Science.gov

Sample records for magna molecular fingerprints

  1. Molecular impact of juvenile hormone agonists on neonatal Daphnia magna.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Miyakawa, Hitoshi; Yatsu, Ryohei; Mizutani, Takeshi; Ogino, Yukiko; Miyagawa, Shinichi; Watanabe, Hajime; Nishide, Hiroyo; Uchiyama, Ikuo; Tatarazako, Norihisa; Iguchi, Taisen

    2014-05-01

    Daphnia magna has been used extensively to evaluate organism- and population-level responses to pollutants in acute toxicity and reproductive toxicity tests. We have previously reported that exposure to juvenile hormone (JH) agonists results in a reduction of reproductive function and production of male offspring in a cyclic parthenogenesis, D. magna. Recent advances in molecular techniques have provided tools to understand better the responses to pollutants in aquatic organisms, including D. magna. DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to JH agonists: methoprene (125, 250 and 500 ppb), fenoxycarb (0.5, 1 and 2 ppb) and epofenonane (50, 100 and 200 ppb). Exposure to these JH analogs resulted in chemical-specific patterns of gene expression. The heat map analyses based on hierarchical clustering revealed a similar pattern between treatments with a high dose of methoprene and with epofenonane. In contrast, treatment with low to middle doses of methoprene resulted in similar profiles to fenoxycarb treatments. Hemoglobin and JH epoxide hydrolase genes were clustered as JH-responsive genes. These data suggest that fenoxycarb has high activity as a JH agonist, methoprene shows high toxicity and epofenonane works through a different mechanism compared with other JH analogs, agreeing with data of previously reported toxicity tests. In conclusion, D. magna DNA microarray is useful for the classification of JH analogs and identification of JH-responsive genes. PMID:24038158

  2. Molecular fingerprints of environmental carcinogens in human cancer.

    PubMed

    Ceccaroli, C; Pulliero, A; Geretto, M; Izzotti, A

    2015-01-01

    Identification of specific molecular changes (fingerprints) is important to identify cancer etiology. Exploitable biomarkers are related to DNA, epigenetics, and proteins. DNA adducts are the turning point between environmental exposures and biological damage. DNA mutational fingerprints are induced by carcinogens in tumor suppressor and oncogenes. In an epigenetic domain, methylation changes occurs in specific genes for arsenic, benzene, chromium, and cigarette smoke. Alteration of specific microRNA has been reported for environmental carcinogens. Benzo(a)pyrene, cadmium, coal, and wood dust hits specific heat-shock proteins and metalloproteases. The multiple analysis of these biomarkers provides information on the carcinogenic mechanisms activated by exposure to environmental carcinogens. PMID:26023758

  3. Pulmonary embolization of immature Fascioloides magna causing fatal hemothorax confirmed by molecular technique in a heifer in the United States.

    PubMed

    Lee, Jung Keun; Rosser, Thomas Graham; Cooley, Jim

    2016-09-01

    The current report describes the use of a molecular technique to identify immature Fascioloides magna An 18-month-old Brangus heifer was found dead in the field without any prior clinical signs. The cause of death was exsanguination into the thoracic cavity associated with pulmonary embolization and infection by immature Fascioloides magna resulting in 2 large foci of pulmonary necrosis and focal arteriolar and lung rupture. The liver had a few random migratory tracts with typical iron and porphyrin fluke exhaust, but no identified fluke larvae. A single immature fluke was found in the lungs, and species level identification as F. magna was confirmed by DNA sequence analysis of the ribosomal internal transcribed spacer regions (ITS1 region, 5.8S rRNA gene, and ITS2) and of partial 28S rRNA gene sequence. This is one of only a few pulmonary fascioloidiasis cases associated with hemothorax in the veterinary literature. PMID:27423736

  4. Fingerprinting Electronic Molecular Complexes in Liquid

    PubMed Central

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules. PMID:26743542

  5. Fingerprinting Electronic Molecular Complexes in Liquid

    NASA Astrophysics Data System (ADS)

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules.

  6. Fingerprinting Electronic Molecular Complexes in Liquid.

    PubMed

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules. PMID:26743542

  7. Systems biology meets stress ecology: linking molecular and organismal stress responses in Daphnia magna

    PubMed Central

    Heckmann, Lars-Henrik; Sibly, Richard M; Connon, Richard; Hooper, Helen L; Hutchinson, Thomas H; Maund, Steve J; Hill, Christopher J; Bouetard, Anthony; Callaghan, Amanda

    2008-01-01

    Background Ibuprofen and other nonsteroidal anti-inflammatory drugs have been designed to interrupt eicosanoid metabolism in mammals, but little is known of how they affect nontarget organisms. Here we report a systems biology study that simultaneously describes the transcriptomic and phenotypic stress responses of the model crustacean Daphnia magna after exposure to ibuprofen. Results Our findings reveal intriguing similarities in the mode of action of ibuprofen between vertebrates and invertebrates, and they suggest that ibuprofen has a targeted impact on reproduction at the molecular, organismal, and population level in daphnids. Microarray expression and temporal real-time quantitative PCR profiles of key genes suggest early ibuprofen interruption of crustacean eicosanoid metabolism, which appears to disrupt signal transduction affecting juvenile hormone metabolism and oogenesis. Conclusion Combining molecular and organismal stress responses provides a guide to possible chronic consequences of environmental stress for population health. This could improve current environmental risk assessment by providing an early indication of the need for higher tier testing. Our study demonstrates the advantages of a systems approach to stress ecology, in which Daphnia will probably play a major role. PMID:18291039

  8. Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting

    PubMed Central

    Khan, Tarik A.; Friedensohn, Simon; de Vries, Arthur R. Gorter; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T.

    2016-01-01

    High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion—the intraclonal diversity index—which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

  9. Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting.

    PubMed

    Khan, Tarik A; Friedensohn, Simon; Gorter de Vries, Arthur R; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T

    2016-03-01

    High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion-the intraclonal diversity index-which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

  10. Linguini Models of Molecular Genetic Mapping and Fingerprinting.

    ERIC Educational Resources Information Center

    Thompson, James N., Jr.; Gray, Stanton B.; Hellack, Jenna J.

    1997-01-01

    Presents an exercise using linguini noodles to demonstrate an aspect of DNA fingerprinting. DNA maps that show genetic differences can be produced by digesting a certain piece of DNA with two or more restriction enzymes both individually and in combination. By rearranging and matching linguini fragments, students can recreate the original pattern…

  11. Telopathes magna gen. nov., spec. nov. (Cnidaria: Anthozoa: Antipatharia: Schizopathidae) from deep waters off Atlantic Canada and the first molecular phylogeny of the deep-sea family Schizopathidae.

    PubMed

    Macisaac, K G; Best, M; Brugler, M R; Kenchington, E L R; Anstey, L J; Jordan, T

    2013-01-01

    A new genus and species of deep-sea antipatharian, Telopathes magna gen. nov., spec. nov., is described from the western North Atlantic off the coast of Canada. Five additional paratypes, consisting ofjuvenile to adult forms, are reported from the New England and Corner Rise Seamounts (NW Atlantic). Preliminary sequencing of a subsection of the nuclear ribosomal cistron confirmed the phylogenetic affinity of T. magna to the order Antipatharia, and in particular the family Schizopathidae. Subsequent sequencing of three mitochondrial DNA segments from nine of the 11 currently-recognized genera within the Schizopathidae revealed a well-supported phylogenetic relationship between T. magna and Stauropathes. This is the first study to use molecular techniques to elucidate the evolutionary relationships of the Schizopathidae, a family of black corals almost exclusively found in the deep sea (depths > 200 m). Telopathes is distinguished from other genera within the family Schizopathidae by its largely pinnulated stalk, sparse branching pattern to the second degree that is not restricted to a single plane, two anterolateral rows of long, simple primary pinnules, arranged alternately to sub-opposite, and colony with an adhesive base. This record of T. magna brings the total number of nominal species of Antipatharia reported to occur off eastern Canada to 12 and represents the third new genus added to the Schizopathidae since a critical review of the family by Dennis Opresko in 2002. PMID:26106725

  12. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  13. [The problem of molecular-genetic identification of sweat and grease deposits in the human fingerprints].

    PubMed

    Faleeva, T G; Ivanov, I N; Mishin, E S; Vnukova, N V; Kornienko, I V

    2016-01-01

    The objective of the present experimental molecular-genetic study of DNA contained in of human fingerprints was to establish the relationship between the reference genetic profiles and the genotypes of the individuals leaving their fingerprints on a smooth metal object. The biological material for the purpose of the investigation was sampled at different time intervals. The were taken using a scotch tape and used to obtain the complete genetic profile immediately after the fingerprints had been left as well as within the next 24 hours and one week. It proved impossible to identify the complete genetic profile one month after the fingerprints had been left. The alleles not typical for reference samples were identified within one week after swabbing the material from the metal surface. The results of the sudy can be explained by the decrease of the concentration of the initial DNA-matrix in the samples due to its degradation in the course of time. It is concluded that the parallel genetic analysis is needed if reliable evidence of identity of the profiles of interest or its absence is to be obtained. PMID:27070033

  14. Exhaled Molecular Fingerprinting in Diagnosis and Monitoring: Validating Volatile Promises.

    PubMed

    Boots, Agnes W; Bos, Lieuwe D; van der Schee, Marc P; van Schooten, Frederik-Jan; Sterk, Peter J

    2015-10-01

    Medical diagnosis and phenotyping increasingly incorporate information from complex biological samples. This has promoted the development and clinical application of non-invasive metabolomics in exhaled air (breathomics). In respiratory medicine, expired volatile organic compounds (VOCs) are associated with inflammatory, oxidative, microbial, and neoplastic processes. After recent proof of concept studies demonstrating moderate to good diagnostic accuracies, the latest efforts in breathomics are focused on optimization of sensor technologies and analytical algorithms, as well as on independent validation of clinical classification and prediction. Current research strategies are revealing the underlying pathophysiological pathways as well as clinically-acceptable levels of diagnostic accuracy. Implementing recent guidelines on validating molecular signatures in medicine will enhance the clinical potential of breathomics and the development of point-of-care technologies. PMID:26432020

  15. Exploring molecular fingerprints of selective PPARδ agonists through comparative and validated chemometric techniques.

    PubMed

    Nandy, A; Roy, K; Saha, A

    2015-01-01

    Peroxysome proliferator-activated receptors (PPARs) have grown greatly in importance due to their role in the metabolic profile. Among three subtypes (α, γ and δ), we here consider the least investigated δ subtype to explore the molecular fingerprints of selective PPARδ agonists. Validated QSAR models (regression based 2D-QSAR, HQSAR and KPLS) and molecular docking with dynamics analyses support the inference of classification-based Bayesian and recursive models. Chemometric studies indicate that the presence of ether linkages and heterocyclic rings has optimum influence in imparting selective bioactivity. Pharmacophore models and docking with molecular dynamics analyses postulate the occurrence of aromatic rings, HB acceptor and a hydrophobic region as crucial molecular fragments for development of PPARδ modulators. Multi-chemometric studies suggest the essential structural requirements of a molecule for imparting potent and selective PPARδ modulation. PMID:25986170

  16. Endoscopic Raman Spectroscopy for Molecular Fingerprinting of Gastric Cancer: Principle to Implementation

    PubMed Central

    2015-01-01

    Currently, positive endoscopic biopsy is the standard criterion for gastric cancer diagnosis but is invasive, often inconsistent, and delayed although early detection and early treatment is the most important policy. Raman spectroscopy is a spectroscopic technique based on inelastic scattering of monochromatic light. Raman spectrum represents molecular composition of the interrogated volume providing a direct molecular fingerprint. Several investigations revealed that Raman spectroscopy can differentiate normal, dysplastic, and adenocarcinoma gastric tissue with high sensitivity and specificity. Moreover, this technique can indentify malignant ulcer and showed the capability to analyze the carcinogenesis process. Automated on-line Raman spectral diagnostic system raised possibility to use Raman spectroscopy in clinical field. Raman spectroscopy can be applied in many fields such as guiding a target biopsy, optical biopsy in bleeding prone situation, and delineating the margin of the lesion. With wide field technology, Raman spectroscopy is expected to have specific role in our future clinical field. PMID:26106612

  17. De novo design of caseinolytic protein proteases inhibitors based on pharmacophore and 2D molecular fingerprints.

    PubMed

    Wu, Guanzhong; Zhang, Zhen; Chen, Hong; Lin, Kejiang

    2015-06-01

    Caseinolytic protein proteases (ClpP) are large oligomeric protein complexes that contribute to cell homeostasis as well as virulence regulation in bacteria. Inhibitors of ClpP can significantly attenuate the capability to produce virulence factors of the bacteria. In this work, we developed a workflow to expand the chemical space of potential ClpP inhibitors based on a set of β-lactones. In our workflow, an artificial pharmacophore model was generated based on HipHop and HYPOGEN method. A de novo compound library based on molecular fingerprints was constructed and virtually screened by the pharmacophore model. The results were further investigated by molecular docking study. The workflow successfully achieved potential ClpP inhibitors. It could be applied to design more novel potential ClpP inhibitors and provide theoretical basis for the further optimization of the hit compounds. PMID:25937012

  18. Quantitative Molecular Assay for Fingerprinting Microbial Communities of Wastewater and Estrogen-Degrading Consortia

    PubMed Central

    Yu, Chang-Ping; Ahuja, Rajiv; Sayler, Gary; Chu, Kung-Hui

    2005-01-01

    A quantitative fingerprinting method, called the real-time terminal restriction fragment length polymorphism (real-time-t-RFLP) assay, was developed for simultaneous determination of microbial diversity and abundance within a complex community. The real-time-t-RFLP assay was developed by incorporating the quantitative feature of real-time PCR and the fingerprinting feature of t-RFLP analysis. The assay was validated by using a model microbial community containing three pure strains, an Escherichia coli strain (gram negative), a Pseudomonas fluorescens strain (gram negative), and a Bacillus thuringiensis strain (gram positive). Subsequently, the real-time-t-RFLP assay was applied to and proven to be useful for environmental samples; the richness and abundance of species in microbial communities (expressed as the number of 16S rRNA gene copies of each ribotype per milliliter) of wastewater and estrogen-degrading consortia (enriched with 17α-estradiol, 17β-estradiol, or estrone) were successfully characterized. The results of this study strongly suggested that the real-time-t-RFLP assay can be a powerful molecular tool for gaining insight into microbial communities in various engineered systems and natural habitats. PMID:15746346

  19. Rotation commensurate echo of asymmetric molecules—Molecular fingerprints in the time domain

    NASA Astrophysics Data System (ADS)

    Chesnokov, E. N.; Kubarev, V. V.; Koshlyakov, P. V.

    2014-12-01

    Using the pulses of terahertz free electron laser and ultra-fast Schottky diode detectors, we observed the coherent transients within a free induction decay of gaseous nitrogen dioxide NO2. The laser excited different sub-bands of rotation spectra of NO2 containing about 50-70 lines. The free induction signal continued more than 30 ns and consisted of many echo-like bursts duration about 0.2 ns. Unlike the similar effect observed previously for linear and symmetric top molecules, the sequence of echo bursts is not periodic. The values for delay of individual echo are stable, and the set of these delays can be considered as a "molecular fingerprint" in the time domain.

  20. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope.

    PubMed

    Burgess, Jacob A J; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-01-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface. PMID:26359203

  1. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    NASA Astrophysics Data System (ADS)

    Burgess, Jacob A. J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-09-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

  2. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    PubMed Central

    Burgess, Jacob A.J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-01-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface. PMID:26359203

  3. Exploring the vibrational fingerprint of the electronic excitation energy via molecular dynamics

    SciTech Connect

    Deyne, Andy Van Yperen-De; Pauwels, Ewald; Ghysels, An; Waroquier, Michel; Van Speybroeck, Veronique; Hemelsoet, Karen; De Meyer, Thierry; De Clerck, Karen

    2014-04-07

    A Fourier-based method is presented to relate changes of the molecular structure during a molecular dynamics simulation with fluctuations in the electronic excitation energy. The method implies sampling of the ground state potential energy surface. Subsequently, the power spectrum of the velocities is compared with the power spectrum of the excitation energy computed using time-dependent density functional theory. Peaks in both spectra are compared, and motions exhibiting a linear or quadratic behavior can be distinguished. The quadratically active motions are mainly responsible for the changes in the excitation energy and hence cause shifts between the dynamic and static values of the spectral property. Moreover, information about the potential energy surface of various excited states can be obtained. The procedure is illustrated with three case studies. The first electronic excitation is explored in detail and dominant vibrational motions responsible for changes in the excitation energy are identified for ethylene, biphenyl, and hexamethylbenzene. The proposed method is also extended to other low-energy excitations. Finally, the vibrational fingerprint of the excitation energy of a more complex molecule, in particular the azo dye ethyl orange in a water environment, is analyzed.

  4. Evaluation of the Orbitrap Mass Spectrometer for the Molecular Fingerprinting Analysis of Natural Dissolved Organic Matter.

    PubMed

    Hawkes, Jeffrey A; Dittmar, Thorsten; Patriarca, Claudia; Tranvik, Lars; Bergquist, Jonas

    2016-08-01

    We investigated the application of the LTQ-Orbitrap mass spectrometer (LTQ-Velos Pro, Thermo Fisher) for resolving complex mixtures of natural aquatic dissolved organic matter (DOM) and compared this technique to the more established state-of-the-art technique, Fourier transform ion cyclotron resonance mass spectrometry (FTICR-MS, Bruker Daltonics), in terms of the distribution of molecular masses detected and the reproducibility of the results collected. The Orbitrap was capable of excellent reproducibility: Bray-Curtis dissimilarity between duplicate measurements was 2.85 ± 0.42% (mean ± standard deviation). The Orbitrap was also capable of the detection of most major ionizable organic molecules in typical aquatic mixtures, with the exception of most sulfur and phosphorus containing masses. This result signifies that the Orbitrap is an appropriate technique for the investigation of very subtle biogeochemical processing of bulk DOM. The lower costs (purchase and maintenance) and wider availability of Orbitrap mass spectrometers in university departments means that the tools necessary for research into DOM processing at the molecular level should be accessible to a much wider group of scientists than before. The main disadvantage of the technique is that substantially fewer molecular formulas can be resolved from a complex mixture (roughly one third as many), meaning some loss of information. In balance, most biogeochemical studies that aim at molecularly fingerprinting the source of natural DOM could be satisfactorily carried out with Orbitrap mass spectrometry. For more targeted metabolomic studies where individual compounds are traced through natural systems, FTICR-MS remains advantageous. PMID:27400998

  5. Highland cattle and Radix labiata, the hosts of Fascioloides magna

    PubMed Central

    2014-01-01

    Background Fascioloides magna is a pathogenic fluke introduced to Europe ca 140 years ago. As it is spreading over the continent, new intermediate and definitive hosts might be involved in transmission of the parasite. In Europe, several studies reported potential new intermediate snail hosts (Radix spp.) for F. magna, and also several cases of fascioloidosis of wild and domestic animals were published. However, the data based on molecular and histological analyses confirming these findings remained unreported. This study aims to refer to unique findings of F. magna in European snails and domestic animals (the first observation in the Czech Republic in the last 30 years) and demonstrate the use of molecular techniques in determination of F. magna. Results Two snails of R. labiata naturally infected with F. magna were found; mature cercariae and daughter rediae were observed. Maturity of cercariae was checked by histological methods, however, their ability to encyst was not confirmed. Co-infection of F. magna and Fasciola hepatica in the liver of two highland cattle bulls was proved. Adult fasciolid flukes producing eggs were found in the liver pseudocysts (F. magna) and the bile ducts (F. hepatica). Identification of intermediate hosts, intramolluscan stages, adult flukes and eggs was performed by sequencing the ITS2 region. Connection of F. magna pseudocysts with the gut (via the bile ducts) was not confirmed by means of histological and coprological examinations. Conclusions For the first time, Radix labiata was confirmed as the snail host for F. magna under natural conditions and, together with the finding of F. magna infection in cattle, we can expect further transmission of F. magna from wildlife to livestock in localities shared by these hosts. PMID:24517409

  6. Molecular fingerprinting reflects different histotypes and brain region in low grade gliomas

    PubMed Central

    2013-01-01

    Background Paediatric low-grade gliomas (LGGs) encompass a heterogeneous set of tumours of different histologies, site of lesion, age and gender distribution, growth potential, morphological features, tendency to progression and clinical course. Among LGGs, Pilocytic astrocytomas (PAs) are the most common central nervous system (CNS) tumours in children. They are typically well-circumscribed, classified as grade I by the World Health Organization (WHO), but recurrence or progressive disease occurs in about 10-20% of cases. Despite radiological and neuropathological features deemed as classic are acknowledged, PA may present a bewildering variety of microscopic features. Indeed, tumours containing both neoplastic ganglion and astrocytic cells occur at a lower frequency. Methods Gene expression profiling on 40 primary LGGs including PAs and mixed glial-neuronal tumours comprising gangliogliomas (GG) and desmoplastic infantile gangliogliomas (DIG) using Affymetrix array platform was performed. A biologically validated machine learning workflow for the identification of microarray-based gene signatures was devised. The method is based on a sparsity inducing regularization algorithm l1l2 that selects relevant variables and takes into account their correlation. The most significant genetic signatures emerging from gene-chip analysis were confirmed and validated by qPCR. Results We identified an expression signature composed by a biologically validated list of 15 genes, able to distinguish infratentorial from supratentorial LGGs. In addition, a specific molecular fingerprinting distinguishes the supratentorial PAs from those originating in the posterior fossa. Lastly, within supratentorial tumours, we also identified a gene expression pattern composed by neurogenesis, cell motility and cell growth genes which dichotomize mixed glial-neuronal tumours versus PAs. Our results reinforce previous observations about aberrant activation of the mitogen-activated protein kinase

  7. Predicting Molecular Targets for Small-Molecule Drugs with a Ligand-Based Interaction Fingerprint Approach.

    PubMed

    Cao, Ran; Wang, Yanli

    2016-06-20

    The computational prediction of molecular targets for small-molecule drugs remains a great challenge. Herein we describe a ligand-based interaction fingerprint (LIFt) approach for target prediction. Together with physics-based docking and sampling methods, we assessed the performance systematically by modeling the polypharmacology of 12 kinase inhibitors in three stages. First, we examined the capacity of this approach to differentiate true targets from false targets with the promiscuous binder staurosporine, based on native complex structures. Second, we performed large-scale profiling of kinase selectivity on the clinical drug sunitinib by means of computational simulation. Third, we extended the study beyond kinases by modeling the cross-inhibition of bromodomain-containing protein 4 (BRD4) for 10 well-established kinase inhibitors. On this basis, we made prospective predictions by exploring new kinase targets for the anticancer drug candidate TN-16, originally known as a colchicine site binder and microtubule disruptor. As a result, p38α was highlighted from a panel of 187 different kinases. Encouragingly, our prediction was validated by an in vitro kinase assay, which showed TN-16 as a low-micromolar p38α inhibitor. Collectively, our results suggest the promise of the LIFt approach in predicting potential targets for small-molecule drugs. PMID:26222196

  8. Molecular fingerprinting with the resolved modes of a femtosecond laser frequency comb.

    PubMed

    Diddams, Scott A; Hollberg, Leo; Mbele, Vela

    2007-02-01

    The control of the broadband frequency comb emitted from a mode-locked femtosecond laser has permitted a wide range of scientific and technological advances--ranging from the counting of optical cycles for next-generation atomic clocks to measurements of phase-sensitive high-field processes. A unique advantage of the stabilized frequency comb is that it provides, in a single laser beam, about a million optical modes with very narrow linewidths and absolute frequency positions known to better than one part in 10(15) (ref. 5). One important application of this vast array of highly coherent optical fields is precision spectroscopy, in which a large number of modes can be used to map internal atomic energy structure and dynamics. However, an efficient means of simultaneously identifying, addressing and measuring the amplitude or relative phase of individual modes has not existed. Here we use a high-resolution disperser to separate the individual modes of a stabilized frequency comb into a two-dimensional array in the image plane of the spectrometer. We illustrate the power of this technique for high-resolution spectral fingerprinting of molecular iodine vapour, acquiring in a few milliseconds absorption images covering over 6 THz of bandwidth with high frequency resolution. Our technique for direct and parallel accessing of stabilized frequency comb modes could find application in high-bandwidth spread-spectrum communications with increased security, high-resolution coherent quantum control, and arbitrary optical waveform synthesis with control at the optical radian level. PMID:17287805

  9. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  10. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  11. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering.

    PubMed

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3'-diethylthiatricarbocyanine iodide] and DTDC [3,3'-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist. PMID:26730189

  12. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering

    PubMed Central

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3′-diethylthiatricarbocyanine iodide] and DTDC [3,3′-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist. PMID:26730189

  13. Virtual fragment screening: discovery of histamine H3 receptor ligands using ligand-based and protein-based molecular fingerprints.

    PubMed

    Sirci, Francesco; Istyastono, Enade P; Vischer, Henry F; Kooistra, Albert J; Nijmeijer, Saskia; Kuijer, Martien; Wijtmans, Maikel; Mannhold, Raimund; Leurs, Rob; de Esch, Iwan J P; de Graaf, Chris

    2012-12-21

    Virtual fragment screening (VFS) is a promising new method that uses computer models to identify small, fragment-like biologically active molecules as useful starting points for fragment-based drug discovery (FBDD). Training sets of true active and inactive fragment-like molecules to construct and validate target customized VFS methods are however lacking. We have for the first time explored the possibilities and challenges of VFS using molecular fingerprints derived from a unique set of fragment affinity data for the histamine H(3) receptor (H(3)R), a pharmaceutically relevant G protein-coupled receptor (GPCR). Optimized FLAP (Fingerprints of Ligands and Proteins) models containing essential molecular interaction fields that discriminate known H(3)R binders from inactive molecules were successfully used for the identification of new H(3)R ligands. Prospective virtual screening of 156,090 molecules yielded a high hit rate of 62% (18 of the 29 tested) experimentally confirmed novel fragment-like H(3)R ligands that offer new potential starting points for the design of H(3)R targeting drugs. The first construction and application of customized FLAP models for the discovery of fragment-like biologically active molecules demonstrates that VFS is an efficient way to explore protein-fragment interaction space in silico. PMID:23140085

  14. Molecular Fingerprint-based Artificial Neural Networks QSAR for Ligand Biological Activity Predictions

    PubMed Central

    Myint, Kyaw-Zeyar; Wang, Lirong; Tong, Qin; Xie, Xiang-Qun

    2012-01-01

    In this manuscript, we have reported a novel 2D fingerprint-based artificial neural network QSAR (FANN-QSAR) method in order to effectively predict biological activities of structurally diverse chemical ligands. Three different types of fingerprints, namely ECFP6, FP2 and MACCS, were used in FANN-QSAR algorithm development, and FANN-QSAR models were compared to known 3D and 2D QSAR methods using five data sets previously reported. In addition, the derived models were used to predict GPCR cannabinoid ligand binding affinities using our manually curated cannabinoid ligand database containing 1699 structurally diverse compounds with reported cannabinoid receptor subtype CB2 activities. To demonstrate its useful applications, the established FANN-QSAR algorithm was used as a virtual screening tool to search a large NCI compound database for lead cannabinoid compounds and we have discovered several compounds with good CB2 binding affinities ranging from 6.70 nM to 3.75 μM. To the best of our knowledge, this is the first report for a fingerprint-based neural network approach validated with a successful virtual screening application in identifying lead compounds. The studies proved that the FANN-QSAR method is a useful approach to predict bioactivities or properties of ligands and to find novel lead compounds for drug discovery research. PMID:22937990

  15. Comparison of molecular species identification for North Sea calanoid copepods (Crustacea) using proteome fingerprints and DNA sequences.

    PubMed

    Laakmann, S; Gerdts, G; Erler, R; Knebelsberger, T; Martínez Arbizu, P; Raupach, M J

    2013-09-01

    Calanoid copepods play an important role in the pelagic ecosystem making them subject to various taxonomic and ecological studies, as well as indicators for detecting changes in the marine habitat. For all these investigations, valid identification, mainly of sibling and cryptic species as well as early life history stages, represents a central issue. In this study, we compare species identification methods for pelagic calanoid copepod species from the North Sea and adjacent regions in a total of 333 specimens. Morphologically identified specimens were analysed on the basis of nucleotide sequences (i.e. partial mitochondrial cytochrome c oxidase subunit I (COI) and complete 18S rDNA) and on proteome fingerprints using the technology of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). On all three molecular approaches, all specimens were classified to species level indicated by low intraspecific and high interspecific variability. Sequence divergences in both markers revealed a second Pseudocalanus species for the southern North Sea identified as Pseudocalanus moultoni by COI sequence comparisons to GenBank. Proteome fingerprints were valid for species clusters irrespective of high intraspecific variability, including significant differences between early developmental stages and adults. There was no effect of sampling region or time; thus, trophic effect, when analysing the whole organisms, was observed in species-specific protein mass spectra, underlining the power of this tool in the application on metazoan species identification. Because of less sample preparation steps, we recommend proteomic fingerprinting using the MALDI-TOF MS as an alternative or supplementary approach for rapid, cost-effective species identification. PMID:23848968

  16. Spatio-temporal variability of the molecular fingerprint of soil dissolved organic matter in a headwater agricultural catchment

    NASA Astrophysics Data System (ADS)

    Jeanneau, Laurent; Pierson-Wickmann, Anne-Catherine; Jaffrezic, Anne; Lambert, Thibault; Gruau, Gérard

    2013-04-01

    Dissolved organic matter (DOM) is implied in (i) ecosystem services such as the support of biodiversity, (ii) the alteration of the drinkable water quality by formation of trihalomethane and (iii) the transfer of micropollutants from soils to rivers. Moreover, since DOM connects soils and oceans that are interacting with the atmosphere, understanding its biogeochemistry will help in investigating the carbon cycle and in creating strategies to mitigate climate change. DOM in headwater stream ecosystems is mainly inherited from allochtonous inputs with different reservoirs being mobilized during storm and interstorm events at the scale of an hydrological year. Those changes in DOM reservoirs, if accompanied by composition and reactivity changes, may impact DOM ecosystem services and drinking water production processes. Elucidating the compositional changes due to changes in the source of DOM in rivers has thus become a important axis of DOM research. The aim of this study is to test the ability of the molecular tools of the organic geochemistry and more specifically the combination of thermochemiolysis and gas chromatography - mass spectrometry (THM-GC-MS) to (i) link the variability of the river DOM composition to different DOM reservoirs in catchment soils and (ii) provide hypothesis on the nature and the mechanisms of formation (microbial growth, litter decomposition) of those reservoirs. This analytical method seems particularly adapted since it allows the differentiation between vegetal and microbial inputs and the determination of the extent of the biodegradation process of biomolecules such as lignin. To test this method, the molecular fingerprint of soil DOM has been investigated in the wetland area of a small (500 ha) agricultural catchment (the so-called Kervidy-Naizin catchment) located in Brittany, western France. The soil DOM was sampled fortnightly at three depths using zero-tension lysimeters during the hydrological year 2010-2011. The samples were

  17. Molecular evolution of epizootic hemorrhagic disease viruses in North America based on historical isolates using motif fingerprints.

    PubMed

    Wilson, W C; Ruder, M G; Jasperson, D; Smith, T P L; Naraghi-Arani, P; Lenhoff, R; Stallknecht, D E; Valdivia-Granda, W A; Sheoran, D

    2016-08-01

    Epizootic hemorrhagic disease virus (EHDV) is an orbivirus of the Reoviridae family that has significant impact on wild and captive white-tailed deer. Although closely related to bluetongue virus that can cause disease in sheep and cattle, North American EHDV historically has not been associated with disease in cattle or sheep. Severe disease in cattle has been reported with other EHDV strains from East Asia and the Middle East. To understand the potential role of viral genetics in the epidemiology of epizootic hemorrhagic disease, a molecular characterization of North American EHDV strains from 1955 to 2012 was conducted via conventional phylogenetic analysis and a new classification approach using motif fingerprint patterns. Overall, this study indicates that the genetic make-up of EHDV populations in North America have slowly evolved over time. The data also suggested limited reassortment events between serotypes 1 and 2 and introduces a new analysis tool for more detailed sequence pattern analysis. PMID:27107856

  18. Morphological and molecular observations on the status of Crassicauda magna, a parasite of the subcutaneous tissues of the pygmy sperm whale, with a re-evaluation of the systematic relationships of the genus Crassicauda.

