleneglycol (TF-PEG-liposomes). Delivery using these liposomes significantly reduced L-OHP partitioning to erythrocytes and improved the circulation time of L-OHP in vivo, resulting in enhanced extravasation of liposomes into tumors. The TF-PEG-liposomes maintained a high L-OHP concentration in tumors for over 72 h after intravenous injection, which was longer than that of the liposomes modified with PEG (PEG-liposomes). Intravenously administered L-OHP encapsulated within TF-PEG-liposomes (L-OHP: 5 mg/kg) suppressed tumor growth more effectively than PEG-liposomes, Bare-liposomes and free L-OHP. Although L-OHP is usually combined with 5-FU and Leucovorin, our results suggest that L-OHP encapsulated within TF-PEG-liposomes has potential for cancer therapy. PMID:17640835

Suzuki, Ryo; Takizawa, Tomoko; Kuwata, Yasuhiro; Mutoh, Mahito; Ishiguro, Nobuyuki; Utoguchi, Naoki; Shinohara, Atsuko; Eriguchi, Masazumi; Yanagie, Hironobu; Maruyama, Kazuo

2008-01-01

355

Peptide-coated liposomal fasudil enhances site specific vasodilation in pulmonary arterial hypertension.  

PubMed

This study sought to develop a liposomal delivery system of fasudil--an investigational drug for the treatment of pulmonary arterial hypertension (PAH)--that will preferentially accumulate in the PAH lungs. Liposomal fasudil was prepared by film-hydration method, and the drug was encapsulated by active loading. The liposome surface was coated with a targeting moiety, CARSKNKDC, a cyclic peptide; the liposomes were characterized for size, polydispersity index, zeta potential, and storage and nebulization stability. The in vitro drug release profiles and uptake by TGF-? activated pulmonary arterial smooth muscle cells (PASMC) and alveolar macrophages were evaluated. The pharmacokinetics were monitored in male Sprague-Dawley rats, and the pulmonary hemodynamics were studied in acute and chronic PAH rats. The size, polydispersity index (PDI), and zeta potential of the liposomes were 206-216 nm, 0.058-0.084, and -20-42.7 mV, respectively. The formulations showed minimal changes in structural integrity when nebulized with a commercial microsprayer. The optimized formulation was stable for >4 weeks when stored at 4 °C. Fasudil was released in a continuous fashion over 120 h with a cumulative release of 76%. Peptide-linked liposomes were taken up at a higher degree by TGF-? activated PASMCs; but alveolar macrophages could not engulf peptide-coated liposomes. The formulations did not injure the lungs; the half-life of liposomal fasudil was 34-fold higher than that of plain fasudil after intravenous administration. Peptide-linked liposomal fasudil, as opposed to plain liposomes, reduced the mean pulmonary arterial pressure by 35-40%, without influencing the mean systemic arterial pressure. This study establishes that CAR-conjugated inhalable liposomal fasudil offers favorable pharmacokinetics and produces pulmonary vasculature specific dilatation. PMID:25333706

Nahar, Kamrun; Absar, Shahriar; Gupta, Nilesh; Kotamraju, Venkata Ramana; McMurtry, Ivan F; Oka, Masahiko; Komatsu, Masanobu; Nozik-Grayck, Eva; Ahsan, Fakhrul

2014-12-01

356

Novel ophthalmic timolol meleate liposomal-hydrogel and its improved local glaucomatous therapeutic effect in vivo.  

PubMed

To overcome the limitations of common eye drops, the study developed a novel timolol mealate (TM) liposomal-hydrogel to enhance drug permeability and prolong residence time in the precorneal region, which achieved more effective local glaucomatous therapeutic effect. Firstly, TM liposome was prepared by an ammonium sulfate gradient-pH regulation method, which its entrapment efficiency reached up to 94% and its averaged particle size is 187?nm with narrow distribution. The corneal permeability through isolated rabbit cornea was measured by modified Franz-type diffusion cells. The results of trans-corneal penetration exhibited that the apparent permeability coefficients (P(app)) and the flow rates of steady state (J(ss)) of TM liposome was 1.50-fold higher than that of the commercialized eye drop, while TM liposome with 0.02% transcutol P was 2.19 times. In order to increase the retention time and improve the stability of liposome, we further developed a TM liposomal-hydrogel formulation by adding 1.0% HPMC K4M in TM liposome. The results showed an stability during a 120 days storage period than TM liposome. Precorneal retention study in vivo indicated that the optimal liposomal-hydrogel formulation had improved bioavailability and its retention time on rabbit corneal surface were significantly longer than that of pure liposomes or eye-drops. No obvious irritations to rabbit eyes were observed by histopathology microscopy after 7 days exposure.. Comparing to the eye drops, the TM liposomal-gel displayed prolonged therapeutic effect in cornea and greatly lowered the intraocular pressure IOP on the eyes of normal and glaucomatous pigmented rabbits. PMID:21790329

Zhang, Hui-hui; Luo, Qiu-hua; Yang, Zhi-jun; Pan, Wei-san; Nie, Shu-fang

2011-01-01

357

A novel method to label preformed liposomes with 64Cu for positron emission tomography (PET) imaging  

PubMed Central

Radiolabeling of liposomes with 64Cu (t1/2 = 12.7 h) is attractive for molecular imaging and monitoring drug delivery. A simple chelation procedure, performed at a low temperature and under mild conditions, is required to radiolabel pre-loaded liposomes without lipid hydrolysis or the release of the encapsulated contents. Here we report a 64Cu post-labeling method for liposomes. A 64Cu-specific chelator, 6-[p-(bromoacetamido)benzyl]-1,4,8,11-tetraazacyclotetradecane-N,N’,N”,N”’-tetraacetic acid (BAT), was conjugated with an artificial lipid to form a BAT-PEG-lipid. After incorporation of 0.5% (mol/mol) BAT-PEG-lipid during the liposome formulation, liposomes were successfully labeled with 64Cu in 0.1 M NH4OAc pH 5 buffer, at 35 °C for 30~40 min with an incorporation yield as high as 95%. After 48 hour incubation of 64Cu-liposomes in 50/50 serum/PBS solution, more than 88% of the 64Cu label was still associated with liposomes. After injection of liposomal 64Cu in a mouse model, 44 ± 6.9, 21 ± 2.7, 15 ± 2.5, and 7.4 ± 1.1 (n = 4) % of the injected dose per cubic centimeter remained within the blood pool at 30 min, 18, 28, and 48 hours, respectively. The biodistribution at 48 hours after injection verified that 7.0 ± 0.47 (n = 4), and 1.4 ± 0.58 (n = 3) % of the injected dose per gram of liposomal 64Cu and free 64Cu remained in the blood pool, respectively. Our results suggest that this fast and easy 64Cu labeling of liposomes could be exploited in tracking liposomes in vivo for medical imaging and targeted delivery. PMID:18991368

Seo, Jai Woong; Zhang, Hua; Kukis, David L.; Meares, Claude F.; Ferrara, Katherine W.

2009-01-01

358

Therapeutic Efficacies of Isoniazid and Rifampin Encapsulated in Lung-Specific Stealth Liposomes against Mycobacterium tuberculosis Infection Induced in Mice  

Microsoft Academic Search

One recent promising development in the modification of drug formulations to improve chemotherapy is the use of a liposome-mediated drug delivery system. The efficacies of isoniazid and rifampin encapsulated in lung-specific stealth liposomes were evaluated by injecting liposomal drugs and free drugs into tuberculous mice twice a week for 6 weeks. Liposome-encapsulated drugs at and below therapeutic concentrations were more

PARAMPAL DEOL; G. K. KHULLER; K. JOSHI

359

Modulated release from liposomes entrapped in chitosan/gelatin hydrogels.  

PubMed

The paper describes the preparation of chitosan/gelatin hydrogels, obtained by double crosslinking with glutaraldehyde and sodium sulphate/sodium tripolyphosphate that may be used as matrices for the inclusion of drug loaded liposomes composed of phosphatidylcholine. The main objective was to create a protective layer to stabilize the liposomal surface and to prolong/control the release of drugs from such systems. Therefore, complex systems capable of prolonged drug release and controlled release kinetics were obtained. Samples consisting of different chitosan/gelatin ratios and type/amount of ionic crosslinker have been prepared and characterized. The present study shows that calcein (used as a model hydrophilic drug) release from polymeric hydrogels has been retarded from several days to weeks after calcein inclusion in small unilamellar vesicles (SUVs) and multilamellar vesicles (MLVs) entrapped subsequently in hydrogels with variable composition. The calcein release kinetics of complex systems were compared to simple systems (control hydrogels) and important changes were observed thus proving that the mechanism of the process increases in complexity. Also, it is demonstrated that liposomes' stability can be greatly improved by inclusion in polymeric matrices. Multilamellar liposomes showed a better release behaviour, which indicates that these calcein loaded vesicles remained intact to some extent after release from the matrix, due to their improved stability provided by the multiple layers. When small unilamellar liposomes were tested, calcein have been released from hydrogels predominantly in a free form (due to their unilamellarity related instability even inside the hydrogel) but in a sustained and controllable manner. The main applications of the systems obtained are in the area of drug release for tissue engineering/tissue repair (topical administration of drugs for wound therapy - burns, for example). Hydrogels capable of delivering drugs over prolonged periods of time represent a step forward in wound management and many diseases that request long term and sustained delivery of drugs. These hydrogels could be used as tissue replacement or injectable depot systems in many high risk diseases including cancer. PMID:25175227

