These are representative sample records from Science.gov related to your search topic.
For comprehensive and current results, perform a real-time search at Science.gov.
1

CGP 55398, a liposomal Ge(IV) phthalocyanine bearing two axially ligated cholesterol moieties: a new potential agent for photodynamic therapy of tumours.  

PubMed Central

Ge(IV) phthalocyanine (GePc) with two axially ligated cholesterol moieties was prepared by chemical synthesis and incorporated in a monomeric state into small unilamellar liposomes (CGP 55398). Upon photoexcitation with light wavelengths around its intense absorption peak at 680 nm, GePc shows an efficient photosensitising activity towards biological substrates through a mechanism which largely involves the intermediacy of singlet oxygen. GePc injected systemically into mice bearing an intramuscularly implanted MS-2 fibrosarcoma is quantitatively transferred to serum lipoproteins and localises in the tumour tissue with good efficiency: at 24 h post injection the GePc content in the tumour is 0.74 and 1.87 micrograms per g of tissue with a tumour/peritumoral ratio of 4.35 and 5.67 for injected doses of 0.76 and 1.52 mg kg-1 respectively. At this time the red-light irradiation of the GePc-loaded fibrosarcoma causes a fast and massive tumour necrosis involving both malignant cells and blood vessels. Images Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:8180009

Segalla, A.; Milanesi, C.; Jori, G.; Capraro, H. G.; Isele, U.; Schieweck, K.

1994-01-01

2

Photosensitization of cells with different metastatic potentials by liposome-delivered Zn(II)-phthalocyanine.  

PubMed

The phototoxicity of liposome-incorporated Zn(II)-phthalocyanine (ZnPc) and its water-soluble tetrasulphonated derivative (ZnPcTS) was studied in the tumorigenic but nonmetastatic (RE4) and the highly metastatic (4R) transformed rat embryo fibroblasts. Upon irradiation with 585-605 nm light in the presence of ZnPc, the cell survival drastically decreased, while it was unaffected by ZnPcTS. Enzymatic assays showed that ZnPc induced about a 60% decrease in the activity of the mitochondrial enzymes NADH and succinate dehydrogenase after 3 min of irradiation, while no significant reduction in the activity of lactate dehydrogenase and lysosomal N-acetyl-beta-glucosaminidase was observed. The transport of thymidine, deoxyglucose and alpha-aminoisobutyric acid through the plasma membrane was strongly inhibited after irradiation. Similarly, the intracellular ATP content was significantly reduced. The reduction of DNA biosynthesis showed a time dependence quite similar to the photo-induced decrease in cell survival. No repair of cellular functions affected by ZnPc was observed in the 2 cell lines. These results indicate that, under our experimental conditions, hydrophobic ZnPc exerts its cytotoxic activity mainly by impairing those functions localized in the plasma membrane of the cells. PMID:9455803

Valduga, G; Reddi, E; Garbisa, S; Jori, G

1998-01-30

3

Liposomal anthracyclines.  

PubMed

Preclinical experiments with liposome-encapsulated anthracyclines indicate that this form of delivery may be effective in decreasing the cardiotoxic effect of these drugs. The tumor drug levels and the antitumor efficacy of anthracyclines in a number of mouse models are significantly enhanced by delivery in long-circulating liposomes. Drastic changes in the clinical pharmacokinetics of doxorubicin have been observed using liposomal delivery. Clinical trials with liposomal anthracycline preparations are ongoing to determine whether the pharmacokinetic changes are translated in a superior therapeutic index of this important group of chemotherapeutic agents. PMID:8040147

Gabizon, A A

1994-04-01

4

Synthesis and cellular studies of nonaggregated water-soluble phthalocyanines.  

PubMed

Water-soluble phthalocyanines are promising photosensitizers for application in cancer therapy and in the photoinactivation of viruses. The water-soluble zinc(II) phthalocyanines 5 and 6 were synthesized by converting the corresponding ester derivative 4 into the sodium carboxylate and carboxylic acid species. Compound 5 can be solubilized in water as a monomeric species, as demonstrated by UV/vis and fluorescence spectroscopy. These compounds were characterized by analytical and spectroscopic methods and, in the case of 4, by X-ray crystallography. The water-soluble phthalocyanines were found to have low dark cytotoxicity toward V79 hamster fibroblasts and human HEp2 cells, to be phototoxic at low light and drug doses, to be taken up by cells in culture, and to localize intracellularly, mainly in the cell lysosomes. Conjugation of the anionic phthalocyanines with positively charged LipoGen liposomes resulted in effective delivery of these compounds into the nuclei of cells. It is concluded that these highly water-soluble phthalocyanines are promising sensitizers for the photodynamic therapy of tumors. PMID:15715471

Liu, Wei; Jensen, Timothy J; Fronczek, Frank R; Hammer, Robert P; Smith, Kevin M; Vicente, M Graça H

2005-02-24

5

Doped colorimetric assay liposomes  

DOEpatents

The present invention provides compositions comprising colorimetric assay liposomes. The present invention also provides methods for producing colorimetric liposomes and calorimetric liposome assay systems. In preferred embodiments, these calorimetric liposome systems provide high levels of sensitivity through the use of dopant molecules. As these dopants allow the controlled destabilization of the liposome structure, upon exposure of the doped liposomes to analyte(s) of interest, the indicator color change is facilitated and more easily recognized.

Charych, Deborah (Albany, CA); Stevens, Raymond C. (Albany, CA)

2001-01-01

6

Interaction of hydro- or lipophilic phthalocyanines with cells of different metastatic potential.  

PubMed

A highly metastatic (4R) and a nonmetastatic (RE4) transformed rat embryo fibroblast cell line were incubated with lipid-soluble Zn(II)-phthalocyanine (ZnPc) and its water-soluble tetrasulphonated derivative (ZnPcTS) and compared for phthalocyanine uptake. The hydrophobic liposome-delivered ZnPc showed a significantly greater uptake by both cell lines than did ZnPcTS. Moreover, the two phthalocyanines appear to interact with cells according to different pathways, as suggested by the different temperature-dependence of the binding process and the different inhibitory action exerted by selected serum proteins, such as lipoproteins and heavy proteins. Under all experimental conditions, the two cell lines exhibited similar interactions with ZnPc and ZnPcTS, suggesting that heterogeneity of the tumor cell population has a minor influence on the accumulation of photosensitizers. PMID:8615893

Valduga, G; Bianco, G; Csik, G; Reddi, E; Masiero, L; Garbisa, S; Jori, G

1996-03-01

7

Method of solubilizing phthalocyanines and metallophthalocyanines  

DOEpatents

A one-step method of manufacturing soluble phthalocyanines and metallophthalocyanines, like zinc phthalocyanine, by converting a phthalocyanine or a metallophthalocyanine to a trialkylsilyl-substituted derivative is disclosed. The phthalocyanine or metallophthalocyanine is converted to a soluble trialkylsilyl-substituted derivative by interacting the phthalocyanine or metallophthalocyanine with an active metal amide, like lithium 2,2,6,6-tetramethylpiperidide, and a halotrialkylsilane, like chlorotrimethylsilane, to provide a phthalocyanine compound, like phthalocyanine monomers, dimers or polymers, metalated or unmetalated, that are soluble in organic media.

Rathke, Jerome W. (Bolingbrook, IL); Chen, Michael J. (Darien, IL); Fendrick, Carol M. (Downers Grove, IL)

1997-01-01

8

Gold liposomes  

SciTech Connect

Lipids are an important class of molecules, being found in membranes, HDL, LDL, and other natural structures, serving essential roles in structure and with varied functions such as compartmentalization and transport. Synthetic liposomes are also widely used as delivery and release vehicles for drugs, cosmetics, and other chemicals; soap is made from lipids. Lipids may form bilayer or multilammellar vesicles, micelles, sheets, tubes, and other structures. Lipid molecules may be linked to proteins, carbohydrates, or other moieties. EM study of this essential ingredient of life has lagged, due to lack of direct methods to visualize lipids without extensive alteration. OsO4 reacts with double bonds in membrane phospholipids, forming crossbridges. This has been the method of choice to both fix and stain membranes, thus far. An earlier work described the use of tungstate clusters (W{sub 11}) attached to lipid moieties to form lipid structures and lipid probes. With the development of gold clusters, it is now possible to covalently and specifically link a dense gold sphere to a lipid molecule; for example, reacting a mono-N-hydroxysuccinimide Nanogold cluster with the amino group on phosphatidyl ethanolaminine. Examples of a gold-fatty acid and a gold-phospholipid are shown.

Hainfeld, J.F. [Brookhaven National Lab., Upton, NY (United States)

1996-12-31

9

Liposome technology. Volume I: Preparation of liposomes  

SciTech Connect

These three volumes cover liposome technology in pharmacology and medicine. Contributors emphasize methodology used in their own laboratories, and include a brief introduction, coverage of relevant literature, applications and critical evaluations for the methods they describe. Volume I examine methods for the preparation of liposomes and auxiliary techniques.

Gregoriadis, G.

1984-01-01

10

New directions in phthalocyanine pigments  

NASA Technical Reports Server (NTRS)

Phthalocyanines have been used as a pigment in coatings and related applications for many years. These pigments are some of the most stable organic pigments known. The phthalo blue and green pigments have been known to be ultraviolet (UV) stable and thermally stable to over 400 C. These phthalocyanines are both a semiconductor and photoconductor, exhibiting catalytic activity and photostabilization capability of polymers. Many metal free and metallic phthalocyanine derivatives have been prepared. Development of the new classes of phthalocyanine pigment could be used as coating on NASA spacecraft material such as glass to decrease the optical degradation from UV light, the outside of the space station modules for UV protection, and coating on solar cells to increase lifetime and efficiency.

Trinh, Diep VO

1994-01-01

11

Fused liposome and acid induced method for liposome fusion  

SciTech Connect

This patent describes a method of fusing liposomes. It comprises: preparing a suspension of liposomes containing at least one lipid which has a tendency to form the inverted hexagonal phase and at least 20 mol percent of palmitoylhomocysteine; and in the absence of externally added divalent cations, proteins or other macromolecules, acidifying the liposome suspension to reduce the pH of the liposomes to below pH 7, such that at least about 20% of the liposomes fuse to one another.

Huang, L.; Connor, J.

1988-12-06

12

Liposome formation in microgravity  

NASA Astrophysics Data System (ADS)

Liposomes are artificial vesicles with a phospholipid bilayer membrane. The formation of liposomes is a self-assembly process that is driven by the amphipathic nature of phospholipid molecules and can be observed during the removal of detergent from phospholipids dissolved in detergent micelles. As detergent concentration in the mixed micelles decreases, the non-polar tail regions of phospholipids produce a hydrophobic effect that drives the micelles to fuse and form planar bilayers in which phospholipids orient with tail regions to the center of the bilayer and polar head regions to the external surface. Remaining detergent molecules shield exposed edges of the bilayer sheet from the aqueous environment. Further removal of detergent leads to intramembrane folding and membrane vesiculation, forming liposomes. We have observed that the formation of liposomes is altered in microgravity. Liposomes that were formed at 1-g did not exceed 150 nm in diameter, whereas liposomes that were formed during spaceflight exhibited diameters up to 2000 nm. Using detergent-stabilized planar bilayers, we determined that the stage of liposome formation most influenced by gravity is membrane vesiculation. In addition, we found that small, equipment-induced fluid disturbances increased vesiculation and negated the size-enhancing effects of microgravity. However, these small disturbances had no effect on liposome size at 1-g, likely due to the presence of gravity-induced buoyancy-driven fluid flows (e.g., convection currents). Our results indicate that fluid disturbances, induced by gravity, influence the vesiculation of membranes and limit the diameter of forming liposomes.

Claassen, D. E.; Spooner, B. S.

13

Liposomal spherical nucleic acids.  

PubMed

A novel class of metal-free spherical nucleic acid nanostructures was synthesized from readily available starting components. These particles consist of 30 nm liposomal cores, composed of an FDA-approved 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) lipid monomer. The surface of the liposomes was functionalized with DNA strands modified with a tocopherol tail that intercalates into the phospholipid layer of the liposomal core via hydrophobic interactions. The spherical nucleic acid architecture not only stabilizes these constructs but also facilitates cellular internalization and gene regulation in SKOV-3 cells. PMID:24983505

Banga, Resham J; Chernyak, Natalia; Narayan, Suguna P; Nguyen, SonBinh T; Mirkin, Chad A

2014-07-16

14

Phthalocyanines functionalized with 2-methyl-5-nitro-1H-imidazolylethoxy and 1,4,7-trioxanonyl moieties and the effect of metronidazole substitution on photocytotoxicity.  

PubMed

Four novel magnesium(II) and zinc(II) phthalocyanines bearing 1,4,7-trioxanonyl, polyether and/or (2-methyl-5-nitro-1H-imidazol-1-yl)ethoxy, heterocyclic substituents at their non-peripheral positions were synthesized and assessed in terms of physicochemical and biological properties. Magnesium phthalocyanine derivatives bearing polyether substituents (Pc-1), a mixed system of polyether and heterocyclic substituents (Pc-3), and four heterocyclic substituents (Pc-4), respectively, were synthesized following the Linstead macrocyclization reaction procedure. Zinc phthalocyanine (Pc-2) bearing polyether substituents at non-peripheral positions was synthesized following the procedure in n-pentanol with the zinc acetate, and DBU. Novel phthalocyanines were purified by flash column chromatography and characterized using NMR, MS, UV-Vis and HPLC. Moreover, two precursors in macrocyclization reaction phthalonitriles were characterized using X-ray. Photophysical properties of the novel macrocycles were evaluated, including UV-Vis spectra analysis and aggregation study. All macrocycles subjected to singlet oxygen generation and the oxidation rate constant measurements exhibited lower quantum yields of singlet oxygen generation in DMSO than in DMF. In addition, the Pc-2 molecule was found to be the most efficient singlet oxygen generator from the group of macrocycles studied. The photocytotoxicity evaluated on the human oral squamous cell carcinoma cell line, HSC-3, for Pc-3 was significantly higher than that for Pc-1, Pc-2, and Pc-4. Interestingly, Pc-3 was found to be the most active macrocycle in vitro although its ability to generate singlet oxygen was significantly lower than those of Pc-1 and Pc-2. However, attempts to encapsulate phthalocyanines Pc-1-Pc-3 in liposomal membranes were unsuccessful. The phthalocyanine-nitroimidazole conjugate, Pc-4 was encapsulated in phosphatidylglycerol:phosphatidylcholine unilamellar liposomes and subjected to photocytotoxicity study. PMID:23872453

Wierzchowski, Marcin; Sobotta, Lukasz; Skupin-Mrugalska, Paulina; Kruk, Justyna; Jusiak, Weronika; Yee, Michael; Konopka, Krystyna; Düzgüne?, Nejat; Tykarska, Ewa; Gdaniec, Maria; Mielcarek, Jadwiga; Goslinski, Tomasz

2013-10-01

15

How liposomes diffuse in concentrated liposome suspensions.  

PubMed

Building upon the observation that liposomes of zwitterionic lipids can be stabilized against fusion by the adsorption of cationic nanoparticles (Yu, Y.; Anthony, S.; Zhang, L.; Bae, S. C.; Granick, S. J. Phys. Chem. C2007, 111, 8233), we study, using single-particle fluorescence tracking, mobility in this distinctively deformable colloid system, in the volume fraction range of ? = 0.01 to 0.7. Liposome motion is diffusive and homogeneous at low volume fractions, but separable fast and slow populations emerge as the volume fraction increases beyond ? ? 0.45, the same volume fraction at which hard colloids with sufficiently strong attraction are known to experience gelation. This is reflected not only in scaling of the mean square displacement, but also in the step size distribution (van Hove function) measured by fluorescence imaging. The fast liposomes are observed to follow Brownian motion, and the slow ones follow anomalous diffusion characterized by a 1/3 time scaling of their mean square displacement. PMID:21384815

Yu, Yan; Anthony, Stephen M; Bae, Sung Chul; Granick, Steve

2011-03-31

16

Phthalocyanine Blends Improve Bulk Heterojunction Solar Cells  

PubMed Central

A core phthalocyanine platform allows engineering the solubility properties the band gap; shifting the maximum absorption toward the red. A simple method to increase the efficiency of heterojunction solar cells uses a self-organized blend of the phthalocyanine chromophores fabricated by solution processing. PMID:20136126

Varotto, Alessandro; Nam, Chang-Yong; Radivojevic, Ivana; Tome, Joao; Cavaleiro, Jose A.S.; Black, Charles T.; Drain, Charles Michael

2010-01-01

17

Viscoelasticity measurements inside liposomes  

NASA Astrophysics Data System (ADS)

Microrheology, the study of the behavior of fluids on the microscopic scale, has been and continues to be one of the most important subjects that can be applied to characterize the behavior of biological fluids. It is extremely difficult to make rapid measurement of the viscoelastic properties of the interior of living cells. Liposomes are widely used as model system for studying different aspects of cell biology. We propose to develop a microrheometer, based on real-time control of optical tweezers, in order to investigate the viscoelastic properties of the fluid inside liposomes. This will give greater understanding of the viscoelastic properties of the fluids inside cells. In our experiment, the liposomes are prepared by different methods to find out both a better way to make GUVs and achieve efficient encapsulation of particle. By rotating the vaterite inside a liposome via spin angular momentum, the optical torque can be measured by measuring the change of polarization of the transmitted light, which allows the direct measurement of viscous drag torque since the optical torque is balanced by the viscous drag. We present an initial feasibility demonstration of trapping and manipulation of a microscopic vaterite inside the liposome. The applied method is simple and can be extended to sensing within the living cells.

Zhang, Shu; Gibson, Lachlan; Preece, Daryl; Nieminen, Timo A.; Rubinsztein-Dunlop, Halina

2014-09-01

18

Inhaled liposomal amikacin.  

PubMed

Arikace™ is a novel formulation of inhaled liposomal amikacin that can penetrate deep within airway secretions and within Pseudomonas aeruginosa biofilms, making it an attractive therapeutic option for the treatment of cystic fibrosis (CF) pulmonary infections. Initial Phase I and Phase II studies in CF patients with chronic P. aeruginosa infection demonstrated that Arikace™ was a safe drug that resulted in significant improvements in lung function after 14-28 days of treatment. Phase III studies of inhaled liposomal amikacin compared to tobramycin inhalation solution in CF patients with P. aeruginosa infection revealed a comparable increase in forced expiratory volume in 1 second at the end of three cycles. In addition, inhaled liposomal amikacin has other potential applications in the management of difficult-to-treat pulmonary infections. A Phase II trial is currently underway to study the use of Arikace™ for the treatment of recalcitrant nontuberculous mycobacterial lung disease. PMID:24882271

Waters, Valerie; Ratjen, Felix

2014-08-01

19

Binding to and photo-oxidation of cardiolipin by the phthalocyanine photosensitizer Pc 4  

NASA Astrophysics Data System (ADS)

Cardiolipin is a unique phospholipid of the mitochondrial inner membrane. Its peroxidation correlates with release of cytochrome c and induction of apoptosis. The phthalocyanine photosensitizer Pc 4 binds preferentially to the mitochondria and endoplasmic reticulum. Earlier Förster resonance energy transfer studies showed colocalization of Pc 4 and cardiolipin, which suggests cardiolipin as a target of photodynamic therapy (PDT) with Pc 4. Using liposomes as membrane models, we find that Pc 4 binds to cardiolipin-containing liposomes similarly to those that do not contain cardiolipin. Pc 4 binding is also studied in MCF-7c3 cells and those whose cardiolipin content was reduced by treatment with palmitate. Decreased levels of cardiolipin are quantified by thin-layer chromatography. The similar level of binding of Pc 4 to cells, irrespective of palmitate treatment, supports the lack of specificity of Pc 4 binding. Thus, factors other than cardiolipin are likely responsible for the preferential localization of Pc 4 in mitochondria. Nonetheless, cardiolipin within liposomes is readily oxidized by Pc 4 and light, yielding apparently mono- and dihydroperoxidized cardiolipin. If similar products result from exposure of cells to Pc 4-PDT, they could be part of the early events leading to apoptosis following Pc 4-PDT.

Rodriguez, Myriam E.; Kim, Junhwan; Delos Santos, Grace B.; Azizuddin, Kashif; Berlin, Jeffrey; Anderson, Vernon E.; Kenney, Malcolm E.; Oleinick, Nancy L.

2010-09-01

20

Synthesis of Metal Phthalocyanine Sheet Polymers  

NASA Technical Reports Server (NTRS)

New method for synthesizing metal phthalocyanine tetracarboxylic acids (MPTCA's) yields high purity end product. In addition, high-purity metal phthalocyanine sheet polymers synthesized from compounds. Monomer formed into sheet polymer by heating. Units of polymer linked in manner similar to phenyl-group linkages in biphenyl: Conjugation extends throughout macromolecule, thereby increasing delocalization of TT-electrons. Increases conductivity and thermal stability of polymer.

Achar, B. N.; Fohlen, G. M.; Parker, J. A.

1986-01-01

21

Boronated liposome development and evaluation  

SciTech Connect

The boronated liposome development and evaluation effort consists of two separate tasks. The first is the development of new boron compounds and the synthesis of known boron species with BNCT potential. These compounds are then encapsulated within liposomes for the second task, biodistribution testing in tumor-bearing mice, which examines the potential for the liposomes and their contents to concentrate boron in cancerous tissues.

Hawthorne, M.F. [Univ. of California, Los Angeles, CA (United States)

1995-11-01

22

Ligation Strategies for Targeting Liposomal Nanocarriers  

PubMed Central

Liposomes have been exploited for pharmaceutical purposes, including diagnostic imaging and drug and gene delivery. The versatility of liposomes as drug carriers has been demonstrated by a variety of clinically approved formulations. Since liposomes were first reported, research of liposomal formulations has progressed to produce improved delivery systems. One example of this progress is stealth liposomes, so called because they are equipped with a PEGylated coating of the liposome bilayer, leading to prolonged blood circulation and improved biodistribution of the liposomal carrier. A growing research area focuses on the preparation of liposomes with the ability of targeting specific tissues. Several strategies to prepare liposomes with active targeting ligands have been developed over the last decades. Herein, several strategies for the functionalization of liposomes are concisely summarized, with emphasis on recently developed technologies for the covalent conjugation of targeting ligands to liposomes. PMID:25126543

Marques-Gallego, Patricia; de Kroon, Anton I. P. M.

2014-01-01

23

Liposome: classification, preparation, and applications  

NASA Astrophysics Data System (ADS)

Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s. Today, they are a very useful reproduction, reagent, and tool in various scientific disciplines, including mathematics and theoretical physics, biophysics, chemistry, colloid science, biochemistry, and biology. Since then, liposomes have made their way to the market. Among several talented new drug delivery systems, liposomes characterize an advanced technology to deliver active molecules to the site of action, and at present, several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles to `second-generation liposomes', in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability and regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents.

Akbarzadeh, Abolfazl; Rezaei-Sadabady, Rogaie; Davaran, Soodabeh; Joo, Sang Woo; Zarghami, Nosratollah; Hanifehpour, Younes; Samiei, Mohammad; Kouhi, Mohammad; Nejati-Koshki, Kazem

2013-02-01

24

Liposome: classification, preparation, and applications  

PubMed Central

Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s. Today, they are a very useful reproduction, reagent, and tool in various scientific disciplines, including mathematics and theoretical physics, biophysics, chemistry, colloid science, biochemistry, and biology. Since then, liposomes have made their way to the market. Among several talented new drug delivery systems, liposomes characterize an advanced technology to deliver active molecules to the site of action, and at present, several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles to ‘second-generation liposomes’, in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability and regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents. PMID:23432972

2013-01-01

25

Liposome: classification, preparation, and applications.  

PubMed

Liposomes, sphere-shaped vesicles consisting of one or more phospholipid bilayers, were first described in the mid-60s. Today, they are a very useful reproduction, reagent, and tool in various scientific disciplines, including mathematics and theoretical physics, biophysics, chemistry, colloid science, biochemistry, and biology. Since then, liposomes have made their way to the market. Among several talented new drug delivery systems, liposomes characterize an advanced technology to deliver active molecules to the site of action, and at present, several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles to 'second-generation liposomes', in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability and regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents. PMID:23432972

Akbarzadeh, Abolfazl; Rezaei-Sadabady, Rogaie; Davaran, Soodabeh; Joo, Sang Woo; Zarghami, Nosratollah; Hanifehpour, Younes; Samiei, Mohammad; Kouhi, Mohammad; Nejati-Koshki, Kazem

2013-01-01

26

Propulsion of liposomes using bacterial motors  

NASA Astrophysics Data System (ADS)

Here we describe the utilization of flagellated bacteria as actuators to propel spherical liposomes by attaching bacteria to the liposome surface. Bacteria were stably attached to liposomes using a cross-linking antibody. The effect of the number of attached bacteria on propulsion speed was experimentally determined. The effects of bacterial propulsion on the bacteria-antibody-liposome complex were stochastic. We demonstrated that liposomal mobility increased when bacteria were attached, and the propulsion speed correlated with the number of bacteria.

Zhang, Zhenhai; Li, Zhifei; Yu, Wei; Li, Kejie; Xie, Zhihong; Shi, Zhiguo

2013-05-01

27

The antimony(III)-bridged heteropolyanion sandwich dimers [Sb(II3(A-?-XW9O34)2]11- (X = SiIV, GeIV and C-shaped double-sandwich [SbIII6O2(PW6O26)(A-?-PW9O34)2]15-.  

PubMed

Interaction of potassium antimony(iii) tartrate hydrate K(2)(SbC(4)H(2)O(6))(2)·3H(2)O with the trilacunary Keggin derivatives [A-?-XW(9)O(34)](10-) (X = Si(IV), Ge(IV)) and [A-?-PW(9)O(34)](9-) in aqueous acidic medium (pH 4.8) resulted in three novel polyanions, [Sb(3)(A-?-XW(9)O(34))(2)](11-) (X = Si(IV) (1), Ge(IV) (2)) and [Sb(6)O(2)(A-PW(6)O(26))(A-?-PW(9)O(34))(2)](15-) (3), which were isolated as the hydrated potassium salts K(11)[Sb(3)(A-?-XW(9)O(34))(2)]·31H(2)O (X = Si(IV) (K-1), Ge(IV) (K-2)) and the mixed potassium-sodium salt K(14)Na[Sb(6)O(2)(A-PW(6)O(26))(A-?-PW(9)O(34))(2)]·61H(2)O (KNa-3) salts, respectively, and characterized by single-crystal X-ray diffraction, IR spectroscopy, as well as elemental and thermogravimetric analyses. The Sb(III)-containing polyanions 1-3 possess unique structural features, as they represent the first examples of sandwich-type POMs with trigonal-pyramidal Sb(III)O(3) linkers. The stability of 1-3 in aqueous media was investigated by multinuclear ((183)W, (31)P) NMR and UV-Vis spectroscopy. PMID:22543312

Assran, Awatef S; Izarova, Natalya V; Banerjee, Abhishek; Rabie, Usama M; Abou-El-Wafa, Moustafa H M; Kortz, Ulrich

2012-09-01

28

Liposome Technology for Industrial Purposes  

PubMed Central

Liposomes, spherical vesicles consisting of one or more phospholipid bilayers, were first described in the mid 60s by Bangham and coworkers. Since then, liposomes have made their way to the market. Today, numerous lab scale but only a few large-scale techniques are available. However, a lot of these methods have serious limitations in terms of entrapment of sensitive molecules due to their exposure to mechanical and/or chemical stress. This paper summarizes exclusively scalable techniques and focuses on strengths, respectively, limitations in respect to industrial applicability. An additional point of view was taken to regulatory requirements concerning liposomal drug formulations based on FDA and EMEA documents. PMID:21490754

Wagner, Andreas; Vorauer-Uhl, Karola

2011-01-01

29

Two-photon excitation of aluminium phthalocyanines  

SciTech Connect

A demonstration is given of the feasibility of two-photon excitation of aluminium phthalocyanine and of the pharmaceutical preparation 'Fotosens', used in photodynamic therapy. The excitation source was an Nd:YAG laser emitting at the 1064 nm wavelength. The spectra of the two-photon-excited luminescence were obtained and the two-photon absorption cross sections were determined. (lasers in medicine)

Meshalkin, Yu P; Alfimov, E E; Makukha, V K [Novosibirsk State Technical University, Novosibirsk (Russian Federation); Vasil'ev, N E; Denisov, A N; Ogirenko, A P [Siberian Laser Medicine Centre, Novosibirsk (Russian Federation)

1999-12-31

30

How to Stabilize Phospholipid Liposomes (Using Nanoparticles)  

E-print Network

How to Stabilize Phospholipid Liposomes (Using Nanoparticles) Liangfang Zhang and Steve Granick The simple strategy of mixing phospholipid liposomes with charged nanoparticles and using sonication to mix them at low volume fraction produces particle-stabilized liposomes that repel one another and do

Granick, Steve

31

Environment-Responsive Multifunctional Liposomes  

PubMed Central

Liposomal nanocarriers modified with cell-penetrating peptide and a pH-sensitive PEG shield demonstrate simultaneously a better systemic circulation and site-specific exposure of the cell-penetrating peptide. PEG chains were incorporated into the liposome membrane via the PEG-attached phosphatidylethanolamine (PE) residue with PEG and PE being conjugated with the lowered pH-degradable hydrazone bond (PEG-HZ-PE), while cell-penetrating peptide (TATp) was added as TATp-PEG-PE conjugate. Under normal conditions, liposome-grafted PEG “shielded” liposome-attached TATp moieties, since the PEG spacer for TATp attachment (PEG(1000)) was shorter than protective PEG(2000). PEGylated liposomes accumulate in targets via the EPR effect, but inside the “acidified” tumor or ischemic tissues lose their PEG coating because of the lowered pH-induced hydrolysis of HZ and penetrate inside cells via the now-exposed TATp moieties. pH-responsive behavior of these constructs is successfully tested in cell cultures in vitro as well as in tumors in experimental mice in vivo. These nanocarriers also showed enhanced pGFP transfection efficiency upon intratumoral administration in mice, compared to control pH nonsensitive counterpart. These results can be considered as an important step in the development of tumor-specific stimuli-sensitive drug and gene delivery systems. PMID:20072884

Kale, Amit A.; Torchilin, Vladimir P.

2012-01-01

32

Capabilities of liposomes for topological transformation.  

PubMed

Dynamic behaviors of liposomes caused by interactions between liposomal membranes and surfactant were studied by direct real-time observation by using high-intensity dark-field microscopy. Solubilization of liposomes by surfactants is thought to be a catastrophic event akin to the explosion of soap bubbles in the air; however, the actual process has not been clarified. We studied this process experimentally and found that liposomes exposed to various surfactants exhibited unusual behavior, namely continuous shrinkage accompanied by intermittent quakes, release of encapsulated liposomes, opening up, and inside-out topological inversion. PMID:11226241

Nomura, F; Nagata, M; Inaba, T; Hiramatsu, H; Hotani, H; Takiguchi, K

2001-02-27

33

Diffusion behaviour of charge carriers in thin films of phthalocyanines  

Microsoft Academic Search

Phthalocyanine (Pc) thin films were prepared by the vacuum-evaporating method. The diffusion behaviour of the charge carriers in these films was investigated by means of transient photovoltage (Dember effect) measurements. The experiments imply that the dominant charge carriers in phthalocyanines are electrons which diffuse from the surface closest to the light to the internal bulk. As a comparative system, photovoltic

He Tian; Kong-Chang Chen

1995-01-01

34

Liposomes as carriers of imaging agents  

SciTech Connect

This review discusses the utilization of liposomes as imaging agents or as vehicles for contrast materials. The initial approach was the use of radiolabeled liposomes for scintigraphy. To this end liposomes were either labeled in the lipid membrane or aqueous radiotracers were incorporated inside the lipid vesicles. The lipid labeling provides a more stable association of the radioactive tracer and the lipid vesicles, while the use of water-soluble radiotracers provides a wider selection of compounds. Early attempts at selective tumor imaging using radiolabeled liposomes were unsuccessful. The use of monoclonal antibodies attached to liposomes offers new hopes. Several strategies have been proposed in this respect and several others can be envisioned. The use of liposomes permits the use of several administration routes for imaging agents. Of particular interest is the subcutaneous administration for lymph node visualization. Liposomes offer clear advantages over most radiocontrast agents for prolonged hepatosplenic contrast enhancement. This is particularly relevant in the diagnostic evaluation of the abdomen with computed tomography. Important research efforts are being conducted in this area. Two different approaches have been advanced: the incorporation of contrast agents into liposomes and the preparation of radiopaque liposomes from radiodense lipids. Nuclear magnetic resonance imaging can also benefit from contrast agents. Several centers are investigating this exciting field using liposomes loaded with paramagnetic elements.152 references.

Caride, V.J.

1985-01-01

35

Effects of intraperitoneal administration of liposomes and methods of preparing liposomes for local therapy.  

PubMed

Many different methods of preparing liposomes exist, but the biological and physical properties of these preparations are not known. We therefore investigated the physical properties of liposomal doxorubicin (DOX) and found it to be most effective when administered intraperitoneally for carcinoma in the abdominal cavity. Liposomal DOX was prepared in three ways, by the Bangham method (BLDOX), pH gradient method, and gelation method. We investigated the physical properties of each preparation. And then we investigated the effects of the liposomes and liposomal lipids on the uptake of DOX by carcinoma cells in vitro and on the survival of Ehrlich ascites carcinoma-bearing mice in vivo. The uptake of DOX by the cells differed significantly with each liposome in vitro. The physical properties of the liposomes, including liposomal membrane lipids, size, zeta potentials and fluidity of liposomal membrane, were not so different, but the leak level of entrapped DOX from the liposomes was. Furthermore, the survival of ascites tumor-bearing mice also differed with each liposome preparation, DMPC containing BLDOX being the most effective when administered intraperitoneally. The method of preparation is an important factor affecting the properties of liposomes, and for local therapy, DMPC containing BLDOX is most effective because of its leaky property. PMID:11751012

Sadzuka, Yasuyuki; Hirama, Rieko; Sonobe, Takashi

2002-01-25

36

Allergic reaction to the liposomal component of liposomal amphotericin B  

Microsoft Academic Search

A case of severe allergic reaction arising during treatment with Ambisome and unresponsive to antihistamine and steroid medication\\u000a is reported. A 2.9-year-old female child with Hurler's syndrome received an allogeneic cord blood transplant from an unrelated\\u000a donor. During the aplastic phase, liposomal amphotericin B (Ambisome) was administered as part of an empirical treatment for\\u000a persistent fever. The patient developed an

S. Cesaro; Elisabetta Calore; Chiara Messina; Luigi Zanesco

1999-01-01

37

Liposome drug delivery system for murine neuroblastoma  

Microsoft Academic Search

Purpose: The effects of liposome-infused doxorubicin on C-1300 murine neuroblastoma were studied. The liposome surface was covered with polyethylene glycol to avoid migration toward the reticuloendothelial system and to prolong its presence in the bloodstream. Liposome-infused doxorubicin hydrochloride (DXR), an anthracycline was used as an anticancer antibiotic substance.Methods: Each AJ mouse was transplanted with 1 × 105 C-1300 murine neuroblastoma

Itsuro Nagae; Yasuhisa Koyanagi; Shinichi Ito; Yoshihide Tanabe; Sakae Unezaki

1998-01-01

38

Liposomal tretinoin for uncomplicated acne vulgaris  

Microsoft Academic Search

Frequently occurring skin irritancy and flare-up reactions impede the use of topical tretinoin for acne vulgaris due to poor patient compliance. Liposome encapsulation improves penetration into the skin and local tolerability in animals. We investigated efficacy and local tolerability of liposomal tretinoin in man. In a double-blind study 20 patients with uncomplicated acne vulgaris received liposomal tretinoin (0.01 %) on

M. Schfifer-Korting; H. C. Korting; E. Ponce-Pöschl

1994-01-01

39

Tumor targeting using liposomal antineoplastic drugs  

PubMed Central

During the last years, liposomes (microparticulate phospholipid vesicles) have been used with growing success as pharmaceutical carriers for antineoplastic drugs. Fields of application include lipid-based formulations to enhance the solubility of poorly soluble antitumor drugs, the use of pegylated liposomes for passive targeting of solid tumors as well as vector-conjugated liposomal carriers for active targeting of tumor tissue. Such formulation and drug targeting strategies enhance the effectiveness of anticancer chemotherapy and reduce at the same time the risk of toxic side-effects. The present article reviews the principles of different liposomal technologies and discusses current trends in this field of research. PMID:18488413

Huwyler, Jorg; Drewe, Jurgen; Krahenbuhl, Stephan

2008-01-01

40

Syntheses of Octasubstituted Metal Phthalocyanines for Nonlinear Optics  

NASA Technical Reports Server (NTRS)

Many organic materials can be used as nonlinear optical media. Phthalocyanines are of special interest because they show an unusually large third order nonlinear response, they are thermally and photochemically stable and they can be formed into oriented thin films (Langmuir-Blodgett films). They also can be easily complexed by a large variety of metals, which place them at the interface between organics and organometallics, and allows for fine tuning of the macro cycle electronic properties by the coordinated metal and substituent groups. A series of 1,4,8,11,15,18,22,25-octaalkoxy metal-free and metal phthalocyanines and 2,3,9,10,16,17,23,24-octaalkoxy metal phthalocyanines has been synthesized. Their nonlinear optical properties have been measured. The physical properties of all the phthalocyanines synthesized in this work are subject to both acid and solvent effects.

Guo, Huaisong; Townsend, Cheryl; Sanghadasa, Mohan; Amai, Robert L. S.; Clark, Ronald D.; Penn, Benjamin

1998-01-01

41

Uranyl phthalocyanines show promise in the treatment of brain tumors  

NASA Technical Reports Server (NTRS)

Processes synthesize sulfonated and nonsulfonated uranyl phthalocyanines for application in neutron therapy of brain tumors. Tests indicate that the compounds are advantageous over the previously used boron and lithium compounds.

Frigerio, N. A.

1967-01-01

42

Electronic structure and bonding in metal phthalocyanines, Metal=Fe, Co, Ni, Cu, Zn, Mg  

NASA Astrophysics Data System (ADS)

Electronic structure and bonding in metal phthalocyanines (Metal=Fe, Co, Ni, Cu, Zn, Mg) is investigated in detail using a density functional method. The metal atoms are strongly bound to the phthalocyanine ring in each case, by as much as 10 eV. The calculated orbital energy levels and relative total energies of these D4h structures indicate that Fe and Co phthalocyanines have 3A2g and 2Eg ground states, respectively, but that these states are changed upon interaction with strong-field axial ligands. The valence electronic structures of Fe and Co phthalocyanines differ significantly from those of the others. The HOMOs in Fe, Co, and Cu phthalocyanine are metal 3d-like, whereas in Ni and Zn phthalocyanines, the HOMO is localized on the phthalocyanine ring. The first ionization removes an electron from the phthalocyanine a1u orbital in all cases, with very little sensitivity of the ionization energy to the identity of the metal. Whereas the first reduction in Fe and Co phthalocyanine occurs at the metal, it is the phthalocyanine that is reduced upon addition of an electron to the other systems. Fe, Ni, and Cu phthalocyanines have smaller HOMO-LUMO separations than do Zn and Co phthalocyanine. There is very little variation in atomic charges within the phthalocyanine from one metal to the next.

Liao, Meng-Sheng; Scheiner, Steve

2001-06-01

43

Serum albumin as a vehicle for zinc phthalocyanine: photodynamic activities in solid tumour models.  

PubMed Central

Zinc phthalocyanine (ZnPc) is a second-generation photosensitiser for the photodynamic therapy (PDT) of cancer. Unsubstituted ZnPc is, however, highly insoluble in most common solvents, and for clinical applications the material needs to be incorporated in liposomes. We report a simple, alternative procedure to formulate ZnPc through non-covalent binding to bovine serum albumin (BSA). Intravenous administration of ZnPc-BSA preparations, at a molar ratio of 11:1 and at a ZnPc dose equivalent to 0.5 mol kg-1, to tumour-bearing mice followed 24 h later by PDT was shown to provide tumour control in two different models, the EMT-6 tumour in Balb/c mice and the human colon T380 carcinoma in nude mice. Analysis of serum fractions from treated animals showed that ZnPc readily redistributes over the serum high-density lipoprotein (HDL) fraction. We also demonstrated the absence of hepatic toxicity of the ZnPc-BSA preparation by monitoring the hepatic cytochrome P450 activity in treated animals and the viability of human cultured hepatocytes. PMID:8980386

Larroque, C.; Pelegrin, A.; Van Lier, J. E.

1996-01-01

44

An approach to conductometric immunosensor based on phthalocyanine thin film  

Microsoft Academic Search

A new approach to conductometric biosensors utilizing iodine-sensitive phthalocyanine thin films has been proposed. The excellent sensitivity of the tetra-tert-butyl copper phthalocyanine (ttb-CuPc) to free iodine was used for the first time to detect a peroxidase-initiated reaction in an aqueous medium. To minimize the interfering effect of aqueous electrolytes on the impedance responses of the ttb-CuPc film itself, Au\\/Cr interdigitated

T. A. Sergeyeva; N. V. Lavrik; A. E. Rachkov; Z. I. Kazantseva; A. V. El'skaya

1998-01-01

45

Modelling copper-phthalocyanine/cobalt-phthalocyanine chains: towards magnetic quantum metamaterials.  

PubMed

The magnetic properties of a theoretically designed molecular chain structure CuCoPc2, in which copper-phthalocyanine (CuPc) and cobalt-phthalocyanine (CoPc) alternate, have been investigated across a range of chain structures. The computed exchange interaction for the ?-phase CuCoPc2 is ? 5 K (ferromagnetic), in strong contrast to the anti-ferromagnetic interaction recently observed in CuPc and CoPc. The computed exchange interactions are strongly dependent on the stacking angle but weakly on the sliding angle, and peak at 20 K (ferromagnetic). These ferromagnetic interactions are expected to arise from direct exchange with the strong suppression of super-exchange interaction. These first-principles calculations show that ?-conjugated molecules, such as phthalocyanine, could be used as building blocks for the design of magnetic materials. This therefore extends the concept of quantum metamaterials further into magnetism. The resulting new magnetic materials could find applications in the studies such as organic spintronics. PMID:24990182

Wu, Wei

2014-07-23

46

Liposomes et peau : passé, présent, futur  

Microsoft Academic Search

Among various approaches to intra- and percutaneous administration of drugs, e.g. application of patches, ointments, iontophoresis, electroporation, the use of lipid vesicles like liposomes and niosomes presents numerous advantages. They are not toxic or invasive, may deliver hydrophobic and\\/or hydrophilic molecules, and the size of the transported molecule is not a limiting factor. Liposomes are obtained with natural amphiphilic lipids

G Redziniak

2003-01-01

47

Recent advances with liposomes as pharmaceutical carriers  

Microsoft Academic Search

Liposomes — microscopic phospholipid bubbles with a bilayered membrane structure — have received a lot of attention during the past 30 years as pharmaceutical carriers of great potential. More recently, many new developments have been seen in the area of liposomal drugs — from clinically approved products to new experimental applications, with gene delivery and cancer therapy still being the

Vladimir P. Torchilin

2005-01-01

48

Liposomal Nanocapsules in Food Science and Agriculture  

Microsoft Academic Search

Liposomes, spherical bilayer vesicles from dispersion of polar lipids in aqueous solvents, have been widely studied for their ability to act as drug delivery vehicles by shielding reactive or sensitive compounds prior to release. Liposome entrapment has been shown to stabilize encapsulated, bioactive materials against a range of environmental and chemical changes, including enzymatic and chemical modification, as well as

T. Matthew Taylor; Jochen Weiss; P. Michael Davidson; Barry D. Bruce

2005-01-01

49

Methods for using redox liposome biosensors  

DOEpatents

The present invention provides methods and compositions for detecting the presence of biologically-important analytes by using redox liposome biosensors. In particular, the present invention provides liposome/sol-gel electrodes suitable for the detection of a wide variety of organic molecules, including but not limited to bacterial toxins.

Cheng, Quan (SF, CA); Stevens, Raymond C. (La Jolla, CA)

2002-01-01

50

Supporting Information Synthesis of Platinum Nanocages using Liposomes  

E-print Network

1 Supporting Information Synthesis of Platinum Nanocages using Liposomes Containing PhotocatalystOEP was obtained from Porphyrin Products (Logan, UT) and used without further purification. Liposome preparation of AA (150 mM) for one hour at 65°C to form multilamellar liposomes. The multilamellar liposomes were

Shelnutt, John A.

51

Electrostatically driven complexation of liposomes with a star-shaped polyelectrolyte to low-toxicity multi-liposomal assemblies.  

PubMed

Anionic liposomes are electrostatically complexed to a star-shaped cationic polyelectrolyte. Upon complexation, the liposomes retain their integrity and the resulting liposome-star complexes do not dissociate in a physiological solution with 0.15?M NaCl. This provides a multi-liposomal container for possible use as a high-capacity carrier. PMID:24243764

Yaroslavov, Alexander A; Sybachin, Andrey V; Zaborova, Olga V; Pergushov, Dmitry V; Zezin, Alexander B; Melik-Nubarov, Nikolay S; Plamper, Felix A; Müller, Axel H E; Menger, Frederic M

2014-04-01

52

Synthesis of novel cationic amphiphilic phthalocyanine derivatives for next generation photosensitizer using photodynamic therapy of cancer  

Microsoft Academic Search

Phthalocyanine derivatives have attracted attention in the photodynamic therapy of cancer. The preparation of cationic amphiphilic zinc phthalocyanine derivatives is described. Novel amphiphilic non-peripheral substituted zinc phthalocyanine derivative is performed by quaternation. Amphiphilic zinc bis(1,4-didecylbenzo)-bis(3,4-pyrido)porphyrazine will be a useful photosensitizer for photodynamic therapy of cancer.

Keiichi Sakamoto; Taku Kato; Eiko Ohno-Okumura; Masaki Watanabe; Michael J. Cook

2005-01-01

53

Unilamellar liposomes with enhanced boron content.  

PubMed

A new type of boron-rich, DSPC-free, unilamellar liposomes was formed using the novel dual-chain, ionic, nido-carborane lipid, K[nido-7-(C16H33OCH2)2CHOCH2-7,8-C2B9H11] (DAC-16), and cholesterol for encapsulation of an aqueous buffer core. Since DSPC was not necessary for the formation of stable DAC-16 liposomes, the boron concentration of these vesicles was increased dramatically to approximately 8.8 wt % in the dry lipid; these liposomes had a high bilayer boron incorporation efficiency of 98%. DSPC-free liposomes exhibited a size distribution pattern of 40-60 nm, which was in the range normally associated with selective tumor uptake. This size distribution was maintained throughout storage at room temperature for several months. Additionally, optimized liposome formulations incorporating DAC-16, DSPC, and cholesterol were identified having stable size distribution patterns after storage for more than two months at a variety of temperatures. Although animal studies indicate that DAC-16 liposomes are toxic, this new ionic nido-carborane lipid allows the formation of liposomes of high boron content for in vitro applications that require the delivery of large amounts of boron. PMID:16417247

Li, Tiejun; Hamdi, Julie; Hawthorne, M Frederick

2006-01-01

54

Topical and mucosal liposomes for vaccine delivery.  

PubMed

Mucosal (and in minor extent transcutanous) stimulation can induce local or distant mucosa secretory IgA. Liposomes and other vesicles as mucosal and transcutaneous adjuvants are attractive alternatives to parenteral vaccination. Liposomes can be massively produced under good manufacturing practices and stored for long periods, at high antigen/vesicle mass ratios. However, their uptake by antigen-presenting cells (APC) at the inductive sites remains as a major challenge. As neurotoxicity is a major concern in intranasal delivery, complexes between archaeosomes and calcium as well as cationic liposomes complexed with plasmids encoding for antigenic proteins could safely elicit secretory and systemic antigen-specific immune responses. Oral bilosomes generate intense immune responses that remain to be tested against challenge, but the admixing with toxins or derivatives is mandatory to reduce the amount of antigen. Most of the current experimental designs, however, underestimate the mucus blanket 100- to 1000-fold thicker than a 100-nm diameter liposome, which has first to be penetrated to access the underlying M cells. Overall, designing mucoadhesive chemoenzymatic resistant liposomes, or selectively targeted to M cells, has produced less relevant results than tailoring the liposomes to make them mucus penetrating. Opposing, the nearly 10 µm thickness stratum corneum interposed between liposomes and underlying APC can be surpassed by ultradeformable liposomes (UDL), with lipid matrices that penetrate up to the limit with the viable epidermis. UDL made of phospholipids and detergents, proved to be better transfection agents than conventional liposomes and niosomes, without the toxicity of ethosomes, in the absence of classical immunomodulators. PMID:21360692

Romero, Eder Lilia; Morilla, Maria Jose

2011-01-01

55

Integrity of liposomes in presence of cyclodextrins: effect of liposome type and lipid composition.  

PubMed

Liposome stability during incubation in presence of cyclodextrins (CDs) is studied. Dried-rehydrated vesicle (DRV), multilamellar vesicle (MLV) and small unilamellar vesicle (SUV) calcein-encapsulating liposomes, composed of different lipids are formulated, and retention of calcein is followed during vesicle incubation in hydroxypropyl-beta-CD (HP beta-CD), HP gamma-CD or methyl-beta-CD (Me beta-CD), for 24h. Results demonstrate that liposome integrity in cyclodextrins is affected by lipid composition and type. For the same lipid composition calcein release from vesicles is faster in the order: MLV > DRV > SUV. Me beta-CD influences liposome stability most, compared to the other CD's studied. Vesicles composed of saturated phospholipids were found more stable compared to phosphatidyl-choline (PC) liposomes, suggesting that phospholipid saturation and membrane rigidity influences the interaction between liposomal-lipids and CD molecules. Chol (cholesterol) addition in lipid membrane improves PC-liposome integrity, but has opposite or no effect on liposomes consisting of saturated lipids. Decrease of vesicle dispersion turbidity and size distribution in presence of CD, implies that Me beta-CD induces vesicle disruption and solubilization (to micelles). Turbidity measurements confirm that DRV liposomes are affected more than SUV. PMID:17101248

Hatzi, Panayiota; Mourtas, Spyridon; Klepetsanis, Pavlos G; Antimisiaris, Sophia G

2007-03-21

56

Detection of liposomes in portal blood following oral administration  

SciTech Connect

125Iodine-labeled human immunoglobulin G-encapsulated dipalmitoyl phosphatidylcholine liposomes were prepared with or without asialoganglioside. Distribution of radioactivity following the oral administration of these liposomes in rats was checked in liver and in blood of the portal vein and heart. Gel filtration of plasma from the portal vein showed the presence of intact liposomes and protein. In contrast, neither liposomes nor protein were detected in cardiac blood but only lower molecular weight materials. The presence of liposomes in portal blood was further suggested from experiments using 6-carboxyfluorescein-entrapped liposomes. The level of liposomes in portal venous blood plasma was found to be lower in asialoganglioside liposomes. But this level could be increased substantially, almost to that in liposomes without asialoganglioside, by injection (iv) of asialofetuin.

Das, N.; Das, M.K.; Bachhawat, B.K.

1984-10-01

57

The buckling of spherical liposomes.  

PubMed

In the classical "first approximation" theory of thin-shell structures, the constitutive relations for a generic shell element--i.e. the elastic relations between the bending moments and membrane stresses and the corresponding changes in curvature and strain, respectively-are written as if an element of the shell is flat, although in reality it is curved. In this theory it is believed that discrepancies on account of the use of "flat" constitutive relations will be negligible provided the ratio shell-radius/thickness is of sufficiently large order. In the study of drawing of narrow, cylindrical "tethers" from liposomes it has been known for many years that it is necessary to use instead a constitutive law which explicitly describes a curved element in order to make sense of the mechanics; and indeed such tethers are generally of "thick-walled" proportions. In this paper we show that the proper constitutive relations for a curved element must also be used in the study, by means of shell equations, of the buckling of initially spherical thin-walled giant liposomes under exterior pressure: these involve the inclusion of what we call the "Mkappa" terms, which are not present in the standard "first-approximation" theory. We obtain analytical expressions for both the bifurcation buckling pressure and the slope of the post-buckling path, in terms of the dimensions and elastic constants of the lipid bi-layer, and also the initial state of bending moment in the vesicle. We explain physically how the initial bending moment can affect the bifurcation pressure, whereas it cannot in "first-approximation" theory. We use these results to map the conditions under which the vesicle buckles into an oblate, as distinct from a prolate ("rugby-ball") shape. Some of our results were obtained long ago by the use of energy methods; but our aim here has been to identify precisely what is lacking in "first-approximation" theory in relation to liposomes, and so to put the "shell equations" approach onto a firm footing in mechanics. PMID:16502648

Pamplona, D C; Greenwood, J A; Calladine, C R

2005-12-01

58

Pegylated liposomal doxorubicin in ovarian cancer  

PubMed Central

The encapsulation of doxorubicin in a pegylated liposomal matrix led to a reformulated agent with a different toxicity profile and improved clinical utility. Liposomal doxorubicin is devoid of the cardiac toxicity associated with doxorubicin, but is associated with predictable muco-cutaneous toxicity. The liposomal formulation leads to improved delivery to the target tumor tissue, allowing enhanced uptake by cancer cells. These properties translate into clinical utility in recurrent ovarian cancer as demonstrated by phase II and III trials, this proven clinical efficacy leading to FDA approval in second-line therapy for ovarian cancer. New combinations with cytotoxics, in particular with carboplatin, have demonstrated an acceptable toxicity profile and clinical utility in platinum-sensitive ovarian cancer. A favorable toxicity profile renders liposomal doxorubicin an ideal partner for combination regimens with other cytotoxics, and more recently with biological agents. Such combinations are the subject of ongoing clinical trials. PMID:19707541

Strother, Robert; Matei, Daniela

2009-01-01

59

Liposomal anticancer therapy: pharmacokinetic and clinical aspects.  

PubMed

Liposomes, which are vesicles composed of a phospholipid bilayer surrounding an aqueous milieu, represent a new strategy for anticancer drug delivery. Extravasation and accumulation of liposomal drugs within neoplastic tissues are possible because of the leaky vasculature and scarce lymphatic vessels of tumours (the enhanced permeability and retention effect). Furthermore, liposomal chemotherapeutic agents display distinctive pharmacokinetic characteristics, because they possess longer elimination half-lives, reduced clearance and smaller volume of distribution with respect to corresponding free drugs. Taken together, these features lead to highest levels of cytotoxic agents in tumours, as demonstrated in preclinical models and clinical trials, whereas healthy tissues are spared from toxicity. In fact, liposomal drugs (i.e., doxorubicin), alone or in combination with other cytotoxic agents, lead to improved clinical effectiveness and ameliorated toxicity profile with respect to corresponding free drugs when they are used for the treatment of metastatic breast and ovarian cancers, and Kaposi's sarcoma. PMID:15688620

Di Paolo, A

2004-11-01

60

Allometric scaling of pegylated liposomal anticancer drugs  

Microsoft Academic Search

Pegylated liposomal formulations contain lipid conjugated to polyethylene glycol. The disposition of encapsulated drug is\\u000a dictated by the composition of the liposome, thus altering the pharmacokinetic (PK) profile of the drug. Allometric scaling\\u000a is based on a power-log relationship between body weight (W) and drug clearance (CL) among mammals and has been used to compare\\u000a the disposition of nonliposomal drugs

Whitney P. Caron; Harvey Clewell; Robert Dedrick; Ramesh K. Ramanathan; Whitney L. Davis; Ning Yu; Margaret Tonda; Jan H. Schellens; Jos H. Beijnen; William C. Zamboni

61

Multi-layered liposomes as optical resonators  

NASA Astrophysics Data System (ADS)

Multi-layered liposomes, comprising a concentric series of lipid bilayers - separated at fixed distances and compartmentalizing aqueous solutions of alternating refractive indices - are proposed as optical Bragg resonators. Seminal work focuses on the feasibility of successive encapsulations coupled with size-control via extrusion. Synthesis criteria for realization of these liposomes were subsequently discussed based on experimental observations. Numerical studies of the proposed structure showed discernible band gaps, qualifying their potential application in biological lasing.

