Science.gov

Sample records for lupus erythematodes aseptic

  1. Association of autoimmune hepatitis and systemic lupus erythematodes: A case series and review of the literature

    PubMed Central

    Beisel, Claudia; Weiler-Normann, Christina; Teufel, Andreas; Lohse, Ansgar W

    2014-01-01

    Liver test abnormalities have been described in up to 60% of patients with systemic lupus erythematodes (SLE) at some point during the course of their disease. Prior treatment with potentially hepatotoxic drugs or viral hepatitis is commonly considered to be the main cause of liver disease in SLE patients. However, in rare cases elevated liver enzymes may be due to concurrent autoimmune hepatitis (AIH). To distinguish whether the patient has primary liver disease with associated autoimmune clinical and laboratory features resembling SLE - such as AIH - or the elevation of liver enzymes is a manifestation of SLE remains a difficult challenge for the treating physician. Here, we present six female patients with complex autoimmune disorders and hepatitis. Patient charts were reviewed in order to investigate the complex relationship between SLE and AIH. All patients had coexisting autoimmune disease in their medical history. At the time of diagnosis of AIH, patients presented with arthralgia, abdominal complaints, cutaneous involvement and fatigue as common symptoms. All patients fulfilled the current diagnostic criteria of both, AIH and SLE. Remission of acute hepatitis was achieved in all cases after the initiation of immunosuppressive therapy. In addition to this case study a literature review was conducted. PMID:25253972

  2. Aseptic necrosis at multiple localisations in a lupus patient with lymphoma.

    PubMed

    Bazso, A; Bazso, T; Szodoray, P; Poor, G; Kiss, E

    2014-04-01

    Avascular or aseptic necrosis is a well-defined entity leading to the degradation of cellular elements of the bone. The pathogenesis of osteonecrosis (ON) is still unknown. There are two main types of ON: traumatic or non-traumatic. Several clinical entities could associate with ON, systemic diseases, environmental factors, pregnancy, systemic autoimmune or rheumatic diseases, thrombophilia, corticosteroid therapy, cytotoxic dugs, infections, metabolic and hematologic diseases, etc. Corticosteroids (CS) are still the most frequently used therapeutic options in the early phase and during flares of these diseases. Inflammatory cytokines and antibodies have been described to participate in the pathogenesis of ON. The infiltrative disorders of the bone marrow could also contribute to the development of ON. Hereby, we describe a female patient with NHL followed by SLE in whom ON has developed at least in two localisations. Lupus flare, long-term CS therapy, lymphoma relapse or the presence of antiphospholipid antibodies were excluded. Although the bi-localised ON could be contributed to immunologic factors or trauma, the exact aetiology in this case could not be elucidated. PMID:24297095

  3. Tumour necrosis factor α (TNF-α), interleukin-6 (IL-6) and their soluble receptors (sTNF-α-Rp55 and slL-6R) serum levels in systemic lupus erythematodes

    PubMed Central

    Robak, E.; Sysa-Jędrzejowska, A.; Stępień, H.; Woźniacka, A.; Waszczykowsk, E.

    1996-01-01

    We investigated a possible association between serum concentrations of tumour necrosis factor α (TNF-α), interleukin-6 (IL-6) and their soluble receptors (sTNF-α-Rp55 and sIL-6R) using an enzyme-linked immunosorbent assay (ELISA) in 55 patients with systemic lupus erythematodes (SLE) and 16 healthy controls. We also examined a possible association between the serum levels of these peptides and SLE activity, as well as TNF-α and IL-6 concentrations and the levels of their soluble receptors. The median concentrations of TNF-α, sTNF-α-Rp55 and IL-6 were significantly higher in SLE patients than in normal individuals. In contrast, there was no difference between the serum level of sIL-6R in both groups. We found positive correlations between the serum concentrations of TNF-α and IL-6 as well as their soluble receptors and disease activity. There were also correlations between TNF-α and sTNF-α-Rp55 as well as IL-6 and sIL-6R serum levels in SLE patients but there were no such correlations in the normal control group. In conclusion, an increase in the serum levels of TNF-α, sTNF-α-Rp55 and IL-6 may become useful markers for SLE activity. Patients with SLE have sIL-6R serum concentration similar to that as in normal individuals. However, it correlates with disease activity and the level of IL-6. PMID:18475749

  4. Lupus

    MedlinePlus

    What is lupus? Lupus is an autoimmune disease. This means that your immune system attacks healthy cells and tissues by mistake. This can ... vessels, and brain. There are several kinds of lupus Systemic lupus erythematosus (SLE) is the most common ...

  5. Lupus

    MedlinePlus

    If you have lupus, your immune system attacks healthy cells and tissues by mistake. This can damage your joints, skin, blood vessels and organs. There are many kinds of lupus. The most common type, systemic lupus erythematosus, affects ...

  6. Syphilitic aseptic meningitis

    MedlinePlus

    Syphilitic aseptic meningitis is a complication of untreated syphilis. It involves inflammation of the tissues covering the ... Syphilis is a sexually transmitted disease caused by the spirochete bacteria Treponema pallidum . Syphilis has three main ...

  7. Understanding Lupus

    MedlinePlus

    ... treat lupus? What causes lupus? What are the risk factors for developing lupus? How does lupus affect the nervous system? What is the history of lupus? Is stress related to lupus? Can hormones trigger the development ...

  8. [Psychotherapy in a patient with lupus erythematodes--a disease with an uncertain course].

    PubMed

    Geiger, I; Langewitz, W

    2007-10-01

    The autoimmune disease Systemic LE (SLE) poses major adjustment problems because the course of the illness is unpredictable. Informing patients thus, does not provide clarity but include information about the fallibility of medical information or prognosis. Even though effective manual based psychological treatment programs exist, an individualised approach seems to be more appropriate. However, reports on individual psychotherapeutic interventions have not been reported sufficiently. The paper describes the short-term treatment of a patient with SLE. In his case cognitive deficits could be attributed to a CNS participation of SLE; central was an identity problem related to the disease. Within a few hours a substantial improvement of his condition could be achieved. PMID:18214212

  9. Lupus - resources

    MedlinePlus

    Resources - lupus ... The following organizations are good resources for information on systemic lupus erythematosus : The Lupus Foundation of America -- www.lupus.org The National Institute of Arthritis and Musculoskeletal ...

  10. Considering syphilis in aseptic meningitis.

    PubMed

    Tayal, Sarup; Chadwick, David; Chawla, Girish

    2009-12-01

    Clinicians need to consider syphilis in the differential diagnosis of macular or papular rashes with neurological conditions, particularly aseptic meningitis, as early diagnosis and treatment lead to a better prognosis. PMID:20095316

  11. Aseptic technique in microgravity.

    PubMed

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  12. Aseptic technique for cell culture.

    PubMed

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here. PMID:18228291

  13. The biology of aseptic osteolysis.

    PubMed

    Holt, G; Murnaghan, C; Reilly, J; Meek, R M D

    2007-07-01

    Total hip arthroplasty is one of the most commonly performed and successful elective orthopaedic procedures. However, numerous failure mechanisms limit the long-term success including aseptic osteolysis, aseptic loosening, infection, and implant instability. Aseptic osteolysis and subsequent implant failure occur because of a chronic inflammatory response to implant-derived wear particles. To reduce particulate debris and their consequences, implants have had numerous design modifications including high-molecular-weight polyethylene sockets and noncemented implants that rely on bone ingrowth for fixation. Surgical techniques have improved cementation with the use of medullary plugs, cement guns, lavage of the canal, pressurization, centralization of the stem, and reduction in cement porosity. Despite these advances, aseptic osteolysis continues to limit implant longevity. Numerous proinflammatory cytokines, such as interleukin-1, interleukin-6, tumor necrosis factor-alpha, and prostaglandin E2, have proosteoclastogenic effects in response to implant-derived wear particles. However, none of these cytokines represents a final common pathway for the process of particle-induced osteoclast differentiation and maturation. Recent work has identified the fundamental role of the RANKL-RANK-NF-kappaB pathway not only in osteoclastogenesis but also in the development and function the immune system. Thus, the immune system and skeletal homeostasis may be linked in the process of osteoclastogenesis and osteolysis. PMID:17620815

  14. Management of aseptic tibial nonunion.

    PubMed

    Hak, David J

    2011-09-01

    Tibial nonunion remains a significant clinical challenge despite advances in surgical management. New techniques to help manage tibial nonunion include extracorporeal shock wave therapy and percutaneous application of bone marrow aspirate. Management strategies vary based on the type of nonunion: aseptic or infected, and atrophic or hypertrophic. Extracorporeal shock wave therapy has been shown to be as effective as surgical management in patients with stable hypertrophic nonunion. New fixation options include locked plates and intramedullary compression nails. Novel methods of external fixation have been developed for bone graft harvest from the intramedullary canal. Several biologic adjuncts also are available, including bone marrow aspirates, stem cells, and bone morphogenetic protein. PMID:21885702

  15. Lupus nephritis

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/000481.htm Lupus nephritis To use the sharing features on this page, please enable JavaScript. Lupus nephritis is a kidney disorder which is a complication ...

  16. Basics of sterile compounding: aseptic processing.

    PubMed

    Akers, Michael J

    2015-01-01

    This article discusses factors that affect the assurance of sterility of an aseptic process operation and balances what is required/practiced in the pharmaceutical industry via the U.S. Food and Drug Administration and European aseptic processing guidelines and what is required/practiced in compounding pharmacies via the United States Pharmacopeia (USP) General Chapter <797>. PMID:25902628

  17. [SAPHO syndrome and aseptic osteitis].

    PubMed

    Cotten, A; Boutry, N; Demondion, X; Chastanet, P; Flipo, R M

    1997-01-01

    Palmoplantar pustulosis and severe acne are sometimes associated with aseptic skeletal lesions, but such skeletal conditions can be observed without skin lesions. The acronym SAPHO (Synovitis, Acne, Palmoplantar pustulosis, Hyperostosis, Osteitis) has been suggested for this cluster of manifestations. The most frequent site of the disease is the upper anterior chest wall, characterized by predominantly osteosclerotic lesions, hyperostosis, and arthritis of the adjacent joints. Osteosclerosis of the vertebral bodies, hyperostosis, and erosions of the vertebral plates can be encountered. Unilateral sacroiliitis of frequently observed. Long bone involvement consists of osteosclerosis or osteolysis with periosteal new bone formation. Peripheral arthritis is rarely associated with joint destruction. The pathogenesis of this syndrome remains unknown, but a link with seronegative spondylarthropathies is probable. Awareness of the SAPHO syndrome should facilitate proper diagnosis and treatment. PMID:9810077

  18. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  19. Systemic lupus erythematosus

    MedlinePlus

    Disseminated lupus erythematosus; SLE; Lupus; Lupus erythematosus; Butterfly rash-SLE; Discoid lupus ... Mouth sores. Sensitivity to sunlight. Skin rash: A "butterfly" rash in about half the people with SLE. ...

  20. Trimethoprim-sulfamethoxazole-induced aseptic meningitis.

    PubMed Central

    Wambulwa, Charles; Bwayo, Salome; Laiyemo, Adeyinka O.; Lombardo, Fredric

    2005-01-01

    We present a 46-year-old African-American man with AIDS who was admitted on two different occasions within three weeks for signs and symptoms of meningitis after using trimethoprim/sulfamethoxazole (TMP/SMX). TMP/SMX is primarily used for the treatment of pneumocystis carinii pneumonia prophylaxis in AIDS patients. Drug-induced aseptic meningitis (DIAM) is commonly seen with nonsteroidal anti-inflammatory drugs (NSAIDS), antibiotics (with TMP/SMX being the most frequently implicated), intravenous immunoglobulins and OKT3 antibodies. However, the implication of TMP/SMX inducing aseptic meningitis has been underreported to FDA/MEDWATCH program. This might be due to the fact that it has also been used to treat bacterial meningitis from organisms like Listeria monocytogenes, which is a common pathogen in the elderly and in infants. We reviewed the literature in an attempt to characterize the pattern and predictors of TMP/SMX-induced aseptic meningitis. PMID:16396068

  1. Septic and aseptic arthritis: a continuum?

    PubMed

    Taylor-Robinson, D; Keat, A

    1999-03-01

    This chapter considers the likelihood that a wide spectrum of infection-provoked arthritis exists, ranging from overt sepsis to apparently aseptic chronic arthritis in which very small numbers of causal bacteria can be detected only by using highly sensitive techniques. It asks whether joints are, as conventionally held, normally devoid of micro-organisms and how to judge the significance of bacteria detected within apparently sterile joints. Through a consideration of known septic, probably infective and apparently aseptic forms of arthritis, a set of criteria for attributing causality to putative arthritogenic micro-organisms is proposed. PMID:10952856

  2. Treating Lupus

    MedlinePlus

    ... Awards Investigator Grants, Fellowships and Career Development Awards & Prizes Peer-Reviewed Grant Program LIFELINE Grant Program 2015 ... Postal Code: Spam Control Text: Please leave this field empty Get social Facebook Twitter Instgram Lupus.org ...

  3. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 3 2014-01-01 2014-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  4. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 3 2011-01-01 2011-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  5. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  6. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 3 2012-01-01 2012-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  7. 7 CFR 58.924 - Aseptic filling.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 3 2013-01-01 2013-01-01 false Aseptic filling. 58.924 Section 58.924 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND...

  8. Quantitative risk modeling in aseptic manufacture.

    PubMed

    Tidswell, Edward C; McGarvey, Bernard

    2006-01-01

    Expedient risk assessment of aseptic manufacturing processes offers unique opportunities for improved and sustained assurance of product quality. Contemporary risk assessments applied to aseptic manufacturing processes, however, are commonly handicapped by assumptions and subjectivity, leading to inexactitude. Quantitative risk modeling augmented with Monte Carlo simulations represents a novel, innovative, and more efficient means of risk assessment. This technique relies upon fewer assumptions and removes subjectivity to more swiftly generate an improved, more realistic, quantitative estimate of risk. The fundamental steps and requirements for an assessment of the risk of bioburden ingress into aseptically manufactured products are described. A case study exemplifies how quantitative risk modeling and Monte Carlo simulations achieve a more rapid and improved determination of the risk of bioburden ingress during the aseptic filling of a parenteral product. Although application of quantitative risk modeling is described here purely for the purpose of process improvement, the technique has far wider relevance in the assisted disposition of batches, cleanroom management, and the utilization of real-time data from rapid microbial monitoring technologies. PMID:17089696

  9. [A case of recurrent aseptic meningitis induced by ergot agents].

    PubMed

    Ogawa, Tomoko; Tagawa, Asako; Hashimoto, Ritsuo; Kato, Hiroyuki

    2015-01-01

    We describe the case of a 29-year-old woman with recurrent aseptic meningitis that was caused by ergot agents. She miscarried at age 27, and the uterus constrictor methylergometrine was prescribed. Three days later, she developed aseptic meningitis and was hospitalized. Two years later, she again developed aseptic meningitis the day after she took ergotamine tartrate. In both events, her symptoms improved rapidly when the medication was stopped. The drug-induced lymphocyte stimulation test for methylergometrine yielded a value of 180%. Drug-induced meningitis is a rare form of recurrent aseptic meningitis. Many studies have reported cases of meningitis caused by non-steroidal anti-inflammatory drugs, but many other drugs can induce aseptic meningitis. To the best of our knowledge, this is the first case of aseptic meningitis induced by ergot agents. PMID:26103816

  10. Failure of aseptic revision total knee arthroplasties

    PubMed Central

    Leta, Tesfaye H; Lygre, Stein Håkon L; Skredderstuen, Arne; Hallan, Geir; Furnes, Ove

    2015-01-01

    Background and purpose In Norway, the proportion of revision knee arthroplasties increased from 6.9% in 1994 to 8.5% in 2011. However, there is limited information on the epidemiology and causes of subsequent failure of revision knee arthroplasty. We therefore studied survival rate and determined the modes of failure of aseptic revision total knee arthroplasties. Method This study was based on 1,016 aseptic revision total knee arthroplasties reported to the Norwegian Arthroplasty Register between 1994 and 2011. Revisions done for infections were not included. Kaplan-Meier and Cox regression analyses were used to assess the survival rate and the relative risk of re-revision with all causes of re-revision as endpoint. Results 145 knees failed after revision total knee arthroplasty. Deep infection was the most frequent cause of re-revision (28%), followed by instability (26%), loose tibial component (17%), and pain (10%). The cumulative survival rate for revision total knee arthroplasties was 85% at 5 years, 78% at 10 years, and 71% at 15 years. Revision total knee arthroplasties with exchange of the femoral or tibial component exclusively had a higher risk of re-revision (RR = 1.7) than those with exchange of the whole prosthesis. The risk of re-revision was higher for men (RR = 2.0) and for patients aged less than 60 years (RR = 1.6). Interpretation In terms of implant survival, revision of the whole implant was better than revision of 1 component only. Young age and male sex were risk factors for re-revision. Deep infection was the most frequent cause of failure of revision of aseptic total knee arthroplasties. PMID:25267502

  11. Lupus erythematosus

    SciTech Connect

    Tuffanelli, D.L.

    1981-02-01

    Lupus erythematosus (LE) is a multisystem disease. Genetic predisposition, altered immunity, hormones, drugs, viruses, and ultraviolet light all may play a role in etiology. A wide range of cutaneous lesions occur, and variants such as subacute cutaneous LE, complement-deficient LE, and neonatal LE have recently been emphasized. Management of the LE patient, including appropriate diagnostic studies and therapy relevant to the dermatologist, is discussed in the review.

  12. Neurological Sequelae of Lupus

    MedlinePlus

    ... Page Synonym(s): Lupus - Neurological Sequelae, Systemic Lupus Erythematosus Table of Contents (click to jump to sections) What ... health problems and have a normal lifespan with periodic doctor visits and treatments with various drugs. What ...

  13. Living Well with Lupus

    MedlinePlus

    ... Awards Investigator Grants, Fellowships and Career Development Awards & Prizes Peer-Reviewed Grant Program LIFELINE Grant Program 2015 ... following a specific diet or nutrition plan for my lupus? How do I explain lupus to others? ...

  14. What Is Lupus?

    MedlinePlus

    ... better about themselves Remain more active. Pregnancy and Contraception for Women With Lupus Women with lupus can ... harmful to an unborn baby may want reliable birth control. Recent studies have shown that oral contraceptives (birth ...

  15. Target Awareness: Lupus

    MedlinePlus Videos and Cool Tools

    ... 15 Questions - Spotlight on Clinical Trials 15 Questions - Kidney Issues and Lupus 15 Questions – Pulmonary Issues and ... 15 Questions - Strategies for Restful Sleep 15 Questions - Kidney Issues with Lupus 15 Questions - Cardiovascular Issues with ...

  16. Cutaneous manifestations of lupus erythematosus.

    PubMed

    Laman, S D; Provost, T T

    1994-02-01

    Lupus erythematosus is an autoimmune disease that demonstrates cutaneous, systemic, or both cutaneous and systemic manifestations. This article reviews the cutaneous manifestations of lupus erythematosus. PMID:8153399

  17. Revision after early aseptic failures in primary total knee arthroplasty.

    PubMed

    Piedade, Sérgio Rocha; Pinaroli, Alban; Servien, Elvire; Neyret, Philippe

    2009-03-01

    The purpose of this study was to evaluate cases of early aseptic failures presented during the first 5-year follow-up in a group of 981 primary total knee arthroplasty (primary TKA). Predisposing factors as well causes of failures and postoperative complications in different groups of aseptic failures were re-assessed and compared to a control group. A retrospective and cohort study compared one group of 944 primary TKA without surgical revision (890 patients) (Group A) with 22 primary TKA (22 patients) (Group B) that had revision TKA secondary to aseptic failure during the first five years follow-up. The cases of isolated patellar button replacement (n = 8) and infection (n = 7) were not considered in this study. All patients underwent a systematic assessment that included clinical and radiographic examinations, and IKS scores. Aseptic failure was more prevalent at the first 2-year follow-up (63%). TKA loosening (n = 11) and undiagnosed pain (n = 7) were considered the most frequent modes of failures, and laxity (n = 1) was a very rare early cause of failure. The aseptic failure group was characterized as average 5 years younger with a greater number of previous knee surgeries, lower IKS scores improvement, and more postoperative pain compared to control group, despite the fact that the aseptic failure group showed a prevalence of cases during the first 2-year follow-up. Inside this group, the undiagnosed pain group had lower improvement of IKS scores, a remarkable prevalence in prior surgical procedure (71%) and a minor mean interval between primary and revision TKA (11.6 months). PMID:19082578

  18. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    SciTech Connect

    Doenmez, Halil Mavili, Ertugrul Ikizceli, Tuerkan; Durak, Ahmet Candan; Kurtsoy, Ali

    2009-07-15

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  19. Ibuprofen-induced aseptic meningoencephalitis confirmed by drug challenge.

    PubMed

    Moreno-Ancillo, A; Gil-Adrados, A C; Jurado-Palomo, J

    2011-01-01

    Drug-induced aseptic meningitis (DIAM) is a diagnostic challenge. The major causative agents are nonsteroidal anti-inflammatory drugs (particularly ibuprofen), antibiotics, intravenous immunoglobulin, and OKT3 monoclonal antibodies. DIAM is more frequently observed in patients with autoimmune diseases. A 36-year-old woman was attended in our department 3 months after being diagnosed with aseptic meningoencephalitis. She had had 2 episodes in 9 months. Neurological symptoms were associated with ibuprofen. A challenge with acetylsalicylic acid was negative, whereas a drug challenge with ibuprofen was positive. Thirty minutes after ingesting 50 mg of ibuprofen, she experienced general malaise and progressively developed chills, fever (39.5 degrees C), headache, and nuchal rigidity. Lumbar puncture showed normal glucose and high protein levels. Neutrophilic pleocytosis was observed at the first admission; lymphocytosis was predominant in the second and third episodes. DIAM is a rare and severe hypersensitivity reaction. Drug challenge enabled us to make an accurate diagnosis. PMID:21995183

  20. Lupus and Your Body

    MedlinePlus

    ... Recipients 2014 LIFELINE Grant Program™ Recipients Lupus Insight Prize Evelyn V. Hess, MD, MACP, MACR, Award About ... V. Hess Mary Betty Stevens, MD, Young Investigator Prize About Dr. Mary Betty Stevens Career Development Award ...

  1. Lupus Foundation of America

    MedlinePlus

    ... Lupus Q&A with Sheri R. Abrams - Social Security and Disability Q&A with Dr. Betsy Blazek- ... Life Insurance Employment, Disability and Legal Issues Social Security Disability Applying for Social Security Disability Work Related ...

  2. Systemic lupus erythematosus.

    PubMed

    Samuelson, S J; Friedlander, A H; Swerdloff, M

    1980-04-01

    A case of osteomyelitis of the mandible in a patient with systemic lupus erythematosus is described. Both the disease process and the treatment modalities must be understood for correct management. PMID:6928895

  3. Lupus and pregnancy.

    PubMed

    Baer, Alan N; Witter, Frank R; Petri, Michelle

    2011-10-01

    Systemic lupus erythematosus (SLE) disproportionately affects women in their reproductive age years. Pregnancy in this systemic autoimmune disease has long been associated with poor obstetric outcomes. However, the frequency of pregnancy loss in lupus has dropped to a level commensurate with that of the general US population. The outcomes of lupus pregnancies are better if conception is delayed until the disease has been inactive for at least 6 months, and the medication regimen has been adjusted in advance. Pregnancy in lupus is prone to complications, including flares of disease activity during pregnancy or in the postpartum period, preeclampsia, miscarriage, stillbirth, intrauterine growth retardation, and preterm birth. Active lupus nephritis poses the greatest risk. The recognition of a lupus flare during pregnancy may be difficult because the signs and symptoms may mimic those of normal pregnancy. Monitoring should include baseline and monthly laboratory tests, serial ultrasonography, fetal surveillance tests, and fetal m-mode echocardiography for mothers with SS-A (Ro) or SS-B (La) antibodies. In the absence of any signs or symptoms of active SLE, affected patients require no specific treatment during pregnancy. If hydroxychloroquine was in use before conception, it should be maintained throughout pregnancy. If a woman with SLE has antiphospholipid antibodies, prophylactic treatment with aspirin and/or low-molecular weight heparin is indicated to prevent fetal loss. Lupus flares during pregnancy are generally treated with hydroxychloroquine, low-dose prednisone, pulse intravenous methylprednisolone, and azathioprine. High-dose prednisone and cyclophosphamide are reserved for severe lupus complications but are associated with significant pregnancy-related complications and poor obstetrical outcomes. PMID:22112525

  4. [Genetics of lupus erythematosus].

    PubMed

    Günther, Claudia

    2015-02-01

    Lupus erythematosus is a prototypic autoimmune disease that can be triggered in genetically predisposed individuals by environmental exposures. The disease is based on an uncontrolled activation of the immune system that recognizes self antigens and induces inflammatory disease flares. The multifactorial pathogenesis is based on a polygenic model of inheritance with multiple various susceptibility genes elevating the disease risk. Many of these polymorphisms have been recently identified by genome-wide association studies. Monogenic forms of lupus erythematosus are rare. The identification of their underlying pathogenesis is important for the recognition of main mechanistic pathways in lupus as demonstrated by the history of defects in the complement system. The monogenic, autosomal dominant inherited familial chilblain lupus is characterized by cold-induced infiltrates on acral locations occurring in early childhood. Molecular exploration of the disease pathogenesis revealed that autoimmunity and especially lupus erythematosus can be induced by defects in intracellular elimination of nucleic acids and the subsequent type I-IFN-dependent activation of the innate immune system. This mechanism extends the concept of lupus pathogenesis: both defects in the extra- and intracellular elimination of autoantigens can lead to activation of the innate and adaptive immune system. PMID:25659384

  5. Lupus anticoagulants and antiphospholipid antibodies

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/000547.htm Lupus anticoagulants and antiphospholipid antibodies To use the sharing features on this page, please enable JavaScript. Lupus anticoagulants are antibodies against substances in the lining ...

  6. Lupus Therapies Continue to Evolve

    MedlinePlus

    ... common form, called systemic lupus erythematosus, commonly causes mouth sores, rash, fatigue, joint pain and swelling, as well ... symptoms such as fatigue, rashes, joint pain or mouth sores. Part of what makes lupus research such a ...

  7. [Aseptic bone flap osteonecrosis following cranioplasty after decompressive cranietomy].

    PubMed

    Smoll, Nicolas R; Stienen, Martin N; Schaller, Karl; Gautschi, Oliver P

    2013-06-19

    This case report discusses a case of aseptic osteonecrosis in a cranioplasty bone flap after decompressive craniectomy, which is a known, but rare complication after autologous cranioplasty. We suggest that the pathophysiology of cranial bone flap necrosis may have a similar pathophysiology to free flap necrosis/failure. The key suggested problem causing the osteonecrosis is vessel thrombosis within the smaller vessels of the bone flap due to the prothrombotic effects of the factors released during drilling of the bone flap. Suspicious local findings like wound dehiscence or fluid leakage should lead to a head computed tomography in order to discuss a prophylactic artificial second cranioplasty if necessary. PMID:23773942

  8. [Aseptic osteonecrosis of alcoholic origin: a case report].

    PubMed

    Jissendi Tchofo, P; Brasseur, P

    2001-06-01

    Alcohol-induced aseptic osteonecrosis is not infrequent but multifocal osseous destruction is very rare. Alcoholic patients often present lipidic metabolism perturbation with fat embolism and are susceptible to develop diffuse intravascular coagulation in terminal microcirculation of femoral and humeral heads. The authors report one case of multifocal alcohol-induced osteonecrosis in a 74 year-woman. She presented with bilateral osteonecrosis of the humeral heads and total osteolysis of the neck and the head of the hips. Hepatic cirrhosis and chronic pancreatitis were additional risk factors inducing intra-osseous thrombosis. PMID:11488085

  9. The pathobiology and pathology of aseptic implant failure

    PubMed Central

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  10. The pathobiology and pathology of aseptic implant failure.

    PubMed

    Athanasou, N A

    2016-05-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles.Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162-168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  11. Performance analysis of exam gloves used for aseptic rodent surgery.

    PubMed

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-05-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  12. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-01-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  13. Genetics Home Reference: systemic lupus erythematosus

    MedlinePlus

    ... Genetics Home Health Conditions systemic lupus erythematosus systemic lupus erythematosus Enable Javascript to view the expand/collapse ... Download PDF Open All Close All Description Systemic lupus erythematosus (SLE) is a chronic disease that causes ...

  14. S.L.E. Lupus Foundation

    MedlinePlus

    ... Strategies for Speaking with Your Lupus Doctor Traveling Smart with Lupus 21st Century Cures A Year’s Worth ... Kickoff 2009 Camp Sunshine 2009 ING New York City Marathon 2009 Life Without Lupus® Gala 2010 Camp ...

  15. Ectopic Axillary Breast during Systemic Lupus

    PubMed Central

    Ben Dhaou, Besma; Boussema, Fatma; Aydi, Zohra; Baili, Lilia; Rokbani, Lilia

    2012-01-01

    Many breast changes may occur in systemic lupus erythematosus. We report a 41-year-old woman with lupus who presented three years after the onset of lupus an ectopic mammary gland confirmed by histological study. PMID:22924044

  16. Lupus nephritis: an update.

    PubMed

    Imran, Tasnim F; Yick, Frederick; Verma, Suneet; Estiverne, Christopher; Ogbonnaya-Odor, Chinonye; Thiruvarudsothy, Srikanth; Reddi, Alluru S; Kothari, Neil

    2016-02-01

    Lupus nephritis (LN) is an inflammatory condition of the kidneys that encompasses various patterns of renal disease including glomerular and tubulointerstitial pathology. It is a major predictor of poor prognosis in patients with systemic lupus erythematosus (SLE). Genetic factors, including several predisposing loci, and environmental factors, such as EBV and ultraviolet light, have been implicated in the pathogenesis. It carries a high morbidity and mortality if left untreated. Renal biopsy findings are utilized to guide treatment. Optimizing risk factors such as proteinuria and hypertension with renin-angiotensin receptor blockade is crucial. Immunosuppressive therapy is recommended for patients with focal or diffuse proliferative lupus nephritis (Class III or IV) disease, and certain patients with membranous LN (Class V) disease. Over the past decade, immunosuppressive therapies have significantly improved long-term outcomes, but the optimal therapy for LN remains to be elucidated. Cyclophosphamide-based regimens, given concomitantly with corticosteroids, have improved survival significantly. Even though many patients achieve remission, the risk of relapse remains considerably high. Other treatments include hydroxychloroquine, mycofenolate mofetil, and biologic therapies such as Belimumab, Rituximab, and Abatacept. In this paper, we provide a review of LN, including pathogenesis, classification, and clinical manifestations. We will focus, though, on discussion of the established as well as emerging therapies for patients with proliferative and membranous lupus nephritis. PMID:26471017

  17. Dehydroepiandrosterone in systemic lupus erythematosus

    PubMed Central

    Sawalha, Amr H; Kovats, Susan

    2009-01-01

    Dehydroepiandrosterone (DHEA) is a weak androgen that exerts pleomorphic effects on the immune system. The hormone has no known receptor, and consequently, the mechanism of action of DHEA on immunocompetent cells remains poorly understood. Interestingly, serum levels of DHEA are decreased in patients with inflammatory disease including lupus, and these levels seem to inversely correlate with disease activity. Following encouraging studies demonstrating beneficial effects of DHEA supplementation in murine lupus models, a number of clinical studies have tested the effect of DHEA administration in lupus patients. DHEA treatment could improve patient’s overall quality of life assessment measures and glucocorticoid requirements in some lupus patients with mild to moderate disease, however, the effect of DHEA on disease activity in lupus patients remains controversial. Long term safety assessment studies are required in light of the reported effect of DHEA supplementation in lowering HDL cholesterol in lupus patients. PMID:18662508

  18. Doxycycline inhibits bone resorption by human interface membrane cells from aseptically loose hip replacements.

    PubMed

    Ong, S M; Taylor, G J S

    2003-04-01

    Matrix metalloproteinases (MMPs) may have a role in the process of aseptic loosening. Doxycycline has been shown to inhibit MMPs. Our aim was to investigate the potential pharmacological effect of doxycycline on aseptic loosening. We used radiolabelled mouse calvariae cultured with human interface membrane cells from aseptically loosened hips. Bone resorption was confirmed in this model. The effect of doxycycline was assessed by culturing dead radiolabelled bone discs with cells from the interface membrane with doxycycline. The control group consisted of the same culture system without doxycycline. Supernatant 45calcium and the total 45calcium remaining in the bone discs at the completion of the culture were used to measure osteolysis. We found that doxycycline can inhibit osteolysis at the interface membrane of aseptically loosened hips. This may have therapeutic implications for the treatment of patients with aseptic loosening of total joint replacements. PMID:12729128

  19. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  20. A pituitary abscess masquerading as recurrent hypernatremia and aseptic meningitis.

    PubMed

    Gonzales, Michael; Marik, Paul Ellis; Khardori, Romesh K; O'Brian, John T

    2012-01-01

    Pituitary abscess is a rare condition. In the setting of multiple surgical interventions, the risk of its development increases. A 49-year-old man presented with episodes of altered mental status. He had two surgeries for a recurrent suprasellar arachnoid cyst. The second surgery was complicated by a persistent cerebrospinal fluid (CSF) leak that required two repairs following which he developed panhypopituitarism and central diabetes insipidus. Twelve months after his last surgery he was diagnosed with aseptic meningitis. This was followed by recurrent hospitalisations for severe hypernatremia blamed on poor medication compliance. He was subsequently hospitalised for the evaluation of a febrile illness. Brain MRI showed ventriculitis and enhancement of the sella. Exploratory surgery revealed a purulent collection in the sella and a mucosal graft which had been used to repair the CSF leak. After drainage of pus and replacement of the graft he recovered completely but requiring life-long hormonal replacement. PMID:22751424

  1. A pituitary abscess masquerading as recurrent hypernatremia and aseptic meningitis

    PubMed Central

    Gonzales, Michael; Marik, Paul Ellis; Khardori, Romesh K; O'Brian, John T

    2012-01-01

    Pituitary abscess is a rare condition. In the setting of multiple surgical interventions, the risk of its development increases. A 49-year-old man presented with episodes of altered mental status. He had two surgeries for a recurrent suprasellar arachnoid cyst. The second surgery was complicated by a persistent cerebrospinal fluid (CSF) leak that required two repairs following which he developed panhypopituitarism and central diabetes insipidus. Twelve months after his last surgery he was diagnosed with aseptic meningitis. This was followed by recurrent hospitalisations for severe hypernatremia blamed on poor medication compliance. He was subsequently hospitalised for the evaluation of a febrile illness. Brain MRI showed ventriculitis and enhancement of the sella. Exploratory surgery revealed a purulent collection in the sella and a mucosal graft which had been used to repair the CSF leak. After drainage of pus and replacement of the graft he recovered completely but requiring life-long hormonal replacement. PMID:22751424

  2. Aseptic laboratory techniques: volume transfers with serological pipettes and micropipettors.

    PubMed

    Sanders, Erin R

    2012-01-01

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: ·Work within the sterile field created by the Bunsen burner flame. ·Use serological pipettes without compromising instrument sterility. ·Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. ·Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. ·Identify different applications for plastic versus glass serological pipettes. ·State accuracy limitations for micropipettors.

  3. Cutaneous Lupus Erythematosus: Diagnosis and treatment

    PubMed Central

    Okon, Lauren G.; Werth, Victoria P.

    2013-01-01

    Cutaneous lupus erythematosus encompasses a wide range of dermatologic manifestations, which may or may not be associated with the development of systemic disease. Cutaneous lupus is divided into several subtypes, including acute cutaneous lupus erythematosus, subacute cutaneous lupus erythematosus, and chronic cutaneous lupus erythematosus. Chronic cutaneous lupus erythematosus includes discoid lupus erythematosus, lupus erythematosus profundus, chilblain cutaneous lupus, and lupus tumidus. Diagnosis of these diseases requires proper classification of the subtype, through a combination of physical exam, laboratory studies, histology, antibody serology, and occasionally direct immunofluorescence, while ensuring to exclude systemic disease. Treatment of cutaneous lupus consists of patient education on proper sun protection along with appropriate topical and systemic agents. Systemic agents are indicated in cases of widespread, scarring, or treatment-refractory disease. In this review, we discuss issues in classification and diagnosis of the various subtypes of CLE, as well as provide an update on therapeutic management. PMID:24238695

  4. Apoptosis in chronic cutaneous lupus erythematosus, discoid lupus, and lupus profundus

    PubMed Central

    Sáenz-Corral, Claudia Ileana; Vega-Memíje, María Elisa; Martínez-Luna, Eduwiges; Cuevas-González, Juan Carlos; Rodríguez-Carreón, Alma Angélica; de la Rosa, Juan José Bollain-y-Goytia; del Muro, Felipe de Jesús Torres; Avalos-Díaz, Esperanza

    2015-01-01

    Introduction: Lupus erythematosus is a multisystemic disease that is characterized by autoantibody production and immune complex deposition in such tissues as the mucosa, joints, the central nervous system, and skin. Cutaneous lupus erythematosus is categorized as acute, subacute, and chronic. Chronic cutaneous lupus erythematosus comprises discoid lupus erythematosus (DLE) and lupus profundus (LP). Aim: To analyze the expression of proapoptotic molecules in patients with lupus erythematosus discoid and lupus profundus. Material and methods: Descriptive study, the study groups comprised 10 cases of LP and 10 cases of DLE, and a control. Skin samples of cases and controls were processed for immunohistochemistry and by TUNEL technique. The database and statistical analysis was performed (statistical test X2) SPSS (Chicago, IL, USA). Results: Apoptotic features were broadly distributed along the skin biopsies in epidermal keratinocytes as well as at dermis. By immunohistochemistry the expression of Fas receptor and Fas-L was higher in the skin of lupus patients compared with controls. We also noted differences in Fas-L, -Fas, and -Bax proteins expression intensity in discoid lupus erythematosus patients in the epidermis, and hair follicles. Conclusions: Fas and Fas-L are expressed similarly in LP and DLE. PMID:26261624

  5. Comparison of Aseptic Compounding Errors Before and After Modified Laboratory and Introductory Pharmacy Practice Experiences

    PubMed Central

    Owora, Arthur H.; Kirkpatrick, Alice E.

    2015-01-01

    Objective. To determine whether aseptic compounding errors were reduced at the end of the third professional year after modifying pharmacy practice laboratories and implementing an institutional introductory pharmacy practice experience (IPPE). Design. An aseptic compounding laboratory, previously occurring during the third-year spring semester, was added to the second-year spring semester. An 80-hour institutional IPPE was also added in the summer between the second and third years. Instructors recorded aseptic compounding errors using a grading checklist for second-year and third-year student assessments. Third-year student aseptic compounding errors were assessed prior to the curricular changes and for 2 subsequent years for students on the Oklahoma City and Tulsa campuses of the University of Oklahoma. Assessment. Both third-year cohorts committed fewer aseptic technique errors than they did during their second years, and the probability was significantly lower for students on the Oklahoma City campus. The probability of committing major aseptic technique errors was significantly lower for 2 consecutive third-year cohorts after the curricular changes. Conclusion. The addition of second-year aseptic compounding laboratory experiences and third-year institutional IPPE content reduced instructor-assessed errors at the end of the third year. PMID:26889070

  6. THE CAROLINA LUPUS STUDY (CLU)

    EPA Science Inventory

    Carolina Lupus (CLU) Study, an epidemiologic study of risk factors for systemic lupus erythematosus (SLE). SLE is a severe, chronic, systemic autoimmune disease that disproportionately affects women and African-Americans. The CLU Study focuses on measures of endogenous hormone ex...

  7. Lupus - the cold, hard facts.

    PubMed

    Wong, N W K; Ng, Vt-Y; Ibrahim, S; Slessarev, M; Chandran, V

    2014-07-01

    Systemic lupus erythematosus (SLE) is a multisystem chronic disease with a multitude of clinical presentations. We review and synthesize how an environmental insult (exposure to extreme cold for a short duration) and endogenous (antiphospholipid antibody syndrome, SLE vasculitis) insults in a susceptible young female with lupus (peripheral arterial disease, smoking, SLE) led to a perfect storm resulting in catastrophic injuries (frostbite). PMID:24699313

  8. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... for the Agency's current good manufacturing practice regulations for PET drugs. DATES: Although you... answers written specifically to help manufacturers comply with the Agency's current good manufacturing... media fill is the performance of an aseptic manufacturing procedure using a sterile...

  9. Prognostic factors in lupus nephritis.

    PubMed

    Mok, C C

    2005-01-01

    Systemic lupus erythematosus (SLE) is a heterogeneous disorder and its renal manifestations are protean. The course and prognosis of lupus nephritis is dependent on a large number of demographic, histopathological, serological, racial, socioeconomic and time dependent factors. Moreover, the initial and maintenance therapeutic regimens may also influence the long term renal outcome. This article reviews the important prognostic factors that have been reported in literature. The management strategy of lupus nephritis should be individualized and based on a composite of these parameters. PMID:15732286

  10. Beyond Apoptosis in Lupus

    PubMed Central

    Colonna, Lucrezia; Lood, Christian; Elkon, Keith B.

    2014-01-01

    Purpose of review Systemic lupus erythematosus (SLE) is characterized by autoantibodies directed against nuclear autoantigens normally concealed from immune recognition in healthy individuals. Here we summarize recently identified mechanisms of abnormal cell death leading to exposure and aberrant processing of nucleoprotein self antigens, and discuss their role in the SLE pathogenesis. Recent findings During the past few years, the unveiling of several new forms of cell death has expanded our understanding beyond the simple view of “apoptotic” versus “necrotic” cell death. SLE patients show abnormalities in cell death at several levels, including increased rates of apoptosis, necrosis, and autophagy, as well as reduced clearance of dying cells. These abnormalities lead to an increased autoantigen burden and also antigen modifications, such as nucleic acid oxidation that increase the inflammatory properties of self antigens. Recent investigations have highlighted the role of opsonins in determining the immunogenic versus tolerogenic characteristics of self antigens. Summary Dysregulation of different forms of programmed cell death contributes to increased exposure, availability, and immunogenic characteristic of intracellular self antigens, which all participate in development of lupus autoimmunity. As our understanding of abnormalities of cell death in SLE advances, potential therapeutic opportunities await human implementation. PMID:25036095

  11. Total hip arthroplasty for failed aseptic Austin Moore prosthesis

    PubMed Central

    Bhosale, Pradeep; Suryawanshi, Ashish; Mittal, Amber

    2012-01-01

    Background: Though Austin Moore (AM) replacement prosthesis has fairly good short term results for intracapsular femoral neck fractures in the elderly, it still is a compromised option and has a high failure rate in the long run. The objective of the present retrospective study is to analyze the functional outcome, assess survivorship of revision total hip arthroplasty (THA) at mid to long term followup, and evaluate intraoperative difficulties faced during conversion of failed aseptic AM prosthesis to cemented THA. Materials and Methods: Eighty-nine cemented THA surgeries for failed AM prosthesis were performed between 1986 and 2005. AM failures were classified into seven groups on the basis of mode of failure. Infected failures were excluded from the study. There were 35 men and 54 women in the study group. The mean age was 68 years (range 57–91 years). Mean followup was 8 years (range 5–13 years). Results: Average Harris Hip Score improved from 65 preoperatively (range 42–73) to 87 (range 76–90) at 1 year postoperatively and to 86 (range 75–89) at the last followup. The overall complication rate was 4.5%. Conclusion: Conversion THA is an excellent treatment strategy for symptomatic failed AM hemiarthroplasty in terms of pain relief and restoration of function and mobility as near as possible to the preinjury level. Also, hemiarthroplasty should not be used in physically active patients, even in elderly individuals. Careful patient selection for hemiarthroplasty versus THA is vital and may decrease the incidence of complications and ameliorate the outcomes in the treatment of intracapsular femoral neck fractures. PMID:22719116

  12. Transient Life-Threatening Cerebral Edema in a Patient with Systemic Lupus Erythematosus

    PubMed Central

    Bianchi, Matt T.; Lavigne, Catherine; Sorond, Farzaneh; Bermas, Bonnie

    2015-01-01

    Central nervous system symptoms occur in a substantial portion of patients with systemic lupus erythematosus. However, coma is a rare presentation and is usually secondary to complications such as subarachnoid hemorrhage, seizure, or ischemia. Here, we present a 49-year-old woman with lupus erythematosus and a history of recurrent aseptic meningitis and mild subarachnoid hemorrhage who presented with altered mental status and lethargy that progressed rapidly over hours to the herniation syndrome of coma, extensor posturing, and unilateral pupillary dilation. Spinal fluid showed massive protein elevation (>1600), and head computed tomography revealed global cerebral edema. The clinical and radiologic findings rapidly reversed with intravenous corticosteroids and mannitol within 24 hours, and her mental status improved to baseline. Her course was complicated by 2 episodes of recurrent encephalopathy when corticosteroids were tapered; these resolved after resuming high dosing. Because of ongoing pancytopenia, chemotherapy immunosuppression was delayed, and instead she received intravenous immunoglobulin with improvement in the pancytopenia. She remained cognitively intact during subsequent corticosteroid tapering. Rapid development of coma in lupus patients may be due to a primary process of the disease impacting blood brain barrier integrity. Although rare, this potentially fatal complication may be reversible with acute corticosteroid administration. PMID:19455059

  13. Lupus Erythematosus Panniculitis in Pregnancy

    PubMed Central

    Gondane, Swati; Kothiwala, Rajkumar; Dangi, Sapna; Meherda, Ashok

    2015-01-01

    A case of lupus erythematosus (LE) panniculitis in pregnancy without any lesions of discoid LE or systemic LE is being reported. There were no systemic symptoms. Her ANA, anti-dsDNA, anti-Ro/SSA, and anti-La/SSB antibodies were within normal limits. Diagnosis of lupus panniculitis was considered on clinical and histopathological grounds. The condition responded favorably to systemic steroid therapy. PMID:26677307

  14. IL-10 regulates murine lupus.

    PubMed

    Yin, Zhinan; Bahtiyar, Gul; Zhang, Na; Liu, Lanzhen; Zhu, Ping; Robert, Marie E; McNiff, Jennifer; Madaio, Michael P; Craft, Joe

    2002-08-15

    MRL/MpJ-Tnfrsf6(lpr) (MRL/MpJ-Fas(lpr); MRL-Fas(lpr)) mice develop a spontaneous lupus syndrome closely resembling human systemic lupus erythematosus. To define the role of IL-10 in the regulation of murine lupus, IL-10 gene-deficient (IL-10(-/-)) MRL-Fas(lpr) (MRL-Fas(lpr) IL-10(-/-)) mice were generated and their disease phenotype was compared with littermates with one or two copies of an intact IL-10 locus (MRL-Fas(lpr) IL-10(+/-) and MRL-Fas(lpr) IL-10(+/+) mice, respectively). MRL-Fas(lpr) IL-10(-/-) mice developed severe lupus, with earlier appearance of skin lesions, increased lymphadenopathy, more severe glomerulonephritis, and higher mortality than their IL-10-intact littermate controls. The increased severity of lupus in MRL-Fas(lpr) IL-10(-/-) mice was closely associated with enhanced IFN-gamma production by both CD4(+) and CD8(+) cells and increased serum concentration of IgG2a anti-dsDNA autoantibodies. The protective effect of IL-10 in this lupus model was further supported by the observation that administration of rIL-10 reduced IgG2a anti-dsDNA autoantibody production in wild-type MRL-Fas(lpr) animals. In summary, our results provide evidence that IL-10 can down-modulate murine lupus through inhibition of pathogenic Th1 cytokine responses. Modulation of the level of IL-10 may be of potential therapeutic benefit for human lupus. PMID:12165544

  15. Epratuzumab for systemic lupus erythematosus.

    PubMed

    Wallace, D J; Goldenberg, D M

    2013-04-01

    Epratuzumab (EMab, UCB, Immunomedics) is a humanized monoclonal antibody targeting CD22 that is being studied in clinical trials for patients with a variety of rheumatic and hematologic conditions, including systemic lupus erythematosus (SLE). An overview of its mechanism of action is followed by a summary of completed lupus studies, and a preview of studies in progress. The agent clearly has anti-inflammatory activity and is a potentially useful agent in the management of autoimmune disorders. PMID:23553783

  16. Early Cutaneous Lupus Erythematosus

    PubMed Central

    Sams, Wiley M.

    1966-01-01

    Cutaneous disorders which manifest themselves on the exposed parts are more likely than are hidden lesions to cause the patient to seek professional services promptly. Usually he consults his family physician or the community dermatologist. The physician who first sees the patient is dependent upon his own resources for management and diagnosis. A background of experience, a measure of energy and an inquisitive attitude are the necessary ingredients for successful management. The difficulties involved in differentiating early lupus erythematosus and polymorphic light eruptions cannot be invariably resolved even with the most complete review. The course of the disorder and the response to environmental factors supply important clues. Investigative work, especially in the field of immunology, offers hope for the solution of some of our problems. PMID:5909872

  17. Haematological manifestations of lupus

    PubMed Central

    Fayyaz, Anum; Igoe, Ann; Kurien, Biji T; Danda, Debashish; James, Judith A; Stafford, Haraldine A; Scofield, R Hal

    2015-01-01

    Our purpose was to compile information on the haematological manifestations of systemic lupus erythematosus (SLE), namely leucopenia, lymphopenia, thrombocytopenia, autoimmune haemolytic anaemia (AIHA), thrombotic thrombocytopenic purpura (TTP) and myelofibrosis. During our search of the English-language MEDLINE sources, we did not place a date-of-publication constraint. Hence, we have reviewed previous as well as most recent studies with the subject heading SLE in combination with each manifestation. Neutropenia can lead to morbidity and mortality from increased susceptibility to infection. Severe neutropenia can be successfully treated with granulocyte colony-stimulating factor. While related to disease activity, there is no specific therapy for lymphopenia. Severe lymphopenia may require the use of prophylactic therapy to prevent select opportunistic infections. Isolated idiopathic thrombocytopenic purpura maybe the first manifestation of SLE by months or even years. Some manifestations of lupus occur more frequently in association with low platelet count in these patients, for example, neuropsychiatric manifestation, haemolytic anaemia, the antiphospholipid syndrome and renal disease. Thrombocytopenia can be regarded as an important prognostic indicator of survival in patients with SLE. Medical, surgical and biological treatment modalities are reviewed for this manifestation. First-line therapy remains glucocorticoids. Through our review, we conclude glucocorticoids do produce a response in majority of patients initially, but sustained response to therapy is unlikely. Glucocorticoids are used as first-line therapy in patients with SLE with AIHA, but there is no conclusive evidence to guide second-line therapy. Rituximab is promising in refractory and non-responding AIHA. TTP is not recognised as a criteria for classification of SLE, but there is a considerable overlap between the presenting features of TTP and SLE, and a few patients with SLE have concurrent

  18. Lupus, discoid on a child's face (image)

    MedlinePlus

    The round or disk shaped (discoid) rash of lupus produces red, raised patches with scales. The pores ( ... The majority (approximately 90%) of individuals with discoid lupus have only skin involvement as compared to more ...

  19. How Does Lupus Affect the Blood?

    MedlinePlus

    ... Awards Investigator Grants, Fellowships and Career Development Awards & Prizes Peer-Reviewed Grant Program LIFELINE Grant Program 2015 ... common symptoms of lupus? How can I manage my fatigue? How is lupus diagnosed? What is photosensitivity? ...

  20. Occult Infection in Aseptic Joint Loosening and the Diagnostic Role of Implant Sonication

    PubMed Central

    Kempthorne, J. T.; Ailabouni, R.; Raniga, S.; Hammer, D.; Hooper, G.

    2015-01-01

    Our aim was to determine the incidence of occult infection and to examine the role of ultrasound sonication of the implants in cases of presumed aseptic loosening in a prospective trial. Joint swabs, aspirates, and deep tissue samples were obtained from around the prosthesis for routine microbiology. Each prosthesis was sonicated and the sonicate examined with Gram staining and extended cultures. There were 106 joints in the study of which 54 were revised for aseptic loosening and 52 were assigned to the control revision group. There were 9 positive cultures with 8/54 positive cultures in the aseptic loosening group and 1/52 in the control revision group (p = 0.017, associated OR 47.7). We found concordant results between sonication fluid culture and conventional samples in 5/9 cultures. Preoperative inflammatory markers were not prognostic for infection. Coagulase-negative Staphylococcus was the most commonly cultured organism (7/9). Previously unrecognised infection was present in 15% of patients undergoing revision for aseptic loosening. Ultrasound sonication of the removed prosthesis was less sensitive than conventional sampling techniques. We recommend routine intraoperative sampling for patients having revision for aseptic loosening, but we do not support the routine use of ultrasound sonication for its detection. PMID:26583149

  1. District nurses' and aseptic technique: where did it all go wrong?

    PubMed

    Unsworth, John

    2011-01-01

    Concerns have been raised about whether it is possible to perform aseptic procedures within a community setting. Hallett (2000) has described how community nurses often have a fatalistic view about whether such procedures can really be performed at home. At the same time there has been an increase in the number of patients being cared for at home who need interventions which must adhere to the principles of asepsis. While it has been acknowledged for some time that community nurses must be resourceful and adapt the procedure, the view that community nurses cannot really perform aseptic procedures is a fairly new phenomenon. This article explores the reasons why concerns about the performance of aseptic procedures in the community may have arisen and what steps can be taken to address these concerns to ensure that care at home is both safe and effective. PMID:21278647

  2. Lupus nephritis management guidelines compared.

    PubMed

    Wilhelmus, Suzanne; Bajema, Ingeborg M; Bertsias, George K; Boumpas, Dimitrios T; Gordon, Caroline; Lightstone, Liz; Tesar, Vladimir; Jayne, David R

    2016-06-01

    In the past years, many (randomized) trials have been performed comparing the treatment strategies for lupus nephritis. In 2012, these data were incorporated in six different guidelines for treating lupus nephritis. These guidelines are European, American and internationally based, with one separate guideline for children. They offer information on different aspects of the management of lupus nephritis including induction and maintenance treatment of the different histological classes, adjunctive treatment, monitoring of the patient, definitions of response and relapse, indications for (repeat) renal biopsy, and additional challenges such as the presence of vascular complications, the pregnant SLE patient, treatment in children and adolescents and considerations about end-stage renal disease and transplantation. In this review, we summarize the guidelines, determine the common ground between them, highlight the differences and discuss recent literature. PMID:25920920

  3. Pro: Cyclophosphamide in lupus nephritis.

    PubMed

    Kallenberg, Cees G M

    2016-07-01

    Based on efficacy and toxicity considerations, both low-dose pulse cyclophosphamide as part of the Euro-Lupus Nephritis protocol and mycophenolate mofetil (MMF) with corticosteroids may be considered for induction of remission in patients with proliferative lupus nephritis. The long-term follow-up data available for low-dose pulse cyclophosphamide, the fact that compliance is guaranteed with this regimen and economic issues all favour the Euro-Lupus regimen in this author's opinion. For maintenance treatment, either azathioprine (AZA) or MMF may be used; AZA is preferred in case pregnancy is planned, while MMF is preferred when the disease relapses during use of AZA and, possibly, after successful induction of remission with MMF. PMID:27190359

  4. Systemic lupus erythematosus.

    PubMed

    Kaul, Arvind; Gordon, Caroline; Crow, Mary K; Touma, Zahi; Urowitz, Murray B; van Vollenhoven, Ronald; Ruiz-Irastorza, Guillermo; Hughes, Graham

    2016-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease that can affect many organs, including the skin, joints, the central nervous system and the kidneys. Women of childbearing age and certain racial groups are typically predisposed to developing the condition. Rare, inherited, single-gene complement deficiencies are strongly associated with SLE, but the disease is inherited in a polygenic manner in most patients. Genetic interactions with environmental factors, particularly UV light exposure, Epstein-Barr virus infection and hormonal factors, might initiate the disease, resulting in immune dysregulation at the level of cytokines, T cells, B cells and macrophages. Diagnosis is primarily clinical and remains challenging because of the heterogeneity of SLE. Classification criteria have aided clinical trials, but, despite this, only one drug (that is, belimumab) has been approved for use in SLE in the past 60 years. The 10-year mortality has improved and toxic adverse effects of older medications such as cyclophosphamide and glucocorticoids have been partially offset by newer drugs such as mycophenolate mofetil and glucocorticoid-sparing regimes. However, further improvements have been hampered by the adverse effects of renal and neuropsychiatric involvement and late diagnosis. Adding to this burden is the increased risk of premature cardiovascular disease in SLE together with the risk of infection made worse by immunosuppressive therapy. Challenges remain with treatment-resistant disease and symptoms such as fatigue. Newer therapies may bring hope of better outcomes, and the refinement to stem cell and genetic techniques might offer a cure in the future. PMID:27306639

  5. Overview of neonatal lupus.

    PubMed

    Johnson, Benay

    2014-01-01

    Neonatal lupus (NL) is defined by the presentation of the fetus and the newborn who possess autoantibodies received from the mother. It is the dysfunction of the maternal immune system that leads to the production of autoantibodies to anti-Sjögren syndrome-A, anti-Sjögren syndrome-B, and anti-ribonuclear protein antigens. These antibodies are shared through the placenta and produce bodily changes in the fetal skin and heart, as well as potential changes in other body systems. Congenital complete heart block is the most dangerous manifestation of NL that can occur in utero or after birth. This article will provide an overview the presentation of NL and current therapies. Prenatal steroids have been the mainstay of therapy to try to reverse first- and second-degree congenital heart block and to prevent progression to a more advanced stage. New therapies are combining steroids with intravenous immunoglobulin and plasmapheresis. This article will provide guidelines for practitioners so they can consider NL as a differential diagnosis when presented with cutaneous lesions, congenital heart block, or abnormal findings in the hematologic, hepatobiliary, neurologic, and musculoskeletal systems. PMID:24100008

  6. Animal Models of Interferon Signature Positive Lupus.

    PubMed

    Zhuang, Haoyang; Szeto, Christopher; Han, Shuhong; Yang, Lijun; Reeves, Westley H

    2015-01-01

    Human lupus is strongly associated with a gene expression signature characterized by over-expression of Type I interferon-regulated genes. A strong interferon signature generally is not seen in the standard mouse models of lupus, despite considerable evidence for the involvement of toll-like receptor-driven interferon production. In contrast, pristane-induced lupus exhibits a prominent TLR7-dependent interferon signature. Importantly, genetic disorders with dysregulated interferon production in both human beings and mice cause severe autoinflammatory diseases but not the typical manifestations of lupus, suggesting that interferon over-production is insufficient to cause systemic lupus erythematosus itself. Single-gene models in mice suggest that lupus-like disease may result from abnormalities in B-cell activation and the clearance of dead cells. Pristane may mimic human systemic lupus erythematosus by causing synergistic abnormalities in interferon production along with defective clearance of apoptotic cells and over-active B-cell signaling. PMID:26097482

  7. Animal Models of Interferon Signature Positive Lupus

    PubMed Central

    Zhuang, Haoyang; Szeto, Christopher; Han, Shuhong; Yang, Lijun; Reeves, Westley H.

    2015-01-01

    Human lupus is strongly associated with a gene expression signature characterized by over-expression of Type I interferon-regulated genes. A strong interferon signature generally is not seen in the standard mouse models of lupus, despite considerable evidence for the involvement of toll-like receptor-driven interferon production. In contrast, pristane-induced lupus exhibits a prominent TLR7-dependent interferon signature. Importantly, genetic disorders with dysregulated interferon production in both human beings and mice cause severe autoinflammatory diseases but not the typical manifestations of lupus, suggesting that interferon over-production is insufficient to cause systemic lupus erythematosus itself. Single-gene models in mice suggest that lupus-like disease may result from abnormalities in B-cell activation and the clearance of dead cells. Pristane may mimic human systemic lupus erythematosus by causing synergistic abnormalities in interferon production along with defective clearance of apoptotic cells and over-active B-cell signaling. PMID:26097482

  8. Rethinking biologics in lupus nephritis.

    PubMed

    Venuturupalli, S

    2016-09-01

    Lupus nephritis (LN) is a chronic and devastating complication of systemic lupus erythematosus. Despite advances in our understanding of LN and the availability of effective therapies, LN remains a difficult clinical problem, and progression to end stage renal disease remains a significant challenge. Though the advent of biologics has revolutionized the treatment of many rheumatological conditions, and several clinical trials of biologics have been conducted in LN, the promise of biologics remains unfulfilled. The experience gained from these initial clinical trials can help tailor approaches in future clinical trials, and the lessons learned can be applied to find a cure for this condition. PMID:27497255

  9. Feasibility of raw glycerol conversion into single cell oil by zygomycetes under non-aseptic conditions.

    PubMed

    Moustogianni, Anna; Bellou, Stamatia; Triantaphyllidou, Irene-Eva; Aggelis, George

    2015-04-01

    The use of plant oils as feedstock for the biodiesel manufacture has many drawbacks, thus, the interest has turned to single cell oil (SCO) as an alternative. However, the production of SCO is still too expensive, mainly due to the low oil productivity and the high cost of medium sterilization required. In this work raw glycerol was converted into SCO by oleaginous Zygomycetes under non-aseptic conditions on selective (i.e., containing essential oils and/or antibiotics) nitrogen limited media. The obtained data showed that although bacterial populations inhibited the fungal growth, lipid accumulation remained unaffected by the presence of bacteria in the growth medium compared to control experiments (conducted under aseptic conditions). Therefore, a two-stage process was developed in which growth was performed under aseptic conditions (1st stage) followed by lipid accumulation performed under non-aseptic conditions (2nd stage) in the presence of thyme essential oil as an antibacterial agent. Large amounts of lipids were accumulated inside the mycelia, yielding around 13% wt/wt of oil per glycerol consumed. PMID:25335774

  10. Continuous flow microwave-assisted processing and aseptic packaging of purple-fleshed sweetpotato purees

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pumpable purees from purple-flesh sweetpotatoes (PFSP) were subjected to microwave heating using a 915 MHz continuous flow system, followed by aseptic packaging in flexible containers to obtain a shelf-stable product. Initial test runs were conducted using a 5 kW microwave unit to measure dielectr...