Ciobanu, Bogdan C; Cadinoiu, Anca N; Popa, Marcel; Desbrières, Jacques; Peptu, C?t?lina A

2014-10-01

360

Microfluidic Synthesis of PEG- and Folate-Conjugated Liposomes for One-Step Formation of Targeted Stealth Nanocarriers  

PubMed Central

Purpose A microfluidic hydrodynamic flow focusing technique enabling the formation of small and nearly monodisperse liposomes is investigated for continuous-flow synthesis of poly(ethylene glycol) (PEG)-modified and PEG-folate-functionalized liposomes for targeted drug delivery. Methods Controlled laminar flow in thermoplastic microfluidic devices facilitated liposome self-assembly from initial lipid compositions including lipid/cholesterol mixtures containing PEG-lipid and folate-PEG-lipid conjugates. The relationships between flow conditions, lipid composition, and liposome size were evaluated, and the impact of these parameters on PEG and folate incorporation were determined through a combination of UV-vis absorbance measurements and characterization of liposome zeta potential. Results Both PEG and folate were successfully incorporated into microfluidic-synthesized liposomes over the full range of liposome sizes studied. The efficiency of PEG-lipid incorporation was found to be inversely correlated with liposome diameter. Folate-lipid was also effectively integrated into liposomes at various flow conditions. Conclusions Liposomes incorporating relatively large PEG-modified and folate-PEG-modified lipids were successfully synthesized using the microfluidic flow focusing platform, providing a simple, low cost, rapid method for preparing functionalized liposomes. Relationships between preparation conditions and PEG or folate-PEG functionalization have been elucidated, providing insight into the process and defining paths for optimization of the microfluidic method toward the formation of functionalized liposomes for pharmaceutical applications. PMID:23386106

Hood, Renee R.; Shao, Chenren; Omiatek, Donna M.; Vreeland, Wyatt N.; DeVoe, Don L.

2013-01-01

361

Enhanced retention and anti-tumor efficacy of liposomes by changing their cellular uptake and pharmacokinetics behavior.  

PubMed

Although PEGylated liposome-based drug delivery systems hold great promising applications for cancer therapy due to their prolonged blood circulation time, PEGylation significantly reduces their cellular uptake, which markedly impairs the in vivo tumor retention and antitumor efficiency of drug-loaded liposomes. Most importantly, it has been proved that repeated injections of PEGylated liposomes with cell cycle specific drug such as topotecan (TPT) in the same animal at certain time intervals will induce "accelerated blood clearance" (ABC) phenomenon, which decreases the tumor accumulation of drug-loaded liposomes and presents a tremendous challenge to the clinical use of liposome-based drug delivery systems. Herein, we developed a zwitterionic poly(carboxybetaine) (PCB) modified liposome-based drug delivery system. The presence of PCB could avoid protein adsorption and enhance the stability of liposomes as that for PEG. Quite different from the PEGylated liposomes, the pH-sensitive PCBylated liposomes were internalized into cells via endocytosis with excellent cellular uptake and drug release ability. Furthermore, the PCBylated liposomes would avoid ABC phenomenon, which promoted the tumor accumulation of drug-loaded liposomes in vivo. With higher tumor accumulation and cellular uptake, the PCBylated drug-loaded liposomes significantly inhibited tumor growth and provided a promising approach for cancer therapy. PMID:25522960

Li, Yan; Liu, Ruiyuan; Yang, Jun; Shi, Yuanjie; Ma, Guanghui; Zhang, Zhenzhong; Zhang, Xin

2015-02-01

362

Linear DNA Low Efficiency Transfection by Liposome Can Be Improved by the Use of Cationic Lipid as Charge Neutralizer  

E-print Network

Linear DNA Low Efficiency Transfection by Liposome Can Be Improved by the Use of Cationic Lipid the efficiency of a liposome-mediated transfection by circular and linear DNA. The results obtained showed a low rate of transfection by linear DNA:liposome complexes. To explore whether the structure

Barbosa, Marcia C. B.

363

Freeze-Drying of Liposomes with Cryoprotectants and Its Effect on Retention Rate of Encapsulated Ftorafur and Vitamin A  

Microsoft Academic Search

In this article, the glass transition temperature (Tg) of liposomal suspensions, in which glucose, sucrose, mannitol, and trehalose are used as cryoprotectants, are measured by differential scanning calorimetry (DSC). The protective effect of the cryoprotectants added for liposomes during freeze-drying is investigated. Results show that the Tg of liposomal suspension with trehalose is the highest, while that with glucose is

Ze-Zhao Hua; Bao-Guo Li; Zhan-Jie Liu; Da-Wen Sun

2003-01-01

364

The role of surface charge density in cationic liposome-promoted dendritic cell maturation and vaccine-induced immune responses  

NASA Astrophysics Data System (ADS)

Cationic liposomes have emerged as a novel adjuvant and antigen delivery system to enhance vaccine efficacy. However, the role of surface charge density in cationic liposome-regulated immune responses has not yet been elucidated. In the present study, we prepared a series of DOTAP/DOPC cationic liposomes with different surface densities by incorporating varying amounts of DOPC (a neutral lipid) into DOTAP (a cationic lipid). The results showed that DOTAP/DOPC cationic liposome-regulated immune responses relied on the surface charge density, and might occur through ROS signaling. The liposomes with a relatively high charge density, such as DOTAP/DOPC 5 : 0 and 4 : 1 liposomes, potently enhanced dendritic cell maturation, ROS generaion, antigen uptake, as well as the production of OVA-specific IgG2a and IFN-?. In contrast, low-charge liposomes, such as DOTAP/DOPC 1 : 4 liposome, failed to promote immune responses even at high concentrations, confirming that the immunoregulatory effect of cationic liposomes is mostly attributable to their surface charge density. Moreover, the DOTAP/DOPC 1 : 4 liposome suppressed anti-OVA antibody responses in vivo. Overall, maintaining an appropriate surface charge is crucial for optimizing the adjuvant effect of cationic liposomes and enhancing the efficacy of liposome-based vaccines.

Ma, Yifan; Zhuang, Yan; Xie, Xiaofang; Wang, Ce; Wang, Fei; Zhou, Dongmei; Zeng, Jianqiang; Cai, Lintao

2011-05-01

365

Application of surface-linked liposomal antigens to the development of vaccines that induce both humoral and cellular immunity.  

PubMed

The first characteristic identified in surface-linked liposomal antigens was the ability to induce antigen-specific, IgE-selective unresponsiveness. These results remained consistent even when different coupling procedures were employed for antigens with liposomes or for liposomes with different lipid components. The potential usefulness of surface-linked liposomal antigens for application to vaccine development was further investigated. During this investigation, a significant difference was observed in the recognition of liposomal antigens by antigen-presenting cells between liposomes with different lipid components, and this difference correlated closely with the adjuvant activity of liposomes. In addition to this "quantitative" difference between liposomes with differential lipid components, a "qualitative" difference (i.e., a differential ability to induce cross-presentation) was observed between liposomes with different lipid components. Therefore, by utilizing the ability to induce cross-presentation, surface-linked liposomal antigens might be used to develop virus vaccines that would induce cytotoxic T lymphocyte (CTL) responses. We have successfully developed a liposome vaccine that is capable of inducing CTL responses against internal antigens of influenza viruses and thus removing virus-infected cells in the host. This CTL-based liposomal vaccine might be applicable to the development of vaccines against influenza and other viruses that frequently undergo changes in their surface antigenic molecules. PMID:25056068

Uchida, Tetsuya; Taneichi, Maiko

2014-01-01

366

Liposomes composed of a double-chain cationic amphiphile (Vectamidine) induce their own encapsulation into human erythrocytes  

E-print Network

Liposomes composed of a double-chain cationic amphiphile (Vectamidine) induce their own is a liposome-forming double-chain cationic amphiphile. The present work was aimed to microscopically study amphiphiles may transfer from membrane-attached liposomes to the plasma membrane and then translocate

Iglic, Ales

367

Spectroscopic investigation of different concentrations of the vapour deposited copper phthalocyanine as a "guest" in polyimide matrix.  

PubMed

Nanocomposite layers 250nm copper phthalocyanine/polyimide prepared by simultaneous vapour deposition of three different sources were studied. Different concentrations of copper phthalocyanine as a "guest" in polyimide matrix as a function of conditions of the preparation have been determined by FTIR (Fourier Transform Infrared) and UV-VIS (Ultraviolet-Visible) spectroscopies. The aim was to estimate the possibility of the spectroscopic methods for quantitative determination of the "guest" and compare with the quality of the polyimide thin films in relation to the "guest" concentration. The band at 1334cm(-1) has been used for quantitative estimation of "guest" in polyimide matrix. The concentrations of the copper phthalocyanine less than 20% require curve fitting techniques with Fourier self deconvolution. The relationship between "guest" concentrations and degree of imidization, as well as the electronic UV-VIS spectra are discussed in relation to the composition, imidization degree and the two crystallographic modification of the embedded chromophore. PMID:25638427

Georgiev, Anton; Yordanov, Dancho; Dimov, Dean; Assa, Jacob; Spassova, Erinche; Danev, Gencho

2015-04-01

368

Ammonia adsorption on iron phthalocyanine on Au(111): Influence on adsorbate-substrate coupling and molecular spin  

SciTech Connect

The adsorption of ammonia on Au(111)-supported monolayers of iron phthalocyanine has been investigated by x-ray photoelectron spectroscopy, x-ray absorption spectroscopy, and density functional theory calculations. The ammonia-induced changes of the x-ray photoemission lines show that a dative bond is formed between ammonia and the iron center of the phthalocyanine molecules, and that the local spin on the iron atom is quenched. This is confirmed by density functional theory, which also shows that the bond between the iron center of the metalorganic complex and the Au(111) substrate is weakened upon adsorption of ammonia. The experimental results further show that additional adsorption sites exist for ammonia on the iron phthalocyanine monolayer.