Yong, Derrick; Ng, Wei Long; Lee, Elizabeth; Yu, Xia; Bosman, Michel; Chan, Chi Chiu

62

Liposomal Formulation of Amphiphilic Fullerene Antioxidants  

PubMed Central

Novel amphiphilic fullerene[70] derivatives that are rationally designed to intercalate in lipid bilayers are reported, as well as its vesicular formulation with surprisingly high loading capacity up to 65% by weight. The amphiphilic C70 bisadduct forms uniform and dimensionally stable liposomes with auxiliary natural phospholipids as demonstrated by buoyant density test, particle size distribution and 31P NMR. The antioxidant property of fullerenes is retained in the bipolarly functionalized C70 derivative, Amphiphilic Liposomal Malonylfullerene[70] (ALM) as well as in its liposomal formulations, as shown by both electron paramagnetic resonance (EPR) studies and in vitro reactive oxygen species (ROS) inhibition experiments. The liposomally formulated ALM efficiently quenched hydroxyl radicals and superoxide radicals. In addition, the fullerene liposome inhibited radical-induced lipid peroxidation and maintained the integrity of the lipid bilayer structure. This new class of liposomally formulated, amphipathic fullerene compounds represents a novel drug delivery system for fullerenes and provides a promising pathway to treat oxidative stress-related diseases. PMID:20839887

Zhou, Zhiguo; Lenk, Robert P.; Dellinger, Anthony; Wilson, Stephen R.; Sadler, Robert; Kepley, Christopher L.

2010-01-01

63

In vitro cytotoxicity of liposome-encapsulated doxorubicin: dependence on liposome composition and drug release.  

PubMed

We have investigated the in vitro cytotoxicity of free doxorubicin (DOX) and liposome-entrapped DOX (L-DOX) against a human ovarian carcinoma cell line (OV-1063) using a colorimetric assay. DOX was encapsulated in the inner water phase of liposomes by an ammonium sulfate-generated proton gradient. Liposomes varied in phospholipid composition but were of a similar size. It was found that the cytotoxic activity of L-DOX is substantially decreased when liposomes containing phospholipids of high phase-transition temperature (Tm) are used. The type of negatively charged headgroup did not have any significant influence on the cytotoxicity observed. Experiments using resin beads that bind free and protein-bound DOX, but do not interact with L-DOX, indicated that the cytotoxic effect is mediated by the release of drug from the liposomes into the extracellular medium; no evidence was found for direct cellular uptake of liposome-encapsulated drug. The use of the ionophore nigericin to induce the release of DOX from high-Tm liposomes increased cytotoxicity to a level comparable to free DOX, suggesting that 'remote release' techniques may substantially improve the efficiency of liposome-mediated drug delivery and allow for the full exploitation of the favorable pharmacokinetic properties of specific high-Tm formulations. PMID:1520697

Horowitz, A T; Barenholz, Y; Gabizon, A A

1992-08-24

64

Density Functional Theory of Transition Metal Phthalocyanines  

NASA Astrophysics Data System (ADS)

Metal phthalocyanines (MPc's) are a family of highly stable molecules that, as a molecular solid, form organic semiconductors. They have been used in a broad range of applications, e.g., light emitting diodes, solar cells, gas sensors, thin film transistors, and even as single molecule devices. Here, we present a systematic density functional theory (DFT) study of the electronic structure of selected transition metal Pc's: CuPc, NiPc, CoPc, MnPc, and FePc. We critically assess the performance of several semi-local and hybrid exchange-correlation functionals for these systems, and compare the results to experimental photoemission data. For the low-spin systems CuPc, NiPc, and CoPc, we show that semi-local functionals fail qualitatively, primarily because of under- binding of localized orbitals due to self-interaction errors. For the intermediate-spin systems, MnPc and FePc, we show that DFT calculations are extremely sensitive to the choice of functional and basis set with respect to the obtained electronic configuration and to symmetry breaking. However, interestingly, all simulated spectra are in good agreement with experiment despite the differences in the underlying electronic configurations.

Marom, Noa; Kronik, Leeor

2009-03-01

65

Excited state dynamics of phthalocyanine films  

SciTech Connect

Femtosecond pump-probe transient absorption measurements were performed for thermally evaporated polycrystalline vanadyl and lead phthalocyanine (VOPc and PbPc) films in order to obtain information about the excitation energy migration and relaxation. The films were shown to be composed of phase II and amorphous material. Fast excitation localization in phase II was concluded from measurement and analysis of the ground and excited state spectra. Comparison of the ground state, difference absorption, and luminescence spectra suggests a small oscillator strength of the electronic transition from the lowest excited state to the ground state. The influence of local heating on the transient spectra is discussed, and the possibility to obtain the excitation decay kinetics free from this influence is proposed. Exciton-exciton annihilation with a time dependent rate (proportional to t{sup -0.5}) is observed in both films. This is explained by one-dimensional diffusion-limited annihilation. Linear relaxation times are equal to 28{+-}6 and 42{+-}8 ps and approximate intermolecular excitation hopping times of 0.1 divide 0.4 and 0.02 divide 0.08 ps were determined for VOPc and PbPc, respectively. 22 refs., 8 figs., 1 tab.

Gulbians, V.; Valkunas, L. [Vilnius Inst. of Physics (Lithuania)] [Vilnius Inst. of Physics (Lithuania); Chachisvillis, M.; Sundstrom, V. [Lund Univ. (Sweden)] [Lund Univ. (Sweden)

1996-02-08

66

Preparation of heterogeneous phthalocyanine catalysts by cotton fabric dyeing  

Microsoft Academic Search

Metal-free (2) and metallo-phthalocyanines (2a–d) bearing four thioglycolic acid groups on the periphery were prepared by cyclotetramerization of a new precursor, namely 4-(carboxymethylsulfanyl)phthalonitrile (1) in the presence of the corresponding divalent metal salts (Zn(II), Co(II), Ni(II), Cu(II)). The new compounds were characterized by elemental analyses, IR, UV–Vis, mass, 13C-NMR and 1H-NMR techniques. All these newly synthesized water-soluble metallo-phthalocyanine derivatives were

Altu? Mert Sevim; Cidal Ilgün; Ahmet Gül

2011-01-01

67

Entrapment of nucleic acids in liposomes.  

PubMed

The entrapment efficiency of three main methods used in the literature for the encapsulation of nucleic acids in liposomes were studied using 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) liposomes. In particular the reverse phase method, the dehydration/rehydration method, and the freeze/thawing method were compared to each other under standardised conditions, i.e. using in every case the same concentration of guest molecules (DNA, tRNA and ATP as low molecular weight analogue) and equally extruded liposomes. The percentage of entrapment strictly referred to the material localized inside the liposomes, i.e. particular care was devoted to ruling out the contribution of the nucleic acid material bound to the outer surface of the liposomes: this was eliminated by extensive enzymatic digestion prior to column chromatography. Depending on the conditions used, the percentage of the entrapped material varied between 10 and 54% of the initial amount. Further, the encapsulation efficiency was markedly affected by the salt concentration, by the size of liposomes, but to a lower degree by the molecular weight of the guest molecules. In general, we observed that the freeze/thawing encapsulation procedure was the most efficient one. In a second part of the work the freeze/thawing method was applied to encapsulate DNA (369 bp and 3368 bp, respectively) using liposomes obtained from POPC mixed with 1-10% charged cosurfactant, i.e. phosphatidylserine (PS) or didodecyldimethylammonium bromide (DDAB), respectively. Whereas PS had no significant effect, the entrapment efficiency went up to 60% in POPC/DDAB (97.5:2.5) liposomes. The large entrapment efficiency of DNA permits spectroscopic investigations of the DNA encapsulated in the water pool of the liposomes. UV absorption and circular dichroism spectra were practically the same as in water, indicating no appreciable perturbation of the electronic transitions or of the conformation of the entrapped biopolymer. This was in contrast to the DNA bound externally to the POPC/DDAB liposomes which showed significant spectral changes with respect to DNA dissolved in water. PMID:9370243

Monnard, P A; Oberholzer, T; Luisi, P

1997-10-01

68

Glycosylated nucleoside lipid promotes the liposome internalization in stem cells.  

PubMed

We report new glycosyl-nucleoside-lipid based liposomes decorated with sugar moieties. The GNL-liposomes feature a suitable glycosylated surface for their internalization into ADSC stem cells. PMID:21966673

Latxague, Laurent; Ziane, Sophia; Chassande, Olivier; Patwa, Amit; Dalila, Marie-José; Barthélémy, Philippe

2011-12-21

69

Encapsulated liposomes for long-term drug delivery  

NSDL National Science Digital Library

Solve the steady-state radial diffusion equation in a sphere to calculate the resistance to drug diffusion through a liposome encapsulant; then compare to resistance to transport through the liposome membrane and determine the limiting step.

Powell, Adam C., IV

2004-08-11

70

Immunogenicity of Liposomal Malaria Sporozoite Antigen in Monkeys: Adjuvant Effects of Aluminum Hydroxide and Non-Pyrogenic Liposomal Lipid A.  

National Technical Information Service (NTIS)

The immunogenicity of a recombinant protein containing sequences from the tetrapeptide repeat region of the circumsporozoite protein of Plasmodium falciparum was enhanced by encapsulation in liposomes containing lipid A and adsorption of the liposomes wit...

R. L. Richards, G. M. Swartz, C. Schultz, M. D. Hayre, G. S. Ward

1989-01-01

71

Silicon Phthalocyanine 4 Phototoxicity in Trichophyton rubrum  

PubMed Central

Trichophyton rubrum is the leading pathogen that causes long-lasting skin and nail dermatophyte infections. Currently, topical treatment consists of terbinafine for the skin and ciclopirox for the nails, whereas systemic agents, such as oral terbinafine and itraconazole, are also prescribed. These systemic drugs have severe side effects, including liver toxicity. Topical therapies, however, are sometimes ineffective. This led us to investigate alternative treatment options, such as photodynamic therapy (PDT). Although PDT is traditionally recognized as a therapeutic option for treating a wide range of medical conditions, including age-related macular degeneration and malignant cancers, its antimicrobial properties have also received considerable attention. However, the mechanism(s) underlying the susceptibility of dermatophytic fungi to PDT is relatively unknown. As a noninvasive treatment, PDT uses a photosensitizing drug and light, which, in the presence of oxygen, results in cellular destruction. In this study, we investigated the mechanism of cytotoxicity of PDT in vitro using the silicon phthalocyanine (Pc) 4 [SiPc(OSi(CH3)2(CH2)3N(CH3)2)(OH)] in T. rubrum. Confocal microscopy revealed that Pc 4 binds to cytoplasmic organelles, and upon irradiation, reactive oxygen species (ROS) are generated. The impairment of fungal metabolic activities as measured by an XTT (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxyanilide inner salt) assay indicated that 1.0 ?M Pc 4 followed by 670 to 675 nm light at 2.0 J/cm2 reduced the overall cell survival rate, which was substantiated by a dry weight assay. In addition, we found that this therapeutic approach is effective against terbinafine-sensitive (24602) and terbinafine-resistant (MRL666) strains. These data suggest that Pc 4-PDT may have utility as a treatment for dermatophytosis. PMID:24614382

Lam, Minh; Dimaano, Matthew L.; Oyetakin-White, Patricia; Retuerto, Mauricio A.; Chandra, Jyotsna; Mukherjee, Pranab K.; Ghannoum, Mahmoud A.; Cooper, Kevin D.

2014-01-01

72

Advanced nanostructuring of metal phthalocyanines for organic photovoltaic devices  

Microsoft Academic Search

The field of organic photovoltaics (OPV) has benefited greatly from improved structuring of materials at the nanoscale. The ideal active layer morphology in these devices is an interpenetrating network of donor and acceptor materials with feature dimensions that match their short exciton diffusion lengths. Here we report on the optimization of metal phthalocyanine (MPc) nanorod arrays through the use of

J. G. Van Dijken; M. D. Fleischauer; M. J. Brett

2011-01-01

73

Mucosal immunoadjuvant activity of liposomes: role of alveolar macrophages.  

PubMed Central

Previously, we have reported on a liposomal adjuvant system for stimulation of both systemic IgG and mucosal s-IgA responses against viral antigens (influenza virus subunit antigen or whole inactivated measles virus) administered intranasally to mice. Immune stimulation is observed with negatively charged, but not with zwitterionic, liposomes and is independent of a physical association of the antigen with the liposomes. Furthermore, liposome-mediated immune stimulation requires deposition of the liposomes and the antigen in the lower respiratory tract. In the present study, it is shown that alveolar macrophages (AM) are the main target cells for negatively charged liposomes administered to the lungs of mice. AM isolated from animals, to which negatively charged liposomes were administered beforehand, showed large intracellular vacuoles, suggestive of massive liposome uptake. Under ex vivo conditions, both AM and RAW 264 cells exhibited a high capacity to take up negatively charged liposomes. The deposition of negatively charged liposomes, but not zwitterionic, liposomes in the lung reduced the phagocytic and migratory behaviour of AM, as assessed on the basis of transport of carbon particles to the draining lymph nodes of the lungs. Depletion of AM in vivo with dichloromethylene diphosphonate, facilitated an enhanced systemic and local antibody response against influenza subunit antigen deposited subsequently to the lower respiratory tract. In conclusion, these data provide support for the hypothesis that uptake of negatively charged liposomes blocks the immunosuppressive activity of AM, thereby facilitating local and systemic antibody responses. Images Figure 1 PMID:9014811

de Haan, A; Groen, G; Prop, J; van Rooijen, N; Wilschut, J

1996-01-01

74

Nanoengineered Structures for Holding and Manipulating Liposomes and Cells  

E-print Network

Nanoengineered Structures for Holding and Manipulating Liposomes and Cells Clyde F. Wilson, Garth J exceptional stability in capturing, transporting, and releasing single cells and liposomes 1-12 µm in diameter subsequently probed by laser-induced fluorescence (LIF). In the second study, a single liposome containing car

Zare, Richard N.

75

Surface Potential of Charged Liposomes Determined by Second Harmonic Generation  

E-print Network

Articles Surface Potential of Charged Liposomes Determined by Second Harmonic Generation Yan Liu that the surface potential of charged liposomes can be determined by second harmonic generation. The Gouy charge density and the surface potential of liposomes consisting of the negatively charged phospholipid

Eisenthal, Kenneth B.

76

The antimicrobial activity of liposomal lauric acids against Propionibacterium acnes  

E-print Network

The antimicrobial activity of liposomal lauric acids against Propionibacterium acnes Darren Yang a Liposome a b s t r a c t This study evaluated the antimicrobial activity of lauric acid (LA) and its liposomal derivatives against Propionibacterium acnes (P. acnes), the bacterium that promotes inflammatory

Zhang, Liangfang

77

Thermally Triggered Calcium Phosphate Formation from Calcium-Loaded Liposomes  

E-print Network

Thermally Triggered Calcium Phosphate Formation from Calcium-Loaded Liposomes Phillip B 15, 1997X A thermally triggered liposome-based mineralization system is described that is metastable liposome suspension whose bulk ionic concentration was highly supersaturated with respect to hydroxyapatite

78

Sterically Stabilized Liposomes: Improvements in Pharmacokinetics and Antitumor Therapeutic Efficacy  

Microsoft Academic Search

The results obtained in this study establish that liposome formulations incorporating a synthetic polyethylene glycol-derivatized phospholipid have a pronounced effect on liposome tissue distribution and can produce a large increase in the pharmacological efficacy of encapsulated antitumor drugs. This effect is substantially greater than that observed previously with conventional liposomes and is associated with a more than 5-fold prolongation of

D. Papahadjopoulos; T. M. Allen; A. Gabizon; E. Mayhew; K. Matthay; S. K. Huang; K.-D. Lee; M. C. Woodle; D. D. Lasic; C. Redemann; F. J. Martin

1991-01-01

79

Stimuli-Responsive Liposome Fusion Mediated by Gold Nanoparticles  

E-print Network

Stimuli-Responsive Liposome Fusion Mediated by Gold Nanoparticles Dissaya Pornpattananangkul,, Sage, and diagnostic and imaging agents.1 Liposomes can carry both hydro- philic and hydrophobic agents with high ef functionalized with specific ligands that target liposomes and their pay- loads to the sites of action

Zhang, Liangfang

80

Liposomal Encapsulated Rhodomyrtone: A Novel Antiacne Drug  

PubMed Central

Rhodomyrtone isolated from the leaves of Rhodomyrtus tomentosa possesses antibacterial, anti-inflammatory, and anti-oxidant activities. Since rhodomyrtone is insoluble in water, it is rather difficult to get to the target sites in human body. Liposome exhibited ability to entrap both hydrophilic and hydrophobic compounds and easily penetrate to the target site. The present study aimed to develop a novel liposomal encapsulated rhodomyrtone formulations. In addition, characterization of liposome, stability profiles, and their antiacne activity were performed. Three different formulations of total lipid concentrations 60, 80, and 100??mol/mL were used. Formulation with 60??mol/mL total lipid (phosphatidylcholine from soybean and cholesterol from lanolin in 4?:?1, w/w) exhibited the highest rhodomyrtone encapsulation efficacy (65.47 ± 1.7%), average particle size (209.56 ± 4.8?nm), and ?-potential (–41.19 ± 1.3?mV). All formulations demonstrated good stability when stored for 2 months in dark at 4°C as well as room temperature. Minimal inhibitory concentration and minimal bactericidal concentration values of liposomal formulation against 11 clinical bacterial isolates and reference strains ranged from 1 to 4 and from 4 to 64??g/mL, respectively, while those of rhodomyrtone were 0.25–1 and 0.5–2??g/mL, respectively. The MIC and MBC values of liposome formulation were more effective than topical drugs against Staphylococcus aureus and Staphylococcus epidermidis. PMID:23762104

Chorachoo, Julalak; Amnuaikit, Thanaporn; Voravuthikunchai, Supayang P.

2013-01-01

81

Treatment of Digital Ischemia with Liposomal Bupivacaine  

PubMed Central

Objective. This report describes a case in which the off-label use of liposomal bupivacaine (Exparel) in a peripheral nerve block resulted in marked improvement of a patient's vasoocclusive symptoms. The vasodilating and analgesic properties of liposomal bupivacaine in patients with ischemic symptoms are unknown, but our clinical experience suggests a role in the management of patients suffering from vasoocclusive disease. Case Report. A 45-year-old African American female was admitted to the hospital with severe digital ischemic pain. She was not a candidate for any vascular surgical or procedural interventions. Two continuous supraclavicular nerve blocks were placed with modest clinical improvement. These effects were also short-lived, with the benefits resolving after the discontinuation of the peripheral nerve blocks. She continued to report severe pain and was on multiple anticoagulant medications, so a decision was made to perform an axillary nerve block using liposomal bupivacaine (Exparel) given the compressibility of the site as well as the superficial nature of the target structures. Conclusions. This case report describes the successful off-label usage of liposomal bupivacaine (Exparel) in a patient with digital ischemia. Liposomal bupivacaine (Exparel) is currently FDA approved only for wound infiltration use at this time. PMID:24653844

Raul Soberón, José; Duncan, Scott F.; Sternbergh, W. Charles

2014-01-01

82

Treatment of digital ischemia with liposomal bupivacaine.  

PubMed

Objective. This report describes a case in which the off-label use of liposomal bupivacaine (Exparel) in a peripheral nerve block resulted in marked improvement of a patient's vasoocclusive symptoms. The vasodilating and analgesic properties of liposomal bupivacaine in patients with ischemic symptoms are unknown, but our clinical experience suggests a role in the management of patients suffering from vasoocclusive disease. Case Report. A 45-year-old African American female was admitted to the hospital with severe digital ischemic pain. She was not a candidate for any vascular surgical or procedural interventions. Two continuous supraclavicular nerve blocks were placed with modest clinical improvement. These effects were also short-lived, with the benefits resolving after the discontinuation of the peripheral nerve blocks. She continued to report severe pain and was on multiple anticoagulant medications, so a decision was made to perform an axillary nerve block using liposomal bupivacaine (Exparel) given the compressibility of the site as well as the superficial nature of the target structures. Conclusions. This case report describes the successful off-label usage of liposomal bupivacaine (Exparel) in a patient with digital ischemia. Liposomal bupivacaine (Exparel) is currently FDA approved only for wound infiltration use at this time. PMID:24653844

Raul Soberón, José; Duncan, Scott F; Sternbergh, W Charles

2014-01-01

83

Remotely controlled diffusion from magnetic liposome microgels.  

PubMed

The reversible, temperature-dependent change in the permeability of a phospholipid bilayer has been used for controlling the diffusion rate of encapsulated molecular payload from liposomes. Liposomes were preloaded with a fluorescent dye and immobilized in calcium alginate hydrogel microparticles that also contained iron oxide nanoparticles. The composite microparticles were produced by a drop-on-demand inkjet method. The ability of iron oxide nanoparticles to locally dissipate heat upon exposure to a radio-frequency (RF) alternating magnetic field was used to control the local temperature and therefore diffusion from the liposomes in a contactless way using an RF coil. Several different release patterns were realized, including repeated on-demand release. The internal structure of the composite alginate-liposome-magnetite microparticles was investigated, and the influence of microparticle concentration on the heating rate was determined. In order to achieve a temperature rise required for the liposome membrane melting, the concentration of alginate beads should be at least 25% of their maximum packing density for the nanoparticle concentration and specific absorption rate used. PMID:23461732

Hanuš, Jaroslav; Ullrich, Martin; Dohnal, Ji?í; Singh, Mandeep; St?pánek, František

2013-04-01

84

Fluorescence Resonance Energy Transfer in Polydiacetylene Liposomes  

PubMed Central

Conjugated polydiacetylene (PDA) possessing stimuli-responsive properties has been intensively investigated for developing efficient sensors. We report here fluorescence resonance energy transfer (FRET) in liposomes synthesized using different molar ratios of dansyl-tagged diacetylene and diacetylene–carboxylic acid monomers. Photopolymerization of diacetylene resulted in cross-linked PDA liposomes. We used steady-state electronic absorption, emission, and fluorescence anisotropy (FA) analysis to characterize the thermal-induced FRET between dansyl fluorophores (donor) and PDA (acceptor). We found that the monomer ratio of acceptor to donor (Rad) and length of linkers (functional part that connects dansyl fluorophores to the diacetylene group in the monomer) strongly affected FRET. For Rad = 10 000, the acceptor emission intensity was amplified by more than 18 times when the liposome solution was heated from 298 to 338 K. A decrease in Rad resulted in diminished acceptor emission amplification. This was primarily attributed to lower FRET efficiency between donors and acceptors and a higher background signal. We also found that the FRET amplification of PDA emissions after heating the solution was much higher when dansyl was linked to diacetylene through longer and flexible linkers than through shorter linkers. We attributed this to insertion of dansyl in the bilayer of the liposomes, which led to an increased dansyl quantum yield and a higher interaction of multiple acceptors with limited available donors. This was not the case for shorter and more rigid linkers where PDA amplification was much smaller. The present studies aim at enhancing our understanding of FRET between fluorophores and PDA-based conjugated liposomes. Furthermore, receptor tagged onto PDA liposomes can interact with ligands present on proteins, enzymes, and cells, which will produce emission sensing signal. Therefore, using the present approach, there exist opportunities for designing FRET-based highly sensitive and selective chemical and biochemical sensors. PMID:18816092

Li, Xuelian; Matthews, Shelton; Kohli, Punit

2009-01-01

85

Liposomal boron delivery for neutron capture therapy.  

PubMed

Tumor cell destruction in boron neutron capture therapy (BNCT) is due to the nuclear reaction between (10)B and thermal neutrons. The thermal neutrons have an energy of 0.025 eV, clearly below the threshold energy required to ionize tissue components. However, neutron capture by (10)B produces lithium ion and helium (alpha-particles), which are high linear energy transfer (LET) particles, and dissipate their kinetic energy before traveling one cell diameter (5-9 microm) in biological tissues, ensuring their potential for precise cell killing. BNCT has been applied clinically for the treatment of malignant brain tumors, malignant melanoma, head and neck cancer, and hepatoma using two boron compounds: sodium borocaptate (Na(2)(10)B(12)H(11)SH; Na(2)(10)BSH) and l-p-boronophenylalanine (l-(10)BPA). These low molecular weight compounds are cleared easily from the cancer cells and blood. Therefore, high accumulation and selective delivery of boron compounds into tumor tissues are most important to achieve effective BNCT and to avoid damage of adjacent healthy cells. Much attention has been focused on the liposomal drug delivery system (DDS) as an attractive, intelligent technology of targeting and controlled release of (10)B compounds. Two approaches have been investigated for incorporation of (10)B into liposomes: (1) encapsulation of (10)B compounds into liposomes and (2) incorporation of (10)B-conjugated lipids into the liposomal bilayer. Our laboratory has developed boron ion cluster lipids for application of the latter approach. In this chapter, our boron lipid liposome approaches as well as recent developments of the liposomal boron delivery system are summarized. PMID:19913168

Nakamura, Hiroyuki

2009-01-01

86

Application of liposomes in drug development -- focus on gastroenterological targets  

PubMed Central

Over the past decade, liposomes became a focal point in developing drug delivery systems. New liposomes, with novel lipid molecules or conjugates, and new formulations opened possibilities for safely and efficiently treating many diseases including cancers. New types of liposomes can prolong circulation time or specifically deliver drugs to therapeutic targets. This article concentrates on current developments in liposome based drug delivery systems for treating diseases of the gastrointestinal tract. We will review different types and uses of liposomes in the development of therapeutics for gastrointestinal diseases including inflammatory bowel diseases and colorectal cancer. PMID:23630417

Zhang, Jian-Xin; Wang, Kun; Mao, Zheng-Fa; Fan, Xin; Jiang, De-Li; Chen, Min; Cui, Lei; Sun, Kang; Dang, Sheng-Chun

2013-01-01

87

[Hydrophobic modification of water soluble drug and its reconstitutable liposomes].  

PubMed

Water soluble drugs carried in liposomes have rather low encapsulation percentage (EP%) and poor stability. In this paper metronidazole (I) was chosen as a model of water soluble drugs which was modified by means of esterification. Its myristic ester (II) was synthesized. On studying the liposomes of I and II, the results have shown that EP% and stability of II were more than ten times as high as that of I. Furthermore, the reconstitutable liposomes of II were prepared successfully. The amoebacide activity of II liposomes was increased also. Therefore, the hydrophobic modification of water soluble drugs is a good way to improve the drug entrapped in liposomes. PMID:2099094

Hou, X P; Cui, D H; Yi, Y Y; Li, X Y; Yang, L P

1990-01-01

88

Recent Trends of Polymer Mediated Liposomal Gene Delivery System  

PubMed Central

Advancement in the gene delivery system have resulted in clinical successes in gene therapy for patients with several genetic diseases, such as immunodeficiency diseases, X-linked adrenoleukodystrophy (X-ALD) blindness, thalassemia, and many more. Among various delivery systems, liposomal mediated gene delivery route is offering great promises for gene therapy. This review is an attempt to depict a portrait about the polymer based liposomal gene delivery systems and their future applications. Herein, we have discussed in detail the characteristics of liposome, importance of polymer for liposome formulation, gene delivery, and future direction of liposome based gene delivery as a whole. PMID:25250340

Lee, Sang-Soo; George Priya Doss, C.; Yagihara, Shin; Kim, Do-Young

2014-01-01

89

Microfluidic-Enabled Liposomes Elucidate Size-Dependent Transdermal Transport  

PubMed Central

Microfluidic synthesis of small and nearly-monodisperse liposomes is used to investigate the size-dependent passive transdermal transport of nanoscale lipid vesicles. While large liposomes with diameters above 105 nm are found to be excluded from deeper skin layers past the stratum corneum, the primary barrier to nanoparticle transport, liposomes with mean diameters between 31–41 nm exhibit significantly enhanced penetration. Furthermore, multicolor fluorescence imaging reveals that the smaller liposomes pass rapidly through the stratum corneum without vesicle rupture. These findings reveal that nanoscale liposomes with well-controlled size and minimal size variance are excellent vehicles for transdermal delivery of functional nanoparticle drugs. PMID:24658111

Junqueira, Mariana; Vreeland, Wyatt N.; Quezado, Zenaide; Finkel, Julia C.; DeVoe, Don L.

2014-01-01

90

Microfluidic-enabled liposomes elucidate size-dependent transdermal transport.  

PubMed

Microfluidic synthesis of small and nearly-monodisperse liposomes is used to investigate the size-dependent passive transdermal transport of nanoscale lipid vesicles. While large liposomes with diameters above 105 nm are found to be excluded from deeper skin layers past the stratum corneum, the primary barrier to nanoparticle transport, liposomes with mean diameters between 31-41 nm exhibit significantly enhanced penetration. Furthermore, multicolor fluorescence imaging reveals that the smaller liposomes pass rapidly through the stratum corneum without vesicle rupture. These findings reveal that nanoscale liposomes with well-controlled size and minimal size variance are excellent vehicles for transdermal delivery of functional nanoparticle drugs. PMID:24658111

Hood, Renee R; Kendall, Eric L; Junqueira, Mariana; Vreeland, Wyatt N; Quezado, Zenaide; Finkel, Julia C; DeVoe, Don L

2014-01-01

91

Liposomes from hydrogenated soya lecithin formed in sintered glass pores.  

PubMed

Possible complete closure of hydrophilic drug solutions in liposomes with required dimensions is the aim of variety liposome techniques. The ease of separating medication-loaded liposomes from liposome suspension to achieve an appropriate drug concentration in the final preparation is also desired. This paper describes the use of liposome preparation method, called reverse-phase evaporation, which leads to practical achievement of the earlier mentioned objectives. Preparation process is performed in an appropriately designed device. In optimal conditions of liposome preparation the final encapsulation efficiency of hydrophilic drug solution amounted to 50% in liposomes with a diameter in the range of a few micrometers up to 250 nm. The diameter of terminal liposomes is a simple function of relative amount of the lipid used and the degree of emulsion emulsification w/o at the beginning of liposome preparation. The density of the concentrated drug solution trapped in liposomes is usually higher than that of the buffer. Therefore, the loaded liposomes may be easily separated from non-trapped material by using of a simple sedimentation at 30000 x g. Density of aqueous drug solution insufficient to effective centrifugation can be magnified with an appropriate quantity of sucrose solution before encapsulation. PMID:22574513

Zawada, Zygmunt H

2012-01-01

92

Overcoming cellular and tissue barriers to improve liposomal drug delivery  

NASA Astrophysics Data System (ADS)

Forty years of liposome research have demonstrated that the anti-tumor efficacy of liposomal therapies is, in part, driven by three parameters: 1) liposome formulation and lipid biophysics, 2) accumulation and distribution in the tumor, and 3) release of the payload at the site of interest. This thesis outlines three studies that improve on each of these delivery steps. In the first study, we engineer a novel class of zwitterlipids with an inverted headgroup architecture that have remarkable biophysical properties and may be useful for drug delivery applications. After intravenous administration, liposomes accumulate in the tumor by the enhanced permeability and retention effect. However, the tumor stroma often limits liposome efficacy by preventing distribution into the tumor. In the second study, we demonstrate that depletion of hyaluronan in the tumor stroma improves the distribution and efficacy of DoxilRTM in murine 4T1 tumors. Once a liposome has distributed to the therapeutic site, it must release its payload over the correct timescale. Few facile methods exist to quantify the release of liposome therapeutics in vivo. In the third study, we outline and validate a simple, robust, and quantitative method for tracking the rate and extent of release of liposome contents in vivo. This tool should facilitate a better understanding of the pharmacodynamics of liposome-encapsulated drugs in animals. This work highlights aspects of liposome behavior that have prevented successful clinical translation and proposes alternative approaches to improve liposome drug delivery.

Kohli, Aditya G.

93

Zinc oxide and metal phthalocyanine based hybrid P-N junction diodes  

NASA Astrophysics Data System (ADS)

Hybrid p-n junction diode based on zinc oxide (ZnO) and metal phthalocyanine (MePc) has been demonstrated using highly conducting Al doped ZnO as transparent electrode. Three different MePcs: copper phthalocyanine, zinc phthalocyanine (ZnPc), and cobalt phthalocyanine are used as p-type layer in hybrid p-n junction. It is found that most desirable performance can be achieved in ZnO/ZnPc based hybrid p-n junction. The depletion region in hybrid p-n junctions has been measured using current-voltage and capacitance-voltage characteristics.

Singh, Budhi; Ghosh, Subhasis

2013-09-01

94

Release profile of lidocaine HCl from topical liposomal gel formulation.  

PubMed

Liposomal hydrogel formulations of lidocaine HCl, suitable for topical application, have been prepared and drug release properties in vitro have been evaluated. Liposomes composed of Soya lechitin and cholesterol, with lidocaine HCl, entrapped in the inner water compartment, were prepared by simple hydration method. Topical liposomal gel formulations were prepared by incorporation of liposomes into a structured vehicle (hydrogels of Carbopol 940 in concentration of 1.5, 1.75 and 2%). High percentage of encapsulated drug in liposomes has been obtained (over 70%). Liposomal gel formulations provided prolonged drug release rate. The concentration of gelling agent in a range 1.5-2.0% affected the release rate slightly. In vitro release data showed that release kinetic can be described as diffusion-controlled, while liposomes act as reservoir systems for continuous delivery of drug. Proposed formulations provided stable percentage of entrapped drug and drug release within an examination period of 3 weeks. PMID:12176284

Glavas-Dodov, M; Goracinova, K; Mladenovska, K; Fredro-Kumbaradzi, E

2002-08-21

95

Liposomal membranes. XIV. Fusion of liposomal membranes induced by polyisoprenoids as monitored by fluorescence quenching method.  

PubMed

Fusion of the single-walled liposomes of egg phosphatidylcholine as induced by the polyisoprenoids such as solanesol, trans-ethyl decaprenoate (EDP), coenzyme Q10, and dolichol has been investigated adopting the fluorescence quenching method. Relative efficiency of the polyisoprenoids employed on the induced fusion of liposomes was a sequence of solanesol less than or equal to EDP much less than CoQ10, dolichol, which was consistent with the result previously obtained by the dye-release method. PMID:6627530

Sunamoto, J; Iwamoto, K; Tezuka, T; Kadosaki, K; Kondo, H

1983-08-01

96

Development of monodispersed and functional magnetic polymeric liposomes via simple liposome method  

Microsoft Academic Search

\\u000a Abstract  We are reporting a simple and rapid method to prepare superparamagnetic, controlled size, and monodispersed magnetic cationic\\u000a polymeric liposomes (MCPL) by octadecyl quaternized carboxymethyl chitosan (OQCMC) and cholesterol. The whole process is only\\u000a about 25 min with simple thin-film dispersion and solvent evaporation method. Hydrophilic magnetic nanoparticles (LM) and\\u000a hydrophobic magnetic nanoparticles (BM) can be encapsulated into these cationic polymeric liposomes,

Xiaofei Liang; Hanjie Wang; Xinguo Jiang; Jin Chang

2010-01-01

97

Innovative Liposomes as a Transfollicular Drug Delivery System: Penetration into Porcine Hair Follicles  

Microsoft Academic Search

Liposomes had been widely used for drug delivery in the past. In this study, five different liposomes were used as a follicular delivery system in pig ear skin. The liposomes mainly differed in their sphere diameter, lipid composition, and surface charge. A novel class of liposomes being amphoteric in their charge behavior are compared to established anionic and cationic liposomes.

Sascha Jung; Nina Otberg; Gisela Thiede; Heike Richter; Wolfram Sterry; Steffen Panzner; Jürgen Lademann

2006-01-01

98

Nanocomposite liposomes containing quantum dots and anticancer drugs for bioimaging and therapeutic delivery: a comparison of cationic, PEGylated and deformable liposomes  

NASA Astrophysics Data System (ADS)

Multifunctional liposomes loaded with quantum dots (QDs) and anticancer drugs were prepared for simultaneous bioimaging and drug delivery. Different formulations, including cationic, PEGylated and deformable liposomes, were compared for their theranostic efficiency. We had evaluated the physicochemical characteristics of these liposomes. The developed liposomes were examined using experimental platforms of cytotoxicity, cell migration, cellular uptake, in vivo melanoma imaging and drug accumulation in tumors. The average size of various nanocomposite liposomes was found to be 92-134 nm. Transmission electron microscopy confirmed the presence of QDs within liposomal bilayers. The incorporation of polyethylene glycol (PEG) and Span 20 into the liposomes greatly increased the fluidity of the bilayers. The liposomes provided sustained release of camptothecin and irinotecan. The cytotoxicity and cell migration assay demonstrated superior activity of cationic liposomes compared with other carriers. Cationic liposomes also showed a significant fluorescence signal in melanoma cells after internalization. The liposomes were intratumorally administered to a melanoma-bearing mouse. Cationic liposomes showed the brightest fluorescence in tumors, followed by classical liposomes. This signal could last for up to 24 h for cationic nanosystems. Intratumoral accumulation of camptothecin from free control was 35 nmol g-1 it could be increased to 50 nmol g-1 after loading with cationic liposomes. However, encapsulation of irinotecan into liposomes did not further increase intratumoral drug accumulation. Cationic liposomes were preferable to other liposomes as nanocarriers in both bioimaging and therapeutic approaches.

Wen, Chih-Jen; Sung, Calvin T.; Aljuffali, Ibrahim A.; Huang, Yu-Jie; Fang, Jia-You

2013-08-01

99

Effect of heat pretreatment on the electrical conductance of lead phthalocyanine films for NO 2 gas detection  

Microsoft Academic Search

The phthalocyanines are organic semiconductors which exhibit high chemical and thermal stability. Their semiconducting behaviour is p-type both in terms of the effects of common dopants and temperature. Phthalocyanines have been studied as prototype organic semiconductors and used as active elements in oxidizing gases [1-3]. Some work on a semiconductive gas sensor using phthalocyanines has been published recently [4, 5].

Y. Sadaoka; T. A. Jones; W. Göpel

1989-01-01

100

Cobaltacarborane-phthalocyanine conjugates: Syntheses and photophysical properties  

PubMed Central

Syntheses of two new cobaltacarborane–phthalocyanine conjugates, one anionic (Pc 6) and one zwitterionic (Pc 7), were accomplished via cyclotetramerization of the corresponding cobaltacarborane-substituted phthalonitriles (4 or 5) with excess phthalonitrile in quinoline. X-ray structures of two phthalonitrile precursors (2 and 3) were obtained and are discussed, and the absorption and emission properties of the two cobaltacarborane–phthalocyanine conjugates in several solvents were investigated. The anionic conjugate 6 exists mainly as a monomer in polar organic solvents and has fluorescence quantum yields in the region 0.2–0.3. The zwitterionic conjugate 7 aggregates in solution and displays lower quantum yields ~0.1 in organic solvents. PMID:20808725

Li, Hairong; Fronczek, Frank R.; Vicente, M. Graca H.

2010-01-01

101

Photophysical study of Zn phthalocyanine in binary solvent mixtures  

NASA Astrophysics Data System (ADS)

Photophysical properties of phthalocyanines are important in photodynamic therapy, where these compounds are proposed as photosensitizing agents. We report here some significant solvent effects on the photophysical properties of Zn phthalocyanine (ZnPc) observed in binary solvent mixture dimethyl sulfoxide/water at several ratios of cosolvents. The absorbance of ZnPc at the maximum of Q band has a sharp drop in intensity for a water mass percent in the solvent mixture larger than 40%. The same characteristic shows also the quantum yield of fluorescence. A particular result is the increase of singlet oxygen lifetime for water percentage raise up to 20% in the solvent mixture. The effects are discussed in connection with the particular solvent microenvironment, involving DMSO/water clusters formation and the strong interaction between the solute and the solvent.

Staicu, A.; Pascu, A.; Boni, M.; Pascu, M. L.; Enescu, M.

2013-07-01

102

Metalloporphyrin intercalation in liposome membranes: ESR study  

PubMed Central

Liposomes characterized by membranes featuring diverse fluidity (liquid-crystalline and/or gel phase), prepared from egg yolk lecithin (EYL) and dipalmitoylphosphatidylcholine (DPPC), were doped with selected metalloporphyrins and the time-related structural and dynamic changes within the lipid double layer were investigated. Porphyrin complexes of Mg(II), Mn(III), Fe(III), Co(II), Ni(II), Cu(II), Zn(II), and the metal-free base were embedded into the particular liposome systems and tested for 350 h at 24°C using the electron spin resonance (ESR) spin probe technique. 5-DOXYL, 12-DOXYL, and 16-DOXYL stearic acid methyl ester spin labels were applied to explore the interior of the lipid bilayer. Only the 16-DOXYL spin probe detected evident structural changes inside the lipid system due to porphyrin intercalation. Fluidity of the lipid system and the type of the porphyrin complex introduced significantly affected the intermolecular interactions, which in certain cases may result in self-assembly of metalloporphyrin molecules within the liposome membrane, reflected in the presence of new lines in the relevant ESR spectra. The most pronounced time-related effects were demonstrated by the EYL liposomes (liquid-crystalline phase) when doped with Mg and Co porphyrins, whereas practically no spectral changes were revealed for the metal-free base and both the Ni and Zn dopants. ESR spectra of the porphyrin-doped gel phase of DPPC liposomes did not show any extra lines; however, they indicated the formation of a more rigid lipid medium. Electronic configuration of the porphyrin’s metal center appeared crucial to the degree of molecular reorganization within the phospholipid bilayer system. Electronic supplementary material The online version of this article (doi:10.1007/s00775-010-0715-1) contains supplementary material, which is available to authorized users. PMID:20963616

Man, Dariusz; Broda, Malgorzata A.; Mele, Giuseppe; Li, Jun

2010-01-01

103

Metalloporphyrin intercalation in liposome membranes: ESR study.  

PubMed

Liposomes characterized by membranes featuring diverse fluidity (liquid-crystalline and/or gel phase), prepared from egg yolk lecithin (EYL) and dipalmitoylphosphatidylcholine (DPPC), were doped with selected metalloporphyrins and the time-related structural and dynamic changes within the lipid double layer were investigated. Porphyrin complexes of Mg(II), Mn(III), Fe(III), Co(II), Ni(II), Cu(II), Zn(II), and the metal-free base were embedded into the particular liposome systems and tested for 350 h at 24°C using the electron spin resonance (ESR) spin probe technique. 5-DOXYL, 12-DOXYL, and 16-DOXYL stearic acid methyl ester spin labels were applied to explore the interior of the lipid bilayer. Only the 16-DOXYL spin probe detected evident structural changes inside the lipid system due to porphyrin intercalation. Fluidity of the lipid system and the type of the porphyrin complex introduced significantly affected the intermolecular interactions, which in certain cases may result in self-assembly of metalloporphyrin molecules within the liposome membrane, reflected in the presence of new lines in the relevant ESR spectra. The most pronounced time-related effects were demonstrated by the EYL liposomes (liquid-crystalline phase) when doped with Mg and Co porphyrins, whereas practically no spectral changes were revealed for the metal-free base and both the Ni and Zn dopants. ESR spectra of the porphyrin-doped gel phase of DPPC liposomes did not show any extra lines; however, they indicated the formation of a more rigid lipid medium. Electronic configuration of the porphyrin's metal center appeared crucial to the degree of molecular reorganization within the phospholipid bilayer system. PMID:20963616

Man, Dariusz; S?ota, Rudolf; Broda, Ma?gorzata A; Mele, Giuseppe; Li, Jun

2011-01-01

104

Allometric scaling of pegylated liposomal anticancer drugs.  

PubMed

Pegylated liposomal formulations contain lipid conjugated to polyethylene glycol. The disposition of encapsulated drug is dictated by the composition of the liposome, thus altering the pharmacokinetic (PK) profile of the drug. Allometric scaling is based on a power-log relationship between body weight (W) and drug clearance (CL) among mammals and has been used to compare the disposition of nonliposomal drugs across species. The objectives of this study were to use allometric scaling to: (1) compare the disposition of pegylated liposomal drugs across speciesand determine the best scaling model and (2) predict PK parameters of pegylated liposomal drugs in humans. The PK of pegylated liposomal CKD-602 (S-CKD602), doxorubicin (Doxil®), and cisplatin (SPI-077) were compared. PK studies ofS-CKD602, Doxil®, and SPI-077 were performed at the maximum tolerated dose (MTD) in male and female mice, rats, dogs and patients with refractory solid tumors. The allometric equation used to evaluate the relationship between W and CL in each species was CL = a(W)(m) (a = empirical coefficient; m = allometric exponent). Substitution of physiological variables other than body weight, such as factors representative of the mononuclear phagocyte system (MPS) were evaluated. Dedrick Plots and Maximum Life-Span Potential (MLP) were used to determine scaling feasibility. Standard allometry demonstrated a relationship between clearance of S-CKD602, Doxil®, and SPI-077 and body, spleen, liver, and kidney weights, total monocyte count, and spleen and liver blood flow. However, using scaling to predict CL of these agents in humans often resulted in differences >30%. Despite a strong correlation between body weight and MPS-associated variables with CL among preclinical species, the use of the equations did not predict CL. Thus, new methods of allometric scaling and measures of MPS function need to be developed. PMID:21863380

Caron, Whitney P; Clewell, Harvey; Dedrick, Robert; Ramanathan, Ramesh K; Davis, Whitney L; Yu, Ning; Tonda, Margaret; Schellens, Jan H; Beijnen, Jos H; Zamboni, William C

2011-10-01

105

Liposome disposition in vivo. VI: Delivery to the lung  

SciTech Connect

The effect of negatively charged liposome components and vesicle size on the time course and dose dependency of liposome disposition in mice was studied with a view to optimizing liposome delivery to the lung. The disposition of large multilamellar liposomes was followed using 125I-labeled p-hydroxybenzamidine phosphatidyl ethanolamine. Of the three negatively charged liposome compositions studied (phosphatidyl choline-X-cholesterol-alpha-tocopherol, molar ratio: 4:1:5:0.1; X . phosphatidyl serine, dipalmitoyl phosphatidic acid, or phosphatidyl glycerol), phosphatidyl serine liposomes resulted in the greatest accumulation in lungs. Lung levels decreased up to 95 h postdose, at which time 6% of the liposome dose present at 2 h still remained. The disposition of phosphatidyl serine-containing liposomes was independent of dose for the range 0.04-21 mumol/animal. When liposomes containing phosphatidyl choline were prepared using a variety of extrusion and dialysis conditions, a strong link between liposome size and lung accumulation was revealed. A maximum lung accumulation of 30.9% of the administered dose was achieved with no detectable gross pathological lung lesions up to 24 h postdose.

Abra, R.M.; Hunt, C.A.; Lau, D.T.

1984-02-01

106

Origin of electronic transport of lithium phthalocyanine iodine crystal  

SciTech Connect

The electronic structures of Lithium Phthalocyanine Iodine are investigated using density functional theory. Comparing the band structures of several model crystals, the metallic conductivity of highly doped LiPcI{sub x} can be explained by the band of doped iodine. These results reveal that there is a new mechanism for electronic transport of doped organic semiconductors that the dopant band plays the main role.

Koike, Noritake; Oda, Masato; Shinozuka, Yuzo [Department of Materials Science and Chemistry, Wakayama University, 930 Sakaedani, Wakayama (Japan)

2013-12-04

107

Photovoltaic Characteristics of Phthalocyanine-Polysilane Composite Films  

Microsoft Academic Search

Poly[p-(methylphenylsilanylene)anthrylene] (PMPSA) which introduced anthracene into the Si-Si backbone structure of poly(methylphenylsilanylene) (PMPS) was synthesized. Schottky barrier photovoltaic cells consisting of semitransparent aluminum and phthalocyanine (H2Pc) dispersed in PMPSA were fabricated (H2Pc-PMPSA). The effects of a binder polymer and annealing of PMPSA on the photovoltaic characteristics were investigated. Since the conductivity of H2Pc-PMPSA composite films increases by the introduction of

Yutaka Haga; Yuto Harada

2001-01-01

108

Nanostructured copper phthalocyanine-sensitized multiwall carbon nanotube films.  

PubMed

We report a detailed study of the interaction between surface-oxidized multiwall carbon nanotubes (o-MWCNTs) and the molecular semiconductor tetrasulfonate copper phthalocyanine (TS-CuPc). Concentrated dispersions of o-MWCNT in aqueous solutions of TS-CuPc are stable toward nanotube flocculation and exhibit spontaneous nanostructuring upon rapid drying. In addition to hydrogen-bonding interactions, the compatibility between the two components is shown to result from a ground-state charge-transfer interaction with partial charge transfer from o-MWCNT to TS-CuPc molecules orientated such that the plane of the macrocycle is parallel to the nanotube surface. The electronegativity of TS-CuPc as compared to unsubsubtituted copper phthalocyanine is shown to result from the electron-withdrawing character of the sulfonate substituents, which increase the molecular ionization potential and promote cofacial molecular aggregation upon drying. Upon spin casting to form uniform thin films, the experimental evidence is consistent with an o-MWCNT scaffold decorated with phthalocyanine molecules self-assembled into extended aggregates reminiscent of 1-D linearly stacked phthalocyanine polymers. Remarkably, this self-organization occurs in a fraction of a second during the spin-coating process. To demonstrate the potential utility of this hybrid material, it is successfully incorporated into a model organic photovoltaic cell at the interface between a poly(3-hexylthiophene):[6,6]-phenyl-C61 butyric acid methyl ester bulk heterojunction layer and an indium-tin oxide-coated glass electrode to increase the light-harvesting capability of the device and facilitate hole extraction. The resulting enhancement in power conversion efficiency is rationalized in terms of the electronic, optical, and morphological properties of the nanostructured thin film. PMID:17439261

Hatton, Ross A; Blanchard, Nicholas P; Stolojan, Vlad; Miller, Anthony J; Silva, S Ravi P

2007-05-22

109

Decorated Magnetoliposomes: An Attractive Idea for Multifunctional Therapeutics Liposomes, particles composed of a thin  

E-print Network

Decorated Magnetoliposomes: An Attractive Idea for Multifunctional Therapeutics Liposomes as a poten- tial biomedical tool for diagnostic or thera- peutic use. Hybridizing liposomes with bound upon arriving at the target site. In prin- ciple, decorating liposomes with bound nanoparticles

Lin, Zhiqun

110

Application of Antibody and Fluorophore-Derivatized Liposomes to Heterogeneous Immunoassays for D-dimer  

E-print Network

Application of Antibody and Fluorophore-Derivatized Liposomes to Heterogeneous Immunoassays for D Carolina State University, Raleigh, North Carolina 27695-7905 Small unilamellar liposomes comprised functionalized with antibodies. The liposomes were conjugated with thousands of fluorescein molecules and 10

Kilpatrick, Peter K.

111

Antibacterial Activities of Liposomal Linolenic Acids against Antibiotic-Resistant Helicobacter pylori  

E-print Network

Antibacterial Activities of Liposomal Linolenic Acids against Antibiotic-Resistant Helicobacter a liposomal nanoformulation of linolenic acid (LipoLLA) and evaluated its bactericidal activity against infection, free fatty acid, linolenic acid, liposome INTRODUCTION Helicobacter pylori (H. pylori) colonizes

Zhang, Liangfang

112

The effect of lipid composition and liposome size on the release properties of liposomes-in-hydrogel.  

PubMed

To study the release of liposome-associated drugs into hydrogels, we designed and synthesized two pH-sensitive rhodamine derivatives to use as model compounds of different lipophilicities. The dyes were fluorescent when in the free form released from liposomes into the chitosan hydrogel, but not when incorporated within liposomes. The effect of liposomal composition, surface charge and vesicle size on the release of those incorporated dyes was evaluated. The lipophilicity of the rhodamine derivatives affected both the amount and rate of release. While liposome size had only a minor effect on the release of dyes into the hydrogel, the surface charge affected the release to a greater extent. By optimizing the characteristics of liposomes we could develop a liposomes-in-hydrogel system for application in wound therapy. We further characterized liposomes-in-hydrogel for their rheological properties, textures and moisture handling, as well as their potential to achieve a controlled release of the dye. The polymer-dependent changes in the hydrogel properties were observed upon addition of liposomes. The charged liposomes exhibited stronger effects on the textures of the chitosan hydrogels than the neutral ones. In respect to the ability of the system to handle wound exudates, chitosan-based hydrogels were found to be superior to Carbopol-based hydrogels. PMID:23994014

Hurler, Julia; Žakelj, Simon; Mravljak, Janez; Pajk, Stane; Kristl, Albin; Schubert, Rolf; Škalko-Basnet, Nataša

2013-11-01

113

NiemannPick Human Lymphoblasts Are Resistant to Phthalocyanine 4-Photodynamic  

E-print Network

Niemann­Pick Human Lymphoblasts Are Resistant to Phthalocyanine 4-Photodynamic Therapy; phthalocyanine. Photodynamic therapy is a cancer treatment that uses a photosensitizer, light and oxygen associated with apoptosis in several malig- nant and nonmalignant cell lines. Photodynamic ther- apy (PDT

Homes, Christopher C.

114

Morphological control of copper phthalocyanine films by protonation-electrophoretic deposition  

NASA Astrophysics Data System (ADS)

Films composed of various nanostructured copper phthalocyanine are controllably prepared by the method of protonation-electrophoretic deposition. The ultralong nanowires of copper phthalocyanine are grown at the deposition temperature of 70 °C. And the results of films UV-vis absorption spectra and X-ray diffraction indicate that copper phthalocyanine possesses the transformation tendency from ?-phase to thermostable ?-phase under the higher deposition temperature. The formation process of the ultralong nanowires illustrates that the nanowires grow in longitudinal orientation much faster than in lateral direction. And the time dependence of the films morphology, from another point of view, proves that copper phthalocyanine is dissolved in the precursor solutions, and the formation of the nanostructured copper phthalocyanine contains the process of crystal growth, which is different from the traditional electrophoretic deposition. So the films morphology is flexible to be controlled by varying the deposition conditions. These diverse nanostructured films have potential applications in the electrochemical and optoelectrical equipments.

Zhu, Yuanyuan; Qian, Lingfeng; Xue, Minzhao; Sheng, Qiaorong; Zhang, Qing; Liu, Yangang

2011-01-01

115

Polymorphism of DNAanionic liposome complexes reveals hierarchy of ion-mediated interactions  

E-print Network

Polymorphism of DNA­anionic liposome complexes reveals hierarchy of ion-mediated interactions). Although synthetic nonviral systems such as cationic liposomes generally transfect less efficiently than

Harries, Daniel

116

Liposome-coated quantum dots targeting the sentinel lymph node  

Microsoft Academic Search

Sentinel lymph node (SLN) mapping with near-infrared (NIR) quantum dot (QDs) have many advantages over traditional methods.\\u000a However, as an inorganic nanomaterial, QDs have low biocompatibility and low affinity to the lymphatic system. Here, we encapsulated\\u000a QDs into nanoscale liposomes and then used these liposome-coated QDs for SLN mapping. The results showed that the liposome-coated\\u000a QDs exhibited core–shell characterization, and

Maoquan Chu; Shu Zhuo; Jiang Xu; Qiunan Sheng; Shengke Hou; Ruifei Wang

2010-01-01

117

Liposome-mediated DNA vaccination: the effect of vesicle composition  

Microsoft Academic Search

Liposome-entrapped DNA has been shown to enhance the potency of DNA vaccines, possibly by facilitating uptake of the plasmid by antigen-presenting cells (APC). In this paper, we have investigated the influence of the liposomal composition and surface charge on such potency. Plasmid DNA pRc\\/CMV HBS encoding the S (small) region of hepatitis B surface antigen was entrapped within cationic liposomes

Yvonne Perrie; Peter M. Frederik; Gregory Gregoriadis

2001-01-01

118

Endocytosis and intracellular processing accompanying transfection mediated by cationic liposomes  

Microsoft Academic Search

Cationic liposomes mediate efficient transfection of mammalian cells, but the manner in which cells internalize and process cationic liposome-DNA complexes has not been well characterized. We exposed several cell types, including human and murine erythroleukemia cells, African green monkey kidney cells (CV-1), isolated rat alveolar type II cells and alveolar macrophages to DNA-cationic liposome complexes containing N-(1-2,3-dioleyloxypropyl)-N,N,N-triethylammonium (DOTMA) and Dioleylphosphatidylethanolamine

Daniel S Friend; Demetrios Papahadjopoulos; Robert J Debs

1996-01-01

119

[Isolation and low-temperature preservation of liposomes containing rifampicin].  