  11. 77 FR 21783 - Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-11

    ... the Agency's current good manufacturing practice regulations for PET drugs. DATES: Submit either... good manufacturing practices for PET drugs (21 CFR part 212) regarding media fills. A draft guidance of..., such as bacterial endotoxins. The media fill is the performance of an aseptic manufacturing...

  12. Systemic lupus erythematosus.

    PubMed

    Manson, Jessica J; Rahman, Anisur

    2006-01-01

    Systemic lupus erythematosus (SLE) is a clinically heterogeneous disease, which is autoimmune in origin and is characterized by the presence of autoantibodies directed against nuclear antigens. It is a multi-system disease, and patients can present in vastly different ways. Prevalence varies with ethnicity, but is estimated to be about 1 per 1000 overall with a female to male ratio of 10:1. The clinical heterogeneity of this disease mirrors its complex aetiopathogenesis, which highlights the importance of genetic factors and individual susceptibility to environmental factors. SLE can affect every organ in the body. The most common manifestations include rash, arthritis and fatigue. At the more severe end of the spectrum, SLE can cause nephritis, neurological problems, anaemia and thrombocytopaenia. Over 90% of patients with SLE have positive anti-nuclear antibodies (ANA). Significant titres are accepted to be of 1:80 or greater. SLE is a relapsing and remitting disease, and treatment aims are threefold: managing acute periods of potentially life-threatening ill health, minimizing the risk of flares during periods of relative stability, and controlling the less life-threatening, but often incapacitating day to day symptoms. Hydroxychloroquine and non-steroidal anti-inflammatory drugs are used for milder disease; corticosteroids and immunosuppressive therapies are generally reserved for major organ involvement; anti-CD20 monoclonal antibody is now used in patients with severe disease who has not responded to conventional treatments. Despite enormous improvements in prognosis since the introduction of corticosteroids and immunosuppressive drugs, SLE continues to have a significant impact on the mortality and morbidity of those affected. PMID:16722594

  13. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  14. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    PubMed

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products. PMID:9143820

  15. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  16. Lupus Panniculitis as an Initial Manifestation of Systemic Lupus Erythematosus

    PubMed Central

    Zhao, Yu-Kun; Wang, Fang; Chen, Wen-Na; Xu, Rui; Wang, Zhuo; Jiang, Yuan-Wen; Luo, Di-Qing; Han, Jian-De

    2016-01-01

    Abstract Lupus erythematosus panniculitis (LEP) is a variant of chronic cutaneous lupus erythematosus (CCLE). Reported cases of LEP lesions before the diagnosis of systemic lupus erythematosus (SLE) were very rare; only 9 cases have been reported, to the best of our knowledge. We now describe the case of a 19-year-old male patient, with an overall review of the English literature. In the earliest stage of the present case, nodules and ulcers involved his left leg and face, with no other accompanied symptoms. The skin lesions disappeared after treatment with methylprednisolone, 16 mg/d for 1 month. Seven months after discontinuing methylprednisolone, the cutaneous nodules and ulcers on his back recurred and were accompanied by fever, hair loss, and polyarthritis. Blood tests revealed leucopenia, positive antinuclear antibody and Smith antibody, and proteinuria. Histopathological findings were most consistent with LEP. This was followed sequentially by the diagnosis of SLE. The patient improved again after treatment with methylprednisolone and cyclophosphamide. Patients with LEP should have regular follow-ups because the development of SLE is possible. Early diagnosis and proper treatment is pivotal to improve the prognosis of such patients. PMID:27100438

  17. [Aseptic osteonecrosis of the femoral head in cancer patients with neuropathies caused by vincristine and vinblastine].

    PubMed

    Meneghello, A; Presacco, D; Di Maggio, C

    1989-06-01

    Aseptic osteonecrosis has been described in many and dissimilar pathologic conditions--most frequently as the aftermath of fractures or dislocations; in falciform anemia, obesity, alcoholism; in diseases requiring constant and heavy corticosteroid therapy, and also following renal transplantation. Many of these pathologies, especially alcoholism, diabetes, uremia, and collagen vascular diseases, have a common denominator: peripheral neuropathy, which is believed to be a pathogenetic factor supporting osteonecrosis. The authors analyze 3 cases of aseptic osteonecrosis of the femoral head in cancer patients treated with vincristine and/or vinblastine. Since in these subjects severe and persistent neuropathy preceded the onset of osteonecrosis, a possible relationship is postulated between the vincristine/vinblastine treatment and the onset of femoral head osteonecrosis, through the pathogenetic mechanism of peripheral neuropathy. PMID:2756179

  18. Irradiated or aseptically prepared frozen dairy desserts: acceptability to bone marrow transplant recipients.

    PubMed

    Dong, F M; Hashisaka, A E; Rasco, B A; Einstein, M A; Mar, D R; Aker, S N

    1992-06-01

    Sterile ice cream and frozen yogurt were offered to immunosuppressed patients recovering from bone marrow transplantation. To obtain sterile products, two of the dairy desserts (prepackaged ice cream and frozen yogurt bars) were exposed to 40 kGy of cobalt 60 irradiation. Four different flavors of ice cream were aseptically prepared under a laminar airflow hood using commercially sterilized ingredients. A commercially sterile, frozen milk-based drink on the low-microbial menu served as the control. Ratings of the seven products by 17 patients indicated that a frozen vanilla milk-based drink and aseptically prepared chocolate ice cream were highly acceptable to recovery immunosuppressed patients who have difficulty eating most foods. However, the seven desserts received higher ratings from a sensory panel of healthy individuals than from the patient panel, confirming that new foods for the low-microbial diet should be "market-tested" by the targeted patient population before inclusion in the menu. PMID:1607569

  19. Aseptic Endocarditis in Behçet's Disease Presenting as Tricuspid Valve Stenosis

    PubMed Central

    Lee, Hyun Sang; Choi, Won Suk; Kim, Kyun Hee; Kang, Jung Kyu; Kim, Na Young; Park, Sun Hee; Park, Youngwhi; Nam, Eon Jeong; Yang, Dong Heon; Cho, Yongkeun; Lee, Jong-Myung; Chae, Shung-Chull

    2011-01-01

    Aseptic endocarditis is an uncommon complication of Behçet's disease (BD). We describe a rare case of a 39-year-old female who had BD with aseptic endocarditis of the tricuspid valve (TV) presenting as tricuspid stenosis. She was diagnosed with BD four years ago. The mucocutaneous lesions were well-controlled with colchicine and short courses of corticosteroids. She remained free of signs and symptoms of BD for one year without any medication. Three months before admission, she gradually developed dyspnea on exertion and peripheral edema. Echocardiography revealed dilated right atrium and markedly thickened TV with severe stenosis. TV replacement was performed. Pathologic examination of the valve showed fibrinoid necrotic material and inflammatory cell infiltration. Blood cultures and cultures of the excised valve were negative for microorganisms. PMID:21860642

  20. Fatigue in systemic lupus erythematosus.

    PubMed

    Ahn, Grace E; Ramsey-Goldman, Rosalind

    2012-04-01

    Systemic lupus erythematosus is a chronic inflammatory autoimmune disease often characterized by fatigue, with significant effects on physical functioning and wellbeing. The definition, prevalence and factors associated with fatigue, including physical activity, obesity, sleep, depression, anxiety, mood, cognitive dysfunction, vitamin D deficiency/insufficiency, pain, effects of medications and comorbidities, as well as potential therapeutic options of fatigue in the systemic lupus erythematosus population are reviewed. Due to variability in the reliability and validity of various fatigue measures used in clinical studies, clinical trial data have been challenging to interpret. Further investigation into the relationships between these risk factors and fatigue, and improved measures of fatigue, may lead to an improvement in the management of this chronic inflammatory disease. PMID:22737181

  1. IL-17 promotes murine lupus.

    PubMed

    Amarilyo, Gil; Lourenço, Elaine V; Shi, Fu-Dong; La Cava, Antonio

    2014-07-15

    The proinflammatory activity of IL-17-producing Th17 cells has been associated with the pathogenesis of several autoimmune diseases. In this article, we provide direct evidence for a role of IL-17 in the pathogenesis of systemic lupus erythematosus (SLE). The induction of SLE by pristane in IL-17-sufficient wild-type mice did not occur in IL-17-deficient mice, which were protected from development of lupus autoantibodies and glomerulonephritis. The protection from SLE in IL-17-deficient mice was associated with a reduced frequency of CD3(+)CD4(-)CD8(-) double-negative T cells and an expansion of CD4(+) regulatory T cells, and did not depend on Stat-1 signaling. These data affirm the key role of IL-17 in the pathogenesis of SLE and strengthen the support for IL-17 blockade in the therapy of SLE. PMID:24920843

  2. Molecular Epidemiology of Human Enterovirus Associated with Aseptic Meningitis in Shandong Province, China, 2006–2012

    PubMed Central

    Liu, Guifang; Xu, Aiqiang; Lin, Xiaojuan; Song, Lizhi; Ji, Feng; Wang, Suting; Cui, Ning; Song, Yanyan

    2014-01-01

    Background Human enteroviruses (HEVs) are common causes of acute meningitis. However, there is limited information about HEV associated with aseptic meningitis in mainland China because it has not been classified as a notifiable disease. Objectives To characterize the HEVs associated with sporadic aseptic meningitis in China and to analyze their genetic features. Study Design Cerebrospinal fluid, throat swab and feces specimens were collected from patients with aseptic meningitis in 5 sentinel hospitals in Shandong Province, China between 2006 and 2012. Virological investigation (viral isolation and molecular identification) and phylogenetic analysis were performed. Results A total of 437 hospitalized patients were reported, and enteroviruses were detected in the specimens from 84 patients (19.2%) and were identified into 17 serotypes. The nine main serotypes were echovirus (E) 30 (27.4%), EV71 (13.1%), coxsackievirus (CV) B1 (9.5%), CVB3 (7.1%), CVB5 (7.1%), E6 (7.1%), E9 (7.1%), CVA9 (6.0%), and CVA10 (3.6%). Monthly distribution of isolated enteroviruses revealed a major peak in summer-fall season and a small second peak in winter constituted totally by EV71. Sequence analysis on VP1 coding region suggested Shandong strains had great genetic divergence with isolates from other countries. Conclusions Multiple serotypes were responsible for enterovirus meningitis in mainland China. Aseptic meningitis caused by EV71 and coxsackie A viruses–the predominant pathogens for the hand, foot, and mouth disease–is currently an important concern in mainland China. PMID:24587020

  3. Detection of Leptospira DNA in Patients with Aseptic Meningitis by PCR

    PubMed Central

    Romero, Eliete C.; Billerbeck, Ana E. C.; Lando, Valéria S.; Camargo, Eide D.; Souza, Candida C.; Yasuda, Paulo H.

    1998-01-01

    Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively. PMID:9574730

  4. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-01-01

    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  5. Infections and systemic lupus erythematosus

    PubMed Central

    Skare, Thelma Larocca; Dagostini, Jéssica Scherer; Zanardi, Patricia Imai; Nisihara, Renato Mitsunori

    2016-01-01

    ABSTRACT Objective To determine the incidence of infections in a population of systemic lupus erythematosus individuals and the characteristics of infections regarding original site, as well as to study the possible associations between infections and treatment. Methods An analytical retrospective study using data from medical charts of systemic lupus erythematosus patients from a single university hospital. A total of 144 patients followed up for five years were included. Data collected comprised age of patients and age at onset of lupus, sex and ethnicity, disease duration before the study period, medications, cumulative dose of prednisone, occurrence of infections and their original site. Results The most frequent infections were urinary tract infections (correlated to use of prednisone − p<0.0001 and cyclophosphamide − p=0.045), upper airways infections (correlated to use of prednisone − p=0.0004, mycophenolate mofetil − p=0.0005, and cyclosporine − p=0.025), and pneumonia (associated to prednisone − p=0.017). Conclusion Prednisone was the drug more often associated with presence of infections, pointing to the need for a more judicious management of this drug. PMID:27074234

  6. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis

    PubMed Central

    Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  7. Aseptic versus Sterile Acellular Dermal Matrices in Breast Reconstruction: An Updated Review

    PubMed Central

    Mendenhall, Shaun D.; Neumeister, Michael W.; Cederna, Paul S.; Momoh, Adeyiza O.

    2016-01-01

    Background: As the use of acellular dermal matrices in breast reconstruction has become more commonplace and efforts are made to improve on postoperative outcomes, the method of acellular dermal matrix (ADM) processing (aseptic versus sterile) has become a subject of interest. This article provides an updated overview of the critical aspects of ADM processing in addition to application of ADMs in single- and two-stage breast reconstruction, a review of the morbidity associated with ADM use, and alternatives. Methods: A literature review was performed in PubMed identifying recent systematic reviews, meta-analyses, and head-to-head comparisons on aseptically processed ADM and sterile-processed ADM in implant-based breast reconstruction. Results: Recent meta-analyses have shown a 2- to 3-fold increase in infections and tissue expander/implant explantation rates and a 3- to 4-fold increase in seroma formation compared with non-ADM reconstruction techniques. Comparisons of aseptic and sterile ADMs in multiple studies have shown no significant difference in infection rates and equivocal findings for other specific complications such as seroma formation. Conclusions: Current evidence on the impact of processing techniques that improve ADM sterility on postoperative morbidity in implant breast reconstruction is unclear. Deficiencies of the available data highlight the need for well-designed, multicenter, randomized controlled studies that will aid in optimizing outcomes in implant-based breast reconstruction. PMID:27536502

  8. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis.

    PubMed

    Jha, Pinky; Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  9. Varicella Zoster Aseptic Meningitis: Report of an Atypical Case and Literature Review

    PubMed Central

    Ibrahim, Walid; Elzouki, Abdel-Naser; Husain, Ahmed; Osman, Lubna

    2015-01-01

    Patient: Female, 15 Final Diagnosis: Varicella Zoster aseptic meningitis Symptoms: — Medication: — Clinical Procedure: Lumber punctur Specialty: Infectious Diseases Objective: Unusual clinical course Background: Neurologic complications can occur with varicella zoster virus (VZV) infection, usually after vesicular exanthem. A review of the literature revealed 3 cases of viral meningitis associated with 6th nerve palsy but without significantly increased intracranial pressure. Case Report: We report a case of a previously healthy 15-year-old girl with aseptic meningitis as a result of reactivated-VZV infection with symptoms of increased intracranial pressure and reversible 6th cranial nerve palsy but without exanthema. Diagnosis was made by detection of VZV-DNA in cerebrospinal fluid using polymerase chain reaction and documented high intracranial pressure. Full recovery was achieved after a course of acyclovir and acetazolamide. Conclusions: This case demonstrates that VZV may be considered in cases of aseptic meningitis in immunocompetent individuals, even without exanthema, and it may increase the intracranial pressure, leading to symptoms, and causing reversible neurological deficit. PMID:26342350

  10. Drug-induced lupus erythematosus.

    PubMed

    Vedove, Camilla Dalle; Del Giglio, Micol; Schena, Donatella; Girolomoni, Giampiero

    2009-01-01

    Drug-induced lupus erythematosus (DILE) is defined as a lupus-like syndrome temporally related to continuous drug exposure which resolves after discontinuation of the offending drug. There are currently no standard diagnostic criteria for DILE and the pathomechanisms are still unclear. Similarly to idiopathic lupus, DILE can be diveded into systemic (SLE), subacute cutaneous (SCLE) and chronic cutaneous lupus (CCLE). Systemic DILE is characterized by typical lupus-like symptoms including skin signs, usually mild systemic involvement and a typical laboratory profile with positive antinuclear and anti-histone antibodies, while anti-double strand (ds) DNA and anti-extractable nuclear antigens antibodies are rare. High risk drugs include hydralazine, procainamide and isoniazid. Drug-induced SCLE is very similar to idiopathic SCLE in terms of clinical and serologic characteristic, and it is more common than the systemic form of DILE. Drugs associated with SCLE include calcium channel blockers, angiotensin-converting enzyme inhibitors, interferons, thiazide diuretics and terbinafine. Drug-induced CCLE is very rarely reported in the literature and usually refers to fluorouracile agents or non steroidal anti-inflammatory drugs. Recently, cases of DILE have been reported with anti-TNFalpha agents. These cases present with disparate clinical features including arthritis/arthralgia, skin rash, serositis, cytopenia and variable laboratory abnormalities. DILE to anti-TNFalpha agents differs in several ways to classic DILE. The incidence of rashes is higher compared to classical systemic DILE. In most cases of classic DILE visceral involvement is rare, whereas several cases of anti-TNFalpha DILE with evidence of renal disease have been reported. Low serum complement levels as well as anti-extractable nuclear antigen antibodies and anti-dsDNA antibodies are rarely present in classic DILE, whereas they are reported in half the cases of anti-TNFalpha DILE; in contrast, anti

  11. Acute transverse myelopathy complicating systemic lupus erythematosus.

    PubMed Central

    Propper, D J; Bucknall, R C

    1989-01-01

    A sixteen year old girl with systemic lupus erythematosus developed acute transverse myelopathy. She was treated with high dose steroids, cyclophosphamide, and plasma exchange and regained partial neurological function. Previous descriptions of transverse myelopathy complicating systemic lupus erythematosus are reviewed, with particular reference to the efficacy of high dose steroid treatment. PMID:2662918

  12. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.

    PubMed

    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2015-01-01

    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  13. Case report on a patient with lupus panniculitis

    PubMed Central

    Bednarek, Agata; Samborski, Włodzimierz

    2015-01-01

    Lupus panniculitis is a rare variant of lupus erythematosus. It may occur as a separate disease or coexist with systemic or discoid lupus erythematosus. It is characterized by persistent, tender and hard nodules localised on the face, arms, shoulders, breast and buttocks. Healing of lesions is associated with scarring, lipoatrophy and rarely ulceration. Treatment of lupus panniculitis depends on disease advancement or concomitance of additional lupus erythematosus symptoms. We report a case of a 44-year-old patient with lupus panniculitis treated with chloroquine and glucocorticosteroids, including high dose infusions. Despite intense treatment, the patient developed symptoms that suggested a diagnosis of systemic lupus erythematosus. PMID:25821430

  14. [Pulmonary manifestations in systemic lupus erythematosus].

    PubMed

    Vincze, Krisztina; Odler, Balázs; Müller, Veronika

    2016-07-01

    Systemic lupus erythematosus is the most common connective tissue disease that is associated with pulmonary manifestations. Although lupus has the potential to affect any organ, lung involvement is observed during the course of the disease in most cases and it is prognostic for outcome. Pulmonary manifestations in lupus can be classified into five groups based on the anatomical involvement: pleura, lung parenchyma, bronchi and bronchioli, lung vasculature and respiratory muscles can be involved. The most common respiratory manifestations attributable to lupus are pleuritis with or without pleural effusion, pulmonary vascular disease, upper and lower airway dysfunction, parenchymal disease, and diaphragmatic dysfunction (shrinking lung syndrome). In this article the authors summarize lung involvement of lupus, its diagnosis, therapy and prognosis. Orv. Hetil., 2016, 157(29), 1154-1160. PMID:27426464

  15. Lupus cerebritis after visiting a tanning salon.

    PubMed

    Geara, Abdallah S; Torbey, Estelle; El-imad, Badiaa

    2009-01-01

    A 53-year-old female was admitted to the intensive care unit for lupus cerebritis; she had a 15-year history of stable lupus. Over the prior 1 to 2 months, the patient visited a tanning salon and this triggered the exacerbation of lupus. Her initial symptoms were cutaneous in the form of an erythematous rash. Within 2 weeks she started to have headaches and was admitted for seizure and psychosis. Ultraviolet A exposure in the tanning salon is known to exacerbate lupus by modulation of the immune system at the level of the skin. It has also been found that ultraviolet light can lead to the formation of antinuclear antibodies. This case illustrates the need to emphasize the danger of the tanning salon to patients with systemic lupus erythematous; the risk is not only cutaneous, it can also be systemic. PMID:20001946

  16. The BCL2 -938C>A Promoter Polymorphism Is Associated with Risk for and Time to Aseptic Loosening of Total Hip Arthroplasty

    PubMed Central

    Fuest, Lena; Kurscheid, Gina; Gehrke, Thorsten; Klenke, Stefanie; Jäger, Marcus; Kauther, Max D.; Bachmann, Hagen S.

    2016-01-01

    Aseptic loosening is a major cause of revision surgery of total hip arthroplasty (THA). Only few host factors affecting aseptic loosening have been identified until now, although they are urgently needed to identify and possibly treat those patients at higher risk for aseptic loosening. To determine whether the functional single nucleotide polymorphism (SNP) c.-938C>A (rs2279115), located in the promoter region of the BCL2 gene has an impact on aseptic loosening of THA we genotyped and analyzed 234 patients suffering from aseptic loosening and 231 patients after primary THA. The polymorphism is associated with risk for aseptic loosening with the CC genotype at highest risk for aseptic loosening, Odds Ratio CC vs. AA 1.93, 95%CI 1.15–3.25, p = 0.013. In contrast, low risk AA genotype carriers that still developed aseptic loosening showed a significantly shorter time to aseptic loosening than patients carrying the C allele (p = 0.004). These results indicate that the BCL2 -938C>A polymorphism influences the occurrence and course of aseptic loosening and suggests this polymorphism as an interesting candidate for prospective studies and analyses in THA registers. PMID:26881923

  17. Missed low-grade infection in suspected aseptic loosening has no consequences for the survival of total hip arthroplasty

    PubMed Central

    Boot, Willemijn; Moojen, Dirk Jan F; Visser, Els; Lehr, A Mechteld; De Windt, Tommy S; Van Hellemondt, Gijs; Geurts, Jan; Tulp, Niek J A; Schreurs, B Wim; Burger, Bart J; Dhert, Wouter J A; Gawlitta, Debby; Vogely, H Charles

    2015-01-01

    Background and purpose — Aseptic loosening and infection are 2 of the most common causes of revision of hip implants. Antibiotic prophylaxis reduces not only the rate of revision due to infection but also the rate of revision due to aseptic loosening. This suggests under-diagnosis of infections in patients with presumed aseptic loosening and indicates that current diagnostic tools are suboptimal. In a previous multicenter study on 176 patients undergoing revision of a total hip arthroplasty due to presumed aseptic loosening, optimized diagnostics revealed that 4–13% of the patients had a low-grade infection. These infections were not treated as such, and in the current follow-up study the effect on mid- to long-term implant survival was investigated. Patients and methods — Patients were sent a 2-part questionnaire. Part A requested information about possible re-revisions of their total hip arthroplasty. Part B consisted of 3 patient-related outcome measure questionnaires (EQ5D, Oxford hip score, and visual analog scale for pain). Additional information was retrieved from the medical records. The group of patients found to have a low-grade infection was compared to those with aseptic loosening. Results — 173 of 176 patients from the original study were included. In the follow-up time between the revision surgery and the current study (mean 7.5 years), 31 patients had died. No statistically significant difference in the number of re-revisions was found between the infection group (2 out of 21) and the aseptic loosening group (13 out of 152); nor was there any significant difference in the time to re-revision. Quality of life, function, and pain were similar between the groups, but only 99 (57%) of the patients returned part B. Interpretation — Under-diagnosis of low-grade infection in conjunction with presumed aseptic revision of total hip arthroplasty may not affect implant survival. PMID:26364842

  18. Belimumab in systemic lupus erythematosus

    PubMed Central

    Vilas-Boas, Andreia; Morais, Sandra A; Isenberg, David A

    2015-01-01

    Systemic lupus erythematosus (SLE) is one of the most challenging autoimmune disorders with a complex pathophysiology and diverse clinical presentation. Many drugs have been used to treat SLE with suboptimal results, especially in patients with moderate-to-severe disease. Belimumab is the first biological drug to be approved for the treatment of SLE in more than 50 years. This monoclonal antibody blocks B-cell activating factor, a cytokine important for B-cell differentiation and survival. In this review we focus on the activity of belimumab in patients with SLE and discuss the controversies of its use. PMID:26509047

  19. Cross-fostering in gray wolves (Canis lupus lupus).

    PubMed

    Scharis, Inger; Amundin, Mats

    2015-01-01

    Cross-fostering in canids, with captive-bred pups introduced into endangered wild populations, might aid conservation efforts by increasing genetic diversity and lowering the risk of inbreeding depression. The gray wolf (Canis lupus lupus) population in Scandinavia suffers from severe inbreeding due to a narrow genetic base and geographical isolation. This study aimed at evaluating the method to cross-foster wolf pups from zoo-born to zoo-born litters. The following was assessed: female initial acceptance of foster pups, growth rate in relation to age difference between foster pups and pups in recipient litters and survival over the first 33 weeks. The study included four litters added by two foster pups in each. The age differences between the foster pups and the recipient litters were 2-8 days. After augmentation, all four females accepted the foster pups, demonstrated by her moving the entire litter to a new den site. Growth rate was dependent on the age difference of the pups in the foster litters, with a considerably slower growth rate in the 8 days younger pups. However, these pups later appeared to be at no disadvantage. Foster pups had a higher survival rate than females' pups, however, the causes of death were probably not kin or non-kin related. The results indicate that cross-fostering works in gray wolves and that this might be a plausible way to increase genetic variation in the wild population. PMID:25773058

  20. The stellar population of the Lupus clouds

    NASA Technical Reports Server (NTRS)

    Hughes, Joanne; Hartigan, Patrick; Krautter, Joachim; Kelemen, Janos

    1994-01-01

    We present photometric and spectroscopic observations of the H alpha emission stars in the Lupus dark cloud complex. We estimate the effective temperatures of the stars from their spectral types and calculate the reddening towards each object from the (R-I) colors. From these data, we derive mass and age distributions for the Lupus stars using a new set of pre-main sequence evolutionar tracks. We compare the results for the Lupus stars with those for a similar population of young stellar objects in Taurus-Auriga and Chamaeleon and with the initial mass function for field stars in the solar neighborhood. From the H-R diagrams, Lupus appears to contain older stars than Taurus. The Lupus dark clouds form a greater proportion of low mass stars than the Taurus complex. Also, the proportion of low mass stars in Lupus is higher than that predicted by the Miller-Scalo initial mass function, and the lowest mass stars in Lupus are less active than similar T Tauri stars in other regions.

  1. Immunopathogenesis of environmentally induced lupus in mice.

    PubMed

    Shaheen, V M; Satoh, M; Richards, H B; Yoshida, H; Shaw, M; Jennette, J C; Reeves, W H

    1999-10-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune syndrome defined by clinical and serologic features, including arthritis, glomerulonephritis, and certain autoantibodies such as anti-nuclear ribonucleoprotein (nRNP)/Smith antigen (Sm), DNA, and ribosomal P. Although lupus is considered primarily a genetic disorder, we recently demonstrated the induction of a syndrome strikingly similar to spontaneous lupus in many nonautoimmune strains of mice exposed to the isoprenoid alkane pristane (2,6,10,14-tetramethylpentadecane), a component of mineral oil. Intraperitoneal injection of pristane leads to the formation of lipogranulomas consisting of phagocytic cells that have engulfed the oil and collections of lymphocytes. Subsequently, pristane-treated BALB/c and SJL mice develop autoantibodies characteristic of SLE, including anti-nRNP/Sm, antiribosomal P, anti-Su, antichromatin, anti-single-stranded DNA, and anti-double-stranded DNA. This is accompanied by a severe glomerulonephritis with immune complex deposition, mesangial or mesangiocapillary proliferation, and proteinuria. All inbred mice examined appear to be susceptible to this novel form of chemically induced lupus. Pristane-induced lupus is the only inducible model of autoimmunity associated with the clinical syndrome as well as with the characteristic serologic abnormalities of SLE. Defining the immunopathogenesis of pristane-induced lupus in mice may provide insight into the causes of spontaneous (idiopathic) lupus and also may lead to information concerning possible risks associated with the ingestion or inhalation of mineral oil and exposure to hydrocarbons in the environment. PMID:10502537

  2. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    USGS Publications Warehouse

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  3. An echovirus 18-associated outbreak of aseptic meningitis in Taiwan: epidemiology and diagnostic and genetic aspects.

    PubMed

    Tsai, Huey-Pin; Huang, Sheng-Wen; Wu, Feng-Ling; Kuo, Pin-Hwa; Wang, Shih-Min; Liu, Ching-Chuan; Su, Ih-Jen; Wang, Jen-Ren

    2011-09-01

    In 2006, an outbreak of aseptic meningitis was noted in Taiwan. From January to October 2006, a total of 3283 specimens collected from patients with viral infection, including 173 cerebrospinal fluid (CSF) samples, were examined for virus isolation and identification. Overall, 339 enterovirus (EV)-positive cases were identified by virus culture: echovirus 18 (E18) formed the majority (27.4 %, 93 cases), followed by coxsackievirus B2 (13.8 %, 47 cases) and coxsackievirus A2 (10.8 %, 37 cases). The manifestations of the 93 E18 cases were aseptic meningitis (44.1 %), viral exanthema (23.6 %), acute tonsillitis (15.1 %), acute pharyngitis (14.0 %), acute gastritis (11.8 %), herpangina (7.5 %) and bronchopneumonia (5.3 %). Of 107 E18 isolates identified, 100, 62.5 and 19 % were obtained following culture in RD, MRC-5 and A549 cells, respectively. E18 was identified most frequently from throat swabs (67.2 %) and less frequently from stool samples (15.9 %) and CSF (16.8 %). The detection rate of E18 was 78.2 % from CSF, 50 % from stool samples and 22.9 % from throat swabs. Phylogenetic relationships among the E18 strains were examined. Analysis of the partial VP1 gene showed 3.7-23.8 % variation in sequence compared with sequences from GenBank and, notably, the amino acid change V152S was detected in a protruding loop within the VP1 protein. These results indicate that a genetic variant of E18 was circulating and caused an outbreak of aseptic meningitis in Taiwan in 2006. PMID:21546563

  4. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    PubMed

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones. PMID:26502645

  5. The persistent challenge of lupus nephritis.

    PubMed

    Valesini, Guido; Conti, Fabrizio

    2011-06-01

    Systemic lupus erythematosus has long been considered the prototypic autoimmune disease. Although the etiology remains enigmatic, there has been vigorous definition of the clinical features and the natural history. In this issue, we review the persistent challenge of lupus nephritis and, in particular, features of diagnosis as well as treatment options. It is clear that major therapeutic advances have occurred but there is still a considerable unmet need in the population. This issue does not review all the clinical problems of lupus nephritis, but rather attempts to place the most recent data in perspective for the clinician. PMID:20811786

  6. Cutaneous aseptic neutrophilic abscesses and Yersinia enterocolitica infection in a case subsequently diagnosed as Crohn's disease.

    PubMed

    Safa, G; Loppin, M; Tisseau, L; Lamoril, J

    2008-01-01

    We report the case of a man who presented cutaneous aseptic abscesses, a rare form of neutrophilic disease, associated with Yersinia enterocolitica infection and who was later diagnosed as having Crohn's disease (CD). Genetic analysis showed that the patient had a mutation in the caspase activation recruitment domain 15/nucleotide oligomerization domain 2 gene (R702W heterozygote). This case is in keeping with recent evidence in the literature which suggests that CD is a disease linked to abnormal immune responses to enteric bacteria in genetically susceptible individuals. Further understanding of the innate immune system should provide new insights into the pathogenesis of these inflammatory diseases. PMID:18799880

  7. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI

    PubMed Central

    Wolf, Marc E.; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G.; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient. PMID:26889150

  8. Intracranial Hypertension as an Acute Complication of Aseptic Meningoencephalitis with Leptomeningeal Contrast Enhancement on FLAIR MRI.

    PubMed

    Wolf, Marc E; Eisele, Philipp; Schweizer, Yvonne; Alonso, Angelika; Gass, Achim; Hennerici, Michael G; Szabo, Kristina

    2016-01-01

    We report a case of a 19-year-old woman who developed intracranial hypertension as an unusual clinical complication of severe aseptic meningoencephalitis probably due to a diminished cerebrospinal fluid reabsorption capacity or leptomeningeal transudation as a consequence of blood-brain barrier dysfunction. These severe inflammatory changes were accompanied by prominent leptomeningeal contrast enhancement best visualized on fluid-attenuated inversion recovery magnetic resonance imaging. In such a prolonged course, a continuous lumbar drainage might be a temporary option to provide rapid symptom relief to the patient. PMID:26889150

  9. Solvent effect in the polyethylene recovery from multilayer postconsumer aseptic packaging.

    PubMed

    Cervantes-Reyes, Alejandro; Núñez-Pineda, Alejandra; Barrera-Díaz, Carlos; Varela-Guerrero, Víctor; Martínez-Barrera, Gonzalo; Cuevas-Yañez, Erick

    2015-04-01

    Polyethylene films were separated and recovered from polyethylene-aluminum composites derived from recycling multilayer postconsumer aseptic packaging. A brief study about the separation process by dissolving PE-aluminum (PE-Al) composites into a series of organic solvents with a combination of time and temperature is presented. Through this procedure, 56% polyethylene is recovered from this kind of composites in optimized conditions. DSC and TGA studies were performed to determine the thermal stability of recovered polyethylene films and to establish a comparison with a PE reference commercial product, demonstrating that recovered polyethylene films kept their thermal properties. PMID:25681948

  10. Impact of Lupus on the Body

    MedlinePlus

    ... Recipients 2014 LIFELINE Grant Program™ Recipients Lupus Insight Prize Evelyn V. Hess, MD, MACP, MACR, Award About ... V. Hess Mary Betty Stevens, MD, Young Investigator Prize About Dr. Mary Betty Stevens Career Development Award ...

  11. Anaplastic myeloma in systemic lupus erythematosus.

    PubMed Central

    Butler, R C; Thomas, S M; Thompson, J M; Keat, A C

    1984-01-01

    We describe a patient with systemic lupus erythematosus who developed an unusual form of anaplastic myeloma. Possible relationships between the two disease, and the role played by immunosuppressive therapy, are discussed. Images PMID:6476924

  12. Natural history of "silent" lupus nephritis.

    PubMed

    Bennett, W M; Bardana, E J; Norman, D J; Houghton, D C

    1982-05-01

    Twenty patients with systemic lupus erythematosus but without evident renal involvement previously underwent percutaneous renal biopsy. Findings revealed almost universal pathologic evidence of nephritis. Included were three patients who had diffuse proliferative changes and five who had subendothelial electron dense deposits. Only four patients developed clinical renal disease during the follow-up period while no patient died or required dialysis. Using the Life Table Method, the cumulative percentage of patients free from any clinical renal disease was over 60% at 10 yr from the time of diagnosis of systemic lupus, and at 8 yr from the time of the original biopsy. It is concluded that silent lupus nephritis, regardless of histologic subtype, has a favorable prognosis. These data may not be applicable to patients with similar biopsies who have evidence of clinical lupus nephritis. PMID:7091151

  13. Suitability of different construction materials for use in aseptic processing environments decontaminated with gaseous hydrogen peroxide.

    PubMed

    Unger, Beatriz; Rauschnabel, Uta; Düthorn, Berthold; Kottke, Volker; Hertel, Christian; Rauschnabel, Johannes

    2007-01-01

    The purpose of this study is to examine the behavior of different materials towards the microbial inactivation kinetic of gaseous hydrogen peroxide. Samples of 49 materials potentially used in aseptic processing environments were inoculated with 106 spores of Geobacillus stearothermophilus ATCC #12980 and exposed to defined periods using a reproducible hydrogen peroxide bio-decontamination cycle. The inactivation characteristic of each material was investigated by means of repeated D-value calculations. The results demonstrate that different materials show highly variable performance regarding the inactivation pattern of spores on each particular surface. Not only the chemical composition of the material but also differences in manufacturing processes and surface treatments were found to have an effect on the resistance of the test organisms. From the data obtained it is concluded that some correlation exists between the calculated D-values and roughness as well as wettability of the materials. Best- and worst-case materials were identified, and the dependence of specific decontamination characteristics on material properties was investigated. It is suggested to integrate studies regarding the inactivation characteristics of incorporated materials into the construction process of new aseptic processing systems bio-decontaminated with hydrogen peroxide. PMID:17933208

  14. Intravenous Immunoglobulin with Enhanced Polyspecificity Improves Survival in Experimental Sepsis and Aseptic Systemic Inflammatory Response Syndromes

    PubMed Central

    Djoumerska-Alexieva, Iglika; Roumenina, Lubka; Pashov, Anastas; Dimitrov, Jordan; Hadzhieva, Maya; Lindig, Sandro; Voynova, Elisaveta; Dimitrova, Petya; Ivanovska, Nina; Bockmeyer, Clemens; Stefanova, Zvetanka; Fitting, Catherine; Bläss, Markus; Claus, Ralf; von Gunten, Stephan; Kaveri, Srini; Cavaillon, Jean-Marc; Bauer, Michael; Vassilev, Tchavdar

    2015-01-01

    Sepsis is a major cause for death worldwide. Numerous interventional trials with agents neutralizing single proinflammatory mediators have failed to improve survival in sepsis and aseptic systemic inflammatory response syndromes. This failure could be explained by the widespread gene expression dysregulation known as “genomic storm” in these patients. A multifunctional polyspecific therapeutic agent might be needed to thwart the effects of this storm. Licensed pooled intravenous immunoglobulin preparations seemed to be a promising candidate, but they have also failed in their present form to prevent sepsis-related death. We report here the protective effect of a single dose of intravenous immunoglobulin preparations with additionally enhanced polyspecificity in three models of sepsis and aseptic systemic inflammation. The modification of the pooled immunoglobulin G molecules by exposure to ferrous ions resulted in their newly acquired ability to bind some proinflammatory molecules, complement components and endogenous “danger” signals. The improved survival in endotoxemia was associated with serum levels of proinflammatory cytokines, diminished complement consumption and normalization of the coagulation time. We suggest that intravenous immunoglobulin preparations with additionally enhanced polyspecificity have a clinical potential in sepsis and related systemic inflammatory syndromes. PMID:26701312

  15. Cytokines in systemic lupus erythematosus, London, UK

    PubMed Central

    Rahman, Anisur

    2003-01-01

    The meeting consisted of 11 talks that illustrated the complexity of the pathogenetic mechanisms underlying systemic lupus erythematosus and aimed to identify ways in which cytokine modulation might affect those mechanisms. The evidence relating to the involvement of tumour necrosis factor-α, interleukin-10 and BLyS in this disease was discussed in particular detail. A final discussion explored the possible ways in which cytokine modulation might lead to new methods of treating systemic lupus erythematosus in the future. PMID:12823845

  16. CO observations of dark clouds in Lupus

    NASA Technical Reports Server (NTRS)

    Murphy, D. C.; Cohen, R.; May, J.

    1986-01-01

    C-12O observations covering 170 square degrees toward the southern T Association Lupus have revealed the presence of an extended physically related complex of dark clouds which have recently formed low mass stars. The estimated mass of the clouds (about 30,000 solar masses) is comparable to that of the nearby Ophiuchus dust clouds. The Lupus clouds are projected onto a gap between two subgroups of the Scorpio-Centaurus OB association suggesting that this long accepted subgrouping may require reinterpretation.

  17. Lupus-erythematous-associated interstitial granulomatous dermatitis.

    PubMed

    Marmon, Shoshana; Robinson, Maria; Meehan, Shane A; Franks, Andrew G

    2012-12-01

    A 41-year-old woman with a prior diagnosis of lupus erythematous presented with a five-year history of small, erythematous, flesh-colored papules and nodules that coalesced into symmetrically-distributed plaques on her upper back. A biopsy specimen showed an interstitial, granulomatous mixed-cell dermatitis with eosinophils. These clinicopathologic findings are consistent with a diagnosis of lupus erythematous-associated interstitial granulomatous dermatitis. PMID:23286821

  18. Systemic lupus erythematosus presenting as morbid jealousy.

    PubMed Central

    Ravindran, A.; Carney, M. W.; Denman, A. M.

    1980-01-01

    A patient fulfilling the diagnostic criteria for systemic lupus erythematosus and presenting with morbid jealousy is described. There was evidence of cerebral lupus. Her physical and mental symptoms responded to a combination of chlorpromazine and steroids. The morbid mental process was probably caused by her physical condition while the content of her disordered thought and behaviour was determined by her introverted premorbid personality, religiosity, unhappy childhood experiences and frustrated desire for children. PMID:7413541

  19. Lupus mastitis: a mimicker of breast carcinoma

    PubMed Central

    Warne, Richard Roger; Taylor, Donna; Segal, Amanda; Irish, Ashley

    2011-01-01

    The authors present a case of lupus mastitis which was initially diagnosed following an incisional biopsy of a breast lump, with similar pathology found 2 years later after an ultrasound guided biopsy of the same lump. The woman had been diagnosed 7 years before with systemic lupus erythematosus. The radiological and pathological features are presented in this report with discussion of similar cases in the literature. PMID:22669997

  20. Mucormycosis complications in systemic lupus erythematosus.

    PubMed

    Arce-Salinas, C A; Pérez-Silva, E

    2010-07-01

    This case involved a 75-year-old woman with systemic lupus erythematosus. Two months previously, she had a flare that was treated successfully by increasing the dosages of prednisone and azathioprine. A sudden onset of ocular pain, diplopia, and loss of vision suggestive of optical neuritis or vascular involvement confused the issue, and rhinocerebral zygomycosis was demonstrated later. We review the presentations of this fungal infection in patients with systemic lupus erythematosus with emphasis on its initial features. PMID:20064915

  1. Antiphospholipid Antibodies in Lupus Nephritis.

    PubMed

    Parodis, Ioannis; Arnaud, Laurent; Gerhardsson, Jakob; Zickert, Agneta; Sundelin, Birgitta; Malmström, Vivianne; Svenungsson, Elisabet; Gunnarsson, Iva

    2016-01-01

    Lupus nephritis (LN) is a major manifestation of systemic lupus erythematosus (SLE). It remains unclear whether antiphospholipid antibodies (aPL) alter the course of LN. We thus investigated the impact of aPL on short-term and long-term renal outcomes in patients with LN. We assessed levels of aPL cross-sectionally in SLE patients diagnosed with (n = 204) or without (n = 294) LN, and prospectively in 64 patients with active biopsy-proven LN (52 proliferative, 12 membranous), before and after induction treatment (short-term outcomes). Long-term renal outcome in the prospective LN cohort was determined by the estimated glomerular filtration rate (eGFR) and the Chronic Kidney Disease (CKD) stage, after a median follow-up of 11.3 years (range: 3.3-18.8). Cross-sectional analysis revealed no association between LN and IgG/IgM anticardiolipin or anti-β2-glycoprotein I antibodies, or lupus anticoagulant. Both aPL positivity and levels were similar in patients with active LN and non-renal SLE. Following induction treatment for LN, serum IgG/IgM aPL levels decreased in responders (p<0.005 for all), but not in non-responders. Both at active LN and post-treatment, patients with IgG, but not IgM, aPL had higher creatinine levels compared with patients without IgG aPL. Neither aPL positivity nor levels were associated with changes in eGFR from either baseline or post-treatment through long-term follow-up. Moreover, aPL positivity and levels both at baseline and post-treatment were similar in patients with a CKD stage ≥3 versus 1-2 at the last follow-up. In conclusion, neither aPL positivity nor levels were found to be associated with the occurrence of LN in SLE patients. However, IgG aPL positivity in LN patients was associated with a short-term impairment of the renal function while no effect on long-term renal outcome was observed. Furthermore, IgG and IgM aPL levels decreased following induction treatment only in responders, indicating that aPL levels are affected by

  2. Antiphospholipid Antibodies in Lupus Nephritis

    PubMed Central

    Arnaud, Laurent; Gerhardsson, Jakob; Zickert, Agneta; Sundelin, Birgitta; Malmström, Vivianne; Svenungsson, Elisabet; Gunnarsson, Iva

    2016-01-01

    Lupus nephritis (LN) is a major manifestation of systemic lupus erythematosus (SLE). It remains unclear whether antiphospholipid antibodies (aPL) alter the course of LN. We thus investigated the impact of aPL on short-term and long-term renal outcomes in patients with LN. We assessed levels of aPL cross-sectionally in SLE patients diagnosed with (n = 204) or without (n = 294) LN, and prospectively in 64 patients with active biopsy-proven LN (52 proliferative, 12 membranous), before and after induction treatment (short-term outcomes). Long-term renal outcome in the prospective LN cohort was determined by the estimated glomerular filtration rate (eGFR) and the Chronic Kidney Disease (CKD) stage, after a median follow-up of 11.3 years (range: 3.3–18.8). Cross-sectional analysis revealed no association between LN and IgG/IgM anticardiolipin or anti-β2-glycoprotein I antibodies, or lupus anticoagulant. Both aPL positivity and levels were similar in patients with active LN and non-renal SLE. Following induction treatment for LN, serum IgG/IgM aPL levels decreased in responders (p<0.005 for all), but not in non-responders. Both at active LN and post-treatment, patients with IgG, but not IgM, aPL had higher creatinine levels compared with patients without IgG aPL. Neither aPL positivity nor levels were associated with changes in eGFR from either baseline or post-treatment through long-term follow-up. Moreover, aPL positivity and levels both at baseline and post-treatment were similar in patients with a CKD stage ≥3 versus 1–2 at the last follow-up. In conclusion, neither aPL positivity nor levels were found to be associated with the occurrence of LN in SLE patients. However, IgG aPL positivity in LN patients was associated with a short-term impairment of the renal function while no effect on long-term renal outcome was observed. Furthermore, IgG and IgM aPL levels decreased following induction treatment only in responders, indicating that aPL levels are affected by

  3. The Role of Autophagy in Lupus Nephritis.

    PubMed

    Wang, Linlin; Law, Helen Ka Wai

    2015-01-01

    Systemic lupus erythematosus (SLE) is a multifactorial autoimmune disease characterized by the generation of immune responses to self-antigens. Lupus nephritis is one of the most common and severe complications in SLE patients. Though the pathogenesis of lupus nephritis has been studied extensively, unresolved questions are still left and new therapeutic methods are needed for disease control. Autophagy is a conserved catabolic process through which cytoplasmic constituents can be degraded in lysosome and reused. Autophagy plays vital roles in maintaining cell homeostasis and is involved in the pathogenesis of many diseases. In particular, autophagy can affect almost all parts of the immune system and is involved in autoimmune diseases. Based on genetic analysis, cell biology, and mechanism studies of the classic and innovative therapeutic drugs, there are growing lines of evidence suggesting the relationship between autophagy and lupus nephritis. In the present review, we summarize the recent publications investigating the relationship between autophagy and lupus nephritis and provide a new perspective towards the pathogenesis of lupus nephritis. PMID:26506346

  4. The Role of Autophagy in Lupus Nephritis

    PubMed Central

    Wang, Linlin; Law, Helen Ka Wai

    2015-01-01

    Systemic lupus erythematosus (SLE) is a multifactorial autoimmune disease characterized by the generation of immune responses to self-antigens. Lupus nephritis is one of the most common and severe complications in SLE patients. Though the pathogenesis of lupus nephritis has been studied extensively, unresolved questions are still left and new therapeutic methods are needed for disease control. Autophagy is a conserved catabolic process through which cytoplasmic constituents can be degraded in lysosome and reused. Autophagy plays vital roles in maintaining cell homeostasis and is involved in the pathogenesis of many diseases. In particular, autophagy can affect almost all parts of the immune system and is involved in autoimmune diseases. Based on genetic analysis, cell biology, and mechanism studies of the classic and innovative therapeutic drugs, there are growing lines of evidence suggesting the relationship between autophagy and lupus nephritis. In the present review, we summarize the recent publications investigating the relationship between autophagy and lupus nephritis and provide a new perspective towards the pathogenesis of lupus nephritis. PMID:26506346

  5. 77 FR 38305 - Guidance for Industry on Lupus Nephritis Caused by Systemic Lupus Erythematosus-Developing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-27

    ... a notice published in the Federal Register of June 22, 2010 (75 FR 35492), FDA announced the... HUMAN SERVICES Food and Drug Administration Guidance for Industry on Lupus Nephritis Caused by Systemic Lupus Erythematosus--Developing Medical Products for Treatment; Withdrawal of Guidance AGENCY: Food...

  6. Hydroxychloroquine and pregnancy on lupus flares in Korean patients with systemic lupus erythematosus.

    PubMed

    Koh, J H; Ko, H S; Kwok, S-K; Ju, J H; Park, S-H

    2015-02-01

    We investigated the clinical and laboratory characteristics of pregnancies with systemic lupus erythematosus (SLE) and identified lupus flare predictors during pregnancy. Additionally, we examined lupus activity and pregnancy outcomes in SLE patients who continued, discontinued or underwent no hydroxychloroquine (HCQ) treatment during pregnancy. We retrospectively analyzed 179 pregnancies in 128 SLE patients at Seoul St. Mary's Hospital, Korea, between 1998 and 2012 and then assessed the clinical profiles and maternal and fetal outcomes. Overall, 90.5% of pregnancies resulted in a successful delivery and were divided into two groups: those who experienced lupus flares (80 pregnancies, 44.7%) and those who did not (99 pregnancies, 55.3%). Increased preeclampsia, preterm births, low birth weight, intrauterine growth restriction (IUGR), and low 1-minute Apgar scores occurred in pregnancies with lupus flares compared to pregnancies in quiescent disease. Lupus flares were predicted by HCQ discontinuation, a history of lupus nephritis, high pre-pregnancy serum uric acid and low C4 levels. Our study indicates that achieving pre-pregnancy remission and continuing HCQ treatment during pregnancy are important for preventing lupus flares. PMID:25305214

  7. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    PubMed

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  8. The challenges of lupus anticoagulants.

    PubMed

    Chighizola, Cecilia Beatrice; Raschi, Elena; Banzato, Alessandra; Borghi, Maria Orietta; Pengo, Vittorio; Meroni, Pier Luigi

    2016-01-01

    The term "lupus anticoagulant" (LA) refers to a heterogeneous group of immunoglobulins behaving as acquired in vitro inhibitors of coagulation. These antibodies, namely anti-β2GPI and anti-prothrombin antibodies, induce the in vitro elongation of clotting time interfering with phospholipid-dependent coagulation cofactors. Positive LA is associated with thrombosis and pregnancy complications, providing one of the three laboratory criteria for the classification of the anti-phospholipid syndrome. LA is the strongest predictor of clinical events, especially when associated with other anti-phospholipid antibodies. Much more controversial is the risk conveyed by isolated and weak LA. LA detection is technically laborious, envisaging screening, mixing and confirming tests. Hopefully critical issues in LA detection, such as the interference of anticoagulants, will be overcome, in the next future. PMID:26789237

  9. Remission of systematic lupus erythematosus.

    PubMed

    Drenkard, C; Villa, A R; Garcia-Padilla, C; Pérez-Vázquez, M E; Alarcón-Segovia, D

    1996-03-01

    The occurrence and characteristics of remissions in patients with systematic lupus erythematosus (SLE) have not been determined. We therefore studied this in a cohort of 667 patients and found that 156 patients had achieved at least 1 period of 1 year or more of treatment-free clinical remission. This represents an incidence density of 0.028 new cases/person/year. Remission occurred within the first 2 years of disease in 62 patients. The mean duration of first remission was 4.6 years (range, 1-21 yr), and 81 patients were still in the initial remission up until cutoff time. Half of the remaining 75 patients who flared after achieving remission have not entered again in remission. Twenty-six of the 38 patients who did remained in remission, and the remaining 12 had subsequent flares and remissions. Treatment-free remission accounted for a mean of 5.8 years, corresponding to half the time of follow-up. Remission was not limited to patients with mild disease: at least 41 patients achieved remission despite renal involvement, 19 had had neuropsychiatric lupus, 15 had had thrombocytopenia, and 8 had had hemolytic anemia. We also found that the longer the time lapse between the initial manifestation and the diagnosis of SLE, the less likely it was for a patient to enter into remission. There was a continuous increase in likelihood of achieving a first remission from the beginning of disease up to 30 years of disease duration, when it reached 70%. Patients who achieved remission had increased survival, independently of the effect of other disease manifestations that cause increased mortality. We conclude that a significant proportion of patients with SLE, including those with severe organ involvement, may become symptom-free and in need of no more medication, perhaps indefinitely. Our findings support the notion that, in general, SLE is a more benign disease than previously considered. PMID:8606630

  10. Spontaneous ureteral rupture in a patient with systemic lupus erythematosus

    SciTech Connect

    Benson, C.H.; Pennebaker, J.B.; Harisdangkul, V.; Songcharoen, S.

    1983-08-01

    A patient with known systemic lupus erythematosus had fever and symptoms of a lower urinary tract infection. Bone scintigraphy showed left ureteral perforation and necrosis with no demonstrable nephrolithiasis. It is speculated that this episode was due to lupus vasculitis.

  11. Study Suggests Causes for Lupus' Impact on Immune System

    MedlinePlus

    ... html Study Suggests Causes for Lupus' Impact on Immune System Certain cells seem to malfunction and create inflammation ... that help explain what's going wrong in the immune systems of people with lupus -- insight they hope will ...

  12. Lupus

    NASA Astrophysics Data System (ADS)

    Murdin, P.

    2000-11-01

    (the Wolf; abbrev. Lup, gen. Lupi; area 334 sq. deg.) A southern constellation which lies between Centaurus and Scorpius, and culminates at midnight in early May. It has long been associated with a wild animal, though the identification with a wolf dates from comparatively recent times. It is usually shown on early celestial charts as a wolf impaled on a thyrsus (staff) held by Chiron, the centau...

  13. Lupus

    MedlinePlus

    ... scalp, or ears. photosensitivity: This means sensitivity to ultraviolet rays, like the ones that come from the sun ... wear lots of sunscreen and protective clothing because ultraviolet rays can bring on a flare. Smoking, drinking, and ...

  14. Lupus

    MedlinePlus

    ... the body. Common symptoms include fatigue , hair loss, sensitivity to the sun (photosensitivity), painful and swollen joints, ... when taking a deep breath Sun or light sensitivity Hair loss Purple or pale fingers or toes ...

  15. A Cryosampler Payload for Aseptic Air Sample Collection at Stratospheric Altitudes Using Balloons.

    NASA Astrophysics Data System (ADS)

    Sreenivasan, S.; Dutt, C. B. S.; Bhargava, P.; Shivaji, S.; Manchanda, R. K.

    A balloon borne Astrobiology program is being conducted from the National Balloon Facility of the Tata Institute of Fundamental Research at Hyderabad India in which a liquid Neon cooled cryo pump collects air samples under sterile conditions in the altitude regime 19 - 41 Km Pursuant to the encouraging results obtained from an earlier experiment conducted on January 2001 a new payload was configured and the balloon flight was conducted on April 20 2005 after implementing much more rigorous and enhanced sterilization protocol to completely rule out contamination from ground Air samples were collected in the altitude region 20 - 41 Km and are under analysis in the National laboratories in India for detecting the presence of living microbial cells In this paper we discuss the design and fabrication of the air sample collection probes the stringent sterilization protocol evolved for ensuring that the probes are aseptic before the commencement of the experiment and the sample retrival methods for analysis in the laboratory

  16. Innovative food processing technology using ohmic heating and aseptic packaging for meat.

    PubMed

    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko

    2014-02-01

    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage. PMID:24200557

  17. Overcoming issues associated with the scale-up of a continuous flow microwave system for aseptic processing of vegetable purees

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Continuous flow microwave heating is a promising alternative to conventional heating for aseptic processing of low-acid vegetable purees. However, non-uniform temperature distribution and control of processing parameters are the major hurdles in the implementation of continuous flow microwave heatin...

  18. The value of suction drainage fluid culture during aseptic and septic orthopedic surgery: a prospective study of 901 patients.

    PubMed

    Bernard, L; Pron, B; Vuagnat, A; Gleizes, V; Signoret, F; Denormandie, P; Si-Ali, A; Perrone, C; Feron, J M; Gaillard, J L

    2002-01-01

    There are no guidelines on the value of suction drainage fluid culture (SDC), and it is difficult to determine whether the organisms cultured from suction drainage fluid samples are pathogenic or simply contaminants. We performed 2989 cultures of suction drainage fluid samples obtained, during a 1-year period, from 901 patients who underwent aseptic or septic orthopedic surgery (946 operations). The culture results were analyzed to evaluate their ability to detect postoperative infection after aseptic operations or to detect either a persistent or new episode of sepsis in patients known to have infection. For aseptic operations, the sensitivity of SDC was 25%, the specificity was 99%, the positive predictive value was 25%, and the negative predictive value was 99%. For septic operations, the sensitivity of SDC was 81%, the specificity was 96%, the positive predictive value was 87%, and the negative predictive value was 94%. We conclude that, for aseptic orthopedic surgery, SDC is not useful in detecting postoperative infection. However, for septic orthopedic surgery, it is of clinical importance. PMID:11731944

  19. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Smith, Alistair

    2015-01-01

    Abstract There is growing interest in the development of methods capable of non‐invasive characterization of stem cells prior to their use in cell‐based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm−1 after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up‐regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non‐invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for

  20. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.

    1992-01-01

    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  1. Impact of donor arm cleaning with different aseptic solutions for prevention of contamination in blood bags.

    PubMed

    Patel, Tanvi G; Shukla, Rinku V; Gupte, Snehalata C

    2013-03-01

    Transfusion associated sepsis cases are encountered occasionally and bacterial transmission remains the major cause. The goal of our study was to compare the efficacy of disinfectants in phlebotomy site preparation. After selection of donor the antecubital fossa area of the arm was disinfected with different types of disinfectants namely sprit (70% isopropyl alcohol), povidone iodine (0.5% w/v available iodine in distilled water), savlon (1.5% v/v chlorhexidine gluconate solution and 3.0% cetrimide solution) and combination of sprit and povidone iodine. Swabs were collected from 20 donors using a sterile forceps, after cleaning with different antiseptic solutions. Swab was streaked on blood agar plate aseptically and the plate was incubated at 37°C for 24 h. Colonies were counted and a single colony was re-cultured by growing on nutrient and Mac-Conkey agar. The biochemical characteristics were determined by performing Gram staining, Motility, Catalase and Oxidase tests. The mean values of colonies were significantly higher with savlon compared to other three solutions. The difference was statistically significant by "t" test (t values 1.7-3.0; P < 0.05). Staphylococcus epidermidis, Staphylococcus sp., Streptococcus sp., Micrococcus sp., Bacillus megaterium and Bacillus cereus were the organisms identified. After completion of bleeding, samples from the bag were aseptically inoculated in aerobic and anaerobic culture bottles to be tested on BacT/Alert system. The bag containing donor's blood did not show any contamination when three cleanings were carried out using sprit, povidone iodine and spirit respectively. PMID:24426327

  2. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    PubMed

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. PMID:26441162

  3. Prospective study on the chemokine CXCL13 in neuroborreliosis and other aseptic neuroinfections.

    PubMed

    Pícha, D; Moravcová, L; Smíšková, D

    2016-09-15

    The study evaluates the clinical significance of CXCL13 (leukocyte chemoattractant synthesized in CSF ) in Lyme neuroborreliosis (LNB) and other aseptic CNS infections. 244 patients with symptoms of neuroinfection and/or LNB were divided into groups: A - patients with LNB-positive antibodies in serum and CSF (96) or CSF only (14); B - patients with aseptic non-borrelial neuroinfections (82); C - negative controls (52). Group A was divided into A1-A4 according to pleocytosis in CSF and AIIgG positivity. The highest CSF CXCL13 concentrations (max. 81,287.60pg/ml; median 1766.90pg/ml) were in A1 (positive AI, pleocytosis) and A3 (negative AIIgG, pleocytosis; max. 7201,60pg/ml, median 56.22pg/ml). A2 (positive AI without pleocytosis) and A4 (negative AI without pleocytosis) had low CXCL13 levels - A2 max. 650.50pg/ml (median<7.80pg/ml); A4 max. 118.56pg/ml (median<7.8pg/ml). In B the median was 28.10pg/ml (max. 595.87pg/ml). In C the CXCL13 concentrations were the lowest (max. 83.83pg/ml; median<7.80pg/ml). The lowest cut-off was 29pg/ml (sensitivity 90.0%, specificity 72.2%), the highest one 400pg/ml (sensitivity 59.6%, specificity 94.0%). The group differences of serum CXCL13 were insignificant. The highest concentrations were at the beginning of the disease. In LNB CXCL13 correlates better with the CSF pleocytosis than AI positivity. PMID:27538636

  4. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  5. Obstetric nephrology: lupus and lupus nephritis in pregnancy.