Isvoranu, Cristina; Ataman, Evren; Knudsen, Jan; Andersen, Jesper N.; Schnadt, Joachim [Division of Synchrotron Radiation Research, Department of Physics, Lund University, Box 118, 221 00 Lund (Sweden); Wang Bin; Bocquet, Marie-Laure [Laboratoire de chimie, Ecole normale superieure de Lyon, 46, Allee d'Italie, 69364 Lyon Cedex 07 (France); Schulte, Karina [MAX-lab, Lund University, Box 118, 221 00 Lund (Sweden)

2011-03-21

369

Phthalocyanine-Aggregated Polymeric Nanoparticles as Tumor-Homing Near-Infrared Absorbers for Photothermal Therapy of Cancer  

PubMed Central

Phthalocyanine-aggregated Pluronic nanoparticles were constructed as a novel type of near-infrared (NIR) absorber for photothermal therapy. Tiny nanoparticles (~ 60 nm, FPc NPs) were prepared by aqueous dispersion of phthalocyanine-aggregated self-assembled nanodomains that were phase-separated from the melt mixture with Pluronic. Under NIR laser irradiation, FPc NPs manifested robust heat generation capability, superior to an individual cyanine dye and cyanine-aggregated nanoparticles. Micro- and macroscopic imaging experiments showed that FPc NPs are capable of internalization into live cancer cells as well as tumor accumulation when intravenously administered into living mice. It is shown here that continuous NIR irradiation of the tumor-targeted FPc NPs can cause phototherapeutic effects in vitro and in vivo through excessive local heating, demonstrating potential of phthalocyanine-aggregated nanoparticles as an all-organic NIR nanoabsorber for hyperthermia. PMID:23082099

Lim, Chang-Keun; Shin, Jiyoung; Lee, Yong-Deok; Kim, Jungahn; Oh, Keun Sang; Yuk, Soon Hong; Jeong, Seo Young; Kwon, Ick Chan; Kim, Sehoon

2012-01-01

370

Effect of Some Substituents Increasing the Solubility of Zn(II) and Al(III) Phthalocyanines on Their Photophysical Properties  

PubMed Central

Water solubility of phthalocyanines (Pcs) usually increases by the introduction of charged or carboxy substituents in the peripheral positions of the macrocycle. As a result, such structural changes influence their photophysical and photochemical properties as photosensitizers. Phthalocyanines substituted with four or eight terminal carboxyl groups and having in some cases additional eight positive charges (water soluble phthalocyanines) were studied in order to evaluate the spectroscopic and photophysical effects of these side residues on the chromophore properties. The quantum yield of singlet oxygen (1O2) generation, the triplet-triplet absorption, and the transient absorption spectra were measured and linked to the structure of the substituents. It was shown that charged substituents did not change the quantum yields of 1O2 generation but decrease its lifetimes. The introduction of the charged substituents not only increases the water solubility but also significantly changes absorption, fluorescence, and transient absorption spectra of water soluble Pcs. PMID:25302061

Chernonosov, A. A.; Ermilov, E. A.; Röder, B.; Solovyova, L. I.; Fedorova, O. S.

2014-01-01

371

Visualisation of liposomes prepared from skin and stratum corneum lipids by transmission electron microscopy  

Microsoft Academic Search

Transmission electron microscopy was used to visualize the liposomes prepared from total lipids extracted from mouse, human and porcine skin and stratum corneum. The total lipid composition was monitored by high precision thin layer chromatography coupled with a flame identification detector (HPTLC\\/FID, Iatroscan) and the fatty acid content of the samples was monitored by gas chromatography. The liposomes were prepared

Sophia Hatziantoniou; Ioannis P. Nezis; Lukas H. Margaritis; Costas Demetzos

2007-01-01

372

Complete remission of experimental arthritis by joint targeting of glucocorticoids with long-circulating liposomes  

Microsoft Academic Search

Objective. To increase the therapeutic activity of glucocorticoids in experimental arthritis by encapsula- tion in long-circulating polyethylene glycol liposomes, which have shown the ability to preferentially accumu- late in inflamed joints after intravenous administration. Methods. Rats with adjuvant-induced arthritis (AIA) were treated intravenously with liposomal and free prednisolone phosphate (PLP) a few days after the first signs of disease. The

Josbert M. Metselaar; Marca H. M. Wauben; Josee P. A. Wagenaar-Hilbers; Otto C. Boerman; Gert Storm

2003-01-01

373

Theranostic liposomes loaded with quantum dots and apomorphine for brain targeting and bioimaging  

PubMed Central

Quantum dots (QDs) and apomorphine were incorporated into liposomes to eliminate uptake by the liver and enhance brain targeting. We describe the preparation, physicochemical characterization, in vivo bioimaging, and brain endothelial cell uptake of the theranostic liposomes. QDs and the drug were mainly located in the bilayer membrane and inner core of the liposomes, respectively. Spherical vesicles with a mean diameter of ~140 nm were formed. QDs were completely encapsulated by the vesicles. Nearly 80% encapsulation percentage was achieved for apomorphine. A greater fluorescence intensity was observed in mouse brains treated with liposomes compared to free QDs. This result was further confirmed by ex vivo imaging of the organs. QD uptake by the heart and liver was reduced by liposomal incorporation. Apomorphine accumulation in the brain increased by 2.4-fold after this incorporation. According to a hyperspectral imaging analysis, multifunctional liposomes but not the aqueous solution carried QDs into the brain. Liposomes were observed to have been efficiently endocytosed into bEND3 cells. The mechanisms involved in the cellular uptake were clathrin- and caveola-mediated endocytosis, which were energy-dependent. To the best of our knowledge, our group is the first to develop liposomes with a QD-drug hybrid for the aim of imaging and treating brain disorders. PMID:22619515

Wen, Chih-Jen; Zhang, Li-Wen; Al-Suwayeh, Saleh A; Yen, Tzu-Chen; Fang, Jia-You

2012-01-01

374

The Immunological Enhancement Activity of Propolis Flavonoids Liposome In Vitro and In Vivo  

PubMed Central

The aim of this study was to investigate and assess the effects of propolis flavonoids liposome imposed on the immune system by comparing it to propolis flavonoids and blank liposome. In vitro, the effects of the above drugs on macrophages were assessed by measuring the phagocytic function and cytokine production. In vivo, the immunological adjuvant activity of propolis flavonoids liposome was compared with those of propolis flavonoids and blank liposome. The results showed that in vitro propolis flavonoids liposome can significantly enhance the phagocytic function of macrophages and the release of IL-1?, IL-6, and IFN-?. In addition, subcutaneous administration of propolis flavonoids liposome with ovalbumin to mice could effectively activate the cellular and humoral immune response, including inducing higher level concentrations of IgG, IL-4, and IFN-? in serum and the proliferation rates of splenic lymphocytes. These findings provided valuable information regarding the immune modulatory function of propolis flavonoids liposome and indicated the possibility of use of propolis flavonoids liposome as a potential adjuvant. PMID:25383082

Tao, Yang; Wang, Deqing; Hu, Yuanliang; Huang, Yee; Yu, Yun; Wang, Deyun

2014-01-01

375

Liposomes: A Novel Option in Nuclear Medicine for Diagnostic Imaging and Internal Therapy  

NASA Astrophysics Data System (ADS)

In this work we review some of the more relevant characteristics that are required for the use of liposomes as carriers of radionuclides in nuclear medicine for diagnostic imaging and internal therapy. We also present a general description of the dosimetric methodology required for the use of liposomes as carriers of charge-particle-emitting radionuclides for radiotherapeutic purposes.

Medina, Luis A.; Goins, Beth

2002-08-01

376

Cross-linkable liposomes stabilize a magnetic resonance contrast-enhancing polymeric fastener.  