    PubMed

    Jabbar, Abdul; Beveridge, Ian; Bryant, Malcolm S

    2015-03-01

    Members of the genus Crassicauda (Nematoda: Spirurida) are parasites of the body tissues of whales and dolphins. Owing to the large size of worms and difficulties in the recovery of entire nematodes from the tissues of hosts, limited information is available on morphological descriptions of both male and female worms. Furthermore, there are currently no available sequence data for this genus to assist with such identifications. This paper describes for the first time features of the anterior extremity and the male tail of Crassicauda magna, suggesting that Crassicauda duguyi may be a synonym of this species. In addition, molecular data are presented for the genus for the first time suggesting that the genus belongs within the superfamily Acuarioidea rather than within the Habronematoidea, in which it is currently placed. PMID:25482860

  19. Copper/zinc superoxide dismutase from the Cladoceran Daphnia magna: molecular cloning and expression in response to different acute environmental stressors.

    PubMed

    Lyu, Kai; Zhu, Xuexia; Wang, Qianqian; Chen, Yafen; Yang, Zhou

    2013-08-01

    The copper/zinc superoxide dismutase (Cu/Zn-SOD) is a representative antioxidant enzyme that is responsible for the conversion of superoxide to oxygen and hydrogen peroxide in aerobic organisms. Cu/Zn-SOD mRNAs have been cloned from many species and employed as useful biomarkers of oxidative stresses. In the present study, we cloned Cu/Zn-SOD cDNA from the cladoceran Daphnia magna, analyzed its catalytic properties, and investigated mRNA expression patterns after exposure to known oxidative stressors. The full-length Cu/Zn-SOD of the D. magna (Dm-Cu/Zn-SOD) sequence consisted of 703 bp nucleotides, encoding 178 amino acids, showing well-conserved domains that were required for metal binding and several common characteristics. The deduced amino acid sequence of Dm-Cu/Zn-SOD showed that it shared high identity with Daphnia pulex (88%), Alvinella pompejana (56%), and Cristaria plicata (56%). The phylogenetic analysis indicated that Dm-Cu/Zn-SOD was highly homologous to D. pulex. The variation of Dm-Cu/Zn-SOD mRNA expression was quantified by real-time PCR, and the results indicated that the expression was up-regulated after 48-h exposure to copper, un-ionized ammonia, and low dissolved oxygen. This study shows that the Dm-Cu/Zn-SOD mRNA could be successfully employed as a biomarker of oxidative stress, which is a common mode of toxicity for many other aquatic hazardous materials. PMID:23815380

  20. Molecular Fingerprinting of Cyanobacteria from River Biofilms as a Water Quality Monitoring Tool

    PubMed Central

    Loza, Virginia; Perona, Elvira

    2013-01-01

    Benthic cyanobacterial communities from Guadarrama River (Spain) biofilms were examined using temperature gradient gel electrophoresis (TGGE), comparing the results with microscopic analyses of field-fixed samples and the genetic characterization of cultured isolates from the river. Changes in the structure and composition of cyanobacterial communities and their possible association with eutrophication in the river downstream were studied by examining complex TGGE patterns, band extraction, and subsequent sequencing of 16S rRNA gene fragments. Band profiles differed among sampling sites depending on differences in water quality. The results showed that TGGE band richness decreased in a downstream direction, and there was a clear clustering of phylotypes on the basis of their origins from different locations according to their ecological requirements. Multivariate analyses (cluster analysis and canonical correspondence analysis) corroborated these differences. Results were consistent with those obtained from microscopic observations of field-fixed samples. According to the phylogenetic analysis, morphotypes observed in natural samples were the most common phylotypes in the TGGE sequences. These phylotypes were closely related to Chamaesiphon, Aphanocapsa, Pleurocapsa, Cyanobium, Pseudanabaena, Phormidium, and Leptolyngbya. Differences in the populations in response to environmental variables, principally nutrient concentrations (dissolved inorganic nitrogen and soluble reactive phosphorus), were found. Some phylotypes were associated with low nutrient concentrations and high levels of dissolved oxygen, while other phylotypes were associated with eutrophic-hypertrophic conditions. These results support the view that once a community has been characterized and its genetic fingerprint obtained, this technique could be used for the purpose of monitoring rivers. PMID:23263954

  1. First certified reference materials for molecular fingerprinting of two approved probiotic Bacillus strains.

    PubMed

    De Baets, L; Van Iwaarden, P; Meeus, N; Schimmel, H; Philipp, W; Emons, H

    2009-01-31

    At present probiotic bacteria are widely used in human and animal nutrition because they beneficially influence the balance of the intestinal flora of the host. Positive effects related to probiotics are various and include enhancement of digestion, strengthening of the immune system and stimulation of vitamin production. Moreover, implementation of probiotics is intended to reduce the use of antibiotics and improve animal growth and feed conversion. To protect human and animal health and to improve consumer confidence, a strict legislation on the use of probiotics exists within the European Union (EU). Official controls by national authorities are performed to ensure verification of compliance with feed and food law. Apart from the risk of using unauthorized strains, mislabelling is a known problem, partly because of the use of phenotyping or genotyping methods with a lack of discriminative power. In addition to official controls, private controls by food and feed producing companies are important in the frame of protection of patented strains and industrial property rights. To support these applications, IRMM has developed certified reference materials (CRMs) consisting of genomic DNA inserts of B. subtilis DSM 5749 and B. licheniformis DSM 5750, two strains that received EU approval. In this study we investigated the use of these CRMs, IRMM-311 and IRMM-312, for the detection and unambiguous discrimination of Bacillus strains by pulsed-field gel electrophoresis (PFGE). Identical fingerprints were obtained for the CRMs and control strains isolated from the feed additive Bioplus 2B. On the other hand a distinction could be made from other not approved B. licheniformis and B. subtilis strains. The reference materials discussed in this study are the first CRMs based on a whole bacterial genome and suitable for PFGE. They offer perspectives for applications in other domains such as analysis of foodborne pathogens in outbreaks or routine analysis. PMID:19062121

  2. Rotation commensurate echo of asymmetric molecules—Molecular fingerprints in the time domain

    SciTech Connect

    Chesnokov, E. N.; Kubarev, V. V.; Koshlyakov, P. V.

    2014-12-29

    Using the pulses of terahertz free electron laser and ultra-fast Schottky diode detectors, we observed the coherent transients within a free induction decay of gaseous nitrogen dioxide NO{sub 2}. The laser excited different sub-bands of rotation spectra of NO{sub 2} containing about 50–70 lines. The free induction signal continued more than 30 ns and consisted of many echo-like bursts duration about 0.2 ns. Unlike the similar effect observed previously for linear and symmetric top molecules, the sequence of echo bursts is not periodic. The values for delay of individual echo are stable, and the set of these delays can be considered as a “molecular fingerprint” in the time domain.

  3. The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

    PubMed

    Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

    2015-01-01

    In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis. PMID:24328820

  4. mRNA-Seq Reveals Novel Molecular Mechanisms and a Robust Fingerprint in Graves' Disease

    PubMed Central

    Sachidanandam, Ravi; Morshed, Syed; Latif, Rauf; Shi, Ruijin; Davies, Terry F.

    2014-01-01

    Context: The immune response in autoimmune thyroid disease has been shown to occur primarily within the thyroid gland in which the most abundant antigens can be found. A variety of capture molecules are known to be expressed by thyroid epithelial cells and serve to attract and help retain an intrathyroidal immune infiltrate. Objective: To explore the entire repertoire of expressed genes in human thyroid tissue, we have deep sequenced the transcriptome (referred to as mRNA-Seq). Design and Patients: We applied mRNA-Seq to thyroid tissue from nine patients with Graves' disease subjected to total thyroidectomy and compared the data with 12 samples of normal thyroid tissue obtained from patients having a thyroid nodule removed. The expression for each gene was calculated from the sequencing data by taking the median of the coverage across the length of the gene. The expression levels were quantile normalized and a gene signature was derived from these. Results: On comparison of expression levels in tissues derived from Graves' patients and controls, there was clear evidence for overexpression of the antigen presentation pathway consisting of HLA and associated genes. We also found a robust disease signature and discovered active innate and adaptive immune signaling networks. Conclusions: These data reveal an active immune defense system in Graves' disease, which involves novel molecular mechanisms in its pathogenesis and development. PMID:24971664

  5. The Molecular Fingerprint of High Grade Serous Ovarian Cancer Reflects Its Fallopian Tube Origin

    PubMed Central

    Kessler, Mirjana; Fotopoulou, Christina; Meyer, Thomas

    2013-01-01

    High grade serous ovarian cancer (HGSC), the most lethal and frequent type of epithelial ovarian cancer (EOC), has poor long term prognosis due to a combination of factors: late detection, great metastatic potential and the capacity to develop resistance to available therapeutic drugs. Furthermore, there has been considerable controversy concerning the etiology of this malignancy. New studies, both clinical and molecular, strongly suggest that HGSC originates not from the surface of the ovary, but from the epithelial layer of the neighboring fallopian tube fimbriae. In this paper we summarize data supporting the central role of fallopian tube epithelium in the development of HGSC. Specifically, we address cellular pathways and regulatory mechanisms which are modulated in the process of transformation, but also genetic changes which accumulate during disease progression. Similarities between fallopian tube mucosa and the malignant tissue of HGSC warrant a closer analysis of homeostatic mechanisms in healthy epithelium in order to elucidate key steps in disease development. Finally, we highlight the importance of the cancer stem cell (CSC) identification and understanding of its niche regulation for improvement of therapeutic strategies. PMID:23528888

  6. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD.

    PubMed

    Sunil Kumar, K N; Maruthi, K R; Alfarhan, A H; Rajakrishnan, R; Thomas, J

    2016-05-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard's coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  7. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD

    PubMed Central

    Sunil Kumar, K.N.; Maruthi, K.R.; Alfarhan, A.H.; Rajakrishnan, R.; Thomas, J.

    2015-01-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard’s coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  8. The culturome of the human nose habitats reveals individual bacterial fingerprint patterns.

    PubMed

    Kaspar, Ursula; Kriegeskorte, André; Schubert, Tanja; Peters, Georg; Rudack, Claudia; Pieper, Dietmar H; Wos-Oxley, Melissa; Becker, Karsten

    2016-07-01

    The complex anatomy of the human nose might offer distinct microbial niches. Microbiota composition may affect nose inflammatory diseases and Staphylococcus aureus carriage. Considering different nasal cavity locations, microbial colonization was analysed across individuals exhibiting chronic nasal inflammatory diseases (n = 18) and those without local inflammation signs (n = 16). Samples were collected systematically during surgery and examined by an extensive culture-based approach and, for a subset, by 16S rRNA gene community profiling. Cultivation yielded 141 taxa with members of Staphylococcus, Corynebacterium and Propionibacterium as most common isolates comprising the nasal core culturome together with Finegoldia magna. Staphylococcus aureus was most frequently found in association with Staphylococcus epidermidis and Propionibacterium acnes, and the posterior vestibules were redefined as S. aureus' principle habitat. Culturome analysis revealed host-specific bacterial 'fingerprints' irrespective of host-driven factors or intranasal sites. Comparisons between cultivable and molecular fingerprints demonstrated that only a small fraction of phylotypes (6.2%) was correlated. While the total number of different phylotypes was higher in the molecular dataset, the total number of identifications down to the species level was higher in the culturomic approach. To determine host-specific microbiomes, the advantages of molecular approaches should be combined with the resolution and reliability of species identification by culturomic analyses. PMID:25923378

  9. Combining molecular fingerprints with multidimensional scaling analyses to identify the source of spilled oil from highly similar suspected oils.

    PubMed

    Zhou, Peiyu; Chen, Changshu; Ye, Jianjun; Shen, Wenjie; Xiong, Xiaofei; Hu, Ping; Fang, Hongda; Huang, Chuguang; Sun, Yongge

    2015-04-15

    Oil fingerprints have been a powerful tool widely used for determining the source of spilled oil. In most cases, this tool works well. However, it is usually difficult to identify the source if the oil spill accident occurs during offshore petroleum exploration due to the highly similar physiochemical characteristics of suspected oils from the same drilling platform. In this report, a case study from the waters of the South China Sea is presented, and multidimensional scaling analysis (MDS) is introduced to demonstrate how oil fingerprints can be combined with mathematical methods to identify the source of spilled oil from highly similar suspected sources. The results suggest that the MDS calculation based on oil fingerprints and subsequently integrated with specific biomarkers in spilled oils is the most effective method with a great potential for determining the source in terms of highly similar suspected oils. PMID:25765488

  10. Complete Mitochondrial Genome of Anoplocephala magna Solidifying the Species

    PubMed Central

    Guo, Aijiang

    2016-01-01

    The 2 species of the genus Anoplocephala (Anoplocephalidae), A. perfoliata and A. magna, are among the most important equine cestode parasites. However, there is little information about their differences at the molecular level. The present study revealed that the mitochondrial (mt) genome of A. magna was 13,759 bp in size and 700 bp shorter than that of A. perfoliata. The 2 species includes 2 rRNA, 22 tRNA, and 12 protein-coding genes each. The size of each of the 36 genes was the same as that of A. perfoliata, except for cox1, rrnL, trnC, trnS2(UCN), trnG, trnH, trnQ, and trnP. In the full mitochondrial genome, the sequence similarity was 87.1%. The divergence in the nucleotide and amino acid sequences of individual protein-coding genes ranged from 11.1% to 16% and 6.8% to 16.4%, respectively. The 2 noncoding regions of the mt genome of A. magna were 199 bp and 271 bp in length, while the equivalent regions in A. perfoliata were 875 bp and 276 bp, respectively. The results of this study support the proposal that A. magna and A. perfoliata are separate species, consistent with previous morphological analyses. PMID:27417096

  11. Fingerprint detection

    DOEpatents

    Saunders, George C.

    1992-01-01

    A method for detection and visualization of latent fingerprints is provided and includes contacting a substrate containing a latent print thereon with a colloidal metal composition for time sufficient to allow reaction of said colloidal metal composition with said latent print, and preserving or recording the observable print. Further, the method for detection and visualization of latent fingerprints can include contacting the metal composition-latent print reaction product with a secondary metal-containing solution for time sufficient to allow precipitation of said secondary metal thereby enhancing the visibility of the latent print, and preserving or recording the observable print.

  12. [Study on action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis based on techniques of gene expression profile and molecular fingerprint].

    PubMed

    Zhou, Wei; Song, Xiang-gang; Chen, Chao; Wang, Shu-mei; Liang, Sheng-wang

    2015-08-01

    Action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis were discussed based on gene expression profile and molecular fingerprint in this paper. First, gene expression profiles of atherosclerotic carotid artery tissues and histologically normal tissues in human body were collected, and were screened using significance analysis of microarray (SAM) to screen out differential gene expressions; then differential genes were analyzed by Gene Ontology (GO) analysis and KEGG pathway analysis; to avoid some genes with non-outstanding differential expression but biologically importance, Gene Set Enrichment Analysis (GSEA) were performed, and 7 chemical ingredients with higher negative enrichment score were obtained by Cmap method, implying that they could reversely regulate the gene expression profiles of pathological tissues; and last, based on the hypotheses that similar structures have similar activities, 336 ingredients of compound Danshen dripping pills were compared with 7 drug molecules in 2D molecular fingerprints method. The results showed that 147 differential genes including 60 up-regulated genes and 87 down regulated genes were screened out by SAM. And in GO analysis, Biological Process ( BP) is mainly concerned with biological adhesion, response to wounding and inflammatory response; Cellular Component (CC) is mainly concerned with extracellular region, extracellular space and plasma membrane; while Molecular Function (MF) is mainly concerned with antigen binding, metalloendopeptidase activity and peptide binding. KEGG pathway analysis is mainly concerned with JAK-STAT, RIG-I like receptor and PPAR signaling pathway. There were 10 compounds, such as hexadecane, with Tanimoto coefficients greater than 0.85, which implied that they may be the active ingredients (AIs) of compound Danshen dripping pills in treatment of carotid atherosclerosis (CAs). The present method can be applied to the research on material

  13. Mid-infrared supercontinuum covering the 1.4-13.3 μm molecular fingerprint region using ultra-high NA chalcogenide step-index fibre

    NASA Astrophysics Data System (ADS)

    Petersen, Christian Rosenberg; Møller, Uffe; Kubat, Irnis; Zhou, Binbin; Dupont, Sune; Ramsay, Jacob; Benson, Trevor; Sujecki, Slawomir; Abdel-Moneim, Nabil; Tang, Zhuoqi; Furniss, David; Seddon, Angela; Bang, Ole

    2014-11-01

    The mid-infrared spectral region is of great technical and scientific interest because most molecules display fundamental vibrational absorptions in this region, leaving distinctive spectral fingerprints. To date, the limitations of mid-infrared light sources such as thermal emitters, low-power laser diodes, quantum cascade lasers and synchrotron radiation have precluded mid-infrared applications where the spatial coherence, broad bandwidth, high brightness and portability of a supercontinuum laser are all required. Here, we demonstrate experimentally that launching intense ultra-short pulses with a central wavelength of either 4.5 μm or 6.3 μm into short pieces of ultra-high numerical-aperture step-index chalcogenide glass optical fibre generates a mid-infrared supercontinuum spanning 1.5 μm to 11.7 μm and 1.4 μm to 13.3 μm, respectively. This is the first experimental demonstration to truly reveal the potential of fibres to emit across the mid-infrared molecularfingerprint region’, which is of key importance for applications such as early cancer diagnostics, gas sensing and food quality control.

  14. Theranostic Profiling for Actionable Aberrations in Advanced High Risk Osteosarcoma with Aggressive Biology Reveals High Molecular Diversity: The Human Fingerprint Hypothesis.

    PubMed

    Egas-Bejar, Daniela; Anderson, Pete M; Agarwal, Rishi; Corrales-Medina, Fernando; Devarajan, Eswaran; Huh, Winston W; Brown, Robert E; Subbiah, Vivek

    2014-03-12

    The survival of patients with advanced osteosarcoma is poor with limited therapeutic options. There is an urgent need for new targeted therapies based on biomarkers. Recently, theranostic molecular profiling services for cancer patients by CLIA-certified commercial companies as well as in-house profiling in academic medical centers have expanded exponentially. We evaluated molecular profiles of patients with advanced osteosarcoma whose tumor tissue had been analyzed by one of the following methods: 1. 182-gene next-generation exome sequencing (Foundation Medicine, Boston, MA), 2. Immunohistochemistry (IHC)/PCR-based panel (CARIS Target Now, Irving, Tx), 3.Comparative genome hybridization (Oncopath, San Antonio, TX). 4. Single-gene PCR assays, PTEN IHC (MDACC CLIA), 5. UT Houston morphoproteomics (Houston, TX). The most common actionable aberrations occur in the PI3K/PTEN/mTOR pathway. No patterns in genomic alterations beyond the above are readily identifiable, and suggest both high molecular diversity in osteosarcoma and the need for more analyses to define distinct subgroups of osteosarcoma defined by genomic alterations. Based on our preliminary observations we hypothesize that the biology of aggressive and the metastatic phenotype osteosarcoma at the molecular level is similar to human fingerprints, in that no two tumors are identical. Further large scale analyses of osteosarcoma samples are warranted to test this hypothesis. PMID:25126591

  15. Theranostic profiling for actionable aberrations in advanced high risk osteosarcoma with aggressive biology reveals high molecular diversity: the human fingerprint hypothesis

    PubMed Central

    Egas-Bejar, Daniela; Anderson, Pete M.; Agarwal, Rishi; Corrales-Medina, Fernando; Devarajan, Eswaran; Huh, Winston W.; Brown, Robert E; Subbiah, Vivek

    2014-01-01

    The survival of patients with advanced osteosarcoma is poor with limited therapeutic options. There is an urgent need for new targeted therapies based on biomarkers. Recently, theranostic molecular profiling services for cancer patients by CLIA-certified commercial companies as well as in-house profiling in academic medical centers have expanded exponentially. We evaluated molecular profiles of patients with advanced osteosarcoma whose tumor tissue had been analyzed by one of the following methods: 1. 182-gene next-generation exome sequencing (Foundation Medicine, Boston, MA), 2. Immunohistochemistry (IHC)/PCR-based panel (CARIS Target Now, Irving, Tx), 3. Comparative genome hybridization (Oncopath, San Antonio, TX). 4. Single-gene PCR assays, PTEN IHC (MDACC CLIA), 5. UT Houston morphoproteomics (Houston, TX). The most common actionable aberrations occur in the PI3K/PTEN/ mTOR pathway. No patterns in genomic alterations beyond the above are readily identifiable, and suggest both high molecular diversity in osteosarcoma and the need for more analyses to define distinct subgroups of osteosarcoma defined by genomic alterations. Based on our preliminary observations we hypothesize that the biology of aggressive and the metastatic phenotype osteosarcoma at the molecular level is similar to human fingerprints, in that no two tumors are identical. Further large scale analyses of osteosarcoma samples are warranted to test this hypothesis. PMID:25126591

  16. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  17. Fingerprint Recognition with Identical Twin Fingerprints

    PubMed Central

    Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  18. Aerogel Fingerprint Media

    SciTech Connect

    Miller, Fred S.; Andresen, Brian D.

    1999-09-21

    A fingerprint medium which is made of an aerogel having a predetermined density. The fingerprint medium may have a midrange density for forming plates or may be crushed forming a powder. The fingerprint medium may further include at least one of a metal and metal oxide to enhance characteristics desirable in a fingerprint medium.

  19. Phenotypic and molecular fingerprinting of fast growing rhizobia of field-grown pigeonpea from the eastern edge of the Brazilian Pantanal.

    PubMed

    Costa, F M; Schiavo, J A; Brasil, M S; Leite, J; Xavier, G R; Fernandes, P I

    2014-01-01

    The aim of this study was to evaluate the diversity of rhizobial isolates obtained from root nodules of pigeonpea plants grown at the eastern edge of the Brazilian Pantanal. The bacterial isolates were isolated from root nodules from field-growing pigeonpea grown in two rural settlements of the Aquidauana municipality. The bacterial isolates were characterized phenotypically by means of cultural characterization, intrinsic antibiotic resistance (IAR), salt and high incubation temperature tolerance, and amylolytic and cellulolytic activities. The molecular characterization of the bacterial isolates was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and Box-polymerase chain reaction (PCR) techniques. In addition, the symbiotic performance of selected rhizobial isolates was evaluated in a greenhouse experiment using sterile substrate. The phenotypic characterization revealed that the bacterial strains obtained from pigeonpea root nodules presented characteristics that are uncommon among rhizobial isolates, indicating the presence of new species nodulating the pigeonpea plants in the Brazilian Pantanal. The molecular fingerprinting of these bacterial isolates also showed a highly diverse collection, with both techniques revealing less than 25% similarity among bacterial isolates. The evaluation of symbiotic performance also indicated the presence of microorganisms with high potential to increase the growth and nitrogen content at the shoots of pigeonpea plants. The results obtained in this study indicate the presence of a highly diversified rhizobial community nodulating the pigeonpea at the eastern edge of the Brazilian Pantanal. PMID:24535875

  20. Behavioral response of Daphnia magna to silver salt and nanoparticle exposure

    EPA Science Inventory

    Endpoints in the investigation of the toxicity of metallic nanoparticles have varied from genetic and molecular through whole organism responses such as death and reproduction. The work presented here is an effort to quantify behavioral responses of Daphnia magna to exposure to s...

  1. Advanced Fingerprint Analysis Project Fingerprint Constituents

    SciTech Connect

    GM Mong; CE Petersen; TRW Clauss

    1999-10-29

    The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

  2. "Self" and "non-self" in the control of phytoalexin biosynthesis: plant phospholipases A2 with alkaloid-specific molecular fingerprints.

    PubMed

    Heinze, Michael; Brandt, Wolfgang; Marillonnet, Sylvestre; Roos, Werner

    2015-02-01

    The overproduction of specialized metabolites requires plants to manage the inherent burdens, including the risk of self-intoxication. We present a control mechanism that stops the expression of phytoalexin biosynthetic enzymes by blocking the antecedent signal transduction cascade. Cultured cells of Eschscholzia californica (Papaveraceae) and Catharanthus roseus (Apocynaceae) overproduce benzophenanthridine alkaloids and monoterpenoid indole alkaloids, respectively, in response to microbial elicitors. In both plants, an elicitor-responsive phospholipase A2 (PLA2) at the plasma membrane generates signal molecules that initiate the induction of biosynthetic enzymes. The final alkaloids produced in the respective plant inhibit the respective PLA, a negative feedback that prevents continuous overexpression. The selective inhibition by alkaloids from the class produced in the "self" plant could be transferred to leaves of Nicotiana benthamiana via recombinant expression of PLA2. The 3D homology model of each PLA2 displays a binding pocket that specifically accommodates alkaloids of the class produced by the same plant, but not of the other class; for example, C. roseus PLA2 only accommodates C. roseus alkaloids. The interaction energies of docked alkaloids correlate with their selective inhibition of PLA2 activity. The existence in two evolutionary distant plants of phospholipases A2 that discriminate "self-made" from "foreign" alkaloids reveals molecular fingerprints left in signal enzymes during the evolution of species-specific, cytotoxic phytoalexins. PMID:25670767

  3. Isolation and expression analysis of partial sequences of heavy metal transporters from Brassica juncea by coupling high throughput cloning with a molecular fingerprinting technique.

    PubMed

    Das, Soumita; Sen, Monali; Saha, Chinmay; Chakraborty, Debjani; Das, Antara; Banerjee, Manidipa; Seal, Anindita

    2011-07-01

    Heavy metal transporters play a key role in regulating metal accumulation and transport in plants. These are important candidate genes to study in metal tolerant and accumulator plants for their potential use in environmental clean up. We coupled a degenerate primer-based RT-PCR approach with a molecular fingerprinting technique based on amplified rDNA restriction analysis (ARDRA) to identify novel ESTs corresponding to heavy metal transporters from metal accumulator Brassica juncea. We utilized this technique to clone several family members of natural resistance-associated macrophage proteins (NRAMP) and yellow stripe-like proteins (YSL) in a high throughput manner to distinguish between closely related isoforms and/or allelic variants from the allopolyploid B. juncea. Partial clones of 23 Brassica juncea NRAMPs and 27 YSLs were obtained with similarity to known Arabidopsis thaliana and Noccaea (Thlaspi) caerulescens NRAMP and YSL genes. The cloned transporters showed Brassica-specific changes in domains, which can have important functional consequences. Semi-quantitative RT-PCR-based expression analysis of chosen members indicated that even closely related isoforms/allelic variants of BjNRAMP and BjYSL have distinct tissue-specific and metal-dependent expressions which might be essential for adaptive fitness and heavy metal tolerance. Consistent to this, BjYSL6.1 and BjYSL5.8 were found to show elevated expressions specifically in cadmium-treated shoots and lead-treated roots of B. juncea, respectively. PMID:21394470

  4. “Self” and “Non-Self” in the Control of Phytoalexin Biosynthesis: Plant Phospholipases A2 with Alkaloid-Specific Molecular Fingerprints

    PubMed Central

    Heinze, Michael; Brandt, Wolfgang; Marillonnet, Sylvestre; Roos, Werner

    2015-01-01

    The overproduction of specialized metabolites requires plants to manage the inherent burdens, including the risk of self-intoxication. We present a control mechanism that stops the expression of phytoalexin biosynthetic enzymes by blocking the antecedent signal transduction cascade. Cultured cells of Eschscholzia californica (Papaveraceae) and Catharanthus roseus (Apocynaceae) overproduce benzophenanthridine alkaloids and monoterpenoid indole alkaloids, respectively, in response to microbial elicitors. In both plants, an elicitor-responsive phospholipase A2 (PLA2) at the plasma membrane generates signal molecules that initiate the induction of biosynthetic enzymes. The final alkaloids produced in the respective plant inhibit the respective PLA, a negative feedback that prevents continuous overexpression. The selective inhibition by alkaloids from the class produced in the “self” plant could be transferred to leaves of Nicotiana benthamiana via recombinant expression of PLA2. The 3D homology model of each PLA2 displays a binding pocket that specifically accommodates alkaloids of the class produced by the same plant, but not of the other class; for example, C. roseus PLA2 only accommodates C. roseus alkaloids. The interaction energies of docked alkaloids correlate with their selective inhibition of PLA2 activity. The existence in two evolutionary distant plants of phospholipases A2 that discriminate “self-made” from “foreign” alkaloids reveals molecular fingerprints left in signal enzymes during the evolution of species-specific, cytotoxic phytoalexins. PMID:25670767

  5. Molecular fingerprinting of Salmonella enterica subsp. enterica Typhimurium and Salmonella enterica subsp. enterica derby isolated from tropical seafood in South India.

    PubMed

    Kumar, Rakesh; Surendran, P K; Thampuran, Nirmala

    2008-09-01

    Salmonella enterica subsp. enterica Typhimurium and Salmonella enterica subsp. enterica Derby strains isolated from different seafood were genotyped by PCR-ribotyping and ERIC-PCR assays. This study has ascertained the genetic relatedness among serovars prevalent in tropical seafood. PCR-ribotyping exhibited genetic variation in both Salmonella serovars, and ribotype profile (II) was most predominant, which was observed in 10/18 of Salmonella enterica subsp. enterica Typhimurium and 7/17 Salmonella enterica subsp. enterica Derby isolates. Cluster analysis of ERIC-PCR for Salmonella enterica subsp. enterica Typhimurium strains exhibited nine different banding patterns and four strains showed >95% genetic homology within the cluster pairs. ERIC-PCR produced more genetic variations in Salmonella enterica subsp. enterica Typhimurium; nevertheless, both methods were found to be comparable for Salmonella enterica subsp. enterica Derby isolates. Discrimination index of PCR-ribotyping for Salmonella enterica subsp. enterica Typhimurium isolates was obtained at 0.674 and index value 0.714 was observed for Salmonella enterica subsp. enterica Derby strains. Molecular fingerprinting investigation highlighted the hypothesis of diverse routes of Salmonella contamination in seafood as multiple clones of Salmonella enterica subsp. enterica Typhimurium and Salmonella enterica subsp. enterica Derby were detected in same or different seafood throughout the study period. PMID:18480975

  6. QSAR for RNases and theoretic-experimental study of molecular diversity on peptide mass fingerprints of a new Leishmania infantum protein.

    PubMed

    González-Díaz, Humberto; Dea-Ayuela, María A; Pérez-Montoto, Lázaro G; Prado-Prado, Francisco J; Agüero-Chapín, Guillermín; Bolas-Fernández, Francisco; Vazquez-Padrón, Roberto I; Ubeira, Florencio M

    2010-05-01

    The toxicity and low success of current treatments for Leishmaniosis determines the search of new peptide drugs and/or molecular targets in Leishmania pathogen species (L. infantum and L. major). For example, Ribonucleases (RNases) are enzymes relevant to several biologic processes; then, theoretical and experimental study of the molecular diversity of Peptide Mass Fingerprints (PMFs) of RNases is useful for drug design. This study introduces a methodology that combines QSAR models, 2D-Electrophoresis (2D-E), MALDI-TOF Mass Spectroscopy (MS), BLAST alignment, and Molecular Dynamics (MD) to explore PMFs of RNases. We illustrate this approach by investigating for the first time the PMFs of a new protein of L. infantum. Here we report and compare new versus old predictive models for RNases based on Topological Indices (TIs) of Markov Pseudo-Folding Lattices. These group of indices called Pseudo-folding Lattice 2D-TIs include: Spectral moments pi ( k )(x,y), Mean Electrostatic potentials xi ( k )(x,y), and Entropy measures theta ( k )(x,y). The accuracy of the models (training/cross-validation) was as follows: xi ( k )(x,y)-model (96.0%/91.7%)>pi ( k )(x,y)-model (84.7/83.3) > theta ( k )(x,y)-model (66.0/66.7). We also carried out a 2D-E analysis of biological samples of L. infantum promastigotes focusing on a 2D-E gel spot of one unknown protein with M<20, 100 and pI <7. MASCOT search identified 20 proteins with Mowse score >30, but not one >52 (threshold value), the higher value of 42 was for a probable DNA-directed RNA polymerase. However, we determined experimentally the sequence of more than 140 peptides. We used QSAR models to predict RNase scores for these peptides and BLAST alignment to confirm some results. We also calculated 3D-folding TIs based on MD experiments and compared 2D versus 3D-TIs on molecular phylogenetic analysis of the molecular diversity of these peptides. This combined strategy may be of interest in drug development or target identification

  7. Fluorescence fingerprints and Cu2+-complexing ability of individual molecular size fractions in soil- and waste-borne DOM.