    PubMed

    Stanhope, Todd J; White, Wendy M; Moder, Kevin G; Smyth, Andrew; Garovic, Vesna D

    2012-12-01

    SLE is a multi-organ autoimmune disease that affects women of childbearing age. Renal involvement in the form of either active lupus nephritis (LN) at the time of conception, or a LN new onset or flare during pregnancy increases the risks of preterm delivery, pre-eclampsia, maternal mortality, fetal/neonatal demise, and intrauterine growth restriction. Consequently, current recommendations advise that the affected woman achieve a stable remission of her renal disease for at least 6 months before conception. Hormonal and immune system changes in pregnancy may affect disease activity and progression, and published evidence suggests that there is an increased risk for a LN flare during pregnancy. The major goal of immunosuppressive therapy in pregnancy is control of disease activity with medications that are relatively safe for a growing fetus. Therefore, the use of mycophenolate mofetil, due to increasing evidence supporting its teratogenicity, is contraindicated during pregnancy. Worsening proteinuria, which commonly occurs in proteinuric renal diseases toward the end of pregnancy, should be differentiated from a LN flare and/or pre-eclampsia, a pregnancy-specific condition clinically characterized by hypertension and proteinuria. These considerations present challenges that underscore the importance of a multidisciplinary team approach when caring for these patients, including a nephrologist, rheumatologist, and obstetrician who have experience with these pregnancy-related complications. This review discusses the pathogenesis, maternal and fetal risks, and management pertinent to SLE patients with new onset or a history of LN predating pregnancy. PMID:22879437

  6. Pyomyositis in childhood-systemic lupus erythematosus.

    PubMed

    Blay, Gabriela; Ferriani, Mariana P L; Buscatti, Izabel M; França, Camila M P; Campos, Lucia M A; Silva, Clovis A

    2016-01-01

    Pyomyositis is a pyogenic infection of skeletal muscle that arises from hematogenous spread and usually presents with localized abscess. This muscle infection has been rarely reported in adult-onset systemic lupus erythematous and, to the best of our knowledge, has not been diagnosed in pediatric lupus population. Among our childhood-onset systemic lupus erythematous population, including 289 patients, one presented pyomyositis. This patient was diagnosed with childhood-onset systemic lupus erythematous at the age of 10 years-old. After six years, while being treated with prednisone, azathioprine and hydroxychloroquine, she was hospitalized due to a 30-day history of insidious pain in the left thigh and no apparent trauma or fever were reported. Her physical examination showed muscle tenderness and woody induration. Laboratory tests revealed anemia, increased acute phase reactants and normal muscle enzymes. Computer tomography of the left thigh showed collection on the middle third of the vastus intermedius, suggesting purulent stage of pyomyositis. Treatment with broad-spectrum antibiotic was initiated, leading to a complete clinical resolution. In conclusion, we described the first case of pyomyositis during childhood in pediatric lupus population. This report reinforces that the presence of localized muscle pain in immunocompromised patients, even without elevation of muscle enzymes, should raise the suspicion of pyomyositis. A prompt antibiotic therapy is strongly recommended. PMID:27267338

  7. B Cell Signature during Inactive Systemic Lupus Is Heterogeneous: Toward a Biological Dissection of Lupus

    PubMed Central

    Blaison, Gilles; Knapp, Anne-Marie; Dembele, Doulaye; Ruer-Laventie, Julie; Korganow, Anne-Sophie; Martin, Thierry; Soulas-Sprauel, Pauline; Pasquali, Jean-Louis

    2011-01-01

    Systemic lupus erythematosous (SLE) is an autoimmune disease with an important clinical and biological heterogeneity. B lymphocytes appear central to the development of SLE which is characterized by the production of a large variety of autoantibodies and hypergammaglobulinemia. In mice, immature B cells from spontaneous lupus prone animals are able to produce autoantibodies when transferred into immunodeficient mice, strongly suggesting the existence of intrinsic B cell defects during lupus. In order to approach these defects in humans, we compared the peripheral B cell transcriptomas of quiescent lupus patients to normal B cell transcriptomas. When the statistical analysis is performed on the entire group of patients, the differences between patients and controls appear quite weak with only 14 mRNA genes having a false discovery rate ranging between 11 and 17%, with 6 underexpressed genes (PMEPA1, TLR10, TRAF3IP2, LDOC1L, CD1C and EGR1). However, unforced hierarchical clustering of the microarrays reveals a subgroup of lupus patients distinct from both the controls and the other lupus patients. This subgroup has no detectable clinical or immunological phenotypic peculiarity compared to the other patients, but is characterized by 1/an IL-4 signature and 2/the abnormal expression of a large set of genes with an extremely low false discovery rate, mainly pointing to the biological function of the endoplasmic reticulum, and more precisely to genes implicated in the Unfolded Protein Response, suggesting that B cells entered an incomplete BLIMP1 dependent plasmacytic differentiation which was undetectable by immunophenotyping. Thus, this microarray analysis of B cells during quiescent lupus suggests that, despite a similar lupus phenotype, different biological roads can lead to human lupus. PMID:21886837

  8. Systemic lupus erythematosus presenting as fulminant lupus pneumonitis: a rare case report.

    PubMed

    Aggarwal, H K; Jain, D; Mittal, A; Rao, A; Yadav, R K; Jain, P

    2016-01-01

    We report a case of 19 year-old female patient diagnosed as systemic lupus erythematosus (SLE) presented with fever and diffuse cutaneous lesions. During the hospital stay she had acute pneumonia, pleural effusion and respiratory failure, which required intensive care unit (ICU) care and mechanical ventilator support. A fulminant course of the disease, decreased values of complement levels and positive antinuclear antibodies (ANA) in pleural fluid and repeated negative sputum for acid-fast bacillus, blood cultures enabled diagnosis of fulminant lupus pneumonitis. Fulminant lupus pneumonitis is a rare but potentially life threatening complication of SLE. Management requires involvement of multiple specialties and rigorous efforts in reviving the patient. PMID:27339374

  9. Clinical outcome measures for Cutaneous Lupus Erythematosus

    PubMed Central

    Albrecht, Joerg; Werth, Victoria P.

    2011-01-01

    Cutaneous lupus erythematosus is a clinically heterogeneous group of rare skin diseases that only rarely have been subjected to controlled clinical trials. This may be have been partly due to a lack of suitable validated outcome instruments. Recently the FDA mandated that organ specific trials for lupus erythematosus need to use a combination of different outcome measures. The patient’s condition needs to be assessed in terms of quality of life, the patient’s global response and organ specific instruments that measure activity of the disease as well as damage due to the disease. For the skin the only formally validated and published instrument is currently the Cutaneous Lupus Erythematosis Disease Area and Severity Index (CLASI). This paper discusses the background of the development of the CLASI as well as issues related to its use and interpretation in the context of clinical research of CLE. PMID:20693208

  10. Fatal rhabdomyolysis in systemic lupus erythematosus.

    PubMed

    de Carvalho, Jozélio Freire; da Mota, Licia Maria Henrique; Bonfa, Eloisa

    2011-09-01

    The authors describe herein the sixth lupus case that evolved with rhabdomyolysis. A 36-year-old woman with systemic lupus erythematosus was admitted to our hospital with malaise, myalgia, dysphagia, fever, preserved muscle strength, leukocytosis (15,600 cells), and increased creatine kinase of 1,358 IU/L that reached 75,000 IU/L in few days. She denied the use of myotoxic drugs and alcohol. Urine 1 showed false positive for hemoglobinuria (myoglobin) without erythrocytes in the sediment, confirming the diagnosis of rhabdomyolysis. Secondary causes were excluded. She was treated with hyperhydration and alkalinization of urine. Despite treatment, the patient developed pulmonary congestion and she died. The authors also review in this article rhabdomyolysis in patients with systemic lupus erythematosus. PMID:21127876

  11. Arrhythmias presenting in neonatal lupus.

    PubMed

    Brucato, A; Previtali, E; Ramoni, V; Ghidoni, S

    2010-09-01

    Perfusion of human foetal heart with anti-Ro/SSA antibodies induces transient heart block. Anti-Ro/SSA antibodies may cross-react with T- and L-type calcium channels, and anti-p200 antibodies may cause calcium to accumulate in rat heart cells. These actions may explain a direct electrophysiological effect of these antibodies. Congenital complete heart block is the more severe manifestation of so-called "Neonatal Lupus". In clinical practice, it is important to distinguish in utero complete versus incomplete atrioventricular (AV) block, as complete AV block to date is irreversible, while incomplete AV block has been shown to be potentially reversible after fluorinated steroid therapy. Another issue is the definition of congenital AV block, as cardiologists have considered congenital blocks detected months or years after birth. We propose as congenital blocks detected in utero or within the neonatal period (0-27 days after birth). The possible detection of first degree AV block in utero, with different techniques, might be a promising tool to assess the effects of these antibodies. Other arrhythmias have been described in NL or have been linked to anti-Ro/SSA antibodies: first degree AV block, in utero and after birth, second degree (i.e. incomplete block), sinus bradycardia and QT prolongation, both in infants and in adults, ventricular arrhythmias (in adults). Overall, these arrhythmias have not a clinical relevance, but are important for research purposes. PMID:20696016

  12. Periodontitis and systemic lupus erythematosus.

    PubMed

    Sete, Manuela Rubim Camara; Figueredo, Carlos Marcelo da Silva; Sztajnbok, Flavio

    2016-01-01

    A large number of studies have shown a potential association between periodontal and autoimmune diseases, such as rheumatoid arthritis and systemic lupus erythematosus (SLE). Similar mechanisms of tissue destruction concerning periodontitis and other autoimmune diseases have stimulated the study of a possible relationship between these conditions. This study aims to review the literature about this potential association and their different pathogenic mechanisms. Considering that periodontal disease is a disease characterized by inflammation influenced by infectious factors, such as SLE, it is plausible to suggest that SLE would influence periodontal disease and vice versa. However, this issue is not yet fully elucidated and several mechanisms have been proposed to explain this association, as deregulation mainly in innate immune system, with action of phagocytic cells and proinflammatory cytokines such as IL-1β and IL-18 in both conditions' pathogenesis, leading to tissue destruction. However, studies assessing the relationship between these diseases are scarce, and more studies focused on common immunological mechanisms should be conducted to further understanding. PMID:27267530

  13. Symptoms, Causes, Diagnosis, and Treatment of Lupus | NIH MedlinePlus the Magazine

    MedlinePlus

    ... box NIH Accelerating Medicines Partnership www.nih.gov/science/amp/index.htm Lupus Foundation of America (LFA) and Julian Lennon www.lupus.org www.lupus.org/lennon American College of Rheumatology www.rheumatology.org Alliance for Lupus Research, Inc www.lupusresearch.org Lupus ...

  14. Why do patients with lupus nephritis die?

    PubMed Central

    Correia, P; Cameron, J S; Lian, J D; Hicks, J; Ogg, C S; Williams, D G; Chantler, C; Haycock, D G

    1985-01-01

    Over 20 years 42 of 138 patients with systemic lupus erythematosus "died"--that is, suffered actual death or went into terminal renal failure, or both; data from 41 were available for analysis. In most patients the causes of death were multiple. Twenty seven patients went into terminal renal failure, of whom 25 were offered dialysis treatment. Three regained renal function later, 12 survived on dialysis or with functioning kidney allografts--almost all with inactive lupus--but 13 died after starting dialysis, most within a few weeks or months. The principal causes were active lupus or infection. In those patients with renal failure after rapid deterioration in renal function (n = 14) there were nine deaths, while of 10 patients with a slow evolution into renal failure, only four died. Four patients with impaired and 10 with normal renal function died, again most often from complications of lupus or from infection. Vascular disease was a major cause of death in seven patients, all but two of whom were young; of 15 postmortem examinations, eight showed severe coronary artery atheroma, and three surviving patients required coronary bypass operations. Analysis of the timing of death or entry into renal failure showed that in 12 out of 13 patients who died within two years of onset the lupus was judged to be active, while this was true in only eight out of 19 patients who died later. Six of the seven vascular deaths occurred later than two years from onset, while only nine of 26 renal "deaths" occurred before two years; deaths from infections (n = 13) were distributed equally. Despite this and aggressive treatment of active disease, the principal cause of actual death was uncontrolled lupus. PMID:3917713

  15. Ofatumumab treatment in lupus nephritis patients.

    PubMed

    Haarhaus, Malena Loberg; Svenungsson, Elisabet; Gunnarsson, Iva

    2016-08-01

    Rituximab is frequently used in systemic lupus erythematosus; however, side effects such as infusion-related reactions limit its use. In this case report, we describe, for the first time, treatment with ofatumumab in four patients with lupus nephritis. The treatment was well tolerated in three of the patients, and a reduction of proteinuria was seen in all cases. This emphasizes the importance of alternative B-cell-depleting therapies in patients with an initial good response to rituximab, but who develop side effects. PMID:27478595

  16. Systemic lupus erythematosus. A prospective analysis.

    PubMed Central

    Grigor, R; Edmonds, J; Lewkonia, R; Bresnihan, B; Hughes, G R

    1978-01-01

    The spectrum of organ involvement in 50 patients with systemic lupus erythematosus has been assessed in a prospective study. All patients were admitted to hospital electively for 2 days and a complete clinical and laboratory assessment protocol completed. Subsequent hospital admissions depended on clinical status. The overall mean observation period was 29 months. Widespread multisystem involvement was found in every patient. Subclinical abnormalities of respiratory and cerebral function were common even in patients in clinical remission. A more conservative approach than has been generally recommended was used for the management of systemic lupus erythematosus and is supported by the estimated 5-year survival of 98%. PMID:646463

  17. Ofatumumab treatment in lupus nephritis patients

    PubMed Central

    Haarhaus, Malena Loberg; Svenungsson, Elisabet; Gunnarsson, Iva

    2016-01-01

    Rituximab is frequently used in systemic lupus erythematosus; however, side effects such as infusion-related reactions limit its use. In this case report, we describe, for the first time, treatment with ofatumumab in four patients with lupus nephritis. The treatment was well tolerated in three of the patients, and a reduction of proteinuria was seen in all cases. This emphasizes the importance of alternative B-cell-depleting therapies in patients with an initial good response to rituximab, but who develop side effects. PMID:27478595

  18. [Juvenile systemic lupus erythematosus with unusual manifestation of lupus-associated panniculitis].

    PubMed

    Hashemie, H; Klossowski, N; Oommen, P T; Neubert, J; Homey, B; Hoff, N-P; Reifenberger, J; Meller, S

    2015-10-01

    Juvenile systemic lupus erythematosus (JSLE) is a rare multisystem autoimmune disease with broad heterogeneity of clinical manifestations. Diagnosing JSLE is often very challenging. This life-threatening, unpredictable, and relapsing disease, which may affect various organ systems, requires interdisciplinary, lifelong care. Here, we report the case of a 13-year-old patient with JSLE suffering from recurrent arthralgia, lupus panniculitis, and rashes that were successfully treated with hydroxychloroquine and prednisolone. PMID:26335858

  19. Lupus podocytopathy: An important differential diagnosis of nephrotic syndrome in systemic lupus erythematosus

    PubMed Central

    Chaudhury, A. R.; Rajarajan, T.; Yousuf, R.; Fernando, E.; Kurien, A. A.

    2016-01-01

    Some patients with systemic lupus erythematosus (SLE) present with sudden onset of nephrotic syndrome and biopsy findings may be of minimal change disease or focal segmental glomerulosclerosis with diffuse foot process effacement on electron microscopy but without significant immune deposits. This entity is termed lupus podocytopathy. Clinicians and renal pathologists need to be aware of this condition. Though steroid sensitive, it needs follow-up to recognize flare and class change, thereby optimizing therapy. PMID:27512302

  20. Lupus podocytopathy: An important differential diagnosis of nephrotic syndrome in systemic lupus erythematosus.

    PubMed

    Chaudhury, A R; Rajarajan, T; Yousuf, R; Fernando, E; Kurien, A A

    2016-01-01

    Some patients with systemic lupus erythematosus (SLE) present with sudden onset of nephrotic syndrome and biopsy findings may be of minimal change disease or focal segmental glomerulosclerosis with diffuse foot process effacement on electron microscopy but without significant immune deposits. This entity is termed lupus podocytopathy. Clinicians and renal pathologists need to be aware of this condition. Though steroid sensitive, it needs follow-up to recognize flare and class change, thereby optimizing therapy. PMID:27512302

  1. Systemic lupus erythematosus presenting as acute lupus pneumonitis in a young female

    PubMed Central

    Chattopadhyay, B; Chatterjee, A; Maiti, A; Debnath, NB

    2015-01-01

    Acute lupus pneumonitis is a rare initial presentation of systemic lupus erythematosus (SLE). We report a 19-year-old female presenting with fever and recurrent hemoptysis with radiological evidence of parenchymal lung involvement with mild pleural effusion. Subsequent development of malar and discoid rash with anti-nuclear antibodies (ANA) and anti-dsDNA positivity clinched the diagnosis. Her clinical signs and symptoms resolved with a course of intravenous pulse methyl-prednisolone along with radiological resolution. PMID:25766350

  2. Systemic lupus erythematosus and fractures

    PubMed Central

    Bultink, Irene E M; Lems, Willem F

    2015-01-01

    Since survival of patients with systemic lupus erythematosus (SLE) has improved over the past decades, increasing attention is focused on complications of the disease. Osteoporosis and fractures contribute to damage in the second most frequently involved organ system in SLE: the musculoskeletal system. Recent studies have reported a high frequency of reduced bone mineral density in SLE, and an increased risk of peripheral and vertebral fractures. The incidence of symptomatic fractures is increased 1.2–4.7-fold in patients with SLE. A large population-based study on 4343 patients with SLE and 21 780 age-matched and sex-matched controls, demonstrated previous glucocorticoid use and longer disease duration as important risk factors for symptomatic fractures in SLE. Prevalent vertebral fractures are demonstrated in 18–50% of these relatively young patients, and one in three of these patients has normal bone density. The aetiology of bone loss in SLE is supposed to be multifactorial, involving clinical osteoporosis risk factors, systemic inflammation, serological factors, metabolic factors, hormonal factors, medication-induced adverse effects and, possibly, genetic factors. A 6-year follow-up study on Dutch patients with SLE revealed that low 25-hydroxyvitamin D serum levels, low body mass index and baseline use of antimalarials were associated with bone loss. In addition, a dose-dependent relationship between glucocorticoid use and bone loss was demonstrated in longitudinal studies in SLE. These findings have implications for daily clinical practice, because vitamin D insufficiency is highly frequent in SLE, antimalarials are regarded as ‘anchor drugs’ for therapy and the majority of patients with SLE are on chronic glucocorticoid treatment. PMID:26557383

  3. Thrombocytopenia in Systemic Lupus Erythematosus

    PubMed Central

    Jung, Jin-Hee; Soh, Moon-Seung; Ahn, Young-Hwan; Um, Yoo-Jin; Jung, Ju-Yang; Suh, Chang-Hee; Kim, Hyoun-Ah

    2016-01-01

    Abstract The aim of the study was to examine the clinical characteristics and prognosis according to severity of thrombocytopenia and response to treatment for thrombocytopenia in patients with systemic lupus erythematosus (SLE). We retrospectively evaluated 230 SLE patients with thrombocytopenia, and reviewed their clinical data and laboratory findings. Thrombocytopenia was defined as platelet counts under 100,000/mm3, and patients were divided into 3 thrombocytopenia groups according to severity: mild (platelet counts >50,000/mm3), moderate (>20,000/mm3, ≤50,000/mm3), and severe (≤20,000/mm3). Clinical characteristics, treatments, and prognoses were compared among the groups. Furthermore, complete remission of thrombocytopenia was defined as platelet counts >100,000/mm3 after treatment. There was no significant difference in clinical or laboratory findings among the groups according to severity of thrombocytopenia. However, hemorrhagic complications were more frequent in severe thrombocytopenia (P < 0.001) and mortality was also higher (P = 0.001). Complete remission was achieved in 85.2% of patients. The clinical characteristics and modality of treatment did not differ between the patients with and without complete remission. Mortality in patients with complete remission (1.5%) was significantly lower than in those without complete remission (29.4%, P < 0.001). Survival was significantly higher in patients with complete remission from thrombocytopenia (odds ratio = 0.049, 95% confidence interval: 0.013–0.191, P < 0.001). The severity of thrombocytopenia in SLE patients can be a useful independent prognostic factor to predict survival. Moreover, complete remission of thrombocytopenia after treatment is an important prognostic factor. The severity of thrombocytopenia and response to treatment should be closely monitored to predict prognosis in SLE patients. PMID:26871854

  4. Vasculitis in systemic lupus erythematosus.

    PubMed

    Drenkard, C; Villa, A R; Reyes, E; Abello, M; Alarcón-Segovia, D

    1997-01-01

    We studied the frequency, location, clinical and histopathological features, associated manifestations, and prognosis of vasculitides in a cohort of 667 SLE patients. Exclusion of patients with previous vasculitis or insufficient information left 540 patients, 194 of whom has vasculitis (incidence density: 0.053 new cases/person/year, cumulative incidence of 0.051 at one year, 0.232 at 5 years and 0.411 at 10 years). Vasculitis was confirmed by biopsy in 46 cases, by arteriography in five, and by both in three. A single episode of vasculitis occurred in 119 and two or more in 75 patients. Vasculitis was cutaneous in 160, visceral in 24, both in 10. In the first episode of cutaneous vasculitides, 111 had punctuate lesions, 32 palpable purpura, 6 urticaria, 6 ulcers, 8 papules, 5 erythematous plaques or macules confirmed with biopsy, 2 erythema with necrosis, and 1 panniculitis (plus small vessel vasculitis). Of 29 with visceral vasculitis in the first episode, 19 had mononeuritis multiplex, 5 digital necrosis, 3 large artery vasculitis of limbs, one mesenteric, and one coronary, more than one type could appear simultaneously or in subsequent episodes. Patients with vasculitis had longer disease duration and followup, younger age of onset of SLE, and were more frequently males than those without. Lupus manifestations associated with vasculitis in univariate logistic regression included myocarditis, psychosis, Raynaud's phenomenon, serositis, leukopenia, lymphopenia and pleuritis. Vasculitis also associated with the antiphospholipid syndrome. The strength of this association increased when patients with vasculitis confirmed by biopsy and/or arteriography were considered separately. Visceral vasculitis associated with increased mortality when controlled for age of onset and nephropathy. PMID:9104729

  5. Progress Made in Lupus Diagnosis and Treatment | NIH MedlinePlus the Magazine

    MedlinePlus

    ... of this page please turn JavaScript on. Feature: Lupus Progress Made in Lupus Diagnosis and Treatment Past Issues / Spring 2014 Table ... W. Clark NIAMS For our readers who have lupus or are the loved ones of someone with ...

  6. Lupus: When the Body Attacks Itself | NIH MedlinePlus the Magazine

    MedlinePlus

    ... of this page please turn JavaScript on. Feature: Lupus Lupus: When the Body Attacks Itself Past Issues / Spring 2014 Table of Contents fast facts 1 Lupus occurs when the body's immune system attacks the ...

  7. Should I Be Following a Specific Diet or Nutrition Plan for My Lupus?

    MedlinePlus

    ... Lupus 15 Questions - Nervous System Issues 15 Questions - Healthy Eating 15 Questions - Strategies for Restful Sleep 15 Questions - ... with lupus Should I be following a specific diet or nutrition plan for my lupus? There is ...

  8. Lupus: When the Body Attacks Itself | NIH MedlinePlus the Magazine

    MedlinePlus

    ... please turn JavaScript on. Feature: Lupus Lupus: When the Body Attacks Itself Past Issues / Spring 2014 Table of Contents fast facts 1 Lupus occurs when the body's immune system attacks the body itself. It ...

  9. Symptoms, Causes, Diagnosis, and Treatment of Lupus | NIH MedlinePlus the Magazine

    MedlinePlus

    ... page please turn JavaScript on. Feature: Lupus Causes, Diagnosis, and Treatment of Lupus Past Issues / Spring 2014 ... and can cause damage to organs and tissues. Diagnosis Diagnosing lupus can be difficult. It may take ...

  10. ABIN1 Dysfunction as a Genetic Basis for Lupus Nephritis

    PubMed Central

    Caster, Dawn J.; Korte, Erik A.; Nanda, Sambit K.; McLeish, Kenneth R.; Oliver, Rebecca K.; G'Sell, Rachel T.; Sheehan, Ryan M.; Freeman, Darrell W.; Coventry, Susan C.; Kelly, Jennifer A.; Guthridge, Joel M.; James, Judith A.; Sivils, Kathy L.; Alarcon-Riquelme, Marta E.; Scofield, R. Hal; Adrianto, Indra; Gaffney, Patrick M.; Stevens, Anne M.; Freedman, Barry I.; Langefeld, Carl D.; Tsao, Betty P.; Pons-Estel, Bernardo A.; Jacob, Chaim O.; Kamen, Diane L.; Gilkeson, Gary S.; Brown, Elizabeth E.; Alarcon, Graciela S.; Edberg, Jeffrey C.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Harley, John B.; Kaufman, Kenneth M.; Reveille, John D.; Anaya, Juan-Manuel; Criswell, Lindsey A.; Vila, Luis M.; Petri, Michelle; Ramsey-Goldman, Rosalind; Bae, Sang-Cheol; Boackle, Susan A.; Vyse, Timothy J.; Niewold, Timothy B.; Cohen, Philip

    2013-01-01

    The genetic factors underlying the pathogenesis of lupus nephritis associated with systemic lupus erythematosus are largely unknown, although animal studies indicate that nuclear factor (NF)-κB is involved. We reported previously that a knockin mouse expressing an inactive form of ABIN1 (ABIN1[D485N]) develops lupus-like autoimmune disease and demonstrates enhanced activation of NF-κB and mitogen-activated protein kinases in immune cells after toll-like receptor stimulation. In the current study, we show that ABIN1[D485N] mice develop progressive GN similar to class III and IV lupus nephritis in humans. To investigate the clinical relevance of ABIN1 dysfunction, we genotyped five single-nucleotide polymorphisms in the gene encoding ABIN1, TNIP1, in samples from European-American, African American, Asian, Gullah, and Hispanic participants in the Large Lupus Association Study 2. Comparing cases of systemic lupus erythematosus with nephritis and cases of systemic lupus erythematosus without nephritis revealed strong associations with lupus nephritis at rs7708392 in European Americans and rs4958881 in African Americans. Comparing cases of systemic lupus erythematosus with nephritis and healthy controls revealed a stronger association at rs7708392 in European Americans but not at rs4958881 in African Americans. Our data suggest that variants in the TNIP1 gene are associated with the risk for lupus nephritis and could be mechanistically involved in disease development via aberrant regulation of NF-κB and mitogen-activated protein kinase activity. PMID:23970121

  11. Lupus a Tough Disease to Spot, Treat

    MedlinePlus

    ... Español You Are Here: Home → Latest Health News → Article URL of this page: https://medlineplus.gov/news/fullstory_159098.html Lupus a Tough Disease to Spot, Treat But experts say scientists are working to unearth genetic causes of autoimmune ...

  12. Record high Wolf, Canis lupus, pack density

    USGS Publications Warehouse

    Mech, L.D.; Tracy, S.

    2004-01-01

    This report documents a year-around Wolf (Canis lupus) density of 18.2/100 km2 and a summer density of 30.8/100 km2, in a northeastern Minnesota Wolf pack. The previous record was a summer density of 14.1/100 km2, for a Wolf pack on Vancouver Island, British Columbia, Canada.

  13. Record high wolf, Canis lupus, pack density

    USGS Publications Warehouse

    Mech, L.D.; Tracy, S.

    2004-01-01

    This report documents a year-around wolf (Canis lupus) density of 18.2/100 m2 and summer density of 30.8/100 km2, in a northeastern Minnesota wolf pack. The previous record was a summer density of 14.1/100 km2, for a wolf pack on Vancouver Island, BC, Canada.

  14. Induction of lupus autoantibodies by adjuvants

    USGS Publications Warehouse

    Satoh, M.; Kuroda, Y.; Yoshida, H.; Behney, K.M.; Mizutani, A.; Akaogi, J.; Nacionales, D.C.; Lorenson, T.D.; Rosenbauer, R.J.; Reeves, W.H.

    2003-01-01

    Exposure to the hydrocarbon oil pristane induces lupus specific autoantibodies in non-autoimmune mice. We investigated whether the capacity to induce lupus-like autoimmunity is a unique property of pristane or is shared by other adjuvant oils. Seven groups of 3-month-old female BALB/cJ mice received a single intraperitoneal injection of pristane, squalene (used in the adjuvant MF59), incomplete Freund's adjuvant (IFA), three different medicinal mineral oils, or saline, respectively. Serum autoantibodies and peritoneal cytokine production were measured. In addition to pristane, the mineral oil Bayol F (IFA) and the endogenous hydrocarbon squalene both induced anti-nRNP/Sm and -Su autoantibodies (20% and 25% of mice, respectively). All of these hydrocarbons had prolonged effects on cytokine production by peritoneal APCs. However, high levels of IL-6, IL-12, and TNF?? production 2-3 months after intraperitoneal injection appeared to be associated with the ability to induce lupus autoantibodies. The ability to induce lupus autoantibodies is shared by several hydrocarbons and is not unique to pristane. It correlates with stimulation of the production of IL-12 and other cytokines, suggesting a relationship with a hydrocarbon's adjuvanticity. The potential to induce autoimmunity may complicate the use of oil adjuvants in human and veterinary vaccines. ?? 2003 Elsevier Ltd. All rights reserved.

  15. Thrombotic thrombocytopenic purpura and systemic lupus erythematosus.

    PubMed Central

    Fox, D A; Faix, J D; Coblyn, J; Fraser, P; Smith, B; Weinblatt, M E

    1986-01-01

    We report two patients with systemic lupus erythematosus who subsequently developed thrombotic thrombocytopenic purpura. In each case the coexistence of these two conditions was confirmed by pathological findings. Both patients responded to treatment, but one eventually died. A review of the literature suggests a possible relationship between the two disorders. Images PMID:3707220

  16. [Systemic lupus erythematosus and regulatory T cells].

    PubMed

    Miyara, M; Amoura, Z; Piette, J-C; Gorochov, G

    2008-09-01

    A global depletion of FoxP3+ CD25(bright) CD4+ regulatory T cell is observed during lupus flares. This phenomenon is not the consequence of the relocalization of Tregs in diseased organs but could be related to their specific sensitivity to Fas mediated apoptosis. Several therapeutic perspectives can be drawn taking into account these pathophysiological insights. PMID:18538896

  17. Challenges for lupus management in emerging countries.

    PubMed

    Tazi Mezalek, Zoubida; Bono, Wafaa

    2014-06-01

    In emerging countries, systemic lupus erythematosus (SLE) has been associated with several unfavorable outcomes including disease activity, damage accrual, work disability and mortality. Poor socioeconomic status (SES) and lack of access to healthcare, especially in medically underserved communities, may be responsible for many of the observed disparities. Diagnostic delay of SLE or for severe organ damages (renal involvement) have a negative impact on those adverse outcomes in lupus patients who either belong to minority groups or live in emerging countries. Longitudinal and observational prospective studies and registries may help to identify the factors that influence poor SLE outcomes in emerging countries. Infection is an important cause of mortality and morbidity in SLE, particularly in low SES patients and tuberculosis appears to be frequent in SLE patients living in endemic areas (mainly emerging countries). Thus, tuberculosis screening should be systematically performed and prophylaxis discussed for patients from these areas. SLE treatment in the developing world is restricted by the availability and cost of some immunosuppressive drugs. Moreover, poor adherence has been associated to bad outcomes in lupus patients with a higher risk of flares, morbidity, hospitalization, and poor renal prognosis. Low education and the lack of money are identified as the main barrier to improve lupus prognosis. Newer therapeutic agents and new protocols had contributed to improve survival in SLE. The use of corticoid-sparing agents (hydroxychloroquine, methotrexate, azathioprine and mycophenolate mofetif) is one of the most useful strategy; availability of inexpensive generics may help to optimize access to these medications. PMID:24857588

  18. Environmental Factors, Toxicants and Systemic Lupus Erythematosus

    PubMed Central

    Mak, Anselm; Tay, Sen Hee

    2014-01-01

    Systemic lupus erythematosus (SLE) is an immune-complex-mediated multi-systemic autoimmune condition of multifactorial etiology, which mainly affects young women. It is currently believed that the onset of SLE and lupus flares are triggered by various environmental factors in genetically susceptible individuals. Various environmental agents and toxicants, such as cigarette smoke, alcohol, occupationally- and non-occupationally-related chemicals, ultraviolet light, infections, sex hormones and certain medications and vaccines, have been implicated to induce SLE onset or flares in a number case series, case-control and population-based cohort studies and very few randomized controlled trials. Here, we will describe some of these recognized environmental lupus triggering and perpetuating factors and explain how these factors potentially bias the immune system towards autoimmunity through their interactions with genetic and epigenetic alterations. Further in-depth exploration of how potentially important environmental factors mechanistically interact with the immune system and the genome, which trigger the onset of SLE and lupus flares, will certainly be one of the plausible steps to prevent the onset and to decelerate the progress of the disease. PMID:25216337

  19. Thrombotic thrombocytopenic purpura preceding systemic lupus erythematosus.

    PubMed Central

    Simeon-Aznar, C P; Cuenca-Luque, R; Fonollosa-Pla, V; Bosch-Gil, J A

    1992-01-01

    The case of a patient admitted with thrombotic thrombocytopenic purpura nine years after developing systemic lupus erythematosus (SLE) is reported. Thrombotic thrombocytopenic purpura associated with SLE has been described on other occasions, but in most patients the diagnosis of SLE precedes that of thrombotic thrombocytopenic purpura. The unusual sequence and the chronological separation of the two diseases is emphasised. PMID:1575591

  20. Mapping susceptibility gene in systemic lupus erythematosus.

    PubMed

    Scofield, R Hal; Kaufman, Kenneth M

    2012-01-01

    Genome-wide association studies have identified many dozen genetic intervals that harbor single-nucleotide polymorphisms (SNPs) showing statistical association with systemic lupus erythematosus. Despite the wealth of data produced, there are limitations of these studies. The causal alleles at a given locus are not identified; only SNP is strong linkage disequilibrium with the putative causative alleles. In order to address identification of the causative SNPs for lupus susceptibility genes, we have initiated a candidate gene study for which more than 40 investigators have contributed patient and control samples. In addition, these investigators have designated SNPs to be placed on a custom array. In this way fine mapping of genetic association findings can occur in order to identify causal alleles. These efforts have thus far benefitted greatly from comparisons of different ethnicities. Work on about ten previously identified associations has been published using this resource. Genome-wide association studies cannot identify rare SNPs or mutations, which may impart greater relative risks than common variants. Much of the genetics of lupus may be from rare variants or mutations. In order to approach this aspect of lupus genetics, next-generation sequencing has begun in which all exons will be sequenced in controls and patients. This effort can also be used to identify causal alleles from association intervals not yet otherwise identified. PMID:22933063

  1. Impressive Subcutaneous Calcifications in Systemic Lupus Erythematosus

    PubMed Central

    DIMA, Alina; BERZEA, Ioana; BAICUS, Cristian

    2015-01-01

    Dystrophic calcinosis cutis was commonly described in long-term dermatomyositis or systemic sclerosis, being rarely reported in other connective tissue diseases. We report the case of a 65-years old woman with an only 5-years history of systemic lupus erythematosus, who presents with multiple, impressive subcutaneous calcified masses and biological normal serum calcium and phosphate levels. PMID:26225152

  2. Epigenetics and Systemic Lupus Erythematosus: Unmet Needs.

    PubMed

    Meroni, Pier Luigi; Penatti, Alessandra Emiliana

    2016-06-01

    Systemic lupus erythematosus (SLE) is a chronic relapsing-remitting autoimmune disease affecting several organs. Although the management of lupus patients has improved in the last years, several aspects still remain challenging. More sensitive and specific biomarkers for an early diagnosis as well as for monitoring disease activity and tissue damage are needed. Genome-wide association and gene mapping studies have supported the genetic background for SLE susceptibility. However, the relatively modest risk association and the studies in twins have suggested a role for environmental and epigenetic factors, as well as genetic-epigenetic interaction. Accordingly, there is evidence that differences in DNA methylation, histone modifications, and miRNA profiling can be found in lupus patients versus normal subjects. Moreover, impaired DNA methylation on the inactive X-chromosome was suggested to explain, at least in part, the female prevalence of the disease. Epigenetic markers may be help in fulfilling the unmet needs for SLE by offering new diagnostic tools, new biomarkers for monitoring disease activity, or to better characterize patients with a silent clinical disease but with an active serology. Anti-DNA, anti-phospholipid, and anti-Ro/SSA autoantibodies are thought to be pathogenic for glomerulonephritis, recurrent thrombosis and miscarriages, and neonatal lupus, respectively. However, tissue damage occurs occasionally or, in some patients, only in spite of the persistent presence of the antibodies. Preliminary studies suggest that epigenetic mechanisms may explain why the damage takes place in some patients only or at a given time. PMID:26206675

  3. Thyroid disorders in systemic lupus erythematosus.

    PubMed Central

    Goh, K L; Wang, F

    1986-01-01

    Of 319 patients with systemic lupus erythematosus (SLE), nine had thyrotoxicosis, three had hypothyroidism, and two had thyroiditis. This prevalence seems greater than that of similar thyroid disorders seen in the general population. It is suggested that patients with autoimmune thyroid disorders may develop SLE or vice versa. This association requires confirmation by prospective study. PMID:3740982

  4. Systemic lupus erythematosus and Raynaud's phenomenon*

    PubMed Central

    Heimovski, Flavia Emilie; Simioni, Juliana A.; Skare, Thelma Larocca

    2015-01-01

    BACKGROUND Patients with systemic lupus erythematosus seem to belong to different serological and clinical subgroups of the disease. Genetic background can cause the appearance of these subgroups. OBJECTIVE To determine whether Brazilian patients who have systemic lupus erythematosus and Raynaud's phenomenon differ from those who do not. METHODS Retrospective analysis of 373 medical records of systemic lupus erythematosus patients studied for demographic, clinical and serological data. A comparative analysis was performed of individuals with and without RP. RESULTS There was a positive association between Raynaud's phenomenon and age at diagnosis (p=0.02), presence of anti-Sm (p=0.01) antibodies and anti-RNP (p<0.0001). Furthermore, a negative association was found between Raynaud's phenomenon and hemolysis (p=0.01), serositis (p=0.01), glomerulonephritis (p=0.0004) and IgM aCL (p=0.004) antibodies. CONCLUSION Raynaud's phenomenon patients appear to belong to a systemic lupus erythematosus subset with a spectrum of clinical manifestations located in a more benign pole of the disease. PMID:26734864

  5. Bilateral non-traumatic aseptic osteonecrosis in the femoral head. An experimental study of incidence

    SciTech Connect

    Hauzeur, J.P.; Pasteels, J.L.; Orloff, S.

    1987-10-01

    Thirty-five patients who were seen with non-traumatic aseptic osteonecrosis of the femoral head were included in a study of the contralateral hip to evaluate the incidence of bilateral disease. We used not only conventional radiography and scintigraphy but also measurement of intramedullary pressure and core biopsy. Pain was caused by 14.3 per cent of the contralateral hips, a lesion was demonstrated on plain radiographs in 51.4 per cent, and increased isotopic uptake was seen in 31.4 per cent. Histological study of specimens obtained by osteomedullary biopsy (after special procedure) showed bilateral necrosis in 88.5 per cent of the patients. After a mean follow-up of thirty-four months, only one of nine hips that were painless and had negative radiographic and isotopic findings, but had positive findings on biopsy, became painful and radiographically positive. The intramedullary pressure in the intertrochanteric area was recorded in each hip, and no correlation was found with the radiographic stage or with pain.

  6. Controlled Human Malaria Infection of Tanzanians by Intradermal Injection of Aseptic, Purified, Cryopreserved Plasmodium falciparum Sporozoites

    PubMed Central

    Shekalaghe, Seif; Rutaihwa, Mastidia; Billingsley, Peter F.; Chemba, Mwajuma; Daubenberger, Claudia A.; James, Eric R.; Mpina, Maximillian; Ali Juma, Omar; Schindler, Tobias; Huber, Eric; Gunasekera, Anusha; Manoj, Anita; Simon, Beatus; Saverino, Elizabeth; Church, L. W. Preston; Hermsen, Cornelus C.; Sauerwein, Robert W.; Plowe, Christopher; Venkatesan, Meera; Sasi, Philip; Lweno, Omar; Mutani, Paul; Hamad, Ali; Mohammed, Ali; Urassa, Alwisa; Mzee, Tutu; Padilla, Debbie; Ruben, Adam; Lee Sim, B. Kim; Tanner, Marcel; Abdulla, Salim; Hoffman, Stephen L.

    2014-01-01

    Controlled human malaria infection (CHMI) by mosquito bite has been used to assess anti-malaria interventions in > 1,500 volunteers since development of methods for infecting mosquitoes by feeding on Plasmodium falciparum (Pf) gametocyte cultures. Such CHMIs have never been used in Africa. Aseptic, purified, cryopreserved Pf sporozoites, PfSPZ Challenge, were used to infect Dutch volunteers by intradermal injection. We conducted a double-blind, placebo-controlled trial to assess safety and infectivity of PfSPZ Challenge in adult male Tanzanians. Volunteers were injected intradermally with 10,000 (N = 12) or 25,000 (N = 12) PfSPZ or normal saline (N = 6). PfSPZ Challenge was well tolerated and safe. Eleven of 12 and 10 of 11 subjects, who received 10,000 and 25,000 PfSPZ respectively, developed parasitemia. In 10,000 versus 25,000 PfSPZ groups geometric mean days from injection to Pf positivity by thick blood film was 15.4 versus 13.5 (P = 0.023). Alpha-thalassemia heterozygosity had no apparent effect on infectivity. PfSPZ Challenge was safe, well tolerated, and infectious. PMID:25070995

  7. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    PubMed

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products. PMID:20549988

  8. The Lupus Family Registry and Repository

    PubMed Central

    Rasmussen, Astrid; Sevier, Sydney; Kelly, Jennifer A.; Glenn, Stuart B.; Aberle, Teresa; Cooney, Carisa M.; Grether, Anya; James, Ellen; Ning, Jared; Tesiram, Joanne; Morrisey, Jean; Powe, Tiny; Drexel, Mark; Daniel, Wes; Namjou, Bahram; Ojwang, Joshua O.; Nguyen, Kim L.; Cavett, Joshua W.; Te, Jeannie L.; James, Judith A.; Scofield, R. Hal; Moser, Kathy; Gilkeson, Gary S.; Kamen, Diane L.; Carson, Craig W.; Quintero-del-Rio, Ana I.; Ballesteros, Maria del Carmen; Punaro, Marilynn G.; Karp, David R.; Wallace, Daniel J.; Weisman, Michael; Merrill, Joan T.; Rivera, Roberto; Petri, Michelle A.; Albert, Daniel A.; Espinoza, Luis R.; Utset, Tammy O.; Shaver, Timothy S.; Arthur, Eugene; Anaya, Juan-Manuel; Bruner, Gail R.

    2011-01-01

    The Lupus Family Registry and Repository (LFRR) was established with the goal of assembling and distributing materials and data from families with one or more living members diagnosed with SLE, in order to address SLE genetics. In the present article, we describe the problems and solutions of the registry design and biometric data gathering; the protocols implemented to guarantee data quality and protection of participant privacy and consent; and the establishment of a local and international network of collaborators. At the same time, we illustrate how the LFRR has enabled progress in lupus genetics research, answering old scientific questions while laying out new challenges in the elucidation of the biologic mechanisms that underlie disease pathogenesis. Trained staff ascertain SLE cases, unaffected family members and population-based controls, proceeding in compliance with the relevant laws and standards; participant consent and privacy are central to the LFRR’s effort. Data, DNA, serum, plasma, peripheral blood and transformed B-cell lines are collected and stored, and subject to strict quality control and safety measures. Coded data and materials derived from the registry are available for approved scientific users. The LFRR has contributed to the discovery of most of the 37 genetic associations now known to contribute to lupus through 104 publications. The LFRR contains 2618 lupus cases from 1954 pedigrees that are being studied by 76 approved users and their collaborators. The registry includes difficult to obtain populations, such as multiplex pedigrees, minority patients and affected males, and constitutes the largest collection of lupus pedigrees in the world. The LFRR is a useful resource for the discovery and characterization of genetic associations in SLE. PMID:20864496

  9. Childhood-onset systemic lupus erythematosus.

    PubMed Central

    Olowu, Wasiu

    2007-01-01

    OBJECTIVES: To describe the initial clinicolaboratory manifestations and short-term outcome in a series of Nigerian children with systemic lupus erythematosus (SLE). METHODS: A nonrandomized prospective study of consecutive cases of childhood-onset SLE. Baseline and follow-up clinicolaboratory data were collected and analyzed. Each patient was followed up for 12 months. RESULTS: Eleven children were studied. There were seven girls (F:M, 1.75). Mean ages at lupus onset and diagnosis were 10.0 +/- 2.53 years and 11.2 +/- 2.53 years, respectively. Mean time at onset of renal disease following SLE symptoms onset was 1.22 +/- 0.93 years. All cases were misdiagnosed prior to presentation; diagnosis was delayed in nine patients. Lupus activity was mild, moderate and severe in two, five and four patients, respectively. Hypertension (n = 5), nephrotic syndrome (n = 6), microerythrocyturia (n = 6) and acute renal failure (n = 7) were associated morbidities. Of the 27 presenting clinical features, 17 were nondiagnostic, while 10 were diagnostic. Fever (n = 9) was a major nondiagnostic symptom; major diagnostic manifestations were lupus nephritis (n = 11), arthritis (n = 10) and serositis (n = 7). Catastrophic antiphospholipid syndrome was diagnosed in three. The glomerular lesions were nonproliferative (n = 1), focal (n = 3) and diffuse (n = 7) proliferative lupus nephritis. Complete remission rate at end-point was 71.4%. Fourteen percent of the patients relapsed. Renal survival and mortality rates were 86.0% and 30.0%, respectively. CONCLUSION: In this study, severe renal and extrarenal comorbidities were common; mortality rate was also high. High frequency of misdiagnosis and delayed diagnosis were probably responsible for these. PMID:17668644

  10. T Tauri Disk Lifetime in the Lupus Association

    NASA Astrophysics Data System (ADS)

    Galli, P. A. B.; Bertout, C.; Teixeira, R.; Ducourant, C.

    2016-01-01

    In a recent study, we derived individual distances for a sample of pre-main sequence stars that define the comoving association of young stars in the Lupus star-forming region. Here, we use these new distances to investigate the mass and age distributions of Lupus T Tauri stars and derive the average disk lifetime in the Lupus association based on an empirical disk model.

  11. Elevated sacroilac joint uptake ratios in systemic lupus erythematosus

    SciTech Connect

    De Smet, A.A.; Mahmood, T.; Robinson, R.G.; Lindsley, H.B.

    1984-08-01

    Sacroiliac joint radiographs and radionuclide sacroiliac joint uptake ratios were obtained on 14 patients with active systemic lupus erythematosus. Elevated joint ratios were found unilaterally in two patients and bilaterally in seven patients when their lupus was active. In patients whose disease became quiescent, the uptake ratios returned to normal. Two patients had persistently elevated ratios with continued clinical and laboratory evidence of active lupus. Mild sacroiliac joint sclerosis and erosions were detected on pelvic radiographs in these same two patients. Elevated quantitative sacroiliac joint uptake ratios may occur as a manifestation of active systemic lupus erythematosus.

  12. Transmission of seasonal outbreak of childhood enteroviral aseptic meningitis and hand-foot-mouth disease.

    PubMed

    Park, Sue K; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu; Cheong, Hae-Kwan

    2010-05-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD. PMID:20436701

  13. Tissue Engineering Chamber Promotes Adipose Tissue Regeneration in Adipose Tissue Engineering Models Through Induced Aseptic Inflammation

    PubMed Central

    Peng, Zhangsong; Dong, Ziqing; Chang, Qiang; Zhan, Weiqing; Zeng, Zhaowei; Zhang, Shengchang

    2014-01-01

    Tissue engineering chamber (TEC) makes it possible to generate significant amounts of mature, vascularized, stable, and transferable adipose tissue. However, little is known about the role of the chamber in tissue engineering. Therefore, to investigate the role of inflammatory response and the change in mechanotransduction started by TEC after implantation, we placed a unique TEC model on the surface of the groin fat pads in rats to study the expression of cytokines and tissue development in the TEC. The number of infiltrating cells was counted, and vascular endothelial growth factor (VEGF) and monocyte chemotactic protein-1 (MCP-1) expression levels in the chamber at multiple time points postimplantation were analyzed by enzyme-linked immunosorbent assay. Tissue samples were collected at various time points and labeled for specific cell populations. The result showed that new adipose tissue formed in the chamber at day 60. Also, the expression of MCP-1 and VEGF in the chamber decreased slightly from an early stage as well as the number of the infiltrating cells. A large number of CD34+/perilipin− perivascular cells could be detected at day 30. Also, the CD34+/perilipin+ adipose precursor cell numbers increased sharply by day 45 and then decreased by day 60. CD34−/perilipin+ mature adipocytes were hard to detect in the chamber content at day 30, but their number increased and then peaked at day 60. Ki67-positive cells could be found near blood vessels and their number decreased sharply over time. Masson's trichrome showed that collagen was the dominant component of the chamber content at early stage and was replaced by newly formed small adipocytes over time. Our findings suggested that the TEC implantation could promote the proliferation of adipose precursor cells derived from local adipose tissue, increase angiogenesis, and finally lead to spontaneous adipogenesis by inducing aseptic inflammation and changing local mechanotransduction. PMID:24559078

  14. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive. PMID:21225195

  15. Systemic lupus erythematosus in Nepal: A review.

    PubMed

    Kafle, M P; Lee, Vws

    2016-08-01

    Nepal is a small country that is landlocked between India and China. Several ethnic groups live within the 147,181 km(2) of this country. Geographic diversity ranges from the high Himalayas to the flatlands of the Ganges plains. Lupus nephritis (LN), a complication of systemic lupus erythematosus (SLE), is a common kidney problem in Nepal; but the real incidence and prevalence of SLE in Nepal is largely not known. Here, it more commonly affects people (mostly women) living in the southern flatlands, but SLE is reported to be uncommon further south in India. Even though the disease appears to be common, good quality research is uncommon in Nepali literature. This article was written to provide a review of the articles published to date about SLE in Nepal and to discuss the gaps in knowledge that require further evaluation. PMID:26957353

  16. Cutaneous manifestations of systemic lupus erythematosus.

    PubMed

    Uva, Luís; Miguel, Diana; Pinheiro, Catarina; Freitas, João Pedro; Marques Gomes, Manuel; Filipe, Paulo

    2012-01-01

    Systemic lupus erythematosus (SLE) is a multiorgan autoimmune disease of unknown etiology with many clinical manifestations. The skin is one of the target organs most variably affected by the disease. The American College of Rheumatology (ACR) established 11 criteria as a classificatory instrument to operationalise the definition of SLE in clinical trials. They were not intended to be used to diagnose individuals and do not do well in that capacity. Cutaneous lesions account for four of these 11 revised criteria of SLE. Skin lesions in patients with lupus may be specific or nonspecific. This paper covers the SLE-specific cutaneous changes: malar rash, discoid rash, photosensitivity, and oral mucosal lesions as well as SLE nonspecific skin manifestations, their pathophysiology, and management. A deeper thorough understanding of the cutaneous manifestations of SLE is essential for diagnosis, prognosis, and efficient management. Thus, dermatologists should cooperate with other specialties to provide optimal care of SLE patient. PMID:22888407

  17. Cutaneous Manifestations of Systemic Lupus Erythematosus

    PubMed Central

    Uva, Luís; Miguel, Diana; Pinheiro, Catarina; Freitas, João Pedro; Marques Gomes, Manuel; Filipe, Paulo

    2012-01-01

    Systemic lupus erythematosus (SLE) is a multiorgan autoimmune disease of unknown etiology with many clinical manifestations. The skin is one of the target organs most variably affected by the disease. The American College of Rheumatology (ACR) established 11 criteria as a classificatory instrument to operationalise the definition of SLE in clinical trials. They were not intended to be used to diagnose individuals and do not do well in that capacity. Cutaneous lesions account for four of these 11 revised criteria of SLE. Skin lesions in patients with lupus may be specific or nonspecific. This paper covers the SLE-specific cutaneous changes: malar rash, discoid rash, photosensitivity, and oral mucosal lesions as well as SLE nonspecific skin manifestations, their pathophysiology, and management. A deeper thorough understanding of the cutaneous manifestations of SLE is essential for diagnosis, prognosis, and efficient management. Thus, dermatologists should cooperate with other specialties to provide optimal care of SLE patient. PMID:22888407

  18. Acquired enophthalmos with systemic lupus erythematosus.

    PubMed

    Park, K R; Seo, M R; Ryu, H J; Chi, M J; Baek, H J; Choi, H J

    2016-01-01

    Ocular involvement sometimes occurs with systemic lupus erythematosus (SLE) but enophthalmos with SLE is rare. We report a case of enophthalmos with SLE. A 25-year-old male was admitted for two weeks of fever, sore throat, arthralgia, chest pain and right arm weakness with pain. We diagnosed him with SLE with malar rash, arthritis, pleural effusion, proteinuria, leukopenia, positive antinuclear antibody, anti-dsDNA, and lupus anticoagulant. The patient was prescribed high-dose prednisolone and hydroxychloroquine 400 mg. One week after discharge, he complained about a sensation of a sunken right eye. CT showed right enophthalmos, a post-inflammatory change and chronic inflammation. Proteinuria increased to 3.8 g/day after the patient stopped taking prednisolone. Cyclophosphamide therapy was administered for three months without improvement. We decided to restart prednisolone and change cyclophosphamide to mycophenolate mofetil. Proteinuria decreased but enophthalmos remains as of this reporting. PMID:26306741

  19. Lupus Nephritis: An Overview of Recent Findings

    PubMed Central

    de Zubiria Salgado, Alberto; Herrera-Diaz, Catalina

    2012-01-01

    Lupus nephritis (LN) is one of the most serious complications of systemic lupus erythematosus (SLE) since it is the major predictor of poor prognosis. In susceptible individuals suffering of SLE, in situ formation and deposit of immune complexes (ICs) from apoptotic bodies occur in the kidneys as a result of an amplified epitope immunological response. IC glomerular deposits generate release of proinflammatory cytokines and cell adhesion molecules causing inflammation. This leads to monocytes and polymorphonuclear cells chemotaxis. Subsequent release of proteases generates endothelial injury and mesangial proliferation. Presence of ICs promotes adaptive immune response and causes dendritic cells to release type I interferon. This induces maturation and activation of infiltrating T cells, and amplification of Th2, Th1 and Th17 lymphocytes. Each of them, amplify B cells and activates macrophages to release more proinflammatory molecules, generating effector cells that cannot be modulated promoting kidney epithelial proliferation and fibrosis. Herein immunopathological findings of LN are reviewed. PMID:22536486

  20. Eosinophilic gastroenteritis associated with systemic lupus erythematosus.

    PubMed

    Barbie, David A; Mangi, Abeel A; Lauwers, Gregory Y

    2004-01-01

    Eosinophilic gastroenteritis is an uncommon disease with an obscure etiology, although associations with allergy, the idiopathic hypereosinophilic syndrome, and connective tissue disease have been reported. We present the case of a 37-year-old woman with a history of idiopathic thrombocytopenic purpura who presented with refractory nausea, vomiting, and abdominal pain. Imaging studies were significant for bowel wall thickening and ascites, while laboratory studies revealed a positive antinuclear antibody (ANA), a positive anti-double stranded (DS) DNA antibody, low complement, and proteinuria. Exploratory laparotomy with gastric and small bowel biopsies established the diagnosis of eosinophilic gastroenteritis. In addition, the patient met clinical criteria for the diagnosis of systemic lupus erythematosus. Previous studies have described eosinophilic gastroenteritis in patients with scleroderma, polymyositis, or dermatomyositis. This is the first report to our knowledge of an individual with eosinophilic gastroenteritis and systemic lupus erythematosus. PMID:15492606

  1. Cutaneous neonatal lupus erythematosus with unusual features.

    PubMed

    Sawant, Shankar; Amladi, S T; Wadhawa, S L; Nayak, C S; Nikam, B P

    2007-01-01

    A three month-old boy was brought by his mother with complaints of multiple reddish lesions on his trunk and face since birth. The patient had erythematous annular plaques with scaling on his extremities, palms and soles with periorbital erythema and edema giving the characteristic "eye mask" or "owl's eye" appearance. His mother did not have history of any illness. Hemogram, liver and renal function tests were within normal limits. A skin biopsy was suggestive of subacute cutaneous lupus erythematosus. Immunological work-up was positive for antinuclear antibodies (ANA) (1:40) with anti-Ro titers of 3.4 and 3.47 (>1.1 = clinically significant titre) in the mother and child respectively, although negative for anti-La antibodies. The child's electrocardiogram and 2D echocardiography were normal. We are presenting a case of anti-Ro-positive cutaneous lupus erythematosus with an uncommon skin manifestation. PMID:17675734

  2. Biomarkers for kidney involvement in pediatric lupus

    PubMed Central

    Goilav, Beatrice; Putterman, Chaim; Rubinstein, Tamar B

    2015-01-01

    Lupus nephritis (LN), the renal involvement in systemic lupus erythematosus, is currently diagnosed by histopathology obtained by percutaneous renal biopsy and is associated with increased morbidity and mortality in both adults and children. LN is more prevalent and severe in children, requiring aggressive and prolonged immunosuppression. The consequences of the diagnosis and its treatment have devastating long-term effects on the growth, well-being and quality of life of affected children. The paucity of reliable clinical indicators of the presence and severity of renal involvement have contributed to a halt in the reduction of progression to end-stage renal disease in recent years. Here, we discuss the recent development of biomarkers in the management of LN and their role as therapeutic targets. PMID:26079958

  3. Anastrozole-induced subacute cutaneous lupus erythematosus.

    PubMed

    Fisher, Juliya; Patel, Mital; Miller, Michael; Burris, Katy

    2016-08-01

    Drug-induced subacute cutaneous lupus erythematosus (DI-SCLE) has been associated with numerous drugs, but there are limited reports of its association with aromatase inhibitor anastrozole. We report the case of a patient undergoing treatment with anastrozole for breast cancer who presented with clinical, serological, and histological evidence consistent with DI-SCLE. Her condition quickly began to improve after the use of anastrozole was discontinued and hydroxychloroquine therapy was initiated. Cases such as ours as well as several others that implicate antiestrogen drugs in association with DI-SCLE seem to be contradictory to studies looking at the usefulness of treating systemic lupus erythematosus (SLE) with antiestrogen therapy. Further research on this relationship is warranted. PMID:27622265

  4. Bullous Systemic Lupus Erythematosus: Case report

    PubMed Central

    Miziara, Ivan Dieb; Mahmoud, Ali; Chagury, Azis Arruda; Alves, Ricardo Dourado

    2013-01-01

    Summary Introduction: Bullous systemic lupus erythematosus (BSLE) is an autoantibody-mediated disease with subepidermal blisters. It is a rare form of presentation of SLE that occurs in less than 5% of cases of lupus. Case Report: A 27-year-old, female, FRS patient reported the appearance of painful bullous lesions in the left nasal wing and left buccal mucosa that displayed sudden and rapid growth. She sought advice from emergency dermatology staff 15 days after onset and was hospitalized with suspected bullous disease. Intravenous antibiotics and steroids were administered initially, but the patient showed no improvement during hospitalization. She displayed further extensive injuries to the trunk, axillae, and vulva as well as disruption of the bullous lesions, which remained as hyperemic scars. Incisional biopsy of a lesion in the left buccal mucosa was performed, and pathological results indicated mucositis with extensive erosion and the presence of a predominantly neutrophilic infiltrate with degeneration of basal cells and apoptotic keratinocytes. Under direct immunofluorescence, the skin showed anti-IgA, anti-IgM, and anti-IgG linear fluorescence on the continuous dermal side of the cleavage. Indirect immunofluorescence of the skin showed conjugated anti-IgA, was anti-IgM negative, and displayed pemphigus in conjunction with anti-IgG fluorescence in the nucleus of keratinocytes, consistent with a diagnosis of bullous lupus erythematosus. Discussion: BSLE is an acquired autoimmune bullous disease caused by autoantibodies against type VII collagen or other components of the junctional zone, epidermis, and dermis. It must be differentiated from the secondary bubbles and vacuolar degeneration of the basement membrane that may occur in acute and subacute cutaneous lupus erythematosus. PMID:25992032

  5. Induced murine models of systemic lupus erythematosus.

    PubMed

    Xu, Yuan; Zeumer, Leilani; Reeves, Westley H; Morel, Laurence

    2014-01-01

    Induced mouse models of systemic lupus erythematosus (SLE) have been developed to complement the spontaneous models. This chapter describes the methods used in the pristane-induced model and the chronic graft-versus-host disease (cGVHD) model, both of which have been extensively used. We will also outline the specific mechanisms of systemic autoimmunity that can be best characterized using each of these models. PMID:24497358

  6. Concomitant systemic lupus erythematosus and ankylosing spondylitis.

    PubMed Central

    Olivieri, I; Gemignani, G; Balagi, M; Pasquariello, A; Gremignai, G; Pasero, G

    1990-01-01

    The case is reported of a 42 year old white woman meeting currently used diagnostic criteria for both ankylosing spondylitis and systemic lupus erythematosus (SLE). As found in a previously described similar case of a black man, HLA typing showed antigens associated with both SLE and seronegative spondyloarthropathy. This case thus supports the hypothesis that the two diseases occur together only when this rare combination of HLA antigens is present. Images PMID:2344214

  7. Systemic Lupus Erythematosus in Children and Adolescents

    PubMed Central

    Levy, Deborah M.; Kamphuis, Sylvia

    2012-01-01

    Synopsis Systemic Lupus Erythematosus (SLE) is a chronic autoimmune disease that can involve any organ system with a wide range of disease manifestations, and can lead to significant morbidity and even mortality. This article reviews the epidemiology, common clinical features, complications of disease, and briefly discusses the available treatment options. In addition, important medical and psychosocial issues relevant to the pediatrician caring for children and adolescents with SLE are discussed. PMID:22560574

  8. Drug-induced lupus erythematosus: incidence, management and prevention.

    PubMed

    Chang, Christopher; Gershwin, M Eric

    2011-05-01

    The generation of autoantibodies and autoimmune diseases such as systemic lupus erythematosus has been associated with the use of certain drugs in humans. Early reports suggested that procainamide and hydralazine were associated with the highest risk of developing lupus, quinidine with a moderate risk and all other drugs were considered low or very low risk. More recently, drug-induced lupus has been associated with the use of the newer biological modulators such as tumour necrosis factor (TNF)-α inhibitors and interferons. The clinical features and laboratory findings of TNFα inhibitor-induced lupus are different from that of traditional drug-induced lupus or idiopathic lupus, and standardized criteria for the diagnosis of drug-induced lupus have not been established. The mechanism(s) responsible for the development of drug-induced lupus may vary depending on the drug or even on the patient. Besides lupus, other autoimmune diseases have been associated with drugs or toxins. Diagnosis of drug-induced lupus requires identification of a temporal relationship between drug administration and symptom development, and in traditional drug-induced lupus there must be no pre-existing lupus. Resolution of symptoms generally occurs after cessation of the drug. In this review, we will discuss those drugs that are more commonly associated with drug-induced lupus, with an emphasis on the new biologicals and the difficulty of making the diagnosis of drug-induced lupus against a backdrop of the autoimmune diseases that these drugs are used to treat. Stimulation of the immune system by these drugs to cause autoimmunity may in fact be associated with an increased effectiveness in treating the pathology for which they are prescribed, leading to the dilemma of deciding which is worse, the original disease or the adverse effect of the drug. Optimistically, one must hope that ongoing research in drug development and in pharmacogenetics will help to treat patients with the maximum

  9. Filaments in the Lupus molecular clouds

    NASA Astrophysics Data System (ADS)

    Benedettini, M.; Schisano, E.; Pezzuto, S.; Elia, D.; André, P.; Könyves, V.; Schneider, N.; Tremblin, P.; Arzoumanian, D.; di Giorgio, A. M.; Di Francesco, J.; Hill, T.; Molinari, S.; Motte, F.; Nguyen-Luong, Q.; Palmeirim, P.; Rivera-Ingraham, A.; Roy, A.; Rygl, K. L. J.; Spinoglio, L.; Ward-Thompson, D.; White, G. J.