PubMed

The optimal conditions for preparations of rifampicin-containing liposomes were determined with the methods of mechanical shaking, gas dispersion and and reversible phases. It was found that the percentage of rifampicin incorporation into liposomes depended on the molar ratio of the antibiotic to the lipid (the optimal ratio was 1 : 10), the size and structure of liposomes, the amount of cholesterol added and the lipid membrane charge. Incorporation of rifampicin amounted to 16.1 +/- 2.4, 39.2 +/- 3.2 and 60.5 +/- 2.9 per cent with respect to neutral lecithin multilamellar liposes, liposomes prepared with the gas dispersion method and liposomes prepared with the method of reversible phases, respectively. Cholesterol in a molar ratio to lecithin equal to 2 : 5 or higher and dicetyl phosphate imparting the negative charge to the membrane had an inhibitory effect on the drug uptake by liposomes, while stearyl amine having the positive charge had a stimulating effect. The effect of the cryoprotectors glucose, polyvinylpyrrolidone, poly-ethylene glycole-400 and glycerol on low-temperature preservation and storage of rifampicin-containing liposomes was studied. It was shown that 10--15 per cent solutions of sucrose and glucose had the highest cryoprotective effect, when the two-stage method of freezing was used. It provided almost 84 per cent preservation of liposomal rifampicin. Electron microscopy showed that after defrosting liposomes no significant changes in the size and structure of lipid membranes were observed. PMID:6638970

Tsyganenko, A Ia; Vasil'chenko, V N; Leont'ev, V S; Vasil'chenko, N S; Dedukh, N V

1983-08-01

120

Current trends in the use of liposomes for tumor targeting  

PubMed Central

The use of liposomes for drug delivery began early in the history of pharmaceutical nanocarriers. These nanosized, lipid bilayered vesicles have become popular as drug delivery systems owing to their efficiency, biocompatibility, nonimmunogenicity, enhanced solubility of chemotherapeutic agents and their ability to encapsulate a wide array of drugs. Passive and ligand-mediated active targeting promote tumor specificity with diminished adverse off-target effects. The current field of liposomes focuses on both clinical and diagnostic applications. Recent efforts have concentrated on the development of multifunctional liposomes that target cells and cellular organelles with a single delivery system. This review discusses the recent advances in liposome research in tumor targeting. PMID:23914966

Deshpande, Pranali P; Biswas, Swati; Torchilin, Vladimir P

2013-01-01

121

Extended in vivo blood circulation time of fluorinated liposomes.  

PubMed

The clearance from blood circulation of fluorinated liposomes made with perfluoroalkylated phosphatidylcholines was investigated in mice using liposome-entrapped 5(6)-carboxyfluorescein. The presence of a fluorinated core inside the membrane strongly retards their blood clearance. The fluorinated vesicles showed circulation half-lives of up to 8.6 h, which are 6-13 and 3-6 times larger than those of similarly sized conventional distearoylphosphatidylcholine and distearoylphosphatidylcholine/cholesterol liposomes, respectively. Their blood clearance was similar to that of some polyethylene glycol (PEG)-labelled 'stealth' liposomes and was dose-independent in a 3.3-330 mumol/kg body weight dose range. PMID:8282115

Santaella, C; Frézard, F; Vierling, P; Riess, J G

1993-12-28

122

Modeling the sustained release of lipophilic drugs from liposomes  

NASA Astrophysics Data System (ADS)

The bilayered structure of liposomes enables the encapsulation of lipophilic drugs in their lipid bilayers and water-soluble molecules in the interior aqueous compartments. We develop a convection-driven drug release model that considers the structural characteristics of liposomes and reversible drug-lipid interaction. An analytical solution to the model is obtained. The solution agrees well with experimental data on the sustained release of lipophilic anticancer drugs from liposomes. The model provides a useful tool for the rational design of liposomal drug delivery systems.

Zeng, Like; Wu, Xiaoyi

2010-08-01

123

Liposomal nanoparticles encapsulating iloprost exhibit enhanced vasodilation in pulmonary arteries  

PubMed Central

Prostacyclin analogues are standard therapeutic options for vasoconstrictive diseases, including pulmonary hypertension and Raynaud’s phenomenon. Although effective, these treatment strategies are expensive and have several side effects. To improve drug efficiency, we tested liposomal nanoparticles as carrier systems. In this study, we synthesized liposomal nanoparticles tailored for the prostacyclin analogue iloprost and evaluated their pharmacologic efficacy on mouse intrapulmonary arteries, using a wire myograph. The use of cationic lipids, stearylamine, or 1,2-di-(9Z-octadecenoyl)-3-trimethylammonium-propane (DOTAP) in liposomes promoted iloprost encapsulation to at least 50%. The addition of cholesterol modestly reduced iloprost encapsulation. The liposomal nanoparticle formulations were tested for toxicity and pharmacologic efficacy in vivo and ex vivo, respectively. The liposomes did not affect the viability of human pulmonary artery smooth muscle cells. Compared with an equivalent concentration of free iloprost, four out of the six polymer-coated liposomal formulations exhibited significantly enhanced vasodilation of mouse pulmonary arteries. Iloprost that was encapsulated in liposomes containing the polymer polyethylene glycol exhibited concentration-dependent relaxation of arteries. Strikingly, half the concentration of iloprost in liposomes elicited similar pharmacologic efficacy as nonencapsulated iloprost. Cationic liposomes can encapsulate iloprost with high efficacy and can serve as potential iloprost carriers to improve its therapeutic efficacy. PMID:25045260

Jain, Pritesh P; Leber, Regina; Nagaraj, Chandran; Leitinger, Gerd; Lehofer, Bernhard; Olschewski, Horst; Olschewski, Andrea; Prassl, Ruth; Marsh, Leigh M

2014-01-01

124

pH-Triggered Echogenicity and Contents Release from Liposomes.  

PubMed

Liposomes are representative lipid nanoparticles widely used for delivering anticancer drugs, DNA fragments, or siRNA to cancer cells. Upon targeting, various internal and external triggers have been used to increase the rate for contents release from the liposomes. Among the internal triggers, decreased pH within the cellular lysosomes has been successfully used to enhance the rate for releasing contents. However, imparting pH sensitivity to liposomes requires the synthesis of specialized lipids with structures that are substantially modified at a reduced pH. Herein, we report an alternative strategy to render liposomes pH sensitive by encapsulating a precursor which generates gas bubbles in situ in response to acidic pH. The disturbance created by the escaping gas bubbles leads to the rapid release of the encapsulated contents from the liposomes. Atomic force microscopic studies indicate that the liposomal structure is destroyed at a reduced pH. The gas bubbles also render the liposomes echogenic, allowing ultrasound imaging. To demonstrate the applicability of this strategy, we have successfully targeted doxorubicin-encapsulated liposomes to the pancreatic ductal carcinoma cells that overexpress the folate receptor on the surface. In response to the decreased pH in the lysosomes, the encapsulated anticancer drug is efficiently released. Contents released from these liposomes are further enhanced by the application of continuous wave ultrasound (1 MHz), resulting in substantially reduced viability for the pancreatic cancer cells (14%). PMID:25271780

Nahire, Rahul; Hossain, Rayat; Patel, Rupa; Paul, Shirshendu; Meghnani, Varsha; Ambre, Avinash H; Gange, Kara N; Katti, Kalpana S; Leclerc, Estelle; Srivastava, D K; Sarkar, Kausik; Mallik, Sanku

2014-11-01

125

Preparation and evaluation of liposome-encapsulated codrug LMX.  

PubMed

A novel codrug (LMX) consisting of Lamivudine and Ursolic acid has been shown to possess the dual action of anti-hepatitis B virus activity and hepatoprotective effects against acute liver injury in vivo. Because of the limited water solubility of LMX, our aims were to design and optimize a liposomal formulation that could facilitate its in vivo administration, and to estimate the potential of LMX-loaded liposomes as oral or intravenous delivery system. In this work, LMX-loaded liposomes were prepared by the thin film hydration method coupled with sonication. LMX-loaded liposomes showed spherical morphology under transmission electron microscope (TEM) analysis. The mean particle size of liposomes was about 210 nm, and the drug entrapment efficiency was more than 90%. Stability data indicated that lyophilized liposomes were stable for at least 6 months at 4 °C. In vitro drug release profile of LMX-loaded liposomes showed a sustained release profile of LMX and an initial mild burst was observed. The relative bioavailability of LMX-loaded liposomes was 1074.8% compared with LMX suspension after oral administration, and 135.2% relative to 50% alcohol solution after intravenous (i.v.) administration. These results indicated that LMX-loaded liposomes were valued to develop as a practical preparation for oral or i.v. administration. PMID:22981689

Zhong, Yan; Wang, Jing; Wang, Yao; Wu, Bin

2012-11-15

126

Liposomes from soya phospholipids as percutaneous drug carriers. 2nd communication: quantitative in vivo investigations with radioactively labelled liposomes.  

PubMed

The percutaneous absorption of liposomes (prepared from NAT 106) was investigated with radioactively labelled substances in comparison with percutaneous absorption without liposomes (controls) in vivo on the skin of young pigs. Radioactivity was monitored as a function of time in skin tissue, plasma or blood and in urine. Elevated tissue levels, increased absorption and renal elimination of the various liposomal preparations in comparison to the controls were measured. PMID:1965621

Artmann, C; Röding, J; Ghyczy, M; Pratzel, H G

1990-12-01

127

Liposomes for gene transfer in cancer therapy.  

PubMed

We developed improved liposomes that produce efficacy for the treatment of cancer, cardiovascular diseases, and HIV-1-related diseases in small and large animal models. Because our processes are reproducible, we have standard operating procedures (SOPs) for the cGMP manufacture of these reagents that have been approved by the Food and Drug Administration for use in phase I/II clinical trials. PMID:20686971

Templeton, Nancy Smyth

2010-01-01

128

Microwave-stimulated drug release from liposomes  

Microsoft Academic Search

Microwaves (2450 MHz) are shown to stimulate the release of an aqueous chemotherapeutic drug from phospholipid vesicles. This effect occurs at temperatures below the membrane phase transition temperature of 41°C where these liposomes are normally not leaky. In buffered saline, microwave exposure (60 mW\\/g) triggers the onset of drug release at 33°C, whereas in plasma a near maximal release is

R. P. Liburdy; R. L. Magin

1985-01-01

129

Mechanism of Oligonucleotide Release from Cationic Liposomes  

Microsoft Academic Search

We propose a mechanism for oligonucleotide (ODN) release from cationic lipid complexes in cells that accounts for various observations on cationic lipid-nucleic acid-cell interactions. Fluorescent confocal microscopy of cells treated with rhodamine-labeled cationic liposome\\/fluorescein-labeled ODN (F-ODN) complexes show the F-ODN separates from the lipid after internalization and enters the nucleus leaving the fluorescent lipid in cytoplasmic structures. ODN displacement from

Olivier Zelphati; Francis C. Szoka

1996-01-01

130

Integration of ?-carotene molecules in small liposomes  

NASA Astrophysics Data System (ADS)

The most typical feature of carotenoids is the long polyene chain with conjugated double bonds suggesting that they can serve as conductors of electrons, acting as ''molecular wires'', important elements in the molecular electronic devices. Carotenoids are essential components of photosynthetic systems, performing different functions as light harvesting, photoprotection and electron transfer. They act also as natural antioxidants. In addition they perform structural role stabilizing the three-dimensional organization of photosynthetic membranes. Carotenoids contribute to the stability of the lipid phase, preserving the membrane integrity under potentially harmful environmental conditions. Carotenoids can be easily integrated into model membranes, facilitating the investigation of their functional roles. In carotenoid-egg phosphatidylcholine (EPC) liposomes ß-carotene is randomly distributed in the hydrocarbon interior of the bilayer, without any preferred, well defined orientation and retains a substantial degree of mobility. Here we investigate the degree of integration of ß-carotene in small unilamellar EPC liposomes and the changes in ß-carotene absorption and Raman spectra due to the lipid-pigment interaction. All observed changes in ß-carotene absorption and Raman spectra may be regarded as a result of the lipid-pigment interactions leading to the polyene geometry distortion and increasing of the environment heterogenety in the liposomes as compared to the solutions.

Andreeva, Atanaska; Popova, Antoaneta

2010-11-01

131

Oxygen Measurements in Liposome Encapsulated Hemoglobin  

NASA Astrophysics Data System (ADS)

Liposome encapsulated hemoglobins (LEH's) are of current interest as blood substitutes. An analytical methodology for rapid non-invasive measurements of oxygen in artificial oxygen carriers is examined. High resolution optical absorption spectra are calculated by means of a one dimensional diffusion approximation. The encapsulated hemoglobin is prepared from fresh defibrinated bovine blood. Liposomes are prepared from hydrogenated soy phosphatidylcholine (HSPC), cholesterol and dicetylphosphate using a bath sonication method. An integrating sphere spectrophotometer is employed for diffuse optics measurements. Data is collected using an automated data acquisition system employing lock-in -amplifiers. The concentrations of hemoglobin derivatives are evaluated from the corresponding extinction coefficients using a numerical technique of singular value decomposition, and verification of the results is done using Monte Carlo simulations. In situ measurements are required for the determination of hemoglobin derivatives because most encapsulation methods invariably lead to the formation of methemoglobin, a nonfunctional form of hemoglobin. The methods employed in this work lead to high resolution absorption spectra of oxyhemoglobin and other derivatives in red blood cells and liposome encapsulated hemoglobin (LEH). The analysis using singular value decomposition method offers a quantitative means of calculating the fractions of oxyhemoglobin and other hemoglobin derivatives in LEH samples. The analytical methods developed in this work will become even more useful when production of LEH as a blood substitute is scaled up to large volumes.

Phiri, Joshua Benjamin

132

Disaccharide-modified liposomes and their in vitro intracellular uptake.  

PubMed

Sterically stabilized liposomes (SSL) were known to be accumulated passively in cancer due to the effect of enhanced permeability and retention (EPR). However, drug delivery via SSL to cancer seemed to show an insufficient improvement of chemotherapeutic efficacy. Herein, carbohydrate-binding proteins (lectins) of cell surface, which express on the plasmic membrane of many malignant cells, can be a good model of surface-modified liposomes. In this study, we investigated the in vitro characteristics of liposomes of which the surface was modified with a disaccharide molecule, sucrose or maltose. The disaccharide-modified lipids such as sucrose-modified lipid and maltose-modified lipid, in which the disaccharide was conjugated to the one end of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(polyethylene glycol)-2000 (DSPE-PEG2000), was synthesized. The disaccharide-modified liposomes were prepared by thin film-hydration method and then doxorubicin (DOX), an anticancer drug, was loaded to the prepared liposomes by the remote loading method with ammonium ion gradient. Flow cytometry and confocal microscopy analyses showed that the disaccharide-modified liposomes enhanced the intracellular uptake of liposomes into various cancer cell lines via lectin-mediated endocytosis. The disaccharide-modified liposomes in which DOX was loaded inside of liposomes exhibited higher cytotoxicity against various cancer cells than DOX-loaded SSL did. These results suggest that disaccharide-modified liposomes may be promising cancer targeting carriers which can enhance intracellular uptake and cytotoxicity of the drug-loaded liposomes via lectin-mediated endocytosis. PMID:19635539

Song, Chung Kil; Jung, Suk Hyun; Kim, Dae-Duk; Jeong, Kyu-Sung; Shin, Byung Cheol; Seong, Hasoo

2009-10-01

133

Accelerated blood clearance of PEGylated liposomes following preceding liposome injection: effects of lipid dose and PEG surface-density and chain length of the first-dose liposomes.  

PubMed

We recently reported that a second dose of polyethylene glycol (PEG) (M.W. 2000)-modified liposomes (mPEG2000-liposomes) is rapidly cleared from the blood and accumulates in the liver when injected twice in the same rat or mouse at several-day intervals (referred to as the "accelerated blood clearance (ABC) phenomenon"). In the present study we observed that a high dose (5 micromol/kg) of conventional liposomes (CL: without a PEG-coating) can induce the same phenomenon, while a low lipid dose (0.001 micromol/kg) did not. The induction of the phenomenon by mPEG2000-liposomes decreased with increasing first dose (0.001-5 micromol/kg). We observed a strong inverse relationship between the dose of initially injected PEG2000-liposomes and the extent to which the ABC phenomenon was induced: the higher the dose the smaller the phenomenon. Increasing the PEG density at the liposome surface beyond 5 mol% attenuated rather than induced the induction of the phenomenon, but elongation of the PEG chain length up to M.W. 5000, had no effect. In a series of hematological, serum-biochemical and histopathological safety evaluations we observed neither acute toxicity nor any signs of hepatic damage during the induction of the ABC phenomenon. Morphological examination of the liver by transmission electron microscopy (TEM) showed extensive accumulation of the second dose of mPEG2000-liposomes in the Kupffer cells, even already after 15 min, suggesting that the PEG liposomes had somehow lost the protective effect of the surface-grafted PEG against rapid clearance. The observations reported in this paper may have a considerable impact on the design and engineering of PEGylated liposomal formulations for use in multiple drug therapy. PMID:15908032

Ishida, Tatsuhiro; Harada, Masae; Wang, Xin Yu; Ichihara, Masako; Irimura, Kenji; Kiwada, Hiroshi

2005-07-20

134

AC impedance spectroscopy on copper phthalocyanine thin films  

NASA Astrophysics Data System (ADS)

Impedance spectroscopy is used to study copper phthalocyanine thin films in order to disentangle the contributions of the crystal and the unavoidable grain boundaries. The spectroscopy data is fit with an equivalent circuit model to determine resistance, capacitance, and activation energy for different grain morphologies. The copper phthalocyanine thin films are deposited via thermal evaporation on platinum interdigitated electrodes on glass substrates at different temperatures from 300 to 530 K with constant thickness of 22 nm. AC measurements, implementing a precision LCR meter are taken from 20Hz - 2 MHz, and at measurement temperatures from 25 - 90 °C. Stabilizing current by subjecting samples to 5 days in the dark, the impedance spectrum can be represented by Cole-Cole plots, which show either one or two peaks. The two maxima may be attributed to the crystalline bulk and grain boundaries of the film. We observe that the grain boundary resistance component changes by three orders of magnitude when varying the grain morphology, and the capacitance changes by one order of magnitude. The resistance of the grain boundary shows a minimum near the phase transition temperature of 450 K, followed by an increase in resistance for samples deposited at higher temperatures. The capacitance on the other hand, shows a maximum near the phase transition temperature. Similarly, the activation energy for the grain boundary peaks at 1.29 +/- 0.12 eV at the same phase-transition tempemture, whereas the crystalline bulk component has a constant activation energy of 0.36 +/- 0.08 eV for all sample of different grain sizes. Additional data taken using a perpendicular configuration for a 30 nm thick cobalt phthalocyanine thin film shows a double peak. The low temperature measurements for these samples are interpreted to have two contributions from micro-shorts and crystalline bulk.

Robinson, Kyle P.

135

Synthesis and polymerization of supramolecular assemblies of octasubstituted phthalocyanines  

NASA Astrophysics Data System (ADS)

Substituted phthalocyanines (Pc's) are an important class of organic molecules, which have shown promise in the field of organo-electronics. The goal of the current research was to synthesize a new class of polymerizable Pc's. It was hoped that the new class of compounds would exhibit similar liquid crystalline and self organization properties that had been demonstrated by 2,3,9,10,16,17,23,24-octakis(2-benzyoxyethoxy) phthalocyanine. This Pc formed stable Langmuir monolayer and bilayers, which could be transferred to solid supports without losing the long-range order. The initial reactive Pc was 2,3,9,10,16,17,23,24-octakis(2-benzyoxyethoxy) phthalocyanine. The monomer was a beta-substituted styrene that was located within the alkoxy chains, to prevent inter-columnar cross-linking. The styrene functionalities were dimerized (35% reaction) by photolysis at 254 nm to form cyclo-butanes. The rod-like polymers were characterized using AFM and MALDI-TOF mass spectral analysis and the molecular rods obtained had a mean length of 72 nm. The styrylethoxy Pc was shown to be more crystalline then the previous benzyloxyethoxy Pc's, in order to correct this a new class of reactive Pc's were developed that contained a second oxygen atom. DSC data on the cinnamyloxyethoxy Pc shows that the lower temperature for the liquid crystalline mesophase was restored. Polymerization experiments performed on the cinnamyloxyethoxy Pc showed faster and 2x higher percent conversion. The research detailed in this dissertation describes a novel Diels-Alder synthetic approach to this important class of molecules and a new generic route to polymer rods of Pc.

Drager, Anthony Steven

2001-12-01

136

Pyrolyzed cobalt phthalocyanine as electrocatalyst for oxygen reduction  

Microsoft Academic Search

Cobalt phthalocyanine (CoPc) adsorbed on carbon black (XC-72) and heat-treated at temperature ranging from 300 to 1,150 C display catalytic activity toward the electroreduction of oxygen in acidic medium (H[sub 2]SO[sub 4],pH 0.5). The best catalysts are obtained for pyrolysis temperatures ranging from 700 to 950 C. X-ray diffraction performed on CoPc\\/XC-72 pyrolyzed between 700 and 1,150 C reveals the

M. Ladouceur; G. Lalande; D. Guay; J. P. Dodelet; L. Dignard-Bailey; M. L. Trudeau; R. Schulz

1993-01-01

137

Magnetic interaction in oxygenated alpha Fe-phthalocyanines  

NASA Astrophysics Data System (ADS)

Alpha iron phthalocyanines (?-FePc) oxygenated at low temperatures were investigated with the help of 57Fe Mössbauer spectroscopy, magnetization measurements (SQUID) and X-ray diffractometry (XRD). Mössbauer spectroscopy revealed that upon oxygenation of ?-FePc, new species were formed which could be associated with FeIIIPc oxygen adducts. Unexpectedly, magnetically split spectrum of oxygenated ?-FePc was observed below 20 K. In-field Mössbauer spectra in a 5 T external magnetic field at 5K and magnetization measurements indicate antiferromagnetic coupling in oxygenated ?-FePc.

Kuzmann, Ern?; Pechousek, Jiri; Cuda, Jan; Yin, Houping; Wei, Yen; Homonnay, Zoltán; Klencsár, Zoltán; Horváth, Attila; Machala, Libor; Kubuki, Shiro; Zoppellaro, Giorgio; Zboril, Radek; Nath, Amar

2014-10-01

138

Structural study of monolayer cobalt phthalocyanine adsorbed on graphite  

E-print Network

We present microscopic investigations on the two-dimensional arrangement of cobalt phthalocyanine molecules on a graphite (HOPG) substrate in the low coverage regime. The initial growth and ordering of molecular layers is revealed in high resolution scanning tunneling microscopy (STM). On low coverages single molecules orient mostly along one of the substrate lattice directions, while they form chains at slightly higher coverage. Structures with two different unit cells can be found from the first monolayer on. A theoretical model based on potential energy calculations is presented, which relates the two phases to the driving ordering forces.

Scheffler, M; Baumann, D; Schlegel, R; Hänke, T; Toader, M; Büchner, B; Hietschold, M; Hess, C

2014-01-01

139

Polycation liposome-mediated gene transfer in vivo  

Microsoft Academic Search

The polycation liposome (PCL), a recently developed gene transfer system, is simply prepared by a modification of liposomes with cetylated polyethylenimine (PEI), and shows remarkable transgene efficiency with low cytotoxicity. In the present study, we investigated the applicability of PCLs for in vivo gene transfer, since the PCL-mediated transgene efficiency was found to be maintained in the presence of serum.

Mitsuo Matsuura; Yukako Yamazaki; Mayu Sugiyama; Masami Kondo; Hidetsugu Ori; Mamoru Nango; Naoto Oku

2003-01-01

140

ORIGINAL PAPER Encapsulation of ascorbic acid in liposomes prepared  

E-print Network

ORIGINAL PAPER Encapsulation of ascorbic acid in liposomes prepared with milk fat globule membrane, and to evaluate their encapsulation behavior using ascorbic acid as a model biomolecule. Liposomes prepared efficiencies for ascorbic acid increased as the concentration of phospholipid-rich powder increased from 5

Paris-Sud XI, Université de

141

Fluorescent Liposome Flow Markers for Microscale Particle-Image Velocimetry  

E-print Network

Fluorescent Liposome Flow Markers for Microscale Particle-Image Velocimetry Anup K. Singh,* Eric B-image velocimetry data in micrometer- scale flow channels was employed to analyze the images. These liposomes,7 and caged dyes8 have been explored for examining flow fields in capillaries. Particle-image velocimetry (PIV

Singh, Anup

142

Nerve growth factor-mediated targeting of liposomes to cells  

SciTech Connect

Derivatives of beta-nerve growth factor (NGF), modified by biotinylation of carboxyl groups, were used to target the specific binding of liposomes to cultured rat and human cells bearing NGF receptors. Streptavidin was conjugated via peptide bonds to amino groups on liposomes. Biotinylated NGF, but not unmodified NGF, mediated the binding of radiolabeled streptavidin-liposomes to rat pheochromocytoma PC12 cells in suspension at 4/sup 0/C. In contrast, biotinylated NGF did not increase the binding of hemoglobin-conjugated liposomes tested as a control for specificity. Biotinylated NGF also mediated the specific binding of streptavidin-liposomes containing fluorescein isothiocyanate-labeled dextran to PC12 cells and human melanoma HS294 cells. When HS294 cells were incubated at 37/sup 0/C following liposome binding at 4/sup 0/C, the cell-associated fluorescence appeared to become internalized, in that some cells displayed a perinuclear pattern of fluorescence similar to that observed when lysosomes were stained with acridine orange. Trypsin treatment abolished cell-associated fluorescence when cells were held at 4/sup 0/C but did not affect the fluorescence in cells following incubation at 37/sup 0/C. When liposomes containing carboxyfluorescein, a dye that can diffuse out of acidic compartments, were targeted to HS294 cells, incubation at 37/sup 0/C resulted in diffuse cytoplasmic fluorescence, suggesting that internalized liposomes encounter lysosomal or prelysosomal organelles.

Hawrot, E.; Rosenberg, M.B.; Preston, P.E.; Breakefield, X.O.

1986-05-01

143

Liposomes in the treatment of malignancy: a clinical perspective.  

PubMed

Technological advances in liposomal preparation and efficient drug entrapment, along with supportive preclinical studies, have led to a number of recent clinical trials utilizing liposomes as drug carriers in the treatment of human malignancy. Although the results of these trials must be considered preliminary, it is clear that liposomal delivery of chemotherapeutic agents is safe at the doses administered. Aside from minor constitutional symptoms, virtually all toxicity could be attributed to release of the incorporated drug. Myelosuppression tends to be the dose-limiting toxicity with free drug, whereas constitutional symptoms are more likely to occur with encapsulated biologic therapy. Prior to human trials, there was fear that intravenous injection of liposomes could result in pulmonary emboli. No cases of pulmonary embolism secondary to liposome therapy have been recorded. The objective response rate in the patients studied appears to be minimal. This is not surprising, since the overwhelming majority of patients studied had disease that was advanced and previously shown to be refractory to therapy. Subgroups of patients that appear to benefit most include those with breast cancer who were treated with liposomal doxorubicin and those with advanced melanoma treated with liposomal tumor vaccines. Additional phase II and III clinical trials will better define the effectiveness of treatment modalities incorporating liposomes. VI-A. Future directions One of the earliest applications of liposomes may be in the amelioration of drug toxicity. Although not yet proven, the clinical studies reviewed suggest that liposomal delivery of doxorubicin reduces cardiotoxicity without sacrificing antitumor effect. Although similar claims have been made in support of continuous infusion doxorubicin [11], one can avoid unnecessary hospitalization or the bulk and expense of portable infusion devices by a single administration of the liposomal preparation. Liposome encapsulation can markedly alter the biodistribution and pharmacokinetics of well-known chemotherapeutic agents. The effectiveness of liposomal drug delivery in human trials thus far has probably been more closely related to altered pharmacokinetics rather than enhanced drug delivery to tumor or increased tumor responsiveness. As demonstrated by Gabizon [19], increased liposome circulating time in the murine model can be achieved by using small unilamellar vesicles containing a phosphatidylcholine of high phase-transition temperature and a small molar fraction of monosialoganglioside or hydrogenated phosphatidylinositol.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:1497823

Sugarman, S M; Perez-Soler, R

1992-01-01

144

The toxicity of phthalocyanines to the aquatic plant Lemna minor (duckweed) - testing of 31 compounds.  

PubMed

Phthalocyanines are prospective chemicals that have applications in industry, medicine and biology due especially to their architectural flexibility and production of reactive oxygen species. Although they are used in so many areas of human activities nowadays, there is still little knowledge of their ecotoxicity. Here we present the first observation of their toxic effects on representatives of the aquatic plants Lemna minor. The tested phthalocyanines possess a wide spectrum of phytotoxicity ranging from seldom (>50 mg L(-1)) to highly toxic 0.11 mg L(-1). Moreover, the potential of phthalocyanines to be used as selective cyanocides or herbicides is discussed as well. PMID:22497786

Jan?ula, Daniel; Maršálek, Blahoslav

2012-08-01

145

Highly soluble 3,4-(dimethoxyphenylthio) substituted phthalocyanines: Synthesis, photophysical and photochemical studies  

NASA Astrophysics Data System (ADS)

The synthesis of a new 3,4-(dimethoxyphenylthio) substituted phthalonitrile ( 1) and its soluble metal free ( 2), zinc (II) ( 3), oxo-titanium (IV) ( 4) and nickel (II) ( 5) phthalocyanine derivatives are reported for the first time. The new compounds have been characterized by elemental analysis, FT-IR, 1H NMR, UV-Vis, fluorescence spectroscopies and mass spectra. General trends are described for fluorescence, photodegradation and singlet oxygen quantum yields and fluorescence lifetimes of oxo-titanium (IV) and zinc (II) phthalocyanine compounds in dimethylsulfoxide (DMSO). The effects of the metal ion on the photophysical and photochemical parameters for these phthalocyanines ( 3 and 4) are also reported.

Öztürk, Cansu; Erdo?mu?, Ali; Durmu?, Mahmut; U?ur, Ahmet Lütfi; K?l?çarslan, Fatma Aytan; Erden, ?brahim

2012-02-01

146

Titanium and Ruthenium Phthalocyanines for NO2 Sensors: A Mini-Review  

PubMed Central

This review presents studies devoted to the description and comprehension of phenomena connected with the sensing behaviour towards NO2 of films of two phthalocyanines, titanium bis-phthalocyanine and ruthenium phthalocyanine. Spectroscopic, conductometric, and morphological features recorded during exposure to the gas are explained and the mechanisms of gas-molecule interaction are also elucidated. The review also shows how X-ray reflectivity can be a useful tool for monitoring morphological parameters such as thickness and roughness that are demonstrated to be sensitive variables for monitoring the exposure of thin films of sensor materials to NO2 gas. PMID:22346697

Paoletti, Anna Maria; Pennesi, Giovanna; Rossi, Gentilina; Generosi, Amanda; Paci, Barbara; Albertini, Valerio Rossi

2009-01-01

147

Polytopic cation receptor functional phthalocyanines: Synthesis, characterization, electrochemistry and metal ion binding  

Microsoft Academic Search

Our efforts toward the development of the synthesis of a novel type of receptor ligand and its tetrasubstituted phthalocyanines, 2,9,16,23-tetrakis(6-hydroxyhexylsulfanyl) phthalocyanine, M[Pc(S–C6H13OH)4] (M=Zn(II), Cu(II), Co(II)), bearing sulfur and oxygen donor atoms on the periphery together with hexyl moieties, have been carried out together with spectroscopic and electrochemical characterization. The newly synthesized functional phthalocyanines were soluble in MeOH, EtOH, THF, DMF,

Meryem N. Yara?ir; Mehmet Kandaz; At?f Koca; Bekir Salih

2007-01-01

148

Octa- and tetra-(benzo-15-crown-5)phthalocyanines in surfactant-containing solutions  

Microsoft Academic Search

The behavior of octa-(benzo-15-crown-5)phthalocyanine (H2cr8Pc), as well as cobalt octa- and tetra-(benzo-15-crown-5)phthalocyaninates (Cocr8Pc and Cocr4Pc), in aqueous solutions containing cationic or anionic surfactants, such as cetyl trimethylammonium bromide (CTAB), sodium\\u000a carboxymethyl cellulose (Na-CMC), and sodium dodecyl sulfate (SDS), is studied using electronic spectroscopy. The presence\\u000a of eight benzo-15-crown-5 ether fragments on the periphery of the phthalocyanine ring is shown to

N. F. Gol’dshleger; I. P. Kalashnikova; V. E. Baulin; A. Yu. Tsivadze

2011-01-01

149

Recent Applications of Liposomes in Ophthalmic Drug Delivery  

PubMed Central

Liposomal formulations were significantly explored over the last decade for the ophthalmic drug delivery applications. These formulations are mainly composed of phosphatidylcholine (PC) and other constituents such as cholesterol and lipid-conjugated hydrophilic polymers. Liposomes are biodegradable and biocompatible in nature. Current approaches for topical delivery of liposomes are focused on improving the corneal adhesion and permeation by incorporating various bioadhesive and penetration enhancing polymers. In the case of posterior segment disorders improvement in intravitreal half life and targeted drug delivery to the retina is achieved by liposomes. In this paper we have attempted to summarize the applications of liposomes in the field of ophthalmic drug delivery by citing numerous investigators over the last decade. PMID:21490757

Mishra, Gyan P.; Bagui, Mahuya; Tamboli, Viral; Mitra, Ashim K.

2011-01-01

150

Rupture pathway of phosphatidylcholine liposomes on silicon dioxide.  

PubMed

We have investigated the pathway by which unilamellar POPC liposomes upon adsorption undergo rupture and form a supported lipid bilayer (SLB) on a SiO(2) surface. Biotinylated lipids were selectively incorporated in the outer monolayer of POPC liposomes to create liposomes with asymmetric lipid compositions in the outer and inner leaflets. The specific binding of neutravidin and anti-biotin to SLBs formed by liposome fusion, prior to and after equilibrated flip-flop between the upper and lower monolayers in the SLB, were then investigated. It was concluded that the lipids in the outer monolayer of the vesicle predominantly end up on the SLB side facing the SiO(2) substrate, as demonstrated by having maximum 30-40% of lipids in the liposome outer monolayer orienting towards the bulk after forming the SLB. PMID:19468333

Reimhult, Erik; Kasemo, Bengt; Höök, Fredrik

2009-04-01

151

Rupture Pathway of Phosphatidylcholine Liposomes on Silicon Dioxide  

PubMed Central

We have investigated the pathway by which unilamellar POPC liposomes upon adsorption undergo rupture and form a supported lipid bilayer (SLB) on a SiO2 surface. Biotinylated lipids were selectively incorporated in the outer monolayer of POPC liposomes to create liposomes with asymmetric lipid compositions in the outer and inner leaflets. The specific binding of neutravidin and anti-biotin to SLBs formed by liposome fusion, prior to and after equilibrated flip-flop between the upper and lower monolayers in the SLB, were then investigated. It was concluded that the lipids in the outer monolayer of the vesicle predominantly end up on the SLB side facing the SiO2 substrate, as demonstrated by having maximum 30–40% of lipids in the liposome outer monolayer orienting towards the bulk after forming the SLB. PMID:19468333

Reimhult, Erik; Kasemo, Bengt; Hook, Fredrik

2009-01-01

152

Electromagnetic field triggered drug and chemical delivery via liposomes  

DOEpatents

The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release said chemical agent from the liposomes at a temperature of between about +10 and 65.degree. C. The invention further relates to the use of said liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.

Liburdy, Robert P. (1820 Mountain View Rd., Tiburon, CA 94920)

1993-01-01

153

Liposome–skin interactions and their effects on the skin permeation of drugs  

Microsoft Academic Search

The aim of the study was to evaluate the interaction of phospholipid liposomes with skin and stratum corneum lipid liposomes (SCLLs). The influence of phospholipid liposomes on the skin permeability of model drugs was also studied. The transdermal flux of the drugs applied in various phospholipid containing formulations through human epidermis was studied in diffusion chambers. Liposomes in water solutions

Merja Kirjavainen; Arto Urtti; Riitta Valjakka-Koskela; Juha Kiesvaara; Jukka Mönkkönen

1999-01-01

154

pH-Dependent Fusion between the Semliki Forest Virus Membrane and Liposomes  

Microsoft Academic Search

Semliki Forest virus was mixed with liposomes containing phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, and cholesterol. When the pH of the mixture was dropped to 6 or below, rapid fusion between the membranes of the virus and the liposomes occurred, resulting in the transfer of viral nucleocapsids into the liposomes. Fusion was demonstrated biochemically by trapping RNase or trypsin within the liposomes. Trapped

Judy White; Ari Helenius

1980-01-01

155

Ligandreceptor binding on nanoparticle-stabilized liposome surfaces Liangfang Zhang,a  

E-print Network

Ligand­receptor binding on nanoparticle-stabilized liposome surfaces Liangfang Zhang,a Kevin the access of receptor (streptavidin) to liposome- immobilized ligand (biotin) in cases where the liposomes over that range of nanoparticle surface coverage where liposome fusion and large- scale aggregation

Granick, Steve

156

Therapy of leishmaniasis: Superior efficacies of liposome-encapsulated drugs  

PubMed Central

Liposomes containing antimonial compounds trapped in the aqueous phase were tested in the treatment of experimental leishmaniasis. The rationale of this approach was based on the hypothesis that the liposomes and the parasite are taken up by the same cell, the reticuloendothelial cell, and we present electron microscopic evidence that supports this hypothesis. Suppression of leishmaniasis was quantified by determining the total number of parasites per liver from impression smears. When two antimonials, meglumine antimoniate and sodium stibogluconate, were encapsulated within liposomes, each was more than 700 times more active compared to either of the free (unencapsulated) drugs. After infection, if untreated, all of the hamsters eventually would die from the disease. Liposome-encapsulated meglumine antimoniate was about 330-640 times more effective in causing a drop in the death rate than was the free antimonial. The efficacy of treatment was influenced by the lipid composition and charge of the liposomes. For example, positively charged liposomes containing egg phosphatidylcholine were much less effective than negatively charged ones. In contrast, positively and negatively charged sphingomyelin liposomes were equally effective. Liposomes containing phosphatidylserine (which were negatively charged, but also had a much higher charge density) were among the less-effective preparations. Among those tested, the most consistently efficacious liposomes contained highly saturated long-chain phospholipids (eg., dipalmitoyl phosphatidylcholine), cholesterol, and a negative charge. We conclude that liposomes may be useful as carriers of drugs to treat infectious diseases involving the reticuloendothelial system. The toxicities of antimony are very similar to those of arsenic. Encapsulation of antimonial drugs and reduction of the dose required for effective therapy should minimize such systemic toxicities as acute cardiomyopathy and toxic nephritis. Images PMID:208079

Alving, Carl R.; Steck, Edgar A.; Chapman, Willie L.; Waits, Virginia B.; Hendricks, Larry D.; Swartz, Glenn M.; Hanson, William L.

1978-01-01

157

Liposomes tethered to a biopolymer film through the hydrophobic effect create a highly effective lubricating surface.  

PubMed

Liposomal coatings are formed on films of a biopolymer, hydrophobically modified chitosan (hm-chitosan), containing dodecyl groups as hydrophobes along the polymer backbone. The alkyl groups insert themselves into the liposome bilayer through hydrophobic interactions and thus tether liposomes, leading to a densely packed liposome layer on the film surface. Such liposomal surfaces exhibit effective lubrication properties due to their high degree of hydration, and reduce the coefficient of friction to the biologically-relevant range. The compliancy and robustness of these tethered liposomes allow retention on the film surface upon repeated applications of shear. Such liposome coated films have potential applications in biolubrication. PMID:25315119

Zheng, R; Arora, J; Boonkaew, B; Raghavan, S R; Kaplan, D L; He, J; Pesika, N S; John, V T

2014-11-01

158

Clearance and localization of intravitreal liposomes in the aphakic vitrectomized eye  

SciTech Connect

The authors have examined the fate of intravitreally injected liposomes in the aphakic, vitrectomized eye of the rabbit. Liposomes labelled with /sup 125/(I)-p-hydroxybenzimidylphosphatidylethanolamine were eliminated rapidly from the intraocular fluid. Nonetheless, a significant fraction of these liposomes were found to bind to various ocular tissues including the retina, iris, sclera, and cornea. Ultrastructural studies with gold colloid-loaded liposomes revealed that retinal bound liposomes were attached to the inner limiting lamina but did not penetrate to the internal cells of the retina. Epiretinal cells bound and internalized gold colloid-loaded liposomes suggesting that these cells may be very sensitive to liposome mediated drug delivery.

Stern, W.H.; Heath, T.D.; Lewis, G.P.; Guerin, C.J.; Erickson, P.A.; Lopez, N.G.; Hong, K.L.

1987-05-01

159

Cadherin-integrated liposomes with potential application in a drug delivery system.  

PubMed

N-cadherin (CDH2) proteins were reconstituted with liposomes using a baculovirus expression-liposome fusion method. CDH2 budded viruses were fused with giant liposomes containing dioleoylphophogycerol/dioleoylphosphatidylcholine (DOPG/DOPC) at pH 4.5 and the localization of CDH2 on the liposome membrane was observed by confocal laser scanning microscopy. CDH2 liposomes showed Ca(2+)-dependent association. CDH2-mediated association/dissociation in CDH2 liposomes was specific to Ca(2+) and reversible. CDH2-expressing LN-229 cells (human glioblastoma cell) adhered to CDH2 liposomes and small CDH2 liposomes (diameter approximately 150 nm), in particular, were internalized by endocytosis and partly escaped endosomes. Cadherin-containing liposomes show high potential as a new cell-specific proteoliposome. The baculovirus expression-liposome fusion method is useful as a new enabling technology for biomedical applications of functional proteoliposomes. PMID:21944724

Kamiya, Koki; Tsumoto, Kanta; Yoshimura, Tetsuro; Akiyoshi, Kazunari

2011-12-01

160

Magnetism of phthalocyanine-based organometallic single porous sheet.  

PubMed

A two-dimensional (2D) periodic Fe phthalocyanine (FePc) single-layer sheet has very recently been synthesized experimentally (Abel, M.; et al. J. Am. Chem. Soc.2011, 133, 1203), providing a novel pathway for achieving 2D atomic sheets with regularly and separately distributed transition-metal atoms for unprecedented applications. Here we present first-principles calculations based on density functional theory to investigate systematically the electronic and magnetic properties of such novel organometallics (labeled as TMPc, TM = Cr-Zn) as free-standing sheets. Among them, we found that only the 2D MnPc framework is ferromagnetic, while 2D CrPc, FePc, CoPc, and CuPc are antiferromagnetic and 2D NiPc and ZnPc are nonmagnetic. The difference in magnetic couplings for the studied systems is related to the different orbital interactions. Only MnPc displays metallic d(xz) and d(yz) orbitals that can hybridize with p electrons of Pc, which mediates the long-range ferromagnetic coupling. Monte Carlo simulations based on the Ising model suggest that the Curie temperature (T(C)) of the 2D MnPc framework is ?150 K, which is comparable to the highest T(C) achieved experimentally, that of Mn-doped GaAs. The present study provides theoretical insight leading to a better understanding of novel phthalocyanine-based 2D structures beyond graphene and BN sheets. PMID:21838296

Zhou, Jian; Sun, Qiang

2011-09-28

161

Rational Design of a Zinc Phthalocyanine Binding Protein  

PubMed Central

Phthalocyanines have long been used as primary donor molecules in synthetic light-powered devices due to their superior properties when compared to natural light activated molecules such as chlorophylls. Their use in biological contexts, however, has been severely restricted due to their high degree of self-association, and its attendant photoquenching, in aqueous environments. To this end we report the rational redesign of a de novo four helix bundle di-heme binding protein into a heme and Zinc(II) phthalocyanine (ZnPc) dyad in which the ZnPc is electronically and photonically isolated. The redesign required transformation of the homodimeric protein into a single chain four helix bundle and the addition of a negatively charge sulfonate ion to the ZnPc macrocycle. To explore the role of topology on ZnPc binding two constructs were made and the resulting differences in affinity can be explained by steric interference of the newly added connecting loop. Singular binding of ZnPc was verified by absorption, fluorescence, and magnetic circular dichroism spectroscopy. The engineering guidelines determined here, which enable the simple insertion of a monomeric ZnPc binding site into an artificial helical bundle, are a robust starting point for the creation of functional photoactive nanodevices. PMID:23827257

Mutter, Andrew C.; Norman, Jessica A.; Tiedemann, Michael T.; Singh, Sunaina; Sha, Sha; Morsi, Sara; Ahmed, Ismail; Stillman, Martin J.; Koder, Ronald L.

2014-01-01

162

Analysis of individual lipoproteins and liposomes  

SciTech Connect

We describe the application of single molecule detection (SMD) technologies for the analysis of natural (serum lipoproteins) and synthetic (liposomes) transport systems. The need for advanced analytical procedures of these complex and important systems is presented with the specific enhancements afforded by SMD with flowing sample streams. In contrast to bulk measurements which yield only average values, measurement of individual species allows creation of population histograms from heterogeneous samples. The data are acquired in minutes and the analysis requires relatively small sample quantities. Preliminary data are presented from the analysis of low density lipoprotein, and multilamellar and unilamellar vesicles.

Robbins, D.L.; Keller, R.A.; Nolan, J.P. [and others

1997-08-01

163

Delivery of aerosolized drugs encapsulated in liposomes  

SciTech Connect

Mycobacterium tuberculosis (Mtb) is an infectious disease that resides in the human lung. Due to the difficulty in completely killing off the disease in infected individuals, Mtb has developed drug-resistant forms and is on the rise in the human population. Therefore, ITRI and the University of New Mexico are collaborating to explore the treatment of Mtb by an aerosolized drug delivered directly to the lungs. In conclusion, it is feasible to obtain an appropriate size and concentration of the liposomes before and after aerosolization.

Cheng, Yung-Sung; Lyons, C.R. [Univ. of New Mexico, Albuquerque, NM (United States); Schmid, M.H.

1995-12-01

164

Involvement of lipid rafts in macrophage apoptosis induced by cationic liposomes  

Microsoft Academic Search

We have demonstrated that protein kinase C? (PKC?) could be involved in macrophage apoptosis induced by cationic liposomes composed of stearylamine (SA-liposomes), but the detailed mechanism of how SA-liposomes activate PKC? has remained unclear. In this paper, we clarified whether lipid rafts are involved in the PKC? activation induced by SA-liposomes. Co-localization of SA-liposomes and Cholera toxin B subunit (CBT),

Masaya Arisaka; Katsuki Takano; Yoichi Negishi; Hidetoshi Arima; Yukihiko Aramaki

2011-01-01

165

Spectroscopic insights on imidazole substituted phthalocyanine photosensitizers: Fluorescence properties, triplet state and singlet oxygen generation  

NASA Astrophysics Data System (ADS)

Imidazole substituted metal phthalocyanine (Pc) complexes were synthesized. UV-vis absorption, steady state and time-resolved fluorescence, as well as laser flash photolysis were used to measure the photophysical and photosensitizing properties. All the imidazole-phthalocyanine conjugates show high ?T (quantum yield of excited triplet formation), high ?? (singlet oxygen formation yield, >0.50) and good fluorescence properties (quantum yield ?f > 0.20 and lifetime ?f > 3.0 ns). Compared to the unsubstituted Pc, both ?- and ?-imidazole substitutions result in the remarkable decrease in ?f and ?f, but the ?-substitution is stronger. The imidazole substitution, on the other hand, causes the increase of ?T, ?T, and ?? values. Magnesium phthalocyanine (MgPc) is more susceptible to the substitution than zinc phthalocyanine (ZnPc). The mechanism responsible for the result is suggested based on the involvement of intramolecular photoinduced electron transfer. The high ?? and appropriate fluorescence properties make the Pcs good candidate for PDT photosensitizers.

Zhang, Xian-Fu; Lin, Yong; Guo, Wenfeng; Zhu, Jingzhong

2014-12-01

166

Intrinsic dielectric properties and charge transport in oligomers of organic semiconductor copper phthalocyanine  

E-print Network

in the experimentally detected dielectric response of organic semi- conductor copper phthalocyanine. While a giantIntrinsic dielectric properties and charge transport in oligomers of organic semiconductor copper. Huang and Q. M. Zhang Electrical Engineering Department and Materials Research Institute

Bobnar, Vid

167

Spectroscopic insights on imidazole substituted phthalocyanine photosensitizers: fluorescence properties, triplet state and singlet oxygen generation.  

PubMed

Imidazole substituted metal phthalocyanine (Pc) complexes were synthesized. UV-vis absorption, steady state and time-resolved fluorescence, as well as laser flash photolysis were used to measure the photophysical and photosensitizing properties. All the imidazole-phthalocyanine conjugates show high ?T (quantum yield of excited triplet formation), high ?? (singlet oxygen formation yield, >0.50) and good fluorescence properties (quantum yield ?f>0.20 and lifetime ?f>3.0 ns). Compared to the unsubstituted Pc, both ?- and ?-imidazole substitutions result in the remarkable decrease in ?f and ?f, but the ?-substitution is stronger. The imidazole substitution, on the other hand, causes the increase of ?T, ?T, and ?? values. Magnesium phthalocyanine (MgPc) is more susceptible to the substitution than zinc phthalocyanine (ZnPc). The mechanism responsible for the result is suggested based on the involvement of intramolecular photoinduced electron transfer. The high ?? and appropriate fluorescence properties make the Pcs good candidate for PDT photosensitizers. PMID:24997445

Zhang, Xian-Fu; Lin, Yong; Guo, Wenfeng; Zhu, Jingzhong

2014-12-10

168

Designing of new thermo stabile phthalocyanines: synthesis, characterization, and thermal studies  

Microsoft Academic Search

In this study, new phthalonitrile and phthalocyanines were synthesized and characterized. Starting material compound 3 was obtained by reaction of ninhydrin with 4-nitrophthalonitrile. Phthalocyanines 4–8 were prepared by reaction 4-(2-phenoxy-1, 3-dioxo-2, 3-dihydro-1H-inden-2-yloxy) phthalonitrile with corresponding metal salts. Compound 9 was obtained by reaction of phthaocyanine 4 with NaOH. This compound is soluble in water as sodium salts. Thermal properties of

M. Salih A??rta?; ?lkay Gümü?; M. Sait ?zgi

2012-01-01

169

Tuning pH sensitivities of zinc phthalocyanines in ionic liquid modified matrices  

Microsoft Academic Search

Phthalocyanine dyes are clinically important bright fluorophores with many desirable properties. Their absorption and emission maxima in near infrared region make them proper tool for optical probing of biologically relevant materials and optical-chemical-sensing purposes. In this work we have shown that pH sensitivities of the phthalocyanines can be manipulated as desired. This property makes the Pcs very proper photosensitizers for

Sevinc Zehra Topal; Kadriye Ertekin; Ay?e Gül Gürek; Berrin Yenigul; Vefa Ahsen

2011-01-01

170

Solvent-Free Synthesis of Soluble, Near-IR Absorbing Titanyl Phthalocyanine Derivatives  

SciTech Connect

Solvent-free synthesis of a series of alkylthio-substituted titanyl phthalocyanine (TiOPc) derivatives starting from the corresponding phthalonitriles (Pn) is reported. This methodology eliminates the formation of the unmetalated phthalocyanine (H{sub 2}Pc), a side product that makes purification difficult. The alkylthio groups on the reported derivatives enhance solubility in common organic solvents and shift the absorption to the near-IR region.

Mayukh, Mayank; Sema, Clarissa M.; Roberts, Jessica M.; McGrath, Dominic V.

2010-01-01

171

Communication: Influence of graphene interlayers on the interaction between cobalt phthalocyanine and Ni(111)  

SciTech Connect

The influence of graphene interlayers on electronic interface properties of cobalt phthalocyanine on Ni(111) is studied using both photoemission and X-ray absorption spectroscopy. A charge transfer associated with a redistribution of the d-electrons at the Co-atom of the phthalocyanine occurs at the interface to Ni(111). Even a graphene buffer layer cannot prevent the charge transfer at the interface to Ni(111); however, the detailed electronic situation is different.

Uihlein, Johannes; Peisert, Heiko; Glaser, Mathias; Polek, Malgorzata; Adler, Hilmar; Petraki, Fotini; Chasse, Thomas [Universitaet Tuebingen, Institut fuer Physikalische und Theoretische Chemie, Auf der Morgenstelle 18, 72076 Tuebingen (Germany); Ovsyannikov, Ruslan; Bauer, Maximilian [Helmholtz Zentrum Berlin fuer Materialien und Energie GmbH, Elektronenspeicherring BESSY II, Albert-Einstein-Str. 15, 12489 Berlin (Germany)

2013-02-28

172

Sulfonamide-substituted iron phthalocyanine: design, solubility range, stability and oxidation of olefins.  

PubMed

4-tert-Butylbenzenesulfonamide was used as a substituent of tetra peripherally substituted Fe(ii) phthalocyanine, taking into account several parameters crucial for the design of potential oxidation catalysts such as solubility and stability. The resulting phthalocyanine exhibits a remarkable stability under oxidative conditions. The main product of the oxidation of cyclohexene using H2O2 as the oxidant is the allylic ketone, 2-cyclohexen-1-one. Styrene oxidation led mainly to the formation of benzaldehyde. PMID:25355136

I?ci, Umit; Caner, Celal; Zorlu, Yunus; Gürek, Ay?e Gül; Dumoulin, Fabienne; Ahsen, Vefa

2014-11-18

173

Conductivity of copper phthalocyanine-polystyrene composite films in the presence of adsorbed oxygen  

NASA Astrophysics Data System (ADS)

The electrical conductivity and adsorption-resistive response to nitrogen dioxide of composite films containing copper phthalocyanine nanoparticles dispersed into the polystyrene matrix are investigated experimentally. The results are analyzed using the two-level model of hopping conductivity. The contributions to the conductivity from intrinsic and impurity localization centers are singled out, and the concentrations of the localization centers in copper phthalocyanines free of impurities as well as the electron localization radii in impurity and intrinsic states are determined.

Pochtennyi, A. E.; Misevich, A. V.; Dolgii, V. K.

2014-09-01

174

Liposomes as carriers of antitumor agents: toward a clinical reality.  