    PubMed

    Knoth de Zarruk, K; Scholer, G; Dudal, Y

    2007-09-01

    Land spreading of organic materials introduces large amounts of dissolved organic matter (DOM) into the soil. DOM has the ability to form stable complexes with heavy metals and can facilitate their transport towards the groundwater. The effects on soil processes are difficult to assess, because different DOM components might react differently towards metal ions. The objective of this study was to investigate the fluorescence signature and the Cu2+-binding capacity of individual molecular size fractions of DOM from various sources. DOM extracted from leaf compost, chicken manure, sugar cane vinasse and a fulvic hypercalcaric cambisol was fractionated by the means of dialysis into four molecular size classes: MW<500, 50012000-14000 Da. Vinasse and leaf compost contained around 80% and 70%, respectively, of the total organic carbon in the fractions with low molecular weight (MW<3500 Da); in chicken manure and soil these fractions accounted for 40% and 50% only. Fluorescence was highest in the fraction MW>12000 Da for leaf compost, chicken manure and soil. The opposite result was obtained for vinasse, where the fractions with low molecular weight showed highest fluorescence intensities, distinguishing it from all other samples. Vinasse showed the greatest ability to bind Cu2+ with a resulting complex concentration of 6.31mgl(-1) while in contact with an excess of Cu2+. Leaf compost, soil and chicken manure followed with 2.69, 1.12, and 0.85mgl(-1), respectively. Within vinasse, the fraction MW<500 Da was able to form the most DOM-Cu complexes, indicating the importance of low molecular weight fractions in metal binding. PMID:17498777

  8. Development of 3D-QSAR Model for Acetylcholinesterase Inhibitors Using a Combination of Fingerprint, Molecular Docking, and Structure-Based Pharmacophore Approaches.

    PubMed

    Lee, Sehan; Barron, Mace G

    2015-11-01

    Acetylcholinesterase (AChE), a serine hydrolase vital for regulating the neurotransmitter acetylcholine in animals, has been used as a target for drugs and pesticides. With the increasing availability of AChE crystal structures, with or without ligands bound, structure-based approaches have been successfully applied to AChE inhibitors (AChEIs). The major limitation of these approaches has been the small applicability domain due to the lack of structural diversity in the training set. In this study, we developed a 3 dimensional quantitative structure-activity relationship (3D-QSAR) for inhibitory activity of 89 reversible and irreversible AChEIs including drugs and insecticides. A 3D-fingerprint descriptor encoding protein-ligand interactions was developed using molecular docking and structure-based pharmacophore to rationalize the structural requirements responsible for the activity of these compounds. The obtained 3D-QSAR model exhibited high correlation value (R(2) = 0.93) and low mean absolute error (MAE = 0.32 log units) for the training set (n = 63). The model was predictive across a range of structures as shown by the leave-one-out cross-validated correlation coefficient (Q(2) = 0.89) and external validation results (n = 26, R(2) = 0.89, and MAE = 0.38 log units). The model revealed that the compounds with high inhibition potency had proper conformation in the active site gorge and interacted with key amino acid residues, in particular Trp84 and Phe330 at the catalytic anionic site, Trp279 at the peripheral anionic site, and Gly118, Gly119, and Ala201 at the oxyanion hole. The resulting universal 3D-QSAR model provides insight into the multiple molecular interactions determining AChEI potency that may guide future chemical design and regulation of toxic AChEIs. PMID:26202430

  9. On latent fingerprint enhancement

    NASA Astrophysics Data System (ADS)

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K.

    2010-04-01

    Automatic feature extraction in latent fingerprints is a challenging problem due to poor quality of most latents, such as unclear ridge structures, overlapped lines and letters, and overlapped fingerprints. We proposed a latent fingerprint enhancement algorithm which requires manually marked region of interest (ROI) and singular points. The core of the proposed enhancement algorithm is a novel orientation field estimation algorithm, which fits orientation field model to coarse orientation field estimated from skeleton outputted by a commercial fingerprint SDK. Experimental results on NIST SD27 latent fingerprint database indicate that by incorporating the proposed enhancement algorithm, the matching accuracy of the commercial matcher was significantly improved.

  10. Purification and studies on characteristics of cholinesterases from Daphnia magna *

    PubMed Central

    Yang, Yan-xia; Niu, Li-zhi; Li, Shao-nan

    2013-01-01

    Due to their significant value in both economy and ecology, Daphnia had long been employed to investigate in vivo response of cholinesterase (ChE) in anticholinesterase exposures, whereas the type constitution and property of the enzyme remained unclear. A type of ChE was purified from Daphnia magna using a three-step procedure, i.e., Triton X-100 extraction, ammonium sulfate precipitation, and diethylaminoethyl (DEAE)-Sepharose™-Fast-Flow chromatography. According to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), molecular mass of the purified ChE was estimated to be 84 kDa. Based on substrate studies, the purified enzyme preferred butyrylthiocholine iodide (BTCh) [with maximum velocity (V max)/Michaelis constant (K m)=8.428 L/(min·mg protein)] to acetylthiocholine iodide (ATCh) [with V max/K m=5.346 L/(min·mg protein)] as its substrate. Activity of the purified enzyme was suppressed by high concentrations of either ATCh or BTCh. Inhibitor studies showed that the purified enzyme was more sensitive towards inhibition by tetraisopropylpyrophosphoramide (iso-OMPA) than by 1,5-bis(4-allyldimethylammoniumphenyl) pentan-3-one dibromide (BW284C51). Result of the study suggested that the purified ChE was more like a type of pseudocholinesterase, and it also suggested that Daphnia magna contained multiple types of ChE in their bodies. PMID:23549850

  11. Conversion of the pathogenic fungus Colletotrichum magna to a nonpathogenic, endophytic mutualist by gene disruption

    USGS Publications Warehouse

    Redman, R.S.; Ranson, J.C.; Rodriguez, R.J.

    1999-01-01

    Hygromycin-resistant transformants of the cucurbit pathogen Colletotrichum magna (teleomorph: Glomerella magna) were generated by restriction enzyme-mediated integration (REMI) transformation. A rapid pathogenicity assay involving watermelon (Citrullus lanatus) seedlings was developed and 14,400 REMI transformants were screened and assessed for their ability to cause disease, colonize plant tissues, and confer disease resistance against wild-type C. magna. A total of 176 nonpathogenic REMI mutants capable of colonizing cucurbit plants were isolated and assigned to three groups based on their ability to confer disease resistance: phenotype A, 80 to 100% disease protection; phenotype B, 10 to 65% disease protection; and phenotype C, 0 to 4% disease protection. Molecular and genetic analyses of one REMI mutant (R1) indicated that the nonpathogenic phenotype A resulted from a single-site integration. R1 showed a 1:1 segregation of hygromycin resistance and nonpathogenicity and all hygromycin-resistant progeny were nonpathogenic. The integrated vector and 5.5 kb of flanking fungal genomic DNA were isolated from R1 and designated pGMR1. To verify that pGMR1 contained pathogenicity gene sequences, a wild-type isolate of C. magna was transformed with pGMR1 to induce gene disruptions by homologous integration. Approximately 47% of the pGMR1 transformants expressed phenotype A, indicating homologous integration and gene disruption.

  12. How fingerprints came into use for personal identification.

    PubMed

    Caplan, R M

    1990-07-01

    The use of fingerprints for personal identification became widespread early in this century. How the fingerprints slowly became standardized involves many persons, including Nathaniel Grew, Johannes Purkinje, William Herschel, Henry Faulds, Charles Darwin, Francis Galton, Mark Twain, Juan Vucetich, Edward Henry, and J. Edgar Hoover. Although fingerprints have been noted and used since antiquity, a 25-year burst of activity that secured adoption of their use for identification began in about 1880. New modifications and applications have continued to the present. The history of fingerprints offers an excellent example of how society adopts innovations. This story also includes a bitter struggle for appropriate credit for various crucial steps in developing and adopting this important tool. More recent technical advances, including computers and molecular biology, now supplement the ease and usefulness of fingerprints, although the word fingerprinting continues in use by metaphoric extension. PMID:2195070

  13. Comparing Bacterial DNA Microarray Fingerprints

    SciTech Connect

    Willse, Alan R.; Chandler, Darrell P.; White, Amanda M.; Protic, Miroslava; Daly, Don S.; Wunschel, Sharon C.

    2005-08-15

    Detecting subtle genetic differences between microorganisms is an important problem in molecular epidemiology and microbial forensics. In a typical investigation, gel electrophoresis is used to compare randomly amplified DNA fragments between microbial strains, where the patterns of DNA fragment sizes are proxies for a microbe's genotype. The limited genomic sample captured on a gel is often insufficient to discriminate nearly identical strains. This paper examines the application of microarray technology to DNA fingerprinting as a high-resolution alternative to gel-based methods. The so-called universal microarray, which uses short oligonucleotide probes that do not target specific genes or species, is intended to be applicable to all microorganisms because it does not require prior knowledge of genomic sequence. In principle, closely related strains can be distinguished if the number of probes on the microarray is sufficiently large, i.e., if the genome is sufficiently sampled. In practice, we confront noisy data, imperfectly matched hybridizations, and a high-dimensional inference problem. We describe the statistical problems of microarray fingerprinting, outline similarities with and differences from more conventional microarray applications, and illustrate the statistical fingerprinting problem for 10 closely related strains from three Bacillus species, and 3 strains from non-Bacillus species.

  14. Physics and fingerprints

    NASA Astrophysics Data System (ADS)

    Voss-de Haan, Patrick

    2006-08-01

    This article discusses a variety of aspects in the detection and development of fingerprints and the physics involved in it. It gives an introduction to some basic issues like composition and properties of fingerprint deposits and a rudimentary framework of dactyloscopy; it covers various techniques for the visualization of latent fingerprints; and it concludes with a view of current research topics. The techniques range from very common procedures, such as powdering and cyanoacrylate fuming, to more demanding methods, for example luminescence and vacuum metal deposition, to fairly unusual approaches like autoradiography. The emphasis is placed on the physical rather than the forensic aspects of these topics while trying to give the physicist—who is not dealing with fingerprinting and forensic science on a daily basis—a feeling for the problems and solutions in the visualization of latent fingerprints.

  15. Advanced fingerprint verification software

    NASA Astrophysics Data System (ADS)

    Baradarani, A.; Taylor, J. R. B.; Severin, F.; Maev, R. Gr.

    2016-05-01

    We have developed a fingerprint software package that can be used in a wide range of applications from law enforcement to public and private security systems, and to personal devices such as laptops, vehicles, and door- locks. The software and processing units are a unique implementation of new and sophisticated algorithms that compete with the current best systems in the world. Development of the software package has been in line with the third generation of our ultrasonic fingerprinting machine1. Solid and robust performance is achieved in the presence of misplaced and low quality fingerprints.

  16. Longitudinal study of fingerprint recognition

    PubMed Central

    Yoon, Soweon; Jain, Anil K.

    2015-01-01

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject’s age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis. PMID:26124106

  17. Altered fingerprints: analysis and detection.

    PubMed

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K

    2012-03-01

    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem. PMID:21808092

  18. Online fingerprint verification.

    PubMed

    Upendra, K; Singh, S; Kumar, V; Verma, H K

    2007-01-01

    As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications. PMID:17365425

  19. Fingerprinting of music scores

    NASA Astrophysics Data System (ADS)

    Irons, Jonathan; Schmucker, Martin

    2004-06-01

    Publishers of sheet music are generally reluctant in distributing their content via the Internet. Although online sheet music distribution's advantages are numerous the potential risk of Intellectual Property Rights (IPR) infringement, e.g. illegal online distributions, disables any innovation propensity. While active protection techniques only deter external risk factors, additional technology is necessary to adequately treat further risk factors. For several media types including music scores watermarking technology has been developed, which ebeds information in data by suitable data modifications. Furthermore, fingerprinting or perceptual hasing methods have been developed and are being applied especially for audio. These methods allow the identification of content without prior modifications. In this article we motivate the development of watermarking and fingerprinting technologies for sheet music. Outgoing from potential limitations of watermarking methods we explain why fingerprinting methods are important for sheet music and address potential applications. Finally we introduce a condept for fingerprinting of sheet music.

  20. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  1. Biokinetics and tolerance development of toxic metals in Daphnia magna.

    PubMed

    Tsui, Martin Tsz-Ki; Wang, Wen-Xiong

    2007-05-01

    Daphnia magna is widespread in many freshwater systems of temperate regions and frequently is used to test metal toxicity. Recently, studies have been performed to determine metal biokinetics and development of tolerance in this important zooplankton species. In the present paper, we review the recent progress in these areas and suggest possible directions for future studies. Substantial differences exist in aqueous uptake, dietary assimilation, and elimination of several metals (Cd, Se, Zn, Ag, Hg, and MeHg) by D. magna. The routes of uptake are metal-specific, with Se and MeHg being accumulated predominantly through diet. All metals except Ag can be biomagnified from algae to D. magna, providing that metal concentrations in algae and algal food density are relatively low. Methylmercury is biomagnified in all situations. As a route for metal elimination in D. magna, maternal transfer is especially important for Se, Zn, and MeHg. On the other hand, the effect of single-generation exposure to metals on D. magna is very different from multigeneration exposure, which often results in a significantly higher metal tolerance. Moreover, D. magna easily loses metal tolerance developed through long-term exposure. Recovery from metal stress can temporarily increase the sensitivity of D. magna to metal toxicity. Finally, metallothionein-like protein is responsible for minimizing metal toxicity in D. magna. The results inferred from these studies can be extrapolated to other aquatic invertebrates as well as to other pollutants in the aquatic environment. PMID:17521151

  2. Development of resistance to cyfluthrin and naphthalene among Daphnia magna.

    PubMed

    Brausch, John M; Smith, Philip N

    2009-07-01

    In this study, Daphnia magna were exposed to a pyrethroid insecticide (cyfluthrin) or a polycyclic aromatic hydrocarbon (naphthalene) for 12 generations to evaluate development of resistance followed by a 12 generation recovery period. Twenty-four hour old D. magna were exposed to concentrations of each chemical resulting in 50-70% mortality to select for the least sensitive individuals. LC50 values, survival, reproductive output, and time to first brood in stressor-exposed and control D. magna were recorded for each generation. Significant changes in LC50 values were observed after 4 generations and then declined after 6-10 generations post-exposure. D. magna were 5 times less sensitive to cyfluthrin and 3 times less sensitive to naphthalene as compared to controls after 12 generations of exposure. There were no differences in survival, time to first brood, or total number of offspring produced between control and either of the resistant F13 D. magna. Cyfluthrin exposed D. magna exhibited cross-resistance to DDT and methyl parathion, and naphthalene resistant D. magna were less sensitive than controls to both pyrene and benz(a)anthracene. When the cytochrome P450 inhibitor piperonyl butoxide was used in conjunction with cyfluthrin and naphthalene the sensitivity of resistant and control D. magna were equal, suggesting P450s were responsible for conveying resistance. This study demonstrates that life history and organisms' capacity to develop resistance is important to consider ensuring accuracy of ecological risk assessments. PMID:19399609

  3. A DAPHNIA MAGNA SHORT-TERM SURVIVAL AND GROWTH TEST

    EPA Science Inventory

    With the change in acceptable test temperatures for invertebrate toxicity tests from <20oC to 25oC, it is now possible to use Daphnia magna for short-term chronic testing. When cultured at 25oC the dry weight of <24 hr old D. magna ranges from 7 to 15 g depending upon nutrition,...

  4. Teaching Magna Carta in American History: Land, Law, and Legacy

    ERIC Educational Resources Information Center

    Saxe, David W.

    2010-01-01

    Magna Carta, that great cornerstone of American liberty, has been in the news lately. Put up for sale by three-time U.S. Presidential candidate Ross Perot in December 2007, the 1297 version of Magna Carta displayed in the National Archives was sold to financier David Rubenstein for $21.3 million. While its sale demonstrates the cash value of the…

  5. Compounds altering fat storage in Daphnia magna.

    PubMed

    Jordão, Rita; Garreta, Elba; Campos, Bruno; Lemos, Marco F L; Soares, Amadeu M V M; Tauler, Romà; Barata, Carlos

    2016-03-01

    The analysis of lipid disruptive effects in invertebrates is limited by our poor knowledge of the lipid metabolic pathways. A recent study showed that tributyltin activated the ecdysteroid, juvenile hormone and retinoic X receptor signaling pathways, and disrupted the dynamics of neutral lipids in the crustacean Daphnia magna impairing the transfer of triacylglycerols to eggs and hence promoting their accumulation in post-spawning females. Tributyltin disruptive effects correlated with lower fitness for offspring and adults. The present study aims to addresses effects of existing compounds on storage lipids in post-spawning females and their health effects. D. magna individuals were exposed 12 chemicals that included vertebrate obesogens (tributyltin, triphenyltin, bisphenol A, nonylphenol, di-2-ethylhexyl phthalate), other contaminants known to affect arthropods (pyriproxyfen, fenarimol, methoprene, emamectin benzoate and fluoxetine), as well as the natural hormones methyl farnesoate and 20-hydroxyecdysone. Reproductive effects were also assessed. Quantitative changes in storage lipids accumulated in lipid droplets were studied using Nile red staining, which showed a close relationship with whole organism levels of triacylglycerols. Ten compounds altered storage lipids in a concentration related manner enhancing (tributyltin, bisphenol A, methyl farnesoate, pyriproxyfen and 20-hydroxyecdysone) or decreasing (nonylphenol, fenarimol, emamectin benzoate, methoprene and fluoxetine) their levels in post-spawning females. Eight compounds that altered lipid levels also had detrimental effects on growth and/or reproduction. PMID:26747981

  6. Toxicity of the cyanobacterium Cylindrospermopsis raciborskii to Daphnia magna.

    PubMed

    Nogueira, Isabel C G; Saker, Martin L; Pflugmacher, Stephan; Wiegand, Claudia; Vasconcelos, Vítor M

    2004-10-01

    The effect of two strains of Cylindrospermopsis raciborskii on the survivorship, somatic growth, and detoxification processes of juvenile Daphnia magna were investigated. Both strains of C. raciborskii (and also Ankistrodesmus falcatus, used as the control) were given to newborn D. magna at equivalent biovolumes. The survival curves for D. magna subjected to the two C. raciborskii treatments differed from those of the starved and fed treatments. After 48 h of exposure, the percentage of D. magna surviving after exposure to Cylin-A (a cylindrospermopsin-producing strain isolated from Australia) and Cylin-P (a non-cylindrospermopsin-producing strain isolated from Portugal) was 10.00% and 93.33%, respectively. The strain that produces cylindrospermopsin caused the greatest toxic effect in juvenile D. magna. Statistically significant differences in D. magna body size between the four treatments (Cylin-A, Cylin-P, A. falcatus, and starved) were detected after 48 h of exposure. The juvenile D. magna that received the two C. raciborskii treatments showed an increase in size (relative to their size at T(0)) of 2.54% and 38.14%, respectively. These values were statistically significantly different than those of the A. falcatus-fed control (55.54%) and the starved control (11.47%). In both C. raciborskii treatments there was a tendency for increased GST enzyme activities after 24 h of exposure. Cylindrospermopsin was detected (HPLC-MS/MS) in D. magna tissues after 24 and 48 h (0.025 and 0.02 ng animal(-)1, respectively). The results of this study indicate that C. raciborskii can affect the fitness and growth potential of juvenile D. magna. PMID:15352261

  7. An Introduction to DNA Fingerprinting.

    ERIC Educational Resources Information Center

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  8. Fingerprinting with Wow

    NASA Astrophysics Data System (ADS)

    Yu, Eugene; Craver, Scott

    2006-02-01

    Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

  9. Small scale mass culture of Daphnia magna Straus

    SciTech Connect

    Rees, J.T.; Oldfather, J.M.

    1980-02-01

    Daphnia magna Straus 1820 was raised on a defined medium in 4-liter flasks with controlled light intensity, temperature, and algal food species. Adult D. magna tolerated high levels of ammonia (up to 108 ..mu..M) at high pH (> 10), although at these levels parthenogenic reproduction may be inhibited. Scenedesmus quadricauda and Ankistrodesmus sp. were satisfactory food sources, and by utilizing Ankistrodesmus densities greater than one animal per ml were achieved. Maintaining the pH at about 7 to 8 seems to be important for successful D. magna culture.

  10. Historeceptomic Fingerprints for Drug-Like Compounds

    PubMed Central

    Shmelkov, Evgeny; Grigoryan, Arsen; Swetnam, James; Xin, Junyang; Tivon, Doreen; Shmelkov, Sergey V.; Cardozo, Timothy

    2015-01-01

    Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology). The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300,000 experimentally determined bioactivity values from the ChEMBL database and 4.2 billion molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics) scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic, in vivo picture of the mechanism of any drug's action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at drugable.org for access through a user-friendly web site. PMID:26733872

  11. Vulnerabilities of fingerprint reader to fake fingerprints attacks.

    PubMed

    Espinoza, Marcela; Champod, Christophe; Margot, Pierre

    2011-01-30

    The purpose of this research is to assess the vulnerabilities of a high resolution fingerprint sensor when confronted with fake fingerprints. The study has not been focused on the decision outcome of the biometric device, but essentially on the scores obtained following the comparison between a query (genuine or fake) and a template using an AFIS system. To do this, fake fingerprints of 12 subjects have been produced with and without their cooperation. These fake fingerprints have been used alongside with real fingers. The study led to three major observations: First, genuine fingerprints produced scores higher than fake fingers (translating a closer proximity) and this tendency is observed considering each subject separately. Second, scores are however not sufficient as a single measure to differentiate these samples (fake from genuine) given the variation due to the donors themselves. That explains why fingerprint readers without vitality detection can be fooled. Third, production methods and subjects greatly influence the scores obtained for fake fingerprints. PMID:21216360

  12. Fingerprinting digital elevation maps

    NASA Astrophysics Data System (ADS)

    Gou, Hongmei; Wu, Min

    2006-02-01

    Digital elevation maps (DEMs) provide a digital representation of 3-D terrain information. In civilian applications, high-precision DEMs carry a high commercial value owing to the large amount of effort in acquiring them; and in military applications, DEMs are often used to represent critical geospatial information in sensitive operations. These call for new technologies to prevent unauthorized distribution and to trace traitors in the event of information leak related to DEMs. In this paper, we propose a new digital fingerprinting technique to protect DEM data from illegal re-distribution. The proposed method enables reliable detection of fingerprints from both 3-D DEM data set and its 2-D rendering, whichever format that is available to a detector. Our method starts with extracting from a DEM a set of critical contours either corresponding to important topographic features of the terrain or having application-dependent importance. Fingerprints are then embedded into these critical contours by employing parametric curve modeling and spread spectrum embedding. Finally, a fingerprinted DEM is constructed to incorporate the marked 2-D contours. Through experimental results, we demonstrate the robustness of the proposed method against a number of challenging attacks applied to either DEMs or their contour representations.

  13. An assessment of the bioaccumulation of estrone in Daphnia magna.

    PubMed

    Gomes, Rachel L; Deacon, Hannah E; Lai, Ka M; Birkett, Jason W; Scrimshaw, Mark D; Lester, John N

    2004-01-01

    The bioaccumulation of estrone by Daphnia magna was determined. Direct uptake via the aqueous medium occurred within the first 16 h. A bioconcentration factor of 228 was established over all temporal periods. Ingestion via Chlorella vulgaris gave a partitioning factor of 24, which may approximate to a biomagnification factor assuming steady state conditions. These preliminary results indicate that the partitioning to Daphnia magna via the food source, C. vulgaris is less significant than bioconcentration. PMID:14768873

  14. Effects of acid precipitation on Daphnia magna

    SciTech Connect

    Parent, S.; Cheetham, R.D.

    1980-08-01

    Pollutants derived from fossil fuel combustion and precipitated from the atmosphere have substantially increased in the past decades. These materials, precipitated in such industrialized areas as southeastern Canada, have caused considerable alterations in aquatic ecosystems. Precipitation over most of the eastern United States is presently 10 to 500 times more acidic than is natural. Most affected aquatic ecosystems contain oligotrophic waters in regions of thin poorly buffered soils. Zooplankton are an important link in food chains of aquatic ecosystems and their disappearance or decline could drastically affect trophic relationships. Declines in zooplankton density in response to acid precipitation have been reported and short term survival of Daphnia pulex between pH 4.3 and 10.4; however, its potential for reproduction was limited to a fairly narrow range. Anderson (1944) noted the advantages of using daphnia as test organisms, and concluded that Daphnia magna was representative of other abundant zooplankton in sensitivity to toxic substances.

  15. DNA-based molecular fingerprinting of eukaryotic protists and cyanobacteria contributing to sinking particle flux at the Bermuda Atlantic time-series study

    NASA Astrophysics Data System (ADS)

    Amacher, Jessica; Neuer, Susanne; Lomas, Michael

    2013-09-01

    We used denaturing gradient gel electrophoresis (DGGE) to examine the protist and cyanobacterial communities in the euphotic zone (0-120 m) and in corresponding 150 m particle interceptor traps at the Bermuda Atlantic Time-series Study (BATS) in a two-year monthly time-series from May 2008 to April 2010. Dinoflagellates were the most commonly detected taxa in both water column and trap samples throughout the time series. Diatom sequences were found only eight times in the water column, and only four times in trap material. Small-sized eukaryotic taxa, including the prasinophyte genera Ostreococcus, Micromonas, and Bathycoccus, were present in trap samples, as were the cyanobacteria Prochlorococcus and Synechococcus. Synechococcus was usually overrepresented in trap material, whereas Prochlorococcus was underrepresented compared to the water column. Both seasonal and temporal variability affected patterns of ribosomal DNA found in sediment traps. The two years of this study were quite different hydrographically, with higher storm activity and the passing of a cyclonic eddy causing unusually deep mixing in winter 2010. This was reflected in the DGGE fingerprints of the water column, which showed greater phylotype richness of eukaryotes and a lesser richness of cyanobacteria in winter of 2010 compared with the winter of 2009. Increases in eukaryotic richness could be traced to increased diversity of prasinophytes and prymnesiophytes. The decrease in cyanobacterial richness was in turn reflected in the trap composition, but the increase in eukaryotes was not, indicating a disproportionate contribution of certain taxa to sinking particle flux.

  16. Characterizing the toxicity of pulsed selenium exposure to Daphnia magna.

    PubMed

    Hoang, Tham C; Klaine, Stephen J

    2008-03-01

    The acute toxicity of selenium (Se) to aquatic biota has been studied extensively for decades. However, most studies have used a constant concentration aqueous exposure of Se to an invertebrate species. Since constant concentration exposure of toxicants to invertebrates is unusual in the environment, episodic exposure or pulsed exposures may represent true risk to aquatic biota more accurately. This research was designed to characterize the toxicity effects of pulsed Se exposure to Daphnia magna. Selenium exposure was varied during a 21-d chronic toxicity test to examine the effects of exposure concentration, duration, and recovery on survival, growth, and reproduction of D. magna. While D. magna did not die during exposures, latent mortality was observed. Latent mortality increased with exposure concentration and duration. Hence, standard toxicity test using continuous exposures would underestimate Se toxicity. Risk assessment method using results of continuous exposure would underestimate risk of Se to biota. For double-pulse exposures, cumulative mortality on day 21 was higher when time interval between pulses was shorter. With the same total exposure time, continuous exposure caused higher toxicity than did pulsed exposures due to recovery and tolerance development in D. magna after earlier pulses. Growth and reproduction of surviving D. magna were not affected by pulsed Se exposure due to recovery of D. magna after removal of the pulses. Based on these results, risk assessment for Se should take latent effects and the effect of recovery in to account. PMID:18190947

  17. Distribution of Virulence Factors and Molecular Fingerprinting of Aeromonas Species Isolates from Water and Clinical Samples: Suggestive Evidence of Water-to-Human Transmission ▿ †

    PubMed Central

    Khajanchi, Bijay K.; Fadl, Amin A.; Borchardt, Mark A.; Berg, Richard L.; Horneman, Amy J.; Stemper, Mary E.; Joseph, Sam W.; Moyer, Nelson P.; Sha, Jian; Chopra, Ashok K.

    2010-01-01

    A total of 227 isolates of Aeromonas obtained from different geographical locations in the United States and different parts of the world, including 28 reference strains, were analyzed to determine the presence of various virulence factors. These isolates were also fingerprinted using biochemical identification and pulse-field gel electrophoresis (PFGE). Of these 227 isolates, 199 that were collected from water and clinical samples belonged to three major groups or complexes, namely, the A. hydrophila group, the A. caviae-A. media group, and the A. veronii-A. sobria group, based on biochemical profiles, and they had various pulsotypes. When virulence factor activities were examined, Aeromonas isolates obtained from clinical sources had higher cytotoxic activities than isolates obtained from water sources for all three Aeromonas species groups. Likewise, the production of quorum-sensing signaling molecules, such as N-acyl homoserine lactone, was greater in clinical isolates than in isolates from water for the A. caviae-A. media and A. hydrophila groups. Based on colony blot DNA hybridization, the heat-labile cytotonic enterotoxin gene and the DNA adenosine methyltransferase gene were more prevalent in clinical isolates than in water isolates for all three Aeromonas groups. Using colony blot DNA hybridization and PFGE, we obtained three sets of water and clinical isolates that had the same virulence signature and had indistinguishable PFGE patterns. In addition, all of these isolates belonged to the A. caviae-A. media group. The findings of the present study provide the first suggestive evidence of successful colonization and infection by particular strains of certain Aeromonas species after transmission from water to humans. PMID:20154106

  18. Gabor filter based fingerprint image enhancement

    NASA Astrophysics Data System (ADS)

    Wang, Jin-Xiang

    2013-03-01

    Fingerprint recognition technology has become the most reliable biometric technology due to its uniqueness and invariance, which has been most convenient and most reliable technique for personal authentication. The development of Automated Fingerprint Identification System is an urgent need for modern information security. Meanwhile, fingerprint preprocessing algorithm of fingerprint recognition technology has played an important part in Automatic Fingerprint Identification System. This article introduces the general steps in the fingerprint recognition technology, namely the image input, preprocessing, feature recognition, and fingerprint image enhancement. As the key to fingerprint identification technology, fingerprint image enhancement affects the accuracy of the system. It focuses on the characteristics of the fingerprint image, Gabor filters algorithm for fingerprint image enhancement, the theoretical basis of Gabor filters, and demonstration of the filter. The enhancement algorithm for fingerprint image is in the windows XP platform with matlab.65 as a development tool for the demonstration. The result shows that the Gabor filter is effective in fingerprint image enhancement technology.

  19. Fingerprinting of Materials

    NASA Technical Reports Server (NTRS)

    Workman, Gary L

    1992-01-01

    Recent issues emerging in our fiscal and ecological environments have promulgated that federal agencies shall promote activities which respond to the improvement of both. In response to these developments, the National Aeronautics and Space Administration (NASA) has undertaken an innovative approach to improve the control of materials used in all NASA manufacturing activities. In concert with this goal, NASA is requiring that its contractors and their sub-contractors perform a more intensive consolidation of technologies that can provide an accounting of materials, which includes in-coming materials, materials in process, end-products and waste materials. The purpose of this handbook is to provide guidelines to NASA and its contractor personnel for the planning and implementation of chemical fingerprinting programs and to illustrate the chemical and statistical fundamentals needed for successful use of chemical fingerprinting.

  20. Fingerprints in the Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1

    This graph, or spectrum, shows the light from a dusty, distant galaxy located 11 billion light-years away. The galaxy is invisible to optical telescopes, but NASA's Spitzer Space Telescope was able to capture the light from it and dozens of other similar galaxies using heat-seeking infrared eyes.

    Spectra are created when an instrument called a spectrograph spreads light out into its basic parts, like a prism turning sunlight into a rainbow. They contain the signatures, or 'fingerprints,' of molecules that contribute to an object's light.

    In this case, the galaxy's spectrum reveals the fingerprint for silicate dust (large dip at right), a planetary building block like sand, only smaller. This particular fingerprint is important because it helped astronomers determine how far away the galaxy lies, or more specifically, how much the galaxy's light had stretched, or 'redshifted,' during its journey to Spitzer's eyes. Because the universe is expanding, a galaxy's light will shift toward reddish wavelengths as it moves away from us. This galaxy was found to have a redshift of 1.95, which means that its light took about 11 billion years to get here.

    The presence of the silicate fingerprint is also significant because it implies that galaxies were ripe for planetary formation 11 billion years ago - back to a time when the universe was 3 billion years old. The universe is currently believed to be 13.5 billion years old. This is the furthest back in time that silicate dust has been detected around a galaxy.

    These data were taken by Spitzer's infrared spectrograph in July, 2004.

  1. Fingerprint + Iris = IrisPrint

    NASA Astrophysics Data System (ADS)

    Othman, Asem; Ross, Arun

    2015-05-01

    We consider the problem of generating a biometric image from two different traits. Specifically, we focus on generating an IrisPrint that inherits its structure from a fingerprint image and an iris image. To facilitate this, the continuous phase of the fingerprint image, characterizing its ridge flow, is first extracted. Next, a scheme is developed to extract "minutiae" from an iris image. Finally, an IrisPrint, that resembles a fingerprint, is created by mixing the ridge flow of the fingerprint with the iris minutiae. Preliminary experiments suggest that the new biometric image (i.e., IrisPrint) (a) can potentially be used for authentication by an existing fingerprint matcher, and (b) can potentially conceal and preserve the privacy of the original fingerprint and iris images.