PubMed

Liposomes are commonly used to deliver drugs and contrast agents to their target site in a controlled manner. One of the greatest obstacles in the performance of such delivery vehicles is their stability in the presence of serum. Here, we demonstrate a method to stabilize a class of liposomes that load gadolinium, a magnetic resonance (MR) contrast agent, as a model cargo on their surfaces. We hypothesized that the sequential adsorption of a gadolinium-binding chitosan fastener on the liposome surface followed by covalent cross-linking of the lipid bilayer would provide enhanced stability and improved MR signal in the presence of human serum. To investigate this hypothesis, liposomes composed of diyne-containing lipids were assembled and functionalized via chitosan conjugated with a hydrophobic anchor and diethylenetriaminepentaacetic acid (DTPA). This postadsorption cross-linking strategy served to stabilize the thermodynamically favorable association between liposome and polymeric fastener. Furthermore, the chitosan-coated, cross-linked liposomes proved more effective as delivery vehicles of gadolinium than uncross-linked liposomes due to the reduced liposome degradation and chitosan desorption. Overall, this study demonstrates a useful method to stabilize a broad class of particles used for systemic delivery of various molecular payloads. PMID:24635565

Smith, Cartney E; Kong, Hyunjoon

2014-04-01

377

Preparation, characterization and in vitro antimicrobial activity of liposomal ceftazidime and cefepime against Pseudomonas aeruginosa strains  

PubMed Central

Pseudomonas aeruginosa is an opportunistic microorganism with the ability to respond to a wide variety of environmental changes, exhibiting a high intrinsic resistance to a number of antimicrobial agents. This low susceptibility to antimicrobial substances is primarily due to the low permeability of its outer membrane, efflux mechanisms and the synthesis of enzymes that promote the degradation of these drugs. Cephalosporins, particularty ceftazidime and cefepime are effective against P. aeruginosa, however, its increasing resistance has limited the usage of these antibiotics. Encapsulating antimicrobial drugs into unilamellar liposomes is an approach that has been investigated in order to overcome microorganism resistance. In this study, antimicrobial activity of liposomal ceftazidime and cefepime against P. aeruginosa ATCC 27853 and P. aeruginosa SPM-1 was compared to that of the free drugs. Liposomal characterization included diameter, encapsulation efficiency and stability. Minimum Inhibitory Concentration (MIC) was determined for free and liposomal forms of both drugs. Minimum Bactericidal Concentration (MBC) was determined at concentrations 1, 2 and 4 times MIC. Average diameter of liposomes was 131.88 nm and encapsulation efficiency for cefepime and ceftazidime were 2.29% end 5.77%, respectively. Improved stability was obtained when liposome formulations were prepared with a 50% molar ratio for cholesterol in relation to the phospholipid. MIC for liposomal antibiotics for both drugs were 50% lower than that of the free drug, demonstrating that liposomal drug delivery systems may contribute to increase the antibacterial activity of these drugs. PMID:24031917

Torres, Ieda Maria Sapateiro; Bento, Etiene Barbosa; Almeida, Larissa da Cunha; de Sá, Luisa Zaiden Carvalho Martins; Lima, Eliana Martins

2012-01-01

378

Kinetics of Bile Salt Binding to Liposomes Revealed by Carboxyfluorescein Release and  

E-print Network

Kinetics of Bile Salt Binding to Liposomes Revealed by Carboxyfluorescein Release and Mathematical by the binding of different bile salts to the leaflets of the lipid bilayer. We find that the permeability of the liposomal bilayer depends on the difference in the concentrations of bile salt in the inner and outer

Hinow, Peter

379

Pegylation of liposomes favours the endosomal degradation of the delivered phosphodiester oligonucleotides  

Microsoft Academic Search

Liposomal vesicles have been widely investigated as carriers for the intracellular delivery of oligonucleotides (ONs). To avoid unspecific uptake by the reticulo endothelial system, ‘pegylation’ of the liposomes, by incorporating polyethyleneglycol (PEG) at the surface, has been an attractive strategy. While pegylation has a clear benefit on the systemic level, one could wonder if pegylation also benefits the delivery efficacy

K. Remaut; B. Lucas; K. Braeckmans; J. Demeester; S. C. De Smedt

2007-01-01

380

Liposomes as a carrier for intracellular delivery of antisense oligonucleotides: a real or magic bullet?  

Microsoft Academic Search

Antisense oligonucleotides are specific inhibitors of gene expression. They represent a promising tool in fighting viral, malignant and inflammatory diseases. In many cases their activity is limited by their low cellular uptake and lack of target cell recognition. One approach to circumvent these problems is the use liposomes as an oligonucleotide carrier. The encapsulation of oligonucleotides in liposomes is useful

Olivier Zelphati; Francis C. Szoka

1996-01-01

381

Atomic Force Microscopy and Light Scattering of Small Unilamellar Actin-Containing Liposomes  

PubMed Central

Three-dimensional networks of filamentous actin (F-actin) encapsulated inside phosphatidylcholine liposomes are currently being used in an effort to model the cytoskeleton and plasma membrane of eukaryotic cells. In this article, unilamellar lipid vesicles consisting of egg yolk-derived phosphatidylcholine encapsulating monomeric actin (G-actin) were made via extrusion in low ionic strength buffer (G-buffer). Vesicle shape and structure in these dispersions was studied using a combination of fluid-tapping atomic force microscopy, and multiangle static light scattering. After subjecting the liposome dispersion to high ionic strength polymerization buffer (F-buffer) containing K+ ions, atomic force microscopy imaging and light scattering of these liposomes indicated the formation of specialized structures, including an overall liposome structure transformation from spherical to torus, disk-shaped geometries and tubular assemblies. Several atomic force microscopy control measurements were made to ascertain that the specialized structures formed were not due to free G-actin and F-actin self-assembling on the sample surface, plain liposomes exposed to G- and F-buffer, or liposomes encapsulating G-actin. Liposomes encapsulating G-actin assumed mostly thin disk shapes and some large irregularly shaped aggregates. In contrast, liposomes encapsulating polymerized actin assumed mostly torus or disk shapes along with some high aspect ratio tubular structures. PMID:12885667

Palmer, Andre F.; Wingert, Philip; Nickels, Jonathan

2003-01-01

382

In vitro synthesis and stabilization of amorphous calcium carbonate (ACC) nanoparticles within liposomes  

SciTech Connect

We show that amorphous calcium carbonate (ACC) can be synthesized in phospholipid bilayer vesicles (liposomes). Liposome-encapsulated ACC nanoparticles are stable against aggregation, do not crystallize for at least 20 h, and are ideally suited to investigate the influence of lipid chemistry, particle size, and soluble additives on ACC in situ.

Tester, Chantel C.; Brock, Ryan E.; Wu, Ching-Hsuan; Krejci, Minna R.; Weigand, Steven; Joester, Derk (NWU)

2012-02-07

383

Compartmental Pharmacokinetics and Tissue Distribution of Multilamellar Liposomal Nystatin in Rabbits  

Microsoft Academic Search

The plasma pharmacokinetics of multilamellar liposomal nystatin were studied in normal, catheterized rabbits after single and multiple daily intravenous administration of dosages of 2, 4, and 6 mg\\/kg of body weight, and drug levels in tissues were assessed after multiple dosing. Concentrations of liposomal nystatin were measured as those of nystatin by a validated high-performance liquid chromatography method, and plasma

ANDREAS H. GROLL; DIANA MICKIENE; KATHY WERNER; RUTA PETRAITIENE; VIDMANTAS PETRAITIS; MYRNA CALENDARIO; AIDA FIELD-RIDLEY; JEREMY CRISP; STEPHEN C. PISCITELLI; THOMAS J. WALSH

2000-01-01

384

Liposome-Mediated High-Efficiency Transfection of Human Endothelial Cells  

Microsoft Academic Search

Liposome-mediated transfection of endothelial cells provides a valuable experimental technique to study cellular gene expression and may also be adapted for gene therapy studies. However, the widely recognized disadvantage of liposome-mediated transfection is low efficiency. Therefore, studies were performed to optimize transfection techniques in human endothelial cells. The majority of the experiments were performed with primary cultures of human umbilical

Simone Kaiser; Michal Toborek

2001-01-01

385

Enrichment of Artemia nauplii in PUFA, phospholipids, and water-soluble nutrients using liposomes  

Microsoft Academic Search

Different liposome formulations, includingseveral combinations of membrane composition,type of vesicle (multilamellar and largeunilamellar vesicles), preparation method, andvehiculated nutrient, have been assayed asbioencapsulation products to enrich Artemia nauplii with nutrients for feeding fish larvae.The stability of the liposome preparationsunder conditions of use as enrichment producthas been tested using water soluble fluorescentmarkers as leakage indicators. The content ofthe fatty acids and lipid

Óscar Monroig; Juan Carlos Navarro; Isabel Amat; Pedro González; Francisco Amat; Francisco Hontoria

2003-01-01

386

Ethosomes and liposomes as topical vehicles for azelaic acid: a preformulation study.  

PubMed

The basic properties and the in vitro release rate kinetics of azelaic acid (AA), alternatively vehiculated in different phospholipid-based vesicles such as ethosomes or liposomes, were investigated. Ethosomes were produced by a simple method based on addition of an aqueous phase to an ethanol solution (comprised between 20\\% and 45%, v/v) of soy phosphatidyl choline (5%, w/w) and AA (0.2%, w/w) under mechanical stirring. Liposomes were obtained by the same composition in the absence of ethanol with the reverse-phase evaporation method. Vesicle size was measured by photon correlation spectroscopy (PCS), evidencing smaller mean diameters and narrower dimensional distributions in the case of ethosomes with respect to liposomes. In order to obtain homogeneously sized vesicles, both ethosomal and liposomal dispersions were extruded through polycarbonate membranes with pores of calibrated diameter (400 nm and 200 nm). Vesicle morphology was characterized by freeze-fracture scanning electron microscopy (SEM) showing the presence of unilamellar vesicles both in liposome- and in ethosome-based dispersions. Free energy measurements of the vesicle bilayers were conducted by differential scanning calorimetry (DSC). AA diffusion from ethosomal or liposomal dispersions and from ethosomes and liposomes incorporated in a viscous gel was investigated by a Franz cell assembled with synthetic membranes. The release rate was more rapid from ethosomal systems than from liposomal systems. In particular, ethosomes produced by the highest ethanol concentration released AA more rapidly, and the same trend was found using viscous forms. PMID:15264053

Esposito, Elisabetta; Menegatti, Enea; Cortesi, Rita

2004-01-01

387

Evaluation of biosafety and intracellular uptake of Cremophor EL free paclitaxel elastic liposomal formulation.  