    2015-10-01

    We have studied the filaments extracted from the column density maps of the nearby Lupus 1, 3, and 4 molecular clouds, derived from photometric maps observed with the Herschel satellite. Filaments in the Lupus clouds have quite low column densities, with a median value of ˜1.5 × 1021 cm-2 and most have masses per unit length lower than the maximum critical value for radial gravitational collapse. Indeed, no evidence of filament contraction has been seen in the gas kinematics. We find that some filaments, that on average are thermally subcritical, contain dense cores that may eventually form stars. This is an indication that in the low column density regime, the critical condition for the formation of stars may be reached only locally and this condition is not a global property of the filament. Finally, in Lupus we find multiple observational evidences of the key role that the magnetic field plays in forming filaments, and determining their confinement and dynamical evolution.

  10. Moderator's view: Cyclophosphamide in lupus nephritis.

    PubMed

    Tesar, Vladimir

    2016-07-01

    Mycophenolate mofetil was recently accepted as the effective induction treatment of lupus nephritis, with the potential to replace cyclophosphamide or at least expand our therapeutic armamentarium in patients with this lifelong disease often requiring repeated induction treatment of its relapses. Compared with cyclophosphamide, mycophenolate may be more effective in black patients, and the risk of gonadotoxicity may be significantly lower in mycophenolate-treated subjects. However, experience with mycophenolate in severe lupus nephritis is still limited and we also have insufficient data on the long-term outcome of mycophenolate-treated patients. Treatment with mycophenolate is more expensive than with cyclophosphamide, which may limit its use, especially in low- and middle-income countries. The efficacy of mycophenolate mofetil may be more dependent on the patient's compliance compared with intravenous cyclophosphamide pulses. Low-dose cyclophosphamide remains an effective and relatively safe induction treatment of active lupus nephritis, but to decrease its cumulative toxicity, repeated exposure to cyclophosphamide in relapsing patients should be (if possible) avoided. PMID:27190357

  11. Lupus thrombocytopenia: clinical implications and prognostic significance

    PubMed Central

    Ziakas, P; Giannouli, S; Zintzaras, E; Tzioufas, A; Voulgarelis, M

    2005-01-01

    Methods: 632 patients were reviewed retrospectively. Fifty patients with thrombocytopenia were included as cases and matched with 100 control patients. Clinical manifestations at first thrombocytopenic episode were recorded. Classification criteria at diagnosis, basic immunological profiles, disease activity (ECLAM), and end organ damage (SLICC) were recorded. Results: 29/50 (58%) had thrombocytopenia at diagnosis of lupus. Haemorrhagic manifestations were associated with the degree of thrombocytopenia (p<0.001). Anticardiolipin antibodies were not related to the degree of thrombocytopenia or the severity of haemorrhagic manifestations. Megakaryocytes were normal or increased in 26/28 (93%) bone marrow specimens, indicating peripheral platelet destruction. Patients with high disease activity were more thrombocytopenic than controls (OR = 2.61, 95% CI 1.13 to 5.96, p = 0.009). Patients with low C3 or CH50 were more likely to be thrombocytopenic (OR = 2.36, 95% CI 1.05 to 5.26, p = 0.029). Median SLICC for lupus patients with thrombocytopenia was 2 (range 0–11) compared with 1 (range 0–12) for controls (p<0.001). No deaths occurred during thrombocytopenic episodes. Conclusions: Thrombocytopenia is not directly associated with end organ damage and mortality, but defines a subgroup of patients with higher morbidity and is thus a major complication of systemic lupus erythematosus, affecting overall prognosis. PMID:16100344

  12. Usefulness of inflammatory biomarkers in discriminating between bacterial and aseptic meningitis in hospitalized children from a population with low vaccination coverage

    PubMed Central

    Wysocki, Jacek; Avonts, Dirk; Januszkiewicz-Lewandowska, Danuta; Michalak, Michal

    2016-01-01

    Introduction Neisseria meningitidis and Streptococcus pneumoniae are the most frequent pathogens responsible for meningitis beyond the neonatal period. Aseptic meningitis is a disabling condition, but bacterial meningitis if left untreated is 100% fatal. The aim of the study was to analyze the usefulness of biochemical and hematological parameters in distinguishing between bacterial and non-bacterial meningitis in children with meningitis from a population with low rates of vaccination against S. pneumoniae and N. meningitidis. Material and methods This study is a retrospective chart review of children hospitalized with meningitis. In patients with aseptic and bacterial meningitis the following parameters were compared: C-reactive protein, D-dimers, fibrinogen, glucose level, and leukocyte level, and in cerebrospinal fluid, protein, glucose, and leukocyte concentrations were analyzed. Number of points in the Bacterial Meningitis Score (BMS) was calculated. The predictive value of each parameter to distinguish between bacterial and aseptic meningitis was evaluated. Results In total, 129 patients were included in the study: 65 diagnosed with bacterial meningitis and 64 with aseptic meningitis. Bacterial and aseptic meningitis were statistically significantly different based on each analyzed parameter (p < 0.000001). Among children with aseptic meningitis 42 (66%) scored 0 points in the BMS, while all the children with bacterial meningitis had at least one point. Conclusions In children with meningitis inflammatory biomarkers differ statistically significantly depending on the etiology – bacterial or aseptic. Serum concentration of C-reactive protein higher than 80 mg/dl is a useful marker of bacterial etiology of meningitis. A high Bacterial Meningitis Score is indicative for bacterial meningitis. PMID:27186188

  13. Cardiac tamponade as an initial manifestation of systemic lupus erythematosus.

    PubMed

    Carrion, Diego M; Carrion, Andres F

    2012-01-01

    Clinical manifestations of pericardial disease may precede other signs and symptoms associated with systemic lupus erythematosus. Although pericardial effusion is one of the most common cardiac problems in patients with systemic lupus erythematosus, haemodynamically significant effusions manifesting as cardiac tamponade are rare and require prompt diagnosis and treatment. PMID:22693326

  14. Lupus erythematosus--a case of facial swelling.

    PubMed

    Loescher, A; Edmondson, H D

    1988-04-01

    A case is reported of acute facial swelling following tooth extraction that failed to respond in a normal manner. The patient developed systemic signs and symptoms ultimately revealing the diagnosis of lupus erythematosus. The possibility of soft tissue lesions arising in some forms of lupus is emphasised by this report. PMID:3163493

  15. Aseptic Raman spectroscopy can detect changes associated with the culture of human dental pulp stromal cells in osteoinductive culture

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Tomlinson, Matthew J.; Smith, Alistair

    2015-01-01

    There is an unmet need for the non-invasive characterisation of stem cells to facilitate the translation of cell-based therapies. Raman spectroscopy has proven utility in stem cell characterisation but as yet no method has been reported capable of taking repeated Raman measurements of living cells aseptically over time. The aim of this study was to determine if Raman spectroscopy could be used to monitor changes in a well characterised cell population (human dental pulp stromal cells (DPSCs)) by taking repeated Raman measurements from the same cell populations in osteoinductive culture over time and under aseptic conditions. DPSCs were isolated from extracted premolar teeth from 3 consenting donors. Following in vitro expansion, DPSCs were maintained for 28 days in osteo-inductive medium. Raman spectra were acquired from the cells at days 0, 3, 7, 10, 14 and 28. Principal component analysis (PCA) was carried out to assess if there was any temporal spectral variation. At day 28, osteoinduction was confirmed using alizarin red staining and qRT-PCR for alkaline phosphatase and osteocalcin. Alizarin red staining was positive in all samples at day 28 and significant increases in alkaline phosphatase (p < 0.001) and osteocalcin (p < 0.05) gene expression were also observed compared with day 0. PCA of the Raman data demonstrated trends in PC1 from days 0–10, influenced by protein associated features and PC2 from days 10–28, influenced by DNA/RNA associated features. We conclude that spectroscopy can be used to monitor changes in Raman signature with time associated with the osteoinduction of DPSCs using repeated measurements via an aseptic methodology. PMID:26374253

  16. A pathophysiology-based approach to the diagnosis and treatment of lupus nephritis.

    PubMed

    Anders, Hans-Joachim; Rovin, Brad

    2016-09-01

    Lupus is no longer an unknown chameleon of medicine. Significant progress has been made on unraveling the pathogenesis of lupus and lupus nephritis, and how to treat the disease. Here we provide an update on the pathophysiology of lupus and its related kidney disease, consider areas of controversy in disease management, and discuss the unmet needs of lupus nephritis and how to address these needs. We focus on rethinking how innovative therapies for lupus nephritis should be evaluated and evolving strategies to more efficiently mitigate irreversible nephron loss in patients with lupus nephritis. PMID:27378475

  17. Pregnancy in women with systemic lupus erythematosus (SLE).

    PubMed

    Moroni, Gabriella; Ponticelli, Claudio

    2016-07-01

    For many years pregnancy has been contraindicated in patients with SLE, particularly when kidney involvement was present. Today, pregnancy is no longer considered impossible in women with lupus. Yet, lupus pregnancies are still considered high-risk. The prognosis has considerably improved for pregnant women but the fetal risk, although progressively reduced, is still higher in pregnancies of patients with SLE than in pregnancies of healthy women. Miscarriage, premature delivery, and preeclampsia, as well as heart problems in the baby are the major complications that can occur. In this paper we will review the outcome of pregnant women with SLE, the influence of lupus on fetal outcome, the effects of pregnancy on lupus, and the management of pregnant lupus patients based on our personal experience and the revision of the most recent and significant papers on the subject. PMID:27142327

  18. Con: Cyclophosphamide for the treatment of lupus nephritis.

    PubMed

    Mok, Chi Chiu

    2016-07-01

    Kidney involvement is a major determinant for morbidity and mortality in patients with systemic lupus erythematosus. The treatment target of lupus renal disease is to induce and maintain remission and to minimize disease or treatment-related comorbidities. Cyclophosphamide (CYC), in conjunction with glucocorticoids, has conventionally been used for the initial treatment of lupus nephritis. However, the major concerns of CYC are its toxicities, such as infertility, urotoxicity and oncogenicity, which are particularly relevant in women of childbearing age. As a result, maintenance therapy of lupus nephritis with an extended course of CYC pulses has largely been replaced by other immunosuppressive agents such as mycophenolate mofetil (MMF) and azathioprine. Recent randomized controlled trials have demonstrated non-inferiority of MMF to pulse CYC as induction therapy of lupus nephritis. Although MMF as induction-maintenance therapy has been increasingly used in lupus nephritis, its efficacy in the long-term preservation of renal function remains to be elucidated. MMF is not necessarily less toxic than CYC. Meta-analyses of clinical trials show similar incidence of infective complications and gastrointestinal adverse events in both MMF- and CYC-based regimens. However, considering the reduction in gonadal toxicity and the risk of oncogenicity, MMF may be used as first-line therapy of lupus nephritis. Tacrolimus (TAC) has recently been shown to be equivalent to either MMF or CYC for inducing remission of lupus nephritis and may be considered as another non-CYC alternative. Combined low-dose MMF and TAC appears to be more effective than CYC pulses in Chinese patients with lupus nephritis and has the potential to replace the more toxic CYC regimens in high-risk patients. Currently, CYC still plays an important role in the management of lupus nephritis patients with impaired or rapidly deteriorating renal function, crescentic glomerulonephritis or as salvage therapy for

  19. Treatment of young patients with lupus nephritis using calcineurin inhibitors

    PubMed Central

    Tanaka, Hiroshi; Tsuruga, Kazushi; Aizawa-Yashiro, Tomomi; Watanabe, Shojiro; Imaizumi, Tadaatsu

    2012-01-01

    Recent advances in the management of lupus nephritis, together with earlier renal biopsy and selective use of aggressive immunosuppressive therapy, have contributed to a favorable outcome in children and adolescents with systemic lupus erythematosus (SLE). Nevertheless, we believe that a more effective and less toxic treatment is needed to attain an optimal control of the activity of lupus nephritis. Recent published papers and our experiences regarding treatment of young patients with lupus nephritis using calcineurin inhibitors are reviewed. Although it has been reported that intermittent monthly pulses of intravenous cyclophosphamide (IVCY) are effective for preserving renal function in adult patients, CPA is a potent immunosuppressive agent that induces severe toxicity, including myelo- and gonadal toxicity, and increases the risk of secondary malignancy. Thus, treatment for controlling lupus nephritis activity, especially in children and adolescents, remains challenging. Cyclosporine A (CsA) and tacrolimus (Tac) are T-cell-specific calcineurin inhibitors that prevent the activation of helper T cells, thereby inhibiting the transcription of the early activation genes of interleukin (IL)-2 and suppressing T cell-induced activation of tumor necrosis factor-α, IL-1β and IL-6. Therefore, both drugs, which we believe may be less cytotoxic, are attractive therapeutic options for young patients with lupus nephritis. Recently, a multidrug regimen of prednisolone (PDN), Tac, and mycophenolate mofetile (MMF) has been found effective and relatively safe in adult lupus nephritis. Since the mechanisms of action of MMF and Tac are probably complementary, multidrug therapy for lupus nephritis may be useful. We propose as an alternative to IVCY, a multidrug therapy with mizoribine, which acts very similarly to MMF, and Tac, which has a different mode of action, combined with PDN for pediatric-onset lupus nephritis. We also believe that a multidrug therapy including CsA and

  20. Review of the role of dynamic 18F-NaF PET in diagnosing and distinguishing between septic and aseptic loosening in hip prosthesis.

    PubMed

    Adesanya, Olu; Sprowson, Andrew; Masters, James; Hutchinson, Charles

    2015-01-01

    Joint replacements may fail due to infection, dislocation, peri-prosthetic fracture and loosening. Between 0.4 and 4% of joint replacements are known to be complicated by infection and aseptic loosening 2-18%. Differentiating between infection and aseptic loosening has an important bearing on the ongoing strategy for antimicrobial therapy and surgical intervention, but distinguishing one from the other can be difficult and will often require a battery of clinical and biochemical tests including the use of varying radiological modalities to accurately identify whether problematic joints are infected or aseptically loose. Prompt diagnosis is important due to the development of a biofilm on the surface of the infected prosthesis, which makes treatment difficult. There is no consensus among experts on the ideal imaging technique nor the methodology for image interpretation, but there is an increasing trend to apply hybrid imaging in the investigation of painful joint prosthesis and recent attempts have been made using PET-CT to identify aseptic loosening and infection with (18)F-fluorodeoxyglucose (FDG) and sodium fluoride (18)F-Na. The aim of this paper is to evaluate the role of (18)F-NaF sodium fluoride ((18)F-NaF) positron emission tomography (PET) in distinguishing between septic and aseptic failure in hip and knee replacements, in addition to evaluating the feasibility of using multi-sequential (18)F-NaF PET-CT for the assessment of painful lower limb prostheses. PMID:25592441

  1. Anti-chromatin antibodies in systemic lupus erythematosus: a useful marker for lupus nephropathy

    PubMed Central

    Cervera, R; Vinas, O; Ramos-Casals, M; Font, J; Garcia-Carrasco, M; Siso, A; Ramirez, F; Machuca, Y; Vives, J; Ingelmo, M; Burlingame, R

    2003-01-01

    Background: Anti-chromatin antibodies have recently been described in patients with systemic lupus erythematosus (SLE) and it has been suggested that their presence is associated with lupus nephritis. Objective: To assess the prevalence and clinical associations of these antibodies in SLE. Methods: The presence of anti-chromatin antibodies in 100 patients with SLE was investigated by an enzyme linked immunosorbent assay (ELISA). To determine the specificity of these antibodies, 100 patients with primary Sjögren's syndrome, 30 with primary antiphospholipid syndrome (APS), 10 with systemic sclerosis, and 100 normal controls were also tested. Results: Positive levels were detected in 69/100 (69%) patients with SLE. In contrast, they were found in only 8/100 (8%) of those with primary Sjögren's syndrome, in 1/10 (10%) with systemic sclerosis, in 2/30 (7%) with primary APS, and in none of the 100 healthy controls. Patients with anti-chromatin antibodies had a twofold higher prevalence of lupus nephropathy than those without these antibodies (58% v 29%, p<0.01). A significant correlation was found between the levels of anti-chromatin antibodies and disease activity score as measured by the European Consensus Lupus Activity Measurement (ECLAM; p=0.011). Conclusions: The measurement of anti-chromatin antibodies appears to be a useful addition to the laboratory tests that can help in the diagnosis and treatment of SLE. These antibodies are both sensitive and specific for SLE, and are a useful marker for an increased risk of lupus nephritis. PMID:12695155

  2. Metabolic syndrome in patients with systemic lupus erythematosus: association with traditional risk factors for coronary heart disease and lupus characteristics.

    PubMed

    Telles, Rw; Lanna, Ccd; Ferreira, Ga; Ribeiro, Al

    2010-06-01

    The objective of this study was to determine the frequency of Metabolic Syndrome (MetS) in patients with SLE and to analyze the association of MetS with traditional risk factors for CHD and lupus characteristics. In this cross-sectional study the frequency of MetS was determined according to the National Cholesterol Education Program Adult Treatment Panel III in patients with SLE. The association of MetS with the traditional risk factors for CHD not included in the syndrome definition, and with lupus characteristics was examined. The mean age (sd) of the 162 females patients was 38.8(11.2) years. The frequency of MetS was 32.1%. Abdominal obesity and hypertension were the two most common components of the syndrome (86.5% each) followed by low levels of HDL-cholesterol (84.6%), hypertriglyceridemia (69.2%) and hyperglycemia (15.4%). MetS was significantly associated with older age, family history of CHD, obesity, postmenopausal status, LDL-c > or =100mg/dl, and higher Framingham risk score. Lupus characteristics associated with MetS were history of nephrotic proteinuria during follow-up and current cyclophosphamide use, higher modified SLEDAI-2k, higher damage index score (SLICC/ACR), and older age at lupus diagnosis. In the logistic regression analysis, obesity, LDL-c > or =100mg/dl, older age at lupus diagnosis, higher damage index and nephrotic proteinuria were independently associated with MetS. We conclude that MetS diagnosis was frequent in patients with lupus. The syndrome was associated not only with traditional risk factors for CHD, confirming the clustering of those risk factors, but also with lupus characteristics. Some of those factors, especially LDL-c > or =100mg/dl and age at lupus diagnosis, have been associated with atherosclerosis in lupus patients. Lupus (2010) 19, 803-809. PMID:20118159

  3. Refractory disease in systemic lupus erythematosus.

    PubMed

    Campar, Ana; Farinha, Fátima; Vasconcelos, Carlos

    2011-09-01

    There is no definition or guidelines for refractory disease (RD) in Systemic Lupus Erythematosus (SLE). However, new therapies have been tested mainly in refractory patients. The concept, like the disease, is complex and implies deeper knowledge on the disease pathogenesis and patients' subsets. RD is not included in current activity indices of the disease, what raises the question of how are we monitoring its response to new drugs. In this paper, we analyse some concepts considered important for the global definition of RD in SLE and in some specific organ involvements, excluding lupus nephritis. Management issues will be addressed also. Finally, we review therapeutic options in particular subsets of the disease, namely, cutaneous, articular, haematological and neuropsychiatric lupus. Crucial to the management of a patient suspected to be refractory is an accurate diagnosis, assuring that the persistent clinical manifestations are derived primarily from SLE and not from a concomitant or alternative process. Likewise, certainty about the patient compliance with the therapy prescribed is a frequent unrecognized problem that erroneously might lead to a classification of RD. Therapy of RD for SLE, in general and in most particular involvements, is currently based mainly on the clinician's own experience and judgement, with few randomized trials effectively addressing the issue. In such a heterogeneous disease, consideration of approval of drugs for single-organ indications may pave the way for new therapies. Better biomarkers are needed to add accuracy to the currently used activity indices in order to monitor RD and consolidate its definition. Prospective studies directed to RD in the main SLE involvements are needed to improve our understanding on the management of the disease and foster the development of targeted new drugs. PMID:21600313

  4. Leadership in wolf, Canis lupus, packs

    USGS Publications Warehouse

    Mech, L.D.

    2000-01-01

    I examine leadership in Wolf (Canis lupus) packs based on published observations and data gathered during summers from 1986 to 1998 studying a free-ranging pack of Wolves on Ellesmere Island that were habituated to my presence. The breeding male tended to initiate activities associated with foraging and travel, and the breeding female to initiate, and predominate in, pup care and protection. However, there was considerable overlap and interaction during these activities such that leadership could be considered a joint function. In packs with multiple breeders, quantitative information about leadership is needed.

  5. Systemic lupus erythematosus: Clinical and experimental aspects

    SciTech Connect

    Smolen, J.S.

    1987-01-01

    This text covers questions related to the history, etiology, pathogenesis, clinical aspects and therapy of systematic lupus erythematosus (SLE). Both animal models and human SLE are considered. With regard to basic science, concise information on cellular immunology, autoantibodies, viral aspects and molecular biology in SLE is provided. Clinical topics then deal with medical, dermatologic, neurologic, radiologic, pathologic, and therapeutic aspects. The book not only presents the most recent information on clinical and experimental insights, but also looks at future aspects related to the diagnosis and therapy of SLE.

  6. Bone health, vitamin D and lupus.

    PubMed

    Sangüesa Gómez, Clara; Flores Robles, Bryan Josué; Andréu, José Luis

    2015-01-01

    The prevalence of vitamin D deficiency and insufficiency among patients with systemic lupus erythematosus is high. This is likely due to photoprotection measures in addition to intrinsic factors of the disease. Low levels of vitamin D increase the risk of low bone mineral density and fracture. Vitamin D deficiency could also have undesirable effects on patients' immune response, enhancing mechanisms of loss of tolerance and autoimmunity. Vitamin D levels should be periodically monitored and patients should be treated with the objective of reaching vitamin D levels higher than 30-40 ng/ml. PMID:25488287

  7. Lupus as a paraneoplastic manifestation of cholangiocarcinoma.

    PubMed

    González Amores, Yolanda; Hernando Rebollar, Sofía; Casado Bernabeu, Aida

    2016-05-01

    Tumors originating in the digestive system, like those in other areas, whether solid or otherwise, may present with extradigestive manifestations in the setting of a paraneoplastic syndrome. Systemic lupus erythematosus (SLE) is an autoimmune condition most commonly involving women of childbearing age. On occasion it represents a paraneoplastic manifestation heralding a primary tumor. Cancer suspicion is therefore a key element for newly diagnosed SLE cases with nonstandard epidemiology even in the absence of suggestive symptoms, and digestive tumors should be included in the differential diagnosis. PMID:26925842

  8. Papular Mucinosis Associated with Systemic Lupus Erythematosus

    PubMed Central

    Lee, Woo Jin; Park, Gyeong Hun; Chang, Sung Eun; Choi, Jee Ho; Moon, Kee Chan; Koh, Jai Kyoung

    2008-01-01

    Papulonodular mucinosis (PNM) is a rare variant of lupus erythematosus (LE) eruptions, and PNM is characterized histologically by diffuse dermal mucin without any typical epidermal inflammatory changes. We herein describe a case of papular mucinosis that was characterized by several erythematous papules on the lower back of a 32-year-old man with systemic LE. It is interesting that he didn't display any other skin manifestations of LE such as malar rash, discoid rash and photosensitivity during the previous 2 years. He achieved remission of his PNM without recurrence after 5 months treatment with topical steroids, in addition to receiving systemic antimalarials and steroids. PMID:27303200

  9. Subacute Cutaneous Lupus Erythematosus Triggered by Radiotherapy

    PubMed Central

    Kolm, I.; Pawlik, E.; Eggmann, N.; Kamarachev, J.; Kerl, K.; French, L.E.; Hofbauer, G.F.L.

    2013-01-01

    Background The origin of collagen autoimmune diseases is not fully understood. Some studies postulate a mechanism of molecular mimicry or heterologous immunity following viral infections triggering autoimmunity. Apart from infections, other exogenous factors such as visible light or X-rays have been reported to incite autoimmunity. Case Report We report a case of histologically and serologically confirmed subacute lupus erythematosus (SCLE) following radiotherapy for breast cancer. Discussion The close temporal and spatial correlation between radiotherapy and onset of SCLE in this patient suggests that an autoimmune reaction may have been triggered locally by functionally altering the immune system and breaking self-tolerance. PMID:24019776

  10. RECENT CLINICAL TRIALS IN LUPUS NEPHRITIS

    PubMed Central

    Ward, Michael M.

    2014-01-01

    SYNOPSIS Recent clinical trials have provided evidence for the efficacy of low-dose intravenous cyclophosphamide and mycophenolate mofetil as induction treatment for patients with proliferative lupus nephritis in comparative trials with standard-dose intravenous cyclophosphamide. Trials of maintenance treatments have had more variable results, but suggest that mycophenolate mofetil may be similar to quarterly standard-dose intravenous cyclophosphamide and somewhat more efficacious than azathioprine. Differential responses to mycophenolate mofetil based on ethnicity suggest that it may be more effective in black and Hispanic patients. Rituximab was not efficacious as an adjunct to induction treatment with mycophenolate mofetil. PMID:25034160

  11. What is new in systemic lupus erythematosus.

    PubMed

    Rúa-Figueroa Fernández de Larrinoa, Iñigo

    2015-01-01

    Systemic lupus erythematosus is a heterogeneous rheumatic systemic disease with extremely varied clinical manifestations and a diverse pathogenesis, as illustrated in this review on the most relevant new knowledge related to the disease. Topics such as anemia, pathogenesis, cardiovascular risk assessment, antiphospholipid syndrome, prediction of damage and recent advances in treatment, including tolerogenic and biological agents, are discussed. Relevant contributions regarding classical therapies such as corticosteroid and antimalarials and their optimal use, as well as the roll of vitamin D, are also referred. PMID:25455719

  12. Monoclonal Antibody Drugs for Systemic Lupus Erythematosus.

    PubMed

    Kamenarska, Zornitsa G; Hristova, Maria H; Vinkov, Anton I; Dourmishev, Lyubomir A

    2015-01-01

    Systemic lupus erythematosus (SLE) is a heterogeneous autoimmune disease which engages most of the immune cells in its development. Various studies concerning the application of antibodies against TNF-α, BlyS, CD20, CD22, IL-6R and complement factors in treatment of SLE have been recently conducted and in spite of the good results reported by some of them, no definite conclusion on their risk-benefit profile can be drawn. The current review summarizes the results obtained in the field and reveals the perspectives for the development of new and more effective strategies for SLE treatment in combination with other immunomodulating drugs. PMID:26933777

  13. Dendritic Cells in Systemic Lupus Erythematosus

    PubMed Central

    Seitz, Heather M.; Matsushima, Glenn K.

    2010-01-01

    Systemic lupus erythematosus (SLE) persists as a chronic inflammatory autoimmune disease and is characterized by the production of autoantibodies and immune complexes that affects multiple organs. The underlying mechanism that triggers and sustain disease are complex and involves certain susceptibility genes and environmental factors. There have been several immune mediators linked to SLE including cytokines and chemokines that have been reviewed elsewhere(1–3). A number of articles have reviewed the role of B cells and T cells in SLE(4–10). Here, we focus on role of dendritic cells (DC) and innate immune factors that may regulate autoreactive B cells. PMID:20367140

  14. C1q and systemic lupus erythematosus.

    PubMed

    Walport, M J; Davies, K A; Botto, M

    1998-08-01

    In this chapter we review the association between SLE and C1q. In the first part of the chapter we discuss the clinical associations of C1q deficiency, and tabulate the available information in the literature relating to C1q deficiency and autoimmune disease. Other clinical associations of C1q deficiency are then considered, and we mention briefly the association between other genetically determined complement deficiencies and lupus. In the review we explore the relationship between C1q consumption and lupus and we discuss the occurrence of low molecular weight (7S) C1q in lupus, which raises the possibility that increased C1q turnover in the disease may result in unbalanced chain synthesis of the molecule. Anti-C1q antibodies are also strongly associated with severe SLE affecting the kidney, and with hypocomplementaemic urticarial vasculitis, and these associations are also examined. We address the question of how C1q deficiency may cause SLE, discussing the possibility that this may be due to abnormalities of immune complex processing, which have been well characterised in a umber of different human models. There is clear evidence that immune complex processing is abnormal in patients with hypocomplementaemia, and this is compatible with the hypothesis that ineffective immune complex clearance could cause tissue injury, and this may in turn stimulate an autoantibody response. We have also considered the possibility that C1q-C1q receptor interactions are critical in the regulation of apoptosis, and we explore the hypothesis that dysregulation of apoptosis could explain important features in the development of autoimmune disease associated with C1q deficiency. An abnormally high rate of apoptosis, or defective clearance of apoptotic cells, could promote the accumulation of abnormal cellular products that might drive an autoimmune response. Anti-C1q antibodies have been described in a number of murine models of lupus, and these are also briefly discussed. We focus

  15. Lupus erythematosus: considerations about clinical, cutaneous and therapeutic aspects*

    PubMed Central

    Moura Filho, Jucélio Pereira; Peixoto, Raiza Luna; Martins, Lívia Gomes; de Melo, Sillas Duarte; de Carvalho, Ligiana Leite; Pereira, Ana Karine F. da Trindade C.; Freire, Eutilia Andrade Medeiros

    2014-01-01

    Systemic Lupus Erythematosus is a chronic inflammatory disease with multifactorial etiology. Although clinical manifestations are varied, the skin is an important target-organ, which contributes to the inclusion of skin lesions in 4 out of the 17 new criteria for the diagnosis of the disease, according to the Systemic Lupus International Collaborating Clinics. The cutaneous manifestations of lupus are pleomorphic. Depending on their clinical characteristics, they can be classified into Acute Cutaneous Lupus Erythematosus, Subacute Cutaneous Lupus Erythematosus, Chronic Cutaneous Lupus Erythematosus and Intermittent Cutaneous Lupus Erythematosus. Treatment is based on preventive measures, reversal of inflammation, prevention of damage to target organs and relief of adverse events due to pharmacological therapy. The most commonly used treatment options are topical, systemic and surgical treatment, as well as phototherapy. The correct handling of the cases depends on a careful evaluation of the morphology of the lesions and the patient's general status, always taking into consideration not only the benefits but also the side effects of each therapeutic proposal. PMID:24626656

  16. The systematic status of the Italian wolf Canis lupus

    USGS Publications Warehouse

    Nowak, R.M.; Federoff, N.E.

    2002-01-01

    In the past, the gray wolf Canis lupus Linnaeus, 1758, has been recognized in Italy as either the subspecies lupus or italicus. It has also been postulated that this population has undergone introgression from the domestic dog Canis familiaris. In order to clarify these issues, multistatistical analyses were made of 10 skull measurements of 34 full grown male wolves from the Italian Peninsula, 91 other male Eurasian wolves, and 20 domestic dogs. The analyses, together with other morphological evidence and prior genetic research, support recognition of the Italian wolf as a separate subspecies, Canis lupus italicus. The same evidence indicates that the subspecies has not been affected through hybridization with the domestic dog.

  17. Systemic lupus erythematosus and atherosclerosis: Review of the literature.

    PubMed

    Frieri, Marianne; Stampfl, Heather

    2016-01-01

    The purpose of this manuscript is to extensively review the literature related to systemic lupus erythematosus and atherosclerosis. The conclusion of this review has covered accelerated atherosclerosis in systemic lupus erythematosus, the role of complement, interferon in premature atherosclerosis, inflammatory mediators such as cytokines, leukocytes, innate and adaptive immunity, hydrolytic enzymes, reactive oxygen species, vascular endothelial growth factor, toll receptors in lupus nephritis, several specific anti-inflammatory pharmacological therapies, and potential prevention strategies for atherothrombotic events, interferons and the inflammasome. It is important for allergist-immunologists, rheumatologists both in academic institutions and in practice to understand this important disorder. PMID:26299985

  18. Do we still need renal biopsy in lupus nephritis?

    PubMed Central

    Cervera, Ricard

    2016-01-01

    The natural course of systemic lupus erythematosus (SLE) is characterized by periods of disease activity and remissions. Prolonged disease activity results in cumulative organ damage. Lupus nephritis is one of the most common and devastating manifestations of SLE. In the era of changing therapy to less toxic regimens, some authors have stated that if mycophenolate mofetil can be used for the induction and maintenance treatment in all histological classes of lupus nephritis, renal biopsy can be omitted. This article aims to answer the question of what brings the bigger risk: renal biopsy or its abandonment. PMID:27407281

  19. Systemic lupus erythematosus flare triggered by a spider bite.

    PubMed

    Martín Nares, Eduardo; López Iñiguez, Alvaro; Ontiveros Mercado, Heriberto

    2016-01-01

    Systemic lupus erythematosus is a chronic autoimmune disease with a relapsing and remitting course characterized by disease flares. Flares are a major cause of hospitalization, morbidity and mortality in patients with systemic lupus erythematosus. Some triggers for these exacerbations have been identified, including infections, vaccines, pregnancy, environmental factors such as weather, stress and drugs. We report a patient who presented with a lupus flare with predominantly mucocutaneous, serosal and cardiac involvement after being bitten by a spider and we present the possible mechanisms by which the venom elicited such a reaction. To the best of our knowledge, this is the first such case reported in the literature. PMID:26494589

  20. Julian Lennon Is Global Ambassador for the Lupus Foundation of America | NIH MedlinePlus the Magazine

    MedlinePlus

    ... turn JavaScript on. Feature: Lupus Julian Lennon Is Global Ambassador for the Lupus Foundation of America Past ... disease. You mentioned you are now serving as Global Ambassador for the Lupus Foundation of America. What ...

  1. A model for lupus brain disease

    PubMed Central

    Diamond, Betty; Volpe, Bruce T.

    2015-01-01

    Summary Systemic lupus erythematosus is an autoimmune disease characterized by antibodies that bind target autoantigens in multiple organs in the body. In peripheral organs, immune complexes engage the complement cascade, recruiting blood-borne inflammatory cells and initiating tissue inflammation. Immune complex-mediated activation of Fc receptors on infiltrating blood-borne cells and tissue resident cells amplifies an inflammatory cascade with resulting damage to tissue function, ultimately leading to tissue destruction. This pathophysiology appears to explain tissue injury throughout the body, except in the central nervous system. This review addresses a paradigm we have developed for autoantibody-mediated brain damage. This paradigm suggests that antibody-mediated brain disease does not depend on immune complex formation but rather on antibody-mediated alterations in neuronal activation and survival. Moreover, antibodies only access brain tissue when blood-brain barrier integrity is impaired, leading to a lack of concurrence of brain disease and tissue injury in other organs. We discuss the implications of this model for lupus and for identifying other antibodies that may contribute to brain disease. PMID:22725954

  2. Targeted therapies in systemic lupus erythematosus.

    PubMed

    Grech, P; Khamashta, Ma

    2013-09-01

    Systemic lupus erythematosus (SLE) is a chronic, multisystem disorder characterised by loss of tolerance to endogenous nuclear antigens and autoantibody formation. Recent insight into the immunopathogenesis of lupus has provided the foundation for a novel class of agents which target specific, dysregulated components of the immune system. Efforts have focused predominantly on B-cell depleting therapies, of which belimumab was the first to demonstrate success in phase III studies and thus receive marketing authorisation. Off-label prescribing of rituximab in refractory cases is common and supported by uncontrolled studies, which suggest a favourable risk:benefit profile. However, two placebo-controlled trials failed to show benefit, possibly because of inappropriate patient selection and other aspects of trial methodology. Inhibition of dysregulated co-stimulatory signals and cytokines are other therapeutic strategies currently under investigation. Some candidate drugs failed to meet primary endpoints in early-phase clinical trials, yet demonstrated clinical benefit when alternative assessment criteria were applied or specific patient sub-groups analysed. Well-designed studies of greater size and duration are needed to clarify the therapeutic utility of these agents. Future immunomodulatory strategies targeting interferon-alpha, T cells, oxidative stress and epigenetic abnormalities may reduce multisystem disease activity and prolong survival in this complex and heterogeneic disease. PMID:23963429

  3. The Protective Effect of Bafilomycin A1 Against Cobalt Nanoparticle-Induced Cytotoxicity and Aseptic Inflammation in Macrophages In Vitro.

    PubMed

    Wang, Songhua; Liu, Fan; Zeng, Zhaoxun; Yang, Huilin; Jiang, Haitao

    2016-01-01

    Co ions released due to corrosion of Co nanoparticles (CoNPs) in the lysosomes of macrophages may be a factor in the particle-induced cytotoxicity and aseptic inflammation accompanying metal-on-metal (MOM) hip prosthesis failure. Here, we show that CoNPs are easily dissolved under a low pH, simulating the acidic lysosomal environment. We then used bafilomycin A1 to change the pH inside the lysosome to inhibit intracellular corrosion of CoNPs and then investigated its protective effects against CoNP-induced cytotoxicity and aseptic inflammation on murine macrophage RAW264.7 cells. XTT {2,3-bis (2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide} assays revealed that bafilomycin A1 can significantly decrease CoNP-induced cytotoxicity in RAW264.7 cells. Enzyme-linked immunosorbent assays showed that bafilomycin A1 can significantly decrease the subtoxic concentration of CoNP-induced levels of pro-inflammatory cytokines (tumor necrosis factor-α, interleukin-1β, and interleukin-6), but has no effect on anti-inflammatory cytokines (transforming growth factor-β and interleukin-10) in RAW264.7 cells. We studied the protective mechanism of bafilomycin A1 against CoNP-induced effects in RAW264.7 cells by measuring glutathione/oxidized glutathione (GSH/GSSG), superoxide dismutase, catalase, and glutathione peroxidase levels and employed scanning electron microscopy, transmission electron microscopy, and energy dispersive spectrometer assays to observe the ultrastructural cellular changes. The changes associated with apoptosis were assessed by examining the pAKT and cleaved caspase-3 levels using Western blotting. These data strongly suggested that bafilomycin A1 can potentially suppress CoNP-induced cytotoxicity and aseptic inflammation by inhibiting intracellular corrosion of CoNPs and that the reduction in Co ions released from CoNPs may play an important role in downregulating oxidative stress in RAW264.7 cells. PMID:26054709

  4. Breeding season of wolves, Canis lupus, in relation to latitude

    USGS Publications Warehouse

    Mech, L.D.

    2002-01-01

    A significant relationship was found between Wolf (Canis lupus) breeding dates and latitudes between 12 deg. and 80 deg. N, with Wolves breeding earlier at lower latitudes, probably because of differences in seasonality.

  5. Prey escaping wolves, Canis lupus, despite close proximity

    USGS Publications Warehouse

    Nelson, M.E.; Mech, L.D.

    1993-01-01

    We describe attacks by wolf (Canis lupus) packs in Minnesota on a white-tailed deer (Odocoileus virginianus) and a moose (Alces alces) in which wolves were within contact distance of the prey but in which the prey escaped.

  6. Breeding season of Wolves, Canis lupus, in relation to latitude

    USGS Publications Warehouse

    Mech, L.D.

    2002-01-01

    A significant relationship was found between Wolf (Canis lupus) breeding dates and latitudes between 12?? and 80??N, with Wolves breeding earlier at lower latitudes, probably because of differences in seasonality.

  7. First record of coccidiosis in Wolves, Canis Lupus

    USGS Publications Warehouse

    David, Mech L.; Kurtz, H.J.

    1999-01-01

    Three 4-month-old Wolf (Canis lupus) pups in the Superior National Forest of Minnesota died during August and September 1997, apparently from coccidiosis. This appears to be the first record of coccidiosis in Wolves.

  8. For Parents of Children and Teens Living with Lupus

    MedlinePlus

    ... image and felt increases in negative mood, negative self-esteem, and depressive symptoms. Podcasts | Sep. 11, 2012 Parents ... among children with lupus. Magazine | Jul. 01, 2010 Self-Esteem Survival Skills How to Stay Upbeat When Dealing ...

  9. A diagnostic dilemma: lupus nephritis or renal polyarteritis nodosa?

    PubMed

    Bhushan, Shashi; Abreo, Kenneth; Rodziewicz, Natalie; Gu, Xin; Singh, Neeraj

    2016-07-01

    Lupus nephritis and renal polyarteritis nodosa (PAN) are two distinct disorders that rarely overlap. Herein, we describe a patient who was initially diagnosed with lupus nephritis based on her clinical presentation, proteinuria, hematuria, positive anti-nuclear antibody, and a kidney biopsy. A month later, the patient presented with left flank pain and weakness. A CT scan of the abdomen and pelvis showed a perinephric hematoma and the renal arteriogram revealed numerous microaneurysms within the kidney consistent with renal PAN. This case elucidates the diagnostic and management dilemmas that confront physicians taking care of patients with overlapping features of lupus nephritis and renal PAN and also points to the possible role of lupus nephritis in pathogenesis of renal PAN. PMID:27055352

  10. Intravenous Immunoglobulin in the Management of Lupus Nephritis

    PubMed Central

    Wenderfer, Scott E.; Thacker, Trisha

    2012-01-01

    The occurrence of nephritis in patients with systemic lupus erythematosus is associated with increased morbidity and mortality. The pathogenesis of lupus nephritis is complex, involving innate and adaptive cellular and humoral immune responses. Autoantibodies in particular have been shown to be critical in the initiation and progression of renal injury, via interactions with both Fc-receptors and complement. One approach in the management of patients with lupus nephritis has been the use of intravenous immunoglobulin. This therapy has shown benefit in the setting of many forms of autoantibody-mediated injury; however, the mechanisms of efficacy are not fully understood. In this paper, the data supporting the use of immunoglobulin therapy in lupus nephritis will be evaluated. In addition, the potential mechanisms of action will be discussed with respect to the known involvement of complement and Fc-receptors in the kidney parenchyma. Results are provocative and warrant additional clinical trials. PMID:23056926

  11. Inhibition of C5a receptor alleviates experimental CNS lupus

    PubMed Central

    Jacob, Alexander; Hack, Bradley; Bai, Tao; Brorson, James R.; Quigg, Richard J.; Alexander, Jessy J.

    2010-01-01

    To investigate the role of C5a generated on complement activation in brain, the lupus model, MRL/lpr mice were treated with C5a receptor(R) antagonist (ant). Neutrophil infiltration, ICAM, TNF-α and iNOS mRNA expression, neuronal apoptosis and the expression of p-JNK, pSTAT1 and p-Erk were reduced and p-Akt increased on C5aR inhibition in MRL/lpr brains. MRL/lpr serum caused increased apoptosis in neurons showing that lupus had a direct effect on these cells. C5aRant pretreatment prevented the lupus serum induced loss of neuronal cells. Our findings demonstrate for the first time that C5a/C5aR signaling plays an important role in the pathogenesis of CNS lupus. PMID:20207017

  12. Management of skin disease in patients with lupus erythematosus.

    PubMed

    Callen, Jeffrey P

    2002-04-01

    Skin disease in patients with lupus erythematosus may be subdivided into two broad categories - those represented by a 'specific' histopathology, the interface dermatitis, and those with changes that are not specific to lupus erythematosus, for example, vasculitis, mucin infiltration, etc. The specific skin lesions that are most common are discoid lupus erythematosus (DLE) and subacute cutaneous lupus erythematosus (SCLE). Evaluation will allow the treating physician to assign a prognosis. Cutaneous lesions can generally be managed with standard therapies. Patients with discoid LE and subacute cutaneous LE are generally photosensitive, and therefore sunscreens, protective clothing and behavioural alteration should be discussed with all patients. Topical corticosteroids are a standard form of therapy, but 'newer' agents such as retinoids, calcipotriene and tacrolimus might be effective. Antimalarial agents are generally effective. Attempts to reduce or stop smoking may aid in the control of cutaneous LE. The choice of alternative therapy is personal, and discussions of the risks and benefits should be carefully documented. PMID:12041952

  13. Non-invasive imaging to monitor lupus nephritis and neuropsychiatric systemic lupus erythematosus

    PubMed Central

    Thurman, Joshua M.; Serkova, Natalie J.

    2015-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease that can affect multiple different organs, including the kidneys and central nervous system (CNS). Conventional radiological examinations in SLE patients include volumetric/ anatomical computed tomography (CT), magnetic resonance imaging (MRI) and ultrasound (US). The utility of these modalities is limited, however, due to the complexity of the disease. Furthermore, standard CT and MRI contrast agents are contraindicated in patients with renal impairment. Various radiologic methods are currently being developed to improve disease characterization in patients with SLE beyond simple anatomical endpoints. Physiological non-contrast MRI protocols have been developed to assess tissue oxygenation, glomerular filtration, renal perfusion, interstitial diffusion, and inflammation-driven fibrosis in lupus nephritis (LN) patients. For neurological symptoms, vessel size imaging (VSI, an MRI approach utilizing T2-relaxing iron oxide nanoparticles) has shown promise as a diagnostic tool. Molecular imaging probes (mostly for MRI and nuclear medicine imaging) have also been developed for diagnosing SLE with high sensitivity, and for monitoring disease activity. This paper reviews the challenges in evaluating disease activity in patients with LN and neuropsychiatric systemic lupus erythematosus (NPSLE). We describe novel MRI and positron-emission tomography (PET) molecular imaging protocols using targeted iron oxide nanoparticles and radioactive ligands, respectively, for detection of SLE-associated inflammation. PMID:26309728

  14. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling

    PubMed Central

    Bhadane, Bhushan S.; Patil, Ravindra H.

    2016-01-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  15. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  16. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination.

    PubMed

    Atwater, J E; Michalek, W F; Wheeler, R R; Dahl, R; Lunsford, T D; Garmon, F C; Sauer, R L

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus. PMID:11587573

  17. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    PubMed

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  18. A kinematic study of the Lupus star-forming region

    NASA Astrophysics Data System (ADS)

    Galli, P. A. B.; Bertout, C.; Teixeira, R.; Ducourant, C.

    2014-10-01

    In this paper, we study the southern star-forming region located in Lupus that constitutes one of the richest associations of T Tauri stars. Based on the convergent point (CP) method combined with a k-NN analysis we identify 109 pre-main sequence stars in this region that define the Lupus association of comoving stars, and derive individual distances for all group members.

  19. T-cell-directed therapies in systemic lupus erythematosus.

    PubMed

    Nandkumar, P; Furie, R

    2016-09-01

    Drug development for the treatment of systemic lupus erythematosus (SLE) has largely focused on B-cell therapies. A greater understanding of the immunopathogenesis of SLE coupled with advanced bioengineering has allowed for clinical trials centered on other targets for SLE therapy. The authors discuss the benefits and shortcomings of focusing on T-cell-directed therapies in SLE and lupus nephritis clinical trials. PMID:27497252

  20. Systemic lupus erythematosus presenting as pneumococcal septicaemia and septic arthritis.

    PubMed Central

    Webster, J; Williams, B D; Smith, A P; Hall, M; Jessop, J D

    1990-01-01

    A 50 year old woman presented with pneumococcal septicaemia, septic arthritis, and a lobar pneumonia and was subsequently diagnosed as having systemic lupus erythematosus. The blood film and splenic 99mTc sulphur colloid uptake were normal, although selective functional hyposplenism was shown by the impaired clearance of immunoglobulin coated erythrocytes. Systemic lupus erythematosus presenting with fulminating pneumococcal sepsis in the presence of selective defects in spleen function is previously unreported. PMID:2322028

  1. Advanced and Conventional Magnetic Resonance Imaging in Neuropsychiatric Lupus.

    PubMed

    Sarbu, Nicolae; Bargalló, Núria; Cervera, Ricard

    2015-01-01

    Neuropsychiatric lupus is a major diagnostic challenge, and a main cause of morbidity and mortality in patients with systemic lupus erythematosus (SLE). Magnetic resonance imaging (MRI) is, by far, the main tool for assessing the brain in this disease. Conventional and advanced MRI techniques are used to help establishing the diagnosis, to rule out alternative diagnoses, and recently, to monitor the evolution of the disease. This review explores the neuroimaging findings in SLE, including the recent advances in new MRI methods. PMID:26236469

  2. Advanced and Conventional Magnetic Resonance Imaging in Neuropsychiatric Lupus

    PubMed Central

    Sarbu, Nicolae; Bargalló, Núria; Cervera, Ricard

    2015-01-01

    Neuropsychiatric lupus is a major diagnostic challenge, and a main cause of morbidity and mortality in patients with systemic lupus erythematosus (SLE). Magnetic resonance imaging (MRI) is, by far, the main tool for assessing the brain in this disease. Conventional and advanced MRI techniques are used to help establishing the diagnosis, to rule out alternative diagnoses, and recently, to monitor the evolution of the disease. This review explores the neuroimaging findings in SLE, including the recent advances in new MRI methods. PMID:26236469

  3. Phenotypic associations of genetic susceptibility loci in systemic lupus erythematosus

    PubMed Central

    Sanchez, Elena; Nadig, Ajay; Richardson, Bruce C; Freedman, Barry I; Kaufman, Kenneth M; Kelly, Jennifer A; Niewold, Timothy B; Kamen, Diane L; Gilkeson, Gary S; Ziegler, Julie T; Langefeld, Carl D; Alarcón, Graciela S; Edberg, Jeffrey C; Ramsey-Goldman, Rosalind; Petri, Michelle; Brown, Elizabeth E; Kimberly, Robert P; Reveille, John D; Vilá, Luis M; Merrill, Joan T; Anaya, Juan-Manuel; James, Judith A; Pons-Estel, Bernardo A; Martin, Javier; Park, So-Yeon; Bang, So-Young; Bae, Sang-Cheol; Moser, Kathy L; Vyse, Timothy J; Criswell, Lindsey A; Gaffney, Patrick M; Tsao, Betty P; Jacob, Chaim O; Harley, John B; Alarcón-Riquelme, Marta E; Sawalha, Amr H

    2011-01-01

    Objective Systemic lupus erythematosus is a clinically heterogeneous autoimmune disease. A number of genetic loci that increase lupus susceptibility have been established. This study examines if these genetic loci also contribute to the clinical heterogeneity in lupus. Materials and methods 4001 European-derived, 1547 Hispanic, 1590 African-American and 1191 Asian lupus patients were genotyped for 16 confirmed lupus susceptibility loci. Ancestry informative markers were genotyped to calculate and adjust for admixture. The association between the risk allele in each locus was determined and compared in patients with and without the various clinical manifestations included in the ACR criteria. Results Renal disorder was significantly correlated with the lupus risk allele in ITGAM (p=5.0×10−6, OR 1.25, 95% CI 1.12 to 1.35) and in TNFSF4 (p=0.0013, OR 1.14, 95% CI 1.07 to 1.25). Other significant findings include the association between risk alleles in FCGR2A and malar rash (p=0.0031, OR 1.11, 95% CI 1.17 to 1.33), ITGAM and discoid rash (p=0.0020, OR 1.20, 95% CI 1.06 to 1.33), STAT4 and protection from oral ulcers (p=0.0027, OR 0.89, 95% CI 0.83 to 0.96) and IL21 and haematological disorder (p=0.0027, OR 1.13, 95% CI 1.04 to 1.22). All these associations are significant with a false discovery rate of <0.05 and pass the significance threshold using Bonferroni correction for multiple testing. Conclusion Significant associations were found between lupus clinical manifestations and the FCGR2A, ITGAM, STAT4, TNSF4 and IL21 genes. The findings suggest that genetic profiling might be a useful tool to predict disease manifestations in lupus patients in the future. PMID:21719445

  4. Plasmodium falciparum Malaria Challenge by the Bite of Aseptic Anopheles stephensi Mosquitoes: Results of a Randomized Infectivity Trial

    PubMed Central

    Lyke, Kirsten E.; Laurens, Matthew; Adams, Matthew; Billingsley, Peter F.; Richman, Adam; Loyevsky, Mark; Chakravarty, Sumana; Plowe, Christopher V.; Sim, B. Kim Lee; Edelman, Robert; Hoffman, Stephen L.

    2010-01-01

    Background Experimental infection of malaria-naïve volunteers by the bite of Plasmodium falciparum-infected mosquitoes is a preferred means to test the protective effect of malaria vaccines and drugs. The standard model relies on the bite of five infected mosquitoes to induce malaria. We examined the efficacy of malaria transmission using mosquitoes raised aseptically in compliance with current Good Manufacturing Practices (cGMPs). Methods and Findings Eighteen adults aged 18–40 years were randomized to receive 1, 3 or 5 bites of Anopheles stephensi mosquitoes infected with the chloroquine-sensitive NF54 strain of P. falciparum. Seventeen participants developed malaria; fourteen occurring on Day 11. The mean prepatent period was 10.9 days (9–12 days). The geometric mean parasitemia was 15.7 parasites/µL (range: 4–70) by microscopy. Polymerase chain reaction (PCR) detected parasites 3.1 (range: 0–4) days prior to microscopy. The geometric mean sporozoite load was 16,753 sporozoites per infected mosquito (range: 1,000–57,500). A 1-bite participant withdrew from the study on Day 13 post-challenge and was PCR and smear negative. Conclusions The use of aseptic, cGMP-compliant P. falciparum-infected mosquitoes is safe, is associated with a precise prepatent period compared to the standard model and appears more efficient than the standard approach, as it led to infection in 100% (6/6) of volunteers exposed to three mosquito bites and 83% (5/6) of volunteers exposed to one mosquito bite. Trial Registration ClinicalTrials.gov NCT00744133 PMID:21042404

  5. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    SciTech Connect

    Haydary, J.; Susa, D.; Dudáš, J.

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  6. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed. PMID:27236460

  7. Mood Disorders in Systemic Lupus Erythematosus

    PubMed Central

    Hanly, John G.; Su, Li; Urowitz, Murray B.; Romero-Diaz, Juanita; Gordon, Caroline; Bae, Sang-Cheol; Bernatsky, Sasha; Clarke, Ann E.; Wallace, Daniel J.; Merrill, Joan T.; Isenberg, David A.; Rahman, Anisur; Ginzler, Ellen M.; Petri, Michelle; Bruce, Ian N.; Dooley, M. A.; Fortin, Paul; Gladman, Dafna D.; Sanchez-Guerrero, Jorge; Steinsson, Kristjan; Ramsey-Goldman, Rosalind; Khamashta, Munther A.; Aranow, Cynthia; Alarcón, Graciela S.; Fessler, Barri J.; Manzi, Susan; Nived, Ola; Sturfelt, Gunnar K.; Zoma, Asad A.; van Vollenhoven, Ronald F.; Ramos-Casals, Manuel; Ruiz-Irastorza, Guillermo; Lim, S. Sam; Kalunian, Kenneth C.; Inanc, Murat; Kamen, Diane L.; Peschken, Christine A.; Jacobsen, Soren; Askanase, Anca; Theriault, Chris; Thompson, Kara; Farewell, Vernon

    2015-01-01

    Objective To determine the frequency, clinical and autoantibody associations and outcome of mood disorders in a multi-ethnic/racial, prospective, inception cohort of SLE patients. Methods Patients were assessed annually for mood disorders (4 types as per DSM-IV) and 18 other neuropsychiatric (NP) events. Global disease activity (SLEDAI-2K), SLICC/ACR damage index (SDI) and SF-36 subscale, mental (MCS) and physical (PCS) component summary scores were collected. Time to event, linear and ordinal regressions and multi-state models were used as appropriate. Results Of 1,827 SLE patients, 88.9% were female, 48.9% Caucasian, mean ± SD age 35.1±13.3 years, disease duration 5.6±4.8 months and follow-up 4.73±3.45 years. Over the study 863 (47.2%) patients had 1,627 NP events. Mood disorders occurred in 232/1827 (12.7%) patients and 98/256 (38.3%) events were attributed to SLE. The estimated cumulative incidence of any mood disorder after 10 years was 17.7% (95%CI=[15.1%,20.2%]). There was a greater risk of mood disorder in patients with concurrent NP events (p ≤ 0.01) and lower risk with Asian race/ethnicity (p=0.01) and immunosuppressive drugs (p=0.003). Mood disorders were associated with lower mental health subscale and MCS scores but not with SLEDAI-2K, SDI scores or lupus autoantibodies. Antidepressants were used in 168/232 (72.4%) patients with depression. 126/256 (49.2%) mood disorders resolved in 117/232 (50.4%) patients. Conclusion Mood disorders, the second most frequent NP event in SLE patients, have a negative impact on HRQoL and improve over time. The lack of association with global SLE disease activity, cumulative organ damage and lupus autoantibodies emphasize their multifactorial etiology and a role for non-lupus specific therapies. PMID:25778456

  8. Towards new avenues in the management of lupus glomerulonephritis.

    PubMed

    Mok, C C

    2016-04-01

    Renal involvement in systemic lupus erythematosus (SLE) carries substantial morbidity and mortality. Conventional immunosuppressive agents (cyclophosphamide and azathioprine) have suboptimal efficacy and substantial toxicity. Mycophenolate mofetil has emerged as an alternative agent for both induction and maintenance therapy in lupus nephritis because of its reduced gonadal toxicity, despite its failure to demonstrate superiority over cyclophosphamide in pivotal studies. The calcineurin inhibitor tacrolimus has equivalent efficacy to cyclophosphamide and mycophenolate mofetil for inducing remission of lupus nephritis. Although rituximab has shown promise in refractory lupus nephritis, combining rituximab with mycophenolate mofetil as initial therapy offers no additional benefit. Considerable interethnic variation is evident in the efficacy and tolerability of the various immunosuppressive regimens, which necessitates individualized treatment and comparison of the efficacy of new regimens across different ethnic groups. For example, low-dose combinations of tacrolimus and mycophenolate mofetil seem to be more effective than pulse cyclophosphamide as induction therapy in Chinese patients. The same regimen has also been used successfully to treat refractory proliferative and membranous lupus nephritis in patients of various ethnic groups. Finally, novel serum and urinary biomarkers are being validated for diagnosis, prognostic stratification and early recognition of flares in lupus nephritis. PMID:26729459

  9. Lupus Nephritis: The Evolving Role of Novel Therapeutics

    PubMed Central

    Rovin, Brad H.; Parikh, Samir V.