  2. Petroleum fingerprinting with organic markers

    USGS Publications Warehouse

    Hostettler, Frances D.; Lorenson, T.D.; Bekins, Barbara A.

    2013-01-01

    Petroleum fingerprinting is an invaluable tool in forensic geochemistry. This article summarizes applications of fingerprinting in several oil spills and natural oil seepages that we have studied during the last 25 years. It shows how each unique chemical fingerprint can be used to correlate or differentiate oils. Fingerprints can provide information about processes in the environment that impact oils such as weathering and microbial degradation. They can be used to evaluate organic matter that contributed to oils, and classify oils with regard to the geological framework of their source, such as evaluating geological facies, age, lithology, and depositional environment.

  3. Fingerprinting of Materials: Technical Supplement

    NASA Technical Reports Server (NTRS)

    Workman, Gary L.

    1992-01-01

    This supplement to the Guidelines for Maintaining a Chemical Fingerprinting Program has been developed to assist NASA personnel, contractors, and sub-contractors in defining the technical aspects and basic concepts which can be used in chemical fingerprinting programs. This material is not meant to be totally inclusive to all chemical fingerprinting programs, but merely to present current concepts. Each program will be tailored to meet the needs of the individual organizations using chemical fingerprinting to improve their quality and reliability in the production of aerospace systems.

  4. Development of a Daphnia magna DNA microarray for evaluating the toxicity of environmental chemicals.

    PubMed

    Watanabe, Hajime; Takahashi, Eri; Nakamura, Yuko; Oda, Shigeto; Tatarazako, Norihisa; Iguchi, Taisen

    2007-04-01

    Toxic chemical contaminants have a variety of detrimental effects on various species, and the impact of pollutants on ecosystems has become an urgent issue. However, the majority of studies regarding the effects of chemical contaminants have focused on vertebrates. Among aquatic organisms, Daphnia magna has been used extensively to evaluate organism- and population-level responses of invertebrates to pollutants in acute toxicity or reproductive toxicity tests. Although these types of tests can provide information concerning hazardous concentrations of chemicals, they provide no information about their mode of action. Recent advances in molecular genetic techniques have provided tools to better understand the responses of aquatic organisms to pollutants. In the present study, we adapted some of the techniques of molecular genetics to develop new tools, which form the basis for an ecotoxicogenomic assessment of D. magna. Based on a Daphnia expressed sequence tag database, we developed an oligonucleotide-based DNA microarray with high reproducibility. The DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to several different chemicals: Copper sulfate, hydrogen peroxide, pentachlorophenol, or beta-naphthoflavone. Exposure to these chemicals resulted in characteristic patterns of gene expression that were chemical-specific, indicating that the Daphnia DNA microarray can be used for classification of toxic chemicals and for development of a mechanistic understanding of chemical toxicity on a common freshwater organism. PMID:17447551

  5. Sucralose Induces Biochemical Responses in Daphnia magna

    PubMed Central

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena

    2014-01-01

    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001–5 mg L−1). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology. PMID:24699280

  6. Fossa navicularis magna detection on cone-beam computed tomography.

    PubMed

    Syed, Ali Z; Mupparapu, Mel

    2016-03-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed. PMID:27051639

  7. Responses of Daphnia magna to pulsed exposures of arsenic.

    PubMed

    Hoang, Tham C; Gallagher, Jeffrey S; Klaine, Stephen J

    2007-06-01

    Research on the toxicity of arsenic has focused on sublethal effects that do not provide sufficient information for risk estimation. While most studies have focused on organism response to constant arsenic exposures, organisms in nature are exposed to fluctuating As concentrations. Consequently, results obtained from standardized bioassays with constant exposures may not adequately characterize risk to indigenous biota. This research was designed to characterize the response of Daphnia magna to fluctuating arsenic exposures during 21-day experiments. At concentrations > or =3000 microg/L As, 21-day pulsed exposure mortality increased as a function of exposure concentration and duration. In addition, 21-day pulsed exposure mortality increased with increasing recovery time. Pulsed As exposure did not affect the growth of D. magna over 21 days. Twenty-one day accumulative reproduction of D. magna was only affected by pulsed exposures of high As concentration and long durations. PMID:17497644

  8. Antineoplastic Agents 553. The Texas Grasshopper Brachystola magna1

    PubMed Central

    Pettit, George R.; Meng, Yanhui; Herald, Delbert L.; Knight, John C.; Day, John F.

    2011-01-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) -guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2) and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis (a.k.a. Pancratium littorale Jacq) and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study a crystal of pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1–3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed. PMID:16124772

  9. Antineoplastic agents. 553. The Texas grasshopper Brachystola magna.

    PubMed

    Pettit, George R; Meng, Yanhui; Herald, Delbert L; Knight, John C; Day, John F

    2005-08-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2), and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis), and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1-3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed. PMID:16124772

  10. SMALL SCALE MASS CULTURE OF DAPHNIA MAGNA STRAUS

    SciTech Connect

    Rees, John T.; Oldfather, Joan M.

    1980-03-01

    Daphnia magna Straus 1820 was reared on a defined medium in 4-liter flasks under controlled conditions of light, temperature and species of algal food. Adult D. magna were found to be tolerant to high levels of ammonia, up to 108 {micro}M, at high pH (>10), although parthenogenic reproduction may be inhibited at these high levels. Scenedesmus quadricauda and Ankistrodesmus sp. were found to be satisfactory food sources. Densities of greater than one animal per ml in culture were attained utilizing Ankistrodesmus sp. as a food source at a pH of 7.7. Maintenance of pH at around 7-8 appears to be important to successful D. magna culture.

  11. Fossa navicularis magna detection on cone-beam computed tomography

    PubMed Central

    Mupparapu, Mel

    2016-01-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed. PMID:27051639

  12. Chronic toxicity of 14 phthalate esters to Daphnia magna and rainbow trout (Oncorhynchus mykiss)

    SciTech Connect

    Rhodes, J.E.; Adams, W.J.; Biddinger, G.R.; Robillard, K.A.; Gorsuch, J.W.

    1995-11-01

    Chronic toxicity studies were performed with commercial phthalate esters and Daphnia magna (14 phthalates) and rainbow trout (Oncorhynchus mykiss) (six phthalates). For the lower-molecular-weight phthalate esters--dimethyl phthalate (DMP), diethyl phthalate (DEP), di-n-butyl phthalate (DBP), and butylbenzyl phthalate (BBP)--the results of the studies indicated a general trend in which toxicity for both species increased as water solubility decreased. The geometric mean maximum acceptable toxicant concentration(GM-MATC) for D. magna ranged from 0.63 to 34.8 mg/L. For the higher-molecular-weight phthalate esters--dihexyl phthalate (DHP), butyl 2-ethylhexyl phthalate (BOP), di-(n-hexyl, n-octyl, n-decyl) phthalate (610P), di-(2-ethylhexyl) phthalate (DEHP), diisooctyl phthalate (DIOP), diisononyl phthalate (DINP), di-(heptyl, nonyl, undecyl) phthalate (711P), diisodecyl phthalate (DIDP), diundecyl phthalate (DUP), and ditridecyl phthalate (DTDP)--the GM-MATC values ranged from 0.042 to 0.15 mg/L. Survival was equally sensitive and sometimes more sensitive than reproduction. The observed toxicity to daphnids with most of the higher-molecular-weight phthalate esters appeared to be due to surface entrapment or a mode of toxicity that is not due to exposure to dissolved aqueous-phase chemical. Early life-stage toxicity studies with rainbow trout indicated that survival (DMP) and growth (DBP) were affected at 24 and 0.19 mg/L, respectively. This pattern of observed toxicity with the lower-molecular-weight phthalate esters and not the higher-molecular-weight phthalate esters is consistent with previously reported acute toxicity studies for several aquatic species.

  13. Vibrational fingerprints of the Mn4CaO5 cluster in Photosystem II by mixed quantum-classical molecular dynamics.

    PubMed

    Bovi, Daniele; Capone, Matteo; Narzi, Daniele; Guidoni, Leonardo

    2016-10-01

    A detailed knowledge of the structures of the catalytic steps along the Kok-Joliot cycle of Photosystem II may help to understand the strategies adopted by this unique enzyme to achieve water oxidation. Vibrational spectroscopy has probed in the last decades the intermediate states of the catalytic cycle, although the interpretation of the data turned out to be often problematic. In the present work we use QM/MM molecular dynamics on the S2 state to obtain the vibrational density of states at room temperature. To help the interpretation of the computational and experimental data we propose a decomposition of the Mn4CaO5 moiety into five separate parts, composed by "diamond" motifs involving four atoms. The spectral signatures arising from this analysis can be easily interpreted to assign experimentally known bands to specific molecular motions. In particular, we focused in the low frequency region of the vibrational spectrum of the S2 state. We can therefore identify the observed bands around 600-620cm(-1) as characteristic for the stretching vibrations involving Mn1-O1-Mn2 or Mn3-O5 moieties. PMID:27444240

  14. Importance of metallothioneins in the cadmium detoxification process in Daphnia magna.

    PubMed

    Fraysse, B; Geffard, O; Berthet, B; Quéau, H; Biagianti-Risbourg, S; Geffard, A

    2006-11-01

    Good knowledge of the relationship between toxic metals and biological systems, particularly the sub-cellular fraction, could be a suitable early indicator of toxic effects. These effects and the sub-cellular behaviour of cadmium were studied with a widely used species in freshwater toxicity bioassays, Daphnia magna. In spite of this very commonplace usage in ecotoxicological studies, very few data are available on its toxicant metabolism and in particular metal homeostasis. Combining multi-tools analysis, a soluble protein was found: it is heat-stable, rich in sulfhydryl groups (differential pulse polarography), characterised by a molecular mass of approximately 6.5 kDa, with a G-75 chromatographic profile corresponding to the rabbit metallothioneins monomer, with few if any aromatic-containing amino acids, it binds metals (e.g. Cd, Cu), and its concentration increases with Cd exposure. This evidence led us to hypothesise that metallothioneins (MTs) are present in D. magna. Up to 75% of the Cd body burden with Cd exposure is bound to the MTs fraction. The increase in the Cd concentration in the surrounding medium and concomitantly in daphnids induces sub-cellular reorganisation of essential metals such as Cu and Zn. The rate of metals in the soluble cellular fraction and associated with MTs increases with the Cd body burden. Monitoring sub-cellular distribution of metals after exposure in the natural environment could be very useful for ecotoxicological assessment. PMID:17113354

  15. Fluorescence fingerprints of Eisenia fetida and Eisenia andrei.

    PubMed

    Albani, J R; Demuynck, S; Grumiaux, F; Leprêtre, A

    2003-12-01

    We describe a fluorescent method that allows to differentiate the worms Eisenia fetida and Eisenia andrei. In fact, the coelomic fluid of E. andrei displays specific fluorescence absent in that of E. fetida. The two species do not metabolize the same types of molecules and thus can be differentiated at the molecular level. Each species has specific fluorescence fingerprints. PMID:14743869

  16. Video-Based Fingerprint Verification

    PubMed Central

    Qin, Wei; Yin, Yilong; Liu, Lili

    2013-01-01

    Conventional fingerprint verification systems use only static information. In this paper, fingerprint videos, which contain dynamic information, are utilized for verification. Fingerprint videos are acquired by the same capture device that acquires conventional fingerprint images, and the user experience of providing a fingerprint video is the same as that of providing a single impression. After preprocessing and aligning processes, “inside similarity” and “outside similarity” are defined and calculated to take advantage of both dynamic and static information contained in fingerprint videos. Match scores between two matching fingerprint videos are then calculated by combining the two kinds of similarity. Experimental results show that the proposed video-based method leads to a relative reduction of 60 percent in the equal error rate (EER) in comparison to the conventional single impression-based method. We also analyze the time complexity of our method when different combinations of strategies are used. Our method still outperforms the conventional method, even if both methods have the same time complexity. Finally, experimental results demonstrate that the proposed video-based method can lead to better accuracy than the multiple impressions fusion method, and the proposed method has a much lower false acceptance rate (FAR) when the false rejection rate (FRR) is quite low. PMID:24008283

  17. Molecular Fingerprinting by PCR-Denaturing Gradient Gel Electrophoresis Reveals Differences in the Levels of Microbial Diversity for Musty-Earthy Tainted Corks ▿

    PubMed Central

    Prat, Chantal; Ruiz-Rueda, Olaya; Trias, Rosalia; Anticó, Enriqueta; Capone, Dimitra; Sefton, Mark; Bañeras, Lluís

    2009-01-01

    The microbial community structure of cork with marked musty-earthy aromas was analyzed using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Cork stoppers and discs were used for DNA extraction and were analyzed by using selective primers for bacteria and fungi. Stoppers clearly differed from discs harboring a different fungal community. Moreover, musty-earthy samples of both types were shown to have a specific microbiota. The fungi Penicillium glabrum and Neurospora spp. were present in all samples and were assumed to make only a small contribution to off-odor development. In contrast, Penicillium islandicum and Penicillium variabile were found almost exclusively in 2,4,6-trichloroanisole (TCA) tainted discs. Conversely, Rhodotorula minuta and Rhodotorula sloofiae were most common in cork stoppers, where only small amounts of TCA were detected. Alpha- and gammaproteobacteria were the most commonly found bacteria in either control or tainted cork stoppers. Specific Pseudomonas and Actinobacteria were detected in stoppers with low amounts of TCA and 2-methoxy-3,5-dimethylpyrazine. These results are discussed in terms of biological degradation of taint compounds by specific microorganisms. Reliable and straightforward microbial identification methods based on a molecular approach provided useful data to determine and evaluate the risk of taint formation in cork. PMID:19201983

  18. Influence of Skin Diseases on Fingerprint Recognition

    PubMed Central

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  19. Influence of skin diseases on fingerprint recognition.

    PubMed

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  20. Magna Carta at 800: Ten Key Questions Answered

    ERIC Educational Resources Information Center

    Kaplan, Howard

    2014-01-01

    2015 marks the 800th anniversary of Magna Carta. For Americans, this iconic document is a formative element of our own legal and political heritage. This "Lessons on the Law" column offers an overview of the "Great Charter," why it is significant, and what students and teachers should know about it. The article also highlights…

  1. Efficacy of clorsulon against Fascioloides magna infection in sheep.

    PubMed

    Conboy, G A; Stromberg, B E; Schlotthauer, J C

    1988-04-01

    In a study to evaluate the efficacy of clorsulon against Fascioloides magna infection in sheep, 12 ewes were inoculated orally with 100 metacercariae of F magna, and 6 were treated with clorsulon (15 mg/kg of body weight) 8 weeks after inoculation. The sheep were euthanatized 16 weeks after inoculation, flukes were recovered, and the liver and other tissues were subjectively scored for the severity of lesions (0 to 4+). The number of flukes recovered from the clorsulon-treated group (3.8 +/- 1.2 flukes) was significantly (P = 0.025) lower than the number of flukes recovered from the group of untreated controls (10.0 +/- 6.6 flukes). The severity of lesions was significantly (P = 0.004) reduced (45.9%) in the treated group (2.0 +/- 1.1), compared with that in the untreated controls (3.7 +/- 0.5). In the untreated group, 3 sheep died and 1 became moribund 14 to 16 weeks after inoculation. The data suggested that a single treatment with clorsulon at a dosage of 15 mg/kg 8 weeks after inoculation was not effective in preventing F magna infection in sheep, because the survival of only a few F magna is potentially fatal in sheep within 6 months after infection. PMID:3366676

  2. Magna Carta: Teaching Medieval Topics for Historical Significance

    ERIC Educational Resources Information Center

    Metzger, Scott Alan

    2010-01-01

    The Middle Ages are an immensely important era in the Western experience. Unfortunately, medieval studies are often marginalized or trivialized in school curriculum. With the approach of the 800th anniversary of Magna Carta, the famous charter of rights from medieval England, one has a timely and useful example for considering what a focus on…

  3. Coprologically diagnosing Anoplocephala perfoliata in the presence of A. magna.

    PubMed

    Bohórquez, Alejandro; Meana, Aránzazu; Pato, Nélida F; Luzón, Mónica

    2014-08-29

    Current copro-diagnostic tests for Anoplocephala perfoliata show high variation in their sensitivity and given the morphological similarity of Anoplocephala spp. eggs, this could be related to the presence of Anoplocephala magna alone or co-existing with A. perfoliata. In the present study, coprology was significantly more sensitive (p<0.01) at detecting A. magna than A. perfoliata. This difference was independent of the parasite burden and was greater when testing was limited to horses with mature or gravid tapeworms. A. magna infection was strongly linked to young horses (≤ 2 years). The eggs of A. magna are smaller. Using 15 and 70 μm cut-offs for oncosphere diameter and the major shell bisector length, respectively, the eggs of A. perfoliata were identified with 100% sensitivity, 97% specificity and 98% sensitivity, 84% specificity. The use of these two morphometric variables would therefore be useful for the copro-identification of A. perfoliata in countries where both species coexist. PMID:24877786

  4. Fingerprinting dark energy

    SciTech Connect

    Sapone, Domenico; Kunz, Martin

    2009-10-15

    Dark energy perturbations are normally either neglected or else included in a purely numerical way, obscuring their dependence on underlying parameters like the equation of state or the sound speed. However, while many different explanations for the dark energy can have the same equation of state, they usually differ in their perturbations so that these provide a fingerprint for distinguishing between different models with the same equation of state. In this paper we derive simple yet accurate approximations that are able to characterize a specific class of models (encompassing most scalar-field models) which is often generically called 'dark energy'. We then use the approximate solutions to look at the impact of the dark energy perturbations on the dark matter power spectrum and on the integrated Sachs-Wolfe effect in the cosmic microwave background radiation.

  5. Single-qubit optical quantum fingerprinting.

    PubMed

    Horn, Rolf T; Babichev, S A; Marzlin, Karl-Peter; Lvovsky, A I; Sanders, Barry C

    2005-10-01

    We analyze and demonstrate the feasibility and superiority of linear optical single-qubit fingerprinting over its classical counterpart. For one-qubit fingerprinting of two-bit messages, we prepare "tetrahedral" qubit states experimentally and show that they meet the requirements for quantum fingerprinting to exceed the classical capability. We prove that shared entanglement permits 100% reliable quantum fingerprinting, which will outperform classical fingerprinting even with arbitrary amounts of shared randomness. PMID:16241707

  6. DNA fingerprinting of medically important microorganisms by use of PCR.

    PubMed Central

    van Belkum, A

    1994-01-01

    Selected segments of any DNA molecule can be amplified exponentially by PCR. This technique provides a powerful tool to detect and identify minimal numbers of microorganisms. PCR is applicable both in diagnosis and in epidemiology. By amplification of hypervariable DNA domains, differences can be detected even among closely related strains. PCR fingerprinting is a valuable tool for medical microbiologists, epidemiologists, and microbial taxonomists. The current state of PCR-mediated genotyping is reviewed, and a comparison with conventional molecular typing methods is included. Because of its speed and versatility, PCR fingerprinting will play an important role in microbial genetics, epidemiology, and systematics. Images PMID:8055466

  7. Fascioloides magna--epizootiology in a deer farm in Germany.

    PubMed

    Plötz, Cornelia; Rehbein, Steffen; Bamler, Helmut; Reindl, Hubert; Pfister, Kurt; Scheuerle, Miriam C

    2015-01-01

    After initial observations of suspicious cases in 2009, the occurrence of Fascioloides (F.) magna in deer of a deer farm located in northeastern Bavaria, Germany, at the border to the Czech Republic was confirmed in autumn 2011. In March 2012, the deer were treated for fascioloidosis with triclabendazole. To monitor the epizootiology of fascioloidosis in the farm, 80-100 faecal samples were examined for Fascioloides eggs at monthly intervals from June 2012 to June 2013 inclusive. In addition, livers of 27 red deer and one sika deer collected during winter 2012/2013 were examined for gross lesions suspicious for F. magna infection and 21 of the 28 livers were dissected for F. magna recovery. Fascioloides eggs were recorded in 63 (4.9%) of 1280 faecal samples (range 0.4 to 355 eggs per gram). Both, number of Fascioloides-egg positive samples and egg counts were low during the first eight months of the study but increased notably since February 2013. While Fascioloides egg-positive faecal samples were obtained from red deer (46/948,4.9%) and fallow deer (17/166, 10.2%), no Fascioloides eggs were demonstrated in the 166 samples obtained from sika deer. Livers of five red deer and the sika deer showed gross lesions characteristic for fascioloidosis, and F. magna were recovered from three of the five affected red deer livers (range, five to seven flukes). Results of this study confirm that F. magna is endemic in the deer farm, and measures should be implemented to minimize the transmission of the parasite. PMID:26054221

  8. Filterbank-based fingerprint matching.

    PubMed

    Jain, A K; Prabhakar, S; Hong, L; Pankanti, S

    2000-01-01

    With identity fraud in our society reaching unprecedented proportions and with an increasing emphasis on the emerging automatic personal identification applications, biometrics-based verification, especially fingerprint-based identification, is receiving a lot of attention. There are two major shortcomings of the traditional approaches to fingerprint representation. For a considerable fraction of population, the representations based on explicit detection of complete ridge structures in the fingerprint are difficult to extract automatically. The widely used minutiae-based representation does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Further, minutiae-based matching has difficulty in quickly matching two fingerprint images containing a different number of unregistered minutiae points. The proposed filter-based algorithm uses a bank of Gabor filters to capture both local and global details in a fingerprint as a compact fixed length FingerCode. The fingerprint matching is based on the Euclidean distance between the two corresponding FingerCodes and hence is extremely fast. We are able to achieve a verification accuracy which is only marginally inferior to the best results of minutiae-based algorithms published in the open literature. Our system performs better than a state-of-the-art minutiae-based system when the performance requirement of the application system does not demand a very low false acceptance rate. Finally, we show that the matching performance can be improved by combining the decisions of the matchers based on complementary (minutiae-based and filter-based) fingerprint information. PMID:18255456

  9. A multi-fingerprint browser for the ZINC database

    PubMed Central

    Awale, Mahendra; Reymond, Jean-Louis

    2014-01-01

    To confirm the activity of an initial small molecule ‘hit compound’ from an activity screening, one needs to probe the structure–activity relationships by testing close analogs. The multi-fingerprint browser presented here (http://dcb-reymond23.unibe.ch:8080/MCSS/) enables one to rapidly identify such close analogs among commercially available compounds in the ZINC database (>13 million molecules). The browser retrieves nearest neighbors of any query molecule in multi-dimensional chemical spaces defined by four different fingerprints, each of which represents relevant structural and pharmacophoric features in a different way: sFP (substructure fingerprint), ECFP4 (extended connectivity fingerprint), MQNs (molecular quantum numbers) and SMIfp (SMILES fingerprint). Distances are calculated using the city-block distance, a similarity measure that performs as well as Tanimoto similarity but is much faster to compute. The list of up to 1000 nearest neighbors of any query molecule is retrieved by the browser and can be then clustered using the K-means clustering algorithm to produce a focused list of analogs with likely similar bioactivity to be considered for experimental evaluation. PMID:24782520

  10. Spectral fingerprinting of soil organic matter composition

    NASA Astrophysics Data System (ADS)

    Cecillon, L.; Certini, G.; Lange, H.; Forte, C.; Strand, L. T.

    2009-04-01

    The determination of soil organic matter (SOM) composition relies on a variety of chemical and physical methods, most of them time consuming and expensive. Hitherto, such methodological limitations have hampered the use of detailed SOM composition in process-based models of SOM dynamics, which usually include only three poorly defined carbon pools. Here we show a novel approach merging both near and mid infrared spectroscopy into a single fingerprint for an expeditious prediction of the molecular composition of organic materials in soil, as inferred from a molecular mixing model (MMM) based on 13C nuclear magnetic resonance (NMR), which describes SOM as a mixture of common biologically derived polymers. Infrared and solid-state 13C NMR spectroscopic measurements were performed on a set of mineral and organic soil samples presenting a wide range of organic carbon content (2 to 500 g kg-1), collected in a boreal heathland (Storgama, Norway). The implementation of the MMM using 13C NMR spectra allowed the calculation of five main biochemical components (carbohydrate, protein, lignin, lipids and black carbon) for each sample. Partial least squares regression models were developed for the five biopolymers using outer product analysis of near and mid infrared spectra (Infrared-OPA). All models reached ratios of performance to deviation (RPD) above 2 and specific infrared wavenumbers associated to each biochemical component were identified. Our results demonstrate that Infrared-OPA provides a robust and cost-effective fingerprint of SOM composition that could be useful for the routine assessment of soil carbon pools.

  11. Accumulation of dieldrin in an alga (Scenedesmus obliquus), Daphnia magna, and the guppy (Poecilia reticulata)

    USGS Publications Warehouse

    Reinert, Robert E.

    1972-01-01

    Scenedesmus obliquus, Daphnia magna, and Poecilia reticulata accumulated dieldrin directly from water; average concentration factors (concentration in organism, dry weight, divided by concentration in water) were 1282 for the alga, 13,954 for D. magna, and 49,307 (estimated) for the guppy. The amount accumulated by each species at equilibrium (after about 1.5, 3-4, and 18 days, respectively) was directly proportional to the concentration of dieldrin in the water. Daphnia magna and guppies accumulated more dieldrin from water than from food that had been exposed to similar concentrations in water. When guppies were fed equal daily rations of D. magna containing different concentrations of insecticide, the amounts of dieldrin accumulated by the fish were directly proportional to the concentration in D. magna; when two lots of guppies were fed different quantities of D. magna (10 and 20 organisms per day) containing identical concentrations of dieldrin, however, the amounts accumulated did not differ substantially.

  12. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis

    PubMed Central

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F.; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  13. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    PubMed

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  14. Robust efficient video fingerprinting

    NASA Astrophysics Data System (ADS)

    Puri, Manika; Lubin, Jeffrey

    2009-02-01

    We have developed a video fingerprinting system with robustness and efficiency as the primary and secondary design criteria. In extensive testing, the system has shown robustness to cropping, letter-boxing, sub-titling, blur, drastic compression, frame rate changes, size changes and color changes, as well as to the geometric distortions often associated with camcorder capture in cinema settings. Efficiency is afforded by a novel two-stage detection process in which a fast matching process first computes a number of likely candidates, which are then passed to a second slower process that computes the overall best match with minimal false alarm probability. One key component of the algorithm is a maximally stable volume computation - a three-dimensional generalization of maximally stable extremal regions - that provides a content-centric coordinate system for subsequent hash function computation, independent of any affine transformation or extensive cropping. Other key features include an efficient bin-based polling strategy for initial candidate selection, and a final SIFT feature-based computation for final verification. We describe the algorithm and its performance, and then discuss additional modifications that can provide further improvement to efficiency and accuracy.

  15. Effect of Fascioloides magna (Digenea) on fecundity, shell height, and survival rate of Pseudosuccinea columella (Lymnaeidae).

    PubMed

    Pankrác, Jan; Novobilský, Adam; Rondelaud, Daniel; Leontovyč, Roman; Syrovátka, Vít; Rajský, Dušan; Horák, Petr; Kašný, Martin

    2016-08-01

    Infection with Fascioloides magna (Digenea) causes serious damage to liver tissue in definitive hosts represented by ruminants, especially cervids. The distribution of F. magna includes the indigenous areas in North America, and the areas to which F. magna was introduced-Central Europe, Southeast Europe, and Italy. The North American intermediate host of F. magna, the freshwater snail Pseudosuccinea columella (Lymnaeidae), is an invasive species recorded in South America, the Caribbean, Africa, Australia, and west and Southeast Europe. In Europe, Galba truncatula is the snail serving for transmission, but P. columella has potential to become here a new intermediate host of F. magna. Little is known about interactions between F. magna and P. columella. In this study, the susceptibility of P. columella (Oregon, USA) to the infection by a single miracidium of the Czech strain of F. magna and the influence of F. magna on snail fecundity, shell height, and survival were evaluated. The data show that the Oregon strain of P. columella is a highly suitable host for the Czech strain of F. magna, with the infection rate of 74 %. In addition, a negative effect on survival rate of infected snails was recorded only in the late phase of infection. The infection was accompanied by a major reduction in egg mass production and by a decrease in the number of eggs per egg mass. The shell height of infected snails did not significantly differ from that in unexposed controls. PMID:27098161

  16. Multigenerational cadmium acclimation and biokinetics in Daphnia magna.

    PubMed

    Guan, Rui; Wang, Wen-Xiong

    2006-05-01

    A Cd exposure (3 microg L(-1)) experiment was conducted for six successive generations to investigate the responses to chronic Cd stress in Daphnia magna. We observed a biphasic accumulation of Cd in the six generations and suggested a similar pattern with respect to daphnids' tolerance. Cd assimilation efficiencies, daphnid growth, and reproduction corresponded to the changes of tolerance, which was partially accounted for by metallothionein induction. When maternally exposed neonates grew in Cd-free water for one or two generations, their growth, MT concentration and biokinetic parameters partially or totally recovered. The rapid recovery suggests the high potential for ecological restoration from Cd pollution. Our results indicate that the tolerance of sensitive D. magna clones to Cd was dependent on long-term or multigenerational exposure. The tolerance developed within the first several generations might not be maintained, and the animals may become even more sensitive to Cd stress in subsequent generations. PMID:16202491

  17. Effect of lindane on the clearance rate of daphnia magna

    PubMed

    Hartgers; Heugens; Deneer

    1999-05-01

    The impact of the insecticide lindane (gamma-hexachlorocyclohexane) on the clearance rate (CR) of Daphnia magna was investigated using artificial beads. CR (24-h EC50: 65 &mgr;g L-1) was found to be a more sensitive endpoint than acute lethality for D. magna (48-h LC50: 516 &mgr;g L-1). The onset of the effect was rapid; after 2 h of exposure to approximately 241 &mgr;g L-1 of lindane a significant decrease in CR was observed. Daphnids recovered rapidly after transfer to clean water; after 24 h of exposure to approximately 250 &mgr;g L-1 lindane, transfer into clean water resulted in recovery to 80% of control levels within 2 h and complete recovery within 24 h. PMID:10227859

  18. Chronic toxicity of biphenyl to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Bartlett, E.A.; Murphy, P.G.; Milazzo, D.P. )

    1989-09-01

    The US Environmental Protection Agency (EPA) issued a final test rule (1985) for biphenyl on the authority of Section 4(a) of the Toxic Substances Control Act (TSCA). Contained within this rule was the requirement for generating chronic daphnid toxicity data for biphenyl. Biphenyl is used primarily to produce dye carriers, heat-transfer fluids and alkylated biphenyls. The acute toxicity of biphenyl to Daphnia magna has been reported. The 48-hr LC50 values were 4.7 and 2.1 mg/L, respectively. To date, the chronic toxicity of biphenyl to fish and aquatic invertebrates has not been investigated. The objective of this study was to determine the chronic toxicity of biphenyl to D. magna. The daphnid chronic toxicity test is designed to estimate the maximum acceptable toxicant concentration (MATC). The MATC is defined as the concentration falling between the highest concentration showing no effect and the next higher concentration showing a toxic effect when compared to the controls.

  19. Acute toxicity and QSAR of chlorophenols on Daphnia magna

    SciTech Connect

    Devillers, J.; Chambon, P.

    1986-10-01

    Chlorophenols which are released into natural waters from various industrial processes and from agricultural uses have been recognized as a group of chemical substances potentially hazardous to the aquatic environment. Therefore it is important to estimate their toxic impact on biota. Thus, the scope of this research was to obtain acute toxicity data for seventeen chlorophenols towards Daphnia magna and to explore the possibilities of deriving QSAR's (quantitative structure-activity relationship) from the above values.

  20. Chapelieria magna, a new species of Rubiaceae from eastern Madagascar

    PubMed Central

    Kainulainen, Kent; Razafimandimbison, Sylvain G.

    2015-01-01

    Abstract A new species of Chapelieria was discovered during a recent field trip to the Masoala National Park in eastern Madagascar, and is described here as Chapelieria magna Kainul., sp. nov. This species is readily distinguishable from previously described species of the genus by its quadrangular shoots, triangular-calyptrate stipules, sessile leaves, pubescent styles, and ridged fruits. It also differs in the larger number of ovules and the much larger size of leaves and fruits. PMID:25698895

  1. Spectral Fingerprints of Habitability

    NASA Astrophysics Data System (ADS)

    Kaltenegger, L.; Selsis, F.