PubMed

The present study examines the acute, sub-acute toxicity, and cytotoxicity of paclitaxel elastic liposomal formulation in comparison to a marketed Cremophor EL (polyoxyethylated castor oil):ethanol (1:1, v/v) based formulation. In the previous study, Cremophor EL free paclitaxel elastic liposomal formulation was developed and characterized. Cytotoxicity of formulation was evaluated by MTT assay using A549 cell lines. Percentage intracellular uptake of paclitaxel elastic liposomal and marketed formulation was determined using a fluorescence activating cell sorting assay (FACS) and fluorescence microscopy techniques. Single and repeated dose toxicity measurement showed no mortality, hematological, biochemical, or histopathological changes up to a dose of 120?mg/kg for paclitaxel elastic liposomal formulation, in comparison the marketed formulation showed toxicity at a dose of 40?mg/kg. Maximum tolerated dose (MTD) for paclitaxel elastic liposomal and marketed formulation was found to be 160?mg/kg and 40?mg/kg, respectively. Results of FACS analysis showed a 94.6?±?2.5% intracellular uptake of fluorescence marker acridine orange (AO) loaded in elastic liposomes; in comparison the AO solution showed only a 19.8?±?1.1% uptake. Paclitaxel elastic liposomal formulation seems to be a better alternative for safe and effective delivery of paclitaxel. This study proves the safety and higher intracellular uptake of paclitaxel elastic liposomal formulation. PMID:22074176

Utreja, Puneet; Jain, Subheet; Tiwary, A K

2012-01-01

388

Vibrating-mesh nebulization of liposomes generated using an ethanol-based proliposome technology.  

PubMed

This is the first study that evaluates the influence of the compartmental design of the micropump Aeroneb Go nebulizer and the viscosity of a proliposome hydration medium on vibrating-mesh aerosolization of liposomes. Ethanol-based proliposomes comprising soya phosphatidylcholine and cholesterol (1:1 mole ratio) were hydrated by using isotonic NaCl (0.9%) or sucrose (9.25%) solutions to generate liposomes that entrapped approximately 61% of the hydrophilic drug, salbutamol sulphate. Liposomes were aerosolized by the nebulizer to a two-stage impinger. For both formulations, the aerosol mass output was higher than the phospholipid output, indicating some accumulation of large liposomes or liposome aggregate within the nebulizer. Using NaCl (0.9%) solution as the dispersion medium, aerosol droplet size was much smaller and aerosol mass and phospholipid outputs were higher. This was attributed to the lower viscosity of the NaCl solution, resulting in a reduced retention of the aerosols in the "trap" of the nebulizer. For the entrapped salbutamol sulphate, although the "fine particle fraction" was relatively high (57.44%), size reduction of the liposomes during nebulization caused marked losses of the drug originally entrapped. Overall, liposomes generated from proliposomes when using this nebulizer showed high nebulization output and small droplet size. However, further work is required to reduce the losses of the originally entrapped drug from liposomes. PMID:20684671

Elhissi, Abdelbary; Gill, Hardyal; Ahmed, Waqar; Taylor, Kevin

2011-06-01

389

Glioma targeting and blood-brain barrier penetration by dual-targeting doxorubincin liposomes.  

PubMed

Effective chemotherapy for glioblastoma requires a carrier that can penetrate the blood-brain barrier (BBB) and subsequently target the glioma cells. Dual-targeting doxorubincin (Dox) liposomes were produced by conjugating liposomes with both folate (F) and transferrin (Tf), which were proven effective in penetrating the BBB and targeting tumors, respectively. The liposome was characterized by particle size, Dox entrapment efficiency, and in vitro release profile. Drug accumulation in cells, P-glycoprotein (P-gp) expression, and drug transport across the BBB in the dual-targeting liposome group were examined by using bEnd3 BBB models. In vivo studies demonstrated that the dual-targeting Dox liposomes could transport across the BBB and mainly distribute in the brain glioma. The anti-tumor effect of the dual-targeting liposome was also demonstrated by the increased survival time, decreased tumor volume, and results of both hematoxylin-eosin staining and terminal deoxynucleotidyl transferase dUTP nick end labeling analysis. The dual-targeting Dox liposome could improve the therapeutic efficacy of brain glioma and were less toxic than the Dox solution, showing a dual-targeting effect. These results indicate that this dual-targeting liposome can be used as a potential carrier for glioma chemotherapy. PMID:23628475

Gao, Jian-Qing; Lv, Qing; Li, Li-Ming; Tang, Xin-Jiang; Li, Fan-Zhu; Hu, Yu-Lan; Han, Min

2013-07-01

390

Selective delivery of an anticancer drug with aptamer-functionalized liposomes to breast  

E-print Network

Selective delivery of an anticancer drug with aptamer-functionalized liposomes to breast cancer, their effectiveness has rarely been established in vivo. Here we report the development of a liposomal drug delivery overexpressed on MCF-7 cell surface, and therefore enable drug delivery with high specificity. Introduction

Cheng, Jianjun

391

Thermosensitive liposomes: Extravasation and release of contents in tumor microvascular networks  

Microsoft Academic Search

Purpose: The purpose of this study was to determine whether hyperthermic exposure would accelerate drug release from thermosensitive sterically stabilized liposomes and enhance their extravasation in tumor tissues.Materials and Methods: In vivo fluorescence video microscopy was used to measure the extravasation of liposomes, as well as release of their contents, in a rat skin flap window chamber containing a vascularized

Mohamed H. Gaber; Ning Z. Wu; Keelung Hong; Shi Kun Huang; Mark W. Dewhirst; Demetrios Papahadjopoulos

1996-01-01

392

Liposomal encapsulation of the natural flavonoid fisetin improves bioavailability and antitumor efficacy.  

PubMed

The natural flavonoid fisetin (3,3',4',7-tetrahydroxyflavone) has shown antiangiogenic and anticancer properties. Because of fisetin limited water solubility, we designed a liposomal formulation and evaluated its biological properties in vitro and in Lewis lung carcinoma (LLC) bearing mice. A liposomal formulation was developed with DOPC and DODA-PEG2000, possessing a diameter in the nanometer range (173.5±2.4nm), a high homogeneity (polydispersity index 0.181±0.016) and high fisetin encapsulation (58%). Liposomal fisetin incubated with LLC cells were internalized, induced a typical fisetin morphological effect and increased the sub-G1 cell distribution. In vivo, liposomal fisetin allowed a 47-fold increase in relative bioavailability compared to free fisetin. The effect of liposomal fisetin on LLC tumor growth in mice at low dose (21mg/kg) allowed a higher tumor growth delay (3.3 days) compared to free fisetin at the same dose (1.6 day). Optimization of liposomal fisetin therapy was attempted by co-treatment with cyclophosphamide which led to a significant improvement in tumor growth delay (7.2 days) compared to cyclophosphamide with control liposomes (4.2 days). In conclusion, fisetin liposomes markedly improved fisetin bioavailability and anticancer efficacy in mice and this formulation could facilitate the administration of this flavonoid in the clinical setting. PMID:23380621

Seguin, Johanne; Brullé, Laura; Boyer, Renaud; Lu, Yen Mei; Ramos Romano, Miriam; Touil, Yasmine S; Scherman, Daniel; Bessodes, Michel; Mignet, Nathalie; Chabot, Guy G

2013-02-28

393

Pharmaceutical Nanotechnology Enhanced solubility and stability of PEGylated liposomal paclitaxel: In vitro and in vivo evaluation  

Microsoft Academic Search

An improved PEGylated liposomal formulation of paclitaxel has been developed with the purpose of improving the solubility of paclitaxel as well as the physicochemical stability of liposome in comparison to the current Taxol® formulation. The use of 3% (v\\/v) Tween 80 in the hydration media was able to increase the solubility of drug. The addition of sucrose as a lyoprotectant

Tao Yang; Fu-De Cui; Min-Koo Choi; Jei-Won Cho; Suk-Jae Chung; Chang-Koo Shim; Dae-Duk Kim

394

Hypersensitivity and Loss of Disease Site Targeting Caused by Antibody Responses to PEGylated Liposomes  

Microsoft Academic Search

The systemic application of nucleic acid drugs requires delivery systems that overcome the poor pharmacokinetics, limited biodistribution, and inefficient uptake of nucleic acids. PEGylated liposomes show considerable promise because of their intrinsic ability to accumulate at disease sites and facilitate transfection of target cells. Unlike many viral vectors, PEGylated liposomes are generally considered to be nonimmunogenic. We have developed a

Adam Judge; Kevin McClintock; Janet R. Phelps; Ian MacLachlan

395

Magnetic anisotropy of van der Waals absorbed iron(II) phthalocyanine layer on Bi2Te3  

NASA Astrophysics Data System (ADS)

A self-assembled iron(II) phthalocyanine single layer adsorbed on the topological insulator Bi2Te3 was investigated by spin-polarized scanning tunneling microscopy and density functional theory calculations. Although the molecule-substrate interaction is dominated by a relatively weak van der Waals force, the local density of states of Fe was found to strongly depend on the adsorption sites, resulting in a supermolecular lattice. Spin-polarized measurements show that the magnetic moment of iron(II) phthalocyanine persists with an in-plane magnetic easy axis, which was further confirmed by density functional calculations.