    2014-01-01

    Immune complex accumulation in the kidney is the hallmark of lupus nephritis and triggers a series of events that result in kidney inflammation and injury. Cytotoxic agents and corticosteroids are standard of care for lupus nephritis treatment, but are associated with considerable morbidity and suboptimal outcomes. Recently, there has been interest in using novel biologic agents and small molecules to treat lupus nephritis. These therapies can be broadly categorized as anti-inflammatory (laquinamod, anti–tumor necrosis factor–like weak inducer of apotosis, anti-C5, and retinoids), antiautoimmunity (anti-CD20, anti–interferon α, and costimulatory blockers), or both (anti–interleukin 6 and proteasome inhibitors). Recent lupus nephritis clinical trials applied biologics or small molecules of any category to induction treatment, seeking short-term end points of complete renal response. These trials in general have not succeeded. When lupus nephritis comes to clinical attention during the inflammatory stage of the disease, the autoimmune stage leading to kidney inflammation will have been active for some time. The optimal approach for using novel therapies may be to initially target kidney inflammation to preserve renal parenchyma, followed by suppression of autoimmunity. In this review, we discuss novel lupus nephritis therapies and how they fit into a combinatorial treatment strategy based on the pathogenic stage. PMID:24411715

  10. Systemic Lupus Erythematosus: Primary Care Approach to Diagnosis and Management.

    PubMed

    Lam, Nguyet-Cam Vu; Ghetu, Maria V; Bieniek, Marzena L

    2016-08-15

    Systemic lupus erythematosus is an autoimmune disease that affects many systems, including the skin, musculoskeletal, renal, neuropsychiatric, hematologic, cardiovascular, pulmonary, and reproductive systems. Family physicians should be familiar with the manifestations of lupus to aid in early diagnosis, monitoring patients with mild disease, recognizing warning signs that require referral to a rheumatologist, and helping to monitor disease activity and treatment in patients with moderate to severe disease. The American College of Rheumatology has 11 classification criteria for lupus. If a patient meets at least four criteria, lupus can be diagnosed with 95% specificity and 85% sensitivity. All patients with lupus should receive education, counseling, and support. Hydroxychloroquine is the cornerstone of treatment because it reduces disease flares and other constitutional symptoms. Low-dose glucocorticoids can be used to treat most manifestations of lupus. The use of immunosuppressive and cytotoxic agents depends on the body systems affected. Patients with mild disease that does not involve major organ systems can be monitored by their family physician. Patients with increased disease activity, complications, or adverse effects from treatment should be referred to a rheumatologist. To optimize treatment, it is important that a rheumatologist coordinate closely with the patient's family physician to improve chronic care as well as preventive health services. PMID:27548593

  11. Major gastrointestinal manifestations in lupus patients in Asia: lupus enteritis, intestinal pseudo-obstruction, and protein-losing gastroenteropathy.

    PubMed

    Chng, H H; Tan, B E; Teh, C L; Lian, T Y

    2010-10-01

    Gastrointestinal (GI) symptoms are common in patients with systemic lupus erythematosus (SLE) and may be due to the disease itself, side-effects of medications, or non-SLE causes. However, GI manifestations of lupus attract far less attention than the other major organ involvements, are infrequently reviewed and rarely documented in published lupus databases or cohort studies including those from countries in Asia. According to three reports from two countries in Asia, the cumulative prevalence of SLE GI manifestations range from 3.8% to 18%. In this review, we focus on three major GI manifestations in patients from Asian countries: lupus enteritis, intestinal pseudo-obstruction, and protein-losing gastroenteropathy, for which early recognition improves outcome and reduces morbidity and mortality. PMID:20947549

  12. Lupus vulgaris in a young girl.

    PubMed

    Goyal, Tarang; Varshney, Anupam; Bakshi, S K

    2013-01-01

    With the estimated global burden of TB being 8.8 million incident cases and 1.1 million deaths from TB in HIV-negative cases and additional 0.35 million deaths in HIV-associated cases,1 the total number of cutaneous TB cases ( < 1-2 % of total cases) becomes significant. With the WHO setting up public-private mix partnerships and a millenium development goal of a 50% reduction in the total number of incident cases, the case detection and reporting of unusual cutaneous TB cases becomes very important. We present a case of lupus vulgaris in a young girl with rapid progression of a large plaque with hypertrophic features in the periphery. The case is unusual due to its rapid progression, unusual site and extensive giant form which have never been reported previously. PMID:24060723

  13. [Therapeutic strategies for systemic lupus erythematosus].

    PubMed

    Schneider, M

    2015-04-01

    Therapeutic strategy means the definition of a long-term target, which should be reached by a chosen management. As for rheumatoid arthritis, the treat to target initiative recommends remission as the target for systemic lupus erythematosus (SLE) but the command variables of remission are not yet defined. The basis of a therapeutic strategy is first the analysis of those factors that may influence the achievement of the objectives: SLE disease activity, the differentiation of damage, organ manifestations, comorbidities, genetics, sex, age of onset and considering the pathophysiological basis are some of these factors. The next step is the analysis of the available substances and concepts that allow the target to be reached. Finally, rules for management (e.g. guidelines) are needed that enrich the possibility to reach the target and improve the prognosis of patients suffering from SLE. PMID:25854154

  14. The metabolic syndrome in systemic lupus erythematosus.

    PubMed

    Parker, Ben; Bruce, Ian N

    2010-02-01

    The metabolic syndrome (MetS) is a recently defined clustering of cardiovascular risk factors associated with increased insulin resistance and a high risk of developing type II diabetes mellitus. Systemic lupus erythematosus (SLE) is associated with an increased prevalence of the MetS and patients also show evidence of increased insulin resistance. Controversy remains, however, regarding the precise definition of the MetS and its exact role in predicting long-term coronary heart disease risk both in SLE and in the general population. The major benefit of identifying the MetS in patients with SLE is likely to be from highlighting patients for focused lifestyle interventions and helping to guide individualized therapeutic regimes that take into account cardiovascular risk. PMID:20202592

  15. Cerebral blood flow variations in CNS lupus

    SciTech Connect

    Kushner, M.J.; Tobin, M.; Fazekas, F.; Chawluk, J.; Jamieson, D.; Freundlich, B.; Grenell, S.; Freemen, L.; Reivich, M. )

    1990-01-01

    We studied the patterns of cerebral blood flow (CBF), over time, in patients with systemic lupus erythematosus and varying neurologic manifestations including headache, stroke, psychosis, and encephalopathy. For 20 paired xenon-133 CBF measurements, CBF was normal during CNS remissions, regardless of the symptoms. CBF was significantly depressed during CNS exacerbations. The magnitude of change in CBF varied with the neurologic syndrome. CBF was least affected in patients with nonspecific symptoms such as headache or malaise, whereas patients with encephalopathy or psychosis exhibited the greatest reductions in CBF. In 1 patient with affective psychosis, without clinical or CT evidence of cerebral ischemia, serial SPECT studies showed resolution of multifocal cerebral perfusion defects which paralleled clinical recovery.

  16. Immunofluorescence profile of discoid lupus erythematosus.

    PubMed

    Bharti, Shreekant; Dogra, Sunil; Saikia, Biman; Walker, Ranjana Minz; Chhabra, Seema; Saikia, Uma Nahar

    2015-01-01

    The direct immunofluorescence (DIF) of skin in conjunction with histopathology gives the best diagnostic yield. It is invaluable in confirming the diagnosis of small vessel vasculitides and bullous lesions of the skin and can be used as an additional tool to pinpoint the diagnosis of systemic and localized autoimmune diseases involving the skin. This study was undertaken to analyze the strength of DIF vis-à -vis histopathology in the diagnosis of discoid lupus erythematosus (DLE) and at the same time to elaborate the specific immunofluorescence findings in the lesions of DLE. The clinical profile and cutaneous lesions of 75 patients with DLE are described. DIF was positive in 68% and histopathology in 60% of cases. The most common immunoreactant was IgG at the dermoepidermal junction, followed by IgM and IgA. A conclusive diagnosis of DLE could be achieved satisfactorily in 64 cases (85%) by a combination of the two techniques. PMID:26549071

  17. Lupus or syphilis? That is the question!

    PubMed

    Duarte, Joana Azevedo; Henriques, Celia Coelho; Sousa, Carolina; Alves, José Delgado

    2015-01-01

    A 47-year-old man presented with fever, a maculopapular rash of the palms and soles, muscular weakness, weight loss, faecal incontinence, urinary retention and mental confusion with 1 month of evolution. Neurological examination revealed paraparesis and tactile hypoesthesia with distal predominance, and no sensory level. Laboratory investigations revealed a venereal disease research laboratory (VDRL) titre of 1/4 and Treponema pallidum haemagluttin antigen (TPHA) of 1/640, positive anti-nuclear antibodies of 1/640 and nephrotic proteinuria (3.6 g/24 h). Lumbar puncture excluded neurosyphilis, due to the absence of TPHA and VDRL. The diagnosis of systemic lupus erythematosus (SLE) was established and even though transverse myelitis as a rare presentation of SLE has a poor outcome, the patient improved with cyclophosphamide, high-dose corticosteroids and hydroxychloroquine. A diagnosis of secondary syphilis was also established and the patient was treated with intramuscular benzathine penicillin G. PMID:26045520

  18. Lupus anticoagulants: pathogenesis and laboratory diagnosis.

    PubMed

    Court, E L

    1997-12-01

    The pathogenesis of the lupus anticoagulant (LA) has been the focus of much research over the past decade, and a plethora of laboratory tests have been developed to detect it. This essay reviews the nature of LA and its pathogenesis, and a number of approaches employed in its diagnosis. These range from well established tests such as the kaolin clotting time (KCT), activated partial thromboplastin time (APTT) and tissue thromboplastin inhibition test (TTI), to the 'newer' tests such as the dilute Russell's viper venom time (DRVVT) and more recent snake venom tests such as the textarin/ecarin ratio and Taipan snake venom time (TSVT). The criteria for diagnosis are discussed, including pre-analytical variables such as sample preparation, and the effects of therapeutic anticoagulants used to treat thrombotic manifestations of the syndrome or an underlying disease process. PMID:9624740

  19. Systemic lupus erythematosus in 50 year olds.

    PubMed Central

    Domenech, I.; Aydintug, O.; Cervera, R.; Khamashta, M.; Jedryka-Goral, A.; Vianna, J. L.; Hughes, G. R.

    1992-01-01

    We compared the clinical and serological characteristics of 15 patients with onset of systemic lupus erythematosus after the age of 50 with those of 232 younger patients. The sex distribution was similar in both groups. All 15 patients were Caucasian. Autoimmune thyroiditis was found in 20% of the elderly patients. Initial manifestations, which presented more frequently in the older group, included thrombocytopenia (P < 0.05), sicca syndrome (P < 0.01) and cardiomyopathy (P < 0.005), whereas butterfly rash (P < 0.05) presented more frequently in the younger group. Analysis of cumulative clinical symptoms showed that butterfly rash (P < 0.05) and livedo reticularis (P < 0.05) were less frequent in the elderly. However, this group presented a significantly increased incidence of sicca syndrome (P < 0.005) and cardiomyopathy (P < 0.005). Antibodies to double-stranded DNA tended to occur less frequently in older patients (P < 0.05). PMID:1437923

  20. Silent renal involvement in systemic lupus erythematosus.

    PubMed

    Bennett, W M; Bardana, E J; Houghton, D C; Pirofsky, B; Striker, G D

    1977-01-01

    20 patients with active SLE without clinical evidence of renal involvement underwent percutaneous renal biopsy. 12 had varying proliferative changes on light microscopy. Of 19 ultrastructural examinations performed only 3 had no electron-dense deposits. Serum C3 and C4 levels were 63 +/- 8 and 8 +/- 2 mg% in patients with subendothelial deposits, compared to 142 +/- 27 and 27 +/- 6 mg%, respectively, in patients without deposits (p less than 0.01). All patients with diffuse proliferative changes had subendothelial deposits; however, one with normal light microscopy and another with focal proliferation also had them. It is concluded that no variant of lupus nephropathy can be excluded on clinical grounds alone. PMID:338507

  1. Periosteal reaction in systemic lupus erythematosus.

    PubMed

    Ahn, Joong Kyong; Lee, You Sun; Chung, Hey Won; Cha, Hoon-Suk; Koh, Eun-Mi

    2007-12-01

    Musculoskeletal complaints are the most common presenting symptoms in most of the patients with systemic lupus erythematosus (SLE). However, periosteal new bone formation is an extraordinarily rare condition in SLE. We report a case of periosteal reaction in SLE. A 31-year-old woman with SLE presented with both knee pain. Radiographs revealed periosteal reactions in both femur and tibia and around the metaphysis of the right distal tibia. Periosteal reaction can be caused by benign or malignant lesions and infection. We cannot find any other cause of periosteal reaction in our case after thorough evaluations. Periosteal reaction in SLE might be associated with inflammatory vascular changes. This is the first report of periosteal reaction in SLE after the 1990s description and the first report in Korea. PMID:17920323

  2. [Systemic treatment of cutaneous lupus erythematosus].

    PubMed

    Wenzel, Joerg; Bieber, Thomas; Uerlich, Manfred; Tüting, Thomas

    2003-09-01

    The treatment of cutaneous lupus erythematosus (CLE) remains a therapeutic challenge. In many cases, systemic treatment of the disease is necessary, especially in cases resistant to topical treatment or with internal organ involvement. Even though many different agents can be employed in this situation, most are not approved in Germany for the treatment of CLE. We give an overview of the agents used in the systemic treatment of CLE and review their mechanisms of action, indications and their practical use in cutaneous LE based on literature results and our own experience. We discuss corticosteroids, antimalarials, dapsone, azathioprine, cyclophosphamide, methotrexate, retinoids, cyclosporine A, mycophenolate mofetil, sulfasalazine, thalidomide, clofazimine, tacrolimus, immunoglobulins, monoclonal antibodies, plasmapheresis, etanercept, infliximab, feflunomid, gold and interferon-alpha. PMID:16285276

  3. Hypocomplementemic urticarial vasculitis or systemic lupus erythematosus?

    PubMed

    Trendelenburg, M; Courvoisier, S; Späth, P J; Moll, S; Mihatsch, M; Itin, P; Schifferli, J A

    1999-10-01

    The 2 patients presented here showed the typical signs of hypocomplementemic urticarial vasculitis syndrome (HUVS). During follow-up, there was an inverse correlation between anti-C1q autoantibody titer and C1q antigen concentration in serum in both patients over a period of 2 years. The first patient had nephritis characterized by immune deposits in glomeruli and around the tubules. The histological findings, C1q deposits, and presence of tubuloreticular inclusions in capillary endothelial cells suggested a disease process identical to systemic lupus erythematosus (SLE). The second patient, after a lag phase of 2 years, fulfilled a fourth American College of Rheumatology criteria for SLE when she developed anti-double-stranded DNA antibodies. HUVS and SLE overlap, and the criteria for identifying HUVS as an entity distinct from SLE are lacking. PMID:10516358

  4. Integrative neuroscience approach to neuropsychiatric lupus

    PubMed Central

    Gibson, Elizabeth L.; Rey, Carson; Huerta, Tomás S.; Huerta, Patricio T.

    2016-01-01

    We present a succinct review of our approach to study the interactions between the DNA-reactive antibodies that cross-react with the GluN2A and GluN2B subunits of the N-methyl-D-aspartate receptor, denoted DNRABs, and their brain targets in subjects with neuropsychiatric systemic lupus erythematosus (NPSLE). We have analyzed the DNRAB-based brain symptomatology in mouse models of NPSLE by using an integrative neuroscience approach, which includes behavioral assessment coupled with electrophysiological studies of neural networks and synaptic connections in target brain regions, such as the CA1 region of the hippocampus. Our results suggest a framework for understanding the interactions between immune factors and neural networks. PMID:26467973

  5. Neuropsychiatric Systemic Lupus Erythematosus: A Diagnostic Conundrum

    PubMed Central

    Joseph, Vivek; Anil, Rahul; Aristy, Sary

    2016-01-01

    A 70-year-old man presented with complaints of rapid cognitive decline and new onset leukopenia. The patient had a 17-year history of refractory seizures. Detailed review of symptoms and investigations revealed the patient met American College of Rheumatology (ACR) diagnostic criteria for systemic lupus erythematosus (SLE). The patient had high titer ANA with a strongly positive dsDNA. Immunosuppressive therapy with hydroxychloroquine and mycophenolate mofetil led to significant improvement in cognition and seizures. Neuropsychiatric SLE should be considered a potential differential diagnosis for patients presenting with seizures or cognitive decline. Moreover, neuropsychiatric manifestations especially seizures are an early event in the disease course of SLE. Hence, we believe that early diagnosis of SLE by neuropsychiatric manifestations will not only lead to better control of CNS symptoms but early immunosuppressive therapy could control the progression of the underlying autoimmune disease.

  6. Systemic Lupus Erythematosus Presenting as Neuroretinitis.

    PubMed

    Santra, Gouranga; Das, Indrani

    2015-10-01

    Neuroretinitis is the inflammation of retina and optic nerve. It is associated with optic disc edema accompanied by peripapillary or macular hard exudates. A 17 yr old female presented with headache and nausea of five days duration. She had periorbital edema and mild splenomegaly. Neurological assessment was non-contributory. She was found to have pancytopenia, albuminuria and a high ESR. Thereafter she developed blurring of vision of both eyes. Opthalmological examination showed it to be due to bilateral neuroretinitis. ANA and anti-ds DNA were strongly positive. Renal biopsy with immunofluorescence study revealed diffuse global proliferative lupus nephritis with active lesions [class IV-G (A)]. She was diagnosed as a case of SLE presenting with neuroretinitis. PMID:27608700

  7. Symptoms, Causes, Diagnosis, and Treatment of Lupus | NIH MedlinePlus the Magazine

    MedlinePlus

    ... most serious and life-threatening complications of lupus. Hydroxychloroquine, an antimalarial medication, is also used in the ... research has shown that lupus patients treated with hydroxychloroquine were less likely to develop severe kidney disease, ...

  8. Julian Lennon Is Global Ambassador for the Lupus Foundation of America

    MedlinePlus

    ... Julian Lennon Is Global Ambassador for the Lupus Foundation of America Past Issues / Spring 2014 Table of ... now serving as Global Ambassador for the Lupus Foundation of America. What do you hope to achieve ...

  9. What Black Women Should Know about Lupus: Ideas for Community Programs.

    ERIC Educational Resources Information Center

    National Inst. of Arthritis and Musculoskeletal and Skin Diseases (NIH), Bethesda, MD.

    Lupus is a serious health problem that mainly affects young women between the ages of 15 and 44. Although people of all races may get lupus, black women have three times higher rates of incidence, prevalence, and mortality than white women. With early detection and proper treatment, most people with lupus can lead a normal life. This kit is…

  10. Probable systemic lupus erythematosus with cell-bound complement activation products (CB-CAPS).

    PubMed

    Lamichhane, D; Weinstein, A

    2016-08-01

    Complement activation is a key feature of systemic lupus erythematosus (SLE). Detection of cell-bound complement activation products (CB-CAPS) occurs more frequently than serum hypocomplementemia in definite lupus. We describe a patient with normocomplementemic probable SLE who did not fulfill ACR classification criteria for lupus, but the diagnosis was supported by the presence of CB-CAPS. PMID:26911153

  11. Organ involvement other than lupus nephritis in childhood-onset systemic lupus erythematosus.

    PubMed

    Huggins, J L; Holland, M J; Brunner, H I

    2016-07-01

    In this review we critically analyze pulmonary, gastrointestinal and cardiac manifestations of childhood-onset systemic lupus erythematosus (cSLE). Clinical manifestations of these organ systems may be the initial manifestation of cSLE; frequently occur with very active cSLE; and are potential life-threatening manifestations often presenting to the emergency department and requiring admission to the intensive care unit. Early recognition and treatment of the pulmonary, gastrointestinal and cardiac manifestations of cSLE will result in improved prognosis and better outcomes. PMID:27252262

  12. Hair dye treatment use and clinical course in patients with systemic lupus erythematosus and cutaneous lupus.

    PubMed

    Jiménez-Alonso, J; Sabio, J M; Pérez-Alvarez, F; Reche, I; Hidalgo, C; Jáimez, L

    2002-01-01

    The etiological role of hair dye treatment (HDT), some of them such as permanent hair dyes containing aromatic amines, in the development of SLE has been previously ruled out. However, the possible influence of HDT use on the course and prognosis of lupus patients has been assessed only in one short-term study. Since HDT is very extensive among the population, the knowledge of this possible negative effect may be very important. Thus, the aim of this study was to assess the long-term influence of several HDTs on the course and clinical severity of patients with both systemic lupus erythematosus (SLE) and cutaneous lupus (CL). In this longitudinal case series study, 91 SLE patients and 22 CL patients were prospectively studied from October 1988 to May 2000. They were divided into three groups: (a) non-HDT users--patients who have never used HDT (n = 65); (b) P-HDT users--HDT permanent type users, alone or in combination with other types of HDT (n = 28); (c) non P-HDT--users of other treatments different from permanent tinting (bleach, lowlights, etc; n = 20). In each patient we determined: (1) number of flares/year in SLE patients and worsening of cutaneous lesions for CL; (2) Systemic Lupus International Collaborating Clinics/American College of Rheumatology (SLICC/ACR) damage index; (3) predominant damaged organs/systems according to the HDT use and type of HDT; and (4) subjective impression about the disease evolution in relation to HDT use. No significant differences were found with respect to flares/year and SLICC/ACR damage index between the study groups. Non-HDT group presented more renal involvement and serositis than both HDT-user groups. No patient related the HDT use to the worsening of his disease. Therefore, in this study no evidence of an association between the long-term use of several types of HDT and the clinical activity and course of SLE and CL was found. PMID:12195784

  13. Systemic lupus erythematosus and thrombotic thrombocytopenia purpura: a refractory case without lupus activity.

    PubMed

    Garcia Boyero, Raimundo; Mas Esteve, Eva; Mas Esteve, Maria; Millá Perseguer, M Magdalena; Marco Buades, Josefa; Beltran Fabregat, Juan; Cañigral Ferrando, Guillermo; Belmonte Serrano, Miguel Angel

    2013-01-01

    The association between systemic lupus erythematosus (SLE) and thrombotic thrombocytopenic purpura (TTP) has been infrequently reported. Usually, patients with TTP have more SLE activity and frequent renal involvement. Here we present a case of TTP associated to low-activity SLE. The absence of renal and major organ involvement increased the difficulty in making the initial diagnosis. ADAMTS13 activity in plasma in this patient was very low, as seen in other similar cases. The evolution of the patient was poor, needing plasma exchanges and immunosuppressive therapy, including the use of rituximab. PMID:23473755

  14. IRF5 deficiency ameliorates lupus but promotes atherosclerosis and metabolic dysfunction in a mouse model of lupus-associated atherosclerosis

    PubMed Central

    Watkins, Amanda A.; Yasuda, Kei; Wilson, Gabriella E.; Aprahamian, Tamar; Xie, Yao; Maganto-Garcia, Elena; Shukla, Prachi; Oberlander, Lillian; Laskow, Bari; Menn-Josephy, Hanni; Wu, Yuanyuan; Duffau, Pierre; Fried, Susan K.; Lichtman, Andrew H.; Bonegio, Ramon G.; Rifkin, Ian R.

    2015-01-01

    Premature atherosclerosis is a severe complication of lupus and other systemic autoimmune disorders. Gain-of-function polymorphisms in interferon regulatory factor 5 (IRF5) are associated with an increased risk of developing lupus and IRF5 deficiency in lupus mouse models ameliorates disease. However, whether IRF5 deficiency also protects against atherosclerosis development in lupus is not known. Here we addressed this question using the gld.apoE−/− mouse model. IRF5 deficiency markedly reduced lupus disease severity. Unexpectedly, despite the reduction in systemic immune activation, IRF5-deficient mice developed increased atherosclerosis and also exhibited metabolic dysregulation characterized by hyperlipidemia, increased adiposity and insulin resistance. Levels of the atheroprotective cytokine IL-10 were reduced in aortae of IRF5-deficient mice and in vitro studies demonstrated that IRF5 is required for IL-10 production downstream of TLR7 and TLR9 signaling in multiple immune cell types. Chimera studies showed that IRF5 deficiency in bone marrow-derived cells prevents lupus development and contributes in part to the increased atherosclerosis. Notably, IRF5 deficiency in non-bone marrow-derived cells also contributes to the increased atherosclerosis through the generation of hyperlipidemia and increased adiposity. Together, our results reveal a protective role for IRF5 in lupus-associated atherosclerosis that is mediated through the effects of IRF5 in both immune and non-immune cells. These findings have implications for the proposed targeting of IRF5 in the treatment of autoimmune disease as global IRF5 inhibition may exacerbate cardiovascular disease in these patients. PMID:25595782

  15. Mechanisms of Autoantibody Production in Systemic Lupus Erythematosus

    PubMed Central

    Han, Shuhong; Zhuang, Haoyang; Shumyak, Stepan; Yang, Lijun; Reeves, Westley H.

    2015-01-01

    Autoantibodies against a panoply of self-antigens are seen in systemic lupus erythematosus, but only a few (anti-Sm/RNP, anti-Ro/La, anti-dsDNA) are common. The common lupus autoantigens are nucleic acid complexes and levels of autoantibodies can be extraordinarily high. We explore why that is the case. Lupus is associated with impaired central or peripheral B-cell tolerance and increased circulating autoreactive B cells. However, terminal differentiation is necessary for autoantibody production. Nucleic acid components of the major lupus autoantigens are immunostimulatory ligands for toll-like receptor (TLR)7 or TLR9 that promote plasma cell differentiation. We show that the levels of autoantibodies against the U1A protein (part of a ribonucleoprotein) are markedly higher than autoantibodies against other antigens, including dsDNA and the non-nucleic acid-associated autoantigens insulin and thyroglobulin. In addition to driving autoantibody production, TLR7 engagement is likely to contribute to the pathogenesis of inflammatory disease in lupus. PMID:26029213

  16. Lupus-associated thrombotic thrombocytopenic purpura-like microangiopathy.

    PubMed

    Blum, Daniel; Blake, Geoffrey

    2015-11-01

    Recently reported cases of lupus complicated by a thrombotic thrombocytopenic purpura (TTP)-like syndrome suggest a survival benefit to early treatment with plasma exchange. The following is a report of the eighth such case in the last ten years. A 44-year-old lady known for lupus presented with the nephrotic syndrome and a renal biopsy was consistent with class 4G lupus nephritis. She was given high-dose steroids and cytotoxic therapy, but her induction therapy was complicated by the classic pentad of TTP. She was subsequently treated with another course of high-dose steroids, a different cytotoxic agent, and plasma exchange, with clinical resolution shortly thereafter. Similar to seven recently reported cases of microangiopathy in lupus, this lady's TTP-like syndrome improved dramatically after initiation of plasma exchange, despite not having a severely deficient ADAMTS13. This has implications on both current clinical practice and on the pathogenesis of TTP-like syndromes in lupus. PMID:26558190

  17. Two case reports indicating the dilemma in diagnosing lupus cerebritis.

    PubMed

    Goswami, Dharitri; Chatterjee, Shuddhosatta; Ahmad, Bashar Imam; Das, Shantanu

    2013-01-01

    Systemic Lupus Erythematosus (SLE) is a connective-tissue disorder commonly affecting females of reproductive age group. Lupus Cerebritis is a serious neurological complication encountered in a good percentage of SLE cases. In this report, we discuss two Lupus Cerebritis patients, who were successfully diagnosed and treated. The first case, presented with generalized seizure, severe metabolic acidosis, and shock, with a history of fever of one-month duration. The second case manifested with an attack of generalized seizure after suffering from low-grade intermittent fever and joint pains for a duration of one-and-a-half months. Central Nervous System (CNS) involvement in SLE is caused by an inflammatory response of the autoimmune system, precipitated by an increased concentration of cytokines. Prompt identification of Lupus Cerebritis is extremely difficult, mainly because there is no single laboratory or radiological confirmatory test. Assessment of the clinical features and neurological signs, along with detection of antibodies in the serum and cerebrospinal fluid are necessary to arrive at a diagnosis. Lupus Cerebritis should be included in the provisional diagnosis of a female patient of reproductive age group, who presents with complicated neurological manifestations and with no clear-cut clinical, pathological, or image finding. PMID:24479062

  18. Lupus-associated thrombotic thrombocytopenic purpura-like microangiopathy

    PubMed Central

    Blum, Daniel; Blake, Geoffrey

    2015-01-01

    Recently reported cases of lupus complicated by a thrombotic thrombocytopenic purpura (TTP)-like syndrome suggest a survival benefit to early treatment with plasma exchange. The following is a report of the eighth such case in the last ten years. A 44-year-old lady known for lupus presented with the nephrotic syndrome and a renal biopsy was consistent with class 4G lupus nephritis. She was given high-dose steroids and cytotoxic therapy, but her induction therapy was complicated by the classic pentad of TTP. She was subsequently treated with another course of high-dose steroids, a different cytotoxic agent, and plasma exchange, with clinical resolution shortly thereafter. Similar to seven recently reported cases of microangiopathy in lupus, this lady’s TTP-like syndrome improved dramatically after initiation of plasma exchange, despite not having a severely deficient ADAMTS13. This has implications on both current clinical practice and on the pathogenesis of TTP-like syndromes in lupus. PMID:26558190

  19. Novel Autoantigens Associated with Lupus Nephritis

    PubMed Central

    Onishi, Sachiko; Adnan, Endy; Ishizaki, Jun; Miyazaki, Tatsuhiko; Tanaka, Yuki; Matsumoto, Takuya; Suemori, Koichiro; Shudou, Masachika; Okura, Takafumi; Takeda, Hiroyuki; Sawasaki, Tatsuya; Yasukawa, Masaki; Hasegawa, Hitoshi

    2015-01-01

    Systemic lupus erythematosus (SLE) is characterized by production of a variety of autoantibodies. Although anti-double-stranded DNA (anti-dsDNA) antibodies contribute to the pathogenesis of lupus nephritis (LN), they are not sufficient for diagnosis and evaluation of disease activity. To obtain other autoantibodies associated with LN, we screened autoantigens reacting with the sera of LN patients by using an N-terminal biotinylated protein library created from a wheat cell-free protein production system. We screened 17 proteins that showed higher positive signals in the active phase than in the inactive phase of SLE, and higher positive signals in the serum of SLE patient with nephritis than in that of patient without nephritis. Of these, two LN-associated autoantigens, ribosomal RNA-processing protein 8 (RRP8) and spermatid nuclear transition protein 1 (TNP1) were identified by immunoprecipitation and immunofluorescence of renal tissues. Circulating anti-RRP8 and anti-TNP1 autoantibodies were recognized and deposited as an immune complex (IC) in glomeruli. IC was deposited preferentially in glomeruli rather than in other organs in C57BL/6 mice injected with RRP8 or TNP1. ELISA analysis of sera from patients with various rheumatic diseases demonstrated reactivity for RRP8 and TNP1 in 20% and 14.7% of SLE patients, respectively, whereas there was little or no reactivity in patients with other rheumatic diseases. Among SLE patients, 63.6% and 45.5% of those with LN were positive for anti-RRP8 and anti-TNP1 antibodies, compared with 12.5% and 9.4% of SLE patients without nephritis, respectively. Both proteins are cationic, and their respective antibodies did not cross-react with dsDNA. These proteins released from apoptotic cells form ICs with each autoantibody, and their ICs may become trapped at anionic sites in the glomerular basement membrane, leading to deposition in glomeruli. These autoantibodies may be useful for prediction of LN in subsets of SLE patients who

  20. Sex differences in the expression of lupus-associated miRNAs in splenocytes from lupus-prone NZB/WF1 mice

    PubMed Central

    2013-01-01

    Background A majority of autoimmune diseases, including systemic lupus erythematosus (SLE), occur predominantly in females. Recent studies have identified specific dysregulated microRNAs (miRNAs) in both human and murine lupus, implying an important contribution of these miRNAs to lupus pathogenesis. However, to date, there is no study that examined sex differences in miRNA expression in immune cells as a plausible basis for sex differences in autoimmune disease. This study addresses this aspect in NZB/WF1 mice, a classical murine lupus model with marked female bias, and further investigates estrogen regulation of lupus-associated miRNAs. Methods The Taqman miRNA assay system was used to quantify the miRNA expression in splenocytes from male and female NZB/WF1 mice at 17–18, 23, and 30 weeks (wks) of age. To evaluate potential estrogen's effect on lupus-associated miRNAs, 6-wk-old NZB/WF1 male mice were orchidectomized and surgically implanted with empty (placebo) or estrogen implants for 4 and 26 wks, respectively. To assess the lupus status in the NZB/WF1 mice, serum anti-dsDNA autoantibody levels, proteinuria, and renal histological changes were determined. Results The sex differences in the expression of lupus-associated miRNAs, including the miR-182-96-183 cluster, miR-155, miR-31, miR-148a, miR-127, and miR-379, were markedly evident after the onset of lupus, especially at 30 wks of age when female NZB/WF1 mice manifested moderate to severe lupus when compared to their male counterparts. Our limited data also suggested that estrogen treatment increased the expression of aforementioned lupus-associated miRNAs, with the exception of miR-155, in orchidectomized male NZB/WF1 mice to a similar level in age-matched intact female NZB/WF1 mice. It is noteworthy that orchiectomy, itself, did not affect the expression of lupus-associated miRNAs. Conclusion To our knowledge, this is the first study that demonstrated sex differences in the expression of lupus

  1. Acute lupus pneumonitis followed by intestinal pseudo-obstruction in systemic lupus erythematosus: A case report

    PubMed Central

    JI, CAIHONG; YU, XING; WANG, YONG; SHI, LUFENG

    2016-01-01

    Intestinal pseudo-obstruction (IpsO) and acute lupus pneumonitis (ALP) are uncommon severe complications of systemic lupus erythematosus (SLE). The present study reports the case of a 26-year-old female who presented with abdominal pain, nausea and vomiting as initial symptoms. Computed tomography (CT) scanning revealed the jejunal wall was thickened and streaky, mimicking the presentation of intestinal obstruction. Following emergency surgery, the patient's general condition was aggravated, with evident limb erythematous rashes. A series of laboratory examinations revealed SLE, and combined with patient's medical history IpsO was diagnosed, with a disease Activity Index score of 10. During the therapeutic period, high fever, dyspnea and oxygen saturation (SaO2) reductions were detected, and CT scans indicated lung infiltration, excluding other causes through a comprehensive infectious work-up and a bronchoalveolar lavage examination. ALP was confirmed and treated with high-dose methylprednisolone and gamma globulin supplement. The patient responded well and was discharged in 2 weeks. In the one-year tapering period and after stopping corticosteroids, the patient recovered well with no relapse detected. In conclusion, the manifestation of IpsO in SLE is rare and represents a challenge for the surgeon to establish the correct diagnosis and avoid inappropriate surgical intervention. ALP may be the consequence of emergency surgery, and immediate high-dose glucocorticoid therapy is recommended. PMID:27347044

  2. IL-33 neutralization suppresses lupus disease in lupus-prone mice.

    PubMed

    Li, Pin; Lin, Wei; Zheng, Xiangxiong

    2014-06-01

    IL-33 is a new member of the IL-1 family that plays a role in inflammation. In this study, we evaluated the potential of IL-33 inhibition as a treatment for systemic lupus erythematosus (SLE) using the lupus-prone model MRL/lpr mice and the underlying mechanisms of action. We treated mice with anti-mouse IL-33 antibody (anti-IL-33Ab) via intraperitoneal injection every other day from week 14 until week 20 for 6 weeks. A control group received the same amount of IgG control. Renal damage and mouse survival were compared. Cytokines, antibodies, immune complex, Tregs, myeloid-derived suppressor cells (MDSCs), and Th17 cells were also analyzed. Correlations between serum IL-33 and SLE disease activity index in human SLE were also investigated. MRL/lpr mice treated with anti-IL-33Ab showed reduced proteinuria and reduced serum anti-dsDNA levels. Nephritis, immune complex deposits, and the circulating antibodies and immune complex besides the mortality were significantly reduced by anti-IL-33Ab. Anti-IL-33Ab remarkably increased Tregs and MDSCs and reduced the Th17 cells and IL-1β, IL-6, and IL-17 levels in MRL/lpr mice. These results suggest that IL-33 inhibition may inhibit SLE via expansion of Tregs and MDSCs and inhibition of Th17 cells and proinflammatory responses, indicating that blockade of IL-33 has a protective effect on SLE. PMID:24398614

  3. Aseptic Meningitis Associated with ECHO Virus Type 9 Infection—With Special Reference to Variability by Sex and Incidence of Paralytic Sequelae

    PubMed Central

    Portnoy, Bernard; Hanes, Bernard; Pierce, Nathaniel F.; Leedom, John M.; Kunzman, E. Eugene; Wehrle, Paul F.

    1965-01-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable. A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  4. ASEPTIC MENINGITIS ASSOCIATED WITH ECHO VIRUS TYPE 9 INFECTION. WITH SPECIAL REFERENCE TO VARIABILITY BY SEX AND INCIDENCE OF PARALYTIC SEQUELAE.

    PubMed

    PORTNOY, B; HANES, B; PIERCE, N F; LEEDOM, J M; KUNZMAN, E E; WEHRLE, P F

    1965-04-01

    The clinical and clinical laboratory findings in a group of 104 patients with aseptic meningitis associated with ECHO-9 infection were widely variable.A male to female case ratio of 3.7:1 was noted, and the mean age of the female group was significantly greater than that of the male group. The median of cerebrospinal fluid leukocyte counts was significantly higher in the male than in the female patients. Clinical manifestations of the disease were similar to those noted in other reports. Residual paralysis was rare and mild. Further study of the ecology of aseptic meningitis seems indicated for elucidation of the factors governing variability of the disease by sex. PMID:14288142

  5. Myocardial perfusion abnormalities in asymptomatic patients with systemic lupus erythematosus

    SciTech Connect

    Hosenpud, J.D.; Montanaro, A.; Hart, M.V.; Haines, J.E.; Specht, H.D.; Bennett, R.M.; Kloster, F.E.

    1984-08-01

    Accelerated coronary artery disease and myocardial infarction in young patients with systemic lupus erythematosus is well documented; however, the prevalence of coronary involvement is unknown. Accordingly, 26 patients with systemic lupus were selected irrespective of previous cardiac history to undergo exercise thallium-201 cardiac scintigraphy. Segmental perfusion abnormalities were present in 10 of the 26 studies (38.5 percent). Five patients had reversible defects suggesting ischemia, four patients had persistent defects consistent with scar, and one patient had both reversible and persistent defects in two areas. There was no correlation between positive thallium results and duration of disease, amount of corticosteroid treatment, major organ system involvement or age. Only a history of pericarditis appeared to be associated with positive thallium-201 results (p less than 0.05). It is concluded that segmental myocardial perfusion abnormalities are common in patients with systemic lupus erythematosus. Whether this reflects large-vessel coronary disease or small-vessel abnormalities remains to be determined.

  6. Total lymphoid irradiation in refractory systemic lupus erythematosus

    SciTech Connect

    Ben-Chetrit, E.; Gross, D.J.; Braverman, A.; Weshler, Z.; Fuks, Z.; Slavin, S.; Eliakim, M.

    1986-07-01

    In two patients with systemic lupus erythematosus, conventional therapy was considered to have failed because of persistent disease activity and unacceptable side effects. Both were treated with total lymphoid irradiation without clinical benefit, despite adequate immunosuppression as documented by markedly reduced numbers of circulating T lymphocytes and T-lymphocyte-dependent proliferative responses in vitro. The first patient developed herpes zoster, gram-negative septicemia, neurologic symptoms, and deterioration of lupus nephritis. The second patient developed massive bronchopneumonia, necrotic cutaneous lesions, and progressive nephritis and died 2 weeks after completion of radiotherapy. These observations, although limited to two patients, indicate that total lymphoid irradiation in patients with severe systemic lupus erythematosus should be regarded as strictly experimental.

  7. The Soul of Lupus with ALMA (SOLA) Project Overview

    NASA Astrophysics Data System (ADS)

    Saito, M.; de Gregorio, I.; Team SOLA

    2015-12-01

    The SOLA (Soul of Lupus with ALMA) project is conducting comprehensive studies of the Lupus Molecular Clouds and their star formation processes. Our goal is to exploit ALMA and other facilities over a wide wavelength range to establish a prototypical low-mass star forming scenario based on the Lupus region. We focus mainly on 10-104 au scale physics, kinematics, density, and temperature, together with detailed modelling of radiative transfer. Our unique source catalog so far contains more than 700 sources at various evolutionary stages and we have obtained complementary data with Mopra, APEX, etc. In the poster, we will report the latest status of SOLA and the expected outcome in observing runs in the near future, including ALMA Cycle 3.

  8. Star counts in southern dark clouds: Corona Australis and Lupus.

    NASA Astrophysics Data System (ADS)

    Andreazza, C. M.; Vilas-Boas, J. W. S.

    1996-03-01

    Star counts technique is used towards southern dark globular filaments situated in the cloud complexes of Corona Australis and Lupus. Tables and maps of the distribution of visual extinction are presented for each filament. Lower limit masses for the filaments and condensations have been estimated and the central coordinates of the condensations are also given. R CrA is the most active star forming region among the filaments studied in this work whereas Lupus 1, with almost the same lower limit of mass, has only a few T Tauri stars and just one young embedded object. The distribution of direction of the magnetic field in the condensations of Lupus, suggests that the condensation morphologies does not have any apparent relation with the magnetic field orientation.

  9. Refractory Angioedema in a Patient with Systemic Lupus Erythematosus

    PubMed Central

    Habibagahi, Zahra; Ruzbeh, Jamshid; Yarmohammadi, Vahide; Kamali, Malihe; Rastegar, Mohammad Hassan

    2015-01-01

    Angioedema secondary to C1 inhibitor deficiency has been rarely reported to be associated with systemic lupus erythematosus. A genetic defect of C1 inhibitor produces hereditary angioedema, which is usually presented with cutaneous painless edema, but edema of the genital area, gastrointestinal and laryngeal tracts have also been reported. In lupus patients, angioedema may be the result of an acquired type of C1 inhibitor deficiency, most probably due to antibody formation directed against the C1 inhibitor molecule. Herein we report a new case of lupus nephritis that developed angioedema and a rapid course of disease progression with acute renal failure and alveolar hemorrhage without response to high dose steroid and plasmapheresis. PMID:26170526

  10. Btk inhibition treats TLR7/IFN driven murine lupus.

    PubMed

    Bender, Andrew T; Pereira, Albertina; Fu, Kai; Samy, Eileen; Wu, Yin; Liu-Bujalski, Lesley; Caldwell, Richard; Chen, Yi-Ying; Tian, Hui; Morandi, Federica; Head, Jared; Koehler, Ursula; Genest, Melinda; Okitsu, Shinji L; Xu, Daigen; Grenningloh, Roland

    2016-03-01

    Bruton's tyrosine kinase (Btk) is expressed in a variety of immune cells and previous work has demonstrated that blocking Btk is a promising strategy for treating autoimmune diseases. Herein, we utilized a tool Btk inhibitor, M7583, to determine the therapeutic efficacy of Btk inhibition in two mouse lupus models driven by TLR7 activation and type I interferon. In BXSB-Yaa lupus mice, Btk inhibition reduced autoantibodies, nephritis, and mortality. In the pristane-induced DBA/1 lupus model, Btk inhibition suppressed arthritis, but autoantibodies and the IFN gene signature were not significantly affected; suggesting efficacy was mediated through inhibition of Fc receptors. In vitro studies using primary human macrophages revealed that Btk inhibition can block activation by immune complexes and TLR7 which contributes to tissue damage in SLE. Overall, our results provide translational insight into how Btk inhibition may provide benefit to a variety of SLE patients by affecting both BCR and FcR signaling. PMID:26821304

  11. Cutaneous lupus after herpes zoster: isomorphic, isotopic, or both?

    PubMed

    Lee, Nicole Y; Daniel, Alyssa S; Dasher, David A; Morrell, Dean S

    2013-01-01

    Koebner isomorphic response describes the phenomenon of histopathologically identical skin lesions of a preceding cutaneous disease appearing in sites of trauma. Wolf isotopic response describes the phenomenon of a new skin disease appearing in the site of an unrelated cutaneous disease. Neither of the phenomena has been reported in relation to systemic lupus erythematosus. This report describes a 17-year-old girl with systemic lupus erythematosus exhibiting particularly severe cutaneous involvement confined primarily to sun-exposed areas presenting with a dermatomal band of atrophic, scaling, erythematous papules, and plaques on her left shoulder extending down her left arm after herpes zoster eruption. The histopathologil result showed lupus erythematosus. This phenomenon is best considered as a Koebner isomorphic response, although Wolf isotopic response has some clinical relevance as well. Koebner isomorphic and Wolf isotopic responses are discussed as related to this case. PMID:22639953

  12. Radiologic findings in late-onset systemic lupus erythematosus

    SciTech Connect

    Braunstein, E.M.; Weissman, B.N.; Sosman, J.L.; Schur, P.H.

    1983-03-01

    Systemic lupus erythematosus in the elderly has a different clinical and serologic course from that in young patients. Radiographic findings in patients in whom the diagnosis was made after age 50 were compared with findings in younger patients to see if the radiologic patterns are also different. The only significant radiographic difference between the two groups was that the older group had a greater incidence of soft-tissue swelling of the hands and wrists (p < 0.001). There was no significant difference in osteopenia, erosion, soft-tissue calcification, alignment abnormalities, or intrathoracic findings. Of 24 patients over age 50, two developed lymphoma and another developed multiple myeloma. The data agree with clinical observations that there is a higher incidence of arthritis in late-onset lupus, but clinical findings of increased incidence of pleuropericardial disease are not confirmed radiographically. The coincidence of hematologic malignancy with late-onset lupus in this series is noteworthy.

  13. Design, development and qualification of a microbiological challenge facility to assess the effectiveness of BFS aseptic processing.

    PubMed

    Leo, F; Poisson, P; Sinclair, C S; Tallentire, A

    2005-01-01

    A programme of work has been initiated to further the understanding of the impact of the environment surrounding a Blow/Fill/Seal (BFS) machine upon the microbiological quality of processed product. A dedicated facility (Challenge Room) has been constructed and qualified to provide for the production and containment of dispersions of micro organisms in air of a room housing an operating BFS machine of a given style and configuration. The facility achieves homogeneous distribution of generated dispersions throughout the Challenge Room air, including that within and close to the critical area in which aseptic BFS operations occur. Generated microbial dispersions can be maintained in the room over extended time periods (up to 600 min) at a desired concentration within the range 10(1) to 10(7) cfu m(-3). They can also be produced employing different cell types, including bacterial endospores, Gram-positive and Gram-negative vegetative cells and yeast cells. Effective containment of dispersions is achieved while 'cards of product' (vials in sets) are conveyed from the Challenge Room to an adjacent Packing and Storage Area. Decontamination of the room and the housed BFS machine is accomplished through exposure to chlorine dioxide gas at a concentration of 1.0 mg dm(-3) for 120 min at room temperature (approximately 23 degrees C). PMID:15796134

  14. The development of invertase activity in slices of the root of Beta vulgaris L. washed under aseptic conditions

    PubMed Central

    Bacon, J. S. D.; MacDonald, I. R.; Knight, A. H.

    1965-01-01

    1. When disks of root tissue from sugar or red beet (Beta vulgaris L.) are washed in running aerated tap water the sucrose contained in them disappears and glucose and fructose are formed. 2. Invertase activity in the disks has been measured by a polarimetric method. Freshly cut tissue has a very low activity, but a considerable increase occurs during the first 3–4 days of washing, the final activity being sufficient to hydrolyse the sucrose contained in the disk within a few hours. 3. Disks of red beet have been cut and shaken in water under aseptic conditions. Sucrose breakdown and invertase development still took place. Microbial contamination is therefore not responsible. 4. Trisaccharides that appear in sugar-beet disks during the washing process have been isolated and identified; their formation also suggests that a higher-plant invertase is acting. 5. The significance of these results is discussed in relation to protein synthesis in washed storage-tissue slices, and the occurrence of high invertase activity in growing plant cells. PMID:14342226

  15. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    PubMed

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work. PMID:23428565

  16. Surgical treatment of an aseptic fistulized acromioclavicular joint cyst: a case report and review of the literature

    PubMed Central

    Murena, Luigi; D’angelo, Fabio; Falvo, Daniele A

    2009-01-01

    An acromioclavicular joint cyst is an uncommonly reported condition, which seems to result from a massive rotator cuff tear and degenerative osteoarthritis of the acromioclavicular joint. We present the case of an 81-year-old man affected by an acromioclavicular joint cyst, associated to a massive rotator cuff tear, proximal migration of the humeral head and osteoarthritis of the gleno-humeral joint. The mass was 7 × 2.5 cm in size and the overlying skin presented a fistula that drained clear synovial-like fluid. Plain X-ray examination of the left shoulder showed proximal migration of the humeral head migration and osteoarthritis of the gleno-humeral joint, and further MRI evaluation confirmed the clinical diagnosis of a complete rotator cuff tear and observed a large subcutaneous cyst in communication with the degenerative acromioclavicular joint. The patient underwent surgical excision of the cyst and lateral resection of the clavicle to prevent disease recurrence. To the best of our knowledge, this is the first reported case of an acromioclavicular joint cyst complicated by an aseptic fistula resulting from multiple aspirations. PMID:19918423

  17. Aseptic non-touch technique and catheter-related bloodstream infection in children receiving parenteral nutrition at home

    PubMed Central

    Evans, Victoria; Hughes, Anna; Hill, Susan

    2015-01-01

    Objectives Parenteral nutrition (PN) at home is an acceptable form of delivering long-term PN for children with intestinal failure. Catheter-related bloodstream infection (CRBSI) is one of the serious complications of long-term PN and can lead to increasing morbidity and mortality. Using aseptic non-touch technique (ANTT) was proven to decrease the incidence of CRBSI in hospital patients. In this study we aimed to review the incidence of CRBSI in children receiving PN at home in our institution using the ANTT and a simplified training programme for parents and carers. Methods We retrospectively collected clinical and microbiological data on all children with intestinal failure (IF) who were on treatment with PN at home under our specialist IF rehabilitation service between November 2012 and November 2013. Results Thirty-five children were included, 16 of whom did not have any infection recorded during the study period. The overall CRBSI rate was 1.3 infections per 1000 line-days, with Staphylococcus being the commonest organism. Twenty-one children did not require catheter change and the overall catheter changes were 1.8 per 1000 line-days. Conclusion In this article, we report a low incidence of CRBSI in a single institution by using the principle of ANTT for accessing central venous catheters combined with a simplified, nurse-led, two-week standardised training programme for parents of children going home on PN. PMID:26279849

  18. Advances in mechanisms of systemic lupus erythematosus.

    PubMed

    Dema, Barbara; Charles, Nicolas

    2014-05-01

    Systemic lupus erythematosus (SLE) is a complex autoimmune disease associated with hormonal, environmental, and genetic factors and linked to the tolerance breakdown of B and T cells to self-antigens. SLE is characterized by the presence in patient serum of autoantibodies raised against nuclear components. Association of these antibodies to self-antigens, complement factors, DNA, and particular proteins will form circulating immune complexes (CIC) which can deposit in several organs, causing tissue damage and clinical manifestations. Historically, SLE is considered as an adaptive immune system disorder. Over the past decade, advances in the understanding of SLE pathogenesis placed the innate immune system as a key player in perpetuating and amplifying this systemic disease. In this review, we summarize some recent key advances in understanding the SLE immune-pathogenesis with a particular focus on newly discovered key factors from the innate immune system and how they influence the pathogenic adaptive immune system: neutrophils and neutrophil extracellular traps (NETs), plasmacytoid dendritic cells (pDCs) and type I interferons, basophils and autoreactive IgE, monocytes/macrophages and the inflammasome. Recent advances on B and T cell involvement in the SLE pathogenesis mechanisms are also discussed. Although the disease is clinically, genetically, and immunologically heterogeneous between affected individuals, the latest discoveries are offering new promising therapeutic strategies. PMID:24882716

  19. Quantity Discrimination in Wolves (Canis lupus)

    PubMed Central

    Utrata, Ewelina; Virányi, Zsófia; Range, Friederike

    2012-01-01

    Quantity discrimination has been studied extensively in different non-human animal species. In the current study, we tested 11 hand-raised wolves (Canis lupus) in a two-way choice task. We placed a number of food items (one to four) sequentially into two opaque cans and asked the wolves to choose the larger amount. Moreover, we conducted two additional control conditions to rule out non-numerical properties of the presentation that the animals might have used to make the correct choice. Our results showed that wolves are able to make quantitative judgments at the group, but also at the individual level even when alternative strategies such as paying attention to the surface area or time and total amount are ruled out. In contrast to previous canine studies on dogs (Canis familiaris) and coyotes (Canis latrans), our wolves’ performance did not improve with decreasing ratio, referred to as Weber’s law. However, further studies using larger quantities than we used in the current set-up are still needed to determine whether and when wolves’ quantity discrimination conforms to Weber’s law. PMID:23181044

  20. Intestinal Dysbiosis Associated with Systemic Lupus Erythematosus

    PubMed Central

    Hevia, Arancha; Milani, Christian; López, Patricia; Cuervo, Adriana; Arboleya, Silvia; Duranti, Sabrina; Turroni, Francesca; González, Sonia; Suárez, Ana; Gueimonde, Miguel; Ventura, Marco

    2014-01-01

    ABSTRACT Systemic lupus erythematosus (SLE) is the prototypical systemic autoimmune disease in humans and is characterized by the presence of hyperactive immune cells and aberrant antibody responses to nuclear and cytoplasmic antigens, including characteristic anti–double-stranded DNA antibodies. We performed a cross-sectional study in order to determine if an SLE-associated gut dysbiosis exists in patients without active disease. A group of 20 SLE patients in remission, for which there was strict inclusion and exclusion criteria, was recruited, and we used an optimized Ion Torrent 16S rRNA gene-based analysis protocol to decipher the fecal microbial profiles of these patients and compare them with those of 20 age- and sex-matched healthy control subjects. We found diversity to be comparable based on Shannon’s index. However, we saw a significantly lower Firmicutes/Bacteroidetes ratio in SLE individuals (median ratio, 1.97) than in healthy subjects (median ratio, 4.86; P < 0.002). A lower Firmicutes/Bacteroidetes ratio in SLE individuals was corroborated by quantitative PCR analysis. Notably, a decrease of some Firmicutes families was also detected. This dysbiosis is reflected, based on in silico functional inference, in an overrepresentation of oxidative phosphorylation and glycan utilization pathways in SLE patient microbiota. PMID:25271284

  1. Rectal ulcers induced by systemic lupus erythematosus

    PubMed Central

    Yau, Alan Hoi Lun; Chu, Karen; Yang, Hui Min; Ko, Hin Hin

    2014-01-01

    A 28-year-old woman presented with diarrhoea, haematochezia, tenesmus and rectal pain for 2 months. She was diagnosed with systemic lupus erythematosus (SLE) 8 years ago and remained on prednisone, azathioprine and hydroxychloroquine. Blood work revealed a positive ANA (antinuclear antibody test), anti-dsDNA 749 IU/mL (0–300 IU/mL), C3 0.22 g/L (0.65–1.65 g/L) and C4 0.05 g/L (0.16–0.60 g/L). Stool studies were unremarkable. MRI of the pelvis showed a rectum with eccentric wall thickening. Flexible sigmoidoscopy showed severe proctitis with multiple deep ulcers and diffuse submucosal haemorrhage. Rectal biopsy revealed crypt architectural distortion and reactive fibrosis in the lamina propria. The patient was given mesalamine suppository for 2 weeks with minimal improvement. Repeat flexible sigmoidoscopy showed a coalesced 3×4 cm full-thickness rectal ulcer. Therefore, the patient was given intravenous methylprednisolone for 3 days, followed by intravenous cyclophosphamide for 2 weeks. Her symptoms resolved and repeat flexible sigmoidoscopy showed fibrotic healing of the rectal ulcers. PMID:25150239

  2. Unmet medical needs in systemic lupus erythematosus

    PubMed Central

    2012-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease of diverse manifestations, with onset usually in young women in the third to fourth decade of life. The chronic nature of this relapsing remitting disease leads to organ damage accrual over time. Mortality and morbidity are increased in patients with SLE compared with the general population. Therapeutic advances over the last few decades have led to significant improvements in patient outcomes. Five-year survival has improved to over 90% from a low of 50% in the 1950s. However, multiple aspects of the management of SLE patients are still far from optimal. Early diagnosis remains a challenge; diagnostic delays leading to delay in definitive treatment are common. Monitoring treatment remains problematic due to the paucity of sensitive biomarkers. Current treatment regimens rely heavily on corticosteroids, even though corticosteroids are well known to cause organ damage. Treatment of refractory disease manifestations such as nephritis, recalcitrant cutaneous lesions and neurological involvement require new approaches with greater efficacy. Cognitive dysfunction is common in SLE patients, but early recognition and adequate treatment are yet to be established. Premature accelerated atherosclerosis remains a leading cause of morbidity and mortality. Fatigue is one of the most disabling symptoms, and contributes to the poor quality of life in patients with SLE. Ongoing research in SLE faces many challenges, including enrollment of homogeneous patient populations, use of reliable outcome measures and a standard control arm. The current review will highlight some of the outstanding unmet challenges in the management of this complex disease. PMID:23281889

  3. Human papillomavirus vaccine and systemic lupus erythematosus.

    PubMed

    Gatto, Mariele; Agmon-Levin, Nancy; Soriano, Alessandra; Manna, Raffaele; Maoz-Segal, Ramit; Kivity, Shaye; Doria, Andrea; Shoenfeld, Yehuda

    2013-09-01

    To investigate the association between human papillomavirus (HPV) vaccination and autoimmune manifestations compatible with systemic lupus erythematosus (SLE) or SLE-like disease, the medical history of six women who presented with SLE or SLE-like disease following HPV immunization was collected. Data regarding type of vaccine, number of immunization, family and personal, clinical and serological features, as well as response to treatments were analyzed. In the reported cases, several common features were observed, such as personal or familial susceptibility to autoimmunity or adverse response to a prior dose of the vaccine, both of which may be associated with a higher risk of post-vaccination autoimmunity. Favorable response to immunosuppressant was observed in all patients. In the current study, a temporal association between immunization with HPV vaccine and the appearance of a spectrum of SLE-like conditions is reported. Additionally, among the patients described, several common features were observed that may enable better identification of subjects at risk. Further studies are required to assess the safety of immunization with the HPV vaccine in patients with autoimmune-rheumatic diseases or in subject at risk of autoimmunity as well as the potential beneficial effect of preventive immunosuppressants. PMID:23624585

  4. Inflammasome polymorphisms in juvenile systemic lupus erythematosus.

    PubMed

    Pontillo, Alessandra; Reis, Edione C; Liphaus, Bernadete L; Silva, Clovis A; Carneiro-Sampaio, Magda

    2015-01-01

    Inflammasome is the cytoplasmic complex responsible for pro-IL1 β cleavage and secretion of IL-1β. Recently our group reported the first association between polymorphisms in the inflammasome receptor NLRP1 and adult-onset systemic lupus erythematosus (SLE) "di per se" and especially in SLE-associated renal disease, suggesting the involvement of NLRP1-inflammasome in the immune dysregulation characteristic of SLE patients. Considering that juvenile-onset SLE (JSLE) is more severe than adult SLE, and that the genetic background plays a major role in the early development of autoimmune diseases, we analysed selected polymorphisms in inflammasome genes (NLRP1, NLRP3, CARD8, IL1B, TNFAIP3) of children and adolescents with JSLE (n = 90) and in healthy controls (n = 144). A single polymorphism in IL1B, and not NLRP1, gene resulted in association with JSLE, suggesting that IL-1 β is involved in the pathogenesis of SLE, but different genes could play specific role in adult- or early-onset disease. PMID:26182076

  5. Hepatic manifestations in juvenile systemic lupus erythematosus.

    PubMed

    El-Shabrawi, Mortada H; Farrag, Mona I

    2014-01-01

    Juvenile systemic lupus erythematosus (JSLE) is a chronic autoimmune disease characterized by multisystem involvement and diverse clinical and serological manifestations. Clinically significant hepatic disease is generally regarded as unusual in JSLE, but many studies have showed that hepatic disease may be more common in SLE than was usually thought. Hepatic disease does not cause significant morbidity and mortality, but subclinical liver involvement is common. One of the hepatic disorders associated with JSLE is autoimmune hepatitis (AIH). The precise etiology of AIH and JSLE remains unknown, however both AIH and JSLE are associated with antinuclear antibody (ANA) and multisystem disease manifestations. A shared immunologic response and genetic predisposition were suggested. Recently, new approaches for treatment of SLE and recent patents that could develop into novel therapeutic agents in clinical management of SLE have been proposed. An array of promising new therapies is currently emerging or being developed including B-cell depletion therapies, agents targeting B-cell survival factors, blockade of T-cell co-stimulation and present review, we will also report the case of a 12-year old girl who developed JSLE four years after her preliminary diagnosis with AIH. PMID:24383439

  6. Parkinsonian syndrome complicating systemic lupus erythematosus.

    PubMed

    Shahar, E; Goshen, E; Tauber, Z; Lahat, E

    1998-05-01

    Two girls with florid extrapyramidal parkinsonism complicating systemic lupus erythematosus (SLE) are reported. One patient (15 years old) presented with extreme rigidity, irritability, and mutism initially diagnosed as acute psychosis. Examination revealed severe extrapyramidal akinetic mutism, along with marked restlessness. CT and MRI imaging of the brain were unremarkable. EEG revealed moderate generalized disturbance of background activity. 99mTc-HmPAO SPECT cerebral scanning detected decreased regional cerebral blood flow at the basal ganglia. Dopamine-agonist drugs led to complete recovery after 3 months, along with normalization of EEG and SPECT alterations. The second patient (16 years old) was assessed for progressive bradykinesia and apathy impeding her active daily activities, and she was suspected to have developed depression. Neurologic assessment revealed a parkinsonian syndrome that was less severe than that of the first patient. The EEG showed mild disturbance of background activity, and 99mTc-HmPAO SPECT demonstrated impaired regional cerebral blood flow over the basal ganglia. A parkinsonian extrapyramidal syndrome complicating SLE should therefore be taken into account in any patient with SLE presenting with marked behavioral alterations, rigidity, or akinetic mutism. PMID:9650692

  7. Systemic lupus erythematosus in Trinidadian children.

    PubMed

    Balkaran, B N; Roberts, L A; Ramcharan, J

    2004-09-01

    Thirty-three children with a diagnosis of systemic lupus erythematosus (SLE) were studied. At diagnosis, 29 of them (88%) were aged between 10 and 17 years and the other four (12%) between 5 and 9 years. The majority were girls (28, 82%) and the male:female ratio was 1:6.6. Children of East Indian and mixed racial origin formed the largest groups (37 and 39%, respectively) and mortality was higher in these two groups. The most common symptoms at diagnosis were: fever for > 1 week (75.8%), musculoskeletal symptoms (arthralgia, arthritis and myalgia (69.7%) and renal involvement (63.6%). Malar and discoid rashes were common, 39 and 37%, respectively. Central nervous system involvement at presentation was a rare but important cause of mortality. The mortality rate during follow-up was high at 39.3% and the commonest cause of death was renal failure. Childhood SLE is uncommon in Trinidad and Tobago. Diagnosis is often delayed because of the protean and non-specific manifestations. This study reports a higher prevalence, a more severe course and greater mortality in children of East Indian and mixed descent than in children of African origin. It also shows that the symptomatology at first presentation is consistent with other studies and should be recognised early. Early diagnosis and prompt and appropriate management are essential in order to reduce the high mortality still associated with SLE. PMID:15479574

  8. [Contraception in women suffering from systemic lupus ethymatosus].