    2010-01-01

    The emerging field of extrasolar planet search has shown an extraordinary ability to combine research by astrophysics, chemistry, biology and geophysics into a new and exciting interdisciplinary approach to understand our place in the universe. Are there other worlds like ours? How can we characterize those planets and assess if they are habitable? After a decade rich in giant exoplanet detections, observation techniques have now reached the ability to find planets of less than 10 M_Earth (so called Super-Earths) that may potentially be habitable. The detection and characterization of Earth-like planet is approaching rapidly with dedicated space observatories already in operation (Corot) or in development phase (Kepler, James Webb Space Telescope, Extremely Large Telescope (ELT), Darwin/TPF). Space missions like CoRoT (CNES, Rouan et al. 1998) and Kepler (NASA, Borucki et al. 1997) will give us statistics on the number, size, period and orbital distance of planets, extending to terrestrial planets on the lower mass range end as a first step, while missions like Darwin/TPF are designed to characterize their atmospheres. In this chapter we discuss how we can read a planet's spectral fingerprint and characterize if it is potentially habitable. We discuss the first steps to detect a habitable planet and set biomarker detection in context in Section 1. In Section 2 we focus on biomarkers, their signatures at different wavelengths, abiotic sources and cryptic photosynthesis - using Earth as our primary example - the only habitable planet we know of so far. Section 3 concentrates on planets around different stars, and Section 4 summarizes the chapter.

  2. Daphnia magna ecotoxicogenomics provides mechanistic insights into metal toxicity.

    PubMed

    Poynton, Helen C; Varshavsky, Julia R; Chang, Bonnie; Cavigiolio, Giorgio; Chan, Sarah; Holman, Patricia S; Loguinov, Alexandre V; Bauer, Darren J; Komachi, Kelly; Theil, Elizabeth C; Perkins, Edward J; Hughes, Owen; Vulpe, Chris D

    2007-02-01

    Toxicogenomics has provided innovative approaches to chemical screening, risk assessment, and predictive toxicology. If applied to ecotoxicology, genomics tools could greatly enhance the ability to understand the modes of toxicity in environmentally relevant organisms. Daphnia magna, a small aquatic crustacean, is considered a "keystone" species in ecological food webs and is an indicator species for toxicant exposure. Our objective was to demonstrate the potential utility of gene expression profiling in ecotoxicology by identifying novel biomarkers and uncovering potential modes of action in D. magna. Using a custom D. magna cDNA microarray, we identified distinct expression profiles in response to sublethal copper, cadmium, and zinc exposures and discovered specific biomarkers of exposure including two probable metallothioneins, and a ferritin mRNA with a functional IRE. The gene expression patterns support known mechanisms of metal toxicity and reveal novel modes of action including zinc inhibition of chitinase activity. By integrating gene expression profiling into an environmentally important organism, this study provides experimental support for the utility of ecotoxicogenomics. PMID:17328222

  3. Fingerprint fake detection by optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

    2013-03-01

    The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

  4. Phototoxic effects of titanium dioxide nanoparticles on Daphnia magna

    NASA Astrophysics Data System (ADS)

    Mansfield, Charles M.

    Titanium dioxide nanoparticles (TiO2-NP) are one of the most abundantly utilized nanomaterials in the world. Studies have demonstrated the mechanism of acute toxicity in TiO2-NP to be the production of reactive oxygen species (ROS) leading to oxidative stress and mortality in exposed organisms. It has also been demonstrated that the anatase crystalline conformation is capable of catalyzing the cleavage of water molecules to further increase the concentration of ROS in the presence of ultraviolet radiation. This photoenhanced toxicity significantly lowers the toxicity threshold of TiO2-NP to environmentally relevant concentrations (ppb). The goal of this study was to determine whether dietary uptake and accumulation of TiO2-NP in the aquatic filter feeder Daphnia magna resulted in photoenhanced toxicity. D. magna and S. caprincornatum were exposed to aqueous solutions of 20ppm and 200ppm TiO2-NP for 24hrs and then transferred to clean moderately hard water. Samples were taken at various time points, dried, and TiO 2 quantified using ICP-MS. Toxicity assays were run on D. magna using three TiO2-NP (20ppm, 200ppm) exposure protocols and two ultraviolet radiation treatments. The first exposure group was exposed to aqueous solutions of TiO2-NP for the duration of the test. The second exposure group was exposed to TiO2-NP for an hour and then transferred to clean water. The third exposure group was fed S. capricornatum that had been allowed to adsorb TiO2-NP. All samples were then placed in an outdoor UV exposure system and exposed to either full spectrum sunlight (with UV) or filtered sunlight (no UV). Here we show that TiO2 uptake peaked at one hour of exposure likely due to sedimentation of the particles out of suspension, thus decreasing bioavailability for the duration of the test. Interestingly, when D. magna were moved to clean water, aqueous concentrations of TiO2 increase as a result of depuration from the gut tract. Data also suggests these excreted particles

  5. Detection and Rectification of Distorted Fingerprints.

    PubMed

    Si, Xuanbin; Feng, Jianjiang; Zhou, Jie; Luo, Yuxuan

    2015-03-01

    Elastic distortion of fingerprints is one of the major causes for false non-match. While this problem affects all fingerprint recognition applications, it is especially dangerous in negative recognition applications, such as watchlist and deduplication applications. In such applications, malicious users may purposely distort their fingerprints to evade identification. In this paper, we proposed novel algorithms to detect and rectify skin distortion based on a single fingerprint image. Distortion detection is viewed as a two-class classification problem, for which the registered ridge orientation map and period map of a fingerprint are used as the feature vector and a SVM classifier is trained to perform the classification task. Distortion rectification (or equivalently distortion field estimation) is viewed as a regression problem, where the input is a distorted fingerprint and the output is the distortion field. To solve this problem, a database (called reference database) of various distorted reference fingerprints and corresponding distortion fields is built in the offline stage, and then in the online stage, the nearest neighbor of the input fingerprint is found in the reference database and the corresponding distortion field is used to transform the input fingerprint into a normal one. Promising results have been obtained on three databases containing many distorted fingerprints, namely FVC2004 DB1, Tsinghua Distorted Fingerprint database, and the NIST SD27 latent fingerprint database. PMID:26353261

  6. Forensic Chemistry: The Revelation of Latent Fingerprints

    ERIC Educational Resources Information Center

    Friesen, J. Brent

    2015-01-01

    The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

  7. Group-Oriented Fingerprinting for Multimedia Forensics

    NASA Astrophysics Data System (ADS)

    Wang, Z. Jane; Wu, Min; Trappe, Wade; Liu, K. J. Ray

    2004-12-01

    Digital fingerprinting of multimedia data involves embedding information in the content signal and offers protection to the digital rights of the content by allowing illegitimate usage of the content to be identified by authorized parties. One potential threat to fingerprinting is collusion, whereby a group of adversaries combine their individual copies in an attempt to remove the underlying fingerprints. Former studies indicate that collusion attacks based on a few dozen independent copies can confound a fingerprinting system that employs orthogonal modulation. However, in practice an adversary is more likely to collude with some users than with other users due to geographic or social circumstances. To take advantage of prior knowledge of the collusion pattern, we propose a two-tier group-oriented fingerprinting scheme where users likely to collude with each other are assigned correlated fingerprints. Additionally, we extend our construction to represent the natural social and geographic hierarchical relationships between users by developing a more flexible tree-structure-based fingerprinting system. We also propose a multistage colluder identification scheme by taking advantage of the hierarchial nature of the fingerprints. We evaluate the performance of the proposed fingerprinting scheme by studying the collusion resistance of a fingerprinting system employing Gaussian-distributed fingerprints. Our results show that the group-oriented fingerprinting system provides the superior collusion resistance over a system employing orthogonal modulation when knowledge of the potential collusion pattern is available.

  8. Fingerprints in the Dust

    NASA Technical Reports Server (NTRS)

    2001-01-01

    These MISR nadir-camera images of eastern China compare a somewhat hazy summer view from July 9, 2000 (left) with a spectacularly dusty spring view from April 7, 2001 (middle). The left-hand and middle images are from Terra orbits 2967 and 6928, respectively, and extend from central Manchuria near the top to portions of North and South Korea at the bottom. They are approximately 380 kilometers in width.

    Asia's desert areas are prone to soil erosion, as underground water tables are lowered by prolonged drought and by industrial and agricultural water use. Heavy winds blowing eastward across the arid and sparsely vegetated surfaces of Mongolia and western China pick up large quantities of yellow dust. Airborne dust clouds from the April 2001 storm blew across the Pacific Ocean and were carried as far as North America. The minerals transported in this manner are believed to provide nutrients for both oceanic and land ecosystems.

    According to the Xinhua News Agency in China, nearly one million tons of Gobi Desert dust blow into Beijing each year. During a similar dust outbreak last year, the Associated Press reported that the visibility in Beijing had been reduced the point where buildings were barely visible across city streets, and airline schedules were significantly disrupted. The dust has also been implicated in adverse health effects such as respiratory discomfort and eye irritation.

    The image on the right is a higher resolution MISR nadir-camera view of a portion of the April 7, 2001 dust cloud. It covers an area roughly 250 kilometers wide by 470 kilometers high. When viewed at full magnification, a number of atmospheric wave features, like the ridges and valleys of a fingerprint, are apparent. These are probably induced by surface topography, which can disturb the wind flow. A few small cumulus clouds are also visible, and are casting shadows on the thick lower dust layer.

    Analyses of images such as these constitute one phase of MISR

  9. Evolving transcriptomic fingerprint based on genome‐wide data as prognostic tools in prostate cancer

    PubMed Central

    Schliekelman, Mark; Shin, Heesun; Erho, Nicholas; Davicioni, Elai

    2015-01-01

    Background Information Prostate cancer (PCa) is a common disease but only a small subset of patients are at risk of developing metastasis and lethal disease, and identifying which patients will progress is challenging because of the heterogeneity underlying tumour progression. Understanding this heterogeneity at the molecular level and the resulting clinical impact is a critical step necessary for risk stratification. Defining genomic fingerprint elucidates molecular variation and may improve PCa risk stratification, providing more accurate prognostic information of tumour aggressiveness (or lethality) for prognostic biomarker development. Therefore, we explored transcriptomic differences between patients with indolent disease outcome and patients who developed metastasis post‐radical prostatectomy using genome‐wide expression data in the post radical prostatectomy clinical space before metastatic spread. Results Based on differential expression analysis, patients with adverse pathological findings who are at higher risk of developing metastasis have a distinct transcriptomic fingerprint that can be detected on surgically removed prostate specimens several years before metastasis detection. Nearly half of the transcriptomic fingerprint features were non‐coding RNA highlighting their pivotal role in PCa progression. Protein‐coding RNA features in the fingerprint are involved in multiple pathways including cell cycle, chromosome structure maintenance and cytoskeleton organisation. The metastatic transcriptomic fingerprint was determined in independent cohorts verifying the association between the fingerprint and metastatic patients. Further, the fingerprint was confirmed in metastasis lesions demonstrating that the fingerprint represents early metastatic transcriptomic changes, suggesting its utility as a prognostic tool to predict metastasis and provide clinical value in the early radical prostatectomy setting. Conclusions Here, we show that transcriptomic

  10. Network fingerprint: a knowledge-based characterization of biomedical networks

    PubMed Central

    Cui, Xiuliang; He, Haochen; He, Fuchu; Wang, Shengqi; Li, Fei; Bo, Xiaochen

    2015-01-01

    It can be difficult for biomedical researchers to understand complex molecular networks due to their unfamiliarity with the mathematical concepts employed. To represent molecular networks with clear meanings and familiar forms for biomedical researchers, we introduce a knowledge-based computational framework to decipher biomedical networks by making systematic comparisons to well-studied “basic networks”. A biomedical network is characterized as a spectrum-like vector called “network fingerprint”, which contains similarities to basic networks. This knowledge-based multidimensional characterization provides a more intuitive way to decipher molecular networks, especially for large-scale network comparisons and clustering analyses. As an example, we extracted network fingerprints of 44 disease networks in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The comparisons among the network fingerprints of disease networks revealed informative disease-disease and disease-signaling pathway associations, illustrating that the network fingerprinting framework will lead to new approaches for better understanding of biomedical networks. PMID:26307246

  11. Interspecific Differences between D. pulex and D. magna in Tolerance to Cyanobacteria with Protease Inhibitors

    PubMed Central

    Kuster, Christian J.; Von Elert, Eric

    2013-01-01

    It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids’ tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC− contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC−, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease inhibitors. PMID:23650523

  12. Protective effects of ectoine on heat-stressed Daphnia magna.

    PubMed

    Adam, Bownik; Zofia, Stępniewska; Tadeusz, Skowroński

    2014-12-01

    Ectoine (ECT) is an amino acid produced and accumulated by halophilic bacteria in stressful conditions in order to prevent the loss of water from the cell. There is a lack of knowledge on the effects of ECT in heat-stressed aquatic animals. The purpose of our study was to determine the influence of ECT on Daphnia magna subjected to heat stress with two temperature gradients: 1 and 0.1 °C/min in the range of 23-42 °C. Time to immobilisation, survival during recovery, swimming performance, heart rate, thoracic limb movement and the levels of heat shock protein 70 kDa 1A (HSP70 1A), catalase (CAT) and nitric oxide species (NOx) were determined in ECT-exposed and unexposed daphnids; we showed protective effects of ECT on Daphnia magna subjected to heat stress. Time to immobilisation of daphnids exposed to ECT was longer when compared to the unexposed animals. Also, survival rate during the recovery of daphnids previously treated with ECT was higher. ECT significantly attenuated a rapid increase of mean swimming velocity which was elevated in the unexposed daphnids. Moreover, we observed elevation of thoracic limb movement and modulation of heart rate in ECT-exposed animals. HSP70 1A and CAT levels were reduced in the presence of ECT. On the other hand, NOx level was slightly elevated in both ECT-treated and unexposed daphnids, however slightly higher NOx level was found in ECT-treated animals. We conclude that the exposure to ectoine has thermoprotective effects on Daphnia magna, however their mechanisms are not associated with the induction of HSP70 1A. PMID:25223383

  13. Increasing toxicity of enrofloxacin over four generations of Daphnia magna.

    PubMed

    Dalla Bona, Mirco; Lizzi, Francesca; Borgato, Arianna; De Liguoro, Marco

    2016-10-01

    The effects of both continuous and alternate exposure to 2mgL(-1) of enrofloxacin (EFX) on survival, growth and reproduction were evaluated over four generations of Daphnia magna. Mortality increased, reaching 100% in most groups by the end of the third generation. Growth inhibition was detected in only one group of the fourth generation. Reproduction inhibition was >50% in all groups and, in second and third generations, groups transferred to pure medium showed a greater inhibition of reproduction than those exposed to EFX. To verify whether the effects observed in these groups could be explained by the perinatal exposure to the antibacterial, a reproduction test with daphnids obtained from in vitro exposed D. magna embryos was also carried out. Perinatal exposure to EFX seemed to act as an 'all-or-nothing' toxicity effect as 31.4% of embryos died, but the surviving daphnids did not show any inhibition of reproduction activity. However, the embryonic mortality may at least partially justify the inhibition of reproduction observed in exposed groups along the multigenerational test. Concluding, the multigenerational test with D. magna did show disruption to a population that cannot be evidenced by the official tests. The increasing deterioration across generations might be inferred as the consequence of heritable alterations. Whilst the concentration tested was higher than those usually detected in the natural environment, the increasing toxicity of EFX across generations and the possible additive toxicity of fluoroquinolone mixtures, prevent harm to crustacean populations by effects in the real context from being completely ruled out. PMID:27379980

  14. Acute toxicity of 50 metals to Daphnia magna.

    PubMed

    Okamoto, Akira; Yamamuro, Masumi; Tatarazako, Norihisa

    2015-07-01

    Metals are essential for human life and physiological functions but may sometimes cause disorders. Therefore, we conducted acute toxicity testing of 50 metals in Daphnia magna: EC50s of seven elements (Be, Cu, Ag, Cd, Os, Au and Hg) were < 100 µg l(-1) ; EC50s of 13 elements (Al, Sc, Cr, Co, Ni, Zn, Se, Rb, Y, Rh, Pt, Tl and Pb) were between 100 and 1000 µg l(-1) ; EC50s of 14 elements (Li, V, Mn, Fe, Ge, As, In, Sn, Sb, Te, Cs, Ba, W and Ir) were between 1,001 and 100,000 µg l(-1) ; EC50s of six elements (Na, Mg, K, Ca, Sr and Mo) were > 100,000 µg l(-1) ; and. 7 elements (Ti, Zr, Bi, Nb, Hf, Re and Ta) did not show EC50 at the upper limit of respective aqueous solubility, and EC50s were not obtained. Ga, Ru and Pd adhered to the body of D. magna and physically retarded the movement of D. magna. These metals formed hydroxides after adjusting the pH. Therefore, here, we distinguished this physical effect from the physiological toxic effect. The acute toxicity results of 40 elements obtained in this study were not correlated with electronegativity. Similarly, the acute toxicity results of metals including the rare metals were also not correlated with first ionization energy, atomic weight, atomic number, covalent radius, atomic radius or ionic radius. PMID:25382633

  15. Statistical validation of structured population models for Daphnia magna

    PubMed Central

    Adoteye, Kaska; Banks, H.T.; Cross, Karissa; Eytcheson, Stephanie; Flores, Kevin B.; LeBlanc, Gerald A.; Nguyen, Timothy; Ross, Chelsea; Smith, Emmaline; Stemkovski, Michael; Stokely, Sarah

    2016-01-01

    In this study we use statistical validation techniques to verify density-dependent mechanisms hypothesized for populations of Daphnia magna. We develop structured population models that exemplify specific mechanisms, and use multi-scale experimental data in order to test their importance. We show that fecundity and survival rates are affected by both time-varying density-independent factors, such as age, and density-dependent factors, such as competition. We perform uncertainty analysis and show that our parameters are estimated with a high degree of confidence. Further, we perform a sensitivity analysis to understand how changes in fecundity and survival rates affect population size and age-structure. PMID:26092608

  16. Effects of metal salt mixtures on Daphnia magna reproduction

    SciTech Connect

    Biesinger, K.E.; Christensen, G.M.; Fiandt, J.T.

    1986-02-01

    Three binary metal experiments were conducted using a complete block design; testing the chlorides of Cd, Hg, and Zn individually and in combinations of Cd-Hg, Cd-Zn, and Zn-Hg on Daphnia magna reproduction. These mixtures were tested at one-half, once, and twice the 16% reproductive impairment concentration previously determined for individual metals. The Cd-Hg, Cd-Zn, and Zn-Hg mixtures all showed significant reductions in reproduction at concentrations where the metal salts alone caused no significant effect.

  17. Orientation field estimation for latent fingerprint enhancement.

    PubMed

    Feng, Jianjiang; Zhou, Jie; Jain, Anil K

    2013-04-01

    Identifying latent fingerprints is of vital importance for law enforcement agencies to apprehend criminals and terrorists. Compared to live-scan and inked fingerprints, the image quality of latent fingerprints is much lower, with complex image background, unclear ridge structure, and even overlapping patterns. A robust orientation field estimation algorithm is indispensable for enhancing and recognizing poor quality latents. However, conventional orientation field estimation algorithms, which can satisfactorily process most live-scan and inked fingerprints, do not provide acceptable results for most latents. We believe that a major limitation of conventional algorithms is that they do not utilize prior knowledge of the ridge structure in fingerprints. Inspired by spelling correction techniques in natural language processing, we propose a novel fingerprint orientation field estimation algorithm based on prior knowledge of fingerprint structure. We represent prior knowledge of fingerprints using a dictionary of reference orientation patches. which is constructed using a set of true orientation fields, and the compatibility constraint between neighboring orientation patches. Orientation field estimation for latents is posed as an energy minimization problem, which is solved by loopy belief propagation. Experimental results on the challenging NIST SD27 latent fingerprint database and an overlapped latent fingerprint database demonstrate the advantages of the proposed orientation field estimation algorithm over conventional algorithms. PMID:22826508

  18. Optical wavelet transform for fingerprint identification

    NASA Astrophysics Data System (ADS)

    MacDonald, Robert P.; Rogers, Steven K.; Burns, Thomas J.; Fielding, Kenneth H.; Warhola, Gregory T.; Ruck, Dennis W.

    1994-03-01

    The Federal Bureau of Investigation (FBI) has recently sanctioned a wavelet fingerprint image compression algorithm developed for reducing storage requirements of digitized fingerprints. This research implements an optical wavelet transform of a fingerprint image, as the first step in an optical fingerprint identification process. Wavelet filters are created from computer- generated holograms of biorthogonal wavelets, the same wavelets implemented in the FBI algorithm. Using a detour phase holographic technique, a complex binary filter mask is created with both symmetry and linear phase. The wavelet transform is implemented with continuous shift using an optical correlation between binarized fingerprints written on a Magneto-Optic Spatial Light Modulator and the biorthogonal wavelet filters. A telescopic lens combination scales the transformed fingerprint onto the filters, providing a means of adjusting the biorthogonal wavelet filter dilation continuously. The wavelet transformed fingerprint is then applied to an optical fingerprint identification process. Comparison between normal fingerprints and wavelet transformed fingerprints shows improvement in the optical identification process, in terms of rotational invariance.

  19. A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

    PubMed Central

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  20. A support vector machine approach for truncated fingerprint image detection from sweeping fingerprint sensors.

    PubMed

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  1. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    PubMed Central

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-01-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm−1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light–matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon–phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications. PMID:27460765

  2. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    NASA Astrophysics Data System (ADS)

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-07-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm-1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light-matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon-phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications.

  3. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons.

    PubMed

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-01-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm(-1), is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light-matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon-phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications. PMID:27460765

  4. Graphene Nanopres for DNA Fingerprinting

    NASA Astrophysics Data System (ADS)

    Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

    2013-03-01

    The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

  5. Identification of chemical-specific protein profiles in Daphnia magna using neural networks

    SciTech Connect

    Iamonte, T.; Broadt, T.; Bradley, B.

    1995-12-31

    One dimensional gel electrophoresis was performed on whole-animal homogenates of 10 Daphnia magna exposed for 48 hours to one toxic and one non-toxic concentration of 2,4-dinitrophenol and sodium pentachlorophenate, two uncouplers of oxidative phosphorylation; malathion, an organophosphate; and permethrine, a pyrethroid, along with culture water and solvent controls, as appropriate. Ten randomized complete block exposures were conducted to minimize among-cohort variability. The 10-animal samples were gel electrophoresed, visualized using neutral silver staining and digitized with a Molecular Dynamics personal laser densitometer equipped with ImageQuant software. Densitometric data were used in a commercial neural network software package to construct a learning set, or database, of the protein profiles induced by the known chemical treatments. Novel data sets were then presented to the neural network program for assignment to treatment categories. Although no differences in protein profile between controls and chemical treatments and among chemical treatments could be detected visually in one dimensional gels, the neural network was able to correctly assign each sample to the appropriate learned treatment category about 70 percent of the time. Key proteins used by the neural network software to learn the protein profile of each chemical were identified by molecular weight and assigned a relative importance for identification of that chemical.

  6. Influence of organism age on metal toxicity to Daphnia magna.

    PubMed

    Hoang, Tham C; Klaine, Stephen J

    2007-06-01

    Aquatic organisms living in surface water experience contaminant exposure at different life stages. While some investigators have examined the influence of organism age on the toxicity of pollutants, the general assumption in toxicology has been that young organisms were more sensitive than older organisms. In fact, some standardized toxicity tests call for the use of organisms less than 24 h old. This research characterized the age sensitivity of the water flea Daphnia magna to copper, zinc, selenium, and arsenic. During 21-d toxicity tests, organisms were exposed to a single 12-h pulse of either 70 microg/L Cu, 750 microg/L Zn, 1000 microg/L Se, or 5000 microg/L As at different ages ranging from 3 h to 10 d old. Mortality and reproduction were compiled over 21 d. During the juvenile stage, mortality increased and cumulative reproduction decreased with age, respectively. However, mortality decreased and cumulative reproduction increased with age when organisms became adult. Peak sensitivity occurred in 4-d-old organisms exposed to Cu and Zn, while 2- to 3-d-old organisms were most sensitive to As and Se. Growth of D. magna over 21 d was not affected by the 12-h pulse of Cu, Zn, Se, or As given at any organism age. This indicates the recovery of the organisms after exposure termination. PMID:17571686

  7. TALEN-mediated homologous recombination in Daphnia magna

    PubMed Central

    Nakanishi, Takashi; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2015-01-01

    Transcription Activator-Like Effector Nucleases (TALENs) offer versatile tools to engineer endogenous genomic loci in various organisms. We established a homologous recombination (HR)-based knock-in using TALEN in the crustacean Daphnia magna, a model for ecological and toxicological genomics. We constructed TALENs and designed the 67 bp donor insert targeting a point deletion in the eyeless mutant that shows eye deformities. Co-injection of the TALEN mRNA with donor DNA into eggs led to the precise integration of the donor insert in the germ line, which recovered eye deformities in offspring. The frequency of HR events in the germ line was 2% by using both plasmid and single strand oligo DNA with 1.5 kb and 80 nt homology to the target. Deficiency of ligase 4 involved in non-homologous end joining repair did not increase the HR efficiency. Our data represent efficient HR-based knock-in by TALENs in D. magna, which is a promising tool to understand Daphnia gene functions. PMID:26674741

  8. Toxicity of new generation flame retardants to Daphnia magna.

    PubMed

    Waaijers, Susanne L; Hartmann, Julia; Soeter, A Marieke; Helmus, Rick; Kools, Stefan A E; de Voogt, Pim; Admiraal, Wim; Parsons, John R; Kraak, Michiel H S

    2013-10-01

    There is a tendency to substitute frequently used, but relatively hazardous brominated flame retardants (BFRs) with halogen-free flame retardants (HFFRs). Consequently, information on the persistence, bioaccumulation and toxicity (PBT) of these HFFRs is urgently needed, but large data gaps and inconsistencies exist. Therefore, in the present study the toxicity of a wide range of HFFRs to the water flea Daphnia magna was investigated. Our results revealed that four HFFRs were showing no effect at their Sw (saturated water concentration) and three had a low toxicity (EC50>10 mg L(-1)), suggesting that these compounds are not hazardous. Antimony trioxide had a moderate toxicity (EC50=3.01 mg L(-1), 95% CL: 2.76-3.25) and triphenyl phosphate and the brominated reference compound tetra bromobisphenol A were highly toxic to D. magna (EC50=0.55 mg L(-1), 95% CL: 0.53-0.55 and EC50=0.60 mg L(-1), 95% CL: 0.24-0.97 respectively). Aluminum trihydroxide and bisphenol A bis(diphenyl phosphate) caused limited mortality at Sw (26 and 25% respectively) and have a low solubility (<10 mg L(-1)). Hence, increased toxicity of these compounds may be observed when for instance decreasing pH could increase solubility. By testing all compounds under identical conditions we provided missing insights in the environmental hazards of new generation flame retardants and propose as best candidates for BFR replacements: APP, ALPI, DOPO, MHO, MPP, ZHS and ZS. PMID:23886749

  9. FROG - Fingerprinting Genomic Variation Ontology.

    PubMed

    Abinaya, E; Narang, Pankaj; Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: "FingeRprinting Ontology of Genomic variations" is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog. PMID:26244889

  10. A Computational Discriminability Analysis on Twin Fingerprints

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Srihari, Sargur N.

    Sharing similar genetic traits makes the investigation of twins an important study in forensics and biometrics. Fingerprints are one of the most commonly found types of forensic evidence. The similarity between twins’ prints is critical establish to the reliability of fingerprint identification. We present a quantitative analysis of the discriminability of twin fingerprints on a new data set (227 pairs of identical twins and fraternal twins) recently collected from a twin population using both level 1 and level 2 features. Although the patterns of minutiae among twins are more similar than in the general population, the similarity of fingerprints of twins is significantly different from that between genuine prints of the same finger. Twins fingerprints are discriminable with a 1.5%~1.7% higher EER than non-twins. And identical twins can be distinguished by examine fingerprint with a slightly higher error rate than fraternal twins.

  11. A novel approach for fingerprinting mummified hands.

    PubMed

    Fields, Roy; Molina, D Kimberley

    2008-07-01

    Fingerprinting has long been used as a method for identifying bodies and, since first discovered, many advances have been made in both fingerprint acquisition and interpretation. However, in the field of forensic pathology, the attainment of fingerprints from mummified bodies has remained difficult. The most common technique historically used to obtain fingerprints in these cases usually employs the amputation of the fingers combined with soaking and/or injecting the fingers with various solutions in order to enhance the fingerprints. A novel approach to fingerprinting mummified fingers is presented which involves removal and rehydration of the fingerpads (including the epidermal, dermal, and adipose tissues) followed by inking and rolling, using a gloved finger for support. The technique presented produces a superior quality of print without amputation of the finger, yielding excellent results and assisting in obtaining positive identification. PMID:18489553

  12. Chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Milazzo, D.P.

    1988-01-01

    Data generated from daphnid chronic toxicity tests are used by various regulatory agencies for the development of water quality criteria. Two chemicals which are lacking reported chronic data are aniline and 2,4-dichlorophenol. The acute toxicity of 2,4-dichlorophenol to Daphnia magna has been reported; the toxicity of aniline to D. magna also has been reported. Chronic data for these chemicals are lacking for invertebrates. The objective of this study was to estimate the chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus, using a standard 21-day static renewal procedure.

  13. A registration problem for functional fingerprinting.

    PubMed

    Kaplan, David M; Craver, Carl F

    2016-01-01

    Functional fingerprints aggregate over heterogeneous tasks, protocols, and controls. The appearance of functional diversity might be explained by task heterogeneity and conceptual imprecision. PMID:27561900

  14. TV system for detection of latent fingerprints

    NASA Astrophysics Data System (ADS)

    Li, Ping; Ban, Xianfu; Liu, Shaowu; Ding, Zhenfang

    1993-04-01

    A fingerprint is reliable evidence for recognizing criminals in detecting cases. There are many conventional chemical and physical methods in detecting fingerprints. In this paper, a newly developed portable TV system for detecting a latent fingerprint is described. This system is suited for field reconnaissance of cases as well as for laboratory testing. It can display a latent fingerprint, which is hard to identify and even cannot be displayed by conventional methods, and it can detect prints or stamps which are faded, altered, or falsified, etc.

  15. On relative distortion in fingerprint comparison.

    PubMed

    Kalka, Nathan D; Hicklin, R Austin

    2014-11-01

    When fingerprints are deposited, non-uniform pressure in conjunction with the inherent elasticity of friction ridge skin often causes linear and non-linear distortions in the ridge and valley structure. The effects of these distortions must be considered during analysis of fingerprint images. Even when individual prints are not notably distorted, relative distortion between two prints can have a serious impact on comparison. In this paper we discuss several metrics for quantifying and visualizing linear and non-linear fingerprint deformations, and software tools to assist examiners in accounting for distortion in fingerprint comparisons. PMID:25216456

  16. Microorganism Identification Based On MALDI-TOF-MS Fingerprints

    NASA Astrophysics Data System (ADS)

    Elssner, Thomas; Kostrzewa, Markus; Maier, Thomas; Kruppa, Gary

    Advances in MALDI-TOF mass spectrometry have enabled the ­development of a rapid, accurate and specific method for the identification of bacteria directly from colonies picked from culture plates, which we have named the MALDI Biotyper. The picked colonies are placed on a target plate, a drop of matrix solution is added, and a pattern of protein molecular weights and intensities, "the protein fingerprint" of the bacteria, is produced by the MALDI-TOF mass spectrometer. The obtained protein mass fingerprint representing a molecular signature of the microorganism is then matched against a database containing a library of previously measured protein mass fingerprints, and scores for the match to every library entry are produced. An ID is obtained if a score is returned over a pre-set threshold. The sensitivity of the techniques is such that only approximately 104 bacterial cells are needed, meaning that an overnight culture is sufficient, and the results are obtained in minutes after culture. The improvement in time to result over biochemical methods, and the capability to perform a non-targeted identification of bacteria and spores, potentially makes this method suitable for use in the detect-to-treat timeframe in a bioterrorism event. In the case of white-powder samples, the infectious spore is present in sufficient quantity in the powder so that the MALDI Biotyper result can be obtained directly from the white powder, without the need for culture. While spores produce very different patterns from the vegetative colonies of the corresponding bacteria, this problem is overcome by simply including protein fingerprints of the spores in the library. Results on spores can be returned within minutes, making the method suitable for use in the "detect-to-protect" timeframe.

  17. Fingerprinting Codes for Multimedia Data against Averaging Attack

    NASA Astrophysics Data System (ADS)

    Yagi, Hideki; Matsushima, Toshiyasu; Hirasawa, Shigeichi

    Code construction for digital fingerprinting, which is a copyright protection technique for multimedia, is considered. Digital fingerprinting should deter collusion attacks, where several fingerprinted copies of the same content are mixed to disturb their fingerprints. In this paper, we consider the averaging attack, which is known to be effective for multimedia fingerprinting with the spread spectrum technique. We propose new methods for constructing fingerprinting codes to increase the coding rate of conventional fingerprinting codes, while they guarantee to identify the same number of colluders. Due to the new fingerprinting codes, the system can deal with a larger number of users to supply digital contents.