PubMed

For several years, liposomes have been explored as carriers of antitumor agents. Liposomes can be administered intravenously to carry lipid-soluble drugs, to improve drug stability, to target organs with fenestrated capillaries, to achieve an intravascular slow drug-release system, and to reduce drug levels in certain organs sensitive to toxicity. They also have significant potential for local therapy when administered subcutaneously or intraperitoneally. The preclinical development of liposome-entrapped antitumor agents has been, in general, slowed by cumbersome formulation problems. However, during the last few years, new drug loading techniques and a better selection of the drugs for liposome entrapment have resulted in pharmaceutically acceptable liposomal formulations or antitumor agents. Three preparations have been approved by the Federal Drug Administration, two containing doxorubicin, and the other a new lipophilic cisplatin analogue [cis-bis-neodecanoato-trans-R,R-1,2-diamino-cyclohexane platinum (II)]. In preclinical studies, these preparations were shown to be less toxic than the parent compounds and more active in models of liver micrometastases. Clinical Phase I and II studies with these formulations are now in progress. Although liposomal antitumor agents have no established role in the anticancer armamentarium at this stage, the information available suggests that they may improve the therapeutic index or broaden the applications of available antitumor agents and possibly act as carriers for newly designed liposome-dependent antitumor agents. PMID:2670206

Perez-Soler, R

1989-06-01

175

Droplet-Based Production of Liposomes  

NASA Technical Reports Server (NTRS)

A process for making monodisperse liposomes having lipid bilayer membranes involves fewer, simpler process steps than do related prior methods. First, a microfluidic, cross junction droplet generator is used to produce vesicles comprising aqueous solution droplets contained in single layer lipid membranes. The vesicles are collected in a lipid-solvent mix that is at most partially soluble in water and is less dense than is water. A layer of water is dispensed on top of the solvent. By virtue of the difference in densities, the water sinks to the bottom and the solvent floats to the top. The vesicles, which have almost the same density as that of water, become exchanged into the water instead of floating to the top. As there are excess lipids in the solvent solution, in order for the vesicles to remain in the water, the addition of a second lipid layer to each vesicle is energetically favored. The resulting lipid bilayers present the hydrophilic ends of the lipid molecules to both the inner and outer membrane surfaces. If lipids of a second kind are dissolved in the solvent in sufficient excess before use, then asymmetric liposomes may be formed.

Ackley, Donald E.; Forster, Anita

2009-01-01

176

Photophysical property of a polymeric nanoparticle loaded with an aryl benzyl ester silicon (IV) phthalocyanine  

NASA Astrophysics Data System (ADS)

Because of their excellent near-infrared (NIR) optical properties, phthalocyanines (Pcs) have been regarded as promising therapy agents for fluorescence image-guided drug delivery and noninvasive treatment of tumors by photodynamic therapy (PDT). Nevertheless, phthalocyanines are substantially limited in clinical applications owing to their poor solubility, aggregation and insufficient selectivity for cancer cells. To address these issues, we have developed a novel dendrimer-based theranostic nanoparticle for tumor-targeted delivery of phthalocyanine. The preparation procedure involved the modification of the silicon (IV) phthalocyanine molecule with a dendritic axially substitution, which significantly enhances their photophysical property. In order to improve biocompatibility and tumor-targeted delivery, the hydrophobic dendritic phthalocyanine was encapsulated by diblock amphiphilic copolymer poly (ethylene glycol)-poly (Epsilon-caprolactone) (MPEG-PCL) to form a polymeric nanoparticle. The polymeric nanoparticle is spherical with a diameter at about 90 nm. The photophysical property of the polymeric nanoparticle was studied by UV/Vis and fluorescence spectroscopic methods. Compared with the free dendritic phthalocyanine, the Q band of the polymeric nanoparticle was red-shifted, and the fluorescence intensity decreased. Furthermore, the polymeric nanoparticle has a relatively high loading amount and encapsulation rate. Therefore, the polymeric nanoparticle would be a promising third-generation photosensitizer (PS) for PDT.

Pan, Sujuan; Ma, Dongdong; Chen, Xiuqin; Wang, Yuhua; Yang, Hongqin; Peng, Yiru

2014-09-01

177

Pharmacokinetics of Liposomal Amphotericin B in Pleural Fluid?  

PubMed Central

We report the penetration of liposomal amphotericin B into the pleural fluid of a patient with pulmonary zygomycosis and empyema. The ratio of area under the concentration-versus-time curve in pleural fluid (AUCpleural fluid) to that in serum (AUCserum) for liposomal amphotericin B over 24 h was 9.4%, with pleural fluid concentrations of 2.12 to 4.91 ?g/ml. Given the relatively low level of intrapleural penetration of liposomal amphotericin B, chest tube drainage may be warranted for successful treatment of zygomycotic empyema. PMID:20086161

Moriyama, Brad; Torabi-Parizi, Parizad; Pratt, Alexandra K.; Henning, Stacey A.; Pennick, Gennethel; Shea, Yvonne R.; Roy Chowdhuri, Sinchita; Rinaldi, Michael G.; Barrett, A. John; Walsh, Thomas J.

2010-01-01

178

Targeted drug delivery and enhanced intracellular release using functionalized liposomes  

NASA Astrophysics Data System (ADS)

The ability to target cancer cells using an appropriate drug delivery system can significantly reduce the associated side effects from cancer therapies and can help in improving the overall quality of life, post cancer survival. Integrin alpha5beta1 is expressed on several types of cancer cells, including colon cancer and plays an important role in tumor growth and metastasis. Thus, the ability to target the integrin alpha 5beta1 using an appropriate drug delivery nano-vector can significantly help in inhibiting tumor growth and reducing tumor metastasis. The work in this thesis focuses on designing and optimizing, functionalized stealth liposomes (liposomes covered with polyethylene glycol (PEG)) that specifically target the integrin alpha5beta1. The PEG provides a steric barrier allowing the liposomes to circulate in the blood for longer duration and the functionalizing moiety, PR_b peptide specifically recognizes and binds to integrin alpha5beta1 expressing cells. The work demonstrates that by optimizing the amount of PEG and PR_b on the liposomal interface, nano-vectors can be engineered that bind to CT26.WT colon cancer cells in a specific manner and internalize through alpha 5beta1-mediated endocytosis. To further improve the efficacy of the system, PR_b functionalized pH-sensitive stealth liposomes that exhibit triggered release under mild acidic conditions present in endocytotic vesicles were designed. The study showed that PR_b functionalized pH-sensitive stealth liposomes, undergo destabilization under mildly acidic conditions and incorporation of the PR_b peptide does not significantly affect the pH-sensitivity of the liposomes. PR_b functionalized pH-sensitive stealth liposomes bind to CT26.WT colon carcinoma cells that express integrin alpha5beta 1, undergo cellular internalization, and release their load intracellularly in a short period of time as compared to other formulations. PR_b-targeted pH-sensitive stealth liposomes encapsulating 5-fluorouracil (5-FU) show significantly higher cytotoxicity than the PR_b-targeted inert stealth liposomes and the non-targeted stealth liposomes (both pH-sensitive and inert). The studies demonstrated that optimized PR_b functionalized pH sensitive liposomes have the potential to deliver a payload, such as chemotherapeutic agents, directly to colon cancer cells in an efficient and specific manner.

Garg, Ashish

179

Studies on precellular evolution - The encapsulation of polyribonucleotides by liposomes  

NASA Technical Reports Server (NTRS)

Liposomes have been suggested as possible models of precellular systems formed in the early Archean earth from lipids of nonenzymatic origin. Since it is generally accepted that RNA molecules preceded double-stranded DNA molecules as genetic material, the encapsulation of polyribonucleotides within liposomes (made from dipalmitoyl phosphatidylcholine and from egg yolk phosphatidylcholine) was studied. Quantitative determinations show that approximately 50 percent of the available lipids form liposomes, and that up to 5 percent of the polyribonucleotides can be entrapped by them. Also studied was the encapsulation of polyribonucleotides in the presence of urea and cyanamide and of Zn(2+) and Pb(2+).

Baeza, I.; Ibanez, M.; Santiago, J. C.; Wong, C.; Lazcano, A.

1986-01-01

180

Photodynamic therapy potential of thiol-stabilized CdTe quantum dot-group 3A phthalocyanine conjugates (QD-Pc).  

PubMed

Thiol stabilized CdTe quantum dot (QD) nanoparticles were synthesized in aqueous phase and were used as energy donors to tetra-triethyleneoxythia substituted aluminum, gallium and indium phthalocyanines through fluorescence resonance energy transfer (FRET). Energy transfer occurred from the QDs to phthalocyanines upon photoexcitation of the QDs. An enhancement in efficiency of energy transfer with the nature of the carboxylic thiol stabilizer on the QDs was observed. As a result of the nanoparticle and the phthalocyanine mixing, the photoluminescence efficiency of the phthalocyanine moieties in the mixtures does not strictly follow the quantum yields of the bare phthalocyanines. The photochemistry study of phthalocyanines in the presence of the QDs revealed high singlet oxygen quantum yield, hence the possibility of using QDs in combination with phthalocyanines as photosensitizers in photodynamic therapy of cancer. The fluorescence of the CdTe quantum dots-phthalocyanine conjugates (QDs-Pc) were effectively quenched by addition of 1,4-benzoquinone. PMID:22484269

Tekda?, Duygu Ayd?n; Durmu?, Mahmut; Yan?k, Hülya; Ahsen, Vefa

2012-07-01

181

Thermal and photic stimuli-responsive polydiacetylene liposomes with reversible fluorescence  

NASA Astrophysics Data System (ADS)

A novel reversible fluorescent switch of a polydiacetylene liposome (PDA liposome) was realized by alternating heating and UV irradiation processes. The reversible fluorescence switching of the PDA liposome was mainly caused by the microstructural changes of the PDA backbone in the PDA liposomes under the alternating conditions of heating and UV irradiation.A novel reversible fluorescent switch of a polydiacetylene liposome (PDA liposome) was realized by alternating heating and UV irradiation processes. The reversible fluorescence switching of the PDA liposome was mainly caused by the microstructural changes of the PDA backbone in the PDA liposomes under the alternating conditions of heating and UV irradiation. Electronic supplementary information (ESI) available: The preparation method, cytotoxicity and biocompatibility assays and HREM images of PDA liposomes. See DOI: 10.1039/c3nr00954h

Yan, Xiaojuan; An, Xueqin

2013-06-01

182

Magnetoresistance effects in phthalocyanine based magnetic tunnel Junctions  

NASA Astrophysics Data System (ADS)

We will report on the fabrication and magneto-transport properties of nanometer size organic magnetic tunnel junctions based on the cobalt-phthalocyanine organic semiconductor. We will present spin dependent transport measurements in Co/CoPc/Co magnetic tunnel junctions where the thickness of the organic semiconductor is only few nm. We have observed a significant magnetoresistance effect at low temperature. Two contributions to the magnetoresistance are isolated: a tunnel anisotropic magnetoresistance (TAMR) and a spin valve effect associated to the magnetic configuration of Co electrodes (parallel and antiparallel magnetic configurations). Strong variations of coercive fields with respect to angle measurements and to the bias voltage were observed. The bias dependence of MR effects was also studied and revealed an interesting new behavior compared to standard inorganic magnetic tunnel junctions. All these results will be discussed.

Barraud, C.; Mattana, R.; Seneor, P.; Fusil, S.; Bouzehouane, K.; Deranlot, C.; Petroff, F.; Fert, A.; Beaufrand, J. B.; Kim, D. J.; Rakshit, R.; Arakski, J.; Boukari, S.; Bowen, M.; Beaurepaire, E.

2010-03-01

183

Laser deposition of sulfonated phthalocyanines for gas sensors  

NASA Astrophysics Data System (ADS)

Thin layers of nickel and copper tetrasulfonated phthalocyanines (NiPcTS and CuPcTS) were prepared by Matrix Assisted Pulsed Laser Evaporation method. The depositions were carried out with KrF excimer laser (energy density of laser radiation EL = 0.1-0.5 J cm-2) from dimethylsulfoxide matrix. For both materials the ablation threshold EL-th was determined. The following properties of deposited layers were characterized: (a) chemical composition (FTIR spectra); (b) morphology (SEM and AFM portraits); and (c) impedance of gas sensors based on NiPcTS and CuPcTS layers in the presence of two analytes - hydrogen and ozone. The prepared sensors exhibit response to 1000 ppm of hydrogen and 100 ppb of ozone even at laboratory temperature.

Fitl, Premysl; Vrnata, Martin; Kopecky, Dusan; Vlcek, Jan; Skodova, Jitka; Bulir, Jiri; Novotny, Michal; Pokorny, Petr

2014-05-01

184

Anomalous photoelectric emission from Ag on zinc-phthalocyanine film  

NASA Astrophysics Data System (ADS)

Photoelectric emission from organic and metal thin films is generally observed with irradiation of photon energy larger than 4 eV. In this paper, however, we report photoelectric emission from Ag on a zinc-phthalocyanine (ZnPc) layer at a photon energy of 3.4 eV. The threshold energy for this photoelectric emission is much smaller than the work function of Ag estimated by conventional photoelectron spectroscopy. The photoelectric emission by low-energy photons is significant for Ag thicknesses of less than 1 nm. Photoelectron spectroscopy and morphological study of the Ag/ZnPc suggest that the anomalous photoelectric emission from the Ag surface is caused by a vacuum level shift at the Ag/ZnPc interface and by surface plasmons of the Ag nanoparticles.

Tanaka, Senku; Otani, Tomohiro; Fukuzawa, Ken; Ogawa, Koji; Azuma, Junpei; Yamamoto, Isamu; Takahashi, Kazutoshi; Kamada, Masao; Hiromitsu, Ichiro

2014-05-01

185

Thermal boundary resistance of copper phthalocyanine-metal interface  

NASA Astrophysics Data System (ADS)

Systems containing interfaces between dissimilar materials can exhibit lower thermal conductivity than their pure constituents, with important implications for thermal management and thermoelectric energy conversion. However, the heat transfer processes at such interfaces, in particular those between organic and inorganic materials, remain for the most part uncharacterized. We use vacuum thermal evaporation to grow archetypal multilayer thin films of copper phthalocyanine (CuPc) and Ag or Al, and measure their thermal conductivity as a function of interface density. We observe large thermal boundary resistance values (7.8×10-8 m2 K/W for CuPc/Ag and 2.0×10-8 m2 K/W for CuPc/Al), attributable to acoustic mismatch, heat carrier mismatch, and weak bonding.

Jin, Y.; Yadav, A.; Sun, K.; Sun, H.; Pipe, K. P.; Shtein, M.

2011-02-01

186

Effects of the liposomal formulation on the behavior and physical characteristics of acoustic liposomes  

NASA Astrophysics Data System (ADS)

Ultrasound contrast agents (UCAs) are nano/microbubbles that contain air or a highmolecular-weight, low-solubility gas encapsulated in a lipid or albumin shell. Previous studies have developed acoustic liposomes (ALs), liposomes that encapsulate perfluoropropane (C3F8) gas. These ALs can be used as just UCAs, for early diagnostic or observation of angiogenesis. They can also be used for drug delivery, through their ultrasound-induced destruction leading to permeabilization of the neighboring cells. However, the echogenicity of ALs decreases within minutes, raising the need for more stable preparations. Here we show that the in vitro stability of ALs is affected by fluidity changes in the bilayer, the presence of anionic phospholipids and the density of the PEG coating layer. These results allowed the preparation of "optimized" ALs displaying a 50% enhanced detection time in vitro. We anticipate their stability to be enhanced in a similar manner, in vivo. Further research aims at further improvement of the stability of gas encapsulation by surface modification and coating of the liposomes, and in vivo characterization of the optimized ALs.

Sax, Nicolas; Horie, Sachiko; Li, Li; Sakamoto, Maya; Mori, Shiro; Kodama, Tetsuya

2012-09-01

187

Structural analysis of ``flexible'' liposome formulations: new insights into the skin-penetrating ability of soft nanostructures  

E-print Network

Structural analysis of ``flexible'' liposome formulations: new insights into the skin. The main examples of these are the so-called ``flexible liposomes'', which are mixtures of lipids corneum. Here, we reexamine the structure of ``flexible'' liposome formulations and show

Raghavan, Srinivasa

188

Galactodendritic phthalocyanine targets carbohydrate-binding proteins enhancing photodynamic therapy.  

PubMed

Photosensitizers (PSs) are of crucial importance in the effectiveness of photodynamic therapy (PDT) for cancer. Due to their high reactive oxygen species production and strong absorption in the wavelength range between 650 and 850 nm, where tissue light penetration is rather high, phthalocyanines (Pcs) have been studied as PSs of excellence. In this work, we report the evaluation of a phthalocyanine surrounded by a carbohydrate shell of sixteen galactose units distributed in a dendritic manner (PcGal16) as a new and efficient third generation PSs for PDT against two bladder cancer cell lines, HT-1376 and UM-UC-3. Here, we define the role of galacto-dendritic units in promoting the uptake of a Pc through interaction with GLUT1 and galectin-1. The photoactivation of PcGal16 induces cell death by generating oxidative stress. Although PDT with PcGal16 induces an increase on the activity of antioxidant enzymes immediately after PDT, bladder cancer cells are unable to recover from the PDT-induced damage effects for at least 72 h after treatment. PcGal16 co-localization with galectin-1 and GLUT1 and/or generation of oxidative stress after PcGal16 photoactivation induces changes in the levels of these proteins. Knockdown of galectin-1 and GLUT1, via small interfering RNA (siRNA), in bladder cancer cells decreases intracellular uptake and phototoxicity of PcGal16. The results reported herein show PcGal16 as a promising therapeutic agent for the treatment of bladder cancer, which is the fifth most common type of cancer with the highest rate of recurrence of any cancer. PMID:24763311

Pereira, Patrícia M R; Silva, Sandrina; Cavaleiro, José A S; Ribeiro, Carlos A F; Tomé, João P C; Fernandes, Rosa

2014-01-01

189

Percutaneous permeation measurement of topical phthalocyanine by photoacoustic technique  

NASA Astrophysics Data System (ADS)

This investigation have studied photoacoustic (PA) technique to percutaneous permeation of topical hydroxy-(29H,31H-phthalocyaninate) aluminum (PcAlOH) on pig ear skin. The PcAlOH was incorporated in an emulsion (O/W) (1 mg/dl) with assessed stability parameters of: pH, short and long term stability tests (in the several conditions). The skin was prepared through a heat separation technique, and with a scalpel, the outer skin of the cartilage was removed. The skins were then cut into 4 cm2 pieces and treated with sodium bromide 2 mol/L for 6 h at 37 °C. The epidermis layer was washed with purified water, dried, and stored under reduced pressure until use. The skin permeation kinetics was determined by photoacoustic technique in an open photoacoustic cell. Short (after preparation) and long-term stability tests showed no phase separation. The emulsion developed pH 7.6 and after incorporating the pH was unchanged. The typical times for percutaneous permeation of the emulsion base and emulsion + PcAlOH were 182 (±6) and 438 (±3) s, respectively. This study indicated that the formulations containing PcAlOH have stabile characteristics and show promising results in absorption into the skin. The presence of the photosensitive agent in the formulation contributed significantly to the greater absorption time than observed in the base formulation. The used photoacoustic technical to examine the penetration kinetics of PcAlOH in pig ear skin was adequate and may be employed in the determination of the percutaneous permeation of phthalocyanines.

Silva, Emanoel P. O.; Barja, Paulo R.; Cardoso, Luiz E.; Beltrame, Milton

2012-11-01

190

Real-time observation of liposome bursting induced by acetonitrile.  

PubMed

We show the bursting process of dioleoylphosphatidylcholine (DOPC) liposomes in response to the addition of acetonitrile, a small toxic molecule widely used in the fields of chemistry and industry. The percentage of destroyed liposomes is reduced upon decreasing the acetonitrile fraction in the aqueous solution and vesicle bursting is not observed at volume ratios of 4:6 and below. This indicates that a high fraction of acetonitrile causes the bursting of liposomes, and it is proposed that this occurs through insertion of the molecules into outer leaflet of the lipid bilayer. The elapsed time between initial addition of acetonitrile and liposome bursting at each vesicle is also measured and demonstrated to be dependent on the volume fraction of acetonitrile and the vesicle size. PMID:25065500

Yoshida, Kazunari; Horii, Keitaro; Fujii, Yasuhiro; Nishio, Izumi

2014-10-01

191

Efficacy and toxicity of cisplatin liposomes modified with polyethylenimine.  

PubMed

The polycation transfection agent, polyethylenimine (PEI) was introduced into cisplatin (CDDP)-encapsulated liposomes by modification with amphiphilic PEI-cholesterol (PEI-Chol) to evaluate its potential application in chemotherapeutic drug delivery. Compared with unmodified neutral liposomes (CDDP-NL), the remarkable features of PEI-modified cationic liposomes (CDDP-CL) increased cytotoxicity attributed to enhanced cellular uptake and extended cellular retention resulting from endosome escape in vitro. In a H22 hepatoma-bearing mouse model, CDDP-CL reduced the nephrotoxicity associated with CDDP and had an antitumor activity similar to free drug, without inducing obvious system toxicity. These results confirm that the cationic modification of liposomes with PEI is efficient and safe for antitumor drug delivery. PMID:24791592

Sun, Xiaoyi; Chen, Jinliang; Gu, Xiaohui; Liang, Wenquan; Wang, Junbo

2014-04-01

192

Bioreactor droplets from liposome-stabilized all-aqueous emulsions  

NASA Astrophysics Data System (ADS)

Artificial bioreactors are desirable for in vitro biochemical studies and as protocells. A key challenge is maintaining a favourable internal environment while allowing substrate entry and product departure. We show that semipermeable, size-controlled bioreactors with aqueous, macromolecularly crowded interiors can be assembled by liposome stabilization of an all-aqueous emulsion. Dextran-rich aqueous droplets are dispersed in a continuous polyethylene glycol (PEG)-rich aqueous phase, with coalescence inhibited by adsorbed ~130-nm diameter liposomes. Fluorescence recovery after photobleaching and dynamic light scattering data indicate that the liposomes, which are PEGylated and negatively charged, remain intact at the interface for extended time. Inter-droplet repulsion provides electrostatic stabilization of the emulsion, with droplet coalescence prevented even for submonolayer interfacial coatings. RNA and DNA can enter and exit aqueous droplets by diffusion, with final concentrations dictated by partitioning. The capacity to serve as microscale bioreactors is established by demonstrating a ribozyme cleavage reaction within the liposome-coated droplets.

Dewey, Daniel C.; Strulson, Christopher A.; Cacace, David N.; Bevilacqua, Philip C.; Keating, Christine D.

2014-08-01

193

Atmospheric-pressure guided streamers for liposomal membrane disruption  

SciTech Connect

The potential to use liposomes (LIPs) as a cellular model in order to study interactions of cold atmospheric-pressure plasma with cells is herein investigated. Cold atmospheric-pressure plasma is formed by a dielectric-barrier discharge reactor. Large multilamellar vesicle liposomes, consisted of phosphatidylcholine and cholesterol, are prepared by the thin film hydration technique, to encapsulate a small hydrophilic dye, i.e., calcein. The plasma-induced release of calcein from liposomes is then used as a measure of liposome membrane integrity and, consequently, interaction between the cold atmospheric plasma and lipid bilayers. Physical mechanisms leading to membrane disruption are suggested, based on the plasma characterization including gas temperature calculation.

Svarnas, P.; Aleiferis, Sp. [High Voltage Laboratory, Department of Electrical and Computer Engineering, University of Patras, Rion 26504 (Greece); Matrali, S. H. [Pharmaceutical Technology Laboratory, Department of Pharmacy, University of Patras, Rion 26504 (Greece); Gazeli, K. [High Voltage Laboratory, Department of Electrical and Computer Engineering, University of Patras, Rion 26504 (Greece); IPREM-LCABIE, Plasmas et Applications, UPPA, 64000 Pau (France); Clement, F. [IPREM-LCABIE, Plasmas et Applications, UPPA, 64000 Pau (France); Antimisiaris, S. G. [Pharmaceutical Technology Laboratory, Department of Pharmacy, University of Patras, Rion 26504 (Greece); Institute of Chemical Engineering Sciences (ICES)-FORTH, Rion 26504 (Greece)

2012-12-24

194

Liposomes with polyribonucleotides as model of precellular systems  

NASA Technical Reports Server (NTRS)

Three types of liposomes were prepared under anoxic conditions: from dipalmitoyl phosphatidyl choline (DPPC), from egg yolk phosphatidyl choline (PC), and from PC with cholesterol (PC:Chol). These were used for encapsulation of poly(U) and poly(C). It was found that 36 to 70 percent of the available liposome lipids and 2 to 5 percent of the polyribonucleotides could be entrapped. An enhanced encapsulation of poly(U) and poly(C) by all three types of liposomes was observed in the presence of 0.001 to 0.01 M Zn(2+), with the effect being greatest with DPPC. The presence of 1.0 M urea inhibited the formation of PC liposomes.

Baeza, Isabel; Ibanez, Miguel; Santiago, Carlos; Lazcano, Antonio; Arguello, Carlos

1987-01-01

195

Liposome surface charge influence on skin penetration behaviour.  

PubMed

Vesicular systems have shown their ability to increase dermal and transdermal drug delivery. Their mechanism of drug transport into and through the skin has been investigated but remains a much debated question. Several researchers have outlined that drug penetration can be influenced by modifying the surface charge of liposomes. In the present work we study the influence of particle surface charge on skin penetration. The final purpose is the development of a carrier system which is able to enhance the skin delivery of two model drugs, betamethasone and betamethasone dipropionate. Liposomes were characterised by their size, morphology, zeta potential, encapsulation efficiency and stability. Ex vivo diffusion studies using Franz diffusion cells were performed. Confocal microscopy was performed to visualise the penetration of fluorescently labelled liposomes into the skin. This study showed the potential of negatively charged liposomes to enhance the skin penetration of betamethasone and betamethasone dipropionate. PMID:21458550

Gillet, A; Compère, P; Lecomte, F; Hubert, P; Ducat, E; Evrard, B; Piel, G

2011-06-15

196

Liposomal delivery of boron to tumors for BNCT  

SciTech Connect

Results are reported on the use of liposomes to encapsulate boron containing compounds for use as a delivery vehicle to tumors. An increase in injected dose to the tumor in mammary glands of mice was realized.

Hawthorne, M.F.; Feakes, D.A.; Shelly, K. [Univ. of California, Los Angeles, CA (United States)

1994-12-31

197

Simultaneous Production of Superoxide Radical and Singlet Oxygen by Sulphonated Chloroaluminum Phthalocyanine Incorporated in Human Low-density Lipoproteins: Implications for Photodynamic Therapy¶  

Microsoft Academic Search

Sulfonated chloroaluminum phthalocyanines have been studied for their use in the photodynamic therapy (PDT) of tumors. Plasma low-density lipoproteins (LDL) are important carriers of phthalocyanines in the blood, but on exposure to visible light, phthalocyanine-loaded LDL undergo an oxida- tion process that propagates to erythrocytes. We attempted to identify the reactive species involved in LDL and erythrocyte oxidation by means

Joana Martins; Leonor Almeida; João Laranjinha

2004-01-01

198

Synthetic liposomes are protective from bleomycin-induced lung toxicity  

PubMed Central

Idiopathic pulmonary fibrosis is a devastating disease characterized by a progressive, irreversible, and ultimately lethal form of lung fibrosis. Except for lung transplantation, no effective treatment options currently exist. The bleomycin animal model is one of the best studied models of lung injury and fibrosis. A previous study using mouse tumor models observed that liposome-encapsulated bleomycin exhibited reduced lung toxicity. Therefore, we hypothesized that airway delivery of synthetic phosphatidylcholine-containing liposomes alone would protect mice from bleomycin-induced lung toxicity. C57BL/6 mice were administered uncharged multilamellar liposomes (100 ?l) or PBS vehicle on day 0 by airway delivery. Bleomycin (3.33 U/kg) or saline vehicle was then given intratracheally on day 1 followed by four additional separate doses of liposomes on days 4, 8, 12, and 16. Fluorescent images of liposomes labeled with 1,1?-dioctadecyl-3,3,3?,3? tetramethylindocarbocyanine perchlorate confirmed effective and widespread delivery of liposomes to the lower respiratory tract as well as uptake primarily by alveolar macrophages and to a lesser extent by type II alveolar epithelial cells. Results at day 22, 3 wk after bleomycin treatment, showed that airway delivery of liposomes before and after intratracheal administration of bleomycin significantly reduced bleomycin-induced lung toxicity as evidenced by less body weight loss, chronic lung inflammation, and fibrosis as well as improved lung compliance compared with controls. These data indicate that airway-delivered synthetic liposomes represent a novel treatment strategy to reduce the lung toxicity associated with bleomycin in a mouse model. PMID:21602446

Gwinn, William M.; Kapita, Mayanga C.; Wang, Ping M.; Cesta, Mark F.

2011-01-01

199

Development of a liposomal nanodelivery system for nevirapine  

PubMed Central

Background The treatment of AIDS remains a serious challenge owing to high genetic variation of Human Immunodeficiency Virus type 1 (HIV-1). The use of different antiretroviral drugs (ARV) is significantly limited by severe side-effects that further compromise the quality of life of the AIDS patient. In the present study, we have evaluated a liposome system for the delivery of nevirapine, a hydrophobic non-nucleoside reverse transcriptase inhibitor. Liposomes were prepared from egg phospholipids using thin film hydration. The parameters of the process were optimized to obtain spherical liposomes below 200 nm with a narrow polydispersity. The encapsulation efficiency of the liposomes was optimized at different ratios of egg phospholipid to cholesterol as well as drug to total lipid. The data demonstrate that encapsulation efficiency of 78.14% and 76.25% were obtained at egg phospholipid to cholesterol ratio of 9:1 and drug to lipid ratio of 1:5, respectively. We further observed that the size of the liposomes and the encapsulation efficiency of the drug increased concomitantly with the increasing ratio of drug and lipid and that maximum stability was observed at the physiological pH. Thermal analysis of the drug encapsulated liposomes indicated the formation of a homogenous drug-lipid system. The magnitude of drug release from the liposomes was examined under different experimental conditions including in phosphate buffered saline (PBS), Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum or in the presence of an external stimulus such as low frequency ultrasound. Within the first 20 minutes 40, 60 and 100% of the drug was released when placed in PBS, DMEM or when ultrasound was applied, respectively. We propose that nevirapine-loaded liposomal formulations reported here could improve targeted delivery of the anti-retroviral drugs to select compartments and cells and alleviate systemic toxic side effects as a consequence. PMID:20624325

2010-01-01

200

In-situ transmission electron microscopy of liposomes in an aqueous environment.  

PubMed

The characterization of liposomes was undertaken using in-situ microfluidic transmission electron microscopy. Liposomes were imaged without contrast enhancement staining or cryogenic treatment, allowing for the observation of functional liposomes in an aqueous environment. The stability and quality of the liposome structures observed were found to be highly dependent on the surface and liposome chemistries within the liquid cell. The successful imaging of liposomes suggests the potential for the extension of in-situ microfluidic TEM to a wide variety of other biological and soft matter systems and processes. PMID:23886420

Hoppe, Sarah M; Sasaki, Darryl Y; Kinghorn, Aubrianna N; Hattar, Khalid

2013-08-13

201

[Stability and absorption of liposomes with incorporated insulin in the small intestine].  

PubMed

Lecithin-cholesterol liposomes with the incorporated insulin were studied in vitro for their stability to the action of some factors of gastrointestinal tract--hydrochloric acid, gastric juice, pepsin, trypsin, bile. A considerable destructive action of bile on liposomes is established. Modification of the lipid composition of liposomes makes it possible to increase their stability to the bile action. Suction of liposomes from the isolated sites of rat small intestine is studied. Insulin from liposomes is established to be sucked most intensive from the initial parts of small intestine. In this case it penetrates into the blood bed not in a free state but in the composition of liposomes. PMID:3518173

Stefanov, A V; Lishko, V K; Shevchenko, A V; Efimov, A S; Khovaka, V V

1986-01-01

202

Liposome distribution after intravenous and selective intraarterial infusion in dogs  

SciTech Connect

In an effort to improve hepatic uptake of liposomes for drug delivery, empty vesicles were administered by means of selective arterial infusion. Negatively charged, multilamellar liposomes were labeled with technetium-99m and infused into healthy adult dogs. Each dog received 100 mg/m2 of lipid over 10 minutes at 2 mL/min. Liposomes were administered via the common hepatic artery after proximal occlusion of the gastroduodenal artery, via the cranial mesenteric artery, and via the cephalic vein. Distribution (liver, spleen, and lungs) was determined by computer-assisted external imaging techniques. On the average, after arterial infusion, 69.2% of the total activity was located in the liver, 3.6% in the spleen, 3.2% in the lungs, and 3.5% in the general circulation. Following venous injection, 50.7% of the radioactivity was found in the liver, 9.1% in the spleen, 8.6% in the lungs, and 6.7% in the peripheral blood. Once the liposomes entered the systemic circulation, they were cleared at the same rate (half-life beta = 21.5 hours) independent of their route of administration. Increased hepatic liposome uptake should translate into higher local and lower systemic liposomal drug levels.

Wright, K.C.; Kasi, L.P.; Jahns, M.S.; Hashimoto, S.; Wallace, S. (Univ. of Texas M.D. Anderson Cancer Center, Houston (USA))

1990-09-01

203

Ultrasonic Activation of Thermally Sensitive Liposomes  

NASA Astrophysics Data System (ADS)

Cancerous cells are known to be more vulnerable to mild hyperthermia than healthy cells, which can survive temperatures above 43° C for brief periods of time. Currently in phase III clinical trials for liver cancer, ThermoDox® (Celsion Corporation) is a drug delivery system containing doxorubicin, a common anti-cancer agent, encapsulated within a thermally sensitive liposome designed to release its contents above 39.5° C. Activation of such an agent with the use of HIFU, which can generate localized heating non-invasively, would combine the benefits of targeted chemotherapy and hyperthermia while minimizing undesirable systemic side-effects. To that end, the resolution and reliability with which HIFU-induced hyperthermia can achieve Thermodox® release was investigated using a novel agar-based gel embedding liposomes at clinically relevant concentrations (0.02 mg/ml). The gel was exposed to 1.15 MHz HIFU (Sonic Concepts H102) using a range of clinically relevant pressure amplitudes (0-6 MPa peak rarefactional), duty cycles (10-100%) and exposure durations to identify optimal insonation conditions for complete doxorubicin release. The corresponding temperature profiles were mapped with 0.5 mm spatial resolution using an embedded needle thermocouple; drug release was quantified using fluorimetry. Complete release over the HIFU focal area was obtained for 6-s continuous wave exposure at 5.2 MPa peak rarefactional pressure, i.e. under exposure conditions for which the temperature exceeded 43° C throughout the focal volume. For a given HIFU energy input, both the final temperature reached and the rate of heating were found to affect release significantly. However, ThermoDox® release was achieved only due to thermal effects of HIFU, and not by other ultrasound effects, such as cavitation without heating, showing robustness of HIFU-induced hyperthermia as a release mechanism.

Mylonopouloua, Eleonora; Arvanitisa, Costas D.; Bazan-Peregrinoa, Miriam; Arora, Manish; Coussios, Constantin C.

2010-03-01

204

Stealth liposomes: review of the basic science, rationale, and clinical applications, existing and potential  

PubMed Central

Among several promising new drug-delivery systems, liposomes represent an advanced technology to deliver active molecules to the site of action, and at present several formulations are in clinical use. Research on liposome technology has progressed from conventional vesicles (“first-generation liposomes”) to “second-generation liposomes”, in which long-circulating liposomes are obtained by modulating the lipid composition, size, and charge of the vesicle. Liposomes with modified surfaces have also been developed using several molecules, such as glycolipids or sialic acid. A significant step in the development of long-circulating liposomes came with inclusion of the synthetic polymer poly-(ethylene glycol) (PEG) in liposome composition. The presence of PEG on the surface of the liposomal carrier has been shown to extend blood-circulation time while reducing mononuclear phagocyte system uptake (stealth liposomes). This technology has resulted in a large number of liposome formulations encapsulating active molecules, with high target efficiency and activity. Further, by synthetic modification of the terminal PEG molecule, stealth liposomes can be actively targeted with monoclonal antibodies or ligands. This review focuses on stealth technology and summarizes pre-clinical and clinical data relating to the principal liposome formulations; it also discusses emerging trends of this promising technology. PMID:17717971

Immordino, Maria Laura; Dosio, Franco; Cattel, Luigi

2006-01-01

205

Porphyrins XXIV. Energy, oscillator strength, and Zeeman splitting calculations (SCMO-CI) for phthalocyanine, porphyrins, and related ring systems  

Microsoft Academic Search

Extensive CI calculations have been done on free base porphin and the metallo derivative of porphin, tetrazaporphin, phthalocyanine, various benzporphins, chlorin, and bacteriochlorin. The transition gradient operator gives good agreement with experimental intensities. Free base porphin may have a weakp-p* transition around 480nm. Tetrabenzporphin and phthalocyanine are predicted to have much more intensity around 50000 cm-1 than porphin and tetrazaporphin

A. J. McHugh; Martin Gouterman; Charles Weiss

1972-01-01

206

Immobilization of zinc phthalocyanines in silicate matrices and investigation of their photobactericidal effect on E. coli.  

PubMed

The aim of the present investigation was to immobilize zinc phthalocyanines in a silicate matrix and to test the photobactericidal properties of the matrices so prepared toward Esherichia coli in model aqueous media. For the purpose, tetra tertiary butyl zinc phthalocyanine (TBZnPc) and zinc phthalocyanine tetrasulfonic acid (ZnPcTS) were used. The abilities of these two photosensitizers to generate singlet oxygen in solution were compared by following the rate of photobleaching of 1,3-diphenylisobenzofuran (DPBF) at 430 nm in dimethylformamide (DMF). The results of this study show clearly that, under the conditions used here, the TBZnPc is the more effective generator of singlet oxygen; with it the DPBF was virtually completely photobleached in 4 min, while with the ZnPcTS under the same conditions, it took 12 min to reach this point. Glass conjugates with the two phthalocyanines were obtained by the sol-gel technique and were characterized by a well-defined color due to the phthalocyanine incorporated in the silicate matrix. Glasses with an intense, but inhomogeneous, green color were obtained when the tetrasulfonic derivative of the zinc phthalocyanine was used, while blue glasses of evenly distributed coloration were formed from the tetra tertiary butyl derivative. The ZnPcTS conjugate demonstrates more effective singlet oxygen evolution than is the case with the TBZnPc conjugate. These results are the opposite of those obtained for the free phthalocyanines in solution. The structural formulae of the compounds show that TBZnPc has a more pronounced hydrophobic character than the sulfonic derivative. In our view, the relative reactivities of the conjugates can be explained by the tetrasulfonic derivative being situated mainly in the surface parts of the glass matrix where the hydrophilic character is prevailing, while the tertiary butyl derivative is mainly present in the internal parts of the matrix as a result of which it is less accessible and therefore less active. The results obtained on the effect of zinc phthalocyanine conjugates on E. coli show a trend similar to that observed with singlet oxygen evolution shown. Thus, for the ZnPcTS conjugate, the log kill is 1.32 and for the TBZnPc conjugate, it is 0.98, in each case after 120 min. The results obtained show that phthalocyanines can be immobilized successfully in a silicate matrix and used for photodisinfection of microbially polluted waters. The silicate matrix has some advantages in comparison with other organic matrices. It is insoluble in water, resistant towards microorganisms, easy to fabricate, and might be developed successfully for the photodisinfection of water, e.g., in swimming pools and in other open water reservoirs. PMID:16565774

Artarsky, Spas; Dimitrova, Stanislava; Bonnett, Raymond; Krysteva, Milka

2006-01-01

207

Antibacterial effect of cationic porphyrazines and anionic phthalocyanine and their interaction with plasmid DNA  

NASA Astrophysics Data System (ADS)

Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.

Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra

2013-11-01

208

Elaboration of ammonia gas sensors based on electrodeposited polypyrrole--cobalt phthalocyanine hybrid films.  

PubMed

The electrochemical incorporation of a sulfonated cobalt phthalocyanine (sCoPc) in conducting polypyrrole (PPy) was done, in the presence or absence of LiClO4, in order to use the resulting hybrid material for the sensing of ammonia. After electrochemical deposition, the morphological features and structural properties of polypyrrole/phthalocyanine hybrid films were investigated and compared to those of polypyrrole films. A gas sensor consisting in platinum microelectrodes arrays was fabricated using silicon microtechnologies, and the polypyrrole and polypyrrole/phthalocyanine films were electrochemically deposited on the platinum microelectrodes arrays of this gas sensor. When exposed to ammonia, polymer-based gas sensors exhibited a decrease in conductance due to the electron exchange between ammonia and sensitive polymer-based layer. The characteristics of the gas sensors (response time, response amplitude, reversibility) were studied for ammonia concentrations varying from 1 ppm to 100 ppm. Polypyrrole/phthalocyanine films exhibited a high sensitivity and low detection limit to ammonia as well as a fast and reproducible response at room temperature. The response to ammonia exposition of polypyrrole films was found to be strongly enhanced thanks to the incorporation of the phthalocyanine in the polypyrrole matrix. PMID:24209308

Patois, Tilia; Sanchez, Jean-Baptiste; Berger, Franck; Fievet, Patrick; Segut, Olivier; Moutarlier, Virginie; Bouvet, Marcel; Lakard, Boris

2013-12-15

209

Formation of bovine serum albumin associates with zinc tetra(4,4'-carboxy)phenylamino- and tetra-(4,4'-carboxy)phenoxy phthalocyanines in aqueous-organic solutions at 298 K  

NASA Astrophysics Data System (ADS)

The states of water-soluble complexes of zinc phthalocyanine containing -O-C6H4-COONa and -NH-C6H4-COONa substituents in aqueous and organic media are studied. The type of dimerization is determined for each phthalocyanine. Phthalocyanine interaction with bovine serum albumin is studied with respect to the association equilibria. It is shown that phthalocyanines are localized in protein subdomains IB and IIA, and the interaction between protein and phthalocyanines is of a multicenter character.

Lebedeva, N. Sh.; Popova, T. E.; Mal'kova, E. A.; Gubarev, Yu. A.

2013-12-01

210

Clinical development of liposome-based drugs: formulation, characterization, and therapeutic efficacy  

PubMed Central

Research on liposome formulations has progressed from that on conventional vesicles to new generation liposomes, such as cationic liposomes, temperature sensitive liposomes, and virosomes, by modulating the formulation techniques and lipid composition. Many research papers focus on the correlation of blood circulation time and drug accumulation in target tissues with physicochemical properties of liposomal formulations, including particle size, membrane lamellarity, surface charge, permeability, encapsulation volume, shelf time, and release rate. This review is mainly to compare the therapeutic effect of current clinically approved liposome-based drugs with free drugs, and to also determine the clinical effect via liposomal variations in lipid composition. Furthermore, the major preclinical and clinical data related to the principal liposomal formulations are also summarized. PMID:22275822

Chang, Hsin-I; Yeh, Ming-Kung

2012-01-01

211

Liposome-based delivery system for vaccine candidates: constructing an effective formulation.  

PubMed

The discovery of liposomes in 1965 by Bangham and coworkers changed the prospects of drug delivery systems. Since then, the application of liposomes as vaccine delivery systems has been studied extensively. Liposomal vaccine delivery systems are made up of nano- or micro-sized vesicles consisting of phospholipid bilayers, in which the bioactive molecule is encapsulated/entrapped, adsorbed or surface coupled. In general, liposomes are not immunogenic on their own; thus, liposomes combined with immunostimulating ligands (adjuvants) or various other formulations have been used as vaccine delivery systems. A thorough understanding of formulation parameters allows the design of effective liposomal vaccine delivery systems. This article provides an overview of various factors that influence liposomal immunogenicity. In particular, the effects of vesicle size, surface charge, bilayer composition, lamellarity, pegylation and targeting of liposomes are described. PMID:23249332

Giddam, Ashwini Kumar; Giddam, Ashwin Kumar; Zaman, Mehfuz; Skwarczynski, Mariusz; Toth, Istvan

2012-12-01

212

Inhibition of cationic liposomes of (3H)thymidine incorporation into DNA of L1210 cells  

SciTech Connect

The in vitro cytotoxicity of cationic liposomes for L1210 cells was studied by measuring in two hours incubation their effect on (3H) thymidine incorporation into DNA. Liposomes prepared from the mixtures dipalmitoylphosphatidylcholine-cholesterol-stearylamine, egg yolk phosphatidyl-choline-cholesterol-stearylamine and egg yolk phosphatidyl-choline-stearylamine inhibit (3H) thymidine incorporation into L1210 cells DNA. The degree of inhibition increases with incubation time and the concentration of liposomes in the incubations. Liposomes of similar compositions, but without stearylamine (neutral liposomes), did not affect (3H) thymidine incorporation. On the other hand, fluorescence microscopy of cell incubated with liposomes containing 10 mM 6-carboxy fluorescein showed only cationic liposomes adsorbed on the surface of L1210 cells. It is concluded that the inhibition of (3H) thymidine incorporation due to cationic liposomes is partly related to their adsorption on the cell plasma membrane.

Laurent, G.; Laduron, C.; Ruysschaert, J.M.; Deleers, M.

1981-03-01

213

Liposome, gel and lipogelosome formulations containing sodium hyaluronate.  

PubMed

Abstract The moisture-imparting effect of sodium hyaluronate (Na-HA) was investigated in liposome, gel and lipogelosome topical formulations. Sixteen liposome formulations were prepared with or without Na-HA (45?kDa) using various ratios of dimyristoylphosphatidylcholine, 1,2-dimyristoyl-sn-glycero-3-phosphatidylglycerol, dipalmitoylphosphatidylcholine and phospholipon 100H. The liposomes were characterized in terms of their structure, composition, zeta potential, Na-HA-entrapment capacity and stability. In particular, scanning electron microscopy, polarized light microscopy, dynamic light scattering and atomic force microscopy were utilized to probe appearance, size and size distribution and lamellarity. The work was then extended to gels using the gelling agents poloxamer (PXM 188 or 407) and Carbopol or Ultrez 21 (U-21), yielding liposome-loaded gel formulations (i.e. lipogelosomes). The in vitro release kinetics of Na-HA from liposomes, lipogelosomes and commercial Na-HA reference formulations were studied via a flow-through cell method. Among the liposomal formulations tested, L6, comprising of Na-HA-loaded phospholipon 100H:stearylamine:cholesterol (7:1:2), displayed optimal traits. The mean particle size, zeta potential and entrapment capacity of L6 were determined as 1900?nm, -20.9?mV and 15.0%. The optimum lipogelosome, LG4, was obtained by incorporating liposome L6 into a U-21 gel at a ratio of 1:1 (w/w). In clinical trials, in-house formulations were applied twice daily to 15 female volunteers. The two-week benefits were assessed against a commercial product; and in all cases, changes of skin humidity, sebum content, pH and wrinkle depth were promising. In particular, the LG4 lipogelosome-based formulation had significantly improved skin hydration and compliance, as evidenced by a moisture content gain of 30.4%. PMID:24724824

Duman, Gülengül; Aslan, Ismail; Yekta Özer, A; Inanç, Ibrahim; Taralp, Alpay

2014-12-01

214

Microfluidic directed formation of liposomes of controlled size.  

PubMed

A new method to tailor liposome size and size distribution in a microfluidic format is presented. Liposomes are spherical structures formed from lipid bilayers that are from tens of nanometers to several micrometers in diameter. Liposome size and size distribution are tailored for a particular application and are inherently important for in vivo applications such as drug delivery and transfection across nuclear membranes in gene therapy. Traditional laboratory methods for liposome preparation require postprocessing steps, such as sonication or membrane extrusion, to yield formulations of appropriate size. Here we describe a method to engineer liposomes of a particular size and size distribution by changing the flow conditions in a microfluidic channel, obviating the need for postprocessing. A stream of lipids dissolved in alcohol is hydrodynamically focused between two sheathed aqueous streams in a microfluidic channel. The laminar flow in the microchannel enables controlled diffusive mixing at the two liquid interfaces where the lipids self-assemble into vesicles. The liposomes formed by this self-assembly process are characterized using asymmetric flow field-flow fractionation combined with quasi-elastic light scattering and multiangle laser-light scattering. We observe that the vesicle size and size distribution are tunable over a mean diameter from 50 to 150 nm by adjusting the ratio of the alcohol-to-aqueous volumetric flow rate. We also observe that liposome formation depends more strongly on the focused alcohol stream width and its diffusive mixing with the aqueous stream than on the sheer forces at the solvent-buffer interface. PMID:17451256

Jahn, Andreas; Vreeland, Wyatt N; DeVoe, Don L; Locascio, Laurie E; Gaitan, Michael

2007-05-22

215

Ultrasound enhancement of liposome-mediated cell transfection is caused by cavitation effects  

Microsoft Academic Search

Cationic liposomes (CL) are widely used vectors for gene transfer. Recently, ultrasound (US) was reported to enhance liposome-mediated gene transfer to eucaryotic cells in culture. The present study was aimed at studying the effects of 2-MHz pulsed Doppler US on malignant brain tumor cells transfection by cationic liposome\\/plasmid-DNA complexes (lipoplexes). Cationic liposomes consisting of DOSPA\\/DOPE were complexed with a plasmid

Sandra Koch; Peter Pohl; Ulrich Cobet; Nikolai G Rainov

2000-01-01

216

The influence of liposomal adjuvant on intranasal vaccination of chickens against Newcastle disease  

Microsoft Academic Search

The adjuvant effect of liposomes formulated with three phospholipids including phosphatidylcholine-liposomes (PC-Lip), phosphatidylserine-liposomes (PS-Lip), and stearylamine-liposomes (SA-Lip) was compared with virus alone using inactivated Newcastle disease virus (NDV) as a model antigen. The difference in adjuvanticity was evaluated using the haemagglutination-inhibition (HI) test, enzyme-linked immunosorbent assay, and a challenge study following intranasal inoculation of specific pathogen-free chickens.After two inoculations, a

Li-Ping Tseng; Hong-Jen Liang; Ming-Chung Deng; Kuo-Ming Lee; Ryh-Nan Pan; Jen-Chang Yang; Yi-You Huang; Der-Zen Liu

2010-01-01

217

Spectroscopic and physicochemical behavior of magnesium phthalocyanine derivatives mono-substituted with a carboxylic acid group  

NASA Astrophysics Data System (ADS)

This work reports on the synthesis of novel unsymmetrically substituted magnesium phthalocyanine complexes containing one carboxyl group. The physicochemical behavior of these complexes were compared with those of their unmetallated and zinc counterparts. The MgPcs showed interesting absorption spectra with [8,15,22-Tris-(naphtho)-4,5-(3-carboxy-1,2-dioxyphenyl)phthalocyaninato]magnesium (II) showing a large split in the Q band whereas [8,15,22-Tris-(naphtho)-2-(carboxy) phthalocyaninato]magnesium(II) presented only a small splitting. The magnesium phthalocyanine derivatives displayed higher fluorescence quantum yields compared to unmetallated and zinc phthalocyanine counterparts. The latter gave admirable triplet and singlet oxygen quantum yields. These molecules can distinctly be employed in the field of photodynamic therapy in combination with fluorescence imaging.

Nombona, Nolwazi; Chidawanyika, Wadzanai; Nyokong, Tebello

2012-03-01

218

Transdermal iontophoretic delivery of enoxacin from various liposome-encapsulated formulations  

Microsoft Academic Search

The major purpose of this work was to study the effect of various liposome formulations on the iontophoretic transport of enoxacin through excised rat skin. The electrochemical stability of these liposomes was also evaluated. The encapsulation percentage of enoxacin was significantly enhanced after 6 h incubation in an electric field; whereas the fusion of liposomes was inhibited by application of

Jia-You Fang; K. C Sung; Hung-Hong Lin; Chia-Lang Fang

1999-01-01

219

Light- and temperature-responsive liposomes incorporating cinnamoyl Pluronic F127.  

PubMed

Light- and temperature-responsive liposomes were prepared by immobilizing cinnamoyl Pluronic F127 (CP F127) on the surface of egg phosphatidylcholine liposomes. CP F127 was prepared by a condensation reaction, and the molar ratio of cinnamoyl group to Pluronic F127 was calculated to be 1:1.4 on (1)H NMR spectrum. The cinnamoyl group of CP F127 was readily dimerized under the irradiation of a UV light (254 nm, 6 W). CP F127 decreased the absolute value of the zeta potential of liposome possibly because it can shift the hydrodynamic plane away from the liposome surface. The size of liposome decorated with CP F127, measured on a dynamic light scattering machine and observed on a TEM, was larger than that of bare liposome. The liposome bearing CP F127 seemed to fuse and aggregate each other. The liposome released calcein, a fluorescence dye, in response to a UV irradiation, possibly because the photo-dimerization of cinnamoyl group perturbs the liposomal membrane. Moreover, the liposome released the dye in response to a temperature change, possible due to the phase transition of Pluronic F127 layer on the liposomal surface or the hydrophobic interaction of the polymer with liposomal membrane. PMID:24709213

Wang, MinHui; Kim, Jin-Chul

2014-07-01

220

Enhanced localization of anticancer drug in tumor tissue using polyethylenimine-conjugated cationic liposomes  

NASA Astrophysics Data System (ADS)

Liposome-based drug delivery systems hold great potential for cancer therapy. However, to enhance the localization of payloads, an efficient method of systemic delivery of liposomes to tumor tissues is required. In this study, we developed cationic liposomes composed of polyethylenimine (PEI)-conjugated distearoylglycerophosphoethanolamine (DSPE) as an enhanced local drug delivery system. The particle size of DSPE-PEI liposomes was 130 ± 10 nm and the zeta potential of liposomes was increased from -25 to 30 mV by the incorporation of cationic PEI onto the liposomal membrane. Intracellular uptake of DSPE-PEI liposomes by tumor cells was 14-fold higher than that of DSPE liposomes. After intratumoral injection of liposomes into tumor-bearing mice, DSPE-PEI liposomes showed higher and sustained localization in tumor tissue compared to DSPE liposomes. Taken together, our findings suggest that DSPE-PEI liposomes have the potential to be used as effective drug carriers for enhanced intracellular uptake and localization of anticancer drugs in tumor tissue through intratumoral injection.

Han, Hee Dong; Byeon, Yeongseon; Jeon, Hat Nim; Shin, Byung Cheol

2014-05-01

221

Improved permeability of acyclovir: optimization of mucoadhesive liposomes using the phospholipid vesicle-based permeation assay.  

PubMed

The antiviral drug acyclovir (ACV) suffers from poor solubility both in lipophilic and hydrophilic environment, leading to low and highly variable bioavailability. To overcome these limitations, this study aimed at designing mucoadhesive ACV-containing liposomes to improve its permeability. Liposomes were prepared from egg phosphatidylcholine (E-PC) and E-PC/egg phosphatidylglycerol (E-PC/E-PG) and their surfaces coated with Carbopol. All liposomal formulations were fully characterized and for the first time the phospholipid vesicle-based permeation assay (PVPA) was used for testing in vitro permeability of drug from mucoadhesive liposome formulations. The negatively charged E-PC/E-PG liposomes could encapsulate more ACV than neutral E-PC liposomes. Coating with Carbopol increased the entrapment in the neutral E-PC liposomes. The incorporation of ACV into liposomes exhibited significant increase in its in vitro permeability, compared with its aqueous solution. The neutral E-PC liposomal formulations exhibited higher ACV permeability values compared with charged E-PC/E-PG formulations. Coating with Carbopol significantly enhanced the permeability from the E-PC/E-PG liposomes, as well as sonicated E-PC liposomes, which showed the highest permeability of all tested formulations. The increased permeability was according to the formulations' mucoadhesive properties. This indicates that the PVPA is suitable to distinguish between permeability of ACV from different mucoadhesive liposome formulations developed for various routes of administration. PMID:24395733

Naderkhani, Elenaz; Erber, Astrid; Škalko-Basnet, Nataša; Flaten, Gøril Eide

2014-02-01

222

Electrostatic self-assembly: An innovative approach to fabricate novel-structured magnetic liposomes  

NASA Astrophysics Data System (ADS)

Electrostatic self-assembly was applied to fabricate novel-structured magnetic liposomes. According to the charge characteristics of the magnetic nanoparticles and the drug-loaded liposomes, magnetic liposomes were fabricated by alternately assembling the suitable polyelectrolytes and magnetic nanoparticles onto the drug-loaded liposomes. TEM photograph provided direct evidence for successful fabrication of the novel-structured magnetic liposomes. It was also found that electrostatic self-assembly is a universal approach to prepare novel-structured magnetic liposomes with tunable size. The reversed phase high performance liquid chromatography (RP-HPLC) method was established to determine the content of the drug in the magnetic liposomes. The content of the magnetic nanoparticles in the magnetic liposomes was determined by UV spectrophotometry, which proved that the content of magnetic nanoparticles in novel-structured magnetic liposomes was higher than in traditional-structured magnetic liposomes. In vitro drug release from the magnetic liposomes was carried out, and fitting of the release curve using Curve Expert software indicated that the in vitro drug release of the magnetic liposomes was in accordance with the First-order equation.