Song, Y. R.; Zhang, Y. Y.; Yang, F.; Zhang, K. F.; Liu, Canhua; Qian, Dong; Gao, C. L.; Zhang, S. B.; Jia, Jin-Feng

2014-11-01

396

Nonlinear absorption of laser radiation by zinc and lead phthalocyanines and zinc porphyrin in a nanoporous-glass/polymer composite  

NASA Astrophysics Data System (ADS)

We have studied the nonlinear absorption of nanosecond 532-nm laser pulses by zinc phthalocyanine (PcZn), lead phthalocyanine (PcPb) and zinc porphyrin (PrZn) incorporated into a nanoporous-glass/polymer composite and determined the basic nonlinear absorption characteristics of these compounds in the composite host. The composite is shown to be suitable for designing nonlinear optical elements activated with organic compounds. The correlation between the characteristics of the three compounds in the composite host and liquid solvents is analysed.

Dolotov, S. M.; Koldunov, L. M.; Koldunov, M. F.; Petukhov, A. V.; Sizyukhin, A. V.

2012-01-01

397

Novel planar binuclear zinc phthalocyanine sensitizer for dye-sensitized solar cells: Synthesis and spectral, electrochemical, and photovoltaic properties  

NASA Astrophysics Data System (ADS)

A planar binuclear zinc phthalocyanine was newly synthesized for use in dye-sensitized solar cells, based on Schiff base and asymmetric amino zinc phthalocyanine. The novel compounds were characterized using FTIR, UV-Vis, 1H NMR, cyclic voltammetry and elemental analysis. From the reduction and oxidation behavior, it is proved that APC and bi-NPC have negative LUMO levels and positive HOMO levels, satisfying the energy gap rule, and can be employed as sensitizers for dye-sensitized solar cells (DSSCs) applications.

Zhu, Baiqing; Zhang, Xuejun; Han, Mingliang; Deng, Pengfei; Li, Qiaoling

2015-01-01

398

Preparation and optimization of quercetin-loaded liposomes for wound healing, using response surface methodology.  

PubMed

The basic objective of this study was to prepare quercetin-loaded liposomes by the thin film hydration method. The liposomal formulation was optimized using response surface methodology (RSM). A rotation speed of 75 rpm and a water bath temperature of 46°C were finalized as the best for optimized drug-loaded liposomal formulation. In vitro characterization of the quercetin-loaded liposomal formulation was done through some parameters including the entrapment efficiency (EE), drug release (DR), and mean particle size; the resulting values of 86.5 ± 0.42%, 76.5%, and146 nm were found to be standard characterized values respectively. It is concluded that quercetin-loaded liposomal formulations achieve sustained release of drug in wound areas. PMID:25375215

Jangde, Rajendra; Singh, Deependra

2014-11-01

399

Cancer Immunotherapy Utilized Bubble Liposomes and Ultrasound as Antigen Delivery System  

NASA Astrophysics Data System (ADS)

In dendritic cells (DCs)-based cancer immunotherapy, it is important to present the epitope peptide derived from tumor associated antigens (TAAs) on MHC class I in order to induce tumor specific cytotoxic T lymphocytes (CTLs). However, MHC class I molecules generally present the epitope peptides derived from endogenous antigens for DCs but not exogenous ones such as TAAs. Recently, we developed the novel liposomal bubbles (Bubble liposomes) encapsulating perfluoropropane nanobubbles. In this study, we attempted to establish the novel antigen delivery system to induce MHC class I presentation using the combination of ultrasound and Bubble liposomes. Using ovalbumin (OVA) as model antigen, the combination of Bubble liposomes and ultrasound exposure for the DC could induce MHC class I presentation. In addition, the viability of DCs was more than 80%. These results suggest that Bubble liposomes might be a novel ultrasound enhanced antigen delivery tool in DC-based cancer immunotherapy.

Oda, Yusuke; Otake, Shota; Suzuki, Ryo; Otake, Shota; Nishiie, Norihito; Hirata, Keiichi; Taira, Yuichiro; Utoguchi, Naoki; Maruyama, Kazuo

2010-03-01

400

Synthesis of protoporphyrin-lipids and biological evaluation of micelles and liposomes.  

PubMed

Protoporphyrin IX (PPIX) lipids were synthesized by introducing a long alkyl chain, such as C13, C15, and C17, at each vinyl group on PPIX via hydrobromination. The PPIX lipids exhibited a water-soluble property by forming their micelles in water and the PPIX-lipid micelles showed relatively low cytotoxicity toward HeLa cells (IC50=151.7-379.9?M) without light irradiation. PL-C17 liposomes (post-inserted liposomes) were readily prepared by adding PL-C17 micelle solution to the liposome solution. The IC50 values of PPIX, PL-C17 micelles, and PL-C17 liposomes toward HeLa cells were 0.53, 5.65, and 12.9?M, respectively, after irradiation with a xenon lamp in the 400-800nm range for 2min. PL-C17 liposomes were selectively accumulated in the Golgi apparatus in cells. PMID:25066052

Tachikawa, Shoji; El-Zaria, Mohamed E; Inomata, Ryu; Sato, Shinichi; Nakamura, Hiroyuki

2014-09-01

401

Introduction of antioxidant-loaded liposomes into endothelial cell surfaces through DNA hybridization.  

PubMed

Ischemia-reperfusion damage is a problem in organ transplantation. Reactive oxygen species are produced in cells by blood-mediated reactions at the time of blood reperfusion. In this study, we developed a method to immobilize and internalize antioxidants in endothelial cells, using vitamin E-loaded liposomes. The liposomes loaded with vitamin E and human umbilical vein endothelial cells (HUVECs) were modified with poly(ethylene glycol)-phospholipid conjugates carrying 20-mer of deoxyadenylic acid (oligo(dA)??) and 20-mer of complementary deoxythymidylic acid (oligo(dT)??), respectively. The liposomes were effectively immobilized on HUVECs through DNA hybridization between oligo(dA)?? and oligo(dT)??. The liposomes loaded with vitamin E were gradually internalized into HUVECs. Then, the cells were treated with antimycin A to induce oxidative stress. We found the amount of reactive oxygen species was greatly reduced in HUVECs carrying vitamin E-loaded liposomes. PMID:24345482

Deno, Sho; Takemoto, Naohiro; Iwata, Hiroo

2014-01-01

402

Luminescence stability improvement in liposome-based homogeneous luminescence resonance energy transfer.  

PubMed

A stable liposome-based time-resolved luminescence resonance energy transfer (TR-LRET) assay was developed based on the interaction of biotinylated lipids and streptavidin. Eu(3+) ion chelated to 4,4,4-trifluoro-1-(2-naphthalenyl)-1,3-butanedione and trioctylphosphine oxide was incorporated into liposomes. Acceptor-labeled streptavidin bound to biotinylated lipids of the liposomes enables TR-LRET. A stable assay performance was achieved by optimization. High Eu(3+) signal and stability, low variation, and sensitivity below 100 pM for free biotin was achieved by incorporating the chelate into liposomes containing cholesterol in a carbonate buffer. Potentially, the stable assay compared with the assay without cholesterol offers an improved platform to liposome-based detection systems. PMID:23702341

Pihlasalo, Sari; Granberg, Jenny; Hänninen, Pekka; Peltonen, Jouko; Härmä, Harri

2013-09-01

403

The Role of Drug-Lipid Interactions on the Disposition of Liposome-Formulated Opioid Analgesics In Vitro and In Vivo  

Microsoft Academic Search

Although liposome encapsulation prolongs the duration of action of epidurally administered drugs, little is known about how liposome encapsulation affects opioids differ- ently, or about how lipid content of liposomes alters the bioavailability of epidurally-administered opioids. To ad- dress these issues, morphine, alfentanil, fentanyl, and sufentanil were loaded into d--dipalmitoyl phosphati- dylcholine multilamellar liposomes, and incorporation efficiency and in vitro

Claudette R. Bethune; Christopher M. Bernards; Tot Bui-Nguyen; Danny D. Shen; Rodney J. Y. Ho

2001-01-01

404

A simplified method to attach antibodies on liposomes by biotin-streptavidin affinity for rapid and economical screening of targeted liposomes.  