  18. Recurrent abscesses due to Finegoldia magna, Dermabacter hominis and Staphylococcus aureus in an immunocompetent patient.

    PubMed

    Martin, J; Bemer, P; Touchais, S; Asseray, N; Corvec, S

    2009-10-01

    A case of recurrent abscesses in an immunocompetent patient is reported, involving the opportunistic human pathogen Dermabacter hominis, the virulent anaerobic pathogen Finegoldia magna and Staphylococcus aureus. PMID:19332143

  19. DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

    PubMed Central

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

  20. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    PubMed

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

  1. Molecular tools used in agriculture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A summary of molecular tools used for research in agriculture were presented. Examples of DNA sequencing, library preparation, use of fingerprinting for pathogens and plant crops, high throughput sequencing, whole-genome amplification, reporter genes, and other methods....

  2. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    SciTech Connect

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  3. Acute toxicity of cyanogen chloride to Daphnia magna

    SciTech Connect

    Kononen, D.W.

    1988-09-01

    The destruction of cyanide in waste waters by chlorination has been shown to result in the formation of the extremely toxic compound, cyanogen chloride. Industrial cyanide-containing waste waters may be treated by a batch chlorination process under highly alkaline conditions prior to being discharged into a receiving water systems. Alternatively, if the concentration of cyanide is relatively low, and such waste waters may be diverted to municipal waste treatment facilities where they may be subjected to a process of chlorination which may not be sufficient for the complete oxidative destruction of the available cyanide. Although a large body of literature exists concerning the toxicity of HCN and metallic cyanide compounds to aquatic organisms, there is a comparative scarcity of information concerning cyanogen chloride toxicity. This study was designed to determine the acute toxicity of CNCl to Daphnia magna neonates under static bioassay conditions.

  4. Chemical Fingerprinting Program for RSRM Critical Materials

    NASA Technical Reports Server (NTRS)

    McClennen, William H.; Fife, Dennis J.; Killpack, Michael O.; Golde, Rick P.; Cash, Steve (Technical Monitor)

    2002-01-01

    This viewgraph presentation provides information on the chemical fingerprinting of RSRM (Reusable Sold Rocket Motor) components. A chemical fingerprint can be used to identify a material, to differentiate it from similar looking materials, or lead to its source. It can also identify unexpected changes to a vendor or supplier's material, and monitor aging.

  5. Tools for quality control of fingerprint databases

    NASA Astrophysics Data System (ADS)

    Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

    2010-04-01

    Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

  6. DNA Fingerprinting in a Forensic Teaching Experiment

    ERIC Educational Resources Information Center

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  7. Genes mirror geography in Daphnia magna.

    PubMed

    Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

    2015-09-01

    Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history. PMID:26190313

  8. Effects of Microcystis aeruginosa on life history of water flea Daphnia magna

    NASA Astrophysics Data System (ADS)

    Liu, Liping; Li, Kang; Chen, Taoying; Dai, Xilin; Jiang, Min; Diana, James S.

    2011-07-01

    Cyanobacterial blooms in eutrophic freshwater systems are a worldwide problem, creating adverse effects for many aquatic organisms by producing toxic microcystins and deteriorating water quality. In this study, microcystins (MCs) in Microcystis aeruginosa, and Daphnia magna exposed to M. aeruginosa, were analyzed by HPLC-MS, and the effects of M. aeruginosa on D. magna were investigated. When D. magna was exposed to M. aeruginosa for more than 2 h, Microcystin-LR (MC-LR) was detected. When exposed to 1.5 × 106, 3 × 106, 0.75 × 107, and 1.5 × 107 cell/mL of M. aeruginosa for 96 h, average survival of D. magna for treatments were 23.33%, 33.33%, 13.33%, 16.67%, respectively, which were significantly lower than the average 100% survival in the control group ( P < 0.05). The adverse effects of M. aeruginosa on body length, time for the first brood, brood numbers, gross fecundity, lifespan, and population growth of D. magna were density-dependent. These results suggest that the occurrence of M. aeruginosa blooms could strongly inhibit the population growth of D. magna through depression of survival, individual growth and gross fecundity. In the most serious situations, M. aeruginosa blooms could undermine the food web by eliminating filter-feeding zooplankton, which would destroy the ecological balance of aquaculture water bodies.

  9. Diofenolan induces male offspring production through binding to the juvenile hormone receptor in Daphnia magna.

    PubMed

    Abe, Ryoko; Toyota, Kenji; Miyakawa, Hitoshi; Watanabe, Haruna; Oka, Tomohiro; Miyagawa, Shinichi; Nishide, Hiroyo; Uchiyama, Ikuo; Tollefsen, Knut Erik; Iguchi, Taisen; Tatarazako, Norihisa

    2015-02-01

    Juvenile hormone (JH) and JH agonists have been reported to induce male offspring production in various daphnid species including Daphnia magna. We recently established a short-term in vivo screening assay to detect chemicals having male offspring induction activity in adult D. magna. Diofenolan has been developed as a JH agonist for insect pest control, but its male offspring induction activity in daphnids has not been investigated yet. In this study, we found that the insect growth regulator (IGR) diofenolan exhibited a potent male offspring induction activity at low ng/L to μg/L concentrations, as demonstrated by the short-term in vivo screening assay and the recently developed TG211 ANNEX 7 test protocol. A two-hybrid assay performed using the D. magna JH receptor confirmed that diofenolan had a strong JH activity. Global whole body transcriptome analysis of D. magna exposed to 10 ng/L diofenolan showed an up-regulation of JH-responsive genes and modulation of several genes involved in the ecdysone receptor signaling pathway. These results clearly demonstrate that diofenolan has strong JH activity and male offspring induction activity, and that a combination of modified standardized regulatory testing protocols and rapid in vitro and in vivo screening assays are able to identify potential endocrine disruptors in D. magna. The observation that diofenolan modulates multiple endocrine signaling pathways in D. magna suggests that further investigation of potential interference with growth, development and reproduction is warranted. PMID:25506888

  10. Spectroscopic fingerprint of tea varieties by surface enhanced Raman spectroscopy.

    PubMed

    Buyukgoz, Guluzar Gorkem; Soforoglu, Mehmet; Basaran Akgul, Nese; Boyaci, Ismail Hakki

    2016-03-01

    The fingerprinting method is generally performed to determine specific molecules or the behavior of specific molecular bonds in the desired sample content. A novel, robust and simple method based on surface enhanced Raman spectroscopy (SERS) was developed to obtain the full spectrum of tea varieties for detection of the purity of the samples based on the type of processing and cultivation. For this purpose, the fingerprint of seven different varieties of tea samples (herbal tea (rose hip, chamomile, linden, green and sage tea), black tea and earl grey tea) combined with silver colloids was obtained by SERS in the range of 200-2000 cm(-1) with an analysis time of 20 s. Each of the thirty-nine tea samples tested showed its own specific SERS spectra. Principal Component Analysis (PCA) was also applied to separate of each tea variety and different models developed for tea samples including three different models for the herbal teas and two different models for black and earl grey tea samples. Herbal tea samples were separated using mean centering, smoothing and median centering pre-processing steps while baselining and derivatisation pre-processing steps were applied to SERS data of black and earl grey tea. The novel spectroscopic fingerprinting technique combined with PCA is an accurate, rapid and simple methodology for the assessment of tea types based on the type of processing and cultivation differences. This method is proposed as an alternative tool in order to determine the characteristics of tea varieties. PMID:27570296

  11. Integrated fingerprinting in secure digital cinema projection

    NASA Astrophysics Data System (ADS)

    Delannay, Damien; Delaigle, Jean-Francois; Macq, Benoit M. M.; Quisquater, Jean-Jacques; Mas Ribes, Joan M.; Boucqueau, Jean M.; Nivart, Jean-Francois

    2001-12-01

    This paper describes the functional model of a combined conditional access and fingerprinting copyright (-or projectionright) protection system in a digital cinema framework. In the cinema industry, a large part of early movie piracy comes from copies made in the theater itself with a camera. The evolution towards digital cinema broadcast enables watermark based fingerprinting protection systems. Besides an appropriate fingerprinting technology, a number of well defined security/cryptographic tools are integrated in order to guaranty the integrity of the whole system. The requirements are two-fold: On one side, we must ensure that the media content is only accessible at exhibition time (under specific authorization obtained after an ad-hoc film rental agreement) and contains the related exhibition fingerprint. At the other end, we must prove our ability to retrieve the fingerprint information from an illegal copy of the media.

  12. DNA fingerprints come to court

    SciTech Connect

    Not Available

    1988-04-15

    DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person.

  13. DNA fingerprinting in zoology: past, present, future.

    PubMed

    Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

    2014-01-01

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work. PMID:24490906

  14. Detection of a novel arginine vasopression defect by dideoxy fingerprinting

    SciTech Connect

    Krishnamani, M.R.S.; Phillips, J.A. III; Copeland, K.C. Univ. of Vermont College of Medicine, Burlington, VT )

    1993-09-01

    Autosomal dominant neurohypophyseal diabetes insipidus is a familial form of diabetes insipidus. This disorder is associated with variable levels of arginine vasopressin (AVP) and diabetes insipidus of varying severity, which responds to exogenous AVP. To determine the molecular basis of autosomal dominant neurohypophyseal diabetes insipidus, the AVP genes of members of a large kindred were analyzed. A new method, called dideoxy fingerprinting, was used to detect an AVP mutation that was characterized by DNA sequencing. The novel defect found changes the last codon of the AVP signal peptide from alanine to threonine, which should perturb cleavage of mature AVP from its precursor protein and inhibit its secretion or action. 18 refs., 3 figs.

  15. Fingerprints of polycyclic aromatic hydrocarbons (PAHs) in infrared absorption spectroscopy.

    PubMed

    Tommasini, Matteo; Lucotti, Andrea; Alfè, Michela; Ciajolo, Anna; Zerbi, Giuseppe

    2016-01-01

    We have analyzed a set of 51 PAHs whose structures have been hypothesized from mass spectrometry data collected on samples extracted from carbon particles of combustion origin. We have obtained relationships between infrared absorption signals in the fingerprint region (mid-IR) and the chemical structures of PAHs, thus proving the potential of IR spectroscopy for the characterization of the molecular structure of aromatic combustion products. The results obtained here for the spectroscopic characterization of PAHs can be also of interest in Materials Science and Astrophysics. PMID:26208268

  16. Fingerprints of polycyclic aromatic hydrocarbons (PAHs) in infrared absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Tommasini, Matteo; Lucotti, Andrea; Alfè, Michela; Ciajolo, Anna; Zerbi, Giuseppe

    2016-01-01

    We have analyzed a set of 51 PAHs whose structures have been hypothesized from mass spectrometry data collected on samples extracted from carbon particles of combustion origin. We have obtained relationships between infrared absorption signals in the fingerprint region (mid-IR) and the chemical structures of PAHs, thus proving the potential of IR spectroscopy for the characterization of the molecular structure of aromatic combustion products. The results obtained here for the spectroscopic characterization of PAHs can be also of interest in Materials Science and Astrophysics.

  17. Fingerprint Minutiae from Latent and Matching Tenprint Images

    National Institute of Standards and Technology Data Gateway

    NIST Fingerprint Minutiae from Latent and Matching Tenprint Images (PC database for purchase)   NIST Special Database 27 contains latent fingerprints from crime scenes and their matching rolled fingerprint mates. This database can be used to develop and test new fingerprint algorithms, test commercial and research AFIS systems, train latent examiners, and promote the ANSI/NIST file format standard.

  18. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  19. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  20. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  1. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  2. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  3. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  4. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  5. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  6. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  7. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  8. Composition and stability of the microbial community inside the digestive tract of the aquatic crustacean Daphnia magna.

    PubMed

    Freese, Heike M; Schink, Bernhard

    2011-11-01

    Small filter-feeding zooplankton organisms like the cladoceran Daphnia spp. are key members of freshwater food webs. Although several interactions between Daphnia and bacteria have been investigated, the importance of the microbial communities inside Daphnia guts has been studied only poorly so far. In the present study, we characterised the bacterial community composition inside the digestive tract of a laboratory-reared clonal culture of Daphnia magna using 16S rRNA gene libraries and terminal-restriction length polymorphism fingerprint analyses. In addition, the diversity and stability of the intestinal microbial community were investigated over time, with different food sources as well as under starvation stress and death, and were compared to the community in the cultivation water. The diversity of the Daphnia gut microbiota was low. The bacterial community consisted mainly of Betaproteobacteria (e.g. Limnohabitans sp.), few Gammaproteobacteria (e.g. Pseudomonas sp.) and Bacteroidetes that were related to facultatively anaerobic bacteria, but did not contain typical fermentative or obligately anaerobic gut bacteria. Rather, the microbiota was constantly dominated by Limnohabitans sp. which belongs to the Lhab-A1 tribe (previously called R-BT065 cluster) that is abundant in various freshwaters. Other bacterial groups varied distinctly even under constant cultivation conditions. Overall, the intestinal microbial community did not reflect the community in the surrounding cultivation water and clustered separately when analysed via the Additive Main Effects and Multiplicative Interaction model. In addition, the microbiota proved to be stable also when Daphnia were exposed to bacteria associated with a different food alga. After starvation, the community in the digestive tract was reduced to stable members. After death of the host animals, the community composition in the gut changed distinctly, and formerly undetected bacteria were activated. Our results suggest

  9. Disturbances in energy metabolism of Daphnia magna after exposure to tebuconazole.

    PubMed

    Sancho, E; Villarroel, M J; Andreu, E; Ferrando, M D

    2009-03-01

    This study was conducted to investigate the change of some biochemical parameters in the aquatic invertebrate Daphnia magna following exposure to the fungicide tebuconazole and to determine the most sensitive biomarker among the ones tested in this species. Four biochemical biomarkers (protein, glycogen, lipids and caloric content) were correlated with feeding behaviour studies of D. magna after fungicide exposure. Juveniles of D. magna were exposed to four sublethal concentrations of tebuconazole (0.41, 0.52, 0.71 and 1.14 mgL(-1)) for 5d. Daphnid samples were taken from each test and control group at 24, 48, 72, 96 and 120 h after the start of the experiment. Tebuconazole EC(50) values were calculated on D. magna in our laboratory as 56.83 and 40.10 mgL(-1) at 24 and 48 h, respectively. Results showed that daphnid energy content decreased as tebuconazole concentration increased, especially after 96-120 h of exposure to 0.52 mgL(-1) and higher fungicide concentrations. The data suggest that tebuconazole is moderately toxic to D. magna but also that it seriously impairs the metabolic functions, resulting in alterations in biochemical constituents. In the D. magna feeding study, algae feeding rates were inhibited after fungicide exposure. Such findings indicate the importance of feeding studies in laboratory toxicity test as well as their relationship with others studies. The results emphasize the importance of considering different kind of biomarkers to identify and evaluate the biological effect of a fungicide in the aquatic environment. Although the biochemical biomarkers used resulted good indicators of tebuconazole toxicity, feeding rates in D. magna decreased after only 5h exposure to the fungicide resulting in the most sensitive parameter of daphnid fungicide exposure. PMID:19135699

  10. A low-rate fingerprinting code and its application to blind image fingerprinting

    NASA Astrophysics Data System (ADS)

    Jourdas, Jean-Francois; Moulin, Pierre

    2008-02-01

    In fingerprinting, a signature, unique to each user, is embedded in each distributed copy of a multimedia content, in order to identify potential illegal redistributors. This paper investigates digital fingerprinting problems involving millions of users and a handful of colluders. In such problems the rate of the fingerprinting code is often well below fingerprinting capacity, and the use of codes with large minimum distance emerges as a natural design. However, optimal decoding is a formidable computational problem. We investigate a design based on a Reed-Solomon outer code modulated onto an orthonormal constellation, and the Guruswami-Sudan decoding algorithm. We analyze the potential and limitations of this scheme and assess its performance by means of Monte-Carlo simulations. In the second part of this paper, we apply this scheme to a blind image fingerprinting problem, using a linear cancellation technique for embedding in the wavelet domain. Dramatic improvements are obtained over previous blind image fingerprinting algorithms.

  11. Mated Fingerprint Card Pairs 2 (MFCP2)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs 2 (MFCP2) (PC database for purchase)   NIST Special Database 14 is being distributed for use in development and testing of automated fingerprint classification and matching systems on a set of images which approximate a natural horizontal distribution of the National Crime Information Center (NCIC) fingerprint classes. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  12. The detection of drugs of abuse in fingerprints using Raman spectroscopy I: latent fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-02-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in latent fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were studied in both sweat-rich and sebum-rich latent fingerprints. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in latent fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in sweat-rich latent fingerprints were of a similar quality to spectra that obtained from the substances under normal sampling conditions. Interfering Raman bands arising from latent fingerprint material were present in the spectra obtained from the substances in sebum-rich fingerprints. These bands did not prevent identification of the substances and could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in latent fingerprints was visually locating the substance in the fingerprint in order to obtain a Raman spectrum.

  13. Dual Resolution Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Dual Resolution Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  14. Forensic Identification of Gender from Fingerprints.

    PubMed

    Huynh, Crystal; Brunelle, Erica; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2015-11-17

    In the past century, forensic investigators have universally accepted fingerprinting as a reliable identification method, which relies mainly on pictorial comparisons. Despite developments to software systems in order to increase the probability and speed of identification, there has been limited success in the efforts that have been made to move away from the discipline's absolute dependence on the existence of a prerecorded matching fingerprint. Here, we have revealed that an information-rich latent fingerprint has not been used to its full potential. In our approach, the content present in the sweat left behind-namely the amino acids-can be used to determine physical such as gender of the originator. As a result, we were able to focus on the biochemical content in the fingerprint using a biocatalytic assay, coupled with a specially designed extraction protocol, for determining gender rather than focusing solely on the physical image. PMID:26460203

  15. Chemical characterization of components in fingerprints

    SciTech Connect

    Jarboe, S.G.; Asano, K.G.; Buchanan, M.V.; Bohanan, A.

    1997-12-31

    Investigations into the chemical composition of fingerprints were initiated after it was observed that the latent fingerprints of children disappear more rapidly from surfaces than those of adults. Initial work included the use of GUMS for the identification of compounds present in fingerprints. The relative concentrations of fatty acids and alkyl esters in children and adults appear to contribute to the higher rate of disappearance of prints from the younger subjects. The presence of alkyl esters is linked to sebaceous excretions originating from the face, which increase markedly after puberty. This work has been expanded to include characterization of other classes of components, including amino acids and triacylglycerols. This research is part of an ongoing project to identify various components of fingerprints and explore possible clinical and forensic applications. Through large sampling pools, trends that can indicate personal characteristics (i.e., gender, age), habits (smoking, drug use), and health-related issues (diabetes) are being investigated.

  16. Combined experimental and theoretical study on photoinduced toxicity of an anthraquinone dye intermediate to Daphnia magna.

    PubMed

    Wang, Ying; Chen, Jingwen; Lin, Jing; Wang, Zhen; Bian, Haitao; Cai, Xiyun; Hao, Ce

    2009-04-01

    The toxicity of chemicals can be enhanced by light through two photochemical pathways: Photomodification to more toxic substances and photosensitization. In the present study, the reactive oxygen species (ROS) mechanism for photoinduced acute toxicity of 1-amino-2,4-dibromoanthraquinone (ADBAQ) to Daphnia magna was clarified by experiment and theoretical calculation. The results of the present study show that ADBAQ exhibited high toxicity to D. magna under simulated solar radiation (SSR), with a median effective concentration of 1.23 +/- 0.19 nM (mean +/- standard deviation). The photomodified ADBAQ (mixtures of ADBAQ and its photoproducts) was less phototoxic than the intact ADBAQ. The SSR-only or ADBAQ-only treatments did not affect the ROS level in D. magna, whereas increased ROS levels were observed in the presence of SSR and ADBAQ. The ROS in vivo were determined by measuring the fluorescence of 2',7'-dichlorofluorescein, which is a useful technique to assess toxicity of chemicals to aquatic organisms. The antioxidants, including vitamin C, vitamin E, and beta-carotene, decreased the photoinduced oxidative damage to D. magna, probably by scavenging ROS. These experimental results demonstrate that photosensitization is the potential mechanism of photoinduced toxicity of ADBAQ to D. magna. Proposed phototoxic pathways of ADBAQ were elucidated by means of time-dependent density functional theory. The theoretical calculation indicates that superoxide anion and singlet oxygen are able to be generated through electron transfer or energy transfer in the photosensitization reactions. PMID:19391687

  17. Reduced fitness of Daphnia magna fed a Bt-transgenic maize variety.

    PubMed

    Bøhn, Thomas; Primicerio, Raul; Hessen, Dag O; Traavik, Terje

    2008-11-01

    Genetically modified (GM) maize expressing the Bt-toxin Cry1Ab (Bt-maize) was tested for effects on survival, growth, and reproduction of the water flea Daphnia magna, a crustacean arthropod commonly used as a model organism in ecotoxicological studies. In three repeated experiments, D. magna were fed 100% ground maize in suspension, using either GM or isogenic unmodified (UM) maize. D. magna fed GM-maize showed a significantly reduced fitness performance: The mortality was higher, a lower proportion of females reached sexual maturation, and the overall egg production was lower compared to D. magna fed UM isogenic maize. We conclude that the tested variety of Bt-maize and its UM counterpart do not have the same quality as food sources for this widely used model organism. The combination of a reduced fitness performance combined with earlier onset of reproduction of D. magna fed Bt-maize indicates a toxic effect rather than a lower nutritional value of the GM-maize. PMID:18347840

  18. Petroleum fingerprinting: Dating a gasoline release

    SciTech Connect

    Johnson, M.D.; Morrison, R.D.

    1996-09-01

    Dating a gasoline releases is particularly important in situations involving a contaminated gasoline service station. Often the station begins under the control of a major oil company, and as it ages and deteriorates it may be operated by a series of smaller operators. When facing a claim for contamination, often operators blame former operators. Fingerprinting is one of several successful methods used to date petroleum releases on contaminated sites. The topics covered in this article are inventory reconciliation; reverse groundwater modeling; hydrocarbon fingerprinting.

  19. On the statistics of the "genetic fingerprint".

    PubMed

    Ritter, H

    1991-01-01

    In analogy to the polygene determined morphological features, the DNA-fingerprint is also not suitable for statistical processing. Statements about the individuality are merely speculative. Frequencies of genes cannot be found, since it is impossible to determine which combinations of bands belong to one gene locus. Hence the DNA fingerprint enables the recognition of exclusions from paternity; it does not, however, allow a statistical analysis, no matter which method be employed. PMID:1685896

  20. Devascularizing complications of free fibula harvest: peronea arteria magna.

    PubMed

    Rosson, Gedge D; Singh, Navin K

    2005-11-01

    The authors present a case report of devascularizing complications following free fibula harvest. A retrospective review of 93 consecutively imaged limbs demonstrated a peronea arteria magna (PAM) prevalence of 5.3 percent in an urban population, which was used to perform a cost-effectiveness analysis for preoperative vascular imaging of the donor limb using magnetic resonance angiography (MRA) and traditional angiography (TA). Donor-site complications of fibula harvest range from 15 to 30 percent, but are rarely limb-threatening. Limb loss is a dreaded complication of congenital PAM, which can be present with a normal vascular exam. Some microsurgery groups advocate using no preoperative imaging of the donor limb; they rely on intraoperative assessment of the vascular anatomy. An aborted harvest due to aberrant anatomy leads to both direct and indirect added costs. The authors believe that MRA imaging of the donor limb, being minimally invasive, is cost-effective and indicated for free fibula transfers. For equivocal results, conversion to more invasive and costly TA may be necessary. PMID:16292729

  1. Toxicokinetic and toxicodynamic model for diazinon toxicity--mechanistic explanation of differences in the sensitivity of Daphnia magna and Gammarus pulex.

    PubMed

    Kretschmann, Andreas; Ashauer, Roman; Hollender, Juliane; Escher, Beate I

    2012-09-01

    A mechanistic toxicokinetic and toxicodynamic model for acute toxic effects (immobilization, mortality) of the organothiophosphate insecticide diazinon in Daphnia magna is presented. The model was parameterized using measured external and internal (whole-body) concentrations of diazinon, its toxic metabolite diazoxon, and the inactive metabolite 2-isopropyl-6-methyl-4-pyrimidinol, plus acetylcholinesterase (AChE) activity measured during exposure to diazinon in vivo. The toxicokinetic and toxicodynamic model provides a coherent picture from exposure to the resulting toxic effect on an organism level through internally formed metabolites and the effect on a molecular scale. A very fast reaction of diazoxon with AChE (pseudo first-order inhibition rate constant k(i) = 3.3 h(-1)) compared with a slow formation of diazoxon (activation rate constant k(act) = 0.014 h(-1)) was responsible for the high sensitivity of D. magna toward diazinon. Recovery of AChE activity from inhibition was slow and rate-determining (99% recovery within 16 d), compared with a fast elimination of diazinon (99% elimination within 17 h). The obtained model parameters were compared with toxicokinetic and toxicodynamic parameters of Gammarus pulex exposed to diazinon from previous work. This comparison revealed that G. pulex is less sensitive because of a six times faster detoxification of diazinon and diazoxon and an approximately 400 times lower rate for damage accrual. These differences overcompensate the two times faster activation of diazinon to diazoxon in G. pulex compared to D. magna. The present study substantiates theoretical considerations that mechanistically based effect models are helpful to explain sensitivity differences among different aquatic invertebrates. PMID:22653849

  2. Linguistically informed digital fingerprints for text

    NASA Astrophysics Data System (ADS)

    Uzuner, Özlem

    2006-02-01

    Digital fingerprinting, watermarking, and tracking technologies have gained importance in the recent years in response to growing problems such as digital copyright infringement. While fingerprints and watermarks can be generated in many different ways, use of natural language processing for these purposes has so far been limited. Measuring similarity of literary works for automatic copyright infringement detection requires identifying and comparing creative expression of content in documents. In this paper, we present a linguistic approach to automatically fingerprinting novels based on their expression of content. We use natural language processing techniques to generate "expression fingerprints". These fingerprints consist of both syntactic and semantic elements of language, i.e., syntactic and semantic elements of expression. Our experiments indicate that syntactic and semantic elements of expression enable accurate identification of novels and their paraphrases, providing a significant improvement over techniques used in text classification literature for automatic copy recognition. We show that these elements of expression can be used to fingerprint, label, or watermark works; they represent features that are essential to the character of works and that remain fairly consistent in the works even when works are paraphrased. These features can be directly extracted from the contents of the works on demand and can be used to recognize works that would not be correctly identified either in the absence of pre-existing labels or by verbatim-copy detectors.

  3. [HPLC fingerprints in seed of Celosia argentea].

    PubMed

    Wang, Ying; Guo, Mei-Li; Wang, Xiao-Kang; Yin, Jun

    2008-01-01

    For preferable authentication and regulation of material quality of Celosia argentea, HPLC fingerprints of different habitats were studied. Analysis was carried out on a Hypersil ODS2 column (4.6 mm x 250 mm, 5 microm) with acetonitrile-0.1% glacial acetic acid as the mobile phase, and eluates were detected by an evaporative light scattering detector (ELSD). The similarity evaluation system for chromatographic fingerprint of traditional Chinese medicine ( Version 2004 A) was applied to analyses the similarity of the fingerprint of diverse habitats. The similarity results were verified by SPSS. The chromatographic profiles of the samples from different regions were very similar. HPLC fingerprints of Semen C. argentea 12 common peaks and each peak in the fingerprint was well separated under the chromatographic condition above. The different habitats of C. argentea can be grouped to two types: the middle region and the south region. The chemical constituents of C. argentea vary with different habitats so selection of material habitat is very important for quality control of C. argentea. The fingerprint with high individuality and specificity could be applied in the identification and quality control of the material of C. argentea. PMID:18338620

  4. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  5. Privacy protection schemes for fingerprint recognition systems

    NASA Astrophysics Data System (ADS)

    Marasco, Emanuela; Cukic, Bojan

    2015-05-01

    The deployment of fingerprint recognition systems has always raised concerns related to personal privacy. A fingerprint is permanently associated with an individual and, generally, it cannot be reset if compromised in one application. Given that fingerprints are not a secret, potential misuses besides personal recognition represent privacy threats and may lead to public distrust. Privacy mechanisms control access to personal information and limit the likelihood of intrusions. In this paper, image- and feature-level schemes for privacy protection in fingerprint recognition systems are reviewed. Storing only key features of a biometric signature can reduce the likelihood of biometric data being used for unintended purposes. In biometric cryptosystems and biometric-based key release, the biometric component verifies the identity of the user, while the cryptographic key protects the communication channel. Transformation-based approaches only a transformed version of the original biometric signature is stored. Different applications can use different transforms. Matching is performed in the transformed domain which enable the preservation of low error rates. Since such templates do not reveal information about individuals, they are referred to as cancelable templates. A compromised template can be re-issued using a different transform. At image-level, de-identification schemes can remove identifiers disclosed for objectives unrelated to the original purpose, while permitting other authorized uses of personal information. Fingerprint images can be de-identified by, for example, mixing fingerprints or removing gender signature. In both cases, degradation of matching performance is minimized.

  6. Development of Quantitative Structure-Activity Relationship Models for Predicting Chronic Toxicity of Substituted Benzenes to Daphnia Magna.

    PubMed

    Fan, Deling; Liu, Jining; Wang, Lei; Yang, Xianhai; Zhang, Shenghu; Zhang, Yan; Shi, Lili

    2016-05-01

    The chronic toxicity of anthropogenic molecules such as substituted benzenes to Daphnia magna is a basic eco-toxicity parameter employed to assess their environmental risk. As the experimental methods are laborious, costly, and time-consuming, development in silico models for predicting the chronic toxicity is vitally important. In this study, on the basis of five molecular descriptors and 48 compounds, a quantitative structure-property relationship model that can predict the chronic toxicity of substituted benzenes were developed by employing multiple linear regressions. The correlation coefficient (R (2)) and root-mean square error (RMSE) for the training set were 0.836 and 0.390, respectively. The developed model was validated by employing 10 compounds tested in our lab. The R EXT (2) and RMSE EXT for the validation set were 0.736 and 0.490, respectively. To further characterizing the toxicity mechanism of anthropogenic molecules to Daphnia, comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) models were developed. PMID:27016939

  7. Toward Surface-Enhanced Raman Imaging of Latent Fingerprints

    SciTech Connect

    Connatser, Raynella M; Prokes, Sharka M.; Glembocki, Orest; Schuler, Rebecca A.; Gardner, Charles W.; Lewis Sr, Samuel Arthur; Lewis, Linda A

    2010-01-01

    Exposure to light or heat, or simply a dearth of fingerprint material, renders some latent fingerprints undetectable using conventional methods. We begin to address such elusive fingerprints using detection targeting photo- and thermally stable fingerprint constituents: surface-enhanced Raman spectroscopy (SERS). SERS can give descriptive vibrational spectra of amino acids, among other robust fingerprint constituents, and good sensitivity can be attained by improving metal-dielectric nanoparticle substrates. With SERS chemical imaging, vibrational bands intensities recreate a visual of fingerprint topography. The impact of nanoparticle synthesis route, dispersal methodology-deposition solvent, and laser wavelength are discussed, as are data from enhanced vibrational spectra of fingerprint components. SERS and Raman chemical images of fingerprints and realistic contaminants are shown. To our knowledge, this represents the first SERS imaging of fingerprints. In conclusion, this work progresses toward the ultimate goal of vibrationally detecting latent prints that would otherwise remain undetected using traditional development methods.

  8. Correlation between heavy metal acute toxicity values in Daphnia magna and fish

    SciTech Connect

    Khangarot, B.S.; Ray, P.K.

    1987-04-01

    In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species have been of recent interest as test models due to the need for developing nonmammalian tests system. The cladoceran Daphnia magna bioassays have several practical advantages. D. magna has been used as a useful test species and its sensitivity to environmental pollutants have been recognized as a general representative of other freshwater zooplankton species. The objectives of this study were to determine the acute toxicity of various heavy metals to Daphnia magna for 48 h of exposure and to compare these values with the existing LC50 values for rainbow trout (Salmo gairdneri); which is commonly used as a test animal in aquatic bioassay studies.

  9. A comparison of the toxicity of 30 reference chemicals to Daphnia magna and Daphnia pulex

    SciTech Connect

    Lilius, H.; Haestbacka, T.; Isomaa, B.