    PubMed

    Musson, P; Serfaty, D; Puissant, A

    1985-10-01

    Systemic lupus erythematosus usually affects young women of reproductive age and may be brought on or worsened by pregnancy or use of some oral contraceptives (OCs). At certain stages of the disease pregnancies are possible, but effective and reversible contraception permitting careful pregnancy planning is required. Amenorrhea is frequent in acute stages of the disease, but most authors have observed fertility levels in lupic women comparable to those of the population at large. Pregnancy complications and aggravations of lupus are much more rare when conception occurs during a stable remission of at least 6 months. Risks of lupus that must be considered in choosing a contraceptive method include vascular accidents such as venous thrombosis and inflammatory lesions of the arteries, hypertension usually secondary to nephropathy or corticotherapy, metabolic disturbances, anomalies of hemostasis, initiation or exacerbation of the disease with use of combined OCs, and predisposition to infection. Pills containing estrogen, even at low doses, are contraindicated because of the already high vascular risk of lupus patients and because estrogens may aggravate the condition. Progestins derived from 19 norsteroids are inadvisable because of the still imperfectly understood secondary effects which may include disturbances of metabolism or blood pressure. Low dose progestins or those derived from 17 hydroxyprogesterone appear to be a contraceptive of choice for lupus patients because of their lack of effects on metabolism or blood pressure. Their contraceptive efficacy is not quite as high as that of other OCs and they may entail a relative hyperestrogenic climate. They are not advisable in case of luteal insufficiency. IUDs are contraindicated because of the risk of infection, although they may be used in periods of remission for mild cases of lupus not treated with immunosuppressive drugs. Progestin-releasing IUDs may reduce risk of infection. Local methods have the

  9. Comparison of the roles of IL-1, IL-6, and TNFα in cell culture and murine models of aseptic loosening1

    PubMed Central

    Taki, Naoya; Tatro, Joscelyn M.; Lowe, Robert; Goldberg, Victor M.; Greenfield, Edward M.

    2007-01-01

    Pro-inflammatory cytokines, such as IL-1, IL-6, and TNF, are considered to be major mediators of osteolysis and ultimately aseptic loosening. This study demonstrated that synergistic interactions among these cytokines are required for the in vitro stimulation of osteoclast differentiation by titanium particles. In contrast, genetic knock out of these cytokines or their receptors does not protect murine calvaria from osteolysis induced by titanium particles. Thus, the extent of osteolysis was not substantially altered in single knock out mice lacking either the IL-1 receptor or IL-6. Osteolysis also was not substantially altered in double knock out mice lacking both the IL-1 receptor and IL-6 or in double knock out mice lacking both TNF receptor-1 and TNF receptor-2. The differences between the in vivo and the cell culture results make it difficult to conclude whether the pro-inflammatory cytokines contribute to aseptic loosening. One alternative is that in vivo experiments are more physiological and that therefore the current results do not support a role for the pro-inflammatory cytokines in aseptic loosening. We however favor the alternative that, in this case, the cell culture experiments can be more informative. We favor this alternative because the role of the pro-inflammatory cytokines may be obscured in vivo by compensation by other cytokines or by the low signal to noise ratio found in measurements of particle-induced osteolysis. PMID:17236833

  10. Chemokines and Chemokine Receptors in the Development of Lupus Nephritis

    PubMed Central

    2016-01-01

    Lupus nephritis (LN) is a major cause of morbidity and mortality in the patients with systemic lupus erythematosus (SLE), an autoimmune disease with damage to multiple organs. Leukocyte recruitment into the inflamed kidney is a critical step to promote LN progression, and the chemokine/chemokine receptor system is necessary for leukocyte recruitment. In this review, we summarize recent studies on the roles of chemokines and chemokine receptors in the development of LN and discuss the potential and hurdles of developing novel, chemokine-based drugs to treat LN. PMID:27403037

  11. Chemokines and Chemokine Receptors in the Development of Lupus Nephritis.

    PubMed

    Liao, Xiaofeng; Pirapakaran, Tharshikha; Luo, Xin M

    2016-01-01

    Lupus nephritis (LN) is a major cause of morbidity and mortality in the patients with systemic lupus erythematosus (SLE), an autoimmune disease with damage to multiple organs. Leukocyte recruitment into the inflamed kidney is a critical step to promote LN progression, and the chemokine/chemokine receptor system is necessary for leukocyte recruitment. In this review, we summarize recent studies on the roles of chemokines and chemokine receptors in the development of LN and discuss the potential and hurdles of developing novel, chemokine-based drugs to treat LN. PMID:27403037

  12. HMGB1: a smoking gun in lupus nephritis?

    PubMed Central

    2012-01-01

    High-mobility group box 1 protein (HMGB1) is a prototypic alarmin that is released from activated and dying cells. Because of its proinflammatory activities, HMGB1 could mediate key events in the pathogenesis of systemic lupus erythematosus, a possibility supported by elevations of HMGB1 in patient blood and increased expression in renal biopsies. The biology of HMGB1 is complicated, however, and its activity is dependent on redox state as well as binding to other molecules such as cytokines. Defining more precisely the role of HMGB1 in lupus will require treatment studies to block the activity of this alarmin in animal models and ultimately patients. PMID:22423653

  13. Extracellular Vesicles as Biomarkers of Systemic Lupus Erythematosus

    PubMed Central

    Perez-Hernandez, Javier; Cortes, Raquel

    2015-01-01

    Systemic lupus erythematosus is an autoimmune disease that predominantly affects women and typically manifests in multiple organs. The damage caused by this disorder is characterized by a chronic inflammatory state. Extracellular vesicles (EVs), including microvesicles (also known as microparticles), apoptotic bodies, and exosomes, are recognized vehicles of intercellular communication, carrying autoantigens, cytokines, and surface receptors. Therefore, the evidence of EVs and their cargo as biomarkers of autoimmune disease is rapidly expanding. This review will focus on biogenesis of extracellular vesicles, their pathophysiological roles, and their potential as biomarkers and therapeutics in inflammatory disease, especially in systemic lupus erythematosus. PMID:26435565

  14. Kikuchi–Fujimoto disease and systemic lupus erythematosus

    PubMed Central

    Baenas, Diego F; Diehl, Fernando A; Haye Salinas, María J; Riva, Verónica; Diller, Ana; Lemos, Pablo A

    2016-01-01

    Kikuchi–Fujimoto disease, or histiocytic necrotizing lymphadenitis, is an infrequent idiopathic disorder. It has been associated with autoimmune disorders, of which systemic lupus erythematosus is the most outstanding. The basis of its diagnosis relies on the histological examination of lymph nodes, which typically reveals necrosis surrounded by histiocytes with crescentic nucleus, immunoblasts and plasma cells, and absence of neutrophils. We report the case of a 27-year-old Argentinian female patient without any relevant past medical history to demonstrate the correlation between Kikuchi–Fujimoto disease and systemic lupus erythematosus. PMID:27418858

  15. Infection in systemic lupus erythematosus: friend or foe?

    PubMed Central

    Francis, Lisa; Perl, Andras

    2010-01-01

    Infectious agents have long been implicated in the pathogenesis of systemic lupus erythematosus. Common viruses, such as the Epstein-Barr virus, transfusion transmitted virus, parvovirus and cytomegalovirus, have an increased prevalence in patients with systemic lupus erythematosus. They may contribute to disease pathogenesis through triggering autoimmunity via structural or functional molecular mimicry, encoding proteins that induce cross-reactive immune responses to self antigens or modulate antigen processing, activation, or apoptosis of B and T cells, macrophages or dendritic cells. Alternatively, some infectious agents, such as malaria, Toxoplasma gondii and Helicobacter pylori, may have a protective effect. Vaccinations may play dual roles by protecting against friend and foe alike. PMID:20209114

  16. Retinal arterial occlusive disease in systemic lupus erythematosus.

    PubMed

    Gold, D; Feiner, L; Henkind, P

    1977-09-01

    Four patients with systemic lupus erythematosus (SLE) developed an unusual form of occlusive retinal arterial disease. The most prominent clinical features of this disorder were deposition of yellow-white material in retinal arterial walls and evidence of multifocal retinal arterial occlusion. Fluorescein angiographic findings included nonperfusion of the obstructed arteries and the retinal capillary beds fed by them, and fluorescein leakage at the sites of involvement of the retinal arteries. This ocular complication of SLE is presumably a manifestation of the widespread systemic vascular problems seen in this disorder. It may be more common in patients with lupus involving the CNS. PMID:901267

  17. Practice and Educational Gaps in Lupus, Dermatomyositis, and Morphea.

    PubMed

    Fett, Nicole M; Fiorentino, David; Werth, Victoria P

    2016-07-01

    Patients with skin-predominant lupus erythematosus, dermatomyositis, and morphea should be evaluated, treated, and followed by dermatologists who can take primary responsibility for their care. Many academic centers have specialized centers with dermatologists who care for these patients. Patients with skin-predominant lupus erythematosus should be followed regularly with laboratory tests to detect significant systemic disease. Antibody tests can help determine the risks for individual patients. Patients with morphea rarely progress to systemic disease, but therapies can be helpful in treating and preventing progression of disease. PMID:27363879

  18. Vitamin D and Systemic Lupus Erythematosus: Myth or Reality?

    PubMed

    Watad, Abdulla; Neumann, Shana G; Soriano, Alessandra; Amital, Howard; Shoenfeld, Yehuda

    2016-01-01

    There is growing interest in the contribution of vitamin D deficiency to autoimmunity. Several studies have shown an association between low levels of vitamin D and autoimmune disorders, including multiple sclerosis, rheumatoid arthritis, type 1 diabetes, autoimmune thyroid diseases, celiac disease, and systemic lupus erythematosus (SLE). Vitamin D receptor ligands can mediate immunosuppressive effects. It has been suggested that low levels of this hormone contribute to the immune activation in lupus and other autoimmune diseases. This review updates and summarizes the literature on the association between vitamin D and SLE, and discusses the various correlations between vitamin D and SLE activity, clinical expressions, serology, and gene polymorphisms of vitamin D receptors. PMID:27228639

  19. [Panzytopenia from combination therapy with azathioprin and allopurinol].

    PubMed

    Seidel, W

    2004-10-01

    Azathioprine has been used in rheumatology for more than twenty years. Indications are collagen diseases with multiorgan involvement, where co-medications are frequently necessary. We describe a patient suffering from pancytopenia following a combination therapy of azathioprine and allopurinol because of lupus erythematodes and diabetic nephropathy with hyperuricemia. PMID:15517303

  20. Bilaterally symmetrical alopecia with reticulated hyperpigmentation: a manifestation of cutaneous lupus erythematosus in a dog with systemic lupus erythematosus.

    PubMed

    Olivry, T; Linder, K E

    2013-07-01

    An adult castrated male Doberman Pinscher was presented with a 6-month history of well-demarcated alopecic patches with reticulated hyperpigmentation and fine peripheral scaling on the axillae, thorax, abdomen, inguinal region, and thighs. The dog later developed hyperthermia, lethargy, apparent joint pain, peripheral lymphadenomegaly, vomiting, and diarrhea. Relevant laboratory tests results included anemia, thrombocytopenia, proteinuria, and an elevated antinuclear antibodies serum titer. Histologically, skin biopsy specimens had a lymphocyte-rich interface dermatitis and interface mural folliculitis ending in follicular destruction. Altogether, these signs were consistent with a unique alopecic variant of chronic cutaneous lupus erythematosus, eventually associated with the development of systemic lupus erythematosus. This rare form of chronic cutaneous lupus needs to be added to the expanding list of lymphocyte-mediated autoimmune alopecias in dogs. PMID:23051917

  1. Postpartum dilated cardiomyopathy in a patient with systemic lupus erythematosus, nephritis and lupus anticoagulant: a diagnostic dilemma

    PubMed Central

    Hall, Daniel; New, David; Kelly, Teresa

    2011-01-01

    A 32-year-old Caucasian woman presented with shortness of breath four weeks postpartum. She was known to suffer from systemic lupus erythematosus with cutaneous, joint and minor renal involvement. During pregnancy, the patient had developed nephrotic syndrome for which she was managed with prophylactic anticoagulation and corticosteroid therapy. A leg deep vein thrombosis had arisen following caesarean section following antepartum haemorrhage. Examination revealed a heart murmur, and pulmonary signs. Computed tomography pulmonary angiogram showed cardiomegaly and bilateral pleural effusions but no pulmonary embolus. Echocardiogram demonstrated dilated cardiomyopathy. An initial diagnosis of peripartum cardiomyopathy was considered, with lupus myocarditis and coronary in situ thrombosis among the differential diagnoses.

  2. Circulating microparticles in systemic Lupus Erythematosus.

    PubMed

    Nielsen, Christoffer Tandrup

    2012-11-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease presenting with a wide array of clinical manifestations and an elusive pathogenesis. A characteristic feature in SLE is the occurrence of autoantibodies against chromatin, double-stranded DNA, and RNA-binding ribonucleoproteins. Observations of defective clearance of dying cells in SLE combined with the generation and exposure of nuclear autoantigens during apoptosis have led to the hypothesis that improperly cleared apoptotic debris constitutes a source of autoantigens capable of triggering autoimmune disease. In blood, circulating, heterogeneous subcellular microparticles (MPs) are released from cells and platelets constitutively and upon cellular activation or apoptosis. Such MPs may reflect the state of their parental cells and tissues, and could serve as markers of pathology. Particular in SLE MPs may serve as carriers of autoantigens and constituents of immune complexes (ICs). The purposes of this PhD thesis were to develop and apply qualitative and quantitative methods to characterize circulating MPs with respect to numbers, cellular origins and composition in a large cohort of well-characterized SLE patients compared to healthy and disease controls and to explore associations with clinical, biochemical and serological parameters. The PhD thesis consists of a review and three papers. In the first paper we show that SLE patients have significantly decreased numbers of annexin V binding MPs and MPs from platelets, leukocytes and endothelial cells using flow cytometry. Two morphologically distinguishable populations of annexin V non-binding MPs were increased in the SLE patients. The annexin V non-binding MPs of most likely cellular origin were associated with the presence of lupus nephritis, markers of increased disease activity and levels of endothelial cell-derived MPs. In the second paper we present the development of a proteomic method to characterize the protein composition of purified

  3. Atherosclerotic vascular disease in systemic lupus erythematosus.

    PubMed Central

    Liang, Matthew H.; Mandl, Lisa A.; Costenbader, Karen; Fox, Ervin; Karlson, Elizabeth

    2002-01-01

    In the United States, systemic lupus erythematosus (SLE) disproportionately affects African Americans. It has become a chronic disease with long-term morbidity including chronic renal disease, osteoporosis, cataracts, psychosocial impairment, and importantly, atherosclerotic vascular disease (ASVD). The latter (myocardial infarction, angina, peripheral vascular disease and stroke) are strikingly accelerated, occurring in subjects who are predominantly premenopausal women at an age when ASVD is rare or unusual. Although much is known about the biology, risk factors, and the prevention of atherosclerosis in normal individuals, little work has been done in SLE. In fact, ASVD in people with SLE may be a different disease. Approximately 1.5% of SLE patients per year will have a myocardial infarction or equivalent; about 0.5% of SLE patients per year will have a stroke. The risk factors for ASVD in SLE are based on small, retrospective, single center studies. These suggest that the risk factors known for the general population (i.e., smoking, obesity, sedentary lifestyle, high LDL cholesterol, etc.) are also observed in SLE. The best study of risk factors shows that even accounting for the known factors, SLE and/or its treatment (glucocorticoids) is by far the most important. Our current management of cardiovascular risk factors in SLE patients with ASVD is substandard and our adherence to national guidelines for prevention is substandard. It is not known whether improving either will prevent these disastrous outcomes. Very little is known about the risk factors in African Americans with SLE, although there is data to suggest that they may not be identical to those seen in Caucasian populations. The study of the best and most effective means to prevent ASVD in SLE and in African Americans with SLE and in African Americans with SLE should be a major priority. PMID:12392045

  4. Neuropsychiatric questionnaires in systemic lupus erythematosus.

    PubMed

    Tani, C; Palagini, L; Moraes-Fontes, M F; Carli, L; Mauri, M; Bombardieri, S; Mosca, M

    2014-01-01

    Patients with systemic lupus erythematosus (SLE) can be affected by a multitude of neurologic and psychiatric symptoms with a wide range of prevalence and severity. Irrespectively from attribution to SLE or other causes, neuropsychiatric (NP) symptoms strongly impact short-term and long-term outcomes, thus NP evaluation during routine clinical practice in SLE should be undertaken regularly. The assessment of NP involvement in SLE patients is challenging and the available diagnostic tools fail to guarantee optimal diagnostic accuracy, sensitivity to changes as well as feasibility in routine clinical care. Standardised questionnaires (both physician-administered and self-reported) can offer valuable help to the treating physician to capture all possible NP syndromes; few SLE-specific NP questionnaire have been developed but validation in large cohort or cross-cultural adaptations are still pending. On the other hand, general instruments have been largely applied to SLE patients. Both kinds of questionnaires can address all possible NP manifestations either globally or, more frequently, focus on specific NP symptoms. These latter have been mainly used in SLE to detect and classify mild and subtle symptoms, more likely to be overlooked during routine clinical assessment such as headache, cognitive impairment and psychiatric manifestations. In conclusion, this literature review highlights a clear case for validation studies in this area and the wider implementation of questionnaires to assess NP involvement is still warranted. The broader use of such instruments could have important consequences; first of all, by standardising symptom assessment, a better definition of the prevalence of NP manifestation across different centres could be achieved. Secondly, prospective studies could allow for the evaluation of clinical significance of mild symptoms and their impact on the patient's function and quality of life. PMID:25365091

  5. Circular RNAs and systemic lupus erythematosus.

    PubMed

    Li, Lian-Ju; Huang, Qing; Pan, Hai-Feng; Ye, Dong-Qing

    2016-08-15

    Circular RNAs (circRNAs) are a large class of noncoding RNAs that form covalently closed RNA circles. The discovery of circRNAs discloses a new layer of gene regulation occurred post-transcriptionally. Identification of endogenous circRNAs benefits from the advance in high-throughput RNA sequencing and remains challenging. Many studies probing into the mechanisms of circRNAs formation occurred cotranscriptionally or posttranscriptionally emerge and conclude that canonical splicing mechanism, sequence properties, and certain regulatory factors are at play in the process. Although our knowledge on functions of circRNAs is rather limited, a few circRNAs are shown to sponge miRNA and regulate gene transcription. The clearest case is one circRNA CDR1as that serves as sponge of miR-7. Researches on circRNAs in human diseases such as cancers highlight the function and physical relevance of circRNAs. Given the implication of miRNAs in the initiation and progression of systemic lupus erythematosus (SLE) and the roles of circRNAs in sponging miRNA and gene regulation, it is appealing to speculate that circRNAs may associate with SLE and may be potential therapeutic targets for treatment of SLE. Future studies should attach more importance to the relationship between circRNAs and SLE. This review will concern identification, biogenesis, and function of circRNAs, introduce reports exploring the association of circRNAs with human diseases, and conjecture the potential roles of circRNAs in SLE. PMID:27450756

  6. Severe Jaccoud's arthropathy in systemic lupus erythematosus.

    PubMed

    Santiago, Mittermayer B; Galvão, Verena; Ribeiro, Daniel Sá; Santos, Willer D; da Hora, Priscila R; Mota, Anna Paula; Pimenta, Emanuela; Oliveira, Isabela; Atta, Ajax M; Reis, Mitermayer G; Reis, Eliana A G; Lins, Carolina

    2015-10-01

    Jaccoud's arthropathy (JA) is a clinical situation nowadays present mostly in systemic lupus erythematosus (SLE). It is characterized by the presence of joint deformities such as "swan neck," ulnar deviation and "Z-thumb" resembling rheumatoid arthritis (RA) but that are passively correctable and without bone erosion on plain radiographs. From our cohort of SLE patients with JA, we selected a subgroup with a more severe form of this arthropathy and looked at their clinical and laboratory profile as well as studied the magnetic resonance imaging (MRI) findings or ultrasound (US) obtained from the hand with most evident deformities. Seven SLE patients with a severe form of JA were identified. All seven patients have "swan neck," ulnar deviation and "Z-thumb" deformities. Two out of seven had "mutilans-type JA" and four had fixed deformities in the metacarpophalangeal (MCP) joints. The MRI of the hand with more evident deformity clinically performed in six cases and US performed in one case showed mild synovitis in five and moderate synovitis in two patients, mild flexor tenosynovitis in six and severe tenosynovitis in one. Only two small bone erosions were observed in the second and third MCP joints of one patient with moderate synovitis. Severe JA compromises the functional capacity of the joints and imposes the risk of misdiagnosis of RA. With the improvement of the survival rate of SLE and the lack of specific prophylactic or therapeutical measures for JA, it is reasonable to assume that more and more cases of severe JA are going to be identified. PMID:26310503

  7. Systemic lupus erythematosus associated with Wells' syndrome.

    PubMed

    Yin, Geng; Xie, Qibing

    2012-04-01

    Wells' syndrome is a multifaceted dermatosis with a wide morphological spectrum, ranging from characteristic cellulitis-like erythema and papula to an unusual presentation of vesicles and pustules. The most important elements for diagnosis are erythemal plaques and histological picture of eosinophilic infiltration of the dermis with 'flame figures' (Plotz et al., in Hautarzt 51:182-186, 2000). Because of its original description as a distinct entity, it has come to be regarded as an abnormal eosinophilic response to a number of causative agents such as herpes simplex virus 2(HSV-2) and toxocara (Ludwig et al., in J Am Acad Dermatol 48:S60-S61, 2003; Bassukas et al., in Cases J 1:356, 2008). Concurrence of WS and malignant diseases as colon cancer, trachea squamous carcinoma, nasopharyngeal carcinoma or angioimmunoblastic lymphadenopathy has been reported (Hirsch et al., in J Dtsch Dermatol Ges 3:530-531, 2005; Renner et al., in Acta Derm Venereol 87:525-528, 2007). Autoimmune diseases, including Systemic lupus erythematosus (SLE) are multi-system disorders of unknown cause and are commonly characterized by protean cutaneous manifestations. To date, few autoimmne disease was found associated with WS except four previous reports of Churg-Strauss syndrome (CSS) and one case of ulcerative colitis (Fujimoto et al., in Clin Exp Dermatol, 2010; Sakaria et al., in J Gastroenterol 42:250-252, 2007). The coexistence of SLE and WS in one patient was not found in literature and our case is the first. Here we described the rare combination and discussed the treatment strategy for this condition. PMID:21340570

  8. Toward the Development of a Lupus Interactive Navigator to Facilitate Patients and Their Health Care Providers in the Management of Lupus: Results of Web-Based Surveys

    PubMed Central

    Neville, Carolyn; DaCosta, Deborah; Rochon, Murray; Eng, Davy

    2014-01-01

    Background Systemic lupus erythematosus is an inflammatory autoimmune disease associated with high morbidity and unacceptable mortality. Information and management tools are needed to help persons with lupus cope with their illness and facilitate health care providers in the delivery of care. Objective The objective of the study was to assess the needs and find solutions to support persons with lupus and their health care providers. Methods Web-based surveys were distributed across Canada to persons with lupus and their relatives (n=3119), rheumatologists (n=517), and arthritis health professionals (AHPs) (n=226) by Lupus Canada, the Canadian Rheumatology Association, and the Arthritis Health Professions Association, respectively. Results The survey sample comprised 665 (21.3%) persons with lupus, 98 (19.0%) rheumatologists, and 74 (32.7%) AHPs. Among the participants with lupus, 92.4% were female, the average age was 46.8 (SD 12.7) years, 79.2% were Caucasian, and 58.8% were employed. All Canadian provinces and territories were represented. The majority (43.3%) of respondents were from Ontario. Mean disease duration was 10.2 (SD 9.5) years, and 41.9% rated their global assessment as fair or poor. There was high agreement between lupus participants and health care providers regarding disease-specific information topics. All groups rated topics related to lupus, fatigue, medications, and stress as most important. Ratings differed among lupus participants and their health care providers regarding perceived helpfulness of some of the patient tools, such as the option to view test results. Needs differed for persons with lupus based on age, sex, depression, stress, and disease activity. Differences in health care provider needs were based on amount of experience in treating lupus. Conclusions Information and support tools needed for persons with lupus and their health care providers were identified. These results will help guide us in the development of a Web

  9. [Lupus nephropathy in childhood and familial lupus. Genetic study of a family].

    PubMed

    Gómez Campdera, F J; Yebra, M; Vicario, J L; Rodríguez, M; Rengel, M; Manzano, L; Martín Villa, J M; Gutiérrez, C

    1989-04-15

    We report a case of a 14 1/2-year-old boy who was diagnosed of systemic lupus erythematosus in the background of an acute nephritic syndrome, 3 1/2 years after being diagnosed of idiopathic thrombocytopenic purpura. The familial history suggested the presence of other cases of SLE, which were proven with relevant clinical and laboratory studies. A genetic study for disease markers was carried out and a correlation was found with haplotypes HLA A25, B18, BW6, DRX, and DQW; C2 deficiency was ruled out. We conclude that it is of paramount importance to rule out the existence of familial SLE in front of infantile SLE, particularly in boys, and we emphasize the necessity of keeping on further searching for genetic markers of the disease. PMID:2755225

  10. The role of Card9 overexpression in peripheral blood mononuclear cells from patients with aseptic acute pancreatitis.

    PubMed

    Yang, Zhi-wen; Weng, Cheng-zhao; Wang, Jing; Xu, Ping

    2016-03-01

    Activated mononuclear cells are an early event in the course of severe acute pancreatitis (SAP). To date, the molecular mechanism triggering peripheral blood mononuclear cells (PBMCs) is poorly understood. The aim of this paper was to determine the potential role of Card9 in SAP. We collected data from 72 subjects between January 2013 and June 2014. Subsequently, PBMCs were isolated on day 1, 3 and 5 of pancreatitis. Immunofluorescence staining, quantitative real-time PCR, Western blotting, immunoprecipitation and ELISA were used to determine the role of Card9 in SAP. Microbial culture showed that SAP patients at the early period did not develop any bacteria and fungi infection. Card9 expression in SAP patients was higher than that in mild acute pancreatitis and volunteer healthy controls, up to the peak on day 1. The monocyte-derived cytokines interleukin (IL)-17, IL-1β, IL-6 and tumour necrosis factor-α mediated by the induction of Card9 markedly increased in SAP patients compared with the control group. Furthermore, the inducible formation of Card9-Bcl10 complex was found in PBMCs, which may be involved in nuclear factor kappa B (NF-κB) and p38 activation in SAP. Receiver operating characteristic curve indicated that Card9 levels had a high sensitivity of 87.5% and specificity of 67.7%, showing the close correlation with SAP patients. Card9 overexpression was firstly found in aseptic SAP, which may be played an important role in NF-κB and p38 activation in PBMCs. It also provided the new insights into therapeutic interventions by targeting monocytes activation in SAP patients. PMID:26893103

  11. 18F-FDG microPET imaging differentiates between septic and aseptic wound healing after orthopedic implant placement

    PubMed Central

    Odekerken, Jim C E; Brans, Boudewijn T; Welting, Tim J M; Walenkamp, Geert H I M

    2014-01-01

    Background and purpose 18F-FDG PET is a widely used tool for molecular imaging of oncological, cardiovascular, and neurological disorders. We evaluated 18F-FDG microPET as an implant osteomyelitis imaging tool using a Staphylococcus aureus-induced peroperative implant infection in rabbits. Methods Intramedullary titanium nails were implanted in contaminated and uncontaminated (control) proximal right tibiae of rabbits. Tibiae were quantitatively assessed with microPET for 18F-FDG uptake before and sequentially at 1, 3, and 6 weeks after surgery. Tracer uptake was assessed in soft tissue and bone in both treatment groups with an additional comparison between the operated and unoperated limb. MicroPET analysis was combined with radiographic assessment and complementary histology of the tibiae. Results At the first postoperative week, the 18F-FDG uptake in the contaminated implant group was significantly higher than the preoperative measurement, without a significant difference between the contaminated and uncontaminated tibiae. From the third postoperative week onward, 18F-FDG uptake allowed discrimination between osteomyelitis and postoperative aseptic bone healing, as well as quantification of the infection at distinct locations around the implant. Interpretation 18F-FDG-based microPET imaging allows differentiation between deep infection and undisturbed wound healing after implantation of a titanium intramedullary nail in this rabbit model. Furthermore, our results indicate that 18F-FDG PET may provide a tool in human clinical diagnostics and for the evaluation of antimicrobial strategies in animal models of orthopedic implant infection. PMID:24673540

  12. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    PubMed

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression. PMID:22318091

  13. Interrelation between Systemic Lupus Erythematosus and Thrombotic Thrombocytopenic Purpura.

    PubMed

    Suleiman, M N; Al-Rukhaimi, M N; Railey, M J; Raizada, S N; Fernandes, H N; Marashi, M M

    1994-01-01

    Features suggestive of thrombotic thrombocytopenic purpura (TTP) are known to occur in patients with systemic lupus erythematosus (SLE). We report a patient who had TTP which resolved with plasma exchange and immunosuppression, but presented three years later with features of SLE. The diagnosis satisfied all the required criteria in both instances. The interrelationship between the two conditions is discussed. PMID:18583760

  14. Automated Detection of Lupus White Matter Lesions in MRI.

    PubMed

    Roura, Eloy; Sarbu, Nicolae; Oliver, Arnau; Valverde, Sergi; González-Villà, Sandra; Cervera, Ricard; Bargalló, Núria; Lladó, Xavier

    2016-01-01

    Brain magnetic resonance imaging provides detailed information which can be used to detect and segment white matter lesions (WML). In this work we propose an approach to automatically segment WML in Lupus patients by using T1w and fluid-attenuated inversion recovery (FLAIR) images. Lupus WML appear as small focal abnormal tissue observed as hyperintensities in the FLAIR images. The quantification of these WML is a key factor for the stratification of lupus patients and therefore both lesion detection and segmentation play an important role. In our approach, the T1w image is first used to classify the three main tissues of the brain, white matter (WM), gray matter (GM), and cerebrospinal fluid (CSF), while the FLAIR image is then used to detect focal WML as outliers of its GM intensity distribution. A set of post-processing steps based on lesion size, tissue neighborhood, and location are used to refine the lesion candidates. The proposal is evaluated on 20 patients, presenting qualitative, and quantitative results in terms of precision and sensitivity of lesion detection [True Positive Rate (62%) and Positive Prediction Value (80%), respectively] as well as segmentation accuracy [Dice Similarity Coefficient (72%)]. Obtained results illustrate the validity of the approach to automatically detect and segment lupus lesions. Besides, our approach is publicly available as a SPM8/12 toolbox extension with a simple parameter configuration. PMID:27570507

  15. An example of endurance in an old wolf, Canis lupus

    USGS Publications Warehouse

    Mech, L.D.

    1997-01-01

    An 11 to 13-year-old Arctic Wolf (Canis lupus arctos) was observed chasing a young Arctic Hare (Lepus arcticus) for 6 to 7 minutes and catching it. This provides an example of the degree of endurance of which an old wolf is capable.

  16. Long daily movements of wolves (Canis lupus) during pup raising

    USGS Publications Warehouse

    Mech, L. David; Cluff, H. Dean

    2009-01-01

    Wolves, Canis lupus, on Ellesmere Island traveled a daily round-trip distance of 40.2 km from their den to a landfill during July 2008, plus an undetermined distance hunting after leaving the landfill. Although long travels by Wolves are well known, this appears to be the first documentation of long daily movements by Wolves rearing pups.

  17. THE LUPUS TRANSIT SURVEY FOR HOT JUPITERS: RESULTS AND LESSONS

    SciTech Connect

    Bayliss, Daniel D. R.; Sackett, Penny D.; Weldrake, David T. F.; Tingley, Brandon W. E-mail: penny.sackett@anu.edu.au E-mail: btingley@iac.es

    2009-05-15

    We present the results of a deep, wide-field transit survey targeting 'Hot Jupiter' planets in the Lupus region of the Galactic plane conducted over 53 nights concentrated in two epochs separated by a year. Using the Australian National University 40-inch telescope at Siding Spring Observatory (SSO), the survey covered a 0.66 deg{sup 2} region close to the Galactic plane (b = 11{sup 0}) and monitored a total of 110,372 stars (15.0 {<=} V {<=} 22.0). Using difference imaging photometry, 16,134 light curves with a photometric precision of {sigma} < 0.025 mag were obtained. These light curves were searched for transits, and four candidates were detected that displayed low-amplitude variability consistent with a transiting giant planet. Further investigations, including spectral typing and radial velocity measurements for some candidates, revealed that of the four, one is a true planetary companion (Lupus-TR-3), two are blended systems (Lupus-TR-1 and 4), and one is a binary (Lupus-TR-2). The results of this successful survey are instructive for optimizing the observational strategy and follow-up procedure for deep searches for transiting planets, including an upcoming survey using the SkyMapper telescope at SSO.

  18. Current and emerging treatment options in the management of lupus.

    PubMed

    Jordan, Natasha; D'Cruz, David

    2016-01-01

    Systemic lupus erythematosus (SLE) is a complex autoimmune disease with variable clinical manifestations. While the clearest guidelines for the treatment of SLE exist in the context of lupus nephritis, patients with other lupus manifestations such as neuropsychiatric, hematologic, musculoskeletal, and severe cutaneous lupus frequently require immunosuppression and/or biologic therapy. Conventional immunosuppressive agents such as mycophenolate mofetil, azathioprine, and cyclophosphamide are widely used in the management of SLE with current more rationalized treatment regimens optimizing the use of these agents while minimizing potential toxicity. The advent of biologic therapies has advanced the treatment of SLE particularly in patients with refractory disease. The CD20 monoclonal antibody rituximab and the anti-BLyS agent belimumab are now widely in use in clinical practice. Several other biologic agents are in ongoing clinical trials. While immunosuppressive and biologic agents are the foundation of inflammatory disease control in SLE, the importance of managing comorbidities such as cardiovascular risk factors, bone health, and minimizing susceptibility to infection should not be neglected. PMID:27529058

  19. Crusted scabies in a child with systemic lupus erythematosus.

    PubMed

    Wanke, N C; Melo, C; Balassiano, V

    1992-01-01

    A child with systemic lupus erythematosus who has been treated with prednisone for three years, developed crusted scabies. Scrapings from lesions revealed Sarcoptes scabiei adult mites mad eggs. The patient died with septicemia and renal failure soon after starting topical 20% sulfur. A marked improvement was observed in the cutaneous lesions. PMID:1308069

  20. Peptidylarginine deiminase inhibition is immunomodulatory and vasculoprotective in murine lupus

    PubMed Central

    Knight, Jason S.; Zhao, Wenpu; Luo, Wei; Subramanian, Venkataraman; O’Dell, Alexander A.; Yalavarthi, Srilakshmi; Hodgin, Jeffrey B.; Eitzman, Daniel T.; Thompson, Paul R.; Kaplan, Mariana J.

    2013-01-01

    Recent evidence suggests that enhanced neutrophil extracellular trap (NET) formation activates plasmacytoid dendritic cells and serves as a source of autoantigens in SLE. We propose that aberrant NET formation is also linked to organ damage and to the premature vascular disease characteristic of human SLE. Here, we demonstrate enhanced NET formation in the New Zealand mixed 2328 (NZM) model of murine lupus. NZM mice also developed autoantibodies to NETs as well as the ortholog of human cathelicidin/LL37 (CRAMP), a molecule externalized in the NETs. NZM mice were treated with Cl-amidine, an inhibitor of peptidylarginine deiminases (PAD), to block NET formation and were evaluated for lupus-like disease activity, endothelial function, and prothrombotic phenotype. Cl-amidine treatment inhibited NZM NET formation in vivo and significantly altered circulating autoantibody profiles and complement levels while reducing glomerular IgG deposition. Further, Cl-amidine increased the differentiation capacity of bone marrow endothelial progenitor cells, improved endothelium-dependent vasorelaxation, and markedly delayed time to arterial thrombosis induced by photochemical injury. Overall, these findings suggest that PAD inhibition can modulate phenotypes crucial for lupus pathogenesis and disease activity and may represent an important strategy for mitigating cardiovascular risk in lupus patients. PMID:23722903

  1. DEPRESSION--A FELLOW TRAVELER WITH SYSTEMIC LUPUS ERYTHEMATOSUS.

    PubMed

    Cojocaru, Doina-Clementina; Costin, Melania; Bădeanu, Lucia Elena; Negru, R D; Aursulesei, Viviana

    2015-01-01

    Systemic lupus erythematosus (SLE) is a chronic multisystem inflammatory disorder that occurs primarily in women of childbearing age, immunologic abnormalities being a prominent feature of the disease. Psychiatric disorders frequently coexist, depression being the most common mood disorder in neuropsychiatric lupus. This literature review was performed through searching MEDLINE database for full-text English-language articles--original research, systematic review and updates published in the last five years (2010-2015), using the keywords "depression and systemic lupus erythematosus". The main outcomes identified were prevalence and predictors of depression in various cultural and ethnic groups, depression-related clinical issues (suicidal ideation, cognitive impairment, altered body image, sleep and sexual disturbances, influence of SLE treatment), and influence on quality of life. A multidisciplinary approach that takes into account the polymorphism and individual variability of the SLE clinical manifestations helps to improve early detection of depression, which is responsible for the increased risk of comorbidities, suicidal attempts, decreased treatment adherence, and impaired quality of life. Physicians across all specialties involved in the care for lupus patients should be aware of the major prevalence of this condition, while helping patients to cope with their disabling disease. PMID:26793837

  2. Chorea in systemic lupus erythematosus: association with antiphospholipid antibodies.

    PubMed Central

    Khamashta, M A; Gil, A; Anciones, B; Lavilla, P; Valencia, M E; Pintado, V; Vázquez, J J

    1988-01-01

    Chorea is a rare manifestation of systemic lupus erythematosus (SLE). In this report the clinical features of two cases of chorea associated with SLE are presented. Of special interest were the raised titres of antiphospholipid antibodies in both cases. The possible pathogenic role of these antibodies is briefly discussed. PMID:3415367

  3. Systemic lupus erythematosus presenting as effuso-constrictive pericarditis.

    PubMed Central

    McMechan, S. R.; McClements, B. M.; McKeown, P. P.; Webb, S. W.; Adgey, A. A.

    1995-01-01

    We describe a 62-year-old woman in whom systemic lupus erythematosus presented as life-threatening effuso-constrictive pericarditis. Surgical drainage of the pericardium was required and the patient made a satisfactory recovery. At six-months follow-up, while taking hydroxychloroquine and a non-steroidal anti-inflammatory agent, she remains well. PMID:8545294

  4. Lupus Nephritis: Animal Modeling of a Complex Disease Syndrome Pathology

    PubMed Central

    McGaha, Tracy L; Madaio, Michael P.

    2014-01-01

    Nephritis as a result of autoimmunity is a common morbidity associated with Systemic Lupus Erythematosus (SLE). There is substantial clinical and industry interest in medicinal intervention in the SLE nephritic process; however, clinical trials to specifically treat lupus nephritis have not resulted in complete and sustained remission in all patients. Multiple mouse models have been used to investigate the pathologic interactions between autoimmune reactivity and SLE pathology. While several models bear a remarkable similarity to SLE-driven nephritis, there are limitations for each that can make the task of choosing the appropriate model for a particular aspect of SLE pathology challenging. This is not surprising given the variable and diverse nature of human disease. In many respects, features among murine strains mimic some (but never all) of the autoimmune and pathologic features of lupus patients. Although the diversity often limits universal conclusions relevant to pathogenesis, they provide insights into the complex process that result in phenotypic manifestations of nephritis. Thus nephritis represents a microcosm of systemic disease, with variable lesions and clinical features. In this review, we discuss some of the most commonly used models of lupus nephritis (LN) and immune-mediated glomerular damage examining their relative strengths and weaknesses, which may provide insight in the human condition. PMID:25722732

  5. Current and emerging treatment options in the management of lupus

    PubMed Central

    Jordan, Natasha; D’Cruz, David

    2016-01-01

    Systemic lupus erythematosus (SLE) is a complex autoimmune disease with variable clinical manifestations. While the clearest guidelines for the treatment of SLE exist in the context of lupus nephritis, patients with other lupus manifestations such as neuropsychiatric, hematologic, musculoskeletal, and severe cutaneous lupus frequently require immunosuppression and/or biologic therapy. Conventional immunosuppressive agents such as mycophenolate mofetil, azathioprine, and cyclophosphamide are widely used in the management of SLE with current more rationalized treatment regimens optimizing the use of these agents while minimizing potential toxicity. The advent of biologic therapies has advanced the treatment of SLE particularly in patients with refractory disease. The CD20 monoclonal antibody rituximab and the anti-BLyS agent belimumab are now widely in use in clinical practice. Several other biologic agents are in ongoing clinical trials. While immunosuppressive and biologic agents are the foundation of inflammatory disease control in SLE, the importance of managing comorbidities such as cardiovascular risk factors, bone health, and minimizing susceptibility to infection should not be neglected. PMID:27529058

  6. Automated Detection of Lupus White Matter Lesions in MRI

    PubMed Central

    Roura, Eloy; Sarbu, Nicolae; Oliver, Arnau; Valverde, Sergi; González-Villà, Sandra; Cervera, Ricard; Bargalló, Núria; Lladó, Xavier

    2016-01-01

    Brain magnetic resonance imaging provides detailed information which can be used to detect and segment white matter lesions (WML). In this work we propose an approach to automatically segment WML in Lupus patients by using T1w and fluid-attenuated inversion recovery (FLAIR) images. Lupus WML appear as small focal abnormal tissue observed as hyperintensities in the FLAIR images. The quantification of these WML is a key factor for the stratification of lupus patients and therefore both lesion detection and segmentation play an important role. In our approach, the T1w image is first used to classify the three main tissues of the brain, white matter (WM), gray matter (GM), and cerebrospinal fluid (CSF), while the FLAIR image is then used to detect focal WML as outliers of its GM intensity distribution. A set of post-processing steps based on lesion size, tissue neighborhood, and location are used to refine the lesion candidates. The proposal is evaluated on 20 patients, presenting qualitative, and quantitative results in terms of precision and sensitivity of lesion detection [True Positive Rate (62%) and Positive Prediction Value (80%), respectively] as well as segmentation accuracy [Dice Similarity Coefficient (72%)]. Obtained results illustrate the validity of the approach to automatically detect and segment lupus lesions. Besides, our approach is publicly available as a SPM8/12 toolbox extension with a simple parameter configuration. PMID:27570507

  7. Blisters and Loss of Epidermis in Patients With Lupus Erythematosus

    PubMed Central

    Merklen-Djafri, Carine; Bessis, Didier; Frances, Camille; Poulalhon, Nicolas; Debarbieux, Sébastien; Cordel, Nadège; Lipsker, Dan

    2015-01-01

    Abstract The nosology of bullous lesions or equivalents (vesicles, erosions, and crusts) in patients with lupus erythematosus (LE) is rarely addressed. The primary aim of this study was to draw up a precise phenotypic inventory of such skin lesions; the secondary objective was to assess a potential relationship between the different types of loss of epidermis and extracutaneous lupus manifestations. We conducted a retrospective multicenter study including 22 patients with definite LE and bullous lesions or equivalents. All biopsies were reviewed. Patients were recruited in the dermatology departments of 6 centers. Patients were included if they met the diagnosis of systemic LE according to American College of Rheumatology and/or Systemic Lupus International Collaborating Clinics criteria or diagnosis of cutaneous LE based on classic clinical criteria and/or histological ascertainment of LE. Patients were recruited through clinician's memory and photographic collections. Three clinico-pathological patterns could be individualized. First, toxic epidermal necrolysis (TEN)-like, sheet-like, skin detachment; sun-exposure, mild mucosal involvement, and dermal mucin deposition allow differential diagnosis with classical Lyell syndrome. Second, vesiculo-bullae and/or crusting occurring on typical lesions of subacute cutaneous lupus erythematosus or chronic cutaneous lupus erythematosus. Third, tense vesicles and/or blisters with an underlying neutrophilic dermatosis and a usual response to dapsone. A careful analysis of 22 LE patients with epidermal detachment reveals 2 main pathomechanisms: a classic LE interface dermatitis, which can be hyperacute and lead to TEN-like skin detachment; and a neutrophilic dermatosis, with tense vesicles and/or blisters, including classic bullous LE. PMID:26579826

  8. Cardiovascular Events in Systemic Lupus Erythematosus

    PubMed Central

    Fernández-Nebro, Antonio; Rúa-Figueroa, Íñigo; López-Longo, Francisco J.; Galindo-Izquierdo, María; Calvo-Alén, Jaime; Olivé-Marqués, Alejandro; Ordóñez-Cañizares, Carmen; Martín-Martínez, María A.; Blanco, Ricardo; Melero-González, Rafael; Ibáñez-Rúan, Jesús; Bernal-Vidal, José Antonio; Tomero-Muriel, Eva; Uriarte-Isacelaya, Esther; Horcada-Rubio, Loreto; Freire-González, Mercedes; Narváez, Javier; Boteanu, Alina L.; Santos-Soler, Gregorio; Andreu, José L.; Pego-Reigosa, José M.

    2015-01-01

    Abstract This article estimates the frequency of cardiovascular (CV) events that occurred after diagnosis in a large Spanish cohort of patients with systemic lupus erythematosus (SLE) and investigates the main risk factors for atherosclerosis. RELESSER is a nationwide multicenter, hospital-based registry of SLE patients. This is a cross-sectional study. Demographic and clinical variables, the presence of traditional risk factors, and CV events were collected. A CV event was defined as a myocardial infarction, angina, stroke, and/or peripheral artery disease. Multiple logistic regression analysis was performed to investigate the possible risk factors for atherosclerosis. From 2011 to 2012, 3658 SLE patients were enrolled. Of these, 374 (10.9%) patients suffered at least a CV event. In 269 (7.4%) patients, the CV events occurred after SLE diagnosis (86.2% women, median [interquartile range] age 54.9 years [43.2–66.1], and SLE duration of 212.0 months [120.8–289.0]). Strokes (5.7%) were the most frequent CV event, followed by ischemic heart disease (3.8%) and peripheral artery disease (2.2%). Multivariate analysis identified age (odds ratio [95% confidence interval], 1.03 [1.02–1.04]), hypertension (1.71 [1.20–2.44]), smoking (1.48 [1.06–2.07]), diabetes (2.2 [1.32–3.74]), dyslipidemia (2.18 [1.54–3.09]), neurolupus (2.42 [1.56–3.75]), valvulopathy (2.44 [1.34–4.26]), serositis (1.54 [1.09–2.18]), antiphospholipid antibodies (1.57 [1.13–2.17]), low complement (1.81 [1.12–2.93]), and azathioprine (1.47 [1.04–2.07]) as risk factors for CV events. We have confirmed that SLE patients suffer a high prevalence of premature CV disease. Both traditional and nontraditional risk factors contribute to this higher prevalence. Although it needs to be verified with future studies, our study also shows—for the first time—an association between diabetes and CV events in SLE patients. PMID:26200625

  9. Systemic lupus erythematosus activity. An operational definition.

    PubMed

    Liang, M H; Stern, S; Esdaile, J M

    1988-04-01

    Improved diagnosis and treatment have reduced mortality from SLE and present us with an opportunity to consider SLE in finer distinctions than alive or dead. Although much has been learned about SLE without a gold standard of disease activity or a universally agreed-upon definition of SLE activity, standardization of one or more measures would greatly enhance our ability to compare results from different centers and to communicate more precisely. It is unlikely that any of the existing measures or any ones to be developed will completely satisfy everyone's needs but it is pointless to proliferate new ones without testing their metric properties. Some differences in concept are desirable, particularly for investigators who have specialized interests or insights, but each should meet criteria of reliability and validity and have explicit definitions of terms, rules for their ascertainment, and the time period covered. Moreover, agreement on minimum essential elements of any SLE activity measure and their operational definitions would be a boon. SLE activity is one dimension in the disease pathway of lupus and implies a continuous phenomena that is potentially reversible. Organ damage, another point in the path of causation, connotes irreversible disease. We recommend that minimum essential elements be based on their frequency of occurrence, biological sensibleness, and the likelihood that degrees of activity can be rated reliably to show a change in a clinical state. The rating should be independent of whether a therapy is employed. Since activity is always considered with severity, the two dimensions could be recognized in the scale. Severity can be used to expand a scale's gradations if a symptom or sign is present. Severity could be rated by the need to treat with immunosuppressive agents, the need to follow the patient more closely, or the functional or prognostic consequences of the manifestation. For every organ system clinical judgment should be used to decide

  10. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    PubMed

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  11. The inhibitory effect of strontium-doped calcium polyphosphate particles on cytokines from macrophages and osteoblasts leading to aseptic loosening in vitro.

    PubMed

    Huang, Chengcheng; Li, Li; Yu, Xixun; Gu, Zhipeng; Zhang, Xu

    2014-04-01

    Aseptic loosening is a common cause of joint implant failure in humans. In order to enhance implant stability, we need to develop a new material that not only promotes the wear resistance of components of an artificial joint, but also possesses the pharmaceutical efficacy of protecting patients against aseptic loosening. Strontium-doped calcium polyphosphate (SCPP) has been found to have this potential ability. The goal of this study is to respectively quantify the levels of TNF-α (for macrophages), receptor activator of NF-kB ligand (RANKL) and osteoprotegerin (OPG) (for osteoblasts) when osteoblasts and macrophages are challenged with various particles (including SCPP). In this study, the osteoblasts ROS 17/2.8 and macrophages RAW 264.7 were challenged with various wear particles (8% SCPP, the molar percentage of Sr in SCPP is 8%, UHMWPE, hydroxyapatite (HA) and CPP). The secretion of TNF-α (from RAW 264.7), OPG and RANKL protein (from ROS 17/2.8) was analyzed by ELISA. The OPG and RANKL mRNA from ROS 17/2.8 was detected by RT-PCR. The data of ELISA indicated that the amount of TNF-α challenged with 8% SCPP particles was more than three-fold lower than that of all other test groups. The ratio of OPG/RANKL in the 8% SCPP group was significantly increased compared to that of all other test groups. The results of OPG and RANKL mRNA expression showed the same tendency as the ELISA results. In general, this study showed that 8% SCPP particles can inhibit the expression of TNF-α and RANKL, promote the expression of OPG so that SCPP can inhibit bone resorption and promote bone formation, and then inhibit aseptic loosening. Thus SCPP could be a promising material for the construction of artificial joints. PMID:24518283

  12. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66)

    PubMed Central

    1971-01-01

    Report of Decompression Sickness Panel, Medical Research Council (1971). Brit. J. industr. Med., 28, 1-21. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66). This paper describes investigations into the health of compressed air workers during and after the construction of a road tunnel under the River Tyne. Altogether 641 men were exposed to the compressed air environment over a period of approximately 31 months. The maximum working pressure was 42 psig (289·6 kN/m2), and the overall decompression sickness rate for work at pressures of 18 psig (124·1 kN/m2) and above was 2%. Radiological examination of the chest was carried out on 183 men to detect lung cysts but only one was found. Thus lung cysts were not shown to be a common factor in the causation of decompression sickness but the possibility of small sub-radiological collections of trapped air being involved was not excluded. Radiological examinations of the shoulders, hips and knee joints were carried out on 171 men. There was evidence of aseptic necrosis in one or more bones of 44 men (26%). Fifteen of the men with definite lesions of aseptic necrosis of bone and 7 of the men with suspected lesions had never worked in compressed air before this contract. The remaining 14 men with definite lesions and the 8 with suspected lesions had worked elsewhere in compressed air prior to this contract, but a definite lesion in one of these men and a suspected lesion in another can almost certainly be attributed to their work in compressed air on this contract. Images PMID:5543625

  13. Optimizing and developing a continuous separation system for the wet process separation of aluminum and polyethylene in aseptic composite packaging waste.

    PubMed

    Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi

    2015-01-01

    The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved. PMID:25458854

  14. A Case of Mania in a Patient with Systemic Lupus Erythematosus

    PubMed Central

    Holtz, Lindsay; Chopra, Kokil

    2010-01-01

    Systemic lupus erythematosus is a chronic inflammatory condition caused by an autoimmune disease. Systemic lupus erythematosus has been described as inducing neuropsychiatric symptoms, including mania and psychosis, in approximately 14 to 80 percent of systemic lupus erythematosus patients. We present and discuss the differential diagnoses in a patient with mania and systemic lupus erythematosus being treated with immunosuppresants and also with a history of glucose-6-phosphate dehydrogenase deficiency. Finally, we review the potential pathogenesis of mania due to an inflammatory-mediated etiology and how this may be used to partly explain the pathogenesis of primary mood disorders. PMID:20508806

  15. [Lupus in Germany: analysis within the German lupus self-help organization (LULA)].

    PubMed

    Fischer-Betz, R; Wessel, E; Richter, J; Winkler-Rohlfing, B; Willers, R; Schneider, M

    2005-03-01

    During the last few decades, the prognosis for patients with systemic lupus erythematosus (LE) has changed from high early mortality to a more chronic longterm course. Although the prevalence of LE has been estimated at 20-50/100,000, data concerning the situation of LE patients in Germany are sparse. Since 2001, a documentation within the German Lupus Self-Help Organisation scheduled for a period of 10 years (LULA) has been recording at the patient level the actual status and the long-term course of a large group of LE patients. A questionnaire adapted from the German rheumatological database is updated once a year and sent to all members.In 2001, 1033 members participated in the documentation. Of these, 92.2% were women (mean age 45.8 years) with a mean disease duration of 9.9 years. 37.6% were employed, and 24.5% were on early retirement. 50.2% rated their overall health status as "not so good" or "poor". Most were receiving treatment with [hydroxy-]chloroquine (35.2%) or azathioprine (21.9%), while 67.9% were receiving corticosteroids. The most frequent comorbidities reported were hypertension (33%), scarring skin disease (24.4%), osteoarthritis (25.2%), osteoporosis (24%), psychiatric disorders/depression (22.9%) and chronic renal disease (22%). Thromboembolic events were reported in 18.5%, myocardial infarction in 2.3% and stroke in 4.8% of cases. Concerning their main contact person for health care, 63.6% specified the rheumatologist. In comparison with other cohort studies and in particular with the German rheumatological database, the data provided exclusively by patients are feasible. Concerning the severity of their disease, their treatment and their global assessment of health status, LULA participants are comparable with other LE patients and can be seen as representative of LE patients in Germany. Further assessment especially of long-term data are needed to obtain additional insights into the burden of the disease and the need for special medical

  16. Lupus nephritis: clinicopathological study of 162 cases in Thailand.

    PubMed Central

    Parichatikanond, P; Francis, N D; Malasit, P; Laohapand, T; Nimmannit, S; Singchoovong, L; Nilwarangkur, S; Chrirawong, P; Vanichakarn, S

    1986-01-01

    One hundred and sixty two cases of lupus nephritis biopsied over three years in Thailand were studied. A pattern of clinical and histological renal disease very similar to that seen in the United States or Europe emerged. The predominant histological type was World Health Organisation class IV (diffuse proliferative; 58.6%). Patients with renal insufficiency (creatinine greater than or equal to 2 mg/100 ml) or hypertension at the time of biopsy had a considerably worse three year survival. Certain features such as sclerotic glomeruli, tubular atrophy, and an interstitial mononuclear cell infiltrate were significantly associated with a worse outcome (0.05 greater than p greater than 0.01), and patients who died with poor renal function had significantly higher chronicity scores than those in other groups (p less than 0.05). These findings emphasise the importance of chronic renal damage in the morbidity and mortality of patients with lupus nephritis. PMID:3485117

  17. Susceptibility genes in the pathogenesis of murine lupus

    PubMed Central

    2002-01-01

    Chapter summary Systemic lupus erythematosus (SLE) is the paradigm of a multisystem autoimmune disease in which genetic factors strongly influence susceptibility. Through genome scans and congenic dissection, numerous loci associated with lupus susceptibility have been defined and the complexity of the inheritance of this disease has been revealed. In this review, we provide a brief description of animal models of SLE, both spontaneous models and synthetic models, with an emphasis on the B6 congenic model derived from analyses of the NZM2410 strain. A hypothetical model of disease progression that organizes many of the identified SLE susceptibility loci in three distinct biological pathways that interact to mediate disease pathogenesis is also described. We finally discuss our recent fine mapping analysis, which revealed a cluster of loci that actually comprise the Sle1 locus. PMID:12110145

  18. The deleterious role of basophils in systemic lupus erythematosus.

    PubMed

    Pellefigues, Christophe; Charles, Nicolas

    2013-12-01

    Systemic lupus erythematosus is a complex autoimmune disease of multifactorial origins. All compartments of the immune system appear to be affected, at least in some way, and to contribute to disease pathogenesis. Because of an escape from negative selection autoreactive T and B cells accumulate in SLE patients leading to the production of autoantibodies mainly raised against nuclear components and their subsequent deposition into target organs. We recently showed that basophils, in an IgE and IL-4 dependent manner, contribute to SLE pathogenesis by amplifying autoantibody production. Here, we summarize what we have learned about the deleterious role of basophils in lupus both in a mouse model and in SLE patients. We discuss which possible pathways could be involved in basophil activation and recruitment to secondary lymphoid organs during SLE, and how basophils may amplify autoantibody production. PMID:24209595

  19. Immunologic findings, thrombocytopenia and disease activity in lupus nephritis.

    PubMed Central

    Clark, W. F.; Linton, A. L.; Cordy, P. E.; Keown, P. E.; Lohmann, R. C.; Lindsay, R. M.