PubMed

The biotin-Streptavidin (STREP) technique for attachment of monoclonal antibodies (mAbs) (or other ligand types) on liposome surface offers high attachment yield, however it is time consuming and expensive due to the number of steps used and the consumption of large quantities of STREP. Herein, a simplified, fast and economic technique, by incubating pre-mixed biotin-mAb/STREP with biotin-liposomes, at a 3:1:1 biotin-mAb/STREP/biotin-LIP ratio (mol/mol/mol) was evaluated. The physichochemical properties, final mAb attachment yield and targeting potential of liposomes decorated with an anti-transferrin receptor mAb (TfR-mAb), prepared by the simple method (SM) and the conventional method (CM), were compared. The vesicle uptake by hCMEC/D3 cells (known to overexpress TfR) were considered as a measure of liposome targeting capability. Results show that both targeted liposome types (SM and CM) have small size (mean diameters around 150 nm), low poly-dispersity (approx. 0.20) and similar mAb attachment yield (between 64-88%). However, the uptake of the SM-liposomes is slightly lower compared to CM-LIP (24-30% decrease), suggesting that the modulated conformation of mAbs on the liposome surface (triplets attached to one single STREP molecule) results in decreased targeting capability. Nevertheless, the simpler and faster one-step preparation procedure which has very high lipid recovery (> 95%) compared to the CM (50-60%) and 15-30 times lower consumption of STREP, may be a good alternative for initial screening of various mAbs as ligands for targeted liposomal or other nanotechnologies, during pre-clinical development. PMID:24734540

Papadia, Konstantina; Markoutsa, Eleni; Antimisiaris, Sophia G

2014-05-01

405

In vitro uptake of lysozyme-loaded liposomes coated with chitosan biopolymer as model immunoadjuvants.  

PubMed

Chitosan binds to negatively charged soy lecithin liposomes by an electrostatic interaction driven by its cationic amino group. This interaction allows developing stable coated vesicles suitable as a targeted carrier and controlled release system for drugs and vaccines. In this work, we studied the effect of chitosan-coated liposomes on the uptake and antigen presentation of hen egg-white lysozyme (HEL) in Peyer's patches peritoneal macrophages isolated from mice. Chitosan-coated liposomes were characterized according to size, zeta potential, and antigen-loading and release properties. Results showed an increase in the positive net charge and size of the liposomes as the concentration of chitosan was increased, suggesting an electrostatic interaction and an effective coating, followed by fluorescence microscopy. About 85% of the antigen loaded remained in the chitosan-coated liposomes after release studies for 4 hours in phosphate-buffered saline. After 4 hours of preincubation with a T-cell hybridoma line cocultured with murine peritoneal macrophages, only trace amounts of interleukin-2 (IL-2) were detected in the cocultures treated with HEL alone, whereas cocultures treated with HEL-liposomes had an important production of IL-2, and the HEL chitosan-coated liposomes had already reached maximum IL-2 expression. Confocal microscopy studies showed that chitosan-coated liposomes had a higher uptake rate of the fluorescently labeled HEL than uncoated liposomal vesicles after 30 minutes of incubation with the peritoneal macrophages. Since uptake by macrophage cells is the first step in vaccination, our results suggest that the chitosan-coated liposomal system is a potential candidate as an immunoadjuvant for vaccine delivery systems. PMID:19514859

Madrigal-Carballo, Sergio; Vila, Amparo O; Sibaja, Maria; Reed, Jess D; Molina, Francisco

2010-03-01

406

Tumor targeting and imaging with dual-peptide conjugated multifunctional liposomal nanoparticles  

PubMed Central

Background The significant progress in nanotechnology provides a wide spectrum of nanosized material for various applications, including tumor targeting and molecular imaging. The aim of this study was to evaluate multifunctional liposomal nanoparticles for targeting approaches and detection of tumors using different imaging modalities. The concept of dual-targeting was tested in vitro and in vivo using liposomes derivatized with an arginine-glycine-aspartic acid (RGD) peptide binding to ?v?3 integrin receptors and a substance P peptide binding to neurokinin-1 receptors. Methods For liposome preparation, lipids, polyethylene glycol building blocks, DTPA-derivatized lipids for radiolabeling, lipid-based RGD and substance P building blocks and imaging labels were combined in defined molar ratios. Liposomes were characterized by photon correlation spectroscopy and zeta potential measurements, and in vitro binding properties were tested using fluorescence microscopy. Standardized protocols for radiolabeling were developed to perform biodistribution and micro-single photon emission computed tomography/computed tomography (SPECT/CT) studies in nude mice bearing glioblastoma and/or melanoma tumor xenografts. Additionally, an initial magnetic resonance imaging study was performed. Results Liposomes were radiolabeled with high radiochemical yields. Fluorescence microscopy showed specific cellular interactions with RGD-liposomes and substance P-liposomes. Biodistribution and micro-SPECT/CT imaging of 111In-labeled liposomal nanoparticles revealed low tumor uptake, but in a preliminary magnetic resonance imaging study with a single-targeted RGD-liposome, uptake in the tumor xenografts could be visualized. Conclusion The present study shows the potential of liposomes as multifunctional targeted vehicles for imaging of tumors combining radioactive, fluorescent, and magnetic resonance signaling. Specific in vitro tumor targeting by fluorescence microscopy and radioactivity was achieved. However, biodistribution studies in an animal tumor model revealed only moderate tumor uptake and no additive effect using a dual-targeting approach. PMID:24353415

Rangger, Christine; Helbok, Anna; Sosabowski, Jane; Kremser, Christian; Koehler, Gottfried; Prassl, Ruth; Andreae, Fritz; Virgolini, Irene J; von Guggenberg, Elisabeth; Decristoforo, Clemens

2013-01-01

407

Mechanosensitive liposomes as artificial chaperones for shear-driven acceleration of enzyme-catalyzed reaction.  

PubMed

Mechanosensitive liposomes were prepared and applied to continuously accelerate the glucose oxidase (GO) reaction in shear flow. The liposome membrane was composed of a ternary lipid mixture containing 20 mol % negatively charged lipid and 30 mol % cholesterol. The liposomes encapsulating GO and catalase were passed through microtubes with inner diameter of 190 or 380 ?m at 25 °C to induce the catalytic oxidation of 10 mM glucose with simultaneous decomposition of H2O2 produced. The liposomal GO showed significantly low reactivity in the static liquid system because of the permeation resistance of lipid membranes to glucose. On the other hand, the enzyme activity of liposomal GO observed at the average shear rate of 7.8 × 10(3) s(-1) was significantly larger than its intrinsic activity free of mass transfer effect in the static liquid system. The structure of liposomes was highly shear-sensitive as elucidated on the basis of shear rate-dependent physical stability of liposomes and membrane permeability to 5(6)-carboxyfluorescein as well as to GO. Thus, the above shear-driven acceleration of GO reaction was indicated to be caused by the free GO molecules released from the structurally altered liposomes at high shear rates. Moreover, the shear-induced denaturation of free GO was completely depressed by the interaction with the sheared liposomes with the chaperone-like function. The shear-sensitive liposomal GO system can be a unique catalyst that continuously accelerates and also decelerates the oxidation reaction depending on the applied shear rate. PMID:24547684

Natsume, Tomotaka; Yoshimoto, Makoto

2014-03-12

408

Efficacy and Safety of Liposomal Clarithromycin and Its Effect on Pseudomonas aeruginosa Virulence Factors  

PubMed Central

We investigated the efficacy and safety of liposomal clarithromycin formulations with different surface charges against clinical isolates of Pseudomonas aeruginosa from the lungs of cystic fibrosis (CF) patients. The liposomal clarithromycin formulations were prepared by the dehydration-rehydration method, and their sizes were measured using the dynamic-light-scattering technique. Encapsulation efficiency was determined by microbiological assay, and the stabilities of the formulations in biological fluid were evaluated for a period of 48 h. The MICs and minimum bactericidal concentrations (MBCs) of free and liposomal formulations were determined with P. aeruginosa strains isolated from CF patients. Liposomal clarithromycin activity against biofilm-forming P. aeruginosa was compared to that of free antibiotic using the Calgary Biofilm Device (CBD). The effects of subinhibitory concentrations of free and liposomal clarithromycin on bacterial virulence factors and motility on agar were investigated on clinical isolates of P. aeruginosa. The cytotoxicities of the liposome preparations and free drug were evaluated on a pulmonary epithelial cell line (A549). The average diameter of the formulations was >222 nm, with encapsulation efficiencies ranging from 5.7% to 30.4%. The liposomes retained more than 70% of their drug content during the 48-h time period. The highly resistant strains of P. aeruginosa became susceptible to liposome-encapsulated clarithromycin (MIC, 256 mg/liter versus 8 mg/liter; P < 0.001). Liposomal clarithromycin reduced the bacterial growth within the biofilm by 3 to 4 log units (P < 0.001), significantly attenuated virulence factor production, and reduced bacterial twitching, swarming, and swimming motilities. The clarithromycin-entrapped liposomes were less cytotoxic than the free drug (P < 0.001). These data indicate that our novel formulations could be a useful strategy to enhance the efficacy of clarithromycin against resistant P. aeruginosa strains that commonly affect individuals with cystic fibrosis. PMID:23545534

Alhajlan, Mai; Alhariri, Moayad

2013-01-01

409

Surface modification of RGD-liposomes for selective drug delivery to monocytes/neutrophils in brain.  