    1995-12-01

    To determine whether significant differences exist in the sensitivity of different Daphnia species to toxicants, the acute toxicity of the first 30 MEIC (multicenter evaluation of in vitro cytotoxicity) reference chemicals was determined in two species of Daphnia: D. magna and D. pulex. Correlation and regression analysis of the EC50 data for immobilization showed a very good concordance (r = 0.97, slope = 1.02). A comparison between the EC50 data obtained for D. magna by two laboratories independently for the 50 MEIC chemicals also showed a good concordance (r = 0.93, slope = 0.91). In both comparisons the regression line did not differ significantly from the regression line for a 1:1 regression. The authors conclude that their study, including a set of reference chemicals, indicates that is no difference in the overall sensitivity of the two Daphnia species and the two clones of D. magna.

  10. The detection of drugs of abuse in fingerprints using Raman spectroscopy II: cyanoacrylate-fumed fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-07-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in cyanoacrylate-fumed fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. These fingerprints were enhanced by cyanoacrylate fuming, a process in which a layer of white cyanoacrylate polymer is deposited on the fingerprint material, enabling visual detection. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were used. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in cyanoacrylate-fumed fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in cyanoacrylate-fumed fingerprints were of a similar quality to spectra obtained from the substances under normal sampling conditions, however, interfering Raman bands arising from the cyanoacrylate polymer were present in the spectra. In most cases the only interfering band was the CN stretching mode of the polymer, and there were no cases where the interfering bands prevented identification of the substances. If necessary, the interfering bands could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in cyanoacrylate-fumed fingerprints was visually locating the substance in the fingerprint beneath the polymer layer in order to obtain a Raman spectrum.

  11. A Study on the D. magna and V. fischeri Toxicity Relationship of Industrial Wastewater from Korea

    NASA Astrophysics Data System (ADS)

    Pyo, S.; Lee, S.; Chun Sang, H.; Park, T. J.; Kim, M. S.

    2015-12-01

    It is well known that high concentration of TDS (total dissolved solid) in industrial effluent gives rise to the toxicity to the Daphnia magna toxicity test. D. magna is vulnerable to relatively low TDS concentration showing the 24-hr EC50 of Salinity 0.6% (as the sea salt concentration). Recently, standard mandatory toxicity testing using Daphnia magna has been used to monitor industrial effluent toxicity according to Korea standard method (Acute Toxicity Test Method of the Daphnia magna Straus (Cladocera, Crustacea), ES 04704. 1a) under regulation. Since only one acute toxicity testing is applied in the present, we are trying to introduce microbial battery for more complete toxicity assessment. In this study, the acute toxicities between daphnids and microbes were compared. The results of D. magna and Vibrio fischeri toxicity test from 165 industrial wastewater effluents showed high positive correlation. In addition, the possibility of predicting daphnia toxicity from the bacterial toxicity data amounts to 92.6% if we consider salinity effect (>5ppt) together. From this study, we found that the V. fischeri toxicity test is a powerful battery tool to assess the industrial wastewater toxicity. Here, we suggest that luminescent bacteria toxicity test be useful not only for complete toxicity assessment which can't be obtained by daphnia toxicity testing only but also for the reduction cost, time, and labor in the Korean society. Keywords : D. magna, V. fischeri, Industrial waste water, battery test Acknowledgement This research was supported by a grant (15IFIP-B089908-02) from Plant Research Program funded by Ministry of Land, Infrastructure and Transport of Korean government

  12. Exploring methods for compositional and particle size analysis of noble metal nanoparticles in Daphnia magna.

    PubMed

    Krystek, Petra; Brandsma, Sicco; Leonards, Pim; de Boer, Jacob

    2016-01-15

    The identification and quantification of the bioaccumulation of noble metal engineered nanoparticles (ENPs) by aquatic organisms is of great relevance to understand the exposure and potential toxicity mechanisms of nanoscale materials. Four analytical scenarios were investigated in relation to various sized and composed noble metal (gold (Au), platinum (Pt) and silver (Ag)) ENPs during acute, short-term exposure of Daphnia (D.) magna. Next to the total elemental quantification of absorbed ENPs by D. magna, especially information on the size and particle distribution of ENPs in D. magna is of relevance. Dissolution of the exposed biological material prior to measurement by asymmetric flow field flow fractionation coupled to inductively coupled plasma mass spectrometry (AF4-ICPMS) is challenging because the ENPs must stay stable regarding to particle size and composition. Next to dissolution of exposed D. magna by tetra methyl ammonium hydroxide (TMAH), a new enzymatic dissolution approach was explored by using trypsin. The presence of various sized and composed ENPs has been confirmed by AF4-ICPMS but the chosen dissolution medium was crucial for the results. TMAH and trypsin led to comparable results for medium-sized (50nm) noble metals ENPs in exposed D. magna. But it was also shown that the dissolution of biological materials with smaller (<5nm) ENPs led to different results in particle size and elemental concentration depending on the selected dissolution medium. A significant uptake of Au and Pt ENPs by D. magna or adsorption to particles occurred because only 1-5% of the exposed ENPs remained in the exposure medium. PMID:26592609

  13. Development of an NMR microprobe procedure for high-throughput environmental metabolomics of Daphnia magna.

    PubMed

    Nagato, Edward G; Lankadurai, Brian P; Soong, Ronald; Simpson, André J; Simpson, Myrna J

    2015-09-01

    Nuclear magnetic resonance (NMR) is the primary platform used in high-throughput environmental metabolomics studies because its non-selectivity is well suited for non-targeted approaches. However, standard NMR probes may limit the use of NMR-based metabolomics for tiny organisms because of the sample volumes required for routine metabolic profiling. Because of this, keystone ecological species, such as the water flea Daphnia magna, are not commonly studied because of the analytical challenges associated with NMR-based approaches. Here, the use of a 1.7-mm NMR microprobe in analyzing tissue extracts from D. magna is tested. Three different extraction procedures (D2O-based buffer, Bligh and Dyer, and acetonitrile : methanol : water) were compared in terms of the yields and breadth of polar metabolites. The D2O buffer extraction yielded the most metabolites and resulted in the best reproducibility. Varying amounts of D. magna dry mass were extracted to optimize metabolite isolation from D. magna tissues. A ratio of 1-1.5-mg dry mass to 40 µl of extraction solvent provided excellent signal-to-noise and spectral resolution using (1)H NMR. The metabolite profile of a single daphnid was also investigated (approximately 0.2 mg). However, the signal-to-noise of the (1)H NMR was considerably lower, and while feasible for select applications would likely not be appropriate for high-throughput NMR-based metabolomics. Two-dimensional NMR experiments on D. magna extracts were also performed using the 1.7-mm NMR probe to confirm (1)H NMR metabolite assignments. This study provides an NMR-based analytical framework for future metabolomics studies that use D. magna in ecological and ecotoxicity studies. PMID:25891518

  14. Dental DNA fingerprinting in identification of human remains

    PubMed Central

    Girish, KL; Rahman, Farzan S; Tippu, Shoaib R

    2010-01-01

    The recent advances in molecular biology have revolutionized all aspects of dentistry. DNA, the language of life yields information beyond our imagination, both in health or disease. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. It is being increasingly used in analyzing various scenarios related to forensic science. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. DNA is an excellent means for identification of unidentified human remains. As dental pulp is surrounded by dentin and enamel, which forms dental armor, it offers the best source of DNA for reliable genetic type in forensic science. This paper summarizes the recent literature on use of this technique in identification of unidentified human remains. PMID:21731342

  15. Social media fingerprints of unemployment.

    PubMed

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

  16. Metabolomic fingerprinting of plant extracts.

    PubMed

    Mattoli, L; Cangi, F; Maidecchi, A; Ghiara, C; Ragazzi, E; Tubaro, M; Stella, L; Tisato, F; Traldi, P

    2006-12-01

    The standardization and quality control of plant extracts is an important topic, in particular, when such extracts are used for medicinal purposes. Consequently, the development of fast and effective analytical methods for metabolomic fingerprinting of plant extracts is of high interest. In this investigation, electrospray mass spectrometry (ESI-MS) and (1)H NMR techniques were employed with further statistical analyses of the acquired data. The results showed that negative ion mode ESI-MS is particularly effective for characterization of plant extracts. Different samples of the same species appear well-clustered and separated from the other species. To verify the effectiveness of the method, two other batches of extracts from a species, in which the principal components were already identified (Cynara scolymus), were analyzed, and the components that were verified by the principal component analysis (PCA) were found to be within the region identified as characteristic of Cynara Scolymus extracts. The data from extracts of the other species were well separated from those pertaining to the species previously characterized. Only the case of a species that was strictly correlated from a botanical point of view, with extracts that were previously analyzed, showed overlapping. PMID:17051519

  17. Social Media Fingerprints of Unemployment

    PubMed Central

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

  18. Iron-Tolerant Cyanobacteria: Ecophysiology and Fingerprinting

    NASA Technical Reports Server (NTRS)

    Brown, I. I.; Mummey, D.; Lindsey, J.; McKay, D. S.

    2006-01-01

    Although the iron-dependent physiology of marine and freshwater cyanobacterial strains has been the focus of extensive study, very few studies dedicated to the physiology and diversity of cyanobacteria inhabiting iron-depositing hot springs have been conducted. One of the few studies that have been conducted [B. Pierson, 1999] found that cyanobacterial members of iron depositing bacterial mat communities might increase the rate of iron oxidation in situ and that ferrous iron concentrations up to 1 mM significantly stimulated light dependent consumption of bicarbonate, suggesting a specific role for elevated iron in photosynthesis of cyanobacteria inhabiting iron-depositing hot springs. Our recent studies pertaining to the diversity and physiology of cyanobacteria populating iron-depositing hot springs in Great Yellowstone area (Western USA) indicated a number of different isolates exhibiting elevated tolerance to Fe(3+) (up to 1 mM). Moreover, stimulation of growth was observed with increased Fe(3+) (0.02-0.4 mM). Molecular fingerprinting of unialgal isolates revealed a new cyanobacterial genus and species Chroogloeocystis siderophila, an unicellular cyanobacterium with significant EPS sheath harboring colloidal Fe(3+) from iron enriched media. Our preliminary data suggest that some filamentous species of iron-tolerant cyanobacteria are capable of exocytosis of iron precipitated in cytoplasm. Prior to 2.4 Ga global oceans were likely significantly enriched in soluble iron [Lindsay et al, 2003], conditions which are not conducive to growth of most contemporary oxygenic cyanobacteria. Thus, iron-tolerant CB may have played important physiological and evolutionary roles in Earths history.

  19. Near Catastrophic Accelerated Structural Degeneration of the Perimount Magna Pericardial Bioprosthesis in Children.

    PubMed

    Philip, Ranjit; Kumar, T K Susheel; Waller, B Rush; McCoy, Mia; Knott-Craig, Christopher J

    2016-07-01

    Experience with pericardial bioprostheses in young patients is limited. Accelerated degeneration of the Mitroflow valve has recently been reported. We report early accelerated structural valve degeneration with the Perimount Magna bioprosthesis, which has not been previously reported. Young patients with the Magna bioprosthesis are at high risk for rapid progression to severe stenosis, which underscores their need for more vigilant surveillance. The benefits and risks of these bioprosthetic valves must be weighed carefully when options for replacement in these young patients are discussed. PMID:27343502

  20. Free ionic nickel accumulation and localization in the freshwater zooplankter, Daphnia magna

    SciTech Connect

    Hall, T.M.

    1982-01-01

    The processes which lead to the accumulation of free ionic nickel (radioactive) from solution by Daphnia magna were studied and incorporated into a model which describes accummulation at different concentrations. Adsorption proved to be a relatively small component of nickel accummulation. The accummulation rate eventually approached zero, which represented an equilibrium between uptake and loss of nickel. However, elimination experiments did reveal a pool of relatively static nickel. The appearance and distribution of nickel within five body parts (body fluid, carapace, gut, filtering appendages, and eggs) of D. magna supported the accummulation data and added to the understanding of the pathways of nickel through the organism.

  1. Reproducibility of a life-cycle toxicity test with Daphnia magna

    SciTech Connect

    Parkhurst, B.R.; Forte, J.L.; Wright, G.P.

    1981-01-01

    Standardized chronic life-cycle toxicity testing procedures for aquatic species are described. The reproducibility of chronic toxicity and points using the static-renewal method with Daphnia magna are investigated. The objectives were to determine if the lowest rejected concentrations tested (LRCTs) obtained for six different toxicity criteria in static-renewal tests with acridine were reproducible over time and to determine the relative sensitivity and variability of the toxicity criteria. Two of the six toxicity criteria, numbers of young per brood and the young produced per female, were found to be reliable and sensitive for estimating the LRCT for acridine to D. magna. (RJC)

  2. Evaluation of clorsulon against immature Fascioloides magna in cattle and sheep.

    PubMed

    Foreyt, W J

    1988-07-01

    Efficacy of clorsulon was evaluated against infection with immature Fascioloides magna in 24 cattle and 12 sheep. Infections were induced by oral administration of 600 metacercariae/host. In cattle, clorsulon at dosages of 7 and 21 mg/kg of body weight was 65 and 100% effective against 8-week-old flukes, and 20 and 74% effective against 16-week-old flukes, respectively. In sheep, clorsulon at a dosage of 21 mg/kg was 92% effective against 8-week-old flukes. Significantly (P less than 0.05) more F magna were recovered from untreated sheep than from untreated cattle. PMID:3421522

  3. Multispectral fingerprint imaging for spoof detection

    NASA Astrophysics Data System (ADS)

    Nixon, Kristin A.; Rowe, Robert K.

    2005-03-01

    Fingerprint systems are the most widespread form of biometric authentication. Used in locations such as airports and in PDA's and laptops, fingerprint readers are becoming more common in everyday use. As they become more familiar, the security weaknesses of fingerprint sensors are becoming better known. Numerous websites now exist describing in detail how to create a fake fingerprint usable for spoofing a biometric system from both a cooperative user and from latent prints. While many commercial fingerprint readers claim to have some degree of spoof detection incorporated, they are still generally susceptible to spoof attempts using various artificial fingerprint samples made from gelatin or silicone or other materials and methods commonly available on the web. This paper describes a multispectral sensor that has been developed to collect data for spoof detection. The sensor has been designed to work in conjunction with a conventional optical fingerprint reader such that all images are collected during a single placement of the finger on the sensor. The multispectral imaging device captures sub-surface information about the finger that makes it very difficult to spoof. Four attributes of the finger that are collected with the multispectral imager will be described and demonstrated in this paper: spectral qualities of live skin, chromatic texture of skin, sub-surface image of live skin, and blanching on contact. Each of these attributes is well suited to discriminating against particular kinds of spoofing samples. A series of experiments was conducted to demonstrate the capabilities of the individual attributes as well as the collective spoof detection performance.

  4. Statistical quality assessment of a fingerprint

    NASA Astrophysics Data System (ADS)

    Hwang, Kyungtae

    2004-08-01

    The quality of a fingerprint is essential to the performance of AFIS (Automatic Fingerprint Identification System). Such a quality may be classified by clarity and regularity of ridge-valley structures.1,2 One may calculate thickness of ridge and valley to measure the clarity and regularity. However, calculating a thickness is not feasible in a poor quality image, especially, severely damaged images that contain broken ridges (or valleys). In order to overcome such a difficulty, the proposed approach employs the statistical properties in a local block, which involve the mean and spread of the thickness of both ridge and valley. The mean value is used for determining whether a fingerprint is wet or dry. For example, the black pixels are dominant if a fingerprint is wet, the average thickness of ridge is larger than one of valley, and vice versa on a dry fingerprint. In addition, a standard deviation is used for determining severity of damage. In this study, the quality is divided into three categories based on two statistical properties mentioned above: wet, good, and dry. The number of low quality blocks is used to measure a global quality of fingerprint. In addition, a distribution of poor blocks is also measured using Euclidean distances between groups of poor blocks. With this scheme, locally condensed poor blocks decreases the overall quality of an image. Experimental results on the fingerprint images captured by optical devices as well as by a rolling method show the wet and dry parts of image were successfully captured. Enhancing an image by employing morphology techniques that modifying the detected poor quality blocks is illustrated in section 3. However, more work needs to be done on designing a scheme to incorporate the number of poor blocks and their distributions for a global quality.

  5. Uncovering Cryptic Asexuality in Daphnia magna by RAD Sequencing.

    PubMed

    Svendsen, Nils; Reisser, Celine M O; Dukić, Marinela; Thuillier, Virginie; Ségard, Adeline; Liautard-Haag, Cathy; Fasel, Dominique; Hürlimann, Evelin; Lenormand, Thomas; Galimov, Yan; Haag, Christoph R

    2015-11-01

    The breeding systems of many organisms are cryptic and difficult to investigate with observational data, yet they have profound effects on a species' ecology, evolution, and genome organization. Genomic approaches offer a novel, indirect way to investigate breeding systems, specifically by studying the transmission of genetic information from parents to offspring. Here we exemplify this method through an assessment of self-fertilization vs. automictic parthenogenesis in Daphnia magna. Self-fertilization reduces heterozygosity by 50% compared to the parents, but under automixis, whereby two haploid products from a single meiosis fuse, the expected heterozygosity reduction depends on whether the two meiotic products are separated during meiosis I or II (i.e., central vs. terminal fusion). Reviewing the existing literature and incorporating recombination interference, we derive an interchromosomal and an intrachromosomal prediction of how to distinguish various forms of automixis from self-fertilization using offspring heterozygosity data. We then test these predictions using RAD-sequencing data on presumed automictic diapause offspring of so-called nonmale producing strains and compare them with "self-fertilized" offspring produced by within-clone mating. The results unequivocally show that these offspring were produced by automixis, mostly, but not exclusively, through terminal fusion. However, the results also show that this conclusion was only possible owing to genome-wide heterozygosity data, with phenotypic data as well as data from microsatellite markers yielding inconclusive or even misleading results. Our study thus demonstrates how to use the power of genomic approaches for elucidating breeding systems, and it provides the first demonstration of automictic parthenogenesis in Daphnia. PMID:26341660

  6. Activity-relevant similarity values for fingerprints and implications for similarity searching

    PubMed Central

    Jasial, Swarit; Hu, Ye; Vogt, Martin; Bajorath, Jürgen

    2016-01-01

    A largely unsolved problem in chemoinformatics is the issue of how calculated compound similarity relates to activity similarity, which is central to many applications. In general, activity relationships are predicted from calculated similarity values. However, there is no solid scientific foundation to bridge between calculated molecular and observed activity similarity. Accordingly, the success rate of identifying new active compounds by similarity searching is limited. Although various attempts have been made to establish relationships between calculated fingerprint similarity values and biological activities, none of these has yielded generally applicable rules for similarity searching. In this study, we have addressed the question of molecular versus activity similarity in a more fundamental way. First, we have evaluated if activity-relevant similarity value ranges could in principle be identified for standard fingerprints and distinguished from similarity resulting from random compound comparisons. Then, we have analyzed if activity-relevant similarity values could be used to guide typical similarity search calculations aiming to identify active compounds in databases. It was found that activity-relevant similarity values can be identified as a characteristic feature of fingerprints. However, it was also shown that such values cannot be reliably used as thresholds for practical similarity search calculations. In addition, the analysis presented herein helped to rationalize differences in fingerprint search performance. PMID:27127620

  7. DNA fingerprinting in botany: past, present, future

    PubMed Central

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined “Fingerprint News” was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on “DNA fingerprinting: approaches and applications”. Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting (“the past”) was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as “DNA fingerprinting in the present”, and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA

  8. DNA fingerprinting in botany: past, present, future.

    PubMed

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  9. Changes in iTRAQ-Based Proteomic Profiling of the Cladoceran Daphnia magna Exposed to Microcystin-Producing and Microcystin-Free Microcystis aeruginosa.

    PubMed

    Lyu, Kai; Meng, Qingguo; Zhu, Xuexia; Dai, Daoxin; Zhang, Lu; Huang, Yuan; Yang, Zhou

    2016-05-01

    Global warming and increased nutrient fluxes cause cyanobacterial blooms in freshwater ecosystems. These phenomena have increased the concern for human health and ecosystem services. The mass occurrences of toxic cyanobacteria strongly affect freshwater zooplankton communities, especially the unselective filter feeder Daphnia. However, the molecular mechanisms of cyanobacterial toxicity remain poorly understood. This study is the first to combine the established body growth rate (BGR), which is an indicator of life-history fitness, with differential peptide labeling (iTRAQ)-based proteomics in Daphnia magna influenced by microcystin-producing (MP) and microcystin-free (MF) Microcystis aeruginosa. A significant decrease in BGR was detected when D. magna was exposed to MP or MF M. aeruginosa. Conducting iTRAQ proteomic analyses, we successfully identified and quantified 211 proteins with significant changes in expression. A cluster of orthologous groups revealed that M. aeruginosa-affected differential proteins were strongly associated with lipid, carbohydrate, amino acid, and energy metabolism. These parameters could potentially explain the reduced fitness based on the cost of the substance metabolism. PMID:27057760

  10. Protein fingerprint diversification of rice seeds

    NASA Astrophysics Data System (ADS)

    Lu, Weihong; Sun, Yeqing; Zheng, Qi; Guan, Shuanghong

    To study protein fingerprint diversification of rice seeds induced by space environment we selected three series mutants induced in Chinese recoverable satellite in 1996 for 15 days including 1 Series 971 971ck the control sample in ground 971-5 and 971-4 samples after space derivation 2 Series 972 972ck the control sample in ground 972-4 and 972-1 samples after space derivation 3 Series 974 974ck the control sample in ground 974-5 and 974-8 samples after space derivation The proteins were extracted and separated to 4 groups Albumin Globulin Prolamine and Glutelin from the seeds of ground control group and inducted by space environment group Using RPLC method Reference peak was selected in every group and its relative retention time was 1 000 The relative retention time of other peaks was the ratio Calculate the contents due to the peak areas and draw a conclusion that some contents of protein were changed in the seeds of the mutant varieties There are character peaks among different varieties as the fingerprint Comparative analysis the fingerprint of Albumin Globulin and Prolamine can find the different in varieties identify The protein express abundance and easy be detected in the seeds So using RPLC method the Protein Fingerprint can identify breed handily and steadily Keywords rice seeds Space environment Protein Fingerprint

  11. Impact of Finger Type in Fingerprint Authentication

    NASA Astrophysics Data System (ADS)

    Gafurov, Davrondzhon; Bours, Patrick; Yang, Bian; Busch, Christoph

    Nowadays fingerprint verification system is the most widespread and accepted biometric technology that explores various features of the human fingers for this purpose. In general, every normal person has 10 fingers with different size. Although it is claimed that recognition performance with little fingers can be less accurate compared to other finger types, to our best knowledge, this has not been investigated yet. This paper presents our study on the topic of influence of the finger type into fingerprint recognition performance. For analysis we employ two fingerprint verification software packages (one public and one commercial). We conduct test on GUC100 multi sensor fingerprint database which contains fingerprint images of all 10 fingers from 100 subjects. Our analysis indeed confirms that performance with small fingers is less accurate than performance with the others fingers of the hand. It also appears that best performance is being obtained with thumb or index fingers. For example, performance deterioration from the best finger (i.e. index or thumb) to the worst fingers (i.e. small ones) can be in the range of 184%-1352%.

  12. Localized Dictionaries Based Orientation Field Estimation for Latent Fingerprints.

    PubMed

    Xiao Yang; Jianjiang Feng; Jie Zhou

    2014-05-01

    Dictionary based orientation field estimation approach has shown promising performance for latent fingerprints. In this paper, we seek to exploit stronger prior knowledge of fingerprints in order to further improve the performance. Realizing that ridge orientations at different locations of fingerprints have different characteristics, we propose a localized dictionaries-based orientation field estimation algorithm, in which noisy orientation patch at a location output by a local estimation approach is replaced by real orientation patch in the local dictionary at the same location. The precondition of applying localized dictionaries is that the pose of the latent fingerprint needs to be estimated. We propose a Hough transform-based fingerprint pose estimation algorithm, in which the predictions about fingerprint pose made by all orientation patches in the latent fingerprint are accumulated. Experimental results on challenging latent fingerprint datasets show the proposed method outperforms previous ones markedly. PMID:26353229

  13. Solving the Mystery of Fading Fingerprints with London Dispersion Forces.

    ERIC Educational Resources Information Center

    Kimbrough, Doris R.; DeLorenzo, Ronald

    1998-01-01

    Focuses on the kidnapping of a child whose fingerprints were not found inside the crime vehicle. Discusses the investigation that followed and led to knowledge of the differences between the fingerprints of children and adults. (DDR)

  14. A fingerprint inpainting technique using improved partial differential equation methods

    NASA Astrophysics Data System (ADS)

    Yang, Xiukun; Wang, Dan; Yang, Zhigang

    2011-10-01

    In an automatic fingerprint identification system (AFIS), fingerprint inpainting is a critical step in the preprocessing procedures. Because partially fouled, breaking or scratched latent fingerprint is difficult to be correctly matched to a known fingerprint. However, fingerprint restoration proved to be a particularly challenging problem because conventional image restoration schemes can not be directly applied to fingerprint due to the unique ridge and valley structures in typical fingerprint images. Based on partial differential equations algorithm, this paper presents a fingerprint restoration algorithm composing gradient and orientation field. According to gradient and orientation field of the known pixel points, different weights are used in different orientation field in the restoration process. Experimental results demonstrate that the proposed restoration algorithm can effectively reduce the false feature points.

  15. Fingerprinting Communication and Computation on HPC Machines

    SciTech Connect

    Peisert, Sean

    2010-06-02

    How do we identify what is actually running on high-performance computing systems? Names of binaries, dynamic libraries loaded, or other elements in a submission to a batch queue can give clues, but binary names can be changed, and libraries provide limited insight and resolution on the code being run. In this paper, we present a method for"fingerprinting" code running on HPC machines using elements of communication and computation. We then discuss how that fingerprint can be used to determine if the code is consistent with certain other types of codes, what a user usually runs, or what the user requested an allocation to do. In some cases, our techniques enable us to fingerprint HPC codes using runtime MPI data with a high degree of accuracy.

  16. Image and video fingerprinting: forensic applications

    NASA Astrophysics Data System (ADS)

    Lefebvre, Frédéric; Chupeau, Bertrand; Massoudi, Ayoub; Diehl, Eric

    2009-02-01

    Fighting movie piracy often requires automatic content identification. The most common technique to achieve this uses watermarking, but not all copyrighted content is watermarked. Video fingerprinting is an efficient alternative solution to identify content, to manage multimedia files in UGC sites or P2P networks and to register pirated copies with master content. When registering by matching copy fingerprints with master ones, a model of distortion can be estimated. In case of in-theater piracy, the model of geometric distortion allows the estimation of the capture location. A step even further is to determine, from passive image analysis only, whether different pirated versions were captured with the same camcorder. In this paper we present three such fingerprinting-based forensic applications: UGC filtering, estimation of capture location and source identification.

  17. Chemical Fingerprinting of Materials Developed Due to Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    Instrumental chemical analysis methods are developed and used to chemically fingerprint new and modified External Tank materials made necessary by changing environmental requirements. Chemical fingerprinting can detect and diagnose variations in material composition. To chemically characterize each material, fingerprint methods are selected from an extensive toolbox based on the material's chemistry and the ability of the specific methods to detect the material's critical ingredients. Fingerprint methods have been developed for a variety of materials including Thermal Protection System foams, adhesives, primers, and composites.

  18. Synthesis, characterization and toxicological evaluation of Cr₂O₃ nanoparticles using Daphnia magna and Aliivibrio fischeri.

    PubMed

    Puerari, Rodrigo Costa; da Costa, Cristina H; Vicentini, Denice S; Fuzinatto, Cristiane F; Melegari, Silvia P; Schmidt, Éder C; Bouzon, Zenilda L; Matias, William G

    2016-06-01

    Chromium III oxide (Cr2O3) nanoparticles (NPs) are used in pigments for ceramics, dyes, paints and cosmetics. However, few studies addressing the toxic potential of these NPs have been reported in the literature. Thus, this research aimed to evaluate the acute and chronic effects of Cr2O3 NPs through acute toxicity tests with Daphnia magna and Aliivibrio fischeri and chronic toxicity tests with Daphnia magna. Cr2O3 NPs were synthesized by the sol-gel method and characterized through TEM, X-Ray diffraction (XRD), zeta potential (ZP) and surface area analysis. In the acute toxicity tests the EC(50,48h) value obtained with D. magna was 6.79 mg L(-1) and for A. fischeri the EC(50,15min) value was 16.10 mg L(-1) and the EC(50,30min) value was 12.91 mg L(-1). Regarding the chronic toxicity tests with D. magna, effects on longevity (OEC=1.00 mg L(-1)), reproduction (OEC=1.00 mg L(-1)) and growth (OEC=0.50 mg L(-1)) were observed. On the SEM and TEM images, ultrastructural alterations in the organelles of exposed organisms were also observed. Thus, toxicological studies with NPs are of great importance in order to reduce the risk of environmental contamination. PMID:26890188

  19. Effect of pulse frequency and interval on the toxicity of chlorpyrifos to Daphnia magna.

    PubMed

    Naddy, R B; Klaine, S J

    2001-11-01

    Due to the episodic nature in which organisms are exposed to non-point source pollutants, it is necessary to understand how they are affected by pulsed concentrations of contaminants. This is essential, as standard toxicity tests may not adequately simulate exposure scenarios for short-lived hydrophobic compounds, such as chlorpyrifos (CPF), a broad-spectrum organophosphate insecticide. Studies were conducted with 7-day old Daphnia magna for 7 days to evaluate the effect of pulse frequency and interval among multiple CPF exposures. Daphnids were exposed to a total exposure of either 12 h at 0.5 microg/l or 6 h at 1.0 microg/l nominal CPF, respectively, in all studies. For interval studies, D. magna were exposed to two pulses of CPF at each concentration, with 0-96-h intervals between pulses. For frequency studies, D. magna were exposed to each CPF concentration altering the pulse scheme by decreasing the exposure duration but increasing the number of pulses, keeping the total exposure time the same. The pulse interval between multiple pulses in these experiments was 24 h. Our results suggest that D. magna can withstand an acutely lethal CPF exposure provided that there is adequate time for recovery between exposures. PMID:11680745

  20. Bioaccumulation and oxidative stress in Daphnia magna exposed to arsenite and arsenate.

    PubMed

    Fan, Wenhong; Ren, Jinqian; Li, Xiaomin; Wei, Chaoyang; Xue, Feng; Zhang, Nan

    2015-11-01

    Arsenic pollution and its toxicity to aquatic organisms have attracted worldwide attention. The bioavailability and toxicity of arsenic are highly related to its speciation. The present study investigated the differences in bioaccumulation and oxidative stress responses in an aquatic organism, Daphnia magna, induced by 2 inorganic arsenic species (As(III) and As(V)). The bioaccumulation of arsenic, Na(+) /K(+) -adenosine triphosphatase (ATPase) activity, reactive oxygen species (ROS) content, total superoxide dismutase (SOD) activity, total antioxidative capability, and malondialdehyde content in D. magna were determined after exposure to 500 µg/L of arsenite and arsenate for 48 h. The results showed that the oxidative stress and antioxidative process in D. magna exposed to arsenite and arsenate could be divided into 3 phases, which were antioxidative response, oxidation inhibition, and antioxidative recovery. In addition, differences in bioaccumulation, Na(+) /K(+) -ATPase activity, and total SOD activity were also found in D. magna exposed to As(III) and As(V). These differences might have been the result of the high affinity of As(III) with sulfhydryl groups in enzymes and the structural similarity of As(V) to phosphate. Therefore, arsenate could be taken up by organisms through phosphate transporters, could substitute for phosphate in biochemical reactions, and could lead to a change in the bioaccumulation of arsenic and activity of enzymes. These characteristics were the possible reasons for the different toxicity mechanisms in the oxidative stress process of arsenite and arsenate. PMID:26084717

  1. Effects of bifenthrin on Daphnia magna during chronic toxicity test and the recovery test.

    PubMed

    Ye, Wei-Hong; Wen, Yue-Zhong; Liu, Wei-Ping; Wang, Zhong-Qiang

    2004-01-01

    The acute and chronic toxic effects of bifenthrin on Daphnia magna were studied. The results showed that 24 h-EC50, 48 h-LC50 and 96 h-LC50 of bifenthrin on D. magna were 3.24, 12.40 and 1.40 microg/L respectively. And the LOEC and NOEC of bifenthrin were 0.02 and 0.004 microg/L respectively. The recovery test of bifenthrin on Daphnia magna was presented. Daphnia magna (F0 generation) were exposed during 21 d to different bifenthrin concentrations. Offspring (animals from the first and third brood: F1 (1st) and F1 (3rd), respectively) were transferred to a free pesticide medium during a 21 d recovery period. In this recovery study, survival, growth, reproduction (mean total young per female, onset of reproduction and number broods per female) and the intrinsic rate of natural increase (r) were assessed as parameters. Reproduction such as number of young per female as well as length was still reduced in F1 (1st) generation daphnids from parentals (F0) exposed to the bifenthrin. However F, (3rd) individuals from parentals exposed to pesticide concentrations were able to restore reproduction when a recovery period of 21 d was allowed, but the length of F, (3rd) from parentals exposed to the 0.5 and 0.75 microg/L bifenthrin concentration was still significantly effected (P < 0.05). PMID:15559825

  2. Daphnia magna feeding behavior after exposure to tetradifon and recovery from intoxication.

    PubMed

    Villarroel, M J; Ferrando, M D; Sancho, E; Andreu, E

    1999-09-01

    The feeding behavior of the cladocera Daphnia magna subjected to a short-term exposure to the acaricide tetradifon (4-chlorophenyl 2,4, 5-trichlorophenyl sulfone) was studied. The experiments were performed using the unicellular algae Nannochloris oculata at a density of 5x10(5) cells/ml as food for the organisms. In a first experiment, three generations (F0, F1, and F3) of the daphnids were exposed to sublethal levels of tetradifon (0.1, 0.18, 0.22, and 0.44 mg/l) and the effect of the toxicant on filtration and ingestion rates was determined. Rates of filtration and ingestion of D. magna declined in the three generations studied with increasing toxicant concentrations; however, toxicant effect was greater in daphnids from generations F1 and F3 than in those from the parental generation F0. A second experiment was conducted in order to evaluate whether animals of a first (1) or third (F3) generation coming from parental daphnids (F0) previously exposed to those pesticide concentrations exhibited any alteration in feeding behavior when transferred to clean water (recovery period). The results indicated that the feeding rates of D. magna generations F1 and F3 were still affected during the recovery period but to a less degree. The effective tetradifon concentrations D. magna at which feeding rates were reduced to 50% that of controls (EC(50)) were also calculated. PMID:10499987

  3. Reproduction recovery of the crustacean Daphnia magna after chronic exposure to ibuprofen.

    PubMed

    Hayashi, Yuya; Heckmann, Lars-Henrik; Callaghan, Amanda; Sibly, Richard M

    2008-05-01

    In mammals, the pharmaceutical ibuprofen (IB), a non-steroidal anti-inflammatory drug, primarily functions by reversibly inhibiting the cyclooxygenase (COX) pathway in the synthesis of eicosanoids (e.g. prostaglandins). Previous studies suggest that IB may act in a similar manner to interrupt production of eicosanoids reducing reproduction in the model crustacean Daphnia magna. On this basis withdrawal of IB should lead to the recovery of D. magna reproduction. Here we test whether the effect of IB is reversible in D. magna, as it is in mammals, by observing reproduction recovery following chronic exposure. D. magna (5-days old) were exposed to a range of IB concentrations (0, 20, 40 and 80 mg l(-1)) for 10 days followed by a 10 day recovery period in uncontaminated water. During the exposure period, individuals exposed to higher concentrations produced significantly fewer offspring. Thereafter, IB-stressed individuals produced offspring faster during recovery, having similar average population growth rates (PGR) (1.15-1.28) to controls by the end of the test. It appears that maternal daphnids are susceptible to IB during egg maturation. This is the first recorded recovery of reproduction in aquatic invertebrates that suffered reproductive inhibition during chronic exposure to a chemical stressor. Our results suggest a possible theory behind the compensatory fecundity that we referred to as 'catch-up reproduction'. PMID:18214676

  4. EFFECT OF AGE ON SENSITIVITY OF 'DAPHNIA MAGNA' TO CADMIUM, COPPER AND CYANAZINE

    EPA Science Inventory

    Daphnia magna were exposed to cadmium, copper and cyanazine to determine the relative sensitivities of several age groups: less than 4 h, less than 24 h, 1 d, 2 d, 3 d, 4 d, 5 d and 6 d old. Mean cadmium 48-h EC50 values for each age group ranged from 23 to 164 micrograms/L. Mean...