    1978-01-01

    Twenty patients with nephritis due to systemic lupus erythematosus were followed up for a mean of 34 months after renal biopsy with serial determinations of total serum complement and C3 and C4 concentrations, binding of deoxyribonucleic acid (DNA), antinuclear antibody pattern and platelet count. There were 25 episodes of nonhematologic observed disease activity in 16 of the 20 patients; elevated DNA binding and thrombocytopenia correlated well with these episodes. The mean platelet count during episodes of observed disease activity was 96 +/- 42 X 10(9)/L, which was significantly different from the mean count of 248 +/- 90 X 10(9)/L during disease quiescence. The proportion of false-positive results with the immunologic tests varied from 25% to 67% and with platelet counts it was 11%. It is suggested that thrombocytopenia may be a simple and accurate index of disease activity in lupus nephritis. PMID:350367

  20. Cerebral large vessel vasculitis in systemic lupus erythematosus.

    PubMed

    Böckle, B C; Jara, D; Aichhorn, K; Junker, D; Berger, T; Ratzinger, G; Sepp, N T

    2014-11-01

    Neuropsychiatric systemic lupus erythematosus (NPSLE) is defined by involvement of the central nervous system in systemic lupus erythematosus (SLE), with a wide range of both neurological and psychiatric manifestations. Although its aetiopathogenesis is not fully elucidated, NPSLE seems to be a consequence of cerebral vascular pathology including thromboembolism, small-vessel vasculopathy and, in rare cases, true vasculitis. Cerebral vasculitis is rare, and cerebral large-vessel vasculitis in SLE is even more unusual. We report the case of a female patient with the diagnosis of SLE. She presented with stroke-like symptoms, headache and vertigo, and palpable purpura on her legs. Further investigations revealed that she suffered from both vasculitis of the cerebral large vessels and coexisting cutaneous small-vessel vasculitis. PMID:24969082

  1. An Unusual Case of Systemic Lupus Erythematosus and Hemophagocytic Syndrome

    PubMed Central

    Sharmeen, Saika; Hussain, Nazia

    2016-01-01

    Hemophagocytic syndrome (HS) or hemophagocytic lymphohistiocytosis (HLH) is an immune mediated phenomenon that can occur in the setting of an autoimmune disease, chronic immunosuppression, malignancy, or infection. It has been more commonly described in the pediatric population and less commonly in adults. We describe a case of a 52-year-old male who presented with a rash. He simultaneously met the Systemic Lupus International Collaborating Clinics (SLICC) criteria for the diagnosis of systemic lupus erythematosus (SLE) and the diagnostic criteria of HS as described in the hemophagocytic lymphohistiocytosis (HLH) 2004 trial. The bone marrow on autopsy showed the presence of abundant hemosiderophages with focal hemophagocytosis. SLE-associated HS might be underdiagnosed due to the overlap in clinical findings. This case represents the importance of prompt diagnosis and treatment of such a potentially fatal clinical syndrome. PMID:26981305

  2. Neonatal lupus with atypical cardiac and cutaneous manifestation

    PubMed Central

    Morais, Sofia; Santos, Isabel Cristina; Pereira, Dolores Faria; Mimoso, Gabriela

    2013-01-01

    Neonatal lupus erythematosus is a rare, passively acquired autoimmune disease, caused by maternal autoantibodies. The most common manifestations are skin rash and congenital heart block. Cutaneous manifestations may be present at birth, but often develop within a few weeks after delivery. Congenital heart block may present as bradycardia in utero or during physical examination at birth. Approximately 40–60% of mothers are asymptomatic when the infants are diagnosed. We present a case of a child, born with erythematosus lesions in the face, scalp, trunk, limbs and nodules/papules on the palmar and plantar surfaces. He also had hepatosplenomegaly and thrombocytopenia. Echocardiography showed hyperechoic lesions on the anterior papilar muscle of the left ventricle and on the lateral cusp of the tricuspid valve. The mother had unexplained fever and vasculitic lesions in her hands and feet. Antinuclear antibodies, anti-SSa/Ro and anti-SSb/La were positive in the mother and child, making the diagnosis of neonatal lupus. PMID:23839605

  3. Mutation of POL B Causes Lupus in Mice

    PubMed Central

    Senejani, Alireza G.; Liu, Yanfeng; Kidane, Dawit; Maher, Stephen E.; Zeiss, Caroline J; Park, Hong-Jae; Kashgarian, Michael; McNiff, Jennifer M.; Zelterman, Daniel; Bothwell, Alfred L. M.; Sweasy, Joann B.

    2014-01-01

    Summary A replication study of a previous genome-wide association study (GWAS) suggested that a single nucleotide polymorphism (SNP) linked to the POLB gene is associated with systemic lupus erythematosus (SLE). This SNP is correlated with decreased POLB expression (Pol β). To determine if decreased Pol β activity results in SLE, we constructed a mouse model of POLB that encodes an enzyme with slow DNA polymerase activity. Pol β is a key enzyme in the base excision repair (BER) pathway.. We show that mice expressing this hypomorphic POLB allele develop autoimmune pathology strongly resembling SLE. Of note, the immunoglobulin heavy chain junctions from the POL BY265C/C mice have shorter lengths, and somatic hypermutation is dramatically increased. These results demonstrate that decreased Pol β activity during the generation of immune diversity leads to lupus-like disease in mice and suggest that decreased expression of Pol β in humans is an underlying cause of SLE. PMID:24388753

  4. Amyloïdosis, sarcoidosis and systemic lupus erythematosus

    PubMed Central

    Rezgui, Amel; Hassine, Imene Ben; Karmani, Monia; Fredj, Fatma Ben; Laouani, Chadia

    2016-01-01

    The occurrence of renal and multiple organ Amyloïdosis is currently considered exceptional in the course of systemic lupus erythematosus. We report a case of a concomitant SLE and Amyloïdosis in a 57 year old female patient with hypothyroidism history, who presented with erythema nodosum, fever, arthralgia and sicca syndrome. Biological findings showed an inflammatory syndrome, renal failure, proteinuria (1g / 24h), positive auto antibodies and anti DNA. Lung radiology revealed medistinal lymphadenopathy, pleural nodules, ground glass infiltrates and pleuritis. Bronchial biopsy showed non specific inflammation. The salivary gland biopsy showed amyloïd deposits. This case report reminds us that lupus and Amyloïdosis association, although exceptional remains possible. The occurrence of Lofgren syndrome in this situation make the originality of this report. PMID:27583087

  5. Genetic Factors in Systemic Lupus Erythematosus: Contribution to Disease Phenotype

    PubMed Central

    Ceccarelli, Fulvia; Perricone, Carlo; Borgiani, Paola; Ciccacci, Cinzia; Rufini, Sara; Cipriano, Enrica; Alessandri, Cristiano; Spinelli, Francesca Romana; Sili Scavalli, Antonio; Novelli, Giuseppe; Valesini, Guido; Conti, Fabrizio

    2015-01-01

    Genetic factors exert an important role in determining Systemic Lupus Erythematosus (SLE) susceptibility, interplaying with environmental factors. Several genetic studies in various SLE populations have identified numerous susceptibility loci. From a clinical point of view, SLE is characterized by a great heterogeneity in terms of clinical and laboratory manifestations. As widely demonstrated, specific laboratory features are associated with clinical disease subset, with different severity degree. Similarly, in the last years, an association between specific phenotypes and genetic variants has been identified, allowing the possibility to elucidate different mechanisms and pathways accountable for disease manifestations. However, except for Lupus Nephritis (LN), no studies have been designed to identify the genetic variants associated with the development of different phenotypes. In this review, we will report data currently known about this specific association. PMID:26798662

  6. Amyloïdosis, sarcoidosis and systemic lupus erythematosus.

    PubMed

    Rezgui, Amel; Hassine, Imene Ben; Karmani, Monia; Fredj, Fatma Ben; Laouani, Chadia

    2016-01-01

    The occurrence of renal and multiple organ Amyloïdosis is currently considered exceptional in the course of systemic lupus erythematosus. We report a case of a concomitant SLE and Amyloïdosis in a 57 year old female patient with hypothyroidism history, who presented with erythema nodosum, fever, arthralgia and sicca syndrome. Biological findings showed an inflammatory syndrome, renal failure, proteinuria (1g / 24h), positive auto antibodies and anti DNA. Lung radiology revealed medistinal lymphadenopathy, pleural nodules, ground glass infiltrates and pleuritis. Bronchial biopsy showed non specific inflammation. The salivary gland biopsy showed amyloïd deposits. This case report reminds us that lupus and Amyloïdosis association, although exceptional remains possible. The occurrence of Lofgren syndrome in this situation make the originality of this report. PMID:27583087

  7. Systemic lupus erythematosus in men: clinical and immunological characteristics.

    PubMed Central

    Font, J; Cervera, R; Navarro, M; Pallarés, L; López-Soto, A; Vivancos, J; Ingelmo, M

    1992-01-01

    Although systemic lupus erythematosus (SLE) has traditionally been considered a disease of women, men may also be affected. Thirty of 261 patients (12%) with SLE seen in this hospital were men. Arthritis was less common as a first symptom in the men, although this group of patients had discoid lesions and serositis more often than the women. During the follow up a lower incidence of arthritis and malar rash and a higher incidence of other skin complications including discoid lesions and subcutaneous lupus erythematosus was found in the men. The incidence of nephropathy, neurological disease, thrombocytopenia, vasculitis, and serositis, was similar in the two groups. No significant immunological differences were found between men and women. These features indicate that several gender associated clinical differences may be present in patients with SLE. PMID:1417135

  8. DNA-damaging autoantibodies and cancer: the lupus butterfly theory.

    PubMed

    Noble, Philip W; Bernatsky, Sasha; Clarke, Ann E; Isenberg, David A; Ramsey-Goldman, Rosalind; Hansen, James E

    2016-07-01

    Autoantibodies reactive against host DNA are detectable in the circulation of most people with systemic lupus erythematosus (SLE). The long-held view that antibodies cannot penetrate live cells has been disproved. A subset of lupus autoantibodies penetrate cells, translocate to nuclei, and inhibit DNA repair or directly damages DNA. The result of these effects depends on the microenvironment and genetic traits of the cell. Some DNA-damaging antibodies alone have little impact on normal cells, but in the presence of other conditions, such as pre-existing DNA-repair defects, can become highly toxic. These findings raise new questions about autoimmunity and DNA damage, and reveal opportunities for new targeted therapies against malignancies particularly vulnerable to DNA damage. In this Perspectives article, we review the known associations between SLE, DNA damage and cancer, and propose a theory for the effects of DNA-damaging autoantibodies on SLE pathophysiology and cancer risk. PMID:27009542

  9. Combined Pulmonary Fibrosis and Emphysema Preceding Lupus Pleuritis.

    PubMed

    Kamiya, Yosuke; Toyoshima, Mikio; Akiyama, Norimichi; Suda, Takafumi

    2016-01-01

    An 83-year-old man, who was a former smoker, with anti-ribonucleoprotein (RNP) antibody-positive combined pulmonary fibrosis and emphysema presented with a cough and dyspnea. A chest radiograph showed bilateral pleural effusions. His laboratory data showed proteinuria and elevated levels of anti-nuclear antibodies, anti-double strand DNA antibodies, and CA125, with decreased serum complement levels. Thoracentesis showed an exudative pleural effusion with an increased lymphocyte count and elevated CA125 levels. A thoracoscopic biopsy specimen showed proliferation of CA125-positive mesothelial cells. Systemic lupus erythematosus was diagnosed. His symptoms and pleural effusion resolved after the initiation of systemic corticosteroid therapy. The detection of anti-RNP antibody and CA125 levels are helpful in the diagnosis of lupus pleuritis. PMID:27041165

  10. Systemic lupus erythematosus-related hypercalcemia with ectopic calcinosis.

    PubMed

    Zhao, Lidan; Huang, Linfang; Zhang, Xuan

    2016-07-01

    We report a case of a 39-year-old female with active systemic lupus erythematosus who complained of lethargy and weakness with a moderate renal impairment. Hypercalcemia was confirmed by laboratory examination. Her X-ray revealed significant ectopic calcinosis in subcutaneous tissue of bilateral hands, and Tc-99(m) methylene diphosphonate bone scan revealed a remarkably intense uptake of bilateral lungs. She had no evidence suggestive of other diseases related to hypercalcemia such as hyperparathyroidism and malignancy. She had abnormally high serum parathyroid hormone-related protein (PTHrP) which fell to normal after treatment. Glucocorticoid, cyclophosphamide plus calcitonin and etidronate were administered and the patient improved greatly. Literature review demonstrated that lupus-related hypercalcemia with ectopic calcinosis is a rare complication and increased PTHrP is probably one of the main mechanisms. Lung uptake in bone scan may be a special and reliable clue suggestive of hypercalcemia. PMID:27136920

  11. Hypocomplementaemic urticarial vasculitis syndrome: a mimicker of systemic lupus erythematosus.

    PubMed

    Roy, Krishnendu; Talukdar, Arunansu; Kumar, Bappaditya; Sarkar, Sumanta

    2013-01-01

    A middle aged female patient presented with generalised palpable purpura associated with intense pruritus along with subconjunctival haemorrhage and orbital inflammation. There was extensive dermographism. Other systemic examinations were within normal limits. Haematological profile was normal except raised D-dimer. Skin biopsy revealed the presence of leucocytoclastic vasculitis. Antinuclear antibody was positive in a titre of 1 : 160, but antidouble-stranded DNA was negative. Urine examination revealed haematuria and proteinuria. Complement C3, C4 and C1q levels were decreased with the presence of anti-C1q antibody. There was a diagnostic dilemma between systemic lupus erythematosus and hypocomplementaemic urticarial vasculitis syndrome. However, as the patient did not fulfil the American College of Rheumatology criteria for systemic lupus erythematosus, but fulfilled all the criteria for hypocomplementaemic urticarial vasculitis syndrome, the case was finally diagnosed as hypocomplementaemic urticarial vasculitis syndrome and treated accordingly with favourable outcome. PMID:23704433

  12. Presence of hepatitis-associated antigen in systemic lupus erythematosus

    PubMed Central

    Alarcón-Segovia, D.; Fishbein, Eugenia; Díaz-Jouanen, E.

    1972-01-01

    Presence of hepatitis-associated antigen (HAA) was investigated in 504 sera from 116 patients with SLE and was found in 41% of them. HAA was present in at least one serum in 75% of the patients but there were variations in presence and titres in the same patient at different times. Except for a tendency of HAA to appear or rise in titre with lupusi nactivation following corticosteroid or immunosuppresive therapy, there was no correlation between its presence and disease activity, specific organ involvement, antinuclear antibodies or immunoglobulin levels. All but one of twelve lupus patients with recurrent bacterial infections had HAA at high titres. HAA appeared in the serum of a patient upon development of IgA deficiency. HAA antigenaemia in systemic lupus erythematosus seems a consequence rather than a cause of the immunological derangement in this disease. PMID:4538860

  13. Thrombotic and hemorrhagic complications in children with the lupus anticoagulant.

    PubMed

    Bernstein, M L; Salusinsky-Sternbach, M; Bellefleur, M; Esseltine, D W

    1984-12-01

    Endogenous circulating anticoagulants are unusual in children without a congenital factor deficiency. In particular, the lupus anticoagulant has only rarely been reported in children. Despite its functioning in vitro to prolong the partial thromboplastin time, patients more frequently have problems with thrombosis than bleeding, unless there is a coexistent prothrombin deficiency or thrombocytopenia. We report the cases of three children with the lupus anticoagulant. Two children had associated thromboses. One had a thrombosis of the iliofemoral system and the other had a partial Budd-Chiari syndrome, a thrombosis of the deep calf veins and ureteric obstruction. The third child had a concomitant prothrombin deficiency and bleeding after tooth extraction. Associated findings in these patients included a positive antinuclear antibody test in two, a positive anti-DNA antibody test in two, a false-positive VDRL test in two, and an antiphospholipid antibody test in two. PMID:6439032

  14. Pregnancies in women with systemic lupus erythematosus and antiphospholipid antibodies.

    PubMed

    Schreiber, K

    2016-04-01

    Systemic lupus erythematosus (SLE) has preponderance in women in their childbearing years; consequently pregnancy has always been an important issue of concern for the patient and the treating physician. Based upon numerous reports on successful pregnancy outcomes in the past decades, the initial advice against pregnancy in the 1950s has been replaced by a common understanding that women with SLE often have successful pregnancy outcomes, and clinicians therefore advise on pregnancy planning, including possible drug adjustments, timing and close surveillance. The recently published Predictors of Pregnancy Outcome: Biomarkers in Antiphospholipid Antibody Syndrome and Systemic Lupus Erythematosus (PROMISSE) study, so far the largest multicentre cohort study of pregnant women with underlying stable SLE, has given some important answers to long-discussed questions. Future studies on data collected from the PROMISSE cohort will hopefully identify serological biomarkers, possibly genes, and in addition, give valuable information about underlying disease mechanisms. PMID:26811370

  15. LAPping up dead cells to prevent lupus nephritis: a novel role for noncanonical autophagy in autoimmunity.

    PubMed

    Leventhal, Jeremy S; Ross, Michael J

    2016-08-01

    The mechanisms underlying the development of systemic lupus erythematosus and lupus nephritis remain poorly understood. A recent study demonstrates that deficiencies in the immune system's ability to degrade scavenged dead cells via noncanonical autophagy is sufficient to break immune tolerance and produce features commonly seen in lupus, including circulating autoantibodies, inflammatory cytokines, and nephritis. This work provides a possible mechanism for the association of polymorphisms in autophagy genes with the risk of lupus. PMID:27418084

  16. Cardiovascular Disease in Systemic Lupus Erythematosus: The Role of Traditional and Lupus Related Risk Factors

    PubMed Central

    Zeller, Carlos Borelli; Appenzeller, Simone

    2008-01-01

    Atherosclerosis is a chronic inflammatory disorder characterized by immune cell activation, inflammation driven plaque formation and subsequent destabilization. In other disorders of an inflammatory nature, the chronic inflammatory state per se has been linked to acceleration of the atherosclerotic process which is underlined by an increased incidence of cardiovascular disease (CVD) in disorders such as systemic lupus erythematosus (SLE), rheumatoid arthritis (RA) and antiphopholipid (Hughes) syndrome (APS). SLE is an autoimmune disease that may affect any organ. Premature coronary heart disease has emerged as a major cause of morbidity and mortality in SLE. In addition to mortality, cardiovascular morbidity is also markedly increased in these patients, compared with the general population. The increased cardiovascular risk can be explained only partially by an increased prevalence of classical risk factors for cardiovascular disease; it also appears to be related to inflammation. Inflammation is increasingly being considered central to the pathogenesis of atherosclerosis and an important risk factor for vascular disease. Recent epidemiologic and pathogenesis studies have suggested a great deal in common between the pathogenesis of prototypic autoimmune disease such as SLE and that of atherosclerosis. We will review traditional risk factors for CVD in SLE. We will also discuss the role of inflammation in atherosclerosis, as well as possible treatment strategies in these patients. PMID:19936286

  17. Denning behaviour of non-gravid wolves, Canis lupus

    USGS Publications Warehouse

    Mech, L.D.; Phillips, M.K.; Smith, D.W.; Kreeger, T.J.

    1996-01-01

    Wild wolves (Canis lupus) that had produced pups in earlier years but were not currently pregnant, and ovariectomized captive wolves, dug dens during and after the whelping season even though they produced no pups. These observations suggest that den digging is not a function of pregnancy or of ovarian estrogen or progesterone. We hypothesize that increasing prolactin in spring elicits or mediates den-digging behavior.

  18. Genetic contributions of nonautoimmune SWR mice toward lupus nephritis.

    PubMed

    Xie, S; Chang, S; Yang, P; Jacob, C; Kaliyaperumal, A; Datta, S K; Mohan, C

    2001-12-15

    (SWR x New Zealand Black (NZB))F(1) (or SNF(1)) mice succumb to lupus nephritis. Although several NZB lupus susceptibility loci have been identified in other crosses, the potential genetic contributions of SWR to lupus remain unknown. To ascertain this, a panel of 86 NZB x F(1) backcross mice was immunophenotyped and genome scanned. Linkage analysis revealed four dominant SWR susceptibility loci (H2, Swrl-1, Swrl-2, and Swrl-3) and a recessive NZB locus, Nba1. Early mortality was most strongly linked to the H2 locus on chromosome (Chr) 17 (log likelihood of the odds (LOD) = 4.59 - 5.38). Susceptibility to glomerulonephritis was linked to H2 (Chr 17, LOD = 2.37 - 2.70), Swrl-2 (Chr 14, 36 cM, LOD = 2.48 - 2.71), and Nba1 (Chr 4, 75 cM, LOD = 2.15 - 2.23). IgG antinuclear autoantibody development was linked to H2 (Chr 17, LOD = 4.92 - 5.48), Swrl-1 (Chr 1, 86 cM, colocalizing with Sle1 and Nba2, LOD = 2.89 - 2.91), and Swrl-3 (Chr 18, 14 cM, LOD = 2.07 - 2.13). For each phenotype, epistatic interaction of two to three susceptibility loci was required to attain the high penetrance levels seen in the SNF(1) strain. Although the SWR contributions H2, Swrl-1, and Swrl-2 map to loci previously mapped in other strains, often linked to very similar phenotypes, Swrl-3 appears to be a novel locus. In conclusion, lupus in the SNF(1) strain is truly polygenic, with at least four dominant contributions from the SWR strain. The immunological functions and molecular identities of these loci await elucidation. PMID:11739537

  19. Neonatal lupus erythematosus associated with unilateral pectoralis major atrophy.

    PubMed

    Mondal, Rakesh; Nandi, Madhumita; Sarkar, Sumantra; Mukherjee, Krishnendu

    2011-11-01

    Neonatal lupus erythematosus (NLE), in most cases, presents with cardiac and dermatological manifestation due to transferred IgG auto antibodies (anti Ro/SSA and anti La/SSB) from the mother. Some unusual associations with myelopathy, vasculopathy, transient myasthenia gravis, congenital nephrotic syndrome, chondrodysplasia punctata etc. are also reported. Here, the authors present a case of NLE with isolated left sided pectoralis major muscle atrophy, which has not been reported earlier. PMID:21553209

  20. Lupus nephritis in Egyptian children: a 16-year experience.

    PubMed

    Elmougy, Atef; Sarhan, Amr; Hammad, Ayman; El-Refaey, Ahmed; Zedan, Mohammed; Eid, Riham; Laimon, Wafaa; Limon, Wafaa; Elrahman, Ashraf Abd; Elhussieni, Fatma; El-Sherbeny, Enas; Bakr, Ashraf

    2015-10-01

    We retrospectively evaluated the clinical features, histo-pathological patterns, treatment modalities, and outcome of children and adolescents with lupus nephritis (LN), followed-up in Lupus Clinic, Pediatric Nephrology Unit, Mansoura University Children's Hospital between January 1997 and December 2012. Out of 194 patients diagnosed with systemic lupus erythematosus (SLE), LN was reported in 136 (70 %) patient, they were 27 males (20 %) and 109 females (80 %). The mean age at presentation was 12.5 ± 2.9 years, the mean duration of follow up was 4.1 years (range 2 months-12 years). Hematuria was present in 79 patients (58 %), proteinuria in 126 (92.6 %), 38 of them were in nephrotic range, while renal impairment was documented in 20 patients (15 %). Renal biopsy was done in 132 patients; diagnosis of class II, III, IV, V were 23, 25, 39, and 2 % respectively. Second renal biopsy was indicated in 58 patients (insufficient first biopsy 2, follow up in 45, lupus flare in 8, no response to therapy in 3 patients), while the third one was needed in only eight patients. Steroids were the commonest initial medications; used in 128 patients (63 alone and 65 with others) and cyclophosphamide was used in 64 patients. At the last follow-up visit; 19 % of patients lost follow-up, 45 % had complete remission, 21 % still had active disease, 1 % had end-stage renal disease, and 11 % died. In conclusion, in Egypt, childhood SLE is associated with frequent and severe nephritis at presentation, and this may be attributed to genetic, ethnic, or environmental factors. PMID:25491938

  1. Cutaneous lupus erythematosus: issues in diagnosis and treatment.

    PubMed

    Walling, Hobart W; Sontheimer, Richard D

    2009-01-01

    Cutaneous lupus erythematosus (LE) may present in a variety of clinical forms. Three recognized subtypes of cutaneous LE are acute cutaneous LE (ACLE), subacute cutaneous LE (SCLE), and chronic cutaneous LE (CCLE). ACLE may be localized (most often as a malar or 'butterfly' rash) or generalized. Multisystem involvement as a component of systemic LE (SLE) is common, with prominent musculoskeletal symptoms. SCLE is highly photosensitive, with predominant distribution on the upper back, shoulders, neck, and anterior chest. SCLE is frequently associated with positive anti-Ro antibodies and may be induced by a variety of medications. Classic discoid LE is the most common form of CCLE, with indurated scaly plaques on the scalp, face, and ears, with characteristic scarring and pigmentary change. Less common forms of CCLE include hyperkeratotic LE, lupus tumidus, lupus profundus, and chilblain lupus. Common cutaneous disease associated with, but not specific for, LE includes vasculitis, livedo reticularis, alopecia, digital manifestations such as periungual telangiectasia and Raynaud phenomenon, photosensitivity, and bullous lesions. The clinical presentation of each of these forms, their diagnosis, and the inter-relationships between cutaneous LE and SLE are discussed. Common systemic findings in SLE are reviewed, as are diagnostic strategies, including histopathology, immunopathology, serology, and other laboratory findings. Treatments for cutaneous LE initially include preventive (e.g. photoprotective) strategies and topical therapies (corticosteroids and topical calcineurin inhibitors). For skin disease not controlled with these interventions, oral antimalarial agents (most commonly hydroxychloroquine) are often beneficial. Additional systemic therapies may be subdivided into conventional treatments (including corticosteroids, methotrexate, thalidomide, retinoids, dapsone, and azathioprine) and newer immunomodulatory therapies (including efalizumab, anti-tumor necrosis

  2. Systemic Lupus Erythematosus with Deep Vein Thrombosis and Cutaneous Ulcer.

    PubMed

    Saigal, Renu; Goyal, Laxmikant; Agrawal, Abhishek; Wadhwani, Dileep; Mital, Pradeep; Sharma, Rajeev

    2015-09-01

    We are reporting a case of systemic lupus erythematosus (SLE) with left upper limb and lower limb deep vein thrombosis (DVT) due to protein S deficiency which was aggravated by anticoagulants. Oral anticoagulant-induced skin necrosis also developed in this patient. This patient was negative for anti-phospholipid antibodies (APLA). Such a case is rarity where SLE patient without APLA has protein S deficiency. PMID:27608879

  3. Systemic Lupus Erythematosus for General Practitioners: A Literature Review

    PubMed Central

    Karrar, Ali; AI-Dalaan, Abdullah

    1994-01-01

    Systemic lupus erythematosus (SLE) is a multisystem disease of unknown etiology or etiologies. The disease may be acute or chronic. A wide clinicopathological spectrum is expressed in each organ involved which is induced through multiple antibodies that result in. imnunologically mediated tissue injury. In this literature review, the clinical and pathological features as well as laboratory abnormalities, measures /or diagnosis, outlines of management, and prognosis are discussed. PMID:23008531

  4. Lupus enteritis: from clinical findings to therapeutic management

    PubMed Central

    2013-01-01

    Lupus enteritis is a rare and poorly understood cause of abdominal pain in patients with systemic lupus erythematosus (SLE). In this study, we report a series of 7 new patients with this rare condition who were referred to French tertiary care centers and perform a systematic literature review of SLE cases fulfilling the revised ACR criteria, with evidence for small bowel involvement, excluding those with infectious enteritis. We describe the characteristics of 143 previously published and 7 new cases. Clinical symptoms mostly included abdominal pain (97%), vomiting (42%), diarrhea (32%) and fever (20%). Laboratory features mostly reflected lupus activity: low complement levels (88%), anemia (52%), leukocytopenia or lymphocytopenia (40%) and thrombocytopenia (21%). Median CRP level was 2.0 mg/dL (range 0–8.2 mg/dL). Proteinuria was present in 47% of cases. Imaging studies revealed bowel wall edema (95%), ascites (78%), the characteristic target sign (71%), mesenteric abnormalities (71%) and bowel dilatation (24%). Only 9 patients (6%) had histologically confirmed vasculitis. All patients received corticosteroids as a first-line therapy, with additional immunosuppressants administered either from the initial episode or only in case of relapse (recurrence rate: 25%). Seven percent developed intestinal necrosis or perforation, yielding a mortality rate of 2.7%. Altogether, lupus enteritis is a poorly known cause of abdominal pain in SLE patients, with distinct clinical and therapeutic features. The disease may evolve to intestinal necrosis and perforation if untreated. Adding with this an excellent steroid responsiveness, timely diagnosis becomes primordial for the adequate management of this rare entity. PMID:23642042

  5. 2010 BLASTPol Observations of Magnetic Fields in Lupus

    NASA Astrophysics Data System (ADS)

    Matthews, Tristan G.

    The Balloon-borne Large Aperture Submillimeter Telescope for Polarimetry (BLASTPol) was created by adding polarimetric capability to the BLAST experiment that was flown in 2003, 2005, and 2006. BLASTPol inherited BLAST's 1.8 m primary and its Herschel/SPIRE heritage focal plane that allows simultaneous observation at 250, 350, and 500 mum. We flew BLASTPol in 2010 and again in 2012. Both were long duration Antarctic flights. The main result presented here is polarimetry of the nearby filamentary dark cloud Lupus I obtained during the 2010 flight. Despite limitations imposed by the effects of a damaged optical component, we were able to clearly detect submillimeter polarization on degree scales. We compare the resulting BLASTPol magnetic field map with a similar map made via optical polarimetry. (The optical data were published in 1998 by J. Rizzo and collaborators.) The two maps partially overlap and are reasonably consistent with one another. We compare these magnetic field maps to the orientations of filaments in Lupus I, and we find that the dominant filament in the cloud is approximately perpendicular to the large-scale field, while secondary filaments appear to run parallel to the magnetic fields in their vicinities. This is similar to what is observed in Serpens South via near-IR polarimetry, and consistent with what is seen in MHD simulations by F. Nakamura and Z. Li. We have performed a similar analysis for Lupus IV and present initial results. The Lupus IV cloud has no clear dominant filament and we make no attempts to interpret these initial findings. Finally, detailed discussions of two of the dominant sources of error in the 2010 data are presented.

  6. Absence of functional alternative complement pathway alleviates lupus cerebritis.

    PubMed

    Alexander, Jessy J; Jacob, Alexander; Vezina, Paul; Sekine, Hideharu; Gilkeson, Gary S; Quigg, Richard J

    2007-06-01

    The complement inhibitor, Crry, which blocks both the classical and alternative pathways, alleviates CNS disease in the lupus model, MRL/MpJ-Tnfrsf6lpr (MRL/lpr) mice. To understand the role of the alternative pathway, we studied mice deficient in a key alternative pathway protein, complement factor B (fB). Immune deposits (IgG and C3) were reduced in the brains of MRL/lpr fB-deficient (fB-/-MRL/lpr) compared to fB-sufficient (MRL/lpr) mice, indicating reduced complement activation. Reduced neutrophil infiltration (22% of MRL/lpr mice) and apoptosis (caspase-3 activity was reduced to 33% of MRL/lpr mice) in these mice indicates that the absence of the alternative pathway was neuroprotective. Furthermore, expression of phospho (p)-Akt (0.16+/-0.02 vs. 0.35+/-0.13, p<0.03) was increased, while expression of p-PTEN (0.40+/-0.06 vs. 0.11+/-0.07, p<0.05) was decreased in fB-/-MRL/lpr mice compared to their MRL/lpr counterparts. The expression of fibronectin, laminin and collagen IV was significantly decreased in fB-/-MRL/lpr mice compared to MRL/lpr mice, indicating that in the lupus setting, tissue integrity was maintained in the absence of the alternative pathway. Absence of fB reduced behavioral alterations in MRL/lpr mice. Our results suggest that in lupus, the alternative pathway may be the key mechanism through which complement activation occurs in brain, and therefore it might serve as a therapeutic target for lupus cerebritis. PMID:17523212

  7. Evidence for gene-gene epistatic interactions among susceptibility loci for systemic lupus erythematosus

    PubMed Central

    Hughes, Travis; Adler, Adam; Kelly, Jennifer A.; Kaufman, Kenneth M.; Williams, Adrienne; Langefeld, Carl D.; Brown, Elizabeth E.; Alarcón, Graciela S.; Kimberly, Robert P.; Edberg, Jeffrey C.; Ramsey-Goldman, Rosalind; Petri, Michelle; Boackle, Susan A.; Stevens, Anne M.; Reveille, John D.; Sanchez, Elena; Martin, Javier; Niewold, Timothy B.; Vilá, Luis M.; Scofield, R Hal; Gilkeson, Gary S.; Gaffney, Patrick M.; Criswell, Lindsey A.; Moser, Kathy L.; Merrill, Joan T.; Jacob, Chaim O.; Tsao, Betty P.; James, Judith A.; Vyse, Timothy J.; Alarcón-Riquelme, Marta E.; Harley, John B.; Richardson, Bruce C.; Sawalha, Amr H.

    2011-01-01

    Objective Several confirmed genetic susceptibility loci for lupus have been described. To date, no clear evidence for genetic epistasis is established in lupus. We test for gene-gene interactions in a number of known lupus susceptibility loci. Methods Eighteen SNPs tagging independent and confirmed lupus susceptibility loci were genotyped in a set of 4,248 lupus patients and 3,818 normal healthy controls of European descent. Epistasis was tested using a 2-step approach utilizing both parametric and non-parametric methods. The false discovery rate (FDR) method was used to correct for multiple testing. Results We detected and confirmed gene-gene interactions between the HLA region and CTLA4, IRF5, and ITGAM, and between PDCD1 and IL21 in lupus patients. The most significant interaction detected by parametric analysis was between rs3131379 in the HLA region and rs231775 in CTLA4 (Interaction odds ratio=1.19, z-score= 3.95, P= 7.8×10−5 (FDR≤0.05), PMDR= 5.9×10−45). Importantly, our data suggest that in lupus patients the presence of the HLA lupus-risk alleles in rs1270942 and rs3131379 increases the odds of also carrying the lupus-risk allele in IRF5 (rs2070197) by 17% and 16%, respectively (P= 0.0028 and 0.0047). Conclusion We provide evidence for gene-gene epistasis in systemic lupus erythematosus. These findings support a role for genetic interaction contributing to the complexity of lupus heritability. PMID:21952918

  8. Pregnancy-related issues in women with systemic lupus erythematosus.

    PubMed

    Singh, Abha G; Chowdhary, Vaidehi R

    2015-02-01

    While fertility is preserved in females with systemic lupus erythematosus (SLE), it is well established that pregnancy in these patients is associated with adverse maternal and fetal outcomes, including pregnancy loss, pre-eclampsia, preterm delivery and intrauterine growth retardation, as well as neonatal mortality. Mechanisms underlying these adverse outcomes are poorly understood, and better understanding of these would allow development of targeted and personalized treatment strategies. Established risk factors for adverse pregnancy outcomes include active disease within 6 months prior to conception and during pregnancy, active nephritis, maternal hypertension, antiphospholipid antibodies and hypocomplementemia. While intensive monitoring is recommended, the comparative effectiveness of appropriate management strategies is unclear. While current strategies are able to achieve live births in 85-90% of pregnancies, certain aspects such as prevention of preterm birth, treatment of congenital heart block due to neonatal lupus and recurrent pregnancy loss despite best management, remains challenging. Pregnancy is also associated with an increased risk of flare of lupus, particularly in patients with active disease at time of conception or within 6 months prior to conception. Pregnant patients with SLE should be followed in a high-risk obstetric clinic, and care should be closely coordinated between the obstetrician and rheumatologist. PMID:25545844

  9. Remission and withdrawal of therapy in lupus nephritis.

    PubMed

    Moroni, Gabriella; Raffiotta, Francesca; Ponticelli, Claudio

    2016-08-01

    There is agreement that early diagnosis and aggressive treatment of lupus nephritis exacerbations are of paramount importance to achieve remission and prevent the development of irreversible lesions. There is less agreement about the optimal duration of maintenance treatment. Instead, the prolonged exposure to corticosteroids and/or immunosuppressive drugs can cause invalidating or even life-threatening complications. It is still unclear if these drugs can be safely withdrawn in lupus patients. We were able to completely withdraw therapy in around 1/3 of our patients after a follow-up of 5 years or more; 60 % of them never had to start therapy again. Based on our own experience, discontinuation of therapy should be applied only in selected cases, i.e. patients who received maintenance therapy for at least 5 years and are in complete renal remission for at least 3 years. Antimalarial agents are helpful in maintaining the remission after withdrawal of therapy. However, to achieve these goals, drugs should be tapered off very slowly and under strict surveillance. If all these prerequisites are satisfied, the withdrawal of therapy in patients with lupus nephritis may be considered safe, may improve the patients' quality of life and may reduce the damage accrual. PMID:27146861

  10. Appraisal of lupus nephritis by renal imaging with gallium-67

    SciTech Connect

    Bakir, A.A.; Lopez-Majano, V.; Hryhorczuk, D.O.; Rhee, H.L.; Dunea, G.

    1985-08-01

    To assess the activity of lupus nephritis, 43 patients with systemic lupus erythematosus (SLE) were studied by gallium imaging. Delayed renal visualization 48 hours after the gallium injection, a positive result, was noted in 25 of 48 scans. Active renal disease was defined by the presence of hematuria, pyuria (10 or more red blood cells or white blood cells per high-power field), proteinuria (1 g or more per 24 hours), a rising serum creatinine level, or a recent biopsy specimen showing proliferative and/or necrotizing lesions involving more than 20 percent of glomeruli. Renal disease was active in 18 instances, inactive in 23, and undetermined in seven (a total of 48 scans). Sixteen of the 18 scans (89 percent) in patients with active renal disease showed positive findings, as compared with only four of 23 scans (17 percent) in patients with inactive renal disease (p less than 0.001). Patients with positive scanning results had a higher rate of hypertension (p = 0.02), nephrotic proteinuria (p = 0.01), and progressive renal failure (p = 0.02). Mild mesangial nephritis (World Health Organization classes I and II) was noted only in the patients with negative scanning results (p = 0.02) who, however, showed a higher incidence of severe extrarenal SLE (p = 0.04). It is concluded that gallium imaging is a useful tool in evaluating the activity of lupus nephritis.

  11. Orthopedic surgery and its complication in systemic lupus erythematosus

    PubMed Central

    Mak, Anselm

    2014-01-01

    Systemic lupus erythematosus (SLE) is a multi-systemic immune-complex mediated autoimmune condition which chiefly affects women during their prime year. While the management of the condition falls into the specialty of internal medicine, patients with SLE often present with signs and symptoms pertaining to the territory of orthopedic surgery such as tendon rupture, carpal tunnel syndrome, osteonecrosis, osteoporotic fracture and infection including septic arthritis, osteomyelitis and spondylodiscitis. While these orthopedic-related conditions are often debilitating in patients with SLE which necessitate management by orthopedic specialists, a high index of suspicion is necessary in diagnosing these conditions early because lupus patients with potentially severe orthopedic conditions such as osteomyelitis frequently present with mild symptoms and subtle signs such as low grade fever, mild hip pain and back tenderness. Additionally, even if these orthopedic conditions can be recognized, complications as a result of surgical procedures are indeed not uncommon. SLE per se and its various associated pharmacological treatments may pose lupus patients to certain surgical risks if they are not properly attended to and managed prior to, during and after surgery. Concerted effort of management and effective communication among orthopedic specialists and rheumatologists play an integral part in enhancing favorable outcome and reduction in postoperative complications for patients with SLE through thorough pre-operative evaluation, careful peri-operative monitoring and treatment, as well as judicious postoperative care. PMID:24653977

  12. International consensus for a definition of disease flare in lupus.

    PubMed

    Ruperto, N; Hanrahan, L M; Alarcón, G S; Belmont, H M; Brey, R L; Brunetta, P; Buyon, J P; Costner, M I; Cronin, M E; Dooley, M A; Filocamo, G; Fiorentino, D; Fortin, P R; Franks, A G; Gilkeson, G; Ginzler, E; Gordon, C; Grossman, J; Hahn, B; Isenberg, D A; Kalunian, K C; Petri, M; Sammaritano, L; Sánchez-Guerrero, J; Sontheimer, R D; Strand, V; Urowitz, M; von Feldt, J M; Werth, V P; Merrill, J T

    2011-04-01

    The Lupus Foundation of America (LFA) convened an international working group to obtain a consensus definition of disease flare in lupus. With help from the Paediatric Rheumatology International Trials Organization (PRINTO), two web-based Delphi surveys of physicians were conducted. Subsequently, the LFA held a second consensus conference followed by a third Delphi survey to reach a community-wide agreement for flare definition. Sixty-nine of the 120 (57.5%) polled physicians responded to the first survey. Fifty-nine of the responses were available to draft 12 preliminary statements, which were circulated in the second survey. Eighty-seven of 118 (74%) physicians completed the second survey, with an agreement of 70% for 9/12 (75%) statements. During the second conference, three alternative flare definitions were consolidated and sent back to the international community. One hundred and sixteen of 146 (79.5%) responded, with agreement by 71/116 (61%) for the following definition: "A flare is a measurable increase in disease activity in one or more organ systems involving new or worse clinical signs and symptoms and/or laboratory measurements. It must be considered clinically significant by the assessor and usually there would be at least consideration of a change or an increase in treatment." The LFA proposes this definition for lupus flare on the basis of its high face validity. PMID:21148601

  13. MicroRNAs Implicated in the Immunopathogenesis of Lupus Nephritis

    PubMed Central

    Chafin, Cristen B.; Reilly, Christopher M.

    2013-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the deposition of immune complexes due to widespread loss of immune tolerance to nuclear self-antigens. Deposition in the renal glomeruli results in the development of lupus nephritis (LN), the leading cause of morbidity and mortality in SLE. In addition to the well-recognized genetic susceptibility to SLE, disease pathogenesis is influenced by epigenetic regulators such as microRNAs (miRNAs). miRNAs are small, noncoding RNAs that bind to the 3′ untranslated region of target mRNAs resulting in posttranscriptional gene modulation. miRNAs play an important and dynamic role in the activation of innate immune cells and are critical in regulating the adaptive immune response. Immune stimulation and the resulting cytokine milieu alter miRNA expression while miRNAs themselves modify cellular responses to stimulation. Here we examine dysregulated miRNAs implicated in LN pathogenesis from human SLE patients and murine lupus models. The effects of LN-associated miRNAs in the kidney, peripheral blood mononuclear cells, macrophages, mesangial cells, dendritic cells, and splenocytes are discussed. As the role of miRNAs in immunopathogenesis becomes delineated, it is likely that specific miRNAs may serve as targets for therapeutic intervention in the treatment of LN and other pathologies. PMID:23983769

  14. Visceral leishmaniasis in a patient with systemic lupus erythematosus

    PubMed Central

    Santos Silva, André Filipe; Figueiredo Dias, João Paulo Branco Calheiros; Nuak, João Miguel Neves Gonçalves Santos; Rocha Aguiar, Francisca; Araújo Pinto, José António; Sarmento, António Carlos Eugénio Megre

    2015-01-01

    Visceral leishmaniasis is an infection with an insidious and disabling course caused by parasites of the genus Leishmania. In Europe, it is mostly associated with HIV infection. Systemic lupus erythematosus and its treatment are associated with increased risk of infection, neoplastic and concomitant autoimmune disorders. The association of these diseases may go unnoticed. A 60 year-old Caucasian woman with lupus presented with a one-year history of fever, malaise, weakness and weight loss. The highlights on physical examination were pallor, palpable hepatosplenomegaly and low-grade fever. Blood tests showed pancytopenia, hyperproteinemia with hypoalbuminemia and hypergammaglobulinemia; electrophoresis showed a polyclonal gamma curve. Full-body CT scan revealed massive hepatosplenomegaly. Microbiology investigation was negative for the most common pathogens, including tuberculosis. There were no signs of hematologic malignancy in the bone marrow smear. PCR for Leishmania infantum was positive both in blood and bone marrow. The patient was treated with liposomal amphotericin B, and immunosuppression was adjusted. She showed rapid clinical improvement and 6 months later had no signs of disease. The differential diagnosis in a patient with lupus presenting with fever and multisystemic manifestations includes infectious or neoplastic disorders. The patient lived in an endemic area of Leishmania, and typical clinical and analytical changes were all present, making this case highly educational. The case highlights the importance of a patient's epidemiological background and how it can lead to the diagnosis and timely treatment of a rare disease. PMID:26793472

  15. Advances in the treatment of cutaneous lupus erythematosus.

    PubMed

    Kuhn, A; Landmann, A; Wenzel, J

    2016-07-01

    Lupus erythematosus (LE) is a multifactorial autoimmune disease with clinical manifestations of differing severity which may present with skin manifestations as primary sign of the disease (cutaneous lupus erythematosus, CLE) or as part of a disease spectrum (systemic lupus erythematosus, SLE). To date, no drugs are approved specifically for the treatment of CLE and only single agents have been applied in randomized controlled trials. Therefore, topical and systemic agents are used "off-label", primarily based on open-label studies, case series, retrospective analyses, and expert opinions. In contrast, several agents, such as hydroxychloroquine, chloroquine, cyclophosphamide, azathioprine, and belimumab, are approved for the treatment of SLE. Recent approaches in the understanding of the molecular pathogenesis of LE enabled the development of further new agents, which target molecules such as interleukin 6 (IL-6) and interferon (IFN). Only single trials, however, applied these new agents in patients with cutaneous involvement of the disease and/or included endpoints which evaluated the efficacy of these agents on skin manifestations. This article provides an updated review on new and recent approaches in the treatment of CLE. PMID:27252259

  16. Creation of a novel, interdisciplinary, multisite clerkship: "understanding lupus".

    PubMed

    Nambudiri, Vinod E; Newman, Lori R; Haynes, Harley A; Schur, Peter; Vleugels, Ruth Ann

    2014-03-01

    Few medical school electives include longitudinal patient care across clinical specialties and environments. Systemic lupus erythematosus represents a disease process with complex pathophysiology for students to learn from providers across medical fields, including dermatology, rheumatology, nephrology, and cardiology, in both pediatric and adult patients. Diagnosis, understanding, and management of lupus also rely heavily on basic science and clinical immunology, providing a link to the preclinical curriculum. In 2009, Harvard Medical School introduced a one-month elective course "Understanding Lupus: A Multidisciplinary Approach to Systemic Disease," designed to provide students with both outpatient and inpatient care experiences in dermatology, rheumatology, and multidisciplinary clinics at Brigham and Women's Hospital and Boston Children's Hospital. Core components of the elective include a continuity experience that allows students to attend one patient's multiple specialist visits; didactics from dermatology, rheumatology, and immunology covering evidence-based medicine and basic sciences; and clinical immunology laboratory exposure to teach serologic and auto-antibody testing methods. The authors provide lessons learned in the development of this interdisciplinary, multi-institution elective rotation, which may serve as a model at other medical schools for incorporating basic sciences into the clinical curriculum and using multidisciplinary care and varied educational settings. PMID:24448033

  17. Cutaneous Lupus Erythematosus: An Update on Pathogenesis, Diagnosis and Treatment.

    PubMed

    Hejazi, Emily Z; Werth, Victoria P

    2016-04-01

    Cutaneous lupus erythematosus (CLE) includes a broad range of dermatologic manifestations, which may or may not be associated with systemic disease. Recent studies in this area continue to shape our understanding of this disease and treatment options. Epidemiologic studies have found an incidence of CLE of 4.30 per 100,000, which approaches similar analysis for systemic lupus erythematosus (SLE). Although there have been extensive efforts to define SLE, the classification of CLE and its subgroups remains a challenge. Currently, diagnosis relies on clinical and laboratory findings as well as skin histology. The Cutaneous Lupus Area and Severity Index™ (CLASI™) is a validated measure of disease activity and damage. CLE pathogenesis is multifactorial and includes genetic contributions as well as effects of ultraviolet (UV) light. Immune dysregulation and aberrant cell signaling pathways through cytokine cascades are also implicated. Patient education and avoidance of triggers are key to disease prevention. Antimalarials and topical steroids continue to be the standard of care; however, immunosuppressants, thalidomide analogs and monoclonal antibodies are possible systemic therapies for the treatment of recalcitrant disease. PMID:26872954

  18. Study of circulating immune complex size in systemic lupus erythematosus.

    PubMed Central

    Tung, K S; DeHoratius, R J; Williams, R C

    1981-01-01

    The molecular size of circulating immune complexes in patients with systemic lupus erythematosus was determined by the C1q solid-phase assay after the sera were fractionated by sucrose-gradient ultracentrifugation. Circulating immune complexes in patients with membranous glomerulonephritis were uniformly large, sedimenting exclusively above 19S, whereas the immune complexes in patients with cerebritis were small, at or just above 7S. In lupus patients with diffuse proliferative glomerulonephritis and patients without renal involvement, immune complexes of both large and small sizes were found. Of patients without renal involvement, more circulating immune complexes were associated with active disease (n = 22, prevalence = 82%, mean level = 24 standard deviations) than with inactive disease (n = 17, prevalence = 41%, mean level = 41%, mean level = 6 . 5 standard deviations). In patients with clinical evidence for renal involvement, circulating immune complexes were detected in all of five patients with membranous glomerulonephritis, in 88% of 17 patients with diffuse proliferative glomerulonephritis and in one of four patients with mesangial nephritis. Thus, in addition to the finding of an overall positive correlation between disease activity and circulating immune complex levels, circulating immune complexes of certain general molecular size ranges appear to be associated with different clinical manifestations of systemic lupus erythematosus. Images Fig. 1 Fig. 2 Fig. 3 PMID:7285395

  19. The importance of toxoplasma gondii infection in diseases presenting with headaches. Headaches and aseptic meningitis may be manifestations of the Jarisch-Herxheimer reaction.

    PubMed

    Prandota, Joseph

    2009-01-01

    Worldwide, approximately 2 billion people are chronically infected with T. gondii with largely unknown consequences. This review presents clinical symptoms, differential diagnosis, triggering factors, treatment, and pathomechanisms responsible for idiopathic intracranial hypertension, pseudotumor cerebri, and aseptic meningitis. Literature cited in this work illustrates that immune state and other biologic mediator imbalances due to various endogenous and exogenous triggering factors may markedly affect latent central nervous system T. gondii infection/inflammation intensity, and cause reactivation of cerebral toxoplasmosis (CT). Irregularities in pro- and anti-inflammatory processes may markedly disturb the host and/or T. gondii defense mechanisms important for immune control of the parasite thereby manifesting as a wide range of neurologic symptoms and signs observed in some patients with migraine, epilepsy, celiac disease, Henoch-Schönlein purpura, and other brain disorders. This is consistent with reactivation of CT in mice after treatment with dexamethasone associated with depression of type T(H)1 immune response, and development of CT after administration of etanercept or other bioproducts. It seems that various types of headaches, epilepsy, aseptic meningitis, systemic adverse reactions to drugs or other substances represent the Jarisch-Herxheimer reaction due to apoptosis of T. gondii tachyzoites. Also development of some brain tumors, such as ependymoma and glioma may be associated with a chronic course of CT. Thus, all these patients should be tested for T. gondii infection. PMID:19916846

  20. Presence of corrosion products and hypersensitivity-associated reactions in periprosthetic tissue after aseptic loosening of total hip replacements with metal bearing surfaces.

    PubMed

    Huber, Monika; Reinisch, Georg; Trettenhahn, Günter; Zweymüller, Karl; Lintner, Felix

    2009-01-01

    Aseptic loosening of articular implants is frequently associated with tissue reactions to wear particles. Some patients, who had received metal-on-metal articulations, present early symptoms including persistent pain and implant failure. These symptoms raise the suspicion about the development of an immunological response. Furthermore, the generation of rare corrosion products in association with metallic implants has been observed. Corrosion products are known to enhance third-body wear and contribute to the loss of the implant. The purpose of this study was to investigate periprosthetic tissue containing solid corrosion products after aseptic loosening of second-generation metal-on-metal total hip replacements made of low-carbon cobalt-chromium-molybdenum alloy for the presence of immunologically determined tissue changes. Periprosthetic tissue of 11 cases containing uncommon solid deposits was investigated by light microscopy. In order to confirm the presence of corrosion products, additional methods including scanning electron microscopy (SEM) investigation, energy dispersive X-ray (EDX) and Fourier transform infrared microspectroscopy (FTIR) analysis were used. All investigated cases revealed solid chromium orthophosphate corrosion products as well as metallic wear particles to a various extent. Moreover, various intense tissue reactions characteristic of immune response were observed in all cases. The simultaneous presence of corrosion products and hypersensitivity-associated tissue reaction indicates that a relationship between corrosion development and implant-related hypersensitivity may exist. PMID:18725188

  1. Resveratrol Protects against Titanium Particle-Induced Aseptic Loosening Through Reduction of Oxidative Stress and Inactivation of NF-κB.

    PubMed

    Luo, Guotian; Li, Ziqing; Wang, Yu; Wang, Haixing; Zhang, Ziji; Chen, Weishen; Zhang, Yangchun; Xiao, Yinbo; Li, Chaohong; Guo, Ying; Sheng, Puyi

    2016-04-01

    Aseptic implant loosening is closely associated with chronic inflammation induced by implant wear debris, and reactive oxygen species (ROS) play an important role in this process. Resveratrol, a plant compound, has been reported to act as an antioxidant in many inflammatory conditions; however, its protective effect and mechanism against wear particle-induced oxidative stress remain unknown. In this study, we evaluated resveratrol's protective effects against wear particle-induced oxidative stress in RAW 264.7 macrophages. At non-toxic concentrations, resveratrol showed dose-dependent inhibition of nitric oxide (NO) production, ROS generation, and lipid peroxidation. It also downregulated the gene expression of oxidative enzymes, including inducible nitric oxide synthase (iNOS) and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase (NOX)-1 and NOX-2, and promoted the gene expression and activities of antioxidant enzymes, including catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR), and glutathione peroxidase (GPx). This protective effect against wear particle-induced oxidative stress was accompanied by a reduction of gene expression and release of tumor necrosis factor-α (TNF-α), and decreased gene expression and phosphorylation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings demonstrate that resveratrol can inhibit wear particle-induced oxidative stress in macrophages, and may exert its antioxidant effect and protect against aseptic implant loosening. PMID:26878849

  2. Anti-dsDNA, anti-Sm antibodies, and the lupus anticoagulant: significant factors associated with lupus nephritis

    PubMed Central

    Alba, P; Bento, L; Cuadrado, M; Karim, Y; Tungekar, M; Abbs, I; Khamashta, M; D'Cruz, D; Hughes, G

    2003-01-01

    Background: Lupus nephritis (LN) is a common manifestation in patients with systemic lupus erythematosus (SLE). Autoantibodies and ethnicity have been associated with LN, but the results are controversial. Objective: To study the immunological and demographic factors associated with the development of LN. Patients and methods: A retrospective case-control study of 127 patients with biopsy-proven LN, and 206 randomly selected patients with SLE without nephritis as controls was designed. All patients had attended our lupus unit during the past 12 years. Standard methods were used for laboratory testing. Results: Patients with LN were significantly younger than the controls at the time of SLE diagnosis (mean (SD) 25.6 (8.8) years v 33.7 (12.5) years; p<0.0001). The proportion of patients of black ethnic origin was significantly higher in the group with nephritis (p=0.02). There were no differences in sex distribution or duration of follow up. A higher proportion of anti-dsDNA, anti-RNP, anti-Sm, and lupus anticoagulant (LA) was seen in the group with nephritis (p=0.002; p=0.005; p=0.0001; p=0.01, respectively). In univariate, but not in multivariate, analysis male sex and absence of anti-dsDNA were associated with earlier onset of renal disease (p=0.03; p=0.008). In multivariate analysis the only factors associated with nephritis were younger age at diagnosis of SLE, black race, presence of anti-dsDNA, anti-Sm, and LA. No demographic or immunological associations were seen with WHO histological classes. Conclusions: Young, black patients with anti-dsDNA, anti-Sm antibodies, and positive LA, appear to have a higher risk of renal involvement. These patients should be carefully monitored for the development of LN. PMID:12759294

  3. Autoantibody profiling to follow evolution of lupus syndromes

    PubMed Central

    2012-01-01

    Introduction Identification of patients who are in early stages of lupus is currently done through clinical evaluation and is not greatly facilitated by available diagnostic tests. Profiling for patient characteristics and antibody specificities that predict disease would enhance the ability of physicians to identify and treat early cases prior to onset of organ damaging illness. Methods A group of 22 patients with 4 or fewer diagnostic criteria for lupus were studied for changes in clinical and autoantibody profiles after a mean follow up period of 2.4 years. An array with more than 80 autoantigens was used to profile immunoglobulin G (IgG) and immunoglobulin M (IgM) autoantibodies. Correlations with clinical disease progression were examined. Results 3 of the 22 patients (14%) added sufficient criteria during follow up to satisfy a diagnosis of systemic lupus erythematosus (SLE) or to acquire a diagnosis of SLE renal disease. Patients who progressed were all females and were younger than those who did not progress (P=0.00054). IgG but not IgM autoreactivity showed greater increases in the progressor group than in the non-progressor group (P=0.047). IgG specificities that were higher at baseline in progressors included proliferating cell nuclear antigen (PCNA), beta 2 microglobulin, C1q and hemocyanin (P<0.019). Progressors had significant increases in La/SSB and liver cytosol type 1 (LC1) IgG autoantibodies over the period of evaluation (P≤0.0072). A quantitative risk profile generated from baseline demographic and autoantibody variables yielded highly different scores for the progressor and non-progressor groups (P=1.38 × 10-7) Conclusions In addition to demographic features, autoantibody profiles using an expanded array of specificities were correlated with the risk of progressive disease in patients with lupus. These findings suggest the feasibility of developing a simple diagnostic that could be applied by nonspecialists to screen for lupus and permit

  4. VizieR Online Data Catalog: T Tauri star population in Lupus (Galli+, 2015)

    NASA Astrophysics Data System (ADS)

    Galli, P. A. B.; Bertout, C.; Teixeira, R.; Ducourant, C.

    2015-11-01

    The newly derived individual parallaxes from our previous kinematic study of the Lupus association have been used in this paper to determine the photospheric luminosities and refine the masses and ages of the TTS population in this SFR. We investigated the mass and age distributions of CTTSs and WTTSs in the Lupus association. (1 data file).

  5. LARGE-SCALE CO MAPS OF THE LUPUS MOLECULAR CLOUD COMPLEX

    SciTech Connect

    Tothill, N. F. H.; Loehr, A.; Stark, A. A.; Lane, A. P.; Harnett, J. I.; Bourke, T. L.; Myers, P. C.; Parshley, S. C.; Wright, G. A.; Walker, C. K.

    2009-11-01

    Fully sampled degree-scale maps of the {sup 13}CO 2-1 and CO 4-3 transitions toward three members of the Lupus Molecular Cloud Complex-Lupus I, III, and IV-trace the column density and temperature of the molecular gas. Comparison with IR extinction maps from the c2d project requires most of the gas to have a temperature of 8-10 K. Estimates of the cloud mass from {sup 13}CO emission are roughly consistent with most previous estimates, while the line widths are higher, around 2 km s{sup -1}. CO 4-3 emission is found throughout Lupus I, indicating widespread dense gas, and toward Lupus III and IV. Enhanced line widths at the NW end and along the edge of the B 228 ridge in Lupus I, and a coherent velocity gradient across the ridge, are consistent with interaction between the molecular cloud and an expanding H I shell from the Upper-Scorpius subgroup of the Sco-Cen OB Association. Lupus III is dominated by the effects of two HAe/Be stars, and shows no sign of external influence. Slightly warmer gas around the core of Lupus IV and a low line width suggest heating by the Upper-Centaurus-Lupus subgroup of Sco-Cen, without the effects of an H I shell.

  6. Persistent scarring, atrophy, and dyspigmentation in a preteen girl with neonatal lupus erythematosus.

    PubMed

    High, Whitney A; Costner, Melissa I

    2003-04-01

    Neonatal lupus erythematosus is an uncommon autoimmune disease with distinctive cutaneous findings. Descriptions of chronic cutaneous sequelae are rare. We describe a 12-year-old girl with persistent dyspigmentation, scarring, and atrophy as a result of neonatal lupus occurring during infancy. PMID:12664034

  7. Case report: disseminated dermatophytosis by microsporum gypseum in a systemic lupus erythematosus patient

    PubMed Central

    Macêdo, Danielle Patrícia Cerqueira; Neves, Rejane Pereira; Lopes, Flávia Cadengue

    2008-01-01

    Mycosis is a major contributor to morbidity and mortality in patients with systemic lupus erythematosus and frequent exposition to an infectious source could enhance the development of dermatophytic infections. A case of disseminated dermatophytosis by Microsporum gypseum is reported in a systemic lupus erythematosus (SLE) patient. PMID:24031171

  8. What Social Workers in Health Care Should Know about Lupus: A Structural Equation Model

    ERIC Educational Resources Information Center

    Auerbach, Charles; Beckerman, Nancy L.