Zhao, Wen; Zhang, Hong; Lu, TingLi; Liu, WenLong; Ma, YuFan; Chen, Tao

2013-01-01

223

Competitive Immunosorbent Assays Using Ligand-Enzyme Conjugates and Bifunctional Liposomes: Theory and Experiment  

E-print Network

Competitive Immunosorbent Assays Using Ligand-Enzyme Conjugates and Bifunctional Liposomes: Theory with liposomes to which many biotin and HRP molecules have been conjugated. This analysis is of interest because previous work has shown that these bifunctional liposomes can reduce the detection limit for antigens

Kilpatrick, Peter K.

224

Investigations of a new, highly negative liposome with improved biodistribution for imaging  

SciTech Connect

An attractive feature of liposomes is the wide range of lipid composition that can lead to liposome formation, coupled with the observation that liposome biodistribution may be altered by varying lipid composition. For instance, adding charged lipids to neutral lecithin will alter the biodistribution of the resulting charged liposomes. We have prepared highly negative liposomes by replacing lecithin with negatively charged cardiolipin. The liposomes have been labeled in the lipid phase with Ga-67 and Tc-99m oxine and their properties evaluated. The expected high negative charge of the resulting liposomes was confirmed by an ion-exchange chromatographic technique. Using paper chromatography, the stability of the label was determined during incubation in saline and serum. Finally, biodistributions were determined at 2 h in mice, and the results compared with those for negative lecithin liposomes. Accumulated activities in liver and spleen were reduced by factors of five and 20, respectively, over lecithin liposomes. Since preferential accumulation of activity in these organs constitutes the biggest limitation to the use of lecithin liposomes, cardiolipin liposomes may prove to be more useful carriers of radioactivity in imaging applications. More importantly, however, these results illustrate the value of studying novel liposome types as potential radiopharmaceuticals.

Hnatowich, D.J.; Clancy, B.

1980-07-01

225

Docking of Liposomes to Planar Surfaces Mediated by trans-SNARE Complexes  

E-print Network

Docking of Liposomes to Planar Surfaces Mediated by trans-SNARE Complexes Olga Vites,* Ernst here that liposomes containing synaptobrevin firmly attach to planar surfaces containing immobilized stability and is capable of substituting in liposome fusion assays. Vesicle attachment is initiated by SNARE

Texas at Austin. University of

226

Time-Resolved Fluorescence Analysis of the Photosystem II Antenna Proteins in Detergent Micelles and Liposomes  

E-print Network

and Liposomes Ismael Moya, Mariuccia Silvestri,§ Olivier Vallon,| Gianfelice Cinque, and Roberto Bassi*, LURE conformation of the Lhc proteins. Upon incorporation of Lhc proteins into liposomes, a quenching of chlorophyll in the liposomes, and therefore the probability of protein-protein interactions, a further decrease of fluorescence

227

Preparation of Calcium-Loaded Liposomes and Their Use in Calcium Phosphate Formation  

E-print Network

Preparation of Calcium-Loaded Liposomes and Their Use in Calcium Phosphate Formation Phillip B Received October 15, 1997X Liposome encapsulation technology has been used to entrap aqueous calcium salts of unencapsulated calcium by ion exchange resulted in calcium-loaded liposome suspensions with calcium concentration

228

Thermosensitive Liposomes Modified with Poly(N-isopropylacrylamide-co-propylacrylic acid) Copolymers  

E-print Network

Thermosensitive Liposomes Modified with Poly(N-isopropylacrylamide-co-propylacrylic acid liposome (pTSL) was developed for the delivery of Doxorubicin (DOX) for cancer therapy. Copolymers copolymers with dual pH/temperature-dependent phase transition properties. When attached to liposomes

229

Effects of Counterions on Molecular Transport Across Liposome Bilayer: Probed by Second Harmonic Generation  

E-print Network

Effects of Counterions on Molecular Transport Across Liposome Bilayer: Probed by Second Harmonic) of the dioleoylphosphatidylglycerol (DOPG) liposome has been studied by the SHG technique. This is the first time to our knowledge mechanism is presented. 1. Introduction Liposomes have been widely used to investigate membrane functions

Eisenthal, Kenneth B.

230

Anionic Saccharides Activate Liposomes Containing Phospholipids Bearing a Boronic Acid for  

E-print Network

Anionic Saccharides Activate Liposomes Containing Phospholipids Bearing a Boronic Acid for Ca2 Here we describe a functional mimic of that general scheme, where liposomes coated with a synthetic. Protons and divalent metal cations such as Ca2+ are often used to promote the fusion of liposomes

Smith, Bradley D.

231

In vivo targeting of acoustically reflective liposomes for intravascular and transvascular ultrasonic enhancement  

Microsoft Academic Search

OBJECTIVESThe purpose of this study was to target acoustically reflective liposomes to atherosclerotic plaques in vivo for ultrasound image enhancement.BACKGROUNDWe have previously demonstrated the development of acoustically reflective liposomes that can be conjugated for site-specific acoustic enhancement. This study evaluates the ability of liposomes coupled to antibodies specific for different components of atherosclerotic plaques and thrombi to target and enhance

Sasha M. Demos; Hayat Alkan-Onyuksel; Bonnie J. Kane; Kishin Ramani; Ashwin Nagaraj; Rodney Greene; Melvin Klegerman; David D. McPherson

1999-01-01

232

Selective delivery of an anticancer drug with aptamer-functionalized liposomes to breast  

E-print Network

Selective delivery of an anticancer drug with aptamer-functionalized liposomes to breast cancer, their effectiveness has rarely been established in vivo. Here we report the development of a liposomal drug delivery system for targeted anticancer chemotherapy. Liposomes were prepared containing doxorubicin as a payload

Cheng, Jianjun

233

Steric Stabilization of Liposomes by pH-Responsive N-Isopropylacrylamide Copolymer  

E-print Network

Steric Stabilization of Liposomes by pH-Responsive N-Isopropylacrylamide Copolymer EMMANUELLE ROUX; accepted 11 March 2002 ABSTRACT: The aim of this study was to characterize a pH-sensitive liposome formu was determined in rats following the intravenous injection of 67 Ga-loaded liposomes with or without the polymer

Pezolet, Michel

234

Kinetics of Bile Salt Binding to Liposomes Revealed by Carboxyfluorescein Release and  

E-print Network

Kinetics of Bile Salt Binding to Liposomes Revealed by Carboxyfluorescein Release and Mathematical model for the release of carboxyfluorescein from liposomes whose membrane permeability is modified of the liposomal bilayer depends on the difference in the concentrations of bile salt in the inner and outer

Hinow, Peter

235

Giant liposomes in physiological buffer using electroformation in a flow chamber  

E-print Network

Giant liposomes in physiological buffer using electroformation in a flow chamber Daniel J. Estes April 2005 Abstract We describe a method to obtain giant liposomes (diameter 10­100 Am) in solutions electroformation on ITO electrodes, we formed surface-attached giant liposomes in solutions of glycerol in a flow

Mayer, Michael

236

Safety Science Article HER2-targeted liposomal doxorubicin displays enhanced anti-tumorigenic effects  

E-print Network

Safety Science Article HER2-targeted liposomal doxorubicin displays enhanced anti-derived cardiomyocytes Doxorubicin Preclinical safety HER2-targeted liposomal doxorubicin Cardiotoxicity Safety sciences, such as trastuzumab. In this regard, HER2-targeted liposomal doxorubicin was developed to pro- vide clinical benefit

Zandstra, Peter W.

237

Association of hydrophobically-modified poly(ethylene glycol) with fusogenic liposomes  

E-print Network

Association of hydrophobically-modified poly(ethylene glycol) with fusogenic liposomes Debra T interactions to shield liposomes by incorporating multiple hydrophobic anchoring sites on polyethylene glycol. Fusogenic liposomes prepared from N-C12-DOPE:DOPC 7:3 (mol:mol) were equilibrated with HMPEGs. Affinity

Auguste, Debra T.

238

Effects of Bilayer Surface Charge Density on Molecular Adsorption and Transport across Liposome Bilayers  

E-print Network

Effects of Bilayer Surface Charge Density on Molecular Adsorption and Transport across Liposome the adsorption of malachite green (MG), a positively charged organic dye, onto liposomes of different lipid compositions, and the transport kinetics of MG across the liposome bilayer in real time. We found that the dye

Eisenthal, Kenneth B.

239

Biopolymer-Connected Liposome Networks as Injectable Biomaterials Capable of Sustained Local Drug Delivery  

E-print Network

Biopolymer-Connected Liposome Networks as Injectable Biomaterials Capable of Sustained Local Drug hydrophobic side-chains, such as hydrophobically modified chitosan (hmC), can connect liposomes into a gel network via hydrophobic interactions. In this paper, we show that such liposome gels possess an attractive

Raghavan, Srinivasa

240

Enhanced cell binding using liposomes containing an artificial carbohydrate-binding receptor  

E-print Network

Enhanced cell binding using liposomes containing an artificial carbohydrate-binding receptor Yvonne) 7th October 1999, Accepted 1st December 1999 Liposomes containing phospholipids bearing a sugar liposomes that selectively self- assemble,1 or interact with specific cell-types,2 as this will likely lead

Smith, Bradley D.

241

Transdermal iontophoretic delivery of enkephalin formulated in liposomes.  

PubMed

Transdermal iontophoretic transport of a liposomal formulation of [Leu5]enkephalin, across human cadaver skin, was investigated. Franz (vertical) cells were supplied with 0.5 mA/cm2 current density via silver/silver chloride electrodes from a Scepter power supply. Enkephalin spiked with [3H]enkephalin was transported across skin from anode or cathode, depending on the charge on the molecule. Liposomes or their constituents were shown to penetrate into the skin. Enkephalin, when delivered iontophoretically at its isoelectric point, from liposomes carrying positive or negative charge on their surface, resulted in permeation of radioactivity which was same or less than that of the controls when analyzed by liquid scintillation counting. When analyzed by radiochromatography detector on HPLC, degradation of enkephalin during transport was observed, with several degradation peaks in the chromatogram. The degradation was less in liposome formulations, as compared to controls. This is the first report of the combined use of liposomes and iontophoresis for transdermal delivery. PMID:8926583

Vutla, N B; Betageri, G V; Banga, A K

1996-01-01

242

Mimicking liver iron overload using liposomal ferritin preparations.  

PubMed

Close monitoring of liver iron content is necessary to prevent iron overload in transfusion-dependent anemias. Liver biopsy remains the gold standard; however, MRI potentially offers a noninvasive alternative. Iron metabolism and storage is complicated and tissue/disease-specific. This report demonstrates that iron distribution may be more important than iron speciation with respect to MRI signal changes. Simple synthetic analogs of hepatic lysosomes were constructed from noncovalent attachment of horse-spleen ferritin to 0.4 microm diameter phospholipid liposomes suspended in agarose. Graded iron loading was achieved by varying ferritin burden per liposome as well as liposomal volume fraction. T1 and T2 relaxation times were measured on a 60 MHz NMR spectrometer and compared to simple ferritin-gel combinations. Liposomal-ferritin had 6-fold stronger T2 relaxivity than unaggregated ferritin but identical T1 relaxivity. Liposomal-ferritin T2 relaxivity also more closely matched published results from hemosiderotic marmoset liver, suggesting a potential role as an iron-calibration phantom. PMID:15004804

Wood, John C; Fassler, Joe D; Meade, Tom

2004-03-01

243

Preparation and evaluation of semi-permanent hair dyes liposome.  

PubMed

This study used phospholipids from fresh egg yolks to prepare liposome-encapsulated semi-permanent hair dyes in different pH buffer solutions and evaluated the functions and colour fastness to washing of the dyes. The extraction ratio of egg yolk phospholipids was 5%, and the purity was 91.8%. Empty liposome solutions were then prepared using high-speed homogenizer with particle size 219-848?nm. After being stored at 4 °C for 28 days, the average particle size of the liposome-encapsulated dye formulas increased from 1.36-1.92?µm to 1.99-2.38?µm. The ?E colour difference values of the five hair extension sets dyed with the control group and hair dyes on the market were of the range 6.56-13.39 after eight times of washing, whereas the ?E values of the four hair extension sets dyed with the liposome-encapsulated dyes were of the range 3.56-5.21 after eight times of washing. The liposome-encapsulated dye at pH 3 showed the best result. PMID:21425943

Chen, Lichou; Chen, Chonyu

2011-01-01

244

Ultrasound-induced calcein release from eLiposomes.  

PubMed

Ultrasound is explored as a method of inducing the release of encapsulated materials from eLiposomes, defined as liposomes containing emulsion droplets. Emulsions were formed using perfluorohexane and perfluoropentane. eLiposomes were formed by folding interdigitated lipid sheets into closed vesicles around the emulsion droplets. Cryogenic transmission electron microscopy was used to verify droplet encapsulation. Self-quenched calcein was also encapsulated inside the vesicles. A fluorometer was used to measure baseline fluorescence, calcein release after ultrasound exposure, and total release from the vesicles. eLiposome samples released 3 to 5 times more of the encapsulated calcein than did controls when exposed to 20-kHz ultrasound. Calcein release increased with exposure time and intensity of ultrasound. eLiposomes with large (400 nm) droplets produced more calcein release than small (100 nm) droplets. These observations suggest that the emulsions are vaporized by ultrasound and that the Laplace pressure in the emulsions has an effect on droplet vaporization. PMID:23062373

Lattin, James R; Pitt, William G; Belnap, David M; Husseini, Ghaleb A

2012-12-01

245

Crosslinked Multilamellar Liposomes for Controlled Delivery of Anticancer Drugs  

PubMed Central

Liposomes constitute one of the most popular nanocarriers for the delivery of cancer therapeutics. However, since their potency is limited by incomplete drug release and inherent instability in the presence of serum components, their poor delivery occurs in certain circumstances. In this study, we address these shortcomings and demonstrate an alternative liposomal formulation, termed crosslinked multilamellar liposome (CML). With its properties of improved sustainable drug release kinetics and enhanced vesicle stability, CML can achieve controlled delivery of cancer therapeutics. CML stably encapsulated the anticancer drug doxorubicin (Dox) in the vesicle and exhibited a remarkably controlled rate of release compared to that of the unilamellar liposome (UL) with the same lipid composition or Doxil-like liposome (DLL). Our imaging study demonstrated that the CMLs were mainly internalized through a caveolin-dependent pathway and were further trafficked through the endosome-lysosome compartments. Furthermore, in vivo experiments showed that the CML-Dox formulation reduced systemic toxicity and significantly improved therapeutic activity in inhibiting tumor growth compared to that of UL-Dox or DLL-Dox. This drug packaging technology may therefore provide a new treatment option to better manage cancer and other diseases. PMID:23375392

Joo, Kye-Il; Xiao, Liang; Liu, Shuanglong; Liu, Yarong; Lee, Chi-Lin; Conti, Peter S.; Wong, Michael K.; Li, Zibo; Wang, Pin

2014-01-01

246

Thermosensitive liposomal drug delivery systems: state of the art review  

PubMed Central

Thermosensitive liposomes are a promising tool for external targeting of drugs to solid tumors when used in combination with local hyperthermia or high intensity focused ultrasound. In vivo results have demonstrated strong evidence that external targeting is superior over passive targeting achieved by highly stable long-circulating drug formulations like PEGylated liposomal doxorubicin. Up to March 2014, the Web of Science listed 371 original papers in this field, with 45 in 2013 alone. Several formulations have been developed since 1978, with lysolipid-containing, low temperature-sensitive liposomes currently under clinical investigation. This review summarizes the historical development and effects of particular phospholipids and surfactants on the biophysical properties and in vivo efficacy of thermosensitive liposome formulations. Further, treatment strategies for solid tumors are discussed. Here we focus on temperature-triggered intravascular and interstitial drug release. Drug delivery guided by magnetic resonance imaging further adds the possibility of performing online monitoring of a heating focus to calculate locally released drug concentrations and to externally control drug release by steering the heating volume and power. The combination of external targeting with thermosensitive liposomes and magnetic resonance-guided drug delivery will be the unique characteristic of this nanotechnology approach in medicine.

Kneidl, Barbara; Peller, Michael; Winter, Gerhard; Lindner, Lars H; Hossann, Martin

2014-01-01

247

Ultrasonic energy in liposome production: process modelling and size calculation.  

PubMed

The use of liposomes in several fields of biotechnology, as well as in pharmaceutical and food sciences is continuously increasing. Liposomes can be used as carriers for drugs and other active molecules. Among other characteristics, one of the main features relevant to their target applications is the liposome size. The size of liposomes, which is determined during the production process, decreases due to the addition of energy. The energy is used to break the lipid bilayer into smaller pieces, then these pieces close themselves in spherical structures. In this work, the mechanisms of rupture of the lipid bilayer and the formation of spheres were modelled, accounting for how the energy, supplied by ultrasonic radiation, is stored within the layers, as the elastic energy due to the curvature and as the tension energy due to the edge, and to account for the kinetics of the bending phenomenon. An algorithm to solve the model equations was designed and the relative calculation code was written. A dedicated preparation protocol, which involves active periods during which the energy is supplied and passive periods during which the energy supply is set to zero, was defined and applied. The model predictions compare well with the experimental results, by using the energy supply rate and the time constant as fitting parameters. Working with liposomes of different sizes as the starting point of the experiments, the key parameter is the ratio between the energy supply rate and the initial surface area. PMID:24647821

Barba, A A; Bochicchio, S; Lamberti, G; Dalmoro, A

2014-04-21

248

Application of Liposomes in Treatment of Rheumatoid Arthritis: Quo Vadis  

PubMed Central

The most common treatments for rheumatoid arthritis include nonsteroidal anti-inflammatory drugs (NSAIDs), corticosteroids, disease modifying antirheumatic drugs (DMARDs), and some biological agents. However, none of the treatments available is able to achieve the ultimate goal of treatment, that is, drug-free remission. This limitation has shifted the focus of treatment to delivery strategies with an ability to deliver the drugs into the synovial cavity in the proper dosage while mitigating side effects to other tissues. A number of approaches like microemulsions, microspheres, liposomes, microballoons, cocrystals, nanoemulsions, dendrimers, microsponges, and so forth, have been used for intrasynovial delivery of these drugs. Amongst these, liposomes have proven to be very effective for retaining the drug in the synovial cavity by virtue of their size and chemical composition. The fast clearance of intra-synovially administered drugs can be overcome by use of liposomes leading to increased uptake of drugs by the target synovial cells, which in turn reduces the exposure of nontarget sites and eliminates most of the undesirable effects associated with therapy. This review focuses on the use of liposomes in treatment of rheumatoid arthritis and summarizes data relating to the liposome formulations of various drugs. It also discusses emerging trends of this promising technology. PMID:24688450

Singh, Sachin Kumar; Gulati, Monica

2014-01-01

249

Liposome-templated supramolecular assembly of responsive alginate nanogels.  

PubMed

Nanosized gel particles (nanogels) are of interest for a variety of applications, including drug delivery and single-molecule encapsulation. Here, we employ the cores of nanoscale liposomes as reaction vessels to template the assembly of calcium alginate nanogels. For our experiments, a liposome formulation with a high bilayer melting temperature (Tm) is selected, and sodium alginate is encapsulated in the liposomal core. The liposomes are then placed in an aqueous buffer containing calcium chloride, and the temperature is raised up to Tm. This allows permeation of Ca2+ ions through the bilayer and into the core, whereupon these ions gel the encapsulated alginate. Subsequently, the lipid bilayer covering the gelled core is removed by the addition of a detergent. The resulting alginate nanogels have a size distribution consistent with that of the template liposomes (ca. 120-200 nm), as confirmed by transmission electron microscopy and light scattering. Nanogels of different average sizes can be synthesized by varying the template dimensions, and the gel size can be further tuned after synthesis by the addition of monovalent salt to the solution. PMID:18338908

Hong, Jennifer S; Vreeland, Wyatt N; Lacerda, Silvia H DePaoli; Locascio, Laurie E; Gaitan, Michael; Raghavan, Srinivasa R

2008-04-15

250

Characterization of liposomes containing iodine-125-labeled radiographic contrast agents  

SciTech Connect

Multilamellar liposomes were prepared containing either iodine-125-labeled (/sup 125/I) diatrizoate or /sup 125/I labeled iotrol in their aqueous phase. The in vitro permeabilities of liposomes containing both contrast agents were measured in the presence of saline and serum at 37 degrees C. Two different phospholipid compositions were studied: phosphatidylcholine/cholesterol/stearylamine (PC/C/S, 8: 1:1 molar ratio) and distearoylphosphatidylcholine/sphingomyelin (DSPC/SM, 5:2 mole ratio). In saline, similar permeabilities were observed for the four phospholipid-contrast agent combinations. In serum, however, leakage of /sup 125/I activity was 2 to 3 times greater from PC/C/S liposomes than from vesicles composed of DSPC/SM. When PC/C/S liposomes that contained /sup 125/I-diatrizoate were injected into rats, the clearance half-times for /sup 125/I activity from the liver, spleen, and whole body were 4.4 hours, 4.5 hours, and 2.8 hours, respectively. Liposomes composed of DSPC/SM cleared at a significantly slower rate from the liver, spleen, and whole body with half-times of 24.0 hours, 18.4 hours, and 17.2 hours observed from these tissues, respectively.

Zalutsky, M.R.; Noska, M.A.; Seltzer, S.E.

1987-02-01

251

Liposomes self-assembled from electrosprayed composite microparticles  

NASA Astrophysics Data System (ADS)

Composite microparticles, consisting of polyvinylpyrrolidone (PVP), naproxen (NAP) and lecithin (PC), have been successfully prepared using an electrospraying process and exploited as templates to manipulate molecular self-assembly for the synthesis of liposomes in situ. Field emission scanning electron microscope (FESEM) and transmission electron microscope (TEM) observations demonstrate that the microparticles have an average diameter of 960 ± 140 nm and a homogeneous structure. X-ray diffraction (XRD) patterns, differential scanning calorimetry (DSC) and attenuated total reflectance-Fourier transform infrared (ATR-FTIR) results verify that the building blocks NAP and PC are scattered in the polymer matrix in a molecular way owing to the very fast drying of the electrospraying process and the favorable secondary interactions among the components. FESEM, scanning probe microscope (SPM) and TEM observations demonstrate that the liposomes can be achieved through molecular self-assembly in situ when the microparticles contact water thanks to ‘like prefers like’ and by means of the confinement effect of the microparticles. The liposomes have an encapsulation rate of 91.3%, and 80.7% of the drug in the liposomes can be freed into the dissolution medium in a sustained way and by a diffusion mechanism over a period of 24 h. The developed strategy not only provides a new, facile, and effective method to assemble and organize molecules of multiple components into liposomes with electrosprayed microparticles as templates, but also opens a new avenue for nanofabrication in a step-by-step and controllable way.

Yu, Deng-Guang; Yang, Jun-He; Wang, Xia; Tian, Feng

2012-03-01

252

Resonance Raman spectra of. cap alpha. -copper phthalocyanine  

SciTech Connect

Raman spectra of ..cap alpha..-copper phthalocyanine (..cap alpha..-CuPc) were recorded at room temperature and at 10 K with excitation wavelengths between 457 and 714 nm. Resonance enhancement was greatest for modes for which the largest displacements were on either the inner five-membered ring of the isoindole groups or the inner macrocycle and consequently assignment of the bands to modes of the entire molecule was possible by comparison with nickel octaethylporphyrin. Four out of five bands resonant in the Q band region and preresonant near the B band absorption region are totally symmetric modes. B band preresonance occurs more strongly with high-frequency modes. At low temperatures, multimode interactions are reduced and profiles were obtained which can be compared with solution profiles of porphyrins. Both Q/sub x/ and Q/sub y/ 0-0 scattering can be identified and a helper mode is evident. A term enhancement predominates, with B/sub 1g/ and B/sub 2g/ modes enhanced because of a Jahn-Teller distortion of the excited state. The resonance studies, together with electronic absorption spectra and published theoretical studies, confirm that the Q band in ..cap alpha..-CuPc is largely due to an allowed ..pi..-..pi..* transition associated mainly with the macrocycle and inner five-membered rings of the isoindole groups. 25 references, 5 figures, 2 tables.

Bovill, A.J.; McConnell, A.A.; Nimmo, J.A.; Smith, W.E.

1986-02-13

253

Photodynamic therapy for experimental intraocular melanoma using chloroaluminum sulfonated phthalocyanine  

SciTech Connect

Chloroaluminum sulfonated phthalocyanine (CASPc), a novel photosensitizing dye, was evaluated for treatment of experimental intraocular melanoma in 33 rabbit eyes. An argon ion pumped dye laser, operating at an emission of 675 nm, was used in a nonthermal mode to irradiate iris tumors in rabbits 24 hours after they received in intravenous dye injection (23 eyes). The effects of laser irradiation alone and dye alone were examined in ten control eyes. A threshold tumoricidal dose was established for photodynamic therapy with CASPc and laser irradiation. Vascular occlusion was produced in a well-circumscribed area corresponding to the boundaries of laser irradiation after CASPc injection. Tumors successfully treated with CASPc and laser irradiation were arrested in growth and exhibited no viable tumor cells on histologic examination. Control tumors continued rapid growth, unaffected by dye or laser. Our data indicate that CASPc demonstrates a strong photosensitizing effect on both tumor and normal tissue. These results suggest that CASPc is a potential photosensitizing compound that may be useful in the treatment of choroidal melanoma.

Panagopoulos, J.A.; Svitra, P.P.; Puliafito, C.A.; Gragoudas, E.S.

1989-06-01

254

Photodynamic Therapy with the Phthalocyanine Photosensitizer Pc 4  

PubMed Central

Photodynamic therapy (PDT) is emerging as a promising non-invasive treatment for cancers. PDT involves either local or systemic administration of a photosensitizing drug, which preferentially localizes within the tumor, followed by illumination of the involved organ with light, usually from a laser source. Here, we provide a selective overview of our experience with PDT at Case Western Reserve University, specifically with the silicon phthalocyanine photosensitizer Pc 4. We first review our in-vitro studies evaluating the mechanism of cell killing by Pc 4-PDT. Then we briefly describe our clinical experience in a Phase I trial of Pc 4-PDT and our preliminary translational studies evaluating the mechanisms behind tumor responses. Preclinical work identified (a) cardiolipin and the anti-apoptotic proteins Bcl-2 and Bcl-xL as targets of Pc 4-PDT, (b) the intrinsic pathway of apoptosis, with the key participation of caspase-3, as a central response of many human cancer cells to Pc 4-PDT, (c) signaling pathways that could modify apoptosis, and (d) a formulation by which Pc 4 could be applied topically to human skin and penetrate at least through the basal layer of the epidermis. Clinical-translational studies enabled us to develop an immunohistochemical assay for caspase-3 activation, using biopsies from patients treated with topical Pc 4 in a Phase I PDT trial for cutaneous T-cell lymphoma. Results suggest that this assay may be used as an early biomarker of clinical response. PMID:17397888

Miller, Janine D.; Baron, Elma D.; Scull, Heather; Hsia, Andrew; Berlin, Jeffrey C.; McCormick, Thomas; Colussi, Valdir; Kenney, Malcolm E.; Cooper, Kevin D.; Oleinick, Nancy L.

2007-01-01

255

Electrochromic lutetium phthalocyanine films for in situ detection of NADH  

NASA Astrophysics Data System (ADS)

A simple and sensitive method for the detection of NADH on a glass substrate modified with spin coated electrochromic [(C6H13S)8Pc]2Lu is presented. The modification of a [(C6H13S)8Pc]2Lu sensing layer was achieved chemically. The functionalized layer shows an efficient activity towards the NADH at conc. as low as 1 × 10-5 M. The in situ UV-Vis and Raman measurements were carried out to study the interaction of oxidized films with NADH. The electrochromic behaviour of [(C6H13S)8Pc]2Lu thin films was examined in detail under various conditions. The spin coated films deposited on glass substrate were chemically oxidized and were found to change the colour. The oxidized films were believed to be reduced to its natural form on interaction with NADH. The colour of the film changed from green to brownish-purple after interaction with NADH. Reversible electrochromism was observed, leading reusable sensor film. The transformation of the oxidised phthalocyanine films into neutral form was monitored by both in situ UV-Vis and Raman techniques.

Basova, Tamara; Gürek, Ay?e Gül; Ahsen, Vefa; Ray, Asim

2013-01-01

256

Structures and redox characteristics of electron-deficient vanadyl phthalocyanines.  

PubMed

The first single-crystal X-ray structures of substituted vanadyl phthalocyanine materials reveal the high-valence vanadium ions (denoted as V(IV)), whose coordination by a highly electron-deficient ligand is facilitated by an axial oxo group. The metal center of the hydrophilic V?O core, encapsulated in F-rich hydrophobic pockets, reaches a coordination number of 6 by binding an additional H(2)O that, in turn, hydrogen-bonds with ketones, resulting in solvent-induced variable solid-state architectures. Fluoroalkyl (R(f)) ligand substituents hinder ?-? stacking interactions and favor ordered long-range packing, as well as the facile formation of film materials that exhibit high thermal stability and oxidation resistance. Reversible redox chemistry and spectroscopic studies in both solution and the solid-state indicate single-site isolation in both phases and an R(f)-induced propensity for electron uptake and inhibition of electron loss. Repeated redox cycles reorganize the thin films to accommodate Li(+) ions and facilitate their migration. The facile reduction, combined with high stability and ease of sublimation imparted by the R(f) scaffold that suppresses oxidations, recommends the new materials for sensors, color displays, electronic materials, and redox catalysts, as well as other applications. PMID:21466193

?apok, ?ukasz; Lener, Martin; Tsaryova, Olga; Nagel, Stefanie; Keil, Christopher; Gerdes, Robert; Schlettwein, Derck; Gorun, Sergiu M

2011-05-01

257

Tissue Distribution Of Chloroaluminium Sulfonated Phthalocyanine In Dogs  

NASA Astrophysics Data System (ADS)

Chloroaluminum sulfonated phthalocyanine (A1PCS) was administered intravenously to clinically normal dogs, and A1PCS levels were determined in tissues using a sensitive assay. A1PCS accumulated to high levels in liver, spleen, bone marrow, kidney, and lung. These tissue levels confirm previous determinations in mice and rats. Only a small amount of dye was retained in skin and very small amounts in muscle and brain. A1PCS was cleared from the blood within 24 h, and excreted primarily by urine. Serum clearance was faster in males than in females. There were also significant tissue distribution differences between the genders, particularly during the first 12 h. The low levels of A1PCS in skin suggest that cutaneous photosensitivity and toxic skin reactions using this photosensitizer in photodynamic therapy of cancer may be eliminated. The difference in tissue distribution between genders is not only intriguing, but indicates that the optimal time window for treatment of various tissue sites may vary by gender.

M. M.; H. C.; Newman

1989-06-01

258

Influence of film thickness and air exposure on the transport gap of manganese phthalocyanine  

SciTech Connect

The interface formation between manganese phthalocyanine (MnPc) and cobalt was investigated combining ultraviolet photoelectron spectroscopy and inverse photoelectron spectroscopy. The transport band gap of the MnPc increases with the film thickness up to a value of (1.2 {+-} 0.3) eV while the optical band gap as determined from spectroscopic ellipsometry amounts to 0.5 eV. The gap values are smaller compared to other phthalocyanines due to metallic Mn 3d states close to the Fermi level. The transport band gap was found to open upon air exposure as a result of the disappearance of the occupied 3d electronic states.

Haidu, F.; Fechner, A.; Salvan, G.; Gordan, O. D.; Fronk, M.; Zahn, D. R. T. [Semiconductor Physics, Chemnitz University of Technology, D-09107 Chemnitz (Germany); Lehmann, D. [Semiconductor Physics, Chemnitz University of Technology, D-09107 Chemnitz (Germany); INNOVENT Technology Development, D-07745 Jena (Germany); Mahns, B.; Knupfer, M. [Electronic and Optical Properties Department, IFW Dresden, D-01171 Dresden (Germany)

2013-06-15

259

Electrochemically Fabricated Phthalocyanine-Based Molecular Conductor Films and Their Potential Use in Organic Electronic Devices  

NASA Astrophysics Data System (ADS)

Nanocrystalline films of phthalocyanine-based molecular conductors were fabricated using a short-time electrocrystallization method with two indium-tin oxide (ITO) electrodes. The size and morphology of the nanocrystals could be controlled by adjusting the electrocrystallization conditions, and the ITO substrate was successfully covered with nanocrystals of the molecular conductor. The current density versus voltage (J-V) characteristics of devices with the configuration ITO/nanocrystals:C60/Al showed a reverse rectifying effect accompanied by a photovoltaic effect under 660 nm wavelength irradiation, which is close to the gap between the HOMO and LUMO of phthalocyanine.

Matsuda, Masaki; Kinoshita, Nobuaki; Fujishima, Mika; Tanaka, Shukichi; Tajima, Hiroyuki; Hasegawa, Hiroyuki

2013-02-01

260

Multivesicular liposomal bupivacaine at the sciatic nerve.  

PubMed

Clinical translation of sustained release formulations for local anesthetics has been limited by adverse tissue reaction. Exparel™ (DepoFoam bupivacaine) is a new liposomal local anesthetic formulation whose biocompatibility near nerve tissue is not well characterized. Exparel™ injection caused sciatic nerve blockade in rats lasting 240 min compared to 120 min for 0.5% (w/v) bupivacaine HCl and 210 min for 1.31% (w/v) bupivacaine HCl (same bupivacaine content as Exparel™). On histologic sections four days after injection, median inflammation scores in the Exparel™ group (2.5 of 4) were slightly higher than in groups treated with bupivacaine solutions (score 2). Myotoxicity scores in the Exparel™ group (2.5 of 6) were similar to in the 0.5% (w/v) bupivacaine HCl group (3), but significantly less than in the 1.31% (w/v) bupivacaine HCl group (5). After two weeks, inflammation from Exparel™ (score 2 of 6) was greater than from 0.5% (w/v) bupivacaine HCl (1) and similar to that from 1.31% (w/v) bupivacaine HCl (1). Myotoxicity in all three groups was not statistically significantly different. No neurotoxicity was detected in any group. Tissue reaction to Exparel™ was similar to that of 0.5% (w/v) bupivacaine HCl. Surveillance for local tissue injury will be important during future clinical evaluation. PMID:24612918

McAlvin, J Brian; Padera, Robert F; Shankarappa, Sahadev A; Reznor, Gally; Kwon, Albert H; Chiang, Homer H; Yang, Jason; Kohane, Daniel S

2014-05-01

261

Liposomes as a topical delivery system: the role of size on transport studied by the EPR imaging method  

Microsoft Academic Search

The relative contribution of the liposome size, lamellarity, composition and charge to the transport into the skin of drug, which was applied entrapped in liposomes is a subject of some controversy. In this study the influence of liposome size on the transport of hydrophilic substance was investigated. For this purpose liposomes composed of dipalmitoylphosphatidylcholine (DPPC), or non-hydrogenated soya lecithin (NSL)

M Šentjurc; K Vrhovnik; J Kristl

1999-01-01

262

Spectroscopic investigation of the molecular state of nystatin encapsulated in liposomes.  

PubMed

The stability and spectral properties of nystatin-encapsulating liposomes, composed of various combinations of dipalmitoyl phosphatidylcholine (DPPC), cholesterol (CH) and distearoyl-N-(monomethoxy poly(ethylene glycol)succinyl) phosphatidylethanolamine (DSPE-PEG), were studied in order to elucidate the molecular state and localization of nystatin encapsulated in liposomes. Localization of nystatin at the surface region of the liposomal membrane was investigated by PEG/dextran two-phase partition and measurement of the fluorescence quenching of nystatin by p-xylene-bis-pyridinium bromide (DPX). In DPPC/DSPE-PEG liposomes and DPPC/CH/DSPE-PEG liposomes, containing 151 and 160 mcg nystatin per mg lipid, respectively, nystatin appeared to be present at the surface region of the liposomal membranes. Self-quenching of nystatin fluorescence was observed in DPPC/CH and DPPC/CH/DSPE-PEG liposomes even at low encapsulated amounts, suggesting the localization of nystatin in CH-incorporating membranes. In CH-free liposomes, nystatin molecules were at first delocalized in the membranes and then self-associated at a higher level of encapsulation. Absorption and circular dichroism (CD) spectra were also measured to examine the monomeric and aggregated states of nystatin in liposomes. High encapsulation efficacy was observed in DPPC and DPPC/DSPE-PEG liposomes, but the highest stability and retention of nystatin in liposomes were observed in DPPC/CH/DSPE-PEG liposomes, evaluated in terms of the nystatin and calcein release from nystatin-encapsulating liposomes in vitro. From the results, possible encapsulation mechanisms of nystatin in liposomes narrowed down to the following three points; interaction with lipid membrane, adsorption on the liposomal surface and complex formation with DSPE-PEG. PMID:10867263

Moribe, K; Maruyama, K; Iwatsuru, M

2000-05-15

263

Predicting diffusive transport of cationic liposomes in 3-dimensional tumor spheroids.  

PubMed

Nanotechnology is widely used in cancer research. Models that predict nanoparticle transport and delivery in tumors (including subcellular compartments) would be useful tools. This study tested the hypothesis that diffusive transport of cationic liposomes in 3-dimensional (3D) systems can be predicted based on liposome-cell biointerface parameters (binding, uptake, retention) and liposome diffusivity. Liposomes comprising different amounts of cationic and fusogenic lipids (10-30mol% DOTAP or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1-20mol% DOPE or 1,2-dioleoyl-3-trimethylammonium-propane, +25 to +44mV zeta potential) were studied. We (a) measured liposome-cell biointerface parameters in monolayer cultures, and (b) calculated effective diffusivity based on liposome size and spheroid composition. The resulting parameters were used to simulate the liposome concentration-depth profiles in 3D spheroids. The simulated results agreed with the experimental results for liposomes comprising 10-30mol% DOTAP and ?10mol% DOPE, but not for liposomes with higher DOPE content. For the latter, model modifications to account for time-dependent extracellular concentration decrease and liposome size increase did not improve the predictions. The difference among low- and high-DOPE liposomes suggests concentration-dependent DOPE properties in 3D systems that were not captured in monolayers. Taken together, our earlier and present studies indicate the diffusive transport of neutral, anionic and cationic nanoparticles (polystyrene beads and liposomes, 20-135nm diameter, -49 to +44mV) in 3D spheroids, with the exception of liposomes comprising >10mol% DOPE, can be predicted based on the nanoparticle-cell biointerface and nanoparticle diffusivity. Applying the model to low-DOPE liposomes showed that changes in surface charge affected the liposome localization in intratumoral subcompartments within spheroids. PMID:24995948

Wientjes, Michael G; Yeung, Bertrand Z; Lu, Ze; Wientjes, M Guillaume; Au, Jessie L S

2014-10-28

264

Evaluation of polyethylene glycol coated liposomes labeled with Tc-99m as a blood pool agent  

SciTech Connect

This investigation evaluated Tc-99m liposomes coated with polyethylene glycol (PEG) as a blood pool agent in comparison with Tc-99m liposomes carrying no surface charge (Neutral) and with Tc-99m autologous red cells. Liposomes (135 nm diameter) encapsulating glutathione were labeled with Tc-99m using the lipophilic chelator, HMPAO as previously described. Autologous red cells were labeled using an Ultratag kit. Labeling efficiencies averaged 66%, 52%, and 97% for the PEG liposomes. Neutral liposomes, and red cells, respectively. Rabbits (3-3.5 Kg) were injected IV via ear vein with 2.0 mls of PEG liposomes (2 mCi, 17 mg phospholipid/Kg body weight, n=5). Neutral liposomes (1.3 mCi, 17 mg phospholipid/Kg body weight, n=4), or red cells (2.6 mCi, n=2). Gamma camera images were acquired at 5,22, and 45 minutes, and 2,20,and 44 hours post-injection. Blood samples were obtained at each time point to determine clearance kinetics. Circulation half lives of both Tc-99m liposome formulations were longer than Tc-99m red cells (8 hrs), with the half life of PEG liposomes (35 hrs) 1.6 times longer than Neutral liposomes (22 hrs). In vivo stability of the Tc-99m label was excellent for the liposomes with only 3.5-4% bladder activity at 45 minutes compared to 12% bladder activity for the red cells. Excellent blood pool images were obtained for the PEG liposomes in the rabbit. Heart/liver ratios calculated from region of interest analysis of 45 minutes images were 1.9, 1.5, and 1.7 for PEG liposomes, Neutral liposomes and red cells. This study demonstrates the feasibility of using Tc-99m PEG liposomes to perform gated cardiac blood pool and rapid gastrointestinal bleeding studies.

Phillips, W.T.; Klipper, R.; Goins, B. [Univ. of Texas Health Science Center, San Antonio, TX (United States)

1994-05-01

265

The organ distribution of liposome-encapsulated and free cobalt in rats. Liposomes decrease the cardiac uptake of the metal  

SciTech Connect

Rats were administered intravenously liposome-encapsulated or free cobalt, and the organ distribution of the metal was explored using Co{sup 57} tracer. Two hours after administration, the cobalt level in the heart was about 40 % of the control when given in sphingomyelin (SM)/cholesterol (CH) (1:1 mole ratio) liposomes. These vesicles also tended to decrease the uptake of cobalt in the kidney and the carcass, and to increase it in the spleen and the bones. Liposomes prepared from soybean phosphatidylcholine (SPC)/CH (1:1) had no effect on the uptake of cobalt in the heart, whereas increased its level in the spleen, liver and lung. The time-course of cobalt deposition in the organs displayed substantial variation with the different preparations. Most importantly, no buildup of cobalt level was observed in the heart when the metal was administered in SM/CH vesicles. While confirming known effects of liposomes on the organ-distribution of entrapped drugs, our findings suggest that administration of cobalt in SM/CH liposome-encapsulated form may result in decreased cardiotoxicity and thus increased safety of cobalt-treatment in some anemias.

Garcia, R.; Eskelson, C.D.; Chvapil, M. (Univ. of Arizona, Tucson (USA)); Szebeni, J. (Univ. of Arizona, Tucson (USA) National Institute of Food Hygiene and Nutrition, Budapest (Hungary))

1989-01-01

266

Design of liposomal colloidal systems for ocular delivery of ciprofloxacin  

PubMed Central

Ophthalmic drug bioavailability is limited due to protective mechanisms of the eye which require the design of a system to enhance ocular delivery. In this study several liposomal formulations containing ciprofloxacin (CPX) have been formulated using reverse phase evaporation technique with final dispersion of pH 7.4. Different types of phospholipids including Phosphatidylcholine, Dipalmitoylphosphatidylcholine and Dimyristoyl-sn-glycero-3-phosphocholine were utilized. The effect of formulation factors such as type of phospholipid, cholesterol content, incorporation of positively charging inducing agents and ultrasonication on the properties of the liposomal vesicles was studied. Bioavailability of selected liposomal formulations in rabbit eye aqueous humor has been investigated and compared with that of commercially available CPX eye drops (Ciprocin®). Pharmacokinetic parameters including Cmax, Tmax, elimination rate constant, t1/2, MRT and AUC0–?, were determined. The investigated formulations showed more than three folds of improvement in CPX ocular bioavailability compared with the commercial product. PMID:25061409

Taha, Ehab I.; El-Anazi, Magda H.; El-Bagory, Ibrahim M.; Bayomi, Mohsen A.

2013-01-01

267

Gemcitabine-loaded liposomes: rationale, potentialities and future perspectives  

PubMed Central

This review describes the strategies used in recent years to improve the biopharmaceutical properties of gemcitabine, a nucleoside analog deoxycytidine antimetabolite characterized by activity against many kinds of tumors, by means of liposomal devices. The main limitation of using this active compound is the rapid inactivation of deoxycytidine deaminase following administration in vivo. Consequently, different strategies based on its encapsulation/complexation in innovative vesicular colloidal carriers have been investigated, with interesting results in terms of increased pharmacological activity, plasma half-life, and tumor localization, in addition to decreased side effects. This review focuses on the specific approaches used, based on the encapsulation of gemcitabine in liposomes, with particular attention to the results obtained during the last 5 years. These approaches represent a valid starting point in the attempt to obtain a novel, commercializable drug formulation as already achieved for liposomal doxorubicin (Doxil®, Caelyx®). PMID:23139626

Federico, Cinzia; Morittu, Valeria M; Britti, Domenico; Trapasso, Elena; Cosco, Donato

2012-01-01

268

Liposomal extended-release bupivacaine for postsurgical analgesia  

PubMed Central

When physicians consider which analgesia to use postsurgery, the primary goal is to relieve pain with minimal adverse side effects. Bupivacaine, a commonly used analgesic, has been formulated into an aqueous suspension of multivesicular liposomes that provide long-lasting analgesia for up to 72 hours, while avoiding the adverse side effects of opioids. The increased efficacy of liposomal extended-release bupivacaine, compared to bupivacaine hydrochloride, has promoted its usage in a variety of surgeries including hemorrhoidectomy, bunionectomy, inguinal hernia repair, total knee arthroplasty, and augmentation mammoplasty. However, like other bupivacaine formulations, the liposomal extended-release bupivacaine does have some side effects. In this brief review, we provide an update of the current knowledge in the use of bupivacaine for postsurgical analgesia. PMID:24043932

Lambrechts, Mark; O'Brien, Michael J; Savoie, Felix H; You, Zongbing

2013-01-01

269

?-Lactoglobulin improves liposome's encapsulation properties for vitamin E delivery.  

PubMed

Vitamin E (VE) or ?-tocopherol is the major fat-soluble antioxidant in the human body. It is a sensitive, easily oxidized in the air, molecule, so it must be protected from pro-oxidant elements which could affect its physiological benefits. Encapsulation constitutes a promising approach to maintain VE native properties over time and increase its concentration in aqueous media. Liposomes have been studied as sustained delivery systems, being biodegradable, non-toxic and non-immunogenic. A new liposome/?-lactoglobulin (?-Lg) formulation has been developed and characterized as a possible stable delivery system for VE. ?-Lg has been selected due to its property to bind a variety of hydrophobic molecules. The aim of this study was the preparation of ?-Lg-liposome formulation and the determination of VE encapsulation efficiency, in order to develop a new more efficient carrier for VE in aqueous media. PMID:24099174

Rovoli, Magdalini; Gortzi, Olga; Lalas, Stavros; Kontopidis, George

2014-03-01

270

Nanoparticle-assisted surface immobilization of phospholipid liposomes.  

PubMed

Phospholipid liposomes (100-200 nm diameter) are deposited onto solid substrates after stabilizing them against fusion with the solid by allowing charged nanoparticles to adsorb at approximately 25% surface coverage. The immobilized vesicles remain stable over a period of days. Epifluorescence imaging shows that they diffuse freely over surfaces with the same charge but adsorb tightly onto surfaces with opposite charge. Nanoparticle adsorption to surface patterns of opposite charge provides a facile method to create large-scale surface-supported arrays of intact liposomes. This surface attachment method is simple chemically and applies generally for solid surfaces that can be hydrophobic or hydrophilic. Offering routes to localize proteins and other vesicle-contained objects at surfaces in tailored spatial patterns, these immobilized liposome arrays may find diverse applications in the emerging field of nanobiotechnology. PMID:16834363

Zhang, Liangfang; Hong, Liang; Yu, Yan; Bae, Sung Chul; Granick, Steve

2006-07-19

271

(99m)Tc-labeled therapeutic inhaled amikacin loaded liposomes.  

PubMed

The radiolabeling of the liposome surface can be a useful tool for in vivo tracking of therapeutic drug loaded liposomes. We investigated radiolabeling therapeutic drug (i.e. an antibiotic, amikacin) loaded liposomes with (99m)Tc, nebulization properties of (99m)Tc-labeled liposomal amikacin for inhalation ((99m)Tc-LAI), and its stability by size exclusion low-pressure liquid chromatography (LPLC). LAI was reacted with (99m)Tc using SnCl2 dissolved in ascorbic acid as a reducing agent for 10?min at room temperature. The labeled products were then purified by anion exchange resin. The purified (99m)Tc-LAI in 1.5% NaCl solution was incubated at 4?°C to assess its stability by LPLC. The purified (99m)Tc-LAI was subjected to studies with a clinically used nebulizer (PARI eFlow®) and the Anderson Cascade Impactor (ACI). The use of ascorbic acid at 0.91?mM resulted in a quantitative labeling efficiency. The LPLC profile showed that the liposomal peak of LAI detected by a UV monitor at both 200?nm and 254?nm overlapped with the radioactivity peak of (99m)Tc-LAI, indicating that (99m)Tc-LAI is suitable for tracing LAI. The ACI study demonstrated that the aerosol droplet size distribution determined gravimetrically was similar to that determined by radioactivity. The liposome surface labeling method using SnCl? in 0.91?mM ascorbic acid produced (99m)Tc-LAI with a high labeling efficiency and stability that are adequate to evaluate the deposition and clearance of inhaled LAI in the lung by gamma scintigraphy. PMID:23879241

Lee, Jae-Ho; Cheng, Kenneth T; Malinin, Vladimir; Li, Zhili; Yao, Zhengsheng; Lee, Sung-Jin; Gould, Christine M; Olivier, Kenneth N; Chen, Clara; Perkins, Walter R; Paik, Chang H

2013-12-01

272

Ultrasound triggered release of cisplatin from liposomes in murine tumors.  

PubMed

The ability of low frequency ultrasound (LFUS) to trigger the release of drugs from nano sterically stabilized liposomes (nSSL) in vitro, without affecting the drugs' chemical integrity or biological potency, has been previously shown. Herein, the ability of LFUS to (a) trigger the release of cisplatin from nSSL in vivo, and (b) affect the therapeutic efficacy by locally releasing the drug, was studied. For this, nSSL loaded with the anti-cancer chemotherapeutic agent cisplatin were injected intraperitoneally (i.p.) to mice bearing well-developed J6456 murine lymphoma tumors in their peritoneal cavity. Then, LFUS was applied externally to the abdominal wall for 120 s, and drug release was quantified. Nearly 70% of the liposomal cisplatin was released in tumors exposed to LFUS, compared to <3% in those not exposed to LFUS. The effect of LFUS-induced localized drug release on the therapeutic efficacy was tested on BALB/c mice with C26 colon adenocarcinoma tumors in a footpad. Mice were injected intravenously with nSSL cisplatin, and 24 h later, the tumor was exposed to LFUS. The group treated by liposomal cisplatin combined with LFUS, compared to all other groups (i.e., free cisplatin with or without LFUS, or liposomal cisplatin without LFUS, or LFUS alone, or no treatment) had the best therapeutic score; tumors stopped proliferating and then regressed over time. This work presents a modality for the release of drugs from liposomes in vivo using LFUS. Implications of these findings for clinical applications of LFUS-induced liposomal drug release are discussed. PMID:19303426

Schroeder, Avi; Honen, Reuma; Turjeman, Keren; Gabizon, Alberto; Kost, Joseph; Barenholz, Yechezkel

2009-07-01

273

Effect of Dibucaine on Phase Behavior of Ternary Liposome  

E-print Network

Despite many studies, detailed physicochemical mechanism of local anesthetic function is still unclear. In order to clarify the mechanism, the effects of anesthetics on ion channels and the lipids surrounding the ion channels should be evaluated. Thus, we investigated the effect of Dibucaine hydrochloride (DC$\\cdot$HCl), one of the local anesthetics, on phase behavior of ternary liposome composed of dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), and cholesterol (Chol). The large DOPC/DPPC/Chol liposome, that is directly observable by optical microscope, is commonly known to be laterally separated into liquid-ordered (Lo) phase (raft-like domain) and liquid-disordered (Ld) phase under certain conditions and is useful for study of lipid-raft-like domains as a simple model system. In order to confirm the effect of DC$\\cdot$HCl on a miscibility transition temperature, $T_{\\rm c}$, of the ternary liposome, we observed the liposomes with three concentrations, 0, 0.05, and 0.2~mM, of DC$\\cdot$HCl at various temperatures. In addition, we calculated the angle-averaged two-dimensional autocorrelation (2D-AC) functions in order to quantify the phase behavior. The results of these observations and calculations revealed that the DC$\\cdot$HCl molecules induce the reduction of $T_{\\rm c}$ of the ternary liposome. Furthermore, we calculated the circularity of Lo domain in order to confirm the change in the line tension of the Lo/Ld phase boundary and revealed that the insertion of the DC molecules induces the reduction of line tension. In terms of the critical phenomena, we conclude that the insertion of the DC molecules induces the reduction of the $T_{\\rm c}$ of the ternary liposome due to reduction of line tension. This suggests that the DC molecules may disturb function of ion channels via affecting the lipid bilayers which surround ion channels.

Kazunari Yoshida; Akito Takashima; Izumi Nishio

2014-11-07

274

PEG Minocycline-Liposomes Ameliorate CNS Autoimmune Disease  

PubMed Central

Background Minocycline is an oral tetracycline derivative with good bioavailability in the central nervous system (CNS). Minocycline, a potent inhibitor of matrix metalloproteinase (MMP)-9, attenuates disease activity in experimental autoimmune encephalomyelitis (EAE), an animal model of multiple sclerosis (MS). Potential adverse effects associated with long-term daily minocycline therapy in human patients are concerning. Here, we investigated whether less frequent treatment with long-circulating polyethylene glycol (PEG) minocycline liposomes are effective in treating EAE. Findings Performing in vitro time kinetic studies of PEG minocycline-liposomes in human peripheral blood mononuclear cells (PBMCs), we determined that PEG minocycline-liposome preparations stabilized with CaCl2 are effective in diminishing MMP-9 activity. Intravenous injections of PEG minocycline-liposomes every five days were as effective in ameliorating clinical EAE as daily intraperitoneal injections of minocycline. Treatment of animals with PEG minocycline-liposomes significantly reduced the number of CNS-infiltrating leukocytes, and the overall expression of MMP-9 in the CNS. There was also a significant suppression of MMP-9 expression and proteolytic activity in splenocytes of treated animals, but not in CNS-infiltrating leukocytes. Thus, leukocytes gaining access to the brain and spinal cord require the same absolute amount of MMP-9 in all treatment groups, but minocycline decreases the absolute cell number. Conclusions Our data indicate that less frequent injections of PEG minocycline-liposomes are an effective alternative pharmacotherapy to daily minocycline injections for the treatment of CNS autoimmune diseases. Also, inhibition of MMP-9 remains a promising treatment target in EAE and patients with MS. PMID:19127301

Ben, Li-Hong; Cravens, Petra D.; Singh, Mahendra P.; Frohman, Elliot M.; Eagar, Todd N.; Racke, Michael K.; Kieseier, Bernd C.; Stuve, Olaf

2009-01-01

275

Liposomal squalenoyl-gemcitabine: formulation, characterization and anticancer activity evaluation  

NASA Astrophysics Data System (ADS)

A new prodrug of gemcitabine, based on the covalent coupling of squalene to gemcitabine (GemSQ), has been designed to enhance the anticancer activity of gemcitabine, a nucleoside analogue active against a wide variety of tumors. In the present study, the feasibility of encapsulating GemSQ into liposomes either PEGylated or non-PEGylated has been investigated. The in vivo anticancer activity of these formulations has been tested on subcutaneous grafted L1210wt leukemia model and compared to that of free gemcitabine. The liposomal GemSQ appears to be a potential delivery system for the effective treatment of tumors.