PubMed

In the present study, RGD peptide was coupled with ferulic acid (FA) liposomes for binding to monocytes and neutrophils in peripheral blood for brain targeting in response to leukocyte recruitment. Cholesterol (Ch) was esterified with succinic anhydride to introduce a carboxylic end group (Ch-COOH). Soybean phosphatidylcholine, cholesterol and Ch-COOH were in a molar ratio of 1 : 0.23 : 0.05. FA was loaded into liposomes with 80.2+/-5.2% entrapment efficiency (EE) using a calcium acetate gradient method since it was difficult to load FA by other methods. RGD peptide was a novel compound coupled with Ch-COOH via carbodiimide and N-hydroxysulfosuccinimide. The results of the in vitro flow cytometric study showed that RGD conjugation liposomes (RGD-liposomes) could bind to monocytes/neutrophils efficiently. The rats were subjected to intrastriatal microinjections of 100 microl of human recombinant IL-1beta to produce brain inflammation and subsequently sacrificed after 15, 30, 60 and 120 min of administration of three formulations (FA solution, FA liposome, RGD-coated FA liposome). The body distribution results showed that RGD-liposomes could be directed to the target site, i.e. the brain, by cell selectivity in case of an inflammatory response. For RGD coated liposomes, the concentration of FA in brain was 6-fold higher than that of FA solution and 3-fold higher than that of uncoated liposomes. MTT assay and flow cytometry were used in the pharmacodynamic studies where it was found that FA liposomes exhibited greater antioxidant activity to FA solution on U937 cell. PMID:17666843

Qin, Jing; Chen, DaWei; Hu, HaiYang; Cui, Qiao; Qiao, MingXi; Chen, BaoYu

2007-08-01

410

Efficacy and safety of liposomal clarithromycin and its effect on Pseudomonas aeruginosa virulence factors.  

PubMed

We investigated the efficacy and safety of liposomal clarithromycin formulations with different surface charges against clinical isolates of Pseudomonas aeruginosa from the lungs of cystic fibrosis (CF) patients. The liposomal clarithromycin formulations were prepared by the dehydration-rehydration method, and their sizes were measured using the dynamic-light-scattering technique. Encapsulation efficiency was determined by microbiological assay, and the stabilities of the formulations in biological fluid were evaluated for a period of 48 h. The MICs and minimum bactericidal concentrations (MBCs) of free and liposomal formulations were determined with P. aeruginosa strains isolated from CF patients. Liposomal clarithromycin activity against biofilm-forming P. aeruginosa was compared to that of free antibiotic using the Calgary Biofilm Device (CBD). The effects of subinhibitory concentrations of free and liposomal clarithromycin on bacterial virulence factors and motility on agar were investigated on clinical isolates of P. aeruginosa. The cytotoxicities of the liposome preparations and free drug were evaluated on a pulmonary epithelial cell line (A549). The average diameter of the formulations was >222 nm, with encapsulation efficiencies ranging from 5.7% to 30.4%. The liposomes retained more than 70% of their drug content during the 48-h time period. The highly resistant strains of P. aeruginosa became susceptible to liposome-encapsulated clarithromycin (MIC, 256 mg/liter versus 8 mg/liter; P < 0.001). Liposomal clarithromycin reduced the bacterial growth within the biofilm by 3 to 4 log units (P < 0.001), significantly attenuated virulence factor production, and reduced bacterial twitching, swarming, and swimming motilities. The clarithromycin-entrapped liposomes were less cytotoxic than the free drug (P < 0.001). These data indicate that our novel formulations could be a useful strategy to enhance the efficacy of clarithromycin against resistant P. aeruginosa strains that commonly affect individuals with cystic fibrosis. PMID:23545534

Alhajlan, Mai; Alhariri, Moayad; Omri, Abdelwahab

2013-06-01

411

Biological activities of phthalocyanines. XIV. Effect of hydrophobic phthalimidomethyl groups on the in vivo phototoxicity and mechanism of photodynamic action of sulphonated aluminium phthalocyanines.  

PubMed Central

Aluminium phthalocyanines substituted to different degrees with hydrophilic sulphonic acid and hydrophobic phthalimidomethyl groups were investigated in vivo as new agents for the photodynamic therapy of malignant tumours. Parameters studied included the photodynamic action on EMT-6 mammary tumours in BALB/c mice, the therapeutic window and the potential for direct cell killing, assayed via an in vivo/in vitro test. Although the efficiency of photoinactivation of the EMT-6 tumour increases by a factor of ten with reduction of the number of sulphonic acid groups from four to two, no further effect was seen with the addition of the hydrophobic phthalimidomethyl groups. Addition of the latter groups however increased the potential for direct cell killing by a factor of two and expanded the therapeutic window by a factor of four, thus improving the usefulness of the dye as a photosensitiser for the photodynamic therapy of cancer. PMID:1616852

Boyle, R. W.; Paquette, B.; van Lier, J. E.

1992-01-01

412

Vapor sensing mechanism of acid on copper phthalocyanine thin films studied by electrical conductivity  

NASA Astrophysics Data System (ADS)

The electrical conductivity of thin films of iron phthalocyanine on glass substrates by thermal evaporation technique have been investigated. The electrical conductivity of thin films of these complexes changes when exposed to oxidizing and reducing gases such as halogens, ammonia, water and NOX. Thermal activation energy in the intrinsic region and impurity scattering region can be calculated by using Arrhenius plot. The dark conductivity and photoconductivity have been taken at different temperatures in the range 312-389 K. These films have been studied as chemical sensors for dilute sulphuric acid.

Singh, Sukhwinder; Saini, G. S. S.; Tripathi, S. K.

2013-06-01

413

Syntheses and properties of trimethylaminophenoxy-substituted Zn(II)-phthalocyanines†  

PubMed Central

The syntheses, photophysical properties and in vitro biological behavior of a series of nine Zn(II)-phthalocyanines (ZnPcs) bearing one to eight positively-charged trimethylaminophenoxy groups are reported. All ZnPcs are highly soluble in polar organic solvents, and show fluorescence and singlet oxygen quantum yields in the ranges 0.11–0.21 and 0.16–0.47, respectively. The cytotoxicity of the ZnPcs depends on both the number of charges and their site of substitution (? vs. ?) on the Pc isoindole units; the most promising for PDT application are the ?-substituted di-cationic ZnPcs 6a and 17a. PMID:22308216

Ongarora, Benson G.; Hu, Xiaoke; Li, Hairong; Fronczek, Frank R.; Vicente, M. Graça H.

2011-01-01

414

Near monolayer deposition of palladium phthalocyanine and perylene tetracarboxylic diimide on Au(001): A STM study  

NASA Astrophysics Data System (ADS)

Near monolayer deposition of palladium phthalocyanine (PdPc) or perylene tetracarboxylic diimide (PTCDI) on the Au(001)-5× 28 reconstructed surface leads to the formation of well ordered molecular assemblies, as observed by means of scanning tunneling microscopy. The PdPc lattice shows locally domains with square or rectangular symmetry having different molecular densities. The underlying gold surface reconstruction remains stable after PdPc deposition, indicating a weak interaction between PdPc and the gold surface. As in the PTCDA case, the PTCDI unit mesh is centered rectangular which is attributed to the formation of H bonds in the lattice.

Guillermet, O.; Glachant, A.; Mossoyan, M.; Mossoyan, J. C.

2006-03-01

415

Photovoltaic properties of phthalocyanine based p–n diode evaporated onto titanium dioxide  

Microsoft Academic Search

We have investigated the photovoltaic properties of organic p–n heterojunction photovoltaic cells consisting of p-type zinc (or copper) phthalocyanine (ZnPc, CuPc) and various dye materials, such as tetrapyridyl porphyrin (H2TPyP), DCM, Coumarin6, perylene derivative (BP-PTCDI), and Buckminsterfullerene (C60), evaporated on an n-type anatase TiO2 film. The open circuit voltage (Voc) of ITO\\/TiO2\\/dye\\/ZnPc\\/Au devices lined up in order of DCM>BP-PTCDI>H2TPyP>C60 which

Yuji Ohmori; Eiji Itoh; Keiichi Miyairi

2006-01-01

416

Unoccupied states in Cu and Zn octaethyl-porphyrin and phthalocyanine  

NASA Astrophysics Data System (ADS)

Copper and zinc phthalocyanines and porphyrins are used in organic light emitting diodes and dye-sensitized solar cells. Using near edge x-ray absorption fine structure (NEXAFS) spectroscopy at the Cu 2p and Zn 2p edges, the unoccupied valence states at the Cu and Zn atoms are probed and decomposed into 3d and 4s contributions with the help of density functional calculations. A comparison with the N 1s edge provides the 2p states of the N atoms surrounding the metal, and a comparison with inverse photoemission provides a combined density of states.

Cook, Peter L.; Yang, Wanli; Liu, Xiaosong; García-Lastra, Juan María; Rubio, Angel; Himpsel, F. J.

2011-05-01

417

Ab initio simulation of optical limiting: the case of metal-free phthalocyanine.  

PubMed

We present a fully ab initio, nonperturbative description of the optical limiting properties of a metal-free phthalocyanine by simulating the effects of a broadband electric field of increasing intensity. The results confirm reverse saturable absorption as the leading mechanism for optical limiting phenomena in this system and reveal that a number of dipole-forbidden excitations are populated by excited-state absorption at more intense external fields. The excellent agreement with the experimental data supports our approach as a powerful tool to predict optical limiting in view of applications. PMID:24877971

Cocchi, Caterina; Prezzi, Deborah; Ruini, Alice; Molinari, Elisa; Rozzi, Carlo A

2014-05-16