    2011-01-01

    This article reports on findings from a cross-sectional study (N = 378) of patients living with systemic lupus erythematosus (SLE). The purpose of this study was to identify and clarify the unique psychosocial challenges for those living with lupus. The specific analysis will help to develop a model to determine how different factors influence SLE…

  9. Maternal systemic lupus erythematosus and chondrodysplasia punctata in two sibs: phenocopy or coincidence?

    PubMed Central

    Elçioglu, N; Hall, C M

    1998-01-01

    Two sibs with chondrodysplasia punctata in whom the mother was suffering from systemic lupus erythematosus are presented and the radiological features described. Comparison with other forms of chondrodysplasia punctata with a review of the relevant publications is presented and the possible association with maternal systemic lupus erythematosus is highlighted. Images PMID:9719382

  10. Postextraction hemorrhage in a young male patient with systemic lupus erythematosus.

    PubMed

    Schwartz, S; Esseltine, D W

    1984-03-01

    A case of a 13-year-old boy with prolonged bleeding after tooth extraction is reported. This was the first manifestation of systemic lupus erythematosus found to be associated with circulating anticoagulants, including the "lupus anticoagulant," and possible hypoprothrombinemia. PMID:6608711

  11. Systemic lupus erythematosus in three ethnic groups. XII. Risk factors for lupus nephritis after diagnosis.

    PubMed

    Bastian, H M; Roseman, J M; McGwin, G; Alarcón, G S; Friedman, A W; Fessler, B J; Baethge, B A; Reveille, J D

    2002-01-01

    The purpose of this study was to determine the cumulative incidence of lupus nephritis (LN) and the factors predictive of its occurrence in a multiethnic systemic lupus erythematosus (SLE) cohort. We studied 353 SLE patients as defined by the American College of Rheumatology (ACR) criteria (65 Hispanics, 93 African-Americans and 91 Caucasians). First, we determined the cumulative incidence of LN in all patients. Next, we determined the predictors for LN in those with nephritis occurring after diagnosis. The dependent variable, LN, was defined by: (1) A renal biopsy demonstrating World Health Organization (WHO), class II-V histopathology; and/or (2) proteinuria > or = 0.5 g/24 h or 3+ proteinuria attributable to SLE; and/or (3) one of the following features also attributable to SLE and present on two or more visits, which were performed at least 6 months apart--proteinuria > or = 2+, serum creatinine > or = 1.4 mg/dl, creatinine clearance < or = 79 ml/min, > or = 10 RBCs or WBCs per high power field (hpf), or > or = 3 granular or cellular casts per hpf. Independent variables assessed at diagnosis, and if absent, at baseline, were from four domains: sociodemographic, clinical, immunologic and immunogenetic (including the complete antibody profile and MHC class II alleles), and health habits. Variables with P < 0.05 by chi square analyses were entered into domain-specific stepwise logistic regression analyses controlling for disease duration, with LN as the dependent variable. Significant domain-specific regression variables (P < or = 0.1) were then entered into an overall model. The cumulative incidence of LN was 54.3% in all patients, and 35.3% for those developing LN after diagnosis. LN after diagnosis occurred in 43.1% of 65 Hispanics, 50.5% of 93 African-Americans, and 14.3% of 91 Caucasians, P < 0.0001. The duration of follow-up for those with LN after diagnosis was 5.5+/-2.4 vs 4.0+/-2.9 years for those without LN. Hispanic (odds ratio (OR) = 2.71, 95

  12. X-ray characteristics of the Lupus Loop and SN 1006 supernova remnants

    SciTech Connect

    Toor, A.

    1980-01-01

    The spatial extent of the Lupus Loop and spectra for the Lupus Loop and SN1006 supernova remnants have been determined with a rocket-borne payload. The Lupus Loop is an extended source of soft X-rays (approx. 300' diam) that shows a correlation between its brightest x-ray and radio-emission regions. Its spectrum is characterized by a temperature of 350 eV. Thus, the Lupus Loop appears similar to Vela X and Cygnus Loop, although much weaker. Emission from SN1006 is spatially unresolved and exhibits a harder spectrum than that of the Lupus Loop. All spectral data (0.2 to 10 keV) from our observation and previous observations are satisfactorily fit with a power law (index = 2.15). This spectral dependence suggests the possibility that a rotating neutron star is the underlying source of the radiated energy although such an interpretation appears inconsistent with the remnant's morphology.

  13. Leukocyte Beta-Catenin Expression Is Disturbed in Systemic Lupus Erythematosus.

    PubMed

    Orme, Jacob J; Du, Yong; Vanarsa, Kamala; Wu, Tianfu; Satterthwaite, Anne B; Mohan, Chandra

    2016-01-01

    Wnt/β-catenin signaling is relatively understudied in immunity and autoimmunity. β-catenin blocks inflammatory mediators and favors tolerogenic dendritic cell (DC) phenotypes. We show here that leukocytes from lupus-prone mice and SLE patients express diminished β-catenin transcriptional activity, particularly in myeloid cells, although other leukocytes revealed similar trends. Serum levels of DKK-1, an inhibitor under transcriptional control of Wnt/β-catenin, were also decreased in lupus-prone mice. Surprisingly, however, preemptive deletion of β-catenin from macrophages appears to have no effect on lupus development, even in mice with varying genetic loads for lupus. Although myeloid-specific loss of β-catenin does not seem to be important for lupus development, the potential role of this transcription factor in other leukocytes and renal cells remain to be elucidated. PMID:27548498

  14. Breakdown of Immune Tolerance in Systemic Lupus Erythematosus by Dendritic Cells

    PubMed Central

    Reihl, Alec M.

    2016-01-01

    Dendritic cells (DC) play an important role in the pathogenesis of systemic lupus erythematosus (SLE), an autoimmune disease with multiple tissue manifestations. In this review, we summarize recent studies on the roles of conventional DC and plasmacytoid DC in the development of both murine lupus and human SLE. In the past decade, studies using selective DC depletions have demonstrated critical roles of DC in lupus progression. Comprehensive in vitro and in vivo studies suggest activation of DC by self-antigens in lupus pathogenesis, followed by breakdown of immune tolerance to self. Potential treatment strategies targeting DC have been developed. However, many questions remain regarding the mechanisms by which DC modulate lupus pathogenesis that require further investigations. PMID:27034965

  15. Leukocyte Beta-Catenin Expression Is Disturbed in Systemic Lupus Erythematosus

    PubMed Central

    Orme, Jacob J.; Du, Yong; Vanarsa, Kamala; Wu, Tianfu; Satterthwaite, Anne B.

    2016-01-01

    Wnt/β-catenin signaling is relatively understudied in immunity and autoimmunity. β-catenin blocks inflammatory mediators and favors tolerogenic dendritic cell (DC) phenotypes. We show here that leukocytes from lupus-prone mice and SLE patients express diminished β-catenin transcriptional activity, particularly in myeloid cells, although other leukocytes revealed similar trends. Serum levels of DKK-1, an inhibitor under transcriptional control of Wnt/β-catenin, were also decreased in lupus-prone mice. Surprisingly, however, preemptive deletion of β-catenin from macrophages appears to have no effect on lupus development, even in mice with varying genetic loads for lupus. Although myeloid-specific loss of β-catenin does not seem to be important for lupus development, the potential role of this transcription factor in other leukocytes and renal cells remain to be elucidated. PMID:27548498

  16. Insights into the epidemiology and management of lupus nephritis from the US rheumatologist's perspective.

    PubMed

    Hoover, Paul J; Costenbader, Karen H

    2016-09-01

    Lupus nephritis is a common and severe manifestation of systemic lupus erythematosus that disproportionately affects nonwhites and those in lower socioeconomic groups. This review discusses recent data on the incidence, prevalence, and outcomes of patients with lupus nephritis with a focus on low-income US Medicaid patients. We also review recent guidelines on diagnosis, treatment, and screening for new onset and relapses of lupus nephritis. Finally, we discuss the management of lupus nephritis from a rheumatologist's perspective, including vigilance for the common adverse events related to disease and treatment, and we review prevention and new treatment strategies. PMID:27344205

  17. An acquired defect in IgG-dependent phagocytosis explains the impairment in antibody-mediated cellular depletion in Lupus.

    PubMed

    Ahuja, Anupama; Teichmann, Lino L; Wang, Haowei; Dunn, Robert; Kehry, Marilyn R; Shlomchik, Mark J

    2011-10-01

    B cells play important roles in autoimmune diseases ranging from multiple sclerosis to rheumatoid arthritis. B cells have also long been considered central players in systemic lupus erythematosus. However, anti-CD20-mediated B cell depletion was not effective in two clinical lupus studies, whereas anti-B lymphocyte stimulator, which inhibits B cell survival, was effective. Others and we previously found that anti-CD20-based depletion was surprisingly ineffective in tissues of lupus-prone mice, but that persistent high doses eventually led to depletion and ameliorated lupus. Lupus patients might also have incomplete depletion, as suggested in several studies, and which could have led to therapeutic failure. In this study, we investigated the mechanism of resistance to Ab-mediated cellular depletion in murine lupus. B cells from lupus-prone mice were easily depleted when transferred into normal environments or in lupus-prone mice that lacked serum Ig. Serum from lupus-prone mice transferred depletion resistance, with the active component being IgG. Because depletion is FcγR-dependent, we assayed macrophages and neutrophils exposed to lupus mouse serum, showing that they are impaired in IgG-mediated phagocytosis. We conclude that depletion resistance is an acquired, reversible phagocytic defect depending on exposure to lupus serum IgG. These results have implications for optimizing and monitoring cellular depletion therapy. PMID:21873531

  18. Identification of new transitional disk candidates in Lupus with Herschel

    NASA Astrophysics Data System (ADS)

    Bustamante, I.; Merín, B.; Ribas, Á.; Bouy, H.; Prusti, T.; Pilbratt, G. L.; André, Ph.

    2015-06-01

    Context. New data from the Herschel Space Observatory are broadening our understanding of the physics and evolution of the outer regions of protoplanetary disks in star-forming regions. In particular they prove to be useful for identifying transitional disk candidates. Aims: The goals of this work are to complement the detections of disks and the identification of transitional disk candidates in the Lupus clouds with data from the Herschel Gould Belt Survey. Methods: We extracted photometry at 70, 100, 160, 250, 350, and 500 μm of all spectroscopically confirmed Class II members previously identified in the Lupus regions and analyzed their updated spectral energy distributions. Results: We have detected 34 young disks in Lupus in at least one Herschel band, from an initial sample of 123 known members in the observed fields. Using recently defined criteria, we have identified five transitional disk candidates in the region. Three of them are new to the literature. Their PACS-70 μm fluxes are systematically higher than those of normal T Tauri stars in the same associations, as already found in T Cha and in the transitional disks in the Chamaeleon molecular cloud. Conclusions: Herschel efficiently complements mid-infrared surveys for identifying transitional disk candidates and confirms that these objects seem to have substantially different outer disks than the T Tauri stars in the same molecular clouds. Herschel is an ESA space observatory with science instruments provided by European-led Principal Investigator consortia and with important participation from NASA.Tables 5-7 and Figs. 3 and 4 are available in electronic form at http://www.aanda.org

  19. Pharmacological Management of Childhood-Onset Systemic Lupus Erythematosus.

    PubMed

    Thorbinson, Colin; Oni, Louise; Smith, Eve; Midgley, Angela; Beresford, Michael W

    2016-06-01

    Systemic lupus erythematosus (SLE) is a rare, severe, multisystem autoimmune disorder. Childhood-onset SLE (cSLE) follows a more aggressive course with greater associated morbidity and mortality than adult-onset SLE. Its aetiology is yet to be fully elucidated. It is recognised to be the archetypal systemic autoimmune disease, arising from a complex interaction between the innate and adaptive immune systems. Its complexity is reflected by the fact that there has been only one new drug licensed for use in SLE in the last 50 years. However, biologic agents that specifically target aspects of the immune system are emerging. Immunosuppression remains the cornerstone of medical management, with glucocorticoids still playing a leading role. Treatment choices are led by disease severity. Immunosuppressants, including azathioprine and methotrexate, are used in mild to moderate manifestations. Mycophenolate mofetil is widely used for lupus nephritis. Cyclophosphamide remains the first-line treatment for patients with severe organ disease. No biologic therapies have yet been approved for cSLE, although they are being used increasingly as part of routine care of patients with severe lupus nephritis or with neurological and/or haematological involvement. Drugs influencing B cell survival, including belimumab and rituximab, are currently undergoing clinical trials in cSLE. Hydroxychloroquine is indicated for disease manifestations of all severities and can be used as monotherapy in mild disease. However, the management of cSLE is hampered by the lack of a robust evidence base. To date, it has been principally guided by best-practice guidelines, retrospective case series and adapted adult protocols. In this pharmacological review, we provide an overview of current practice for the management of cSLE, together with recent advances in new therapies, including biologic agents. PMID:26971103

  20. [Treatment of systemic lupus erythematosus: myths, certainties and doubts].

    PubMed

    Ruiz-Irastorza, Guillermo; Danza, Alvaro; Khamashta, Munther

    2013-12-21

    Systemic lupus erythematosus (SLE) is a complex disease with different clinical forms of presentation, including a wide range of severity and organic involvement. Such circumstance, along with the fact of the uncommon nature of the disease and the absence of clinically representative response criteria, make it difficult to design controlled clinical trials in SLE patients. As a result, observational studies have a special relevance, being a source of valuable information of SLE prognosis and outcome as well as of the efficacy and adverse effects of the different therapies. Herein we update some of the main treatments used in SLE. Steroids may have more risks than benefits if used at high doses. New mechanisms of action have been described, supporting the use of lower doses, possibly with the same efficacy and less adverse effects. Intravenous pulses of cyclophosphamide still have a role in the treatment of proliferative lupus nephritis and other serious SLE manifestations. Mycophenolate mofetil has shown its efficacy both as induction and maintenance therapy of selected cases of lupus nephritis. Biological therapies have emerged as new promising options. Although clinical trials have not confirmed a clear superiority of rituximab in SLE, observational studies have shown good response rates in severe SLE manifestations or refractory forms. Belimumab has recently been added to the therapeutic armamentarium of SLE; although its place in clinical practice is not well-defined, it may be recommended in active patients with no response or good tolerance to standard therapies. Hydroxichloroquine improves survival, decreases the risk of thrombosis and flares and is safe in pregnancy, and should be considered the baseline therapy in most SLE patients. PMID:23622892

  1. Antibiotic cement was associated with half the risk of re-revision in 1,154 aseptic revision total knee arthroplasties

    PubMed Central

    Bini, Stefano A; Chan, Priscilla H; Inacio, Maria C S; Paxton, Elizabeth W; Khatod, Monti

    2016-01-01

    Background and purpose Aseptic revisions comprise 80% of revision total knee arthroplasties (TKAs). We determined the incidence of re-revision TKA, the reasons for re-revision, and risk factors associated with these procedures. Patients and methods We conducted a retrospective cohort study of 1,154 patients who underwent aseptic revision TKA between 2002 and 2013 and were followed prospectively by a total joint replacement registry in the USA. Revision was defined as any operation in which an implanted component was replaced. Patient-, surgeon-, and procedure-related risk factors were evaluated. Survival analyses were conducted. Results There were 114 re-revisions (10%) with a median time to reoperation of 3.6 years (interquartile range (IQR): 2.6–5.2). The infection rate was 2.9% (34/1,154) and accounted for 30% of re-revisions (34 of 114). In adjusted models, use of antibiotic-loaded cement was associated with a 50% lower risk of all-cause re-revision surgery (hazard ratio (HR) = 0.5, 95% CI: 0.3–0.9), age with a 20% lower risk for every 10-year increase (HR = 0.8, CI: 0.7–1.0), body mass index (BMI) with a 20% lower risk for every 5-unit increase (HR = 0.8, CI: 0.7–1.0), and a surgeon’s greater cumulative experience (≥ 20 cases vs. < 20 cases) with a 3 times higher risk of re-revision (HR = 2.8, CI: 1.5–5). Interpretation Revised TKAs were at high risk of subsequent failure. The use of antibiotic-loaded cement, higher age, and higher BMI were associated with lower risk of further revision whereas a higher degree of surgeon experience was associated with higher risk. PMID:26472086

  2. [Recent advance in genetics of systemic lupus erythematosus].

    PubMed

    Feng, Xuebing; Chen, Sunle; Shen, Nan

    2002-12-01

    Systemic lupus erythematosus (SLE) is the prototype systemic autoimmune disease and genetic component seems to play an important role in disease susceptibility. Studies from murine models have shown that about 30 loci are related to the disease. Meanwhile, 50 loci have been found in linkage to SLE in human genomic studies, especially 1q23-24, 1q41-42, 2q37, 4p16-15.2, 6p21-11 and 16q13. A lot of candidate genes contribute to the disease susceptibility and different combinations of genes at multiple loci in individual patient may result in the development of diverse clinical features. PMID:12476427

  3. Emerging role of adipokines in systemic lupus erythematosus.

    PubMed

    Li, Hong-Miao; Zhang, Tian-Ping; Leng, Rui-Xue; Li, Xiang-Pei; Li, Xiao-Mei; Liu, Hai-Rong; Ye, Dong-Qing; Pan, Hai-Feng

    2016-08-01

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder characterized by multisystem organ involvement and unclear pathogenesis. Several adipokines synthesized in the adipose tissue, including leptin, adiponectin, resistin, and chemerin, have been explored in autoimmune rheumatic diseases, especially SLE, and results suggest that these mediators may be implicated in the pathogenesis of SLE. However, the current results are controversial. In this review, we will briefly discuss the expression and possible pathogenic role of several important adipokines, including leptin, adiponectin, resistin, and chemerin in SLE. PMID:27314594

  4. Vaccination of Adult Patients with Systemic Lupus Erythematosus in Portugal

    PubMed Central

    Moraes-Fontes, Maria Francisca; Antunes, Ana Margarida; Gruner, Heidi; Riso, Nuno

    2016-01-01

    In the wake of the Portuguese vaccination program 50th anniversary it seems appropriate to review vaccination in patients with systemic lupus erythematosus. Controversial issues as regards the association between autoimmune diseases, infections, and vaccines are discussed as well as vaccine safety and efficacy issues as regards chronic immunosuppressant (IS) drug therapy. After a brief overview of national policies, specific recommendations are made as regards vaccination for adult patients with SLE with a particular focus on current IS therapy and unmet needs. PMID:27069477

  5. An Unusual Mimicker of Systemic Lupus Erythematosus: A Case Report

    PubMed Central

    Aluoch, Aloice O; Farbman, Mathew; Gladue, Heather

    2015-01-01

    We present a case of a 47 year-old African American female with 15 pack-years of tobacco use and heavy alcohol use who presented with arthritis and was found to have a positive antinuclear antibodies (ANA), anti double stranded DNA antibodies (anti-dsDNA), and anti-Sjogren’s syndrome-related antigen A and antigen B (anti-SSA and anti-SSB). She was subsequently found to have a lung adenocarcinoma associated with hypertrophic pulmonary osteoarthropathy (HPO). This demonstrates a case of positive antinuclear antibodies and arthritis in a patient with lung adenocarcinoma, which can be falsely diagnosed as systemic lupus erythematosus. PMID:26106457

  6. Dietary amino acid-induced systemic lupus erythematosus.

    PubMed

    Montanaro, A; Bardana, E J

    1991-05-01

    The effects of dietary manipulations on autoimmune disease are understood poorly. In this article, we detail our experience with a human subject who developed autoimmune hemolytic anemia while participating in a research study that required the ingestion of alfalfa seeds. Subsequent experimental studies in primates ingesting alfalfa sprout seeds and L-canavanine (a prominent amino acid constituent of alfalfa) is presented. The results of these studies indicate a potential toxic and immunoregulatory role of L-canavanine in the induction of a systemic lupus-like disease in primates. PMID:1862241

  7. Systemic lupus erythematosus in patients with sickle cell disease.

    PubMed

    Appenzeller, Simone; Fattori, Andre; Saad, Sarita T; Costallat, Lilian T L

    2008-03-01

    Sickle cell disease (SCD) is a prevalent genetic disorder that includes sickle cell anemia (hemoglobin SS), hemoglobin SC, and hemoglobin Sb-thalassemia. Patients with SCD present with a defective activation of the alternate pathway of the complement system that increases the risk of capsulate bacteria infection and failure to eliminate antigens, predisposing these patients to autoimmune diseases. The authors describe three patients with SCD that developed systemic lupus erythematosus (SLE). In all patients, SLE diagnosis was delayed because symptoms were initially attributable to SCD. Physicians should be alerted to the possible development of SLE in patients with SCD to not delay the diagnosis and start appropriate treatment. PMID:18000698

  8. Parkinsonism and transient bilateral ptosis in systemic lupus erythematosus

    PubMed Central

    Teoh, P. C.; Richard, A. T. Ng; Wong, P. K.

    1974-01-01

    Many neurological abnormalities have been described in systemic lupus erythematosus (SLE), but transient bilateral ptosis and parkinsonism are rarely encountered. This paper describes a young Malay girl with SLE who develops psychosis, bilateral ptosis and parkinsonism during an exacerbation of her illness. These neurological features disappeared after adequate treatment with cyclophosphamide. Though the pathogenesis of these neurological abnormalities is not clearly known, it is likely that transient bilateral ptosis is due to myoneural dysfunction not unlike that of myasthenia gravis. As for parkinsonism, it can probably be explained on the basis of ‘vasculitis’ of the basal ganglia leading to microinfarcts and encephalomalacia. ImagesFig. 1Fig. 2

  9. Acquired hemophilia A in a patient with systemic lupus erythematosus.

    PubMed

    Ishikawa, T; Tsukamoto, N; Suto, M; Uchiumi, H; Mitsuhashi, H; Yokohama, A; Maesawa, A; Nojima, Y; Naruse, T

    2001-06-01

    A patient with systemic lupus erythematosus (SLE) developed acquired hemophilia A. The patient, a 24-year-old Japanese woman, was referred to our hospital because of uncontrollable bleeding following a tooth extraction. Laboratory examination revealed prolonged APTT (116 seconds), reduced factor VIII activity (2.8 %) and the presence of factor VIII inhibitor at a titer of 46.5 Bethesda units/ml. Transfusion of prothrombin complex concentrate and activated prothrombin complex concentrate followed by administration of prednisolone and cyclophosphamide successfully arrested bleeding and reduced the factor VIII inhibitor level. Acquired hemophilia A is a rare but lethal condition. Rapid diagnosis and introduction of adequate therapies are critical. PMID:11446683

  10. Complete atrioventricular block as initial manifestation of systemic lupus erythematosus.

    PubMed

    Arce-Salinas, C A; Carmona-Escamilla, M A; Rodríguez-García, F

    2009-01-01

    Only a few cases of complete atrioventricular block (AVB) in adult lupus patients have been previously described, but only one as the initial manifestation. A 19-year-old woman who presented with seizures and loss of consciousness, was diagnosed with complete ABV and underwent pacemaker placement. Over the next weeks she developed serositis, joint, cutaneous, and renal involvement; positive antinuclear antibodies and high anti-SSA/Ro titers. This is the second case with AVB as a feature of SLE at onset. A review of previous complete AVB cases of adult SLE patients is presented. PMID:19473581

  11. Effect of gender on clinical presentation in systemic lupus erythematosus.

    PubMed

    Murphy, Grainne; Isenberg, David

    2013-12-01

    The incidence of SLE is markedly increased in females of child-bearing age. Although males are protected in terms of incidence of disease, it is unclear whether a distinct phenotype of male lupus exists in those who do develop SLE. We sought to explore through a detailed literature review whether gender exerts an influence on the clinical presentation and outcome of SLE. We found that males experience less of the typical mucocutaneous and musculoskeletal symptoms commonly present at diagnosis in women. On the other hand, there is limited evidence to support a negative prognostic association between male gender and disease activity or mortality. PMID:23641038

  12. Imbalance between Endothelial Damage and Repair: A Gateway to Cardiovascular Disease in Systemic Lupus Erythematosus

    PubMed Central

    2014-01-01

    Atherosclerosis is accelerated in patients with systemic lupus erythematosus (SLE) and it leads to excessive cardiovascular complications in these patients. Despite the improved awareness of cardiovascular disease and advent of clinical diagnostics, the process of atherogenesis in most patients remains clinically silent until symptoms and signs of cardiovascular complications develop. As evidence has demonstrated that vascular damage is already occurring before clinically overt cardiovascular disease develops in lupus patients, intervention at the preclinical stage of atherogenesis would be plausible. Indeed, endothelial dysfunction, one of the earliest steps of atherogenesis, has been demonstrated to occur in lupus patients even when they are naïve for cardiovascular disease. Currently known “endothelium-toxic” factors including type 1 interferon, proinflammatory cytokines, inflammatory cells, immune complexes, costimulatory molecules, neutrophils extracellular traps, lupus-related autoantibodies, oxidative stress, and dyslipidemia, coupled with the aberrant functions of the endothelial progenitor cells (EPC) which are crucial to vascular repair, likely tip the balance towards endothelial dysfunction and propensity to develop cardiovascular disease in lupus patients. In this review, altered physiology of the endothelium, factors leading to perturbed vascular repair contributed by lupus EPC and the impact of proatherogenic factors on the endothelium which potentially lead to atherosclerosis in lupus patients will be discussed. PMID:24790989

  13. Mucocutaneous manifestations in juvenile-onset systemic lupus erythematosus: a review of literature.

    PubMed

    Chiewchengchol, Direkrit; Murphy, Ruth; Edwards, Steven W; Beresford, Michael W

    2015-01-01

    Patients diagnosed with juvenile-onset systemic lupus erythematosus (JSLE) often have skin and oral lesions as part of their presentation. These mucocutaneous lesions, as defined by the American College of Rheumatology (ACR) in 1997, include malar rash, discoid rash, photosensitivity and oral ulcers. It is therefore essential to recognize mucocutaneous lesions to accurately diagnose JSLE. The mucocutaneous lesions can be divided into those with classical histological features (LE specific) and those strongly associated with and forming part of the diagnostic spectrum, but without the classical histological changes of lupus (LE nonspecific). A malar rash is the most commonly associated LE specific dermatological presentation. This skin manifestation is an acute form and also correlates with disease activity. Subacute (polycyclic or papulosquamous lesions) and chronic (discoid lesions) forms, whilst showing classical histological changes supportive of lupus, are less commonly associated with systemic lupus and do not correlate with disease activity. The most commonly associated skin lesions without classical lupus changes are cutaneous vasculitis, oral ulcers and diffuse non-scarring alopecia. These signs frequently relate to disease activity. An understanding of cutaneous signs and symptoms of lupus in children is important to avoid delay in diagnosis. They will often improve as lupus is adequately controlled and their reappearance is often the first indicator of a disease flare. PMID:25587243

  14. Development and validation of a simple lupus severity index using ACR criteria for classification of SLE

    PubMed Central

    Bello, Ghalib A; Brown, Michael A; Kelly, Jennifer A; Thanou, Aikaterini; James, Judith A; Montgomery, Courtney G

    2016-01-01

    Objective To develop a simple systemic lupus erythematosus (SLE) severity index that requires knowledge of only American College of Rheumatology (ACR) criteria and subcriteria. Methods This study used demographic, mortality and medical records data of 1915 patients with lupus from the Lupus Family Registry and Repository. The data were randomly split (2:1 ratio) into independent training and validation sets. A logistic regression with ridge penalty was used to model the probability of being prescribed major immunosuppressive drugs—a surrogate indicator of lupus severity. ACR criteria and subcriteria were used as predictor variables in this model, and the resulting regression coefficient estimates obtained from the training data were used as item weightings to construct the severity index. Results The resulting index was tested on the independent validation dataset and was found to have high predictive accuracy for immunosuppressive use and early mortality. The index was also found to be strongly correlated with a previously existing severity score for lupus. In addition, demographic factors known to influence lupus severity (eg, age of onset, gender and ethnicity) all showed robust associations with our severity index that were consistent with observed clinical trends. Conclusions This new index can be easily computed using ACR criteria, which may be among the most readily available data elements from patient medical records. This tool may be useful in lupus research, especially large dataset analyses to stratify patients by disease severity, an important prognostic indicator in SLE. PMID:27026812

  15. Recent Star Formation in the Lupus Clouds as Seen by Herschel

    NASA Astrophysics Data System (ADS)

    Rygl, Kazi L. J.; Benedettini, Milena

    We present a study of the star formation histories of the Lupus I, III, and IV clouds using the Herschel 70-500 μm maps obtained by the Herschel Gould Belt Survey Key-Project. By combining the new Herschel data with the existing Spitzer catalog we obtained an unprecedented census of prestellar sources and young stellar objects in the Lupus clouds, which allowed us to study the overall star formation rate (SFR) and efficiency (SFE). The high SFE of Lupus III and its decreasing SFR suggest that Lupus III is the most evolved cloud, that after having experienced a major star formation event, is now approaching the end of its current star-forming cycle. Lupus I is currently undergoing a large star formation event, apparent by the increasing SFR. Also Lupus IV has an increasing SFR, however, the relative number of prestellar sources is much lower than in Lupus I, suggesting that its star formation has not yet reached its peak.

  16. Sunlight triggers cutaneous lupus through a CSF-1-dependent mechanism in MRL-Fas(lpr) mice.

    PubMed

    Menke, Julia; Hsu, Mei-Yu; Byrne, Katelyn T; Lucas, Julie A; Rabacal, Whitney A; Croker, Byron P; Zong, Xiao-Hua; Stanley, E Richard; Kelley, Vicki R

    2008-11-15

    Sunlight (UVB) triggers cutaneous lupus erythematosus (CLE) and systemic lupus through an unknown mechanism. We tested the hypothesis that UVB triggers CLE through a CSF-1-dependent, macrophage (Mø)-mediated mechanism in MRL-Fas(lpr) mice. By constructing mutant MRL-Fas(lpr) strains expressing varying levels of CSF-1 (high, intermediate, none), and use of an ex vivo gene transfer to deliver CSF-1 intradermally, we determined that CSF-1 induces CLE in lupus-susceptible MRL-Fas(lpr) mice, but not in lupus-resistant BALB/c mice. UVB incites an increase in Møs, apoptosis in the skin, and CLE in MRL-Fas(lpr), but not in CSF-1-deficient MRL-Fas(lpr) mice. Furthermore, UVB did not induce CLE in BALB/c mice. Probing further, UVB stimulates CSF-1 expression by keratinocytes leading to recruitment and activation of Møs that, in turn, release mediators, which induce apoptosis in keratinocytes. Thus, sunlight triggers a CSF-1-dependent, Mø-mediated destructive inflammation in the skin leading to CLE in lupus-susceptible MRL-Fas(lpr) but not lupus-resistant BALB/c mice. Taken together, CSF-1 is envisioned as the match and lupus susceptibility as the tinder leading to CLE. PMID:18981160

  17. Increased Urinary Exosomal MicroRNAs in Patients with Systemic Lupus Erythematosus

    PubMed Central

    Perez-Hernandez, Javier; Forner, Maria J.; Pinto, Carolina; Chaves, Felipe J.

    2015-01-01

    There is increased interest in using microRNAs (miRNAs) as biomarkers in different diseases. Present in body fluids, it is controversial whether or not they are mainly enclosed in exosomes, thus we studied if urinary miRNAs are concentrated inside exosomes and if the presence of systemic lupus erythematosus with or without lupus nephritis modifies their distribution pattern. We quantified specific miRNAs in urine of patients with systemic lupus erythematosus (n = 38) and healthy controls (n = 12) by quantitative reverse-transcription PCR in cell-free urine, exosome-depleted supernatant and exosome pellet obtained by ultracentrifugation. In control group, miR-335* and miR-302d were consistently higher in exosomes than in exosome-depleted supernatant, and miR-200c and miR-146a were higher in cell-free fraction. In lupus patients, all urinary miRNAs tested were mainly in exosomes with lower levels outside them (p<0.05 and p<0.01, respectively). This pattern is especially relevant in patients with active lupus nephritis compared to the control group or to the SLE patients in absence of lupus nephritis, with miR-146a being the most augmented (100-fold change, p<0.001). Among the exosomal miRNAs tested, only the miR-146a discriminates the presence of active lupus nephritis. In conclusion, urinary miRNAs are contained primarily in exosomes in systemic lupus erythematosus, and the main increment was found in the presence of active lupus nephritis. These findings underscore the attractiveness of exosomal miRNAs in urine, a non-invasive method, as potential renal disease markers. PMID:26390437

  18. Phenotypic and functional alterations of pDCs in lupus-prone mice

    PubMed Central

    Zhou, Zhenyuan; Ma, Jianyang; Xiao, Chunyuan; Han, Xiao; Qiu, Rong; Wang, Yan; Zhou, Yingying; Wu, Li; Huang, Xinfang; Shen, Nan

    2016-01-01

    Plasmacytoid dendritic cells (pDCs) were considered to be the major IFNα source in systemic lupus erythematosus (SLE) but their phenotype and function in different disease status have not been well studied. To study the function and phenotype of pDCs in lupus-prone mice we used 7 strains of lupus-prone mice including NZB/W F1, NZB, NZW, NZM2410, B6.NZMSle1/2/3, MRL/lpr and BXSB/Mp mice and C57BL/6 as control mice. Increased spleen pDC numbers were found in most lupus mice compared to C57BL/6 mice. The IFNα-producing ability of BM pDCs was similar between lupus and C57BL/6 mice, whereas pDCs from the spleens of NZB/W F1 and NZB mice produced more IFNα than pDCs from the spleens of C57BL/6 mice. Furthermore, spleen pDCs from MRL-lpr and NZM2410 mice showed increased responses to Tlr7 and Tlr9, respectively. As the disease progressed, IFN signature were evaluated in both BM and spleen pDC from lupus prone mice and the number of BM pDCs and their ability to produce IFNα gradually decreased in lupus-prone mice. In conclusion, pDC are activated alone with disease development and its phenotype and function differ among lupus-prone strains, and these differences may contribute to the development of lupus in these mice. PMID:26879679

  19. Autoantibodies to histone, DNA and nucleosome antigens in canine systemic lupus erythematosus.

    PubMed Central

    Monestier, M; Novick, K E; Karam, E T; Chabanne, L; Monier, J C; Rigal, D

    1995-01-01

    Dogs can develop systemic lupus erythematosus syndromes that are clinically similar to those seen in humans. In contrast, previous observations suggest differences in their autoantibody reactivity patterns against histones and DNA which are components of the nucleosome in chromatin. The objective of this study was to assess comprehensively the levels of autoantibodies against histone, DNA and nucleosome antigens in a population of lupus dogs. The specificities of antibodies in lupus and control dog sera were determined using IgM- and IgG-specific reagents in an ELISA against a variety of chromatin antigens. When compared with control sera, IgG antibodies to individual histones H1, H2A, H3 and H4 were significantly higher in the lupus group. In contrast, we did not detect IgG antibodies specific for H2B, H2A-H2B, DNA, H2A-H2B-DNA or nucleosome in lupus dogs. There was no significant increase in any of the IgM specificities tested. Therefore, the reactivity pattern to nucleosome antigens in canine lupus is restricted to IgG antibodies against individual histones H1, H2A, H3 and H4. This stands in contrast with human and murine lupus, where autoantibodies are directed against a wide variety of nucleosomal determinants, suggesting that unique mechanisms lead to the expansion of anti-histone antibody clones in canine lupus. The high incidence of glomerulonephritis in dog lupus suggests that anti-DNA antibodies are not required for the development of this complication, whereas IgG anti-histone antibodies may be relevant to its pathogenesis. PMID:7529150

  20. Lupus anticoagulant: a unique case with lupus anticoagulant and habitual abortion together with antifactor II antibody and bleeding tendency.

    PubMed

    Stormorken, H; Gjemdal, T; Bjøro, K

    1988-01-01

    Lupus anticoagulants (LA) are associated with various forms of thrombotic events. Of particular interest to obstetrics is the association with placental infarcts and habitual abortion. In the case described a near full-term viable infant was delivered subsequent to four early miscarriages. However, the mother had then developed an antifactor II antibody leading to grave hypoprothrombinemia with bleeding tendency, indicating efficient autoanticoagulation. This natural experiment indicates that these patients should receive anticoagulation during pregnancy, possibly in combination with steroids to depress the LA level. PMID:3139508

  1. Redefining cutaneous lupus erythematosus: a proposed international consensus approach and results of a preliminary questionnaire.

    PubMed

    Merola, J F; Nyberg, F; Furukawa, F; Goodfield, M J; Hasegawa, M; Marinovic, B; Szepietowski, J; Dutz, J; Werth, V P

    2015-01-01

    There is currently no uniform definition of cutaneous lupus erythematosus (CLE) upon which to base a study population for observational and interventional trials. A preliminary questionnaire was derived from and sent to a panel of CLE experts which demonstrated consensus agreement that (1) there is a need for new definitions for CLE (2) CLE is distinct from systemic lupus erythematosus and that a CLE grouping scheme should remain apart from current systemic lupus erythematosus schema (3) current CLE grouping schemes are inadequate around communication, prognostic information and to meet the needs of researchers, clinicians, patients and payers. PMID:25861460

  2. Clearing the complexity: immune complexes and their treatment in lupus nephritis

    PubMed Central

    Toong, Catherine; Adelstein, Stephen; Phan, Tri Giang

    2011-01-01

    Systemic lupus erythematosus (SLE) is a classic antibody-mediated systemic autoimmune disease characterised by the development of autoantibodies to ubiquitous self-antigens (such as antinuclear antibodies and antidouble-stranded DNA antibodies) and widespread deposition of immune complexes in affected tissues. Deposition of immune complexes in the kidney results in glomerular damage and occurs in all forms of lupus nephritis. The development of nephritis carries a poor prognosis and high risk of developing end-stage renal failure despite recent therapeutic advances. Here we review the role of DNA-anti-DNA immune complexes in the pathogenesis of lupus nephritis and possible new treatment strategies aimed at their control. PMID:21694945

  3. Transformation of lupus-inducing drugs to cytotoxic products by activated neutrophils.

    PubMed

    Jiang, X; Khursigara, G; Rubin, R L

    1994-11-01

    Drug-induced lupus is a serious side effect of certain medications, but the chemical features that confer this property and the underlying pathogenesis are puzzling. Prototypes of all six therapeutic classes of lupus-inducing drugs were highly cytotoxic only in the presence of activated neutrophils. Removal of extracellular hydrogen peroxide before, but not after, exposure of the drug to activated neutrophils prevented cytotoxicity. Neutrophil-dependent cytotoxicity required the enzymatic action of myeloperoxidase, resulting in the chemical transformation of the drug to a reactive product. The capacity of drugs to serve as myeloperoxidase substrates in vitro was associated with the ability to induce lupus in vivo. PMID:7973636

  4. Noninfectious Meningitis Caused by Systemic Lupus Erythematosus: A Case Series of 4 Patients.

    PubMed

    Lee, Jeong Hoon; Lee, Ji Young; Lee, Young-Jun; Park, Dong Woo; Kim, Young Seo; Kim, Hyun Young

    2016-01-01

    We report magnetic resonance imaging findings of 4 patients with systemic lupus erythematosus who presented with noninfectious meningitis by lupus itself. Magnetic resonance imaging of the brain demonstrated diffuse or localized high-signal intensity in subarachnoid spaces on fluid-attenuated inversion recovery (FLAIR) or postcontrast fluid-attenuated inversion recovery. Cerebrospinal fluid study revealed no abnormalities other than increased level of proteins. Our report is the first description of magnetic resonance findings in context of leptomeningeal involvement in non-infectious meningitis of patients with systemic lupus erythematosus. PMID:26938698

  5. Treatment of intractable lupus nephritis with total lymphoid irradiation

    SciTech Connect

    Strober, S.; Field, E.; Hoppe, R.T.; Kotzin, B.L.; Shemesh, O.; Engleman, E.; Ross, J.C.; Myers, B.D.

    1985-04-01

    Ten patients with lupus nephritis and marked proteinuria (3.9 g or more/d) that did not respond adequately to treatment with prednisone alone or prednisone in combination with azathioprine were treated with total lymphoid irradiation in an uncontrolled feasibility study. Within 6 weeks after the start of total lymphoid irradiation, the serum albumin level rose in all patients in association with a reduction in the serum level of anti-DNA antibodies, an increase in the serum complement level, or both. Improvement in these variables persisted in eight patients followed for more than 1 year, with the stabilization or reduction of the serum creatinine level. Urinary leakage of albumin was substantially reduced in all patients. Side effects associated with radiotherapy included transient constitutional complaints in ten patients, transient blood element depressions in three, localized viral and bacterial infections in four, and ovarian failure in one. The results suggest that total lymphoid irradiation may provide an alternative to cytotoxic drugs in the treatment of lupus nephritis.

  6. Outcome of the acute glomerular injury in proliferative lupus nephritis

    SciTech Connect

    Chagnac, A.; Kiberd, B.A.; Farinas, M.C.; Strober, S.; Sibley, R.K.; Hoppe, R.; Myers, B.D. )

    1989-09-01

    Treatment with total lymphoid irradiation (TLI) and corticosteroids markedly reduced activity of systemic lupus erythematosis in 10 patients with diffuse proliferative lupus nephritis (DPLN) complicated by a nephrotic syndrome. Physiologic and morphometric techniques were used serially before, and 12 and 36 mo post-TLI to characterize the course of glomerular injury. Judged by a progressive reduction in the density of glomerular cells and immune deposits, glomerular inflammation subsided. A sustained reduction in the fractional clearance of albumin, IgG and uncharged dextrans of radius greater than 50 A, pointed to a parallel improvement in glomerular barrier size-selectivity. Corresponding changes in GFR were modest, however. A trend towards higher GFR at 12 mo was associated with a marked increase in the fraction of glomerular tuft area occupied by patent capillary loops as inflammatory changes receded. A late trend toward declining GFR beyond 12 mo was associated with progressive glomerulosclerosis, which affected 57% of all glomeruli globally by 36 mo post-TLI. Judged by a parallel increase in volume by 59%, remaining, patent glomeruli had undergone a process of adaptive enlargement. We propose that an increasing fraction of glomeruli continues to undergo progressive sclerosis after DPLN has become quiescent, and that the prevailing GFR depends on the extent to which hypertrophied remnant glomeruli can compensate for the ensuing loss of filtration surface area.

  7. Understanding and Managing Pregnancy in Patients with Lupus

    PubMed Central

    de Jesus, Guilherme Ramires; Mendoza-Pinto, Claudia; de Jesus, Nilson Ramires; dos Santos, Flávia Cunha; Klumb, Evandro Mendes; Carrasco, Mario García; Levy, Roger Abramino

    2015-01-01

    Systemic lupus erythematosus (SLE) is a chronic, multisystemic autoimmune disease that occurs predominantly in women of fertile age. The association of SLE and pregnancy, mainly with active disease and especially with nephritis, has poorer pregnancy outcomes, with increased frequency of preeclampsia, fetal loss, prematurity, growth restriction, and newborns small for gestational age. Therefore, SLE pregnancies are considered high risk condition, should be monitored frequently during pregnancy and delivery should occur in a controlled setting. Pregnancy induces dramatic immune and neuroendocrine changes in the maternal body in order to protect the fetus from immunologic attack and these modifications can be affected by SLE. The risk of flares depends on the level of maternal disease activity in the 6–12 months before conception and is higher in women with repeated flares before conception, in those who discontinue useful medications and in women with active glomerulonephritis at conception. It is a challenge to differentiate lupus nephritis from preeclampsia and, in this context, the angiogenic and antiangiogenic cytokines are promising. Prenatal care of pregnant patients with SLE requires close collaboration between rheumatologist and obstetrician. Planning pregnancy is essential to increase the probability of successful pregnancies. PMID:26246905

  8. [Anticardiolipin antibodies in patients with systemic lupus erythematosus].

    PubMed

    Petrović, R; Petrović, M; Novicić-Sasić, D; Damjanov, N

    1994-01-01

    The aim of the study was to determine the prevalence and to evaluate clinical significance of anticardiolipin antibodies in cohort of 60 patients with systemic lupus erythematosus. The measurement of autoantibodies was carried out by standardized ELISA method using MELISA anticardiolipin IgG and IgM kits (Walker Diagnostics, Cambridgeshire, UK) A positive result indicated a value in GPL or MPL U/ml more than 3 SD above the mean value obtained with control sera of 48 healthy pearsons. IgG isotype alone, and both isotupe of anticardiolipin antibodies were found in 30 percent, in 6,7 percent and in 11,7 percent of patients, respectively. High or medium levels of IgG anticardiolipin antibodies were found in all 6 patients with actual venous or arterial thrombosis, but in only 3 out of 10 patients with history of thromboembolic features. All 6 patients with actual thrombocytopenia and 3 female with recent spontaneus abortion also had elevated levels of the same isotype. Total anticardiolipin antibodies (IgG and IgM) were significantly associated with recent or history of thrombocytopenia. In conclusion, we emphasize the association of IgG anticardiolipin antibodies with recent events of antiphospholipid syndrome in patients with systemic lupus erythematosus. PMID:18173204

  9. Anti-C1q in systemic lupus erythematosus.

    PubMed

    Stojan, G; Petri, M

    2016-07-01

    C1q is the first component of the classical complement pathway. Both clinically validated in-house ELISA assays as well as commercial ELISA kits are used for detection of anti-C1q antibodies. Anti-C1q autoantibodies can be detected in a wide range of autoimmune diseases and are highly sensitive for hypocomplementemic uticarial vasculitis. In SLE, anti-C1q are strongly associated with proliferative lupus nephritis, and their absence carries a negative predictive value for development of lupus nephritis of close to 100%. Anti-C1q in combination with anti-dsDNA and low complement has the strongest serological association with renal involvement. The anti-C1q titers correlate with global disease activity scores in patients with renal involvement, and higher titers seem to precede renal flares. After the successful treatment of a renal flare, anti-C1q has the tendency to decrease or even become undetectable. The main obstacle to the inclusion of anti-C1q in the classification criteria and clinical management of SLE is the lack of standardized laboratory assays. PMID:27252264

  10. Sex Differences in Monocyte Activation in Systemic Lupus Erythematosus (SLE)

    PubMed Central

    Jiang, Wei; Zhang, Lumin; Lang, Ren; Li, Zihai; Gilkeson, Gary

    2014-01-01

    Introduction TLR7/8 and TLR9 signaling pathways have been extensively studied in systemic lupus erythematosus (SLE) as possible mediators of disease. Monocytes are a major source of pro-inflammatory cytokines and are understudied in SLE. In the current project, we investigated sex differences in monocyte activation and its implications in SLE disease pathogenesis. Methods Human blood samples from 27 healthy male controls, 32 healthy female controls, and 25 female patients with SLE matched for age and race were studied. Monocyte activation was tested by flow cytometry and ELISA, including subset proportions, CD14, CD80 and CD86 expression, the percentage of IL-6-producing monocytes, plasma levels of sCD14 and IL-6, and urine levels of creatinine. Results Monocytes were significantly more activated in women compared to men and in patients with SLE compared to controls in vivo. We observed increased proportions of non-classic monocytes, decreased proportions of classic monocytes, elevated levels of plasma sCD14 as well as reduced surface expression of CD14 on monocytes comparing women to men and lupus patients to controls. Plasma levels of IL-6 were positively related to sCD14 and serum creatinine. Conclusion Monocyte activation and TLR4 responsiveness are altered in women compared to men and in patients with SLE compared to controls. These sex differences may allow persistent systemic inflammation and resultant enhanced SLE susceptibility. PMID:25485543

  11. Stress as a predictor of cognitive functioning in lupus.

    PubMed

    Peralta-Ramírez, M I; Coín-Mejías, M A; Jiménez-Alonso, J; Ortego-Centeno, N; Callejas-Rubio, J L; Caracuel-Romero, A; Pérez-García, M

    2006-01-01

    The objective of this study was to investigate the possible effects of the daily stress experienced during a six-month period on the cognitive functioning of patients with systemic lupus erythematosus (SLE). For this purpose, we evaluated the daily stress of 21 patients with lupus every day for six months. Later, we carried out a neuropsychological exam that included an evaluation of attention and memory. At the same time, scores on depression and anxiety were recorded with the objective of controlling other emotional variables that might be influencing these cognitive processes. The results show that daily stress was able to predict the scores on the neuropsychological variables studied. Specifically, the daily stress experienced in the previous six months is the variable with the greatest explanatory-predictive power on the scores for delayed recall visual memory, visual fluency and attention speed. This relationship proved to be negative in all three cases (R2 corr = 0.290; t = -2.712, P < 0.014); (R2 corr = 0.318; t = -2.818, P < 0.012); (R2 corr = 0.319; t = -2.906, P < 0.009), which means that the greater the daily stress, the lower the score on visual memory, fluency and total attention speed. We can state that daily stress is related to impairments in visual memory, fluency and attention in patients with SLE. This effect was not found with other emotional variables, such as depression and anxiety. PMID:17211991

  12. Embolic Stroke as the Initial Manifestation of Systemic Lupus Erythematosus.

    PubMed

    Khan, Reshma M; Namas, Rajaie; Parikh, Sachin; Rubin, Bernard

    2015-01-01

    We present a case of a 21-year-old African-American female with no significant medical history, who presented to the emergency department with a one-week history of blurry and double vision. Ophthalmology evaluation revealed bilateral retinal artery occlusion. Further workup with imaging of the brain was consistent with an ischemic stroke. Hereditary hypercoagulable workup was unremarkable and initial testing for antiphospholipid syndrome was positive. She underwent transesophageal echocardiogram (TEE), which showed severe mitral regurgitation and thickening of mitral valve leaflets consistent with Libman-Sacks endocarditis. Autoimmune workup was positive for IF-ANA, anti-RNP, and anti-Smith antibody. She fulfilled 4/11 of the ACR criteria and met 5 of the SLICC (Systemic Lupus International Collaborating Clinics) criteria for lupus (nonscaring alopecia, thrombocytopenia, positive ANA, and positive anti-Smith and positive anti-phospholipid antibodies). This case highlights the importance of early recognition of underlying connective tissue diseases and timely management of these diseases in young patients with no previous manifestations of diseases. PMID:26266073

  13. Intracranial hypertension: A rare presentation of lupus nephritis

    PubMed Central

    Yadav, Praveen; Nair, Anishkumar; Cherian, Ajith; Sibi, N. S.; Kumar, Ashwini

    2010-01-01

    A 14-year-old male presented with bilateral papilledema, growth retardation and absent secondary sexual characters. He had a past history of fever, headache and fatigue of 6 months duration. The diagnosis of intracranial hypertension (IH) was confirmed by an increased intracranial pressure and normal neuroimaging studies of the brain, except for partial empty sella, prominent perioptic cerebrospinal fluid (CSF) spaces and buckling of optic nerves. Evaluation showed erythrocyte sedimentation rate (ESR) of 150 mm/hr, positive antinuclear antibody (ANA), anti dsDNA and anti ribosomal P protein. Renal biopsy revealed diffuse segmental proliferative lupus nephritis (LN) class IV S (A) confirming the diagnosis of systemic lupus erythematosus (SLE). Treatment of LN with intravenous pulse methyl prednisolone and cyclophosphamide was effective in normalizing the CSF pressure, resulting in express and dramatic resolution of symptomatology. In a case of IH, SLE must be considered. IH, growth retardation and absence of sexual characters may be presenting manifestations of a chronic systemic inflammatory disease like SLE. These manifestations may act as a pointer to associated advanced grades of LN, which can be totally asymptomatic and missed without a renal biopsy. PMID:21559160

  14. Inverse Association of Parkinson Disease With Systemic Lupus Erythematosus

    PubMed Central

    Liu, Feng-Cheng; Huang, Wen-Yen; Lin, Te-Yu; Shen, Chih-Hao; Chou, Yu-Ching; Lin, Cheng-Li; Lin, Kuen-Tze; Kao, Chia-Hung

    2015-01-01

    Abstract The effects of the inflammatory mediators involved in systemic lupus erythematous (SLE) on subsequent Parkinson disease have been reported, but no relevant studies have focused on the association between the 2 diseases. This nationwide population-based study evaluated the risk of Parkinson disease in patients with SLE. We identified 12,817 patients in the Taiwan National Health Insurance database diagnosed with SLE between 2000 and 2010 and compared the incidence rate of Parkinson disease among these patients with that among 51,268 randomly selected age and sex-matched non-SLE patients. A Cox multivariable proportional-hazards model was used to evaluate the risk factors of Parkinson disease in the SLE cohort. We observed an inverse association between a diagnosis of SLE and the risk of subsequent Parkinson disease, with the crude hazard ratio (HR) being 0.60 (95% confidence interval 0.45–0.79) and adjusted HR being 0.68 (95% confidence interval 0.51–0.90). The cumulative incidence of Parkinson disease was 0.83% lower in the SLE cohort than in the non-SLE cohort. The adjusted HR of Parkinson disease decreased as the follow-up duration increased and was decreased among older lupus patients with comorbidity. We determined that patients with SLE had a decreased risk of subsequent Parkinson disease. Further research is required to elucidate the underlying mechanism. PMID:26579824

  15. miRNAs in the Pathogenesis of Systemic Lupus Erythematosus

    PubMed Central

    Qu, Bo; Shen, Nan

    2015-01-01

    MicroRNAs (miRNAs) were first discovered as regulatory RNAs that controlled the timing of the larval development of Caenorhabditis elegans. Since then, nearly 30,000 mature miRNA products have been found in many species, including plants, warms, flies and mammals. Currently, miRNAs are well established as endogenous small (~22 nt) noncoding RNAs, which have functions in regulating mRNA stability and translation. Owing to intensive investigations during the last decade, miRNAs were found to play essential roles in regulating many physiological and pathological processes. Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by elevated autoantibodies against nuclear antigens and excessive inflammatory responses affecting multiple organs. Although efforts were taken and theories were produced to elucidate the pathogenesis of SLE, we still lack sufficient knowledge about the disease for developing effective therapies for lupus patients. Recent advances indicate that miRNAs are involved in the development of SLE, which gives us new insights into the pathogenesis of SLE and might lead to the finding of new therapeutic targets. Here, we will review recent discoveries about how miRNAs are involved in the pathogenesis of SLE and how it can promote the development of new therapy. PMID:25927578

  16. Update on Biologic Therapies for Systemic Lupus Erythematosus.

    PubMed

    Borba, Helena Hiemisch Lobo; Funke, Andreas; Wiens, Astrid; Utiyama, Shirley Ramos da Rosa; Perlin, Cássio Marques; Pontarolo, Roberto

    2016-07-01

    Systemic lupus erythematosus (SLE) is a chronic multisystemic autoimmune disease driven by genetic, hormonal, and environmental factors. Despite the advances in diagnostic and therapeutic approaches in the last decades, SLE still leads to significant morbidity and increased mortality. Although a cure for SLE is still unknown, treatment is required to control acute disease exacerbation episodes (flares), decrease the frequency and severity of subsequent lupus flares, address comorbidities, and prevent end-organ damage. While conventional SLE pharmacotherapy may exhibit suboptimal efficacy and substantial toxicity, a growing knowledge of the disease pathogenesis enabled the research on novel therapeutic agents directed at specific disease-related targets. In this paper, we review the recent progress in the clinical investigation of biologic agents targeting B cells, T cells, cytokines, innate immunity, and other immunologic or inflammatory pathways. Although many investigational agents exhibited insufficient efficacy or inadequate safety in clinical trials, one of them, belimumab, fulfilled the efficacy and safety regulatory requirements and was approved for the treatment of SLE in Europe and the USA, which confirms that, despite all difficulties, advances in this field are possible. PMID:27299782

  17. Chronic intestinal pseudo-obstruction in systemic lupus erythematosus

    PubMed Central

    Perlemuter, G; Chaussade, S; Wechsler, B; Cacoub, P; Dapoigny, M; Kahan, A; Godeau, P; Couturier, D

    1998-01-01

    Background/Aims—Chronic intestinal pseudo-obstruction (CIPO) reflects a dysfunction of the visceral smooth muscle or the enteric nervous system. Gastrointestinal manifestations are common in systemic lupus erythematosus (SLE) but CIPO has not been reported. Features of CIPO are reported in five patients with SLE. 
Methods—From 1988 to 1993, five patients with SLE or SLE-like syndrome were hospitalised for gastrointestinal manometric studies. CIPO was the onset feature in two cases. Antroduodenal manometry (three hours fasting, two hours fed) was performed in all patients, and oesophageal manometry in four. 
Results—Intestinal hypomotility associated with reduced bladder capacity and bilateral ureteral distension was found in four patients and aperistalsis of the oesophagus in three. Treatment, which consisted of high dose corticosteroids, parenteral nutrition, promotility agents, and antibiotics, led to remission of both CIPO and urinary abnormalities in all cases. Antroduodenal manometry performed in two patients after remission showed increased intestinal motility. One patient died, and postmortem examination showed intestinal vasculitis. 
Conclusions—CIPO in SLE is a life threatening situation that can be reversed by treatment. It may be: (a) a complication or onset feature of the disease; (b) secondary to smooth muscle involvement; (c) associated with ureteral and vesical involvement; (d) the result of intestinal vasculitis. 

 Keywords: chronic intestinal pseudo-obstruction; systemic lupus erythematosus PMID:9771415

  18. Being a victim or an aggressor: Different functions of triadic post-conflict interactions in wolves (Canis lupus lupus).

    PubMed

    Cordoni, Giada; Palagi, Elisabetta

    2015-01-01

    Animals adopt different behavioral strategies to cope with the conflict of interests coming from the competition over limited resources. Starting from the study on chimpanzees, post-conflict third-party affiliation (the affiliative contact provided by a third-party toward the victim--VTA--or the aggressor--ATA) was investigated mainly in primates. Later, this post-conflict mechanism has been demonstrated also in other mammals, such as wallabies, horses, dolphins, domestic dogs, and wolves. Here, we present data on triadic post-conflict affiliation in wolves (Canis lupus lupus) by exploring some of the hypotheses already proposed for primates and never tested before in other social mammals. In this carnivore species, the study of VTA and ATA revealed that these strategies cannot be considered as a unique behavioral category since they differ in many functional aspects. VTA serves to protect the victim by reducing the likelihood of reiterated attacks from the previous aggressor and to reinforce the relationship shared by the third-party and the victim. On the other hand, ATA has a role in bystander protection by limiting the renewed attacks of the previous aggressor toward uninvolved group-members (potential third-parties). In conclusion, exploring VTA and ATA gives the opportunity to concurrently demonstrate some functional differences in triadic post-conflict affiliation according to the different targets of bystanders (victims or aggressors). The data comparison between primates and other social mammals should permit to open new lines of research. PMID:25894742

  19. A Rare Presentation of Lupus Nephritis Flare up with Posterior Reversible Leucoencephalopathy.

    PubMed

    Mani, S Hima; Shivaprasad, S M; Umesh, L

    2016-01-01

    Systemic lupus erythematosus (SLE) is associated with various neurologic or psychiatric abnormalities and Posterior Reversible Leuco Encephalopathy Syndrome (PRES) is very rare neurological manifestation in SLE. PRES is associated with various clinical manifestations, like, seizures, visual loss, headaches, vomiting altered mental status and rarely focal neurological deficits. Other predisposing condition associated with PRES is eclampsia, accelerated hypertension, uraemia, transplantation, autoimmune diseases and/or use of immunosuppressive drugs. It is important to recognise PRES since it is a potentially reversible. We describe an unusual case of PRES caused by uraemia during lupus flare up in a patient with biopsy proven class IV lupus nephritis who presented with features of asymmetrical quadriparesis which completely reversed after haemodialysis sessions and treating lupus flare up. In our case she presented with quadriparesis which is a rare presentation and hypertensive encephalopathy was not present. PMID:26894110

  20. CNS vasculitis and stroke in neonatal lupus erythematosus: a case report and review of literature.

    PubMed

    Saini, Arushi G; Sankhyan, Naveen; Bhattad, Sagar; Vyas, Sameer; Saikia, Biman; Singhi, Pratibha

    2014-05-01

    Neonatal lupus erythematosus refers to the clinical spectrum of cardiac, cutaneous and other systemic abnormalities in neonates born to mothers with autoantibodies against Ro/SSA and La/SSB antigens. Isolated central nervous system involvement is very rare and has been described as transient vasculopathy only. We describe a 2-months-old girl who presented with acute ischemic stroke secondary to central nervous system vasculitis without any cardiac, cutaneous or hematological manifestations. The mother was pauci-symptomatic with raised anti-Ro autoantibody titers; the baby was positive for autoantibodies against Ro-antigen. Angiography confirmed vasculitis in cerebral vasculature. Our case highlights that neonatal lupus erythematosus can present with isolated nervous system manifestations and the vascular damage can be permanent in the form of vasculitis. Early recognition will help pediatricians identify such possible permanent complications in newborns with neonatal lupus erythematosus. A review of previously reported central nervous system manifestations of neonatal lupus is also presented. PMID:24508360