Pili, Barbara; ReddyCurrent Address: Sanofi-Aventis, 13 Quai Jules-Guesdes, 94403, Vitry-Sur-Seine, France., L. Harivardhan; Bourgaux, Claudie; Lepêtre-Mouelhi, Sinda; Desmaële, Didier; Couvreur, Patrick

2010-08-01

276

Selective killing of T lymphocytes by phototoxic liposomes  

SciTech Connect

Two-fold specificity in drug delivery obtained through the localized activation of drugs by physical means and the attachment of drugs to proteins that bind to target cells might be used for highly selective cancer chemotherapy or for immunosuppression. Toward this end, a monoclonal antibody against an antigen on the surface of T lymphocytes was covalently attached to liposomes containing a phototoxic drug, pyrene, bound to the lipid bilayer. When unfractionated peripheral blood lymphocytes, or B- and T-cell lines, were irradiated after treatment with these liposomes, T cells were killed while B cells were spared, demonstrating the validity of the approach in a simple in vitro assay.

Yemul, S.; Berger, C.; Estabrook, A.; Suarez, S.; Edelson, R.; Bayley, H.

1987-01-01

277

Cationic surface charge enhances early regional deposition of liposomes after intracarotid injection.  

PubMed

Rapid first pass uptake of drugs is necessary to increase tissue deposition after intraarterial (IA) injection. Here we tested whether brain tissue deposition of a nanoparticulate liposomal carrier could be enhanced by coordinated manipulation of liposome surface charge and physiological parameters, such as IA injection during transient cerebral hypoperfusion (TCH). Different degrees of blood-brain barrier disruption were induced by focused ultrasound in three sets of Sprague-Dawley rats. Brain tissue retention was then compared for anionic, cationic, and charge-neutral liposomes after IA injection combined with TCH. The liposomes contained a non-exchangeable carbocyanine membrane optical label that could be quantified using diffuse reflectance spectroscopy (DRS) or visualized by multispectral imaging. Real-time concentration-time curves in brain were obtained after each liposomal injection. Having observed greater tissue retention of cationic liposomes compared to other liposomes in all three groups, we tested uptake of cationic liposomes in C6 tumor bearing rats. DRS and multispectral imaging of postmortem sections revealed increased liposomal uptake by the C6 brain tumor as compared to non-tumor contralateral hemisphere. We conclude that regional deposition of liposomes can be enhanced without BBB disruption using IA injection of cationic liposomal formulations in healthy and C6 tumor bearing rats. PMID:25195130

Joshi, Shailendra; Singh-Moon, Rajinder; Wang, Mei; Chaudhuri, Durba B; Ellis, Jason A; Bruce, Jeffrey N; Bigio, Irving J; Straubinger, Robert M

2014-12-01

278

Quantitative analysis of the lamellarity of giant liposomes prepared by the inverted emulsion method.  

PubMed

The inverted emulsion method is used to prepare giant liposomes by pushing water-in-oil droplets through the oil/water interface into an aqueous medium. Due to the high encapsulation efficiency of proteins under physiological conditions and the simplicity of the protocol, it has been widely used to prepare various cell models. However, the lamellarity of liposomes prepared by this method has not been evaluated quantitatively. Here, we prepared liposomes that were partially stained with a fluorescent dye, and analyzed their fluorescence intensity under an epifluorescence microscope. The fluorescence intensities of the membranes of individual liposomes were plotted against their diameter. The plots showed discrete distributions, which were classified into several groups. The group with the lowest fluorescence intensity was determined to be unilamellar by monitoring the exchangeability of the inner and the outer solutions of the liposomes in the presence of the pore-forming toxin ?-hemolysin. Increasing the lipid concentration dissolved in oil increased the number of liposomes ?100 times. However, almost all the liposomes were unilamellar even at saturating lipid concentrations. We also investigated the effects of lipid composition and liposome content, such as highly concentrated actin filaments and Xenopus egg extracts, on the lamellarity of the liposomes. Remarkably, over 90% of the liposomes were unilamellar under all conditions examined. We conclude that the inverted emulsion method can be used to efficiently prepare giant unilamellar liposomes and is useful for designing cell models. PMID:25028876

Chiba, Masataka; Miyazaki, Makito; Ishiwata, Shin'ichi

2014-07-15

279

Hyaluronic acid derivative-coated nanohybrid liposomes for cancer imaging and drug delivery.  

PubMed

Nanohybrid liposomes coated with amphiphilic hyaluronic acid-ceramide (HACE) was fabricated for targeted delivery of anticancer drug and in vivo cancer imaging. Nanohybrid liposomes including doxorubicin (DOX) and Magnevist, a contrast agent for magnetic resonance (MR) imaging, with 120-130nm mean diameter and a narrow size distribution were developed. DOX release from the developed formulation was improved at acidic pH (pH5.5 and 6.8) versus physiological pH (pH7.4). Cytotoxicity induced by the blank plain liposome was reduced by coating the outer surface of the nanohybrid liposome with HACE. Cellular uptake of DOX from the nanohybrid liposome was enhanced by HA and CD44 receptor interaction, versus the plain liposome. In vivo contrast-enhancing effects revealed that the nanohybrid liposome can be used as a tumor targeting MR imaging probe for cancer diagnosis. In a pharmacokinetic study in rats, in vivo clearance of DOX was decreased in the order DOX solution, plain liposome (F2), and nanohybrid liposome (F3), indicating prolonged circulation of the drug in the blood stream and improved therapeutic efficacy of the nanohybrid liposome (F3). Based on these findings, the nanohybrid liposomal system may be a useful candidate for real-time cancer diagnosis and therapy. PMID:24280260

Park, Ju-Hwan; Cho, Hyun-Jong; Yoon, Hong Yeol; Yoon, In-Soo; Ko, Seung-Hak; Shim, Jae-Seong; Cho, Jee-Hyun; Park, Jae Hyung; Kim, Kwangmeyung; Kwon, Ick Chan; Kim, Dae-Duk

2014-01-28

280

Large third-order optical nonlinearity and optical limiting in symmetric and unsymmetrical phthalocyanines studied using Z-scan  

Microsoft Academic Search

The third-order nonlinear optical and optical limiting properties of 2,3,9,10,16,17,23,24-octakis-(heptyloxy)-phthalocyanine, 2,3,9,10,16,17,23,24-octakis-(heptyloxy)-phthalocyanine zinc(II) (symmetric) and 2(3)-(butane-1,4-dioic acid)-9(10),16(17),23(24)-tri tert-butyl phthalocyanine zinc(II) (unsymmetrical) have been investigated using a continuous wave laser at 633nm. We have employed the Z-scan technique to evaluate the sign and magnitude of nonlinear refractive index and the nonlinear absorption coefficient. Optical limiting based on nonlinear refraction was performed and

S. J. Mathews; S. Chaitanya Kumar; L. Giribabu; S. Venugopal Rao

2007-01-01

281

Design of a Gd-DOTA-Phthalocyanine Conjugate Combining MRI Contrast Imaging and Photosensitization Properties as a Potential Molecular Theranostic.  

PubMed

The design and synthesis of a phthalocyanine - Gd-DOTA conjugate is presented to open the way to novel molecular theranostics, combining the properties of MRI contrast imaging with photodynamic therapy. The rational design of the conjugate integrates isomeric purity of the phthalocyanine core substitution, suitable biocompatibility with the use of polyoxo water-solubilizing substituents, and a convergent synthetic strategy ended by the use of click chemistry to graft the Gd-DOTA moiety to the phthalocyanine. Photophysical and photochemical properties, contrast imaging experiments and preliminary in vitro investigations proved that such a combination is relevant and lead to a new type of potential theranostic agent. PMID:25131633

Ayd?n Tekda?, Duygu; Garifullin, Ruslan; Sentürk, Berna; Zorlu, Yunus; Gundogdu, Umut; Atalar, Ergin; Tekinay, Ayse B; Chernonosov, Alexander A; Yerli, Yusuf; Dumoulin, Fabienne; Guler, Mustafa O; Ahsen, Vefa; Gürek, Ay?e Gül

2014-11-01

282

Liposomes as vaccine delivery systems: a review of the recent advances.  

PubMed

Liposomes and liposome-derived nanovesicles such as archaeosomes and virosomes have become important carrier systems in vaccine development and the interest for liposome-based vaccines has markedly increased. A key advantage of liposomes, archaeosomes and virosomes in general, and liposome-based vaccine delivery systems in particular, is their versatility and plasticity. Liposome composition and preparation can be chosen to achieve desired features such as selection of lipid, charge, size, size distribution, entrapment and location of antigens or adjuvants. Depending on the chemical properties, water-soluble antigens (proteins, peptides, nucleic acids, carbohydrates, haptens) are entrapped within the aqueous inner space of liposomes, whereas lipophilic compounds (lipopeptides, antigens, adjuvants, linker molecules) are intercalated into the lipid bilayer and antigens or adjuvants can be attached to the liposome surface either by adsorption or stable chemical linking. Coformulations containing different types of antigens or adjuvants can be combined with the parameters mentioned to tailor liposomal vaccines for individual applications. Special emphasis is given in this review to cationic adjuvant liposome vaccine formulations. Examples of vaccines made with CAF01, an adjuvant composed of the synthetic immune-stimulating mycobacterial cordfactor glycolipid trehalose dibehenate as immunomodulator and the cationic membrane forming molecule dimethyl dioctadecylammonium are presented. Other vaccines such as cationic liposome-DNA complexes (CLDCs) and other adjuvants like muramyl dipeptide, monophosphoryl lipid A and listeriolysin O are mentioned as well. The field of liposomes and liposome-based vaccines is vast. Therefore, this review concentrates on recent and relevant studies emphasizing current reports dealing with the most studied antigens and adjuvants, and pertinent examples of vaccines. Studies on liposome-based veterinary vaccines and experimental therapeutic cancer vaccines are also summarized. PMID:25364509

Schwendener, Reto A

2014-11-01

283

Liposomes as vaccine delivery systems: a review of the recent advances  

PubMed Central

Liposomes and liposome-derived nanovesicles such as archaeosomes and virosomes have become important carrier systems in vaccine development and the interest for liposome-based vaccines has markedly increased. A key advantage of liposomes, archaeosomes and virosomes in general, and liposome-based vaccine delivery systems in particular, is their versatility and plasticity. Liposome composition and preparation can be chosen to achieve desired features such as selection of lipid, charge, size, size distribution, entrapment and location of antigens or adjuvants. Depending on the chemical properties, water-soluble antigens (proteins, peptides, nucleic acids, carbohydrates, haptens) are entrapped within the aqueous inner space of liposomes, whereas lipophilic compounds (lipopeptides, antigens, adjuvants, linker molecules) are intercalated into the lipid bilayer and antigens or adjuvants can be attached to the liposome surface either by adsorption or stable chemical linking. Coformulations containing different types of antigens or adjuvants can be combined with the parameters mentioned to tailor liposomal vaccines for individual applications. Special emphasis is given in this review to cationic adjuvant liposome vaccine formulations. Examples of vaccines made with CAF01, an adjuvant composed of the synthetic immune-stimulating mycobacterial cordfactor glycolipid trehalose dibehenate as immunomodulator and the cationic membrane forming molecule dimethyl dioctadecylammonium are presented. Other vaccines such as cationic liposome–DNA complexes (CLDCs) and other adjuvants like muramyl dipeptide, monophosphoryl lipid A and listeriolysin O are mentioned as well. The field of liposomes and liposome-based vaccines is vast. Therefore, this review concentrates on recent and relevant studies emphasizing current reports dealing with the most studied antigens and adjuvants, and pertinent examples of vaccines. Studies on liposome-based veterinary vaccines and experimental therapeutic cancer vaccines are also summarized. PMID:25364509

2014-01-01

284

Preparation, characterization and properties of sterically stabilized paclitaxel-containing liposomes.  

PubMed

Paclitaxel (Taxol) is a diterpenoid isolated from Taxus brevifolia, approved by the FDA for the treatment of ovarian and breast cancers. Due to its low solubility in water, it is clinically administered dissolved in Cremophor EL, (polyethoxylated castor oil) and ethanol, which cause serious side effects. Inclusion of paclitaxel in liposomal formulations has proved to be a good approach to eliminating this vehicle and improving the drug's antitumor efficacy. We prepared different conventional and PEGylated liposomes containing paclitaxel and determined encapsulation efficiency, physical stability and drug leakage in human plasma. The best conventional liposome formulation was composed of ePC/PG 9:1, while for PEGylated liposomes the best composition was ePC/PG/CHOL/PEG(5000)-DPPE 9:1:2:0.7. PEGylated liposomes were found to be less stable during storage than the corresponding conventional liposomes and to have lower drug release in human plasma at 37 degrees C. In vitro cytotoxic activities were evaluated on HT-29 human colon adenocarcinoma and MeWo melanoma cell lines. After 2 and 48 h, conventional liposomes had the same cytotoxicity as free paclitaxel, while PEGylated liposomes were as active as free drug, only after 48 h. Pharmacokinetics and biodistribution were evaluated in Balb/c mice after i.v. injection of paclitaxel, formulated in Cremophor EL or in conventional or in PEGylated liposomes. Encapsulation of paclitaxel in conventional liposomes produced marked differences over the free drug pharmacokinetics. PEGylated liposomes were long-circulating liposomes, with an increased t(1/2) beta 48.6 h, against t(1/2) beta 9.27 h of conventional liposomes. Biodistribution studies showed a considerable decrease in drug uptake in MPS-containing organs (liver and spleen) at 0.5 and 3 h after injection with PEGylated compared to conventional liposomes. PMID:10640577

Crosasso, P; Ceruti, M; Brusa, P; Arpicco, S; Dosio, F; Cattel, L

2000-01-01

285

Formulation, antileukemia mechanism, pharmacokinetics, and biodistribution of a novel liposomal emodin  

PubMed Central

Emodin is a multifunctional Chinese traditional medicine with poor water solubility. D-?-tocopheryl polyethylene glycol 1000 succinate (TPGS) is a pegylated vitamin E derivate. In this study, a novel liposomal-emodin-conjugating TPGS was formulated and compared with methoxypolyethyleneglycol 2000-derivatized distearoyl-phosphatidylethanolamine (mPEG2000–DSPE) liposomal emodin. TPGS improved the encapsulation efficiency and stability of emodin egg phosphatidylcholine/cholesterol liposomes. A high encapsulation efficiency of 95.2% ± 3.0%, particle size of 121.1 ± 44.9 nm, spherical ultrastructure, and sustained in vitro release of TPGS liposomal emodin were observed; these were similar to mPEG2000–DSPE liposomes. Only the zeta potential of ?13.1 ± 2.7 mV was significantly different to that for mPEG2000–DSPE liposomes. Compared to mPEG2000–DSPE liposomes, TPGS liposomes improved the cytotoxicity of emodin on leukemia cells by regulating the protein levels of myeloid cell leukemia 1 (Mcl-1), B-cell lymphoma-2 (Bcl-2) and Bcl-2-associated X protein, which was further enhanced by transferrin. TPGS liposomes prolonged the circulation time of emodin in the blood, with the area under the concentration–time curve (AUC) 1.7 times larger than for free emodin and 0.91 times larger than for mPEG2000–DSPE liposomes. In addition, TPGS liposomes showed higher AUC for emodin in the lung and kidney than for mPEG2000–DSPE liposomes, and both liposomes elevated the amount of emodin in the heart. Overall, TPGS is a pegylated agent that could potentially be used to compose a stable liposomal emodin with enhanced therapeutics. PMID:22661889

Wang, Tiechuang; Yin, Xiaodong; Lu, Yaping; Shan, Weiguang; Xiong, Subin

2012-01-01

286

Mechanism of reverse saturable absorption in chloro-aluminum phthalocyanine solution studied with Z-scan  

Microsoft Academic Search

Using the Z-scan technique with 532 nm laser pulses of dual widths in the picosecond regime, we distinguish between two-photon absorption (TPA) and excited state absorption (ESA). To account for reverse saturable absorption in chloro-aluminum phthalocyanine dissolved in methanol both TPA and ESA, rather than either one, need be invoked.

Tai-Huei Wei; Tzer-Hsiang Huang; Tsai-Chuan Wen

1999-01-01

287

Lattice expansion of highly oriented 2D phthalocyanine covalent organic framework films.  

PubMed

Expanding into application: covalent organic framework (COF) films are ideally suited for vertical charge transport and serve as precursors of ordered heterojunctions. Their pores, however, were previously too small to accommodate continuous networks of complementary electron acceptors. Four phthalocyanine COFs with increased pore size well into the mesoporous regime are now described. PMID:22223402

Spitler, Eric L; Colson, John W; Uribe-Romo, Fernando J; Woll, Arthur R; Giovino, Marissa R; Saldivar, Abraham; Dichtel, William R

2012-03-12

288

Metabolism of the phthalocyanine textile dye remazol turquoise blue by Phanerochaete chrysosporium  

Microsoft Academic Search

The ability of a strain of Phanerochaete chrysosporium to decolourise the commercially important copper-phthalocyanine dye Remazol turquoise blue was investigated. The fungus was found to completely decolourise the dye at a concentration of 200 mg l?1 within 7 days. High performance liquid chromatography (HPLC) and polarographic analysis of culture supernatants indicated that degradation of the dye structure was occurring with

A Conneely; W. F Smyth; G McMullan

1999-01-01

289

Optical properties of phthalocyanine thin films synthesised in the solid state  

Microsoft Academic Search

A new way of preparing thin films of phthalocyanines (PC) is demonstrated. Starting from the precursor isoindoline 2, a solid-state synthesis of Mn and Zn PC 3a and 3b in thin films by a thermoreaction is described. The optical properties of the thin films which absorb strongly in the near infrared are investigated. Parameters such as film thickness, optical spectra,

M. Baumann; M.-O. Bévierre; N. Bogdanova; X. Xie

1996-01-01

290

Commensurate ordering of iron phthalocyanine on Ag(1 1 1) surface  

NASA Astrophysics Data System (ADS)

Epitaxial growth of iron phthalocyanine on a silver (1 1 1) surface has been studied with scanning tunneling microscopy in ultrahigh vacuum. While several structures were observed, this report concentrates on what appeared to be the most stable phase. This phase has commensurate two-dimensional ordering with oblique unit vectors ( b1, b2) where b1 = 5 a1 + 2 a2 and b2 = 5 a2, where a1 and a2 are unit vectors of Ag(1 1 1) surface. The rotation angle of iron phthalocyanine relative to the silver [1 0 1¯] direction was determined to be 16.63° from the high-resolution image analysis. The oblique structure is more commensurate than that of iron phthalocyanine on graphite and of copper phthalocyanine on the Ag(1 1 1) surface. The observed FePc on Ag(1 1 1) structure is similar to that of FePc on Au(1 1 1), but has significantly higher surface density. Bias dependence of the images was observed and is consistent with the expected small HOMO-LUMO gap.

Takami, Tomohide; Carrizales, Clarisa; Hipps, K. W.

2009-11-01

291

Metal (2) 4,4',4",4'" phthalocyanine tetraamines as curing agents for epoxy resins  

NASA Technical Reports Server (NTRS)

Metal, preferably divalent copper, cobalt or nickel, phthalocyanine tetraamines are used as curing agents for epoxides. The resulting copolymers have high thermal and chemical resistance and are homogeneous. They are useful as binders for laminates, e.g., graphite cloth laminate.

Achar, B. N.; Fohlen, G. M.; Parker, J. A. (inventors)

1985-01-01

292

Selective adsorption of metal-phthalocyanine on Au(111) surface with hydrogen atoms  

E-print Network

that the binding of small gas molecules (such as NO, CO, NH3, and so on) to these molecules results in a change 11 July 2013) Metal phthalocyanine (MPc, M ¼ Mn, Fe) molecules grown on reconstructed Au(111 microscopy. It is found out that the attachment of H atoms to the central metal of the MnPc molecules leads

Gao, Hongjun

293

Dispersion of Ultrafast Optical Kerr Effect in No-aggregation Phthalocyanine Molecules  

NASA Astrophysics Data System (ADS)

We report dispersion property for femtosecond optical Kerr effect in the solutions of no-aggregation 16 (trifluoro ethoxyl) vanadyl phthalocyanine in the wavelength range of 850-770 nm. The optical Kerr effect spectrum shows a broad near-resonant enhancement on the third-order non-linear optical response of the molecule.

Gong, Qi-huang; T, Isoshima; M, Q. Tian; T, Wada; H, Sasabe

1997-02-01

294

Photodynamic pathogen inactivation in red cell concentrates with the silicon phthalocyanine Pc 4  

Microsoft Academic Search

The silicon phthalocyanine Pc 4, a photosensitizer activated with red light, has been studied for pathogen inactivation in red blood cell concentrates (RBCC). Pc 4 targets the envelope of pathogenic viruses such as HIV. To protect RBC during the process two main approaches are used: 1) Inclusion of quenches of reactive oxygen species produced during treatment. Tocopherol succinate was found

Ehud Ben-Hur; Wai-Shun Chan; Zachary Yim; Maria M. Zuk; Vinay Dayal; Nathan Roth; Eli Heldman; A. Lazlo; C. R. Valeri; Bernard Horowitz

2000-01-01

295

Effects of morphology on NO 2 detection in air at room temperature with phthalocyanine thin films  

Microsoft Academic Search

Lead phthalocyanine films freshly deposited on alumina and glass were found to consist of disordered phases and fine particles with mean diameter below 0.2µm. Following annealing at 300 ° C, a transition to a crystalline form is obtained. The crystal size in the films annealed at 300 ° C or above is affected by the nature of the substrate, ambient

Y. Sadaoka; T. A. Jones; G. S. Revell; W. Göpel

1990-01-01

296

Comparison of sample preparation (extraction) techniques for phthalocyanine blue pigment types  

Microsoft Academic Search

Two sample preparation methods, Soxhlet extraction and the perforation of solutions in conc. sulphuric acid were used and compared for PCDD and PCDF determination in phthalocyanine blue (Heliogen ® Blue) pigments. The Soxhlet extraction method gave lower recoveries for the penta to octachloro homologues. The PCDD\\/F-values (?of isomers) determined with the perforation method were in the range of 0.1 to

K. S. Brenner

1994-01-01

297

Spectroelectrochemical characterization and controlled potential chronocoulometric demetallation of tetra- and octa-substituted lead phthalocyanines  

Microsoft Academic Search

The solution redox properties and spectroelectrochemical investigation of the novel lead phthalocyanines carrying chloro alkylthio and alkylmalonyl at periphery were studied using various electrochemical techniques in DCM on a platinum electrode. Cyclic voltammetry and differential pulse voltammetry studies show that all of the complexes give up to five ligand-based diffusion controlled one-electron reversible redox couples. Assignments of the redox couples

At?f Koca; Hatice A. Dinçer; Hatice Çerlek; Ahmet Gül; Makbule B. Koçak

2006-01-01

298

THE JOURNAL OF CHEMICAL PHYSICS 134, 114711 (2011) Adsorption of ammonia on multilayer iron phthalocyanine  

E-print Network

isoindole units linked together by nitrogen atoms and which are character- ized by an electron cloud delocalized over the alternating car- bon and nitrogen atoms.1 In its center, the phthalocyanine molecule may hold an ion from a large variety of different metal elements and the compound is then termed a metal

Schnadt, Joachim

299

Phthalocyanine semiconductor sensors for room-temperature ppb level detection of toxic gases  

Microsoft Academic Search

Nickel and lead phthalocyanine (NiPc and PbPc) thin films prepared by vacuum sublimation have been investigated for use as gas sensors. High sensitivity (25 ppb), reversibility, and very fast response time (? seconds) have been demonstrated for detection of NO2 at room temperature. The sensor output increases by five to seven orders of magnitude as the gas concentration is increased

T. A. Temofonte; K. F. Schoch

1989-01-01

300

Effect of liposomes and niosomes on skin permeation of enoxacin  

Microsoft Academic Search

The skin permeation and partitioning of a fluorinated quinolone antibacterial agent, enoxacin, in liposomes and niosomes, after topical application, were elucidated in the present study. In vitro percutaneous absorption experi- ments were performed on nude mouse skin with Franz diffusion cells. The influence of vesicles on the physicochemical property and stability of the formulations were measured. The enhanced delivery across

Jia-You Fang; Chi-Tzong Hong; Wen-Ta Chiu; Ying-Yue Wang

2001-01-01

301

Porphyrin-phospholipid liposomes permeabilized by near-infrared light  

NASA Astrophysics Data System (ADS)

The delivery of therapeutic compounds to target tissues is a central challenge in treating disease. Externally controlled drug release systems hold potential to selectively enhance localized delivery. Here we describe liposomes doped with porphyrin-phospholipid that are permeabilized directly by near-infrared light. Molecular dynamics simulations identified a novel light-absorbing monomer esterified from clinically approved components predicted and experimentally demonstrated to give rise to a more stable porphyrin bilayer. Light-induced membrane permeabilization is enabled with liposomal inclusion of 10 molar % porphyrin-phospholipid and occurs in the absence of bulk or nanoscale heating. Liposomes reseal following laser exposure and permeability is modulated by varying porphyrin-phospholipid doping, irradiation intensity or irradiation duration. Porphyrin-phospholipid liposomes demonstrate spatial control of release of entrapped gentamicin and temporal control of release of entrapped fluorophores following intratumoral injection. Following systemic administration, laser irradiation enhances deposition of actively loaded doxorubicin in mouse xenografts, enabling an effective single-treatment antitumour therapy.

Carter, Kevin A.; Shao, Shuai; Hoopes, Matthew I.; Luo, Dandan; Ahsan, Bilal; Grigoryants, Vladimir M.; Song, Wentao; Huang, Haoyuan; Zhang, Guojian; Pandey, Ravindra K.; Geng, Jumin; Pfeifer, Blaine A.; Scholes, Charles P.; Ortega, Joaquin; Karttunen, Mikko; Lovell, Jonathan F.

2014-04-01

302

Preparation, Biodistribution and Neurotoxicity of Liposomal Cisplatin following Convection Enhanced  

E-print Network

, United States of America, 2 Division of Pharmaceutics, College of Pharmacy, The Ohio State University. In vivo CHEMS liposomes showed high retention at 24 h after intracerebral (i.c.) convection enhanced in Normal and F98 Glioma Bearing Rats. PLoS ONE 7(11): e48752. doi:10.1371/journal.pone.0048752 Editor

Paris-Sud XI, Université de

303

Thermal analysis of phase transition behaviour in liposomes  

Microsoft Academic Search

Liposomes are small vesicles having one or more concentric phospholipid bilayers, interspersed with aqueous phase. Thermal analysis, particularly differential scanning calorimetry (DSC) has been used extensively to study the behaviour of hydrated phospholipids within bilayers. On heating, and dependent on the state of hydration, phospholipids undergo a series of phase transitions. This paper reviews investigations of the phase transition behaviour

Kevin M. G. Taylor; Rita M. Morris

1995-01-01

304

Liposomal bupivacaine: a review of a new bupivacaine formulation  

PubMed Central

Many attempts have been made to increase the duration of local anesthetic action. One avenue of investigation has focused on encapsulating local anesthetics within carrier molecules to increase their residence time at the site of action. This article aims to review the literature surrounding the recently approved formulation of bupivacaine, which consists of bupivacaine loaded in multivesicular liposomes. This preparation increases the duration of local anesthetic action by slow release from the liposome and delays the peak plasma concentration when compared to plain bupivacaine administration. Liposomal bupivacaine has been approved by the US Food and Drug Administration for local infiltration for pain relief after bunionectomy and hemorrhoidectomy. Studies have shown it to be an effective tool for postoperative pain relief with opioid sparing effects and it has also been found to have an acceptable adverse effect profile. Its kinetics are favorable even in patients with moderate hepatic impairment, and it has been found not to delay wound healing after orthopedic surgery. More studies are needed to establish its safety and efficacy for use via intrathecal, epidural, or perineural routes. In conclusion, liposomal bupivacaine is effective for treating postoperative pain when used via local infiltration when compared to placebo with a prolonged duration of action, predictable kinetics, and an acceptable side effect profile. However, more adequately powered trials are needed to establish its superiority over plain bupivacaine. PMID:23049275

Chahar, Praveen; Cummings, Kenneth C

2012-01-01

305

Gadolinium-containing phosphatidylserine liposomes for molecular imaging of atherosclerosis.  

PubMed

Exteriorized phosphatidylserine (PS) residues in apoptotic cells trigger rapid phagocytosis by macrophage scavenger receptor pathways. Mimicking apoptosis with liposomes containing PS may represent an attractive approach for molecular imaging of atherosclerosis. We investigated the utility of paramagnetic gadolinium liposomes enriched with PS (Gd-PS) in imaging atherosclerotic plaque. Gd-PS-containing Gd-conjugated lipids, fluorescent rhodamine, and PS were prepared and characterized. Cellular uptake in RAW macrophages (fluorescent uptake of rhodamine) was studied on a fluorescence plate reader, while Gd-PS-induced alteration in T1 relaxivity was evaluated using a 1.5 T MRI scanner. RAW cells demonstrate PS-dependent uptake of across a range of concentrations (2, 6, 12, and 20%) in comparison to control liposomes with no PS (0%). In vivo performance of Gd-PS was evaluated in the ApoE(-/-) mouse model by collection of serial T1 weighted gradient echo MR images using an 11.7 T MRI system and revealed rapid and significant enhancement of the aortic wall that was seen for at least 4 h after injection. Gd-PS-enriched liposomes enhance atherosclerotic plaque and colocalize with macrophages in experimental atherosclerosis. PMID:19017616

Maiseyeu, Andrei; Mihai, Georgeta; Kampfrath, Thomas; Simonetti, Orlando P; Sen, Chandan K; Roy, Sashwati; Rajagopalan, Sanjay; Parthasarathy, Sampath

2009-11-01

306

Methods for assessing splenic macrophage depletion by liposome encapsulated clodronate  

Microsoft Academic Search

Small unilamellar vesicles containing clodronate (SUVc) injected intravenously will deplete splenic macrophages and the degree of histological depletion can be assessed by determining the clearance and uptake of monoclonal antibody coated erythrocytes. Splenic Fc dependent clearance, assessed in decomplemented animals, provides a more sensitive index of the effects of large multilamellar liposome encapsulated clodronate (MLVc) and SUVc than does the

J. P. Camilleri; A. S. Williams; N. Amos; A. G. Douglas-Jones; W. G. Love; B. D. Williams

1995-01-01

307

Foamlike Nanostructures Created from Dendritic Platinum Sheets on Liposomes  

E-print Network

and high cost of Pt, researchers are developing methods for eliminating or reducing the precious metal of an aqueous metal complex with ascorbic acid in the presence of liposomes is reported. Variation-10 as a catalyst for reduction of tailpipe emissions, as an electrocatalyst in polymer electrolyte membrane (PEM

Shelnutt, John A.

308

Plasmon-Related Modification of Spectral Kinetic Properties of Copper Phthalocyanine Thin Films in the Presence of Silver Nanoparticles*  

NASA Astrophysics Data System (ADS)

We have studied the relaxation dynamics for hot electrons in hybrid layered nanocomposites based on island films of silver and copper phthalocyanine. Using femtosecond kinetic spectroscopy, we have shown that the fast component of the bleaching relaxation kinetics in the spectral region corresponding to the absorption bands of copper phthalocyanine correlates with the recovery kinetics for surface plasmon resonance absorption of the silver nanoparticles. This suggests that the fast relaxing bleaching recorded in the absorption bands of copper phthalocyanine and its dynamics are not due to a change in the populations of the energy states of copper phthalocyanine but rather to a change in the state of the plasmon nanoparticles, as a result of their excitation by femtosecond pulses and subsequent relaxation.

Buganov, O. V.; Zamkovets, A. D.; Ponyavina, A. N.; Tikhomirov, S. A.

2014-03-01

309

The photochemistry and photophysics of a series of alpha octa(alkyl-substituted) silicon, zinc and palladium phthalocyanines.  

PubMed

Photophysical and photochemical measurements have been made on a series of novel alpha octa(alkyl-substituted) silicon, zinc and palladium phthalocyanines for which the synthesis is outlined. Fluorescence quantum yields and lifetimes, triplet quantum yields and lifetimes and singlet delta oxygen quantum yields were measured in 1% v/v pyridine in toluene. The effects of varying central atom and addition of alkyl substituents relative to unsubstituted parent molecules, zinc phthalocyanine (ZnPc) and silicon phthalocyanine (SiPc), are discussed. All phthalocyanines studied exhibit absorption and emission maxima in the region of 680-750 nm with molar absorptivity of the Q-band ~10(5) M(-1) cm(-1). The series of compounds also exhibited triplet quantum yields of 0.65-0.95 and singlet oxygen quantum yields of 0.49-0.93. PMID:24196234

van Leeuwen, Magda; Beeby, Andrew; Fernandes, Isabelle; Ashworth, Stephen H

2014-01-01

310

Vitamin C-driven epirubicin loading into liposomes  

PubMed Central

The encapsulation of anticancer drugs in a liposome structure protects the drug during circulation and increases drug accumulation in the cancer tissue and antitumor activity while decreasing drug toxicity. This paper presents a new method of active drug loading based on a vitamin C pH/ion gradient. Formulations were characterized in terms of the following parameters: optimal external pH, time and drug-to-lipid ratio for the purpose of remote loading, and in vitro stability. In the case of the selected drug, epirubicin (EPI), its coencapsulation increases its anticancer activity through a possibly synergistic effect previously reported by other groups for a free nonencapsulated drug/vitamin C cocktail. The method also has another advantage over other remote-loading methods: it allows faster drug release through liposome destabilization at the tumor site, thanks to the very good solubility of the EPI vitamin C salt, as seen on cryogenic transmission electron microscopy images. This influences the drug-release process and increases the anticancer activity of the liposome formulation. The liposomes are characterized as stable, with very good pharmacokinetics (half-life 18.6 hours). The antitumor activity toward MCF-7 and 4T-1 breast cancer cells was higher in the case of EPI loaded via our gradient than via an ammonium sulfate gradient. Finally, the EPI liposomal formulation and the free drug were tested using the murine 4T-1 breast cancer model. The antitumor activity of the encapsulated drug was confirmed (tumor-growth inhibition over 40% from day 16 until the end of the experiment), and the free drug was shown to have no anticancer activity at the tested dose. PMID:24101870

Lipka, Dominik; Gubernator, Jerzy; Filipczak, Nina; Barnert, Sabine; Suss, Regine; Legut, Mateusz; Kozubek, Arkadiusz

2013-01-01

311

Vitamin C-driven epirubicin loading into liposomes.  

PubMed

The encapsulation of anticancer drugs in a liposome structure protects the drug during circulation and increases drug accumulation in the cancer tissue and antitumor activity while decreasing drug toxicity. This paper presents a new method of active drug loading based on a vitamin C pH/ion gradient. Formulations were characterized in terms of the following parameters: optimal external pH, time and drug-to-lipid ratio for the purpose of remote loading, and in vitro stability. In the case of the selected drug, epirubicin (EPI), its coencapsulation increases its anticancer activity through a possibly synergistic effect previously reported by other groups for a free nonencapsulated drug/vitamin C cocktail. The method also has another advantage over other remote-loading methods: it allows faster drug release through liposome destabilization at the tumor site, thanks to the very good solubility of the EPI vitamin C salt, as seen on cryogenic transmission electron microscopy images. This influences the drug-release process and increases the anticancer activity of the liposome formulation. The liposomes are characterized as stable, with very good pharmacokinetics (half-life 18.6 hours). The antitumor activity toward MCF-7 and 4T-1 breast cancer cells was higher in the case of EPI loaded via our gradient than via an ammonium sulfate gradient. Finally, the EPI liposomal formulation and the free drug were tested using the murine 4T-1 breast cancer model. The antitumor activity of the encapsulated drug was confirmed (tumor-growth inhibition over 40% from day 16 until the end of the experiment), and the free drug was shown to have no anticancer activity at the tested dose. PMID:24101870

Lipka, Dominik; Gubernator, Jerzy; Filipczak, Nina; Barnert, Sabine; Süss, Regine; Legut, Mateusz; Kozubek, Arkadiusz

2013-01-01

312

Application of antibody and fluorophore-derivatized liposomes to heterogeneous immunoassays for d-dimer.  

PubMed

Small unilamellar liposomes comprised of cholesterol and phospholipids, in which one of the lipids is labeled with a fluorophore, have been covalently functionalized with antibodies. The liposomes were conjugated with thousands of fluorescein molecules and 10-20 monoclonal antibodies per liposome. These bifunctional liposomes were used in a direct (sandwich-type) immunoassay for the detection of thromboembolic disorders by assaying for d-dimer. D-dimer is the final and the smallest proteolytic product in the degradation of cross-linked fibrin by the plasma protein plasmin. The immunoassay using liposomes was compared to a conventional immunoassay that uses a fluor-antibody conjugate. The liposomes, by virtue of having thousands of fluorophores coupled to one liposome in contrast to one or a few reporter molecules in the conventional fluor-antibody conjugate, performed better on two counts: (1) they lowered the detection limit by a factor of 120 and (2) they provided a 1 order of magnitude amplification in signal. The minimum detectable concentration (MDC) of d-dimer was 5.6 ng/mL with the liposomal assay as compared to an MDC of 674 ng/mL with conventional fluor-antibody conjugate. The results of fluorescence assays were also compared with the results obtained by Singh et al. (Biotechnol. Prog. 1995, 11, 333-341) in an enzyme immunoassay developed using liposomes. These results demonstrate the potential of liposomes in lowering detection limits and increasing the sensitivity of immunoassays. PMID:8857195

Singh, A K; Kilpatrick, P K; Carbonell, R G

1996-01-01

313

Lead ions encapsulated in liposomes and their effect on Staphylococcus aureus.  

PubMed

The aim of the study was the preparation of a liposome complex with encapsulated lead ions, which were electrochemically detected. In particular, experiments were focused on the potential of using an electrochemical method for the determination of free and liposome-encapsulated lead and determination of the encapsulation efficiency preventing the lead toxicity. Primarily, encapsulation of lead ions in liposomes and confirmation of successful encapsulation by electrochemical methods was done. Further, the reduction effect of the liposome matrix on the detected electrochemical signal was monitored. Besides encapsulation itself, comparison of toxicity of free lead ions and lead ions encapsulated in liposome was tested. The calculated IC50 values for evaluating the lead cytotoxicity showed significant differences between the lead enclosed in liposomes (28 µM) and free lead ions (237 µM). From the cytotoxicity studies on the bacterial strain of S. aureus it was observed that the free lead ions are less toxic in comparison with lead encapsulated in liposomes. Liposomes appear to be a suitable carrier of various substances through the inner cavity. Due to the liposome structure the lead enclosed in the liposome is more easily accepted into the cell structure and the toxicity of the enclosed lead is higher in comparison to free lead ions. PMID:24317385

Kensova, Renata; Blazkova, Iva; Konecna, Marie; Kopel, Pavel; Chudobova, Dagmar; Zitka, Ondrej; Vaculovicova, Marketa; Hynek, David; Adam, Vojtech; Beklova, Miroslava; Kizek, Rene

2013-12-01

314

Surface modification of liposomes with rhodamine-123-conjugated polymer results in enhanced mitochondrial targeting  

PubMed Central

A novel mitochondrial-targeted liposomal drug-delivery system was prepared by modification of the liposomal surface with a newly synthesized polymer, rhodamine-123 (Rh123)-PEG-DOPE inserted into the liposomal lipid bilayer. This novel polymer was synthesized by conjugating the mitochondriotropic dye Rh123, with the amphiphilic polyethylene glycol–phosphatidylethanolamine (PEG-PE) conjugate. The modified liposomes showed better uptake by cells (HeLa, B16F10) estimated by fluorescence microscopy and FACS analysis. The co-localization study with stained mitochondria as well as with the isolation of mitochondria of the cultured cells after their treatment with Rh123 liposomes showed a high degree of accumulation of the modified liposomes in the mitochondria. We also prepared mitochondrial-targeted and nontargeted paclitaxel (PCL)-loaded liposomes. Mitochondrial-targeted PCL-loaded liposomes demonstrated enhanced cytotoxicity toward cancer cells compared with nontargeted drug-loaded liposomes or free PCL. Thus, Rh123-modified liposomes target mitochondria efficiently and can facilitate the delivery of a therapeutic payload to mitochondria. PMID:21348804

Biswas, Swati; Dodwadkar, Namita S.; Sawant, Rupa R.; Koshkaryev, Alexander; Torchilin, Vladimir P.

2012-01-01

315

Kinetic of the Intracellular Incorporation of New Phthalocyanines Synthesized in mexico and Its Potential as Photosensibilizers in the Photodynamic Therapy  

SciTech Connect

The search of more specific and efficient photosensitizer in low oxygen tensions is a need in the Photodynamic Therapy (PDT). Phthalocyanines have demonstrated to have the above mentioned activity. The aim of this work was to determine the efficiency of PDT using two phthalocyanines synthesized in Mexico to eliminate melanoma cells. B16F0 melanoma mouse cells were exposed to concentrations from 8.95x10{sup -5} to 0.733 m/mL of F16VoPc and F16NbPcC13 during 24h, afterwards cellular mortality was measured. One kinetic was realized to determine the intracellular incorporation of phthalocyanines by confocal microscopy at 1, 2, 4, 8, 16 and 24 h of exposition. The PDT was applied exposing the cells to innocuous concentration (that does not provoke cellular death with out irradiation) and irradiating with an argon laser at 100 J/cm{sup 2}. For each phthalocyanine a control group was used; one group was not treated neither with light nor with phthalocyanine, the other group it was only irradiated. 24 h after treatment the citotoxicity was measured by Alamar blue assay. The innocuous concentration found for the phthalocyanines F16VoPc and F16NbPcC13 were 4.58x10-2 and 2.29xl0{sup -2} mg/mL, respectively. The time of maximum intracellular accumulation for both phthalocyanines was 24 h. Only the F16VoPc had anticancerous activity and induced 31.7% of cellular death. The PDT might offer a potential alternative to the treatment of this cancer when is used the phthalocyanine F16VoPc.

Aragon-Aguilar, Hector; Ramon-Gallegos, Eva; Arenas-Huertero, Francisco Jesus [Departamento de Morfologia, ENCB, Institute Politecnico Nacional. Carpio y Plan de Ayala S/N. Col. Sto Tomas. Mexico, D.F. C.P. 11340 (Mexico); Contreras-Ramos, Alejandra [Hospital Infantil de Mexico (Mexico); Cruz-Orea, Alfredo [Depto. de Fisica, CINVESTAV-IPN, unidad Zacatenco, Mexico, D.F. (Mexico); Sosa-Sanchez, Jose Luis; Garcia Miranda, Maribel [Universidad Autonoma de Puebla. Blvd. 14 Sur y Ave. San Claudio, Edificio 137 Ciudad Universitaria, Col. San Manuel, Puebla, Puebla (Mexico)

2008-08-11

316

Synthesis and highly ordered thin films of optically active 2?-methoxy-1,1?-binaphthyl substituted phthalocyanines  

Microsoft Academic Search

The synthesis of metal-free and metal phthalocyanines modified with optically active binaphthyl is described. The structure is confirmed by 1H NMR, UV-Vis, CD, and MALDL–TOF MS. They can form stable monolayers at the air–water interface. In these layers, the phthalocyanines planes are stacked in edge-on arrangement. The monolayers can be transferred onto solid substrates and the resulting LB films are

Hongwei Liu; Yaohu Liu; Chuanfeng Zhu; Minghua Liu; Chen Wang; Chuanfu Chen; Fu Xi

2002-01-01

317

Features of the spectral dependences of transmittance of organic semiconductors based on tert-butyl substituted lutetium phthalocyanine molecules  

SciTech Connect

Vibronic properties of organic semiconductors based on tert-butyl substituted phthalocyanine lutetium diphthalocyanine molecules are studied by IR and Raman spectroscopy. It is shown that substitution of several carbon atoms in initial phthalocyanine (Pc) ligands with {sup 13}C isotope atoms causes a spectral shift in the main absorption lines attributed to benzene, isoindol, and peripheral C-H groups. A comparison of spectral characteristics showed that the shift can vary from 3 to 1 cm{sup -1}.

Belogorokhov, I. A., E-mail: jugqwerty@mail.ru [State Research and Project Institute of Rare-Metal Industry GIREDMET (Russian Federation); Tikhonov, E. V. [Moscow State University (Russian Federation); Dronov, M. A. [Russian Academy of Sciences, Prokhorov General Physics Institute (Russian Federation); Belogorokhova, L. I. [Moscow State University (Russian Federation); Ryabchikov, Yu. V. [Russian Academy of Sciences, Lebedev Physical Institute (Russian Federation); Tomilova, L. G.; Khokhlov, D. R. [Moscow State University (Russian Federation)

2011-11-15

318

Peptide-carrier interaction: induction of liposome fusion and aggregation by insulin.  

PubMed

As the roles of peptidic agents in therapy expand, the need for gaining the knowledge for formulating peptides and/or polypeptides becomes increasingly urgent. In an attempt to study various approaches to formulating peptidic agents for therapeutic applications, we investigated the interactions between drug carriers and peptides, using liposomes and insulin as a model. The fusion and aggregation properties of dipalmitoylphosphatidylcholine (DPPC) small, unilamellar liposomes, on the binding of insulin was studied by the techniques of resonance energy transfer of fluorescent labeled lipids, electron microscopy, and right-angle scattering. Within 1 h of adding insulin to DPPC liposomes at 25 degrees C, the average size of the liposomes increased from 239 to 361 A in diameter. There was no further increase in the size of the liposomes after the fused liposomes reached this size. However, the aggregation of the fused liposomes continued to increase for several hours after the insulin-induced fusion stopped. Our results suggest that insulin induces the aggregation of newly fused liposomes, when the temperature is below the gel----liquid crystalline phase-transition temperature (Tc) of the liposomes. The aggregation of fused liposomes is markedly affected by not only the zinc content of insulin but also the pH and ionic strength of the solution. The results of the present study demonstrate that an amphyphilic molecule, such as insulin, could induce the fusion of liposomes via hydrophobic interaction and facilitate liposome aggregation via hydrophilic interaction. Thus, when entrapping insulin by small, unilamellar liposomes, care should be taken to avoid fusion and aggregation. PMID:3517295

Wiessner, J H; Mar, H; Baskin, D G; Hwang, K J

1986-03-01

319

Computer-aided design of liposomal drugs: In silico prediction and experimental validation of drug candidates for liposomal remote loading.  

PubMed

Previously we have developed and statistically validated Quantitative Structure Property Relationship (QSPR) models that correlate drugs' structural, physical and chemical properties as well as experimental conditions with the relative efficiency of remote loading of drugs into liposomes (Cern et al., J. Control. Release 160 (2012) 147-157). Herein, these models have been used to virtually screen a large drug database to identify novel candidate molecules for liposomal drug delivery. Computational hits were considered for experimental validation based on their predicted remote loading efficiency as well as additional considerations such as availability, recommended dose and relevance to the disease. Three compounds were selected for experimental testing which were confirmed to be correctly classified by our previously reported QSPR models developed with Iterative Stochastic Elimination (ISE) and k-Nearest Neighbors (kNN) approaches. In addition, 10 new molecules with known liposome remote loading efficiency that were not used by us in QSPR model development were identified in the published literature and employed as an additional model validation set. The external accuracy of the models was found to be as high as 82% or 92%, depending on the model. This study presents the first successful application of QSPR models for the computer-model-driven design of liposomal drugs. PMID:24184343

Cern, Ahuva; Barenholz, Yechezkel; Tropsha, Alexander; Goldblum, Amiram

2014-01-10

320

Kvantifiering av Liposomer med Faergaemnet Stains-All (Quantification of Liposome Using the Dye Stains-All).  

National Technical Information Service (NTIS)

Liposomes or vesicles made up of a lipid bilayer, could be used for a couple of different applications, for example as carriers of drugs or genetic materials, or as a model when biological membranes are to be studied. They could also be used to incorporat...

E. Artursson

1999-01-01

321

The PEGylated liposomal doxorubicin improves the delivery and therapeutic efficiency of (188)Re-Liposome by modulating phagocytosis in C26 murine colon carcinoma tumor model.  

PubMed

Liposome in delivering radionuclide for cancer therapy has been expansively studied; however, liposome itself can be deliberately entrapped and destroyed by the reticuloendothelial system, causing an insufficiency of the drug delivery, which in turn would restrict the effectiveness of the drug. In this study, mice with subcutaneous implantation of C26 murine colon cancer received an experimental treatment regimen in which mice took delivery of PEGylated liposomal doxorubicin (LipoDox) first, after a three-day interval, of Rhenium-188 encapsulated into PEGylated liposome ((188)Re-Liposome) subsequently and by which suppressed the functioning of reticuloendothelial system for the short term. The data showed that based upon the biodistribution assay and the evaluation of the therapeutic efficacy, (188)Re-Liposome was more sufficiently delivered to tumor sites in mice with this treatment regimen than mice without the regimen, and that cancer mortalities in mice with the treatment regimen were much lower than the mortalities in mice without the regimen. Taken together, a new strategy proposed in this study significantly improved both the (188)Re-Liposome delivery and the effectiveness of (188)Re-Liposome, suggesting that the strategy can be an ideal treatment for cancer. PMID:25027866

Hsu, Wei-Hsin; Liu, Si-Yen; Chang, Ya-Jen; Chang, Chih-Hsien; Ting, Gann; Lee, Te-Wei

2014-10-01

322

The preparation and modification of phthalocyanine containing materials  

NASA Astrophysics Data System (ADS)

Phthalocyanines (Pcs) are highly conjugated, 18 pi-electron cyclic molecules composed of four isoindoline units that exhibit unique optical, electrical and chemical properties. While originally used as dyes and pigments, the use of Pcs in modern technology has increased dramatically due to improved understanding and processing capabilities. Work in this dissertation outlines a number of methods to prepare Pc-containing materials for use in various applications. Chapter 1 provides a brief review of methods used to prepare Pc-containing polymeric materials from both symmetric and asymmetric macrocycles. Discussion will focus on methods that incorporate symmetric Pcs as the focal point, with particular attention being paid to the influence of the peripheral substitution of the Pc on macromolecular structure and properties. Further discussion will focus on the utilization of asymmetric Pcs as auxiliary functionalities, such as at the terminus or as pendant groups, of larger macromolecular materials. Chapter 2 describes the preparation of linear Pc-containing polymers through ring-opening metathesis polymerization of a Pc monomer. Through proper selection of catalyst, well-defined polymers with Pcs as pendant groups were prepared. Due to the controlled nature of ROMP, polymers of varying architectures, composition, and size were synthesized. The effect of Pc metallation, polymer composition and architecture on the site-isolation of the chromophore was investigated in both solution and condensed-phase thin films. Chapter 3 reports on efforts to prepare linear polymers with companion functionalities for post-polymerization coupling of asymmetric Pcs. Polymers with pendant furan groups were prepared for coupling with asymmetric Pcs through Diels-Alder cycloaddition. Investigation indicated that while coupling was achievable, the presence of the Pc in the resultant polymer promoted undesired crosslinking when stored at ambient conditions in light. Attempts to mitigate this problem through alternation of functionality locations were attempted by placing the furan functionality on the Pc, but degradation of the furan occurred to quickly to perform coupling sufficiently. Chapter 4 discusses the preparation of Pc-containing networks through Diels-Alder cycloaddition of furan and maleimide containing tetrasubstituted Pcs. Following preparation of the various Pcs, network formation in various states was conducted including solution, molded thick films, and patterned assemblies. Chapter 5 summarizes the results presented in Chapters 2-4 and provides an outlook for some future directions based upon the work herein. In addition, some preliminary results of some of these directions will also be presented.

Korth, Bryan D.

323

Hybrid ZnO/phthalocyanine photovoltaic device with highly resistive ZnO intermediate layer.  

PubMed

We report a hybrid photovoltaic device composed of a 3.3 eV bandgap zinc oxide (ZnO) semiconductor and metal-free phthalocyanine layers and the effects of the insertion of the highly resistive ZnO buffer layer on the electrical characteristics of the rectification feature and photovoltaic performance. The hybrid photovoltaic devices have been constructed by electrodeposition of the 300 nm thick ZnO layer in a simple zinc nitrate aqueous solution followed by vacuum evaporation of 50-400 nm thick-phthalocyanine layers. The ZnO layers with the resistivity of 1.8 × 10(3) and 1 × 10(8) ? cm were prepared by adjusting the cathodic current density and were installed into the hybrid photovoltaic devices as the n-type and buffer layer, respectively. The phthalocyanine layers with the characteristic monoclinic lattice showed a characteristic optical absorption feature regardless of the thickness, but the preferred orientation changed depending on the thickness. The ZnO buffer-free hybrid 50 nm thick phthalocyanine/n-ZnO photovoltaic device showed a rectification feature but possessed a poor photovoltaic performance with a conversion efficiency of 7.5 × 10(-7) %, open circuit voltage of 0.041 V, and short circuit current density of 8.0 × 10(-5) mA cm(-2). The insertion of the ZnO buffer layer between the n-ZnO and phthalocyanine layers induced improvements in both the rectification feature and photovoltaic performance. The excellent rectification feature with a rectification ratio of 3188 and ideally factor of 1.29 was obtained for the hybrid 200 nm thick phthalocyanine/ZnO buffer/n-ZnO photovoltaic device, and the hybrid photovoltaic device possessed an improved photovoltaic performance with the conversion efficiency of 0.0016%, open circuit voltage of 0.31 V, and short circuit current density of 0.015 mA cm(-2). PMID:24016732

Izaki, Masanobu; Chizaki, Ryo; Saito, Takamasa; Murata, Kazufumi; Sasano, Junji; Shinagawa, Tsutomu

2013-10-01

324

Improved Photodynamic Efficacy of Zn(II) Phthalocyanines via Glycerol Substitution  

PubMed Central

Phthalocyanines are excellent photosensitizers for photodynamic therapy as they have strong absorbance in the near infra-red region which is most relevant for in vivo activation in deeper tissular regions. However, most phthalocyanines present two major challenges, ie, a strong tendency to aggregate and low water-solubility, limiting their effective usage clinically. In the present study, we evaluated the potential enhancement capability of glycerol substitution on the photodynamic properties of zinc (II) phthalocyanines (ZnPc). Three glycerol substituted ZnPc, 1–3, (tetra peripherally, tetra non-peripherally and mono iodinated tri non-peripherally respectively) were evaluated in terms of their spectroscopic properties, rate of singlet oxygen generation, partition coefficient (log P), intracellular uptake, photo-induced cytotoxicity and vascular occlusion efficiency. Tetrasulfonated ZnPc (ZnPcS4) was included as a reference compound. Here, we showed that 1–3 exhibited 10–100 nm red-shifted absorption peaks with higher molar absorptivity, and at least two-fold greater singlet oxygen generation rates compared to ZnPcS4. Meanwhile, phthalocyanines 1 and 2 showed more hydrophilic log P values than 3 consistent with the number of glycerol attachments but 3 was most readily taken up by cells compared to the rest. Both phthalocyanines 2 and 3 exhibited potent phototoxicity against MCF-7, HCT-116 and HSC-2 cancer cell-lines with IC50 ranging 2.8–3.2 µM and 0.04–0.06 µM respectively, while 1 and ZnPcS4 (up to 100 µM) failed to yield determinable IC50 values. In terms of vascular occlusion efficiency, phthalocyanine 3 showed better effects than 2 by causing total occlusion of vessels with diameter <70 µm of the chorioallantoic membrane. Meanwhile, no detectable vascular occlusion was observed for ZnPcS4 with treatment under similar experimental conditions. These findings provide evidence that glycerol substitution, in particular in structures 2 and 3, is able to improve the photodynamic properties of ZnPc. PMID:24840576

Chin, Yunni; Lim, Siang Hui; Zorlu, Yunus; Ahsen, Vefa; Kiew, Lik Voon; Chung, Lip Yong; Dumoulin, Fabienne; Lee, Hong Boon

2014-01-01

325

Improved photodynamic efficacy of Zn(II) phthalocyanines via glycerol substitution.  

PubMed

Phthalocyanines are excellent photosensitizers for photodynamic therapy as they have strong absorbance in the near infra-red region which is most relevant for in vivo activation in deeper tissular regions. However, most phthalocyanines present two major challenges, ie, a strong tendency to aggregate and low water-solubility, limiting their effective usage clinically. In the present study, we evaluated the potential enhancement capability of glycerol substitution on the photodynamic properties of zinc (II) phthalocyanines (ZnPc). Three glycerol substituted ZnPc, 1-3, (tetra peripherally, tetra non-peripherally and mono iodinated tri non-peripherally respectively) were evaluated in terms of their spectroscopic properties, rate of singlet oxygen generation, partition coefficient (log P), intracellular uptake, photo-induced cytotoxicity and vascular occlusion efficiency. Tetrasulfonated ZnPc (ZnPcS4) was included as a reference compound. Here, we showed that 1-3 exhibited 10-100 nm red-shifted absorption peaks with higher molar absorptivity, and at least two-fold greater singlet oxygen generation rates compared to ZnPcS4. Meanwhile, phthalocyanines 1 and 2 showed more hydrophilic log P values than 3 consistent with the number of glycerol attachments but 3 was most readily taken up by cells compared to the rest. Both phthalocyanines 2 and 3 exhibited potent phototoxicity against MCF-7, HCT-116 and HSC-2 cancer cell-lines with IC50 ranging 2.8-3.2 µM and 0.04-0.06 µM respectively, while 1 and ZnPcS4 (up to 100 µM) failed to yield determinable IC50 values. In terms of vascular occlusion efficiency, phthalocyanine 3 showed better effects than 2 by causing total occlusion of vessels with diameter <70 µm of the chorioallantoic membrane. Meanwhile, no detectable vascular occlusion was observed for ZnPcS4 with treatment under similar experimental conditions. These findings provide evidence that glycerol substitution, in particular in structures 2 and 3, is able to improve the photodynamic properties of ZnPc. PMID:24840576

Chin, Yunni; Lim, Siang Hui; Zorlu, Yunus; Ahsen, Vefa; Kiew, Lik Voon; Chung, Lip Yong; Dumoulin, Fabienne; Lee, Hong Boon

2014-01-01

326

Liposomes coated with crystalline bacterial cells surface protein (S-layer) as immobilization structures for macromolecules.  

PubMed

Isolated subunits from the crystalline cell surface layer (S-layer) of Bacillus coagulans E38-66 were recrystallized on positively charged liposomes. The liposomes were composed of dipalmitoylphosphatidylcholine/cholesterol and stearylamine. The natural arrangement of the S-layer subunits on the bacterial surface is as an oblique (p2) lattice. The subunits attached to positively charged liposomes by their inner face (which bears a net negative charge) in an orientation identical to the lattice on intact cells. The S-layer protein, once recrystallized on liposomes, was crosslinked with glutaraldehyde and subsequently used as a matrix for the covalent attachment of macromolecules. The high stability of S-layer-coated liposomes and the possibility for immobilizing biologically active molecules on the crystalline array may offer potential in various different liposome applications. PMID:7756334

Küpcü, S; Sára, M; Sleytr, U B

1995-05-01

327

Lectin-mediated attachment of liposomes to cornea: influence on transcorneal drug flux  

SciTech Connect

A method to enhance retention of drug-bearing liposomes at the corneal surface under conditions of tear flow was investigated. Mixed brain gangliosides were incorporated into the membranes of phosphatidyl choline liposomes to provide receptor sites for wheat germ agglutinin, a plant lectin that binds strongly to both human and rabbit corneal epithelium. Ganglioside-containing liposomes showed a 2.5-fold increase in their binding to rabbit cornea in vitro when corneas were pretreated with wheat germ agglutinin (500 micrograms/ml), suggesting that the lectin mediates specific binding of these liposomes to the corneal surface. In addition, under conditions of continuous tear flow (1 ml/hr), ganglioside-containing liposomes with entrapped carbachol significantly enhanced carbachol flux across isolated rabbit corneas pretreated with wheat germ agglutinin 90 min after drug delivery. The data support the potential use of liposomes as a vehicle for topical drug flux enhancement.

Schaeffer, H.E.; Breitfeller, J.M.; Krohn, D.L.

1982-10-01

328

Development of stealth liposome coencapsulating doxorubicin and fluoxetine.  

PubMed

Stealth liposomes form an important subset of liposomes, demonstrating prolonged circulation half-life and improved safety in vivo. Caelyx® (liposomal doxorubicin; Merck & Co., Whitehouse Station, New Jersey, USA) is a successful example of the application of stealth liposomes in anticancer treatment. However, multidrug resistance (MDR) to chemotherapy still remains a critical problem, accounting for more than 90% of treatment failure in patients with advanced cancer. To circumvent MDR, fluoxetine and doxorubicin were tested in combination for synergistic activity in MCF-7 (human breast carcinoma) and MCF-7/adr (doxorubicin-resistant human breast carcinoma) cells using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) cell-viability assay. Coencapsulation of doxorubicin and fluoxetine, using an ammonium sulphate gradient, was investigated, and a factorial experiment was designed to determine the optimal drug-to-lipid (D/L) ratio for coencapsulation. Drug release from Dox-Flu-SL (stealth liposome coencapsulating doxorubicin and fluoxetine) under both in vitro and in vivo conditions was determined. In MCF-7 cells, synergism was demonstrated at specific doxorubicin:fluoxetine ratios of between 0.09 and 0.5 (molar ratio), while MCF/7/adr cells demonstrated synergism across all drug ratios. Coencapsulation of doxorubicin and fluoxetine (Dox-Flu-SL) was successfully achieved (optimal doxorubicin:fluoxetine:lipid molar ratio of 0.02:0.05:1), obtaining a mean concentration of 257 ± 12.1 and 513 ± 29.3 ?M for doxorubicin and fluoxetine, respectively. Most important, Dox-Flu-SL demonstrated drug release in synergistic ratios in cell-culture media, accounting for the improved cytotoxicity of Dox-Flu-SL over liposomal doxorubicin (LD) in both MCF-7 and MCF-7/adr cells. Pharmacokinetic studies also revealed that Dox-Flu-SL effectively prolonged drug-circulation time and reduced tissue biodistribution. Dox-Flu-SL presents a promising anticancer formulation, capable of effective reversal of drug resistance, and may constitute a novel approach for cancer therapy. PMID:21226547

Ong, Jasmine Chiat-Ling; Sun, Feng; Chan, Eli

2011-12-01

329

Microscopic Localization of Sterically Stabilized Liposomes in Colon Carcinoma-bearing Mice1  

Microsoft Academic Search

Using light and electron microscopy, we investigated the in vivo distribution of liposomes Sterically stabilized by specific lipids which prolong their circulation in blood. Tissue distribution of steric- ally stabilized liposomes composed of distearoyl phosphatidylcholine: cholesterol:monosialoganglioside GMI (10:5:l)-encapsulated 67Ga-Des- feral indicates that more than 30% of liposomes still remain in the blood at 24 h after tail vein injection. Moreover,

S. K. Huang; K. D. Lee; K. Hong; D. S. Friend; D. Papahadjopoulos

1992-01-01

330

Treatment of neuroblastoma and rhabdomyosarcoma using RGD-modified liposomal formulations of patupilone (EPO906)  

PubMed Central

Background Patupilone (EPO906) is a microtubule stabilizer with a potent antitumor effect. Integrin ?V?3-binding (RGD) liposomes were loaded with EPO906, and their antitumor efficacy was evaluated in two pediatric tumor models, ie, neuroblastoma and rhabdomyosarcoma. Methods Integrin ?V?3 gene expression, RGD-liposome cellular association, and the effect of EPO906 and liposomal formulations of EPO906 on cell viability were assessed in vitro in human umbilical vein endothelial cells (HUVEC), in the RH-30 rhabdomyosarcoma cell line, and in the Kelly neuroblastoma cell line. In vivo, mice bearing neuroblastoma or rhabdomyosarcoma tumors were treated with EPO906, EPO906-liposomes, or EPO906-RGD-liposomes. Tumor growth, cumulative survival, and toxicity were monitored. Results Integrin ?V?3 was highly expressed in HUVEC and RH-30, but not in Kelly cells. Accordingly, RGD-liposomes were highly associated with HUVEC and RH-30 cells in vitro, but not with the Kelly cells. EPO906 and its liposomal formulations inhibited HUVEC, RH-30, and Kelly cell viability to the same extent. In vivo, EPO906 1.5 mg/kg and liposomal EPO906 potently inhibited tumor growth in both xenograft models without triggering major toxicity. At this dose, liposomal EPO906 did not enhance the antitumor effect of EPO906 in neuroblastoma, but tended to have an increased antitumor effect in rhabdomyosarcoma. Using a lower dose of EPO906-RGD-liposomes significantly enhanced cumulative survival in rhabdomyosarcoma compared with EPO906 alone. Conclusion EPO906 shows a strong antitumor effect in neuroblastoma and rhabdomyosarcoma, without triggering major side effects. Its liposomal encapsulation does not alter its activity, and enhances cumulative survival when EPO906-RGD-liposomes are used at low dose in rhabdomyosarcoma. PMID:23818777

Scherzinger-Laude, Karine; Schönherr, Carina; Lewrick, Felicitas; Süss, Regine; Francese, Giancarlo; Rössler, Jochen

2013-01-01

331

Microcalorimetric studies of the effects of artesunate liposomes on the metabolism of Escherichia coli during growth  

Microsoft Academic Search

A thermal dynamic model of nanoformulations entrapped in artesunate liposomes was established and biological thermodynamics\\u000a was applied for investigation of the drug formulations. Effects of artesunate liposomes on the growth metabolism of Escherichia coli were studied by microcalorimetry. The results showed that (1) Comparison of artesunate and artesunate liposomes, the thermogenesis\\u000a curves of E. coli were significant different in the

Shen XuesongWang; Wang Tao; Jin Meihua; Zhao Chunxia; Qin Xuelian; Liu Hanfu; Qiu Zhuangping; Liu Yi

332

The enhancement of immunosuppressive effects of cyclosporine A on human T-cells using fusogenic liposomes  

Microsoft Academic Search

The aim of this study was to prepare and characterize neutral, positively charged, negatively charged and fusogenic liposomes of different sizes that contain cyclosporine A (CyA) and to evaluate their immunosuppressive activity on human T-cells. Neutral liposomes containing CyA were prepared from dipalmitoylphosphatidylcholine (DPPC) and cholesterol using the solvent evaporation method. To prepare positively charged, negatively charged and fusogenic liposomes

Bizhan Malaekeh-Nikouei; Mahmoud R. Jaafari; Sayyed A. Sajadi Tabassi; Afshin Samiei

2008-01-01

333

Chemical coupling of thiolated chitosan to preformed liposomes improves mucoadhesive properties  

PubMed Central

Aim To develop mucoadhesive liposomes by anchoring the polymer chitosan-thioglycolic acid (chitosan-TGA) to the liposomal surface to target intestinal mucosal membranes. Methods Liposomes consisting of phosphatidylcholine (POPC) and a maleimide-functionalized lipid were incubated with chitosan-TGA, leading to the formation of a thioether bond between free SH-groups of the polymer and maleimide groups of the liposome. Uncoated and newly generated thiomer-coated liposomes were characterized according to their size, zeta potential, and morphology using photon correlation spectroscopy and transmission electron microscopy. The release behavior of calcitonin and the fluorophore/quencher-couple ANTS/DPX (8-aminonaphthalene-1,3,6-trisulfonic acid/p-xylene-bis- pyridinium bromide) from coated and uncoated liposomes, was investigated over 24 hours in simulated gastric and intestinal fluids. To test the mucoadhesive properties of thiomer-coated and uncoated liposomes in-vitro, we used freshly excised porcine small intestine. Results Liposomes showed a concentration-dependent increase in size – from approximately 167 nm for uncoated liposomes to 439 nm for the highest thiomer concentration used in this study. Likewise, their zeta potentials gradually increased from about ?38 mV to +20 mV, clearly indicating an effective coupling of chitosan-TGA to the surface of liposomes. As a result of mucoadhesion tests, we found an almost two-fold increase in the mucoadhesion of coupled liposomes relative to uncoupled ones. With fluorescence microscopy, we saw a tight adherence of coated particles to the intestinal mucus. Conclusion Taken together, our current results indicate that thiomer-coated liposomes possess a high potential to be used as an oral drug-delivery system. PMID:22679365

Gradauer, Kerstin; Vonach, Caroline; Leitinger, Gerd; Kolb, Dagmar; Frohlich, Eleonore; Roblegg, Eva; Bernkop-Schnurch, Andreas; Prassl, Ruth

2012-01-01

334

The role of dioleoyl phosphatidylethanolamine in cationic liposome mediated gene transfer  

Microsoft Academic Search

In a reporter gene assay, cationic liposomes containing the cationic lipid 3?-(N-(N?,N?-dimethylaminoethane)carbamoyl)cholesterol (DC-Chol) and a neutral phospholipid dioleoylphosphatidylethanolamine (DOPE) showed high transfection activity. DNA\\/liposome complex which contained low amount of liposomes could bind to the cell surface but failed to transfect the cells. We have designed a two-step protocol to examine this phenomenon in more detail. A431 human cells were

Hassan Farhood; Natalya Serbina; Leaf Huang

1995-01-01

335

Folate-mediated tumor cell targeting of liposome-entrapped doxorubicin in vitro  

Microsoft Academic Search

Receptors for the vitamin folic acid are frequently overexpressed on epithelial cancer cells. To examine whether this overexpression might be exploited to specifically deliver liposome-encapsulated drug molecules in vitro, folate-targeted liposomes were prepared by incorporating 0.1 mol% of a folate-polyethyleneglycol-distearoylphosphatidylethanolamine (folate-PEG-DSPE) construct into the lipid bilayer, and were loaded with doxorubicin (DOX), an anti-cancer drug. Uptake of folate-PEG-liposomal DOX by

Robert J Lee; Philip S Low

1995-01-01

336

Liposome uptake into human colon adenocarcinoma cells in monlayer, spinner, and trypsinized cultures  

SciTech Connect

The nature of liposome interactions with colon tumor cells was investigated. Thus, experiments were performed to study the uptake and incorporation of multilamellar and of reverse-phase evaporation liposomes of neutral charge into monolayers, suspended spinner cultures, and trypsinized cells of a human colon adenocarcinoma cell line, LS174T. The results showed that the same tumor cells cultured under each condition exhibited a distinct pattern of vesicle uptake as determined at 0, 15, 30, 60, and 120 min. In monolayer cultures of LS174T cells, the uptake of liposomes bearing (/sup 3/H)actinomycin D in the lipid bilayers was linear throughout the incubation period. In contrast, in trypsinized and spinner suspension cultures, uptake of liposomes was biphasic. There was a proportional uptake of both liposome (labeled with (/sup 3/H)phosphantidylcholine or (/sup 14/C)cholesterol) and of actinomycin D (trace labeled with /sup 3/H) into the cells under all culture conditions, indicating quantitative delivery of the drug with the intact lipid vesicle. Although the amount of actinomycin D presented to tumor cells by the two liposomes was equivalent, reverse-phase evaporation liposomes were more effectve than multilamellar vesicles in inhibiting uridine uptake. In the presence of excess liposomes (10 times the uptake studies), saturation of the tumor cell surface occurred by 120 min. However, the liposomes remained accessible to enzymatic removal for 60 min. Liposome-saturated tumor cells remained refractory to further binding of liposomes for at least 2 hr. The results thus revealed that differences in cell uptake were due to the state of the target cells and not the liposome types, or their differential leakage of labels.

Tom, B.H.; Macek, C.M.; Raphael, L.; Sengupta, J.; Cerny, E.A.; Jonah, M.M.; Rahman, Y.E.

1983-01-01

337

Effects of operating parameters on the efficiency of liposomal encapsulation of enzymes.  

PubMed

Encapsulation of active proteins in the hydrophilic core of vesicular liposomes is important for developing a therapeutic protein carrier system. The efficiency of liposomal encapsulation of proteins is generally low. A better understanding of the fundamental mechanisms of encapsulation is needed to increase this efficiency. In this study we investigated the effects of operating parameters such as phospholipid concentration, buffer pH and ionic strength, protein size and surface charge, and liposome size on the enzyme encapsulation yield. Four model enzymes of different molecular weights and isoelectric points (trypsin, horseradish peroxidase, enterokinase and hyaluronidase) were encapsulated into three different sized liposomes (125 nm, 194 nm, and 314 nm in mean diameter). Relatively inert and neutral DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine) was used as the main phospholipid in the liposomes. Size exclusion chromatography was used to separate the enzyme-encapsulated liposomes from the free enzyme, and the encapsulation yield was determined from the peak area. The encapsulation yield was generally low ranging from ca. 5% to 20%, and did not depend much on the molecular weight of the enzyme encapsulated. Larger liposomes had higher encapsulation yields. The electrostatic interaction between the phospholipid and enzyme was the most significant parameter in determining the encapsulation yield. Thus adjusting buffer pH and ionic strength and adding charged phospholipids to the liposome preparation to impart electric charge to the lipid bilayer could significantly improve the yield. This approach can be used to optimize the liposomal encapsulation of clinically significant proteins. PMID:22398367

Hwang, Sang Youn; Kim, Hak Kyung; Choo, Jaebum; Seong, Gi Hun; Hien, Thai Bao Dieu; Lee, E K

2012-06-01

338

Effective mucoadhesive liposomal delivery system for risedronate: preparation and in vitro/in vivo characterization  

PubMed Central

In this work, we aimed to develop chitosan-coated mucoadhesive liposomes containing risedronate to improve intestinal drug absorption. Liposomes containing risedronate were prepared with 1,2-distearoryl-sn-glycero-3-phosphocholine and distearoryl-sn-glycero-3-[phospho-rac-(1-glycerol)] using the freeze-drying method, with subsequent coating of the anionic surfaces of the liposomes with chitosan. The in vitro characteristics of the chitosan-coated liposomes were investigated, including their stability, mucoadhesiveness, and Caco-2 cell permeability. This formulation was stable in simulated gastric and intestinal fluids, with the percentage of drug remaining in the liposomes being more than 90% after 24 hours of incubation. Chitosan-coated liposomes also showed strong mucoadhesive properties, implying potential electrostatic interaction with the mucous layer in the gastrointestinal tract. Compared with the untreated drug, chitosan-coated liposomes significantly enhanced the cellular uptake of risedronate, resulting in an approximately 2.1–2.6-fold increase in Caco-2 cells. Further, the chitosan-coated liposomes increased the oral exposure of risedronate by three-fold in rats. Taken together, the results of this study suggest that chitosan-coated liposomes containing risedronate should be effective for improving the bioavailability of risedronate. PMID:24872692

Jung, Il-Woo; Han, Hyo-Kyung

2014-01-01

339

Adjuvant effect of cationic liposomes and CpG depends on administration route.  

PubMed

In this study we explored the immunization route-dependent adjuvanticity of cationic liposomes loaded with an antigen (ovalbumin; OVA) and an immune potentiator (CpG). Mice were immunized intranodally, intradermally, transcutaneously (with microneedle pre-treatment) and nasally with liposomal OVA/CpG or OVA/CpG solution. In vitro, OVA/CpG liposomes showed enhanced uptake by DCs of both OVA and CpG compared to OVA+CpG solution. A similar enhanced uptake by DCs was observed in vivo when fluorescent OVA/CpG liposomes were administered intranodally. However, after transcutaneous and nasal application a lower uptake of OVA/CpG liposomes compared to an OVA+CpG solution was observed. Moreover, the IgG titers after nasal and transcutaneous administration of OVA/CpG liposomes were reduced compared to administration of an OVA+CpG solution. Although serum IgG titers may suggest limited added value of liposomes to the immunogenicity, for all routes, OVA/CpG liposomes resulted in elevated IgG2a levels, whereas administration of OVA+CpG solutions did not. These data show that encapsulation of antigen and adjuvant into a cationic liposome has a beneficial effect on the quality of the antibody response in mice after intranodal or intradermal immunization, but impairs proper delivery of antigen and adjuvant to the lymph nodes when the formulations are administered transcutaneously or nasally. PMID:21315779

Slütter, Bram; Bal, Suzanne M; Ding, Zhi; Jiskoot, Wim; Bouwstra, Joke A

2011-09-01

340

Multifunctional liposomes for nasal delivery of the anti-Alzheimer drug tacrine hydrochloride.  

PubMed

Abstract The purpose of this study was the development of multifunctional liposomes for nasal administration of tacrine hydrochloride. Liposomes were prepared using traditional excipients (cholesterol and phosphatidylcholine), partly enriched with ?-tocopherol and/or Omega3 fatty acids. This approach was chosen in order to obtain at the same time two positive results: an enhanced drug permeation through nasal mucosa and a concomitant neuroprotective effect. Several liposome formulations were prepared using the Reverse Phase Evaporation technique followed by membrane filter extrusion. In particular, liposome capacity to enhance drug permeation was evaluated by means of membrane permeation and cellular uptake studies. Furthermore, liposome effect on neuronal viability and intracellular ROS production was evaluated as well as their cytoprotective effect against oxidative stress. All liposome formulations showed a mean diameter in the range of 175?nm to 219?nm with polydispersity index lower than 0.22, a lightly negative zeta potential and excellent encapsulation efficiency. Moreover, along with good mucoadhesive properties, multifunctional liposomes showed a markedly increase in tacrine permeability, which can be related to liposome fusion with cellular membrane, a hypothesis, which was also supported by cellular uptake studies. Finally, the addition of ?-tocopherol without Omega3 fatty acids, was found to increase the neuroprotective activity and antioxidant properties of liposomes. PMID:24807822

Corace, Giuseppe; Angeloni, Cristina; Malaguti, Marco; Hrelia, Silvana; Stein, Paul C; Brandl, Martin; Gotti, Roberto; Luppi, Barbara

2014-12-01

341

Formation of supported lipid bilayers on silica: relation to lipid phase transition temperature and liposome size.  

PubMed

DPPC liposomes ranging from 90 nm to 160 nm in diameter were prepared and used for studies of the formation of supported lipid membranes on silica (SiO2) at temperatures below and above the gel to liquid-crystalline phase transition temperature (Tm = 41 °C), and by applying temperature gradients through Tm. The main method was the quartz crystal microbalance with dissipation (QCM-D) technique. It was found that liposomes smaller than 100 nm spontaneously rupture on the silica surface when deposited at a temperature above Tm and at a critical surface coverage, following a well-established pathway. In contrast, DPPC liposomes larger than 160 nm do not rupture on the surface when adsorbed at 22 °C or at 50 °C. However, when liposomes of this size are first adsorbed at 22 °C and at a high enough surface coverage, after which they are subject to a constant temperature gradient up to 50 °C, they rupture and fuse to a bilayer, a process that is initiated around Tm. The results are discussed and interpreted considering a combination of effects derived from liposome-surface and liposome-liposome interactions, different softness/stiffness and shape of liposomes below and above Tm, the dynamics and thermal activation of the bilayers occurring around Tm and (for liposomes containing 33% of NaCl) osmotic pressure. These findings are valuable both for preparation of supported lipid bilayer cell membrane mimics and for designing temperature-responsive material coatings. PMID:24651504

Jing, Yujia; Trefna, Hana; Persson, Mikael; Kasemo, Bengt; Svedhem, Sofia

2014-01-01

342

Nanoparticle-Stabilized Liposomes for pH-Responsive Gastric Drug Delivery  

PubMed Central

We report a novel pH-responsive gold nanoparticle-stabilized liposome system for gastric antimicrobial delivery. By adsorbing small chitosan-modified gold nanoparticles (diameter ~ 10 nm) onto the outer surface of negatively charged phospholipid liposomes (diameter ~ 75 nm), we show that at gastric pH the liposomes have excellent stability with limited fusion ability and negligible cargo releases. However when the stabilized liposomes are present in an environment with neutral pH, the gold stabilizers detach from the liposomes resulting in free liposomes that can actively fuse with bacterial membranes. Using Helicobacter pylori as a model bacterium and doxycycline as a model antibiotic, we demonstrate such pH-responsive fusion activity and drug release profile of the nanoparticle-stabilized liposomes. Particularly, at neutral pH the gold nanoparticles detach and thus the doxycycline-loaded liposomes rapidly fuse with bacteria and cause superior bactericidal efficacy as compared to the free doxycycline counterpart. Our results suggest that the reported liposome system holds a substantial potential for gastric drug delivery; it remains inactive (stable) in the stomach lumen but actively interact with bacteria once reaches the mucus layer of the stomach where the bacteria may reside. PMID:23987129

Thamphiwatana, Soracha; Fu, Victoria; Zhu, Jingying; Lu, Diannan; Gao, Weiwei; Zhang, Liangfang

2014-01-01

343

Modeling the Release Kinetics of Poorly Water-Soluble Drug Molecules from Liposomal Nanocarriers  

PubMed Central

Liposomes are frequently used as pharmaceutical nanocarriers to deliver poorly water-soluble drugs such as temoporfin, cyclosporine A, amphotericin B, and paclitaxel to their target site. Optimal drug delivery depends on understanding the release kinetics of the drug molecules from the host liposomes during the journey to the target site and at the target site. Transfer of drugs in model systems consisting of donor liposomes and acceptor liposomes is known from experimental work to typically exhibit a first-order kinetics with a simple exponential behavior. In some cases, a fast component in the initial transfer is present, in other cases the transfer is sigmoidal. We present and analyze a theoretical model for the transfer that accounts for two physical mechanisms, collisions between liposomes and diffusion of the drug molecules through the aqueous phase. Starting with the detailed distribution of drug molecules among the individual liposomes, we specify the conditions that lead to an apparent first-order kinetic behavior. We also discuss possible implications on the transfer kinetics of (1) high drug loading of donor liposomes, (2) attractive interactions between drug molecules within the liposomes, and (3) slow transfer of drugs between the inner and outer leaflets of the liposomes. PMID:21773045

Loew, Stephan; Fahr, Alfred; May, Sylvio

2011-01-01

344

Interaction of Colistin and Colistin Methanesulfonate with Liposomes: Colloidal Aspects and Implications for Formulation  

PubMed Central

Interaction of colistin and colistin methanesulfonate (CMS) with liposomes has been studied with the view to understanding the limitations to the use of liposomes as a more effective delivery system for pulmonary inhalation of this important class of antibiotic. Thus, in this study, liposomes containing colistin or CMS were prepared and characterized with respect to colloidal behavior and drug encapsulation and release. Association of anionic CMS with liposomes induced negative charge on the particles. However, degradation of the CMS to form cationic colistin over time was directly correlated with charge reversal and particle aggregation. The rate of degradation of CMS was significantly more rapid when associated with the liposome bilayer than when compared with the same concentration in aqueous solution. Colistin liposomes carried positive charge and were stable. Encapsulation efficiency for colistin was approximately 50%, decreasing with increasing concentration of colistin. Colistin was rapidly released from liposomes on dilution. Although the studies indicate limited utility of colistin or CMS liposomes for long duration controlled-release applications, colistin liposomes were highly stable and may present a potential opportunity for coformulation of colistin with a second antibiotic to colocalize the two drugs after pulmonary delivery. PMID:22623044

WALLACE, STEPHANIE J.; LI, JIAN; NATION, ROGER L.; PRANKERD, RICHARD J.; BOYD, BEN J.

2012-01-01

345

Glutathione PEGylated liposomes: pharmacokinetics and delivery of cargo across the blood-brain barrier in rats.  

PubMed

Partly due to poor blood-brain barrier drug penetration the treatment options for many brain diseases are limited. To safely enhance drug delivery to the brain, glutathione PEGylated liposomes (G-Technology®) were developed. In this study, in rats, we compared the pharmacokinetics and organ distribution of GSH-PEG liposomes using an autoquenched fluorescent tracer after intraperitoneal administration and intravenous administration. Although the appearance of liposomes in the circulation was much slower after intraperitoneal administration, comparable maximum levels of long circulating liposomes were found between 4 and 24?h after injection. Furthermore, 24?h after injection a similar tissue distribution was found. To investigate the effect of GSH coating on brain delivery in vitro uptake studies in rat brain endothelial cells (RBE4) and an in vivo brain microdialysis study in rats were used. Significantly more fluorescent tracer was found in RBE4 cell homogenates incubated with GSH-PEG liposomes compared to non-targeted PEG liposomes (1.8-fold, p?liposomes compared with PEG control liposomes. The results support further investigation into the versatility of GSH-PEG liposomes for enhanced drug delivery to the brain within a tolerable therapeutic window. PMID:24524555

Rip, Jaap; Chen, Linda; Hartman, Robin; van den Heuvel, Angelique; Reijerkerk, Arie; van Kregten, Joan; van der Boom, Burt; Appeldoorn, Chantal; de Boer, Marco; Maussang, David; de Lange, Elizabeth C M; Gaillard, Pieter J

2014-06-01

346

pH-responsive gold nanoparticles-in-liposome hybrid nanostructures for enhanced systemic tumor delivery  

NASA Astrophysics Data System (ADS)

We report a pH-responsive gold nanoparticles-in-liposome hybrid nanostructure, which effectively combines the pH-responsive assembly and surface plasmon property changes of `smart' gold nanoparticles and enhanced systemic circulation and tumor accumulation of the PEG-grafted liposomes.We report a pH-responsive gold nanoparticles-in-liposome hybrid nanostructure, which effectively combines the pH-responsive assembly and surface plasmon property changes of `smart' gold nanoparticles and enhanced systemic circulation and tumor accumulation of the PEG-grafted liposomes. Electronic supplementary information (ESI) available: Experimental details and supporting figures. See DOI: 10.1039/c3nr03698g

Nam, Jutaek; Ha, Yeong Su; Hwang, Sekyu; Lee, Woonghee; Song, Jaejung; Yoo, Jeongsoo; Kim, Sungjee

2013-10-01

347

Liposome-enhanced immunomigration strips for field screening of toxic chemicals  

SciTech Connect

The use of liposomes containing encapsulated dye to provide instantaneous enhancement of signals generated in competitive immunoassays is described for two model analytes of environmental concern, alachlor and PCBs. The application of this strategy to field assays is demonstrated utilizing two complementary assay designs based on immunomigration along a nitrocellulose test strip. The liposome immunocompetition (LIC) assay involves immobilizing antibodies onto a strip and allowing the sample and analyte-tagged, dye-containing liposomes to migrate through this zone. Liposomes passing through without binding, as a result of competition from the sample analyte, are totally bound in an upper collection region, and the degree of color in this region is proportional to the analyte concentration. The liposome immunoaggregation (LIA) assay detects antibody-liposome association in a homogeneous incubation solution into which a test strip is subsequently placed. Antibody-bound aggregates of liposomes are trapped on the porous nitrocellulose test strip at the level of the meniscus, due to mechanisms that will be discussed. However, sample analyte competitively inhibits antibody-liposome association and, therefore, a proportional amount of unbound liposomes will escape entrapment on the nitrocellulose and can then be collected and quantitated in a measurement zone. This latter technique shows enhanced sensitivity, but involves an extra incubation step. Therefore these two techniques may be used interchangeably depending on the sensitivity and time requirements of a particular project. Prototype assay designs are demonstrated here and emerging detection strategies are discussed.

Roberts, M.A.; Reeves, S.G.; Siebert, S.T.; Durst, R.A. [Cornell Univ., Geneva, NY (United States). Analytical Chemistry Labs.; [Cornell Univ., Ithaca, NY (United States). National Nanofabrication Facility

1995-12-31

348

Application of anion-exchange resin to remove lipophilic chelates from liposomes  

SciTech Connect

Lipophilic chelates such as 8-hydroxyquinoline, acetylacetone, and tropolone are useful to load high levels of radioactive cations into the inner aqueous compartments of liposomes for investigating the fate of liposomes by the technique of gamma imaging or gamma-ray perturbed angular correlation measurements. However, if lipophilic chelates are not completely removed from liposomes the very same lipophilic chelates can also cause leakage of the entrapped cations from liposomes. Thus, it is essential to make sure that all the lipophilic chelates are removed from liposomes after the loading process. The results of the present study show that more than 99.85% of acetylacetone in liposomal suspension can be removed by a minicolumn of AG1-X8 (phosphate form) anion exchange resin. Virtually all the 8-hydroxyquinoline and tropolone in liposomal suspension are adsorbed tightly to the resin. The procedure is rapid, and the dilution of liposomes is minimal. For experiments involving high levels of gamma-emitting radionuclides, the cleaning up process of removing lipophilic chelates from liposomes can be conveniently operated behind a lead glass.

Choi, H.O.; Hwang, K.J.

1986-07-01

349

Phthalocyanine identification in paintings by reflectance spectroscopy. A laboratory and in situ study  

NASA Astrophysics Data System (ADS)

The importance of identifying pigments using non invasive (n.i.) analyses has gained increasing importance in the field of spectroscopy applied to art conservation and art studies. Among the large set of pigments synthesized and marketed during 20th century, surely phthalocyanine blue and green pigments occupy an important role in the field of painting (including restoration) and printing, thanks to their characteristics like brightness and fastness. This research focused on the most used phthalocyanine blue (PB15:1 and PB15:3) and green pigments (PG7), and on the possibility to identify these organic compounds using a methodology like reflectance spectroscopy in the UV, visible and near IR range (UV-vis-NIR RS), performed easily through portable instruments. Laboratory tests and three examples carried out on real paintings are discussed.

Poldi, G.; Caglio, S.

2013-06-01

350

Charge transfer and polarization screening in organic thin films: phthalocyanines on Au(100)  

NASA Astrophysics Data System (ADS)

Core hole screening effects at organic/metal interfaces were studied by core level X-ray photoemission spectroscopy (XPS), X-ray excited Auger electron spectroscopy (XAES), and valence band ultraviolet photoemission spectroscopy (UPS). The comparison of energetic shifts in XPS and XAES enables the estimation of electronic relaxation energy (screening ability). Magnesium phthalocyanine (MgPc) and zinc phthalocyanine (ZnPc) evaporated on single crystalline Au(100) were used as model molecules. Two different features in the Mg KLL spectra can be clearly separated for (sub-)monolayer coverages, while only minor changes of the shape of Mg 1s are observed. Applying a dielectric continuum model, the major screening mechanism cannot be described sufficiently by polarization screening due to mirror charges, significant contributions by charge transfer screening have to be considered. In contrast, small screening effects in the bulk material can be explained by surface polarization.

Kolacyak, Daniel; Peisert, Heiko; Chassé, Thomas

2009-04-01

351

Structural analysis of zinc phthalocyanine (ZnPc) thin films: X-ray diffraction study  

NASA Astrophysics Data System (ADS)

X-ray diffraction (XRD) was used to analyze the structure of thermally evaporated zinc phthalocyanine (ZnPc) organic thin films, as functions of the substrate temperature and film thickness. A metastable ? to stable ? phase transformation has been observed when the films are coated at higher substrate temperatures. The core structure of the zinc phthalocyanine macrocycle is formed by four isoindole units, which endows the molecule with a two-dimensional conjugated ? electron system. The structural analysis and high-resolution transmittance electron microscope images, along with simulation, support the formation of molecular arrays, with the electronic structure fixing the molecular spacing and producing mainly parallel arrays in small domains. These arrays produce the frontier orbital gap, which match the experimental values, and also the experimental data of periodicity, which can be reproduced theoretically.

Senthilarasu, S.; Hahn, Y. B.; Lee, Soo-Hyoung

2007-08-01

352

In-situ spectro-microscopy on organic films: Mn-Phthalocyanine on Ag(100)  

SciTech Connect

Metal phthalocyanines are attracting significant attention, owing to their potential for applications in chemical sensors, solar cells and organic magnets. As the electronic properties of molecular films are determined by their crystallinity and molecular packing, the optimization of film quality is important for improving the performance of organic devices. Here, we present the results of in situ low-energy electron microscopy / photoemission electron microscopy (LEEM/PEEM) studies of incorporation-limited growth [1] of manganese-phthalocyanine (MnPc) on Ag(100) surfaces. MnPc thin films were grown on both, bulk Ag(100) surface and thin Ag(100)/Fe(100) films, where substrate spin-polarized electronic states can be modified through tuning the thickness of the Ag film [2]. We also discuss the electronic structure and magnetic ordering in MnPc thin films, investigated by angle- and spin-resolved photoemission spectroscopy.

Al-Mahboob A.; Vescovo, E.; Sadowski, J.T.

2013-08-18

353

FAST TRACK COMMUNICATION Tuning the spin state of iron phthalocyanine by ligand adsorption  

NASA Astrophysics Data System (ADS)

The future use of single-molecule magnets in applications will require the ability to control and manipulate the spin state and magnetization of the magnets by external means. There are different approaches to this control, one being the modification of the magnets by adsorption of small ligand molecules. In this paper we use iron phthalocyanine supported by an Au(111) surface as a model compound and demonstrate, using x-ray photoelectron spectroscopy and density functional theory, that the spin state of the molecule can be tuned to different values (S ~ 0, \\case {1}{2} , 1) by adsorption of ammonia, pyridine, carbon monoxide or nitric oxide on the iron ion. The interaction also leads to electronic decoupling of the iron phthalocyanine from the Au(111) support.

Isvoranu, C.; Wang, B.; Schulte, K.; Ataman, E.; Knudsen, J.; Andersen, J. N.; Bocquet, M. L.; Schnadt, J.

2010-12-01

354

Review Article: Structures of phthalocyanine molecules on surfaces studied by STM  

NASA Astrophysics Data System (ADS)

This review mainly focuses on progress recently achieved in the growth of phthalocyanine molecules on single-crystal surfaces of sub-monolayer up to few-monolayer thin films studied by scanning tunneling microscopy in our groups. On metallic surfaces such as Au(111), Ag(111) and Cu(111), molecular superstructures are determined by combining directional intermolecular interactions caused by symmetry reduction, molecule-substrate interactions and indirect long-range interactions due to quantum interference of surface state electrons. On semiconducting TiO2 surface, molecular assembling structures are dictated by the strong molecule-substrate interaction. However, on insulating NaCl film, molecule-molecule interaction dominates over the molecule-NaCl coupling, leading to molecular growth behavior. Knowledge obtained from these studies would help people better understand the physicochemical properties of the phthalocyanine molecules at surfaces so that their new applications could be further explored and uncovered in the future.

Wang, Yongfeng; Wu, Kai; Kröger, Jörg; Berndt, Richard

2012-12-01

355

Molecular arrangement investigation of copper phthalocyanine grown on hydrogen passivated Si(1 1 1) surfaces  

NASA Astrophysics Data System (ADS)

Chemical, electronic and structural properties of ultra thin films of copper phthalocyanine (CuPc) grown on hydrogen passivated silicon (1 1 1) surfaces were investigated in situ by X-ray photoelectron spectroscopy (XPS), ultraviolet photoemission spectroscopy (UPS), X-ray photoelectron diffraction (XPD) and electron diffraction (LEED). The early stages of copper phthalocyanine adsorption (1-2) were characterized by the saturation of surface defects and by a flat lying disposition on the surface. Upon further CuPc coverage, the passivation of Si surfaces resulted in the molecule taking a standing position in films. The molecular packing deduced from these studies appears very close to the one in the bulk ? phase of CuPc. The work function of the films was found to be decreasing during the growth and was correlated with the molecular orientation.

Arbi, I.; Ben Hamada, B.; Souissi, A.; Menzli, S.; Ben Azzouz, C.; Laribi, A.; Akremi, A.; Chefi, C.

2014-06-01

356

Solvent-assisted growth of metal phthalocyanine thin films on Au(111)  

SciTech Connect

Thin films of metal phthalocyanine (MPc) are grown on an Au(111) support with a newly developed aerosol molecular beam deposition source and characterized in situ via ultrahigh vacuum scanning tunneling microscopy. MPcs are delivered to Au(111) in a series of N{sub 2}-entrained microsized solvent droplets of variable surface residence time. Phthalocyanine film registration to the herringbone reconstruction of the Au(111) surface, indicative of thermodynamically favored structure, is observed at submonolayer coverages for aromatic solvents with long residence times. Aerosol-deposited monolayer film structures are noncrystalline with tilted MPc orientations and vacancy nanocavities. Upon annealing, MPc molecules adopt flat-lying orientations with respect to the substrate and vacancies are eliminated. Film morphologies indicate solvation-mediated film nucleation and growth, with less long-range ordering that in vapor-generated films.

Tskipuri, Levan; Shao Qian; Reutt-Robey, Janice [Department of Chemistry and Biochemistry, University of Maryland, College Park, Maryland 20742-4454 (United States)

2012-05-15

357

Structural and electronic properties of porphyrins and phthalocyanines self assembled on conductive surfaces  

NASA Astrophysics Data System (ADS)

Phthalocyanine and porphyrin compounds are intensively studied for their important physical and electronic properties. These organic compounds possess semiconductor properties that make them great candidates for several thin film applications such as: photovoltaics devices, organic light emitted diodes (OLED), and sensors. Before these compound can be used to construct devices their structural and electronic properties at the molecular level must be understood. Scanning tunneling microscopy (STM) was used to investigate the geometrical structure of the aggregate and/or monolayer of the compound. X-ray photoelectron spectroscopy (XPS) studies show the chemical formation such as film composition and protonation state of nitrogens in the macrocycle ring. Ultraviolet photoelectron (UPS) and scanning tunneling spectroscopy, more specifically orbital mediated tunneling spectroscopy (OMTS) provided more insight into the electronic structure of these compounds. Three different compounds will be discussed in the following, diacid tetrasulfonatophenylporphine H2(H4TSPP), tetrakis (4-sulfonatophenyl) phthalocyanine (TSPc) and metal free naphthalocaynine (H2Nc).

Wiggins, Bryan Cortez

358

Mechanism of Charge Transport in Cobalt and Iron Phthalocyanine Thin Films Grown by Molecular Beam Epitaxy  

SciTech Connect

Cobalt phthalocyanine (CoPc), iron phthalocyanine (FePc) and their composite (CoPc-FePc) films have been grown by molecular beam epitaxy (MBE). Grazing incidence X-ray diffraction (GIXRD) and scanning electron microscope (SEM) studies showed that composite films has better structural ordering compared to individual CoPc and FePc films. The temperature dependence of resistivity (in the temperature range 25 K- 100 K) showed that composite films are metallic, while individual CoPc and FePc films are in the critical regime of metal-to-insulator (M-I) transition The composite films show very high mobility of 110 cm{sup 2} V{sup -1} s{sup -1} at room temperature i.e. nearly two order of magnitude higher compared to pure CoPc and FePc films.

Kumar, Arvind; Samanta, Soumen; Singh, Ajay; Debnath, A. K.; Aswal, D. K.; Gupta, S. K. [Technical Physics Division, Bhabha Atomic Research Centre, Mumbai 400 085 (India)

2011-12-12

359

Substituted zinc phthalocyanine based nanowires for room temperature ppb level Cl2 sensing application  

NASA Astrophysics Data System (ADS)

Nanowires of substituted Zinc phthalocyanine have been uniformly grown onto glass substrate by cost effective self-assembly technique and their Cl2 sensing properties have been studied at room temperature in the range 5-1500 ppb. The formation of nanowires is attributed to ?-? interactions between the molecules. The density and dimensions of nanowires is found to be dependent upon the concentration of solution. It has been demonstrated that these nanowires are highly sensitive and selective to Cl2. The nanowires exhibit a response as high as 570% with a fast response time of 15 sec for 1500 ppb of Cl2 while the minimum detection limit is as low as 5 ppb. XPS studies reveal that predominant sites of interaction of chlorine are central metal ions of substituted zinc phthalocyanine molecules. The studies emphasize their application as low cost room temperature ppb level chlorine gas sensor.

Saini, Rajan; Mahajan, Aman; Bedi, R. K.; Debnath, A. K.; Aswal, D. K.

2014-04-01

360

Fabrication and characterization of heterojunction solar cells of hexadecafluorophthalocyanine/metal phthalocyanine  

NASA Astrophysics Data System (ADS)

Fluorophthlocyanine thin films were used as n-type semiconductor in organic solar cell. Heterojunction solar cells of cupper hexadecafluorophthalocyanine (F16CuPc) / copper phthalocyanine (CuPc) and F16CuPc / zinc phthalocyanine (ZnPc) deposited with PEDOT-PSS on ITO as electrode were fabricated and characterized. Comparison between CuPc and ZnPc as p-type semiconductor on photovoltaic performance was studied. Light-induced charge separation and charge transfer was investigated by current density and optical absorption. Internal microstructure in active layer was measured by transmission electron microscopy, X-ray and electron diffractions. The F16CuPc thin film in the deposited active layer worked for electron-accepting layer as n-type semiconductor. The photovoltaic performance was original in charge transfer from CuPc to F16CuPc in active layer.

Suzuki, Atsushi; Mizuno, Atsushi; Oku, Takeo; Akiyama, Tsuyoshi; Yamasaki, Yasuhiro

2012-04-01

361

Fabrication and characterization of heterojunction solar cells of hexadecafluorophthalocyanine/metal phthalocyanine  

NASA Astrophysics Data System (ADS)

Fluorophthlocyanine thin films were used as n-type semiconductor in organic solar cell. Heterojunction solar cells of cupper hexadecafluorophthalocyanine (F16CuPc) / copper phthalocyanine (CuPc) and F16CuPc / zinc phthalocyanine (ZnPc) deposited with PEDOT-PSS on ITO as electrode were fabricated and characterized. Comparison between CuPc and ZnPc as p-type semiconductor on photovoltaic performance was studied. Light-induced charge separation and charge transfer was investigated by current density and optical absorption. Internal microstructure in active layer was measured by transmission electron microscopy, X-ray and electron diffractions. The F16CuPc thin film in the deposited active layer worked for electron-accepting layer as n-type semiconductor. The photovoltaic performance was original in charge transfer from CuPc to F16CuPc in active layer.

Suzuki, Atsushi; Mizuno, Atsushi; Oku, Takeo; Akiyama, Tsuyoshi; Yamasaki, Yasuhiro

2011-11-01

362

Enhanced Reverse Saturable Absorption and Optical Limiting in Heavy-Atom Substituted Phthalocyanines  

NASA Technical Reports Server (NTRS)

The reverse saturable absorption and optical limiting response of metal phthalocyaninies can be enhanced by using the heavy-atom effect. Phthalocyanines containing heavy metal atoms, such as In, Sn, and Pb show nearly a factor of two enhancement in the ratio of effective excited-state to ground-state absorption cross sections compared to those containing lighter atoms, such as Al and Si. In an f/8 optical geometry, homogeneous solutions of heavy metal phthalocyanines, at 30% linear transmission, limit 8-ns, 532-nm laser pulses to less than or equal to 3 (micro)J (the energy for 50% probability of eye damage) for incident pulses up to 800 (micro)J.

Perry, J. W.; Mansour, K.; Marder, S. R.; Alvarez, D., Jr.; Perry, K. J.; Choong, I.

1994-01-01

363

Experimental and theoretical study of electronic structure of lutetium bi-phthalocyanine  

NASA Astrophysics Data System (ADS)

Using Near Edge X-Ray Absorption Fine Structure (NEXAFS) Spectroscopy, the thickness dependent formation of Lutetium Phthalocyanine (LuPc2) films on a stepped passivated Si(100)2×1 reconstructed surface was studied. Density functional theory (DFT) calculations were employed to gain detailed insights into the electronic structure. Photoelectron spectroscopy measurements have not revealed any noticeable interaction of LuPc2 with the H-passivated Si surface. The presented study can be considered to give a comprehensive description of the LuPc2 molecular electronic structure. The DFT calculations reveal the interaction of the two molecular rings with each other and with the metallic center forming new kinds of orbitals in between the phthalocyanine rings, which allows to better understand the experimentally obtained NEXAFS results.

Bidermane, I.; Lüder, J.; Boudet, S.; Zhang, T.; Ahmadi, S.; Grazioli, C.; Bouvet, M.; Rusz, J.; Sanyal, B.; Eriksson, O.; Brena, B.; Puglia, C.; Witkowski, N.

2013-06-01

364

Experimental and theoretical study of electronic structure of lutetium bi-phthalocyanine.  

PubMed

Using Near Edge X-Ray Absorption Fine Structure (NEXAFS) Spectroscopy, the thickness dependent formation of Lutetium Phthalocyanine (LuPc2) films on a stepped passivated Si(100)2×1 reconstructed surface was studied. Density functional theory (DFT) calculations were employed to gain detailed insights into the electronic structure. Photoelectron spectroscopy measurements have not revealed any noticeable interaction of LuPc2 with the H-passivated Si surface. The presented study can be considered to give a comprehensive description of the LuPc2 molecular electronic structure. The DFT calculations reveal the interaction of the two molecular rings with each other and with the metallic center forming new kinds of orbitals in between the phthalocyanine rings, which allows to better understand the experimentally obtained NEXAFS results. PMID:23802970

Bidermane, I; Lüder, J; Boudet, S; Zhang, T; Ahmadi, S; Grazioli, C; Bouvet, M; Rusz, J; Sanyal, B; Eriksson, O; Brena, B; Puglia, C; Witkowski, N

2013-06-21

365

Recognition of concanavalin a by cationic glucosylated liposomes.  

PubMed

The specificity of carbohydrate-lectin interaction has been reported as an attractive strategy for drug delivery in cancer therapy because of the high levels of lectins in several human malignancies. A novel cationic glucosylated amphiphile was therefore synthesized, as a model system, to attribute specificity toward d-glucose receptors to liposome formulations. Fluorescence experiments demonstrated that the monomeric glucosylated amphiphile is capable of interacting with fluorescently labeled concanavalin A, a d-glucose specific plant lectin. The interaction of concanavalin A with liposomes composed of a phospholipid and the glucosylated amphiphile was demonstrated by agglutination observed by optical density and dynamic laser light scattering measurements, thus paving the way to the preparation of other glycosilated amphiphiles differing for the length of polyoxyethylenic spacer, the sugar moieties, and/or the length of the hydrophobic chain. PMID:25185719

Mauceri, Alessandro; Borocci, Stefano; Galantini, Luciano; Giansanti, Luisa; Mancini, Giovanna; Martino, Antonio; Salvati Manni, Livia; Sperduto, Claudio

2014-09-30

366

Double-membraned Liposomes Sculpted by Poliovirus 3AB Protein*  

PubMed Central

Infection with many positive-strand RNA viruses dramatically remodels cellular membranes, resulting in the accumulation of double-membraned vesicles that resemble cellular autophagosomes. In this study, a single protein encoded by poliovirus, 3AB, is shown to be sufficient to induce the formation of double-membraned liposomes via the invagination of single-membraned liposomes. Poliovirus 3AB is a 109-amino acid protein with a natively unstructured N-terminal domain. HeLa cells transduced with 3AB protein displayed intracellular membrane disruption; specifically, the formation of cytoplasmic invaginations. The ability of a single viral protein to produce structures of similar topology to cellular autophagosomes should facilitate the understanding of both cellular and viral mechanisms for membrane remodeling. PMID:23908350

Wang, Jing; Ptacek, Jennifer B.; Kirkegaard, Karla; Bullitt, Esther

2013-01-01

367

Tin compounds interaction with membranes of egg lecithin liposomes.  

PubMed

This work is a continuation of earlier research concerning the influence of tin compounds on the dynamic properties of liposome membranes produced with lecithin hen egg yolks (EYL). The experiments were carried out at room temperature (about 25 degrees C). Four tin compounds were chosen, including three organic ones, (CH3)4Sn, (C2H5)4Sn and (C3H7)3SnCl, and one inorganic, SnCl2. The investigated compounds were admixed to water dispersions of liposomes. The content of the admixture changed within the range 0 mol-% to 11mol-% in proportion to EYL. Two spin probes were used in the experiment: 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO) and 2-ethyl-2-(15-methoxy-15-oxopentadecyl)-4,4-dimethyl-3-oxazolidinyloxyl (16-DOXYL-stearic acid), which penetrated through different areas of the membrane. It was found that tin compounds containing chlorine were the most active in interaction with liposome membranes. In the case of (C3H7)3SnCl, after exceeding 4% admixture content, an additional line appeared in the spectrum of the TEMPO probe which can be a result of formation of domain structures in the membranes of the studied liposomes. Compounds containing chlorine are of ionized form in water solution. The obtained results can thus mean that the activity of admixtures can be seriously influenced by their ionic character. In case of an admixture of non-ionic compounds the compound with a longer hydrocarbon chain displayed a slightly stronger effect on the spectroscopic parameters of the probes. PMID:17708450

Man, Dariusz; Podolak, Marian

2007-01-01

368

Successful treatment of visceral leishmaniasis with liposomal amphotericin B.  

PubMed

We report a case of a 26-year-old female from Kenya who suffered from intermittent fever of unknown origin for one month. The major findings on admission were pancytopenia associated with considerable splenomegaly. The diagnosis was established by visualisation of amastigotes in bone marrow biopsy and by detection of antibodies to Leishmania spp. in blood. The infection was treated intravenously with liposomal amphotericin B for five days. The patient was afebrile after the first infusion. No relapse was reported. PMID:16918063

Lagler, Heimo; Matt, Ulrich; Sillaber, Christian; Winkler, Stefan; Graninger, Wolfgang

2006-01-01

369

Targeted delivery of doxorubicin using stealth liposomes modified with transferrin.  

PubMed

Site-specific delivery of drugs and therapeutics can significantly reduce drug toxicity and increase the therapeutic effect. Transferrin (Tf) is one suitable ligand to be conjugated to drug delivery systems to achieve site-specific targeting, due to its specific binding to transferrin receptors (TfR), highly expressed on the surfaces of tumor cells. Stealth liposomes are effective vehicles for drugs, genes and vaccines and can be easily modified with proteins, antibodies, and other appropriate ligands, resulting in attractive formulations for targeted drug delivery. In this study, we prepared doxorubicin-loaded stealth liposomes (Tf-SL-DOX) by film dispersion followed by ammonium sulphate gradient method, then conjugated Tf to the liposome surface by an amide bound between DSPE-PEG(2000)-COOH and Tf. The results of the intracellular uptake study indicated that Tf-modified SL was able to enhance the intracellular uptake of the entrapped DOX by HepG2 cells compared to SL-DOX. We studied tissue distribution and therapeutic effects of Free DOX, SL-DOX and Tf-SL-DOX in tumor-bearing mice and pharmacokinetics in rats. The pharmacokinetic behavior of Tf-SL-DOX in the plasma was closed to SL-DOX. Administration of Tf-SL-DOX to tumor-bearing mice could be used to deliver DOX effectively to the targeted site, significantly increasing DOX concentration in tumor and decreasing DOX concentration in heart and kidney. In summary, our study indicated that the Tf-coupled PEG liposomes (Tf-SL) could be as the targeted carriers to facilitate the delivery of the encapsulated anticancer drugs into tumor cells by receptor-mediated way. PMID:19429296

Li, XueMing; Ding, Liyan; Xu, Yuanlong; Wang, Yonglu; Ping, QiNeng

2009-05-21

370

Photovoltaic Characteristics of Copper Phthalocyanine-poly(p-phenylene) Co-evaporation Films  

Microsoft Academic Search

Copper phthalocyanine (CuPc) and poly(p-phenylene) (PPP) composite films (CuPc-PPP) were produced by a simultaneous deposition method. Schottky barrier photovoltaic cells consisting of semitransparent aluminum and CuPc-PPP composite films were fabricated. The effects of composition and optimization on the photovoltaic properties of the CuPc-PPP composite films by simultaneous deposition were investigated. The short circuit photocurrent of the CuPc-PPP cells increased in

Takayuki Iwase; Yutaka Haga

2003-01-01

371

Binding interactions and conformational changes induced by sulfonated aluminum phthalocyanines in human serum albumin.  

PubMed

Phthalocyanines (Pc), which are extensively studied as tumor localizing photosensitizers for photodynamic therapy, are transported by the blood circulatory system to target tissues. Binding interactions between human serum albumin and differently sulfonated aluminum phthalocyanines (AlPcSn; n = 1-4) were studied using optical and ESR spectroscopy. AlPcSn (n = 1-3) occupy one strong binding site and eight weaker sites. The high affinity binding site interactions differ with respect to the degree of sulfonation and isomeric composition of the Pc. Phthalocyanines without SO-3 groups on adjacent iso-indole rings exhibit a high affinity binding site constant of K approximately 3-4 x 10(7) M-1, while Pc with two or three adjacent SO-3 groups show binding for this high affinity site that is no longer independent, but cooperative (alpha = 2), with K approximately 2-6 x 10(6) M-1. Binding isotherms for AlPcS4 and its close analog, tempoyl spin-labeled SL-AlPcS3, do not approach saturation at high ligand concentrations. Competition analyses between AlPcSn and spin-labeled fatty acids (5- and 16-doxyl stearate isomers) reveal that all compounds participate in cooperative (allosteric) interactions with the high affinity binding site of 16-DS, while extruding 5-DS isomer from certain sites and increasing the binding affinity for the remaining. Protein conformational dynamics was studied by ESR spectroscopy using covalent (alkylation of Cys34 residue) and noncovalent spin labeling (employing SL-AlPcS3). Phthalocyanines perturb conformational dynamics parameters (tauc and S) depending on the degree of sulfonation and isomeric composition corresponding to the type of sites, i.e., independent or cooperative, occupied on the HSA molecule. PMID:10334859

Gantchev, T G; Ouellet, R; van Lier, J E

1999-06-01

372

Electrochemical Characteristics of Air Electrode with Fe Phthalocyanine for Metal-Air Batteries  

Microsoft Academic Search

In order to fabricate the practical air electrode, the catalytic effects of iron-phthalocyanine (FePc) and FePc polymer (poly-FePc) were studied. Four methods were used to support FePc or poly-FePc on carbon; (1) Mixing, (2) Impregnating, (3) Evaporating and (4) Direct synthesizing (to synthesize poly-FePc on carbon). The polarization of electrodes became smaller in the order of no catalyst ? FePc

T. Hirai; A. Yamaji

1983-01-01

373

New route to unsymmetrical phthalocyanine analogues by the use of structurally distorted subphthalocyanines  

SciTech Connect

In addition to traditional uses as dyes and in photocopying devices, phthalocyanines (Pcs) are now rapidly growing in importance in many fields such as chemical sensors, electrochromism, batteries, photodynamic cancer therapy, molecular metals, photochemical hole burning, and liquid crystals. In this communication, the authors present a completely new method for the preparation of monosubstituted type unsymmetrical Pcs and Pc analogues, which utilizes the so-called subphthalocyanines (SubPcs).

Kobayashi, Nagao; Kondo, Ryoko; Nakajima, Shinichiro; Osa, Tetsuo (Tohoku Univ., Sendai (Japan))

1990-12-19

374

Phthalocyanines as sensitive coatings for QCM sensors: Comparison of gas and liquid sensing properties  

Microsoft Academic Search

The quartz crystal microbalance (QCM) was used to investigate the liquid sensing properties of a set of phthalocyanines (Pcs) which were systematically varied by attaching the substituent 2,2,3,3-tetrafluoropropyloxy to different positions and by introducing a central metal ion (i.e. Ni2+, Zn2+, and Cu2+). The responses to low concentrations of organic compounds such as hydrocarbons and chlorocarbons dissolved in water were

Mika Harbeck; Dilek D. Erbahar; Ilke Gürol; Emel Musluo?lu; Vefa Ahsen; Zafer Ziya Öztürk

2011-01-01

375

Phthalocyanine\\/silica hybrid films on QCM for enhanced nitric oxide sensing  

Microsoft Academic Search

We have attempted to detect nitric oxide (NO) in gaseous state by immobilizing cobalt phthalocyanine (CoPc) in a mesoporous silica matrix deposited on a quartz crystal microbalance (QCM). CoPc\\/mesoporous silica hybrids are prepared by using thermal calcination process. Fourier transform infrared spectroscopy (FT-IR) and scanning electron microscopy (SEM) are used to characterize the CoPc\\/silica hybrids. The sensor response towards NO

Al. Palaniappan; Shabbir Moochhala; Francis E. H. Tay; Xiaodi Su; Nicky C. L. Phua

2008-01-01

376

Nonenzymatic glucose biosensor based on overoxidized polypyrrole nanofiber electrode modified with cobalt(II) phthalocyanine tetrasulfonate  

Microsoft Academic Search

An enzymeless biosensor, based on electrodeposition of overoxidized polypyrrole nanofiber onto pencil graphite electrode and modified with cobalt(II) phthalocyanine tetrasulfonate (CoPcTS), was investigated in this study. CoPcTS showed electrocatalytic activity for the oxidation of glucose in alkaline solution. The electrochemical performance of the modified electrodes was investigated by differential pulse voltammetric (DPV) method. The resulting biosensor exhibited excellent performance for

Levent Özcan; Yücel ?ahin; Hayrettin Türk

2008-01-01

377

In vivo antitumour activity of amphiphilic silicon(IV) phthalocyanine with axially ligated rhodamine B.  

PubMed

We explore the possible cellular cytotoxic activity of an amphiphilic silicon(IV) phthalocyanine with axially ligated rhodamine B under ambient light experimental environment as well as its in vivo antitumour potential using Hep3B hepatoma cell model. After loading into the Hep3B hepatoma cells, induction of cellular cytotoxicity and cell cycle arrest were detected. Strong growth inhibition of tumour xenograft together with significant tumour necrosis and limited toxicological effects exerted on the nude mice could be identified. PMID:23473678

Zhao, Zhinxin; Gambari, Roberto; Lee, Kenneth Ka-Ho; Kok, Stanton Hon-Lung; Wong, Raymond Siu-Ming; Lau, Fung-Yi; Tang, Johnny Cheuk-On; Lam, Kim-Hung; Cheng, Chor-Hing; Hau, Desmond Kwok Po; Chui, Chung-Hin; Wong, Wai-Yeung; Wong, Wai-Kwok

2013-04-15

378

Light-driven manipulation of picobubbles on a titanium oxide phthalocyanine-based optoelectronic chip  

Microsoft Academic Search

Microbubbles have a variety of applications in science and biological technology. Here, we demonstrate the manipulation of the picoliter gas bubble (picobubble) based on the optoelectronic-mechanism. The organic photoconductive material, titanium oxide phthalocyanine (TiOPc), was developed to make the light-sensitive substrate of this optoelectronic chip. The virtual electrodes are formed by projecting the dynamic light pattern onto TiOPc layer for

Shih-Mo Yang; Tung-Ming Yu; Hang-Ping Huang; Meng-Yen Ku; Sheng-Yang Tseng; Che-Liang Tsai; Hung-Po Chen; Long Hsu; Cheng-Hsien Liu

2011-01-01

379

Photovoltaic and rectification properties of Al?Mg phthalocyanine?Ag Schottky-barrier cells  

Microsoft Academic Search

The photovoltaic and rectification properties of Al?Mg phthalocyanine?Ag sandwich cells are reported. At low voltages, the current in the forward direction varies exponentially with voltage. A charge density of [inverted lazy s]1018?cm3 is estimated from C-V measurements. The short-circuit photocurrent Jsc?Fm(m [inverted lazy s]0.5), where F is the incident light intensity. The open-circuit photovoltage Voc? logF as expected for a

Amal K. Ghosh; Don L. Morel; Tom Feng; Robert F. Shaw; Charles A. Rowe Jr

1974-01-01

380

Photovoltaic and rectification properties of Al\\/Mg phthalocyanine\\/Ag Schottky-barrier cells  

Microsoft Academic Search

The photovoltaic and rectification properties of Al\\/Mg phthalocyanine\\/Ag sandwich cells are reported. At low voltages, the current in the forward direction varies exponentially with voltage. A charge density of [inverted lazy s]1018\\/cm3 is estimated from C-V measurements. The short-circuit photocurrent JscalphaFm (m [inverted lazy s]0.5), where F is the incident light intensity. The open-circuit photovoltage Vocalpha logF as expected for

Amal K. Ghosh; Don L. Morel; Tom Feng; Robert F. Shaw; Charles A. Rowe

1974-01-01

381

Theoretical study on phthalocyanine, pyrazinoporphyrazine and their complexation with Mg and Zn  

Microsoft Academic Search

We have studied the UV–vis absorption spectra of metal-free phthalocyanine (H2Pc), metal-free pyrazinoporphyrazine (H2PyzPz) and their complexes with Mg and Zn using semiempirical Zerners intermediate neglect of differential overlap and time-dependent density functional theory methods. The predicted absorption spectra of H2Pc and their complexes are in agreement with a previous experiment report. The calculated results show that the Q band

A. Lee; D. Kim; S.-H. Choi; J.-W. Park; J.-Y. Jaung; D. H. Jung

2010-01-01

382

The interaction of transition metal phthalocyanines with organic molecules: a quartz-microbalance study  

Microsoft Academic Search

Results are presented on the interaction of monomeric transition metal phthalocyanines (PcMs) with organic solvent molecules. For this purpose, quartz-microbalance oscillators are coated with thin PcM films and exposed to different concentrations of organic solvent vapours in air. Frequency changes, which result from an increase of mass during the thin-film deposition and subsequent molecule\\/PcM interaction, are determined and discussed comparatively

K.-D. Schiebaum; R. Zhou; S. Knecht; R. Dieing; M. Hanack; W. Göpel

1995-01-01

383

Organic field-effect transistors with high mobility based on copper phthalocyanine  

Microsoft Academic Search

Organic field-effect transistors that employ copper phthalocyanine (Cu–Pc) as the semiconducting layer can function as p-channel accumulation-mode devices. The charge carrier mobility of such devices is strongly dependent on the morphology of the semiconducting thin film. When the substrate temperature for deposition of Cu–Pc is 125 °C, a mobility of 0.02 cm2\\/V s and on\\/off ratio of 4×105 can be

Zhenan Bao; Andrew J. Lovinger; Ananth Dodabalapur

1996-01-01

384

High-performance liquid chromatographic determination of the silicon phthalocyanine Pc 4 in human blood  

Microsoft Academic Search

A sensitive and reproducible method has been developed for the measurement of the silicon phthalocyanine Pc 4 in red blood cell concentrates (RBCC). The procedure involves extraction of the RBCC with acetonitrile, purification of the extracts with reversed-phase Sep-Pak C18 cartridges and determination of Pc 4 in the extracts by high-performance liquid chromatography (HPLC) using a reversed-phase C18 column. The

M. M. Zuk; M. E. Kenney; B. Horowitz; E. Ben-Hur

1995-01-01

385

Vincristine sulfate liposomal injection for acute lymphoblastic leukemia  

PubMed Central

Vincristine (VCR) is one of the most extensively used cytotoxic compounds in hemato-oncology. VCR is particularly important for the treatment of acute lymphoblastic leukemia (ALL), a disease that accounts for approximately one-third of all childhood cancer diagnoses. VCR’s full therapeutic potential has been limited by dose-limiting neurotoxicity, classically resulting in autonomic and peripheral sensory–motor neuropathy. In the last decade, however, the discovery that liposomal encapsulation of chemotherapeutics can modulate the pharmacokinetic characteristics of a compound has stimulated much interest in liposomal VCR (vincristine sulfate liposomal injection [VSLI]) formulations for the treatment of ALL and other hematological malignancies. Promising data from recent clinical trials investigating VSLI in adults with ALL resulted in US Food and Drug Administration approval for use in patients with Philadelphia chromosome (t[9;22]/BCR–ABL1) (Ph)-negative (Ph?) disease. Additional clinical trials of VSLI in adults and children with both Ph-positive (Ph+) and Ph? ALL are ongoing. Here we review the preclinical and clinical experience to date with VSLI for ALL. PMID:24232122

Raj, Trisha A Soosay; Smith, Amanda M; Moore, Andrew S

2013-01-01

386

Liposomal siRNA nanocarriers for cancer therapy.  

PubMed

Small interfering RNAs (siRNA) have recently emerged as a new class of therapeutics with a great potential to revolutionize the treatment of cancer and other diseases. A specifically designed siRNA binds and induces post-transcriptional silencing of target genes (mRNA). Clinical applications of siRNA-based therapeutics have been limited by their rapid degradation, poor cellular uptake, and rapid renal clearance following systemic administration. A variety of synthetic and natural nanoparticles composed of lipids, polymers, and metals have been developed for siRNA delivery, with different efficacy and safety profiles. Liposomal nanoparticles have proven effective in delivering siRNA into tumor tissues by improving stability and bioavailability. While providing high transfection efficiency and a capacity to form complexes with negatively charged siRNA, cationic lipids/liposomes are highly toxic. Negatively charged liposomes, on the other hand, are rapidly cleared from circulation. To overcome these problems we developed highly safe and effective neutral lipid-based nanoliposomes that provide robust gene silencing in tumors following systemic (intravenous) administration. This delivery system demonstrated remarkable antitumor efficacy in various orthotopic human cancer models in animals. Here, we briefly overview this and other lipid-based approaches with preclinical applications in different tumor models for cancer therapy and potential applications as siRNA-nanotherapeutics in human cancers. PMID:24384374

Ozpolat, Bulent; Sood, Anil K; Lopez-Berestein, Gabriel

2014-02-01

387

Interaction of opiate molecules with lipid monolayers and liposomes.  

PubMed

The interaction of opiate molecules (buprenorphine, codeine, dextromethorphan, diprenorphine, etorphine, meperidine, methadone, morphine, and naloxone) with lipids (phosphatidylcholine, phosphatidylinositol, phatidylinositol, phosphatidylserine, and cholesterol) by using liposomes and monomolecular layers as membrane models is described. The ability of opiates to induce leakage of carboxyfluorescin from liposomes is highly dependent on the hydrophobicity of the opiate molecules. Buprenorphine and etorphine increased the membrane permeability in all the experiments. On the contrary, naloxone, morphine, and codeine only caused a slight release of the entrapped dye in the presence of acidic phospholipids. Moreover, the leakage of carboxyfluorescein is directly related to the concentration of drug in the incubation media. Studies of the kinetics of the surface penetration of these molecules into monolayers of phospholipids were performed. Again, in this system, buprenorphine and etorphine exhibited stronger interactions than the most hydrophilic opiates. Nevertheless, in these experiments, differences among the opiate molecules are not so high as in the liposomes. The time course of the penetration of all of these molecules in the monolayers fits the Lineweaver-Burk equation. This fact suggests a lack of specific interactions and the predominance of hydrophobic factors. Moreover, the high percentage of release of entrapped dye caused by some opiate molecules suggests a possible toxic side-effect for these agents. PMID:1522492

Reig, F; Busquets, M A; Haro, I; Rabanal, F; Alsina, M A

1992-06-01

388

Interaction of anionic/nonionic surfactant mixtures with phosphatidylcholine liposomes.  

PubMed

The mechanisms governing the interaction of mixtures of sodium dodecyl sulfate (SDS) and nonylphenol oxyethylenated with 10 mol of ethylene oxide (NP(EO)10) with phosphatidylcholine liposomes were investigated. Permeability alterations were detected as a change in 5(6)-carboxyfluorescein (CF) released from the interior of vesicles and bilayer solubilization as a decrease in the static light scattered by liposome suspensions. Three parameters were described as the effective surfactant/lipid molar ratios (Re) at which the surfactant system (a) resulted in 50% of CF release (Re50%CF), (b) saturated the liposomes (ReSAT), and (c) led to a complete solubilization of these structures (ReSOL). From these parameters the corresponding surfactant partition coefficients (K50%CF, KSAT, and KSOL) were determined. Despite the fact that Re increased as the mole fraction of the SDS rose (XSDS), the K parameters showed maximum values at XSDS 0.6 and 0.2 for K50%CF and KSAT, respectively, the KSOL reaching the highest value in the absence of SDS XSDS = 0). Thus, the higher the surfactant contribution in surfactant/lipid system, the lower the XSDS at which the maximum bilayer/water partitioning of mixed surfactant systems added took place. The free surfactant concentrations SW were lower than the mixed surfactant CMCs at subsolubilizing level, whereas it remained similar to these values during saturation and solubilization of bilayers in all cases. PMID:7574671

de la Maza, A; Parra, J L

1995-09-10

389

Structure and bonding in alpha-copper phthalocyanine by electron diffraction.  

PubMed

Energy-filtered quantitative electron diffraction at liquid nitrogen temperature has been used to examine the atomic structure and bonding of metastable alpha-Cu phthalocyanine crystals. Three theoretical methods (kinematic, kinematic with excitation errors and Bloch wave) were employed for the intensity calculations. The Bloch-wave method was found to account for dynamical effects by greatly reducing the residual factor between experimental and simulated results. A new method for calculating electron scattering factors for partially charged ions is proposed and the sensitivity of electron diffraction to charge transfer is discussed. The atomic charge states were analyzed for alpha-Cu phthalocyanine using a charge cloud model in which the Gaussian bond charge is positioned along the bonds. Spot patterns were collected in the Kohler mode at two beam energies to reduce error. Using the best-fitting model, a deformation charge-density map is produced and compared to the neutral-atom model. From this, the main features of atomic charge transfer in the alpha-Cu phthalocyanine structure can be seen in the (010) plane. PMID:12944614

Wu, J S; Spence, J C H

2003-09-01

390

NIR Photocleavage of the Si-C Bond in Axial Si-Phthalocyanines.  

PubMed

The use of light-triggered photolysis provides a powerful tool for unique syntheses and for applications that require remote operation such as drug delivery or molecular switches. Here, we describe the photochemistry of a recently developed alkylsilicon phthalocyanine Pc 227, which undergoes an exchange of the alkyl ligand for a ligand derived from the solvent when the axial Si-C bond is photolyzed in a solvent with low-energy visible light. In this work with methanol as the solvent, we investigate the formation of the methoxy analogue of the therapeutic drug Pc 4, (termed Pc 233) upon irradiation. Using steady-state spectroscopy and characterization of the photoproducts, the competing pathways between direct ligand exchange on the central silicon atom and delocalization of the radical produced by homolysis on the phthalocyanine ring is observed. The delocalized radical intermediate is quite long-lived. At long times this intermediate decomposes without significant formation of Pc 233. The results of this investigation provide insights into recent work utilizing Pc 227 for drug delivery applications and for future work on the use of phthalocyanines as long-wavelength phototriggers. PMID:25153643

Doane, Tennyson; Cheng, Yu; Sodhi, Nipun; Burda, Clemens

2014-11-13

391

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification  

PubMed Central

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen 1O2, while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species (.O2?, H2O2, OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O2 and 2-mercaptoethanol or in the presence of H2O2. Under both sensitized and catalyzed conditions, the nucleotides G13–G15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer. PMID:17497012

Chernonosov, Alexander A.; Koval, Vladimir V.; Knorre, Dmitrii G.; Chernenko, Alexander A.; Derkacheva, Valentina M.; Lukyanets, Eugenii A.; Fedorova, Olga S.

2006-01-01

392

Understanding domain symmetry in vanadium oxide phthalocyanine monolayers on Au (111)  

NASA Astrophysics Data System (ADS)

Understanding the growth of organic semiconductors on solid surfaces is of key importance for the field of organic electronics. Non planar phthalocyanines have shown great promise in organic photovoltaic (OPV) applications, but little of the fundamental surface characterization to understand their structure and properties has been performed. Acquiring a deeper understanding of the molecule/substrate interaction in small molecule systems is a vital step in controlling structure/property relationships. Here we characterize the vanadium oxide phthalocyanine (VOPc)/Au (111) surface using a combination of low energy electron diffraction (LEED) and scanning tunneling microscopy (STM), obtaining complex diffraction patterns which can be understood using two dimensional fast Fourier transform (2D-FFT) analysis of STM images. These measurements reveal coexistence of three symmetrically equivalent in-plane orientations with respect to the substrate, each of which is imaged simultaneously within a single area. Combining scanning probe and diffraction measurements allows symmetrically related domains to be visualized and structurally analyzed, providing fundamental information useful for the structural engineering of non-planar phthalocyanine interfaces.

Rochford, L. A.; Hancox, I.; Jones, T. S.

2014-10-01

393

Electronic absorption band broadening and surface roughening of phthalocyanine double layers by saturated solvent vapor treatment  

SciTech Connect

Variations in the electronic absorption (EA) and surface morphology of three types of phthalocyanine (Pc) thin film systems, i.e. copper phthalocyanine (CuPc) single layer, zinc phthalocyanine (ZnPc) single layer, and ZnPc on CuPc (CuPc/ZnPc) double layer film, treated with saturated acetone vapor were investigated. For the treated CuPc single layer film, the surface roughness slightly increased and bundles of nanorods were formed, while the EA varied little. In contrast, for the ZnPc single layer film, the relatively high solubility of ZnPc led to a considerable shift in the absorption bands as well as a large increase in the surface roughness and formation of long and wide nano-beams, indicating a part of the ZnPc molecules dissolved in acetone, which altered their molecular stacking. For the CuPc/ZnPc film, the saturated acetone vapor treatment resulted in morphological changes in mainly the upper ZnPc layer due to the significantly low solubility of the underlying CuPc layer. The treatment also broadened the EA band, which involved a combination of unchanged CuPc and changed ZnPc absorption.

Kim, Jinhyun [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of)] [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of); Yim, Sanggyu, E-mail: sgyim@kookmin.ac.kr [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of)] [Department of Chemistry, Kookmin University, Seoul 136-702 (Korea, Republic of)

2012-10-15

394

Metal-phthalocyanine ordered layers on Au(110): metal-dependent adsorption energy.  

PubMed

Iron-phthalocyanine and cobalt-phthalocyanine chains, assembled along the Au(110)-(1×2) reconstructed channels, present a strong interaction with the Au metallic states, via the central metal ion. X-ray photoemission spectroscopy from the metal-2p core-levels and valence band high-resolution ultraviolet photoelectron spectroscopy bring to light signatures of the interaction of the metal-phthalocyanine single-layer with gold. The charge transfer from Au to the molecule causes the emerging of a metal-2p core level component at lower binding energy with respect to that measured in the molecular thin films, while the core-levels associated to the organic macrocycle (C and N 1s) are less influenced by the adsorption, and the macrocycles stabilize the interaction, inducing a strong interface dipole. Temperature Programmed Desorption experiments and photoemission as a function of temperature allow to estimate the adsorption energy for the thin-films, mainly due to the molecule-molecule van der Waals interaction, while the FePc and CoPc single-layers remain adsorbed on the Au surface up to at least 820 K. PMID:24985665

Massimi, Lorenzo; Angelucci, Marco; Gargiani, Pierluigi; Betti, Maria Grazia; Montoro, Silvia; Mariani, Carlo

2014-06-28

395

A novel method to label preformed liposomes with 64Cu for positron emission tomography (PET) imaging  

PubMed Central

Radiolabeling of liposomes with 64Cu (t1/2 = 12.7 h) is attractive for molecular imaging and monitoring drug delivery. A simple chelation procedure, performed at a low temperature and under mild conditions, is required to radiolabel pre-loaded liposomes without lipid hydrolysis or the release of the encapsulated contents. Here we report a 64Cu post-labeling method for liposomes. A 64Cu-specific chelator, 6-[p-(bromoacetamido)benzyl]-1,4,8,11-tetraazacyclotetradecane-N,N’,N”,N”’-tetraacetic acid (BAT), was conjugated with an artificial lipid to form a BAT-PEG-lipid. After incorporation of 0.5% (mol/mol) BAT-PEG-lipid during the liposome formulation, liposomes were successfully labeled with 64Cu in 0.1 M NH4OAc pH 5 buffer, at 35 °C for 30~40 min with an incorporation yield as high as 95%. After 48 hour incubation of 64Cu-liposomes in 50/50 serum/PBS solution, more than 88% of the 64Cu label was still associated with liposomes. After injection of liposomal 64Cu in a mouse model, 44 ± 6.9, 21 ± 2.7, 15 ± 2.5, and 7.4 ± 1.1 (n = 4) % of the injected dose per cubic centimeter remained within the blood pool at 30 min, 18, 28, and 48 hours, respectively. The biodistribution at 48 hours after injection verified that 7.0 ± 0.47 (n = 4), and 1.4 ± 0.58 (n = 3) % of the injected dose per gram of liposomal 64Cu and free 64Cu remained in the blood pool, respectively. Our results suggest that this fast and easy 64Cu labeling of liposomes could be exploited in tracking liposomes in vivo for medical imaging and targeted delivery. PMID:18991368

Seo, Jai Woong; Zhang, Hua; Kukis, David L.; Meares, Claude F.; Ferrara, Katherine W.

2009-01-01

396

Peptide-coated liposomal fasudil enhances site specific vasodilation in pulmonary arterial hypertension.  

PubMed

This study sought to develop a liposomal delivery system of fasudil-an investigational drug for the treatment of pulmonary arterial hypertension (PAH)-that will preferentially accumulate in the PAH lungs. Liposomal fasudil was prepared by film-hydration method, and the drug was encapsulated by active loading. The liposome surface was coated with a targeting moiety, CARSKNKDC, a cyclic peptide; the liposomes were characterized for size, polydispersity index, zeta potential, and storage and nebulization stability. The in vitro drug release profiles and uptake by TGF-? activated pulmonary arterial smooth muscle cells (PASMC) and alveolar macrophages were evaluated. The pharmacokinetics were monitored in male Sprague-Dawley rats, and the pulmonary hemodynamics were studied in acute and chronic PAH rats. The size, polydispersity index (PDI), and zeta potential of the liposomes were 206-216 nm, 0.058-0.084, and -20-42.7 mV, respectively. The formulations showed minimal changes in structural integrity when nebulized with a commercial microsprayer. The optimized formulation was stable for >4 weeks when stored at 4 °C. Fasudil was released in a continuous fashion over 120 h with a cumulative release of 76%. Peptide-linked liposomes were taken up at a higher degree by TGF-? activated PASMCs; but alveolar macrophages could not engulf peptide-coated liposomes. The formulations did not injure the lungs; the half-life of liposomal fasudil was 34-fold higher than that of plain fasudil after intravenous administration. Peptide-linked liposomal fasudil, as opposed to plain liposomes, reduced the mean pulmonary arterial pressure by 35-40%, without influencing the mean systemic arterial pressure. This study establishes that CAR-conjugated inhalable liposomal fasudil offers favorable pharmacokinetics and produces pulmonary vasculature specific dilatation. PMID:25333706

Nahar, Kamrun; Absar, Shahriar; Gupta, Nilesh; Kotamraju, Venkata Ramana; McMurtry, Ivan F; Oka, Masahiko; Komatsu, Masanobu; Nozik-Grayck, Eva; Ahsan, Fakhrul

2014-12-01

397

Liposome uptake into human colon adenocarcinoma cells in monolayer, spinner, and trypsinized cultures  

SciTech Connect

Experiments were performed to study the uptake and incorporation of multilamellar and of reverse-phase evaporation liposomes of neutral charge into monolayers, suspended spinner cultures, and trypsinized cells of a human colon adenocarcinoma cell line, LS174T. The results showed that the same tumor cells cultured under each condition exhibited a distinct pattern of vesicle uptake as determined at 0, 15, 30, 60, and 120 min. In monolayer cultures of LS174T cells, the uptake of liposomes bearing (/sup 3/H)actinomycin D in the lipid bilayers was linear throughout the incubation period. In contrast, in trypsinized and spinner suspension cultures, uptake of liposomes was biphasic. There was a proportional uptake of both liposome (labeled with (/sup 3/H)phosphatidylcholine or (/sup 14/C)cholesterol) and of actinomycin D (trace labeled with /sup 3/H) into the cells under all culture conditions, indicating quantitative delivery of the drug with the intact lipid vesicle. Although the amount of actinomycin D presented to tumor cells by the two liposomes was equivalent, reverse-phase evaporation liposomes were more effective than multilamellar vesicles in inhibiting uridine uptake. In the presence of excess liposomes (10 times the uptake studies), saturation of the tumor cell surface occurred by 120 min. However, the liposomes remained accessible to enzymatic removal for 60 min. Liposome-saturated tumor cells remained refractory to further binding of liposomes for at least 2 hr. The results thus revealed that differences in cell uptake were due to the state of the target cells and not the liposome types, or their differential leakage of labels.

Tom, B.H. (The Univ. of Texas Medical School at Houston); Macek, C.M.; Raphael, L.; Sengupta, J.; Cerny, E.A.; Jonah, M.M.; Rahman, Y.E.

1983-01-01

398

Preparation, Characterization and Pharmacokinetics of Folate Receptor-Targeted Liposomes for Docetaxel Delivery  

PubMed Central

A novel liposomal formulation of docetaxel targeting the folate receptor (FR) was synthesized and characterized. Liposomal formulations are less toxic and can provide longer systemic circulation time than the Tween 80 and ethanol based clinical formulation of docetaxel. Folate receptor-? (FR) is frequently over-expressed on epithelial cancer cells. Therefore, FR targeted liposomes can potentially enhance tumor cell uptake and antitumor efficacy of encapsulated drugs. The formulation studied had the compositions of egg phosphatidylcholine/cholesterol/methoxy-polyethylene glycol (PEG)2,000-distesroylphnosphatidylethanolamine/folate-PEG3,350-cholesteryl hemisuccinate (ePC/Chol/mPEG-DSPE/folate-PEG-CHEMS) at ratios of (80:15:4.5:0.5, mol/mol) and a drug-to-lipid ratio of 1:20, wt/wt. Sucrose was used as a lyoprotectant. The liposomes were prepared by thin-film hydration, polycarbonate membrane extrusion, followed by lyophilization. They remained stable for more than 5 months when stored as lyophilized powder and for 72 h at 4 °C following rehydration. The mean particle size of reconstituted liposomes ranged from 110 to 120 nm. FR-targeted liposomes of the same lipid composition entrapping calcein were shown to be efficiently taken up by FR + KB oral carcinoma cells. FR-targeted liposomes containing docetaxel showed 4.4-fold greater cytotoxicity compared to non-targeted liposomes in KB cells. Plasma clearance profiles of FR-targeted and non-targeted liposomeal docetaxel were evaluated and compared with that of docetaxel in Tween 80/ethanol formulation. The liposomal formulations showed much longer terminal half lives (4.92 h and 6.75 h for FR-targeted and non-targeted, respectively) than docetaxel in Tween 80/ethanol solution (1.09 h). FR-targeted liposomes are promising tumor cell-selective nanocarriers for docetaxel with potential for therapeutic applications. PMID:19435095

Zhai, Guangxi; Wu, Jun; Xiang, Guangya; Mao, Wenxue; Yu, Bo; Li, Hong; Piao, Longzhu; Lee, L. James

2013-01-01

399

Tumor Burden Talks in Cancer Treatment with PEGylated Liposomal Drugs  

PubMed Central

Purpose PEGylated liposomes are important drug carriers that can passively target tumor by enhanced permeability and retention (EPR) effect in neoplasm lesions. This study demonstrated that tumor burden determines the tumor uptake, and also the tumor response, in cancer treatment with PEGylated liposomal drugs in a C26/tk-luc colon carcinoma-bearing mouse model. Methods Empty PEGylated liposomes (NanoX) and those encapsulated with VNB (NanoVNB) were labeled with In-111 to obtain InNanoX and InVNBL in high labeling yield and radiochemical purity (all >90%). BALB/c mice bearing either small (58.4±8.0 mm3) or large (102.4±22.0 mm3) C26/tk-luc tumors in the right dorsal flank were intravenously administered with NanoVNB, InNanoX, InVNBL, or NanoX as a control, every 7 days for 3 times. The therapeutic efficacy was evaluated by body weight loss, tumor growth inhibition (using calipers and bioluminescence imaging) and survival fraction. The scintigraphic imaging of tumor mouse was performed during and after treatment. Results The biodistribution study of InVNBL revealed a clear inverse correlation (r2?=?0.9336) between the tumor uptake and the tumor mass ranged from 27.6 to 623.9 mg. All three liposomal drugs showed better therapeutic efficacy in small-tumor mice than in large-tumor mice. Tumor-bearing mice treated with InVNBL (a combination drug) showed the highest tumor growth inhibition rate and survival fraction compared to those treated with NanoVNB (chemodrug only) and InNanoX (radionuclide only). Specific tumor targeting and significantly increased tumor uptake after periodical treatment with InVNBL were evidenced by scintigraphic imaging, especially in mice bearing small tumors. Conclusion The significant differences in the outcomes of cancer treatment and molecular imaging between animals bearing small and large tumors revealed that tumor burden is a critical and discriminative factor in cancer therapy using PEGylated liposomal drugs. PMID:23675454

Li, Jia-Je; Hwang, Jeng-Jong; Tseng, Yun-Long; Lin, Wuu-Jyh; Lin, Ming-Hsien; Ting, Gann; Wang, Hsin-Ell

2013-01-01

400

Growth of phthalocyanine doped and undoped nanotubes using mild synthesis conditions for development of novel oxygen reduction catalysts.  

PubMed

Precious metal alloys have been the predominant electrocatalyst used for oxygen reduction in fuel cells since the 1960s. Although performance of these catalysts is high, they do have drawbacks. The two main problems with precious metal alloys are catalyst passivation and cost. This is why new novel catalysts are being developed and employed for oxygen reduction. This paper details the low temperature solvothermal synthesis and characterization of carbon nanotubes that have been doped with both iron and cobalt centered phthalocyanine. The synthesis is a novel low-temperature, supercritical solvent synthesis that reduces halocarbons to form a metal chloride byproduct and carbon nanotubes. Perchlorinated phthalocyanine was added to the nanotube synthesis to incorporate the phthalocyanine structure into the graphene sheets of the nanotubes to produce doped nanotubes that have the catalytic oxygen reduction capabilities of the metallo-phthalocyanine and the advantageous material qualities of carbon nanotubes. The cobalt phthalocyanine doped carbon nanotubes showed a half wave oxygen reduction potential of -0.050 ± 0.005 V vs Hg\\HgO, in comparison to platinum's half wave oxygen reduction potential of -0.197 ± 0.002 V vs Hg\\HgO. PMID:21043456

Arechederra, Robert L; Artyushkova, Kateryna; Atanassov, Plamen; Minteer, Shelley D

2010-11-01

401

Characterization of the Surfaces Generated by Liposome Binding to the Modified Dextran Matrix of a Surface Plasmon Resonance Sensor Chip  

Microsoft Academic Search

The dextran matrix of a surface plasmon resonance (SPR) sensor chip modified with hydrophobic residues (BIAcore sensor chip L1) provides an ideal substrate for liposome adsorption. Liposomes of different lipid compositions are captured on the sensor chips by inserting these residues into the liposome membrane, thereby generating stable lipid surfaces. To gain a more detailed understanding of these surfaces, and

Eva-Maria Erb; Xinyong Chen; Stephanie Allen; Clive J. Roberts; Saul J. B. Tendler; Martyn C. Davies; Sture Forsén

2000-01-01

402

Triggered release of siRNA from poly(ethylene glycol)-protected, pH-dependent liposomes  

E-print Network

Triggered release of siRNA from poly(ethylene glycol)-protected, pH-dependent liposomes Debra T Available online 12 June 2008 Keywords: RNAi siRNA Genedelivery Liposome pH-dependent PEG The ability)-b-polycation polymers from pH-dependent (PD) liposomes enables protection from immune recognition during circulation (p

Auguste, Debra T.

403

Antimicrobial Efficacy of Liposome Encapsulated Nisin and Nisin's Inhibition Against Listeria monocytogenes in Fluid Milk at Different Storage Temperatures  

E-print Network

Page ??? ? ? Liposomes in Drug Delivery.................................................................27 Liposomes in Gene Therapy .................................................................29 Liposomes in Cosmetics... versatility and ability to act as targeted release-on-demand carrier systems for water and oil-soluble compounds, they have been used in a number of industrial applications including drug delivery, gene therapy, cosmetics, ecological preservation, and food...

Schmidt, Shannon E.

2010-10-12

404

Liposomes composed of a double-chain cationic amphiphile (Vectamidine) induce their own encapsulation into human erythrocytes  

E-print Network

Liposomes composed of a double-chain cationic amphiphile (Vectamidine) induce their own is a liposome-forming double-chain cationic amphiphile. The present work was aimed to microscopically study amphiphiles may transfer from membrane-attached liposomes to the plasma membrane and then translocate

Iglic, Ales

405

Linear DNA Low Efficiency Transfection by Liposome Can Be Improved by the Use of Cationic Lipid as Charge Neutralizer  

E-print Network

Linear DNA Low Efficiency Transfection by Liposome Can Be Improved by the Use of Cationic Lipid the efficiency of a liposome-mediated transfection by circular and linear DNA. The results obtained showed a low rate of transfection by linear DNA:liposome complexes. To explore whether the structure

Barbosa, Marcia C. B.

406

Microfluidic Synthesis of PEG- and Folate-Conjugated Liposomes for One-Step Formation of Targeted Stealth Nanocarriers  

PubMed Central

Purpose A microfluidic hydrodynamic flow focusing technique enabling the formation of small and nearly monodisperse liposomes is investigated for continuous-flow synthesis of poly(ethylene glycol) (PEG)-modified and PEG-folate-functionalized liposomes for targeted drug delivery. Methods Controlled laminar flow in thermoplastic microfluidic devices facilitated liposome self-assembly from initial lipid compositions including lipid/cholesterol mixtures containing PEG-lipid and folate-PEG-lipid conjugates. The relationships between flow conditions, lipid composition, and liposome size were evaluated, and the impact of these parameters on PEG and folate incorporation were determined through a combination of UV-vis absorbance measurements and characterization of liposome zeta potential. Results Both PEG and folate were successfully incorporated into microfluidic-synthesized liposomes over the full range of liposome sizes studied. The efficiency of PEG-lipid incorporation was found to be inversely correlated with liposome diameter. Folate-lipid was also effectively integrated into liposomes at various flow conditions. Conclusions Liposomes incorporating relatively large PEG-modified and folate-PEG-modified lipids were successfully synthesized using the microfluidic flow focusing platform, providing a simple, low cost, rapid method for preparing functionalized liposomes. Relationships between preparation conditions and PEG or folate-PEG functionalization have been elucidated, providing insight into the process and defining paths for optimization of the microfluidic method toward the formation of functionalized liposomes for pharmaceutical applications. PMID:23386106

Hood, Renee R.; Shao, Chenren; Omiatek, Donna M.; Vreeland, Wyatt N.; DeVoe, Don L.

2013-01-01

407

Nanoparticle-Assisted Surface Immobilization of Phospholipid Liposomes Liangfang Zhang, Liang Hong, Yan Yu, Sung Chul Bae, and Steve Granick*  

E-print Network

Nanoparticle-Assisted Surface Immobilization of Phospholipid Liposomes Liangfang Zhang, Liang Hong Received April 21, 2006; E-mail: sgranick@uiuc.edu Liposomes are artificially constructed spherical lipid that individual liposomes comprise com- partments with volumes from zeptoliters (10-21 L) to femtoliters (10-15 L

Yu, Yan

408

Transfection Mechanisms of Polyplexes, Lipoplexes, and Stealth Liposomes in 51 Integrin Bearing DLD1 Colorectal Cancer Cells  

E-print Network

Transfection Mechanisms of Polyplexes, Lipoplexes, and Stealth Liposomes in 51 Integrin Bearing DLD PEGylated (stealth) nontargeted liposomes or PR_b peptide (targeted to 51 integrin) functionalized stealth liposomes in DLD-1 colorectal cancer cells in vitro with gene expression assays, flow cytometry and confocal

Kokkoli, Efie

409

Colloids and Surfaces B: Biointerfaces 42 (2005) 115123 Electroformation of giant liposomes from spin-coated films of lipids  

E-print Network

Colloids and Surfaces B: Biointerfaces 42 (2005) 115­123 Electroformation of giant liposomes from-coating of solutions of lipids and using the resulting thin films for electroformation of giant liposomes. Spin (25­50 nm), we demonstrate formation of giant liposomes from lipids (such as asolectin

Mayer, Michael

410

Encapsulation of adenovirus serotype 5 in anionic lecithin liposomes using a bead-based immunoprecipitation technique enhances  

E-print Network

Encapsulation of adenovirus serotype 5 in anionic lecithin liposomes using a bead Available online 22 August 2014 Keywords: Adenovirus Drug delivery Gene therapy Liposome Nanoparticle response and to enhance its potential use to treat primary and metastatic tumors, a method for liposomal

Kummel, Andrew C.

411

PR_b-Targeted PEGylated Liposomes for Prostate Cancer Therapy Done Demirgoz, Ashish Garg, and Efrosini Kokkoli*  

E-print Network

PR_b-Targeted PEGylated Liposomes for Prostate Cancer Therapy Do¨ne Demirgo¨z, Ashish Garg-targeted stealth liposomes (nanoparticles covered with poly(ethylene glycol) (PEG)) that will bind to R5 1. For this purpose, liposomes (with and without PEG2000) were functionalized with a fibronectin-mimetic peptide (PR

Kokkoli, Efie

412

Depletion and repopulation of macrophages in spleen and liver of rat after intravenous treatment with liposome-encapsulated dichloromethylene diphosphonate  

Microsoft Academic Search

Rats received a single intravenous injection with liposome-encapsulated dichloromethylene diphosphonate (Cl2MDP). This treatment resulted in the elimination of macrophages in spleen and liver within 2 days. Macrophages ingest the liposomes and are destroyed by the drug, which is released from the liposomes after disruption of the phospholipid bilayers under the influence of lysosomal phospholipases. Repopulation of macrophages in spleen and

N. Van Rooijen; N. Kors; M. v. d. Ende; C. D. Dijkstra

1990-01-01

413

Liposomal encapsulation of the natural flavonoid fisetin improves bioavailability and antitumor efficacy.  

PubMed

The natural flavonoid fisetin (3,3',4',7-tetrahydroxyflavone) has shown antiangiogenic and anticancer properties. Because of fisetin limited water solubility, we designed a liposomal formulation and evaluated its biological properties in vitro and in Lewis lung carcinoma (LLC) bearing mice. A liposomal formulation was developed with DOPC and DODA-PEG2000, possessing a diameter in the nanometer range (173.5±2.4nm), a high homogeneity (polydispersity index 0.181±0.016) and high fisetin encapsulation (58%). Liposomal fisetin incubated with LLC cells were internalized, induced a typical fisetin morphological effect and increased the sub-G1 cell distribution. In vivo, liposomal fisetin allowed a 47-fold increase in relative bioavailability compared to free fisetin. The effect of liposomal fisetin on LLC tumor growth in mice at low dose (21mg/kg) allowed a higher tumor growth delay (3.3 days) compared to free fisetin at the same dose (1.6 day). Optimization of liposomal fisetin therapy was attempted by co-treatment with cyclophosphamide which led to a significant improvement in tumor growth delay (7.2 days) compared to cyclophosphamide with control liposomes (4.2 days). In conclusion, fisetin liposomes markedly improved fisetin bioavailability and anticancer efficacy in mice and this formulation could facilitate the administration of this flavonoid in the clinical setting. PMID:23380621

Seguin, Johanne; Brullé, Laura; Boyer, Renaud; Lu, Yen Mei; Ramos Romano, Miriam; Touil, Yasmine S; Scherman, Daniel; Bessodes, Michel; Mignet, Nathalie; Chabot, Guy G

2013-02-28

414

In vitro synthesis and stabilization of amorphous calcium carbonate (ACC) nanoparticles within liposomes  

SciTech Connect

We show that amorphous calcium carbonate (ACC) can be synthesized in phospholipid bilayer vesicles (liposomes). Liposome-encapsulated ACC nanoparticles are stable against aggregation, do not crystallize for at least 20 h, and are ideally suited to investigate the influence of lipid chemistry, particle size, and soluble additives on ACC in situ.

Tester, Chantel C.; Brock, Ryan E.; Wu, Ching-Hsuan; Krejci, Minna R.; Weigand, Steven; Joester, Derk (NWU)

2012-02-07

415

Anisamide-targeted stealth liposomes: a potent carrier for targeting doxorubicin to human prostate cancer cells.  

PubMed

Certain human malignancies including prostate cancer overexpress sigma receptor, a membrane bound protein that binds haloperidol and various other neuroleptics with high affinity. An anisamide derivatized ligand possesses high affinity for sigma receptors and we hypothesized that its incorporation into the liposomes encapsulating doxorubicin (DOX) can specifically target and deliver the drug to prostate cancer cells that overexpress sigma receptors. A polyethylene glycol phospholipid was derivatized with an anisamide ligand, which was then incorporated into the DOX-loaded liposome. The resulting anisamide-conjugated liposomal DOX showed significantly higher toxicity to DU-145 cells than non-targeted liposomal DOX, the IC50 being 1.8 microM and 14 microM respectively. The cytotoxicity of the targeted liposomal DOX, however, was significantly blocked by haloperidol, suggesting that the enhanced cytotoxicity was specifically mediated by the sigma receptors. Fluorescence imaging studies after intravenous (i.v.) administration showed that incorporation of anisamide into liposomes significantly improved their accumulation into the tumor. A weekly injection of the targeted liposomal DOX for 4 weeks at a dose of 7.5 mg/kg led to a significant growth inhibition of established DU-145 tumor in nude mice with minimal toxicity. Free DOX was effective, but associated with significant toxicities. The present study is the first to demonstrate the use of small molecular weight ligand for mediating efficient targeting of liposomal drugs to sigma receptor expressing prostate cancer cells both in vitro and in vivo. PMID:15382053

Banerjee, Rajkumar; Tyagi, Pradeep; Li, Song; Huang, Leaf

2004-11-20

416

In vitro evaluation of optimized liposomes for delivery of small interfering RNA.  

PubMed

Abstract One of the biggest challenges for small interfering RNAs (siRNAs) as therapeutic agents is their insufficient cellular delivery efficiency. We developed long circulating and cationic liposomes to improve the cell uptake and inhibitory effectiveness of siRNA on the expression of vascular endothelial growth factor (VEGF) in cancer cells. SiRNA liposomes were obtained by polyelectrolyte complexation between negatively charged siRNA and positively charged liposome prepared by a hydration method. Gel electrophoresis was used to evaluate the loading efficiency of siRNA on the cationic liposome. The optimized siRNA liposomes were observed to be spherical in shape and had smooth surfaces with particle sizes of 167.7?±?2.0?nm and zeta potentials of 4.03?±?0.69?mV, which had no significant change when stored at 4?°C for three months. Fluorescence-activated cell sorting studies and confocal laser scanning images indicated that the cationic liposomes significantly increased the uptake of fluorescence-labeled siRNA in cancer cells. Effects of the siRNA on the inhibition of VEGF were tested by measuring concentrations of VEGF in cell culture media via an enzyme-linked immunosorbent assay and intracellular VEGF levels using a western blotting method. The liposomal siRNA was significantly effective at inhibiting the expression of VEGF in lung, liver and breast cancer cells. Optimal liposomes could effectively deliver siRNA into cancer cells and inhibit VEGF as a therapy agent. PMID:24708056

Yang, Tianzhi; Bantegui, Tracy; Pike, Kaitlynn; Bloom, Raymond; Phipps, Roger; Bai, Shuhua

2014-12-01

417

Spermidinium closo-dodecaborate-encapsulating liposomes as efficient boron delivery vehicles for neutron capture therapy.  

PubMed

closo-Dodecaborate-encapsulating liposomes were developed as boron delivery vehicles for neutron capture therapy. The use of spermidinium as a counter cation of closo-dodecaborates was essential not only for the preparation of high boron content liposome solutions but also for efficient boron delivery to tumors. PMID:25182569

Tachikawa, Shoji; Miyoshi, Tatsuro; Koganei, Hayato; El-Zaria, Mohamed E; Viñas, Clara; Suzuki, Minoru; Ono, Koji; Nakamura, Hiroyuki

2014-09-18

418

Pharmaceutical Nanotechnology Enhanced solubility and stability of PEGylated liposomal paclitaxel: In vitro and in vivo evaluation  

Microsoft Academic Search

An improved PEGylated liposomal formulation of paclitaxel has been developed with the purpose of improving the solubility of paclitaxel as well as the physicochemical stability of liposome in comparison to the current Taxol® formulation. The use of 3% (v\\/v) Tween 80 in the hydration media was able to increase the solubility of drug. The addition of sucrose as a lyoprotectant

Tao Yang; Fu-De Cui; Min-Koo Choi; Jei-Won Cho; Suk-Jae Chung; Chang-Koo Shim; Dae-Duk Kim

419

New Cationic Liposomes for Gene Transfer into Mammalian Cells with High Efficiency and Low Toxicity  

E-print Network

New Cationic Liposomes for Gene Transfer into Mammalian Cells with High Efficiency and Low Toxicity. Cytotoxicity tests were performed for some cell lines. The transfection efficiency of the amphiphiles on different cell lines was evaluated as a liposomal solution in the presence of the fusogenic helper lipid

Park, Jong-Sang

420

Effects of Surface Displayed Targeting Ligand GE11 on Liposome Distribution and Extravasation in Tumor.  

PubMed

Targeting ligands displayed on liposome surface had been used to mediate specific interactions and drug delivery to target cells. However, they also affect liposome distribution in vivo, as well as the tissue extravasation processes after IV injection. In this study, we incorporated an EGFR targeting peptide GE11 on liposome surfaces in addition to PEG at different densities and evaluated their targeting properties and antitumor effects. We found that the densities of surface ligand and PEG were critical to target cell binding in vitro as well as pharmacokinetic profiles in vivo. The inclusion of GE11-PEG-DSPE and PEG-DSPE at 2% and 4% mol ratios in the liposome formulation mediated a rapid accumulation of liposomes within 1 h after IV injection in the tumor tissues surrounding neovascular structures. This is in addition to the EPR effect that was most prominently described for surface PEG modified liposomes. Therefore, despite the fact that the distribution of liposomes into interior tumor tissues was still limited by diffusion, GE11 targeted doxorubicin loaded liposomes showed significantly better antitumor activity in tumor bearing mice as a result of the fast active-targeting efficiency. We anticipate these understandings can benefit further optimization of targeted drug delivery systems for improving efficacy in vivo. PMID:25181533

Tang, Hailing; Chen, Xiaojing; Rui, Mengjie; Sun, Wenqiang; Chen, Jian; Peng, Jinliang; Xu, Yuhong

2014-10-01

421

The Immunological Enhancement Activity of Propolis Flavonoids Liposome In Vitro and In Vivo  

PubMed Central

The aim of this study was to investigate and assess the effects of propolis flavonoids liposome imposed on the immune system by comparing it to propolis flavonoids and blank liposome. In vitro, the effects of the above drugs on macrophages were assessed by measuring the phagocytic function and cytokine production. In vivo, the immunological adjuvant activity of propolis flavonoids liposome was compared with those of propolis flavonoids and blank liposome. The results showed that in vitro propolis flavonoids liposome can significantly enhance the phagocytic function of macrophages and the release of IL-1?, IL-6, and IFN-?. In addition, subcutaneous administration of propolis flavonoids liposome with ovalbumin to mice could effectively activate the cellular and humoral immune response, including inducing higher level concentrations of IgG, IL-4, and IFN-? in serum and the proliferation rates of splenic lymphocytes. These findings provided valuable information regarding the immune modulatory function of propolis flavonoids liposome and indicated the possibility of use of propolis flavonoids liposome as a potential adjuvant. PMID:25383082

Tao, Yang; Wang, Deqing; Hu, Yuanliang; Huang, Yee; Yu, Yun; Wang, Deyun

2014-01-01

422

Liposome-containing polymer films and colloidal assemblies towards biomedical applications  

NASA Astrophysics Data System (ADS)

Liposomes are important components for biomedical applications. Their unique architecture and versatile nature have made them useful carriers for the delivery of therapeutic cargo. The scope of this minireview is to highlight recent developments of biomimetic liposome-based multicompartmentalized assemblies of polymer thin films and colloidal carriers, and to outline a selection of recent applications of these materials in bionanotechnology.

Teo, Boon M.; Hosta-Rigau, Leticia; Lynge, Martin E.; Städler, Brigitte

2014-05-01

423

Ag@4ATP-coated liposomes: SERS traceable delivery vehicles for living cells  

NASA Astrophysics Data System (ADS)

A liposome-Ag nanohybrid has been demonstrated as a SERS traceable intracellular drug nanocarrier. Liposomes have been introduced for their special qualities in drug delivery systems. In essence, 4-aminothiophenol (4ATP) tagged Ag nanoparticles (Ag@4ATP) were adsorbed onto the surfaces of liposomes via electrostatic interactions, in which 4ATP was used as a SERS reporter. In such a nanohybrid, the locations of the carrier can be tracked by SERS signals while those of the drugs can be monitored through their fluorescence, allowing the simultaneous investigation of the intracellular distribution of both the carriers and the drugs. Our experimental results suggest that the reported liposomal system has substantial potential for intracellular drug delivery.A liposome-Ag nanohybrid has been demonstrated as a SERS traceable intracellular drug nanocarrier. Liposomes have been introduced for their special qualities in drug delivery systems. In essence, 4-aminothiophenol (4ATP) tagged Ag nanoparticles (Ag@4ATP) were adsorbed onto the surfaces of liposomes via electrostatic interactions, in which 4ATP was used as a SERS reporter. In such a nanohybrid, the locations of the carrier can be tracked by SERS signals while those of the drugs can be monitored through their fluorescence, allowing the simultaneous investigation of the intracellular distribution of both the carriers and the drugs. Our experimental results suggest that the reported liposomal system has substantial potential for intracellular drug delivery. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr00557k

Zhu, Dan; Wang, Zhuyuan; Zong, Shenfei; Chen, Hui; Wu, Xin; Pei, Yuwei; Chen, Peng; Ma, Xueqin; Cui, Yiping

2014-06-01

424

Theranostic liposomes loaded with quantum dots and apomorphine for brain targeting and bioimaging  

PubMed Central

Quantum dots (QDs) and apomorphine were incorporated into liposomes to eliminate uptake by the liver and enhance brain targeting. We describe the preparation, physicochemical characterization, in vivo bioimaging, and brain endothelial cell uptake of the theranostic liposomes. QDs and the drug were mainly located in the bilayer membrane and inner core of the liposomes, respectively. Spherical vesicles with a mean diameter of ~140 nm were formed. QDs were completely encapsulated by the vesicles. Nearly 80% encapsulation percentage was achieved for apomorphine. A greater fluorescence intensity was observed in mouse brains treated with liposomes compared to free QDs. This result was further confirmed by ex vivo imaging of the organs. QD uptake by the heart and liver was reduced by liposomal incorporation. Apomorphine accumulation in the brain increased by 2.4-fold after this incorporation. According to a hyperspectral imaging analysis, multifunctional liposomes but not the aqueous solution carried QDs into the brain. Liposomes were observed to have been efficiently endocytosed into bEND3 cells. The mechanisms involved in the cellular uptake were clathrin- and caveola-mediated endocytosis, which were energy-dependent. To the best of our knowledge, our group is the first to develop liposomes with a QD-drug hybrid for the aim of imaging and treating brain disorders. PMID:22619515