  5. An evaluation of biotic ligand models predicting acute copper toxicity to Daphnia magna in wastewater effluent.

    PubMed

    Constantino, Carlos; Scrimshaw, Mark; Comber, Sean; Churchley, John

    2011-04-01

    The toxicity of Cu to Daphnia magna was investigated in a series of 48-h immobilization assays in effluents from four wastewater treatment works. The assay results were compared with median effective concentration (EC50) forecasts produced by the HydroQual biotic ligand model (BLM), the refined D. magna BLM, and a modified BLM that was constructed by integrating the refined D. magna biotic ligand characterization with the Windermere humic aqueous model (WHAM) VI geochemical speciation model, which also accommodated additional effluent characteristics as model inputs. The results demonstrated that all the BLMs were capable of predicting toxicity by within a factor of two, and that the modified BLM produced the most accurate toxicity forecasts. The refined D. magna BLM offered the most robust assessment of toxicity in that it was not reliant on the inclusion of effluent characteristics or optimization of the dissolved organic carbon active fraction to produce forecasts that were accurate by within a factor of two. The results also suggested that the biotic ligand stability constant for Na may be a poor approximation of the mechanisms governing the influence of Na where concentrations exceed the range within which the biotic ligand stability constant value had been determined. These findings support the use of BLMs for the establishment of site-specific water quality standards in waters that contain a substantial amount of wastewater effluent, but reinforces the need for regulators to scrutinize the composition of models, their thermodynamic and biotic ligand parameters, and the limitations of those parameters. PMID:21184526

  6. Impact of imidacloprid on Daphnia magna under different food quality regimes.

    PubMed

    Ieromina, Oleksandra; Peijnenburg, Willie J G M; de Snoo, Geert; Müller, Jutta; Knepper, Thomas P; Vijver, Martina G

    2014-03-01

    Aquatic ecosystems are characterized by fluctuating conditions that have direct effects on aquatic communities but also indirect influences such as changing the toxicity of chemicals. Because the effect of food quality on pesticide toxicity has rarely been studied, in the present study Daphnia magna juveniles supplied with 4 different food quality levels were exposed to a range of imidacloprid concentrations for 21 d. Food quality was expressed as carbon:phosphorus ratios of algae Pseudokirchneriella subcapitata (C:P 35, C:P 240, C:P 400, and C:P 1300). Survival, growth rates, and reproduction of D. magna were monitored, and the combined effects of imidacloprid exposure and the phosphorus content of algae were analyzed. A stronger effect on survival was observed at the P-deficient diet (C:P 1300), confirmed by lower 10% effect concentration (EC10) values at days 7, 9, 15, and 21 compared with diets with higher phosphorus contents. Similarly, the growth rate was reduced when D. magna were supplied with algae of low phosphorus content at imidacloprid exposure conditions. The highest reproductive output was observed for D. magna fed the optimal phosphorus diet (C:P 240), both at control and exposed conditions. Poor food quality increased the sensitivity of nontarget species to pesticide exposure, potentially leading to an underestimation of adverse effects on aquatic communities in the field. PMID:24288231

  7. Daphnia magna transcriptome by RNA-Seq across 12 environmental stressors.

    PubMed

    Orsini, Luisa; Gilbert, Donald; Podicheti, Ram; Jansen, Mieke; Brown, James B; Solari, Omid Shams; Spanier, Katina I; Colbourne, John K; Rush, Douglas; Decaestecker, Ellen; Asselman, Jana; De Schamphelaere, Karel A C; Ebert, Dieter; Haag, Christoph R; Kvist, Jouni; Laforsch, Christian; Petrusek, Adam; Beckerman, Andrew P; Little, Tom J; Chaturvedi, Anurag; Pfrender, Michael E; De Meester, Luc; Frilander, Mikko J

    2016-01-01

    The full exploration of gene-environment interactions requires model organisms with well-characterized ecological interactions in their natural environment, manipulability in the laboratory and genomic tools. The waterflea Daphnia magna is an established ecological and toxicological model species, central to the food webs of freshwater lentic habitats and sentinel for water quality. Its tractability and cyclic parthenogenetic life-cycle are ideal to investigate links between genes and the environment. Capitalizing on this unique model system, the STRESSFLEA consortium generated a comprehensive RNA-Seq data set by exposing two inbred genotypes of D. magna and a recombinant cross of these genotypes to a range of environmental perturbations. Gene models were constructed from the transcriptome data and mapped onto the draft genome of D. magna using EvidentialGene. The transcriptome data generated here, together with the available draft genome sequence of D. magna and a high-density genetic map will be a key asset for future investigations in environmental genomics. PMID:27164179

  8. Daphnia magna transcriptome by RNA-Seq across 12 environmental stressors

    PubMed Central

    Orsini, Luisa; Gilbert, Donald; Podicheti, Ram; Jansen, Mieke; Brown, James B.; Solari, Omid Shams; Spanier, Katina I.; Colbourne, John K.; Rush, Douglas; Decaestecker, Ellen; Asselman, Jana; De Schamphelaere, Karel A.C.; Ebert, Dieter; Haag, Christoph R.; Kvist, Jouni; Laforsch, Christian; Petrusek, Adam; Beckerman, Andrew P.; Little, Tom J.; Chaturvedi, Anurag; Pfrender, Michael E.; De Meester, Luc; Frilander, Mikko J.

    2016-01-01

    The full exploration of gene-environment interactions requires model organisms with well-characterized ecological interactions in their natural environment, manipulability in the laboratory and genomic tools. The waterflea Daphnia magna is an established ecological and toxicological model species, central to the food webs of freshwater lentic habitats and sentinel for water quality. Its tractability and cyclic parthenogenetic life-cycle are ideal to investigate links between genes and the environment. Capitalizing on this unique model system, the STRESSFLEA consortium generated a comprehensive RNA-Seq data set by exposing two inbred genotypes of D. magna and a recombinant cross of these genotypes to a range of environmental perturbations. Gene models were constructed from the transcriptome data and mapped onto the draft genome of D. magna using EvidentialGene. The transcriptome data generated here, together with the available draft genome sequence of D. magna and a high-density genetic map will be a key asset for future investigations in environmental genomics. PMID:27164179

  9. Development and validation of a Daphnia magna four-day survival and growth test method

    EPA Science Inventory

    Zooplankton are an important part of the aquatic ecology of all lakes and streams. As a result, numerous methods have been developed to assess the quality of waterbodies using various zooplankton species. Included in these is the freshwater species Daphnia magna. Current test me...

  10. Growth of Daphnia magna exposed to mixtures of chemicals with diverse modes of action

    SciTech Connect

    Deneer, J.W.; Seinen, W.; Hermens, J.L.

    1988-02-01

    Concentrations causing inhibition of growth of Daphnia magna after 16 days of exposure were determined for nine chemicals that presumably act through different modes of action. The joint toxic effect of a mixture of these chemicals is found to be nonadditive.

  11. Metabolism of drugs and other xenobiotics in giant liver fluke (Fascioloides magna).

    PubMed

    Prchal, Lukáš; Vokřál, Ivan; Kašný, Martin; Rejšková, Lenka; Zajíčková, Markéta; Lamka, Jiří; Skálová, Lenka; Lecová, Lenka; Szotáková, Barbora

    2016-01-01

    1. Giant liver fluke Fascioloides magna is a dangerous parasite, which infects herbivores. It was imported to Europe from North America and started to spread. Benzimidazoles like albendazole, mebendazole, triclabendazole and salicylanilides closantel and rafoxanide are the most used anthelmintics to control fascioloidosis. However their effect might be altered via drug-metabolizing enzymes of this parasite. 2. The aim of our study was to determine the activities of drug-metabolizing enzymes in F. magna and the metabolism of above mentioned anthelmintics. 3. Activities of several oxidative, reductive and conjugative enzymes towards various model xenobiotic substrates were found in F. magna subcellular fractions. 4. Subcellular fractions from F. magna oxidized albendazole to its sulphoxide metabolite and reduced mebendazole to hydroxyl-mebendazole. Under ex vivo conditions, only very-low concentrations of these compounds were detected using high-performance liquid chromatography/mass spectrometry. 5. The results indicate that the giant liver fluke possesses the active xenobiotic-metabolizing system. The overexpression of this system may play an important role in parasite resistance against these anthelmintics. PMID:26153440

  12. Three-Dimensional Analysis of the Swimming Behavior of Daphnia magna Exposed to Nanosized Titanium Dioxide

    PubMed Central

    Noss, Christian; Dabrunz, André; Rosenfeldt, Ricki R.; Lorke, Andreas; Schulz, Ralf

    2013-01-01

    Due to their surface characteristics, nanosized titanium dioxide particles (nTiO2) tend to adhere to biological surfaces and we thus hypothesize that they may alter the swimming performance and behavior of motile aquatic organisms. However, no suitable approaches to address these impairments in swimming behavior as a result of nanoparticle exposure are available. Water fleas Daphnia magna exposed to 5 and 20 mg/L nTiO2 (61 nm; polydispersity index: 0.157 in 17.46 mg/L stock suspension) for 96 h showed a significantly (p<0.05) reduced growth rate compared to a 1-mg/L treatment and the control. Using three-dimensional video observations of swimming trajectories, we observed a treatment-dependent swarming of D. magna in the center of the test vessels during the initial phase of the exposure period. Ensemble mean swimming velocities increased with increasing body length of D. magna, but were significantly reduced in comparison to the control in all treatments after 96 h of exposure. Spectral analysis of swimming velocities revealed that high-frequency variance, which we consider as a measure of swimming activity, was significantly reduced in the 5- and 20-mg/L treatments. The results highlight the potential of detailed swimming analysis of D. magna for the evaluation of sub-lethal mechanical stress mechanisms resulting from biological surface coating and thus for evaluating the effects of nanoparticles in the aquatic environment. PMID:24260519

  13. 75 FR 34172 - Lordstown Seating Systems, a Subsidiary of Magna Seating, Including Workers Whose Unemployment...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-16

    ... notice was published in the Federal Register on May 5, 2010 (75 FR 24751). At the request of the state... Employment and Training Administration Lordstown Seating Systems, a Subsidiary of Magna Seating, Including Workers Whose Unemployment Insurance (UI) Wages Are Reported Through Intier Automotive Seatings of...

  14. EFFECTS OF INORGANIC COMPLEXING ON THE TOXICITY OF COPPER TO 'DAPHNIA MAGNA'

    EPA Science Inventory

    The report includes the effects of carbonate-bicarbonate, orthophosphate, and pyrophosphate on the toxicity of copper (II) to Daphnia magna studied at constant pH and total hardness. Mortality rates and reciprocal survival times were directly correlated with cupric (Cu2+) and cop...

  15. Acute toxicity assessment of camphor in biopesticides by using Daphnia magna and Danio rerio

    PubMed Central

    Yim, Eun-Chae; Kim, Hyeon-Joe; Kim, Seong-Jun

    2014-01-01

    Objectives An ecofriendly alternative to chemical pesticides is bio-pesticides, which are derived from natural sources. The interest in bio-pesticides is based on the disadvantages associated with chemical pesticides. Methods We conducted acute toxicity assessments of camphor, a major component of bio-pesticides, by using Daphnia magna (D. magna) as well as assessed the morphological abnormalities that occurred in Danio rerio (D. rerio) embryos. Results The median effective concentration of camphor on D. magna after 48 hours was 395.0 μM, and the median lethal concentration on D. rerio embryos after 96 hours was 838.6 μM. The no observed effect concentration and predicted no effect concentration of camphor on D. magna, which was more sensitive than D. rerio, were calculated as 55.2 μM and 3.95 μM, respectively. Morphological abnormalities in D. rerio embryos exposed to camphor increased over time. Coagulation, delayed hatching, yolk sac edema, pericardial edema, and pigmentation of embryos mainly appeared between 24 and 48 hours. Further, symptoms of scoliosis and head edema occurred after 72 hours. In addition, bent tails, ocular defects and collapsed symptoms of fertilized embryonic tissue were observed after 96 hours. Conclusions The camphor toxicity results suggest that continuous observations on the ecosystem are necessary to monitor toxicity in areas where biological pesticides containing camphor are sprayed. PMID:25234414

  16. The Role of Secure Knowledge in Enabling Year 7 to Write Essays on Magna Carta

    ERIC Educational Resources Information Center

    King, Mark

    2015-01-01

    Setting out to teach Magna Carta to the full attainment range in Year 7, Mark King decided to choose a question that reflected real scholarly debates and also to ensure that pupils held enough knowledge in long-term memory to be able to think about that question meaningfully. As he gradually prepared his pupils to produce their own causation…

  17. EFFECTIVE CONCENTRATIONS OF 6 CONTAMINANTS TO LEMMA MINOR, PIMEPHALES PROMELA, DAPHNIA MAGNA, AND CERIODAPHNIA DUBIA

    EPA Science Inventory

    The research presented here resulted in EC50 and LOEC values for the contaminants copper, cadmium, diazinon, atrazine, and cyanide to the species Lemna Minor, Pimephales promelas, Daphnia magna, and Ceriodaphnia dubia. Observed values were used as benchmarks for assessing the se...

  18. The relative importance of water and food as cadmium sources to Daphnia magna Straus.

    PubMed

    Barata, Carlos; Markich, Scott J; Baird, Donald J; Soares, Amadeu M V M

    2002-12-01

    Knowledge of the transport pathways of metals into aquatic organisms is paramount in determining the metal's potential mechanism of toxicity. To determine the relative importance of water and food as cadmium (Cd) sources for the cladoceran Daphnia magna grazing on the algae Chlorella vulgaris, we measured cadmium accumulation and toxicity (feeding inhibition and survival) in three genetically different clones of D. magna subsequent to water, food, and water and food exposures. We found that Cd uptake from water and food was independent of source and additive in effect, with D. magna juveniles accumulating twice as much Cd from water than from food (algae). However, the efficiency with which Cd was assimilated by D. magna from its algal diet was much higher (10%) than from water (0.3%). Uptake and toxic responses were inversely related: tolerant clones accumulated more Cd. As a consequence, models based on uptake of metals from the combined routes of water and food may be reliable to predict metal dynamics in the field, but may fail to predict toxic effects since tolerance to metals is not necessarily linked to reduced total uptake of metals. PMID:12359386

  19. [Aqueous Fingerprint of Printing and Dyeing Wastewater].

    PubMed

    Wang, Shi-feng; Wu, Jing; Cheng, Cheng; Yang, Lin; Zhao, Yu-fei; Lü, Qing; Fu, Xin-mei

    2015-12-01

    Aqueous fingerprint has an advantage to represent the organic components of water samples as compared to traditional parameters such as chemical oxygen demand (COD) and total organic carbon (TOC). Printing and dyeing wastewater is one of the major types of industrial wastewater in China. It is of huge volume and heavy pollution, containing large numbers of luminescent components and being difficult to be degraded. In this study the aqueous fingerprint of printing and dyeing wastewater was investigated with the fluorescent spectrometry. The experimental results showed that there existed two peaks in the aqueous fingerprint of the printing and dyeing wastewater, locating at the excitation/emission wavelength around 230/340 nm and 280/310 nm respectively. The intensity of the excitation/emission wavelength at 230/340 nm was higher than that of 280/310 nm. The locations and intensities of peaks varied within small range. The intensities of the two peaks linearly correlated with coefficient of 0.910 8 and slope of 1.506. The intensity ratio of Peak at 280/310 nm to Peak at 230/340 nm averagely was 0.777, ranging between 0.712 and 0.829. It was found that the aqueous fingerprints of sewage and aniline compounds were significantly different from that of the printing and dyeing wastewater, but the aqueous fingerprints of several types of widely-used dye were similar to that of the printing and dyeing wastewater. Thus dye may be the main luminescent components in the wastewater. The aqueous fingerprint can be used as a novel tool of early warning of waterbodies. PMID:26964226

  20. Influence of food, aquatic humus, and alkalinity on methylmercury uptake by Daphnia magna

    SciTech Connect

    Monson, B.A.; Brezonik, P.L.

    1999-03-01

    Six-day-old Daphnia magna were exposed to low concentrations of methylmercury (MeHg) in synthetic freshwater and synthetic food. Uptake kinetics were determined in 24- to 72-h experiments, measuring both the loss of Hg from water and accumulation in D. magna. Dose-uptake response was linear for MeHg concentrations up to 4.0 ng/L; an initial concentration of 2.0 ng/L was used when other factors were varied. Concentrations of total Hg and MeHg in water and D. magna were measured in treatments with varied hardness and alkalinity, aquatic humus (AH), and food spiked with MeHg versus water spiked with MeHg. Uptake rate coefficients were derived from two versions of a first-order, two-compartment model. The first version assumed constant MeHg concentration; the second accounted for changing MeHg concentration in water over time. Both models accounted for a nonzero starting concentration of MeHg in plankton. Fitted rate coefficients were higher for the second model than the first: the uptake coefficient (k{sub u}) was nine times higher; the depuration coefficient (k{sub d}) was twice as high. Assuming a constant MeHg concentration for a one-time spike thus underestimated the rate coefficient. The source of MeHg was compared by exposing D. magna for 48 h to MeHg at 2 ng/L in food or water. Daphnia magna accumulated significantly more inorganic Hg (i.e., Hg{sup 2+}) from spiked food than from spiked water, but accumulation of MeHg was the same from both sources. A similar response was found when D. magna were exposed to a lake water extraction of AH at concentrations of C at 3 and 10 mg/L. At the higher AH concentration, total Hg in daphnids was higher, but MeHg was lower, suggesting that AH was a source of inorganic Hg but reduced the bioavailability of MeHg. Exposure of D. magna to MeHg at 2 ng/L in hard or soft water adjusted to pH 6.7 showed no significant difference in MeHg uptake, supporting an argument that hardness and alkalinity per se do not affect MeHg uptake by

  1. Dynamic multipathway modeling of Cd bioaccumulation in Daphnia magna using waterborne and dietborne exposures.

    PubMed

    Goulet, Richard R; Krack, Susannah; Doyle, Patrick J; Hare, Landis; Vigneault, Bernard; McGeer, James C

    2007-02-28

    We tested the predictive ability of the dynamic multipathway bioaccumulation model (DYMBAM) to characterize Cd accumulation in Daphnia magna, a species commonly used in toxicity tests and because of its sensitivity, particularly to metals, a species that is relied upon in ecological risk assessments. We conducted chronic exposure experiments in which D. magna were exposed to either dietborne Cd alone or to both dietborne and waterborne Cd. In the food-only treatments, the algae Chlamydomonas reinhardtii or Pseudokirchneriella subcapitata were pre-exposed to free Cd ion concentrations, [Cd(2+)], from 0.001 to 100nM (0.001-11microgL(-1)) then, on a daily feeding renewal basis, fed to D. magna over 21 days. In the water plus food treatment, D. magna were exposed for 21 days to the same range of [Cd(2+)] and fed with the same algal species that had been exposed to Cd at various concentrations. In the algal exposure media, Cd concentrations in algae were directly related to those in water and were characterized by a linear regression model using the log transformed concentration of the WHAM predicted Cd(2+) concentration. The DYMBAM was used with estimated values of the model constants for ingestion rate (0.08-0.34gg(-1)day(-1)) and growth rate (0.085-0.131day(-1)) based on our experimental data and with literature values for rate constants of Cd influx and efflux as well as Cd assimilation efficiency. Measured Cd concentrations in D. magna agreed with model predictions within a factor of 3. Using the model, we predict that food is an important contributor of Cd burden to D. magna, particularly at lower Cd exposure concentrations over an environmentally realistic gradient of free Cd in water. However, this cladoceran also takes up Cd from water and this exposure route becomes increasingly important at very high concentrations of free Cd (>10nM or 1.1microgL(-1)). Nevertheless, Cd produced lethal effects in D. magna that were exposed to this metal in water and diet, but

  2. DNA fingerprinting in forensics: past, present, future

    PubMed Central

    2013-01-01

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting. PMID:24245688

  3. Chemical Fingerprinting of Materials Developed Due To Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    This paper presents viewgraphs on chemical fingerprinting of materials developed due to environmental issues. Some of the topics include: 1) Aerospace Materials; 2) Building Blocks of Capabilities; 3) Spectroscopic Techniques; 4) Chromatographic Techniques; 5) Factors that Determine Fingerprinting Approach; and 6) Fingerprinting: Combination of instrumental analysis methods that diagnostically characterize a material.

  4. Digital Video of Live-Scan Fingerprint Data

    National Institute of Standards and Technology Data Gateway

    NIST Digital Video of Live-Scan Fingerprint Data (PC database for purchase)   NIST Special Database 24 contains MPEG-2 (Moving Picture Experts Group) compressed digital video of live-scan fingerprint data. The database is being distributed for use in developing and testing of fingerprint verification systems.

  5. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  6. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  7. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  8. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  9. Fingerprint Ridge Count: A Polygenic Trait Useful in Classroom Instruction.

    ERIC Educational Resources Information Center

    Mendenhall, Gordon; And Others

    1989-01-01

    Describes the use of the polygenic trait of total fingerprint ridge count in the classroom as a laboratory investigation. Presents information on background of topic, fingerprint patterns which are classified into three major groups, ridge count, the inheritance model, and activities. Includes an example data sheet format for fingerprints. (RT)

  10. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  11. GENO PROFILER: BATCH PROCESSING OF HIGH THROUGHPUT CAPILLARY FINGERPRINTING DATA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    High-throughput fingerprinting techniques employing capillary electrophoresis place new demands on the editing of fingerprint files for the downstream contig assembly program, FPC. A cross-platform software application, GenoProfiler, was developed for automated editing of sized fingerprinting profil...

  12. Chronic toxicity of dietary copper to Daphnia magna.

    PubMed

    De Schamphelaere, K A C; Forrez, I; Dierckens, K; Sorgeloos, P; Janssen, C R

    2007-03-30

    There is a growing concern that dietborne metal toxicity might be important in aquatic ecosystems. However, the science behind this matter is insufficiently developed to explicitly and accurately account for this in metal regulation or risk assessment. We investigated the effects of a chronic exposure of Daphnia magna to an elevated level of Cu (3000 microg Cu/g dry wt) in their diet (the green alga Pseudokirchneriella subcapitata). Compared to daphnids fed with P. subcapitata containing a background of 10.6 microg Cu/g dry wt, daphnids fed for 21 days with this Cu-contaminated food accumulated a total copper body burden of 325 microg Cu/g dry wt, which is about 30-fold higher than the control body burden of 12.1 microg/g dry wt. The exposed daphnids experienced a 38% reduction of growth (measured as final dry body weight), a 50% reduction of reproduction (total number of juveniles produced per daphnid), and only produced three broods versus four broods by the control daphnids. Unlike most other studies, we were able to demonstrate that these effects were most likely not due to a reduced nutritional quality of the food, based on C:P ratios and fatty acid content and composition of the Cu-contaminated algae. Life-history analysis showed that time to first brood was not affected by dietary Cu, while the second and third broods were significantly delayed by 0.7 and 1.5 days, respectively. On the other hand, brood sizes of all three broods were significantly lower in Cu exposed daphnids, i.e. by 32-55%. The variety of effects observed suggest the possible, and perhaps simultaneous, involvement of several toxicity mechanisms such as increased metabolic cost, reduced energy acquisition (potentially via inhibition of digestive enzyme activity), targeted inhibition of reproduction (potentially via inhibition of vitellogenesis), and/or direct inhibition of molting. Further research is needed to differentiate between these postulated mechanisms of dietary Cu toxicity and to

  13. Ecotoxicity of contaminated suspended solids for filter feeders (Daphnia magna).

    PubMed

    Weltens, R; Goossens, R; Van Puymbroeck, S

    2000-10-01

    It is generally assumed that the dissolved fraction of a toxic substance in surface water is mainly responsible for toxicity to aquatic organisms. However, toxic compounds are often adsorbed or chemically bound to suspended particles in the water column, depending upon the physico-chemical conditions. In the present study potential adverse effects to filter feeding organisms by metal contaminated particles were investigated. In our hypotheses the adsorbed metals might desorb in the gastrointestinal tract-due to different physico-chemical conditions-and exert toxic effects. Clay and sand particles, algae and organic material (peat) were artificially contaminated with cadmium and zinc. The contaminated materials were resuspended in standard conditions and toxicity was measured for the water flea Daphnia magna (mortality at 48 hours). As a reference, supernatant solutions were used containing the same concentration of dissolved metal as the suspensions. It was also established that the test concentrations of solid material (250 and 500 mg/l uncontaminated particles) did not cause any mortality within 48 hours. Daphnids are filter feeders: they filtrate large amounts of surrounding water, redrawing particles as a food source. Results strongly indicate that contaminated particles threaten the health of these particle-feeding organisms. Compared to the reference severe acute toxic effects were seen and cadmium accumulation was increased when contaminated solid material was present. Results were essentially the same for the different materials used in the experiments, except for sand contaminated with cadmium. This shows that mineral as well as organic materials can contribute to the particle bound toxicity. Different results were obtained when a static set up was used instead of a flow through set up, illustrating that the route of administration is important to make particles available and thus to evaluate their toxicity. Contaminated particles clearly have toxic

  14. The developmental toxicity of 1-methyl-3-octylimidazolium bromide on Daphnia magna.

    PubMed

    Luo, Yan-Rui; Li, Xiao-Yu; Chen, Xiao-Xiao; Zhang, Bang-Jun; Sun, Zhen-Jun; Wang, Jian-Ji

    2008-12-01

    The developmental toxicity of 1-methyl-3-octylimidazolium bromide ([C(8)mim]Br) on Daphnia magna was investigated. The 24 and 48 h LC(50) values for [C(8)mim]Br in D. magna were 1.99 and 0.95 mg/L, respectively. A series of multigenerational toxicity tests were then used to explore [C(8)mim]Br effects in D. magna. [C(8)mim]Br significantly inhibited the body lengths of the F0 and F1 1st generations. After 21 days of exposure, [C(8)mim]Br lowered the reproductive ability of the F0 and F1 1st generations. In F1 3rd generation, 21 days of [C(8)mim]Br exposure prolonged the time to bear the first egg and the time to the first brood compared with the control, but the number of first-brood offspring and the number of broods produced by these animals were reduced. After the recovery period all the reproductive parameters returned to normal in F1 1st generation except for the number of broods. The dead neonates increased with prolonged exposure and increasing concentrations, and the dead neonates of the F1 3rd generation went far beyond that of the F1 1st and F0 generations. The intrinsic rate of natural increase (r) values of the three D. magna generations significantly decreased after exposure to higher concentrations of [C(8)mim]Br compared with control groups. Collectively, these results suggest that [C(8)mim]Br exerts a toxic effect on the development of D. magna. This study also highlights the importance of systematically evaluating the potential effects of aquatic ecosystems of ionic liquids that may be released into bodies of water. PMID:18442076

  15. Rapid changes in water hardness and alkalinity: Calcite formation is lethal to Daphnia magna.

    PubMed

    Bogart, Sarah J; Woodman, Samuel; Steinkey, Dylan; Meays, Cindy; Pyle, Greg G

    2016-07-15

    There is growing concern that freshwater ecosystems may be negatively affected by ever-increasing anthropogenic inputs of extremely hard, highly alkaline effluent containing large quantities of Ca(2+), Mg(2+), CO3(2-), and HCO3(-) ions. In this study, the toxicity of rapid and extreme shifts in water hardness (38-600mg/L as CaCO3) and alkalinity (30-420mg/L as CaCO3) to Daphnia magna was tested, both independently and in combination. Within these ranges, where no precipitation event occurred, shifts in water hardness and/or alkalinity were not toxic to D. magna. In contrast, 98-100% of D. magna died within 96h after exposure to 600mg/L as CaCO3 water hardness and 420mg/L as CaCO3 alkalinity (LT50 of 60h with a 95% CI of 54.2-66.0h). In this treatment, a CaCO3 (calcite) precipitate formed in the water column which was ingested by and thoroughly coated the D. magna. Calcite collected from a mining impacted stream contained embedded organisms, suggesting field streams may also experience similar conditions and possibly increased mortality as observed in the lab tests. Although further investigation is required to determine the exact fate of aquatic organisms exposed to rapid calcite precipitation in the field, we caution that negative effects may occur more quickly or at lower concentrations of water hardness and alkalinity in which we observed effects in D. magna, because some species, such as aquatic insects, are more sensitive than cladocerans to changes in ionic strength. Our results provide evidence that both calcite precipitation and the major ion balance of waters should be managed in industrially affected ecosystems and we support the development of a hardness+alkalinity guideline for the protection of aquatic life. PMID:27060657

  16. Silver Coating for High-Mass-Accuracy Imaging Mass Spectrometry of Fingerprints on Nanostructured Silicon.

    PubMed

    Guinan, Taryn M; Gustafsson, Ove J R; McPhee, Gordon; Kobus, Hilton; Voelcker, Nicolas H

    2015-11-17

    Nanostructure imaging mass spectrometry (NIMS) using porous silicon (pSi) is a key technique for molecular imaging of exogenous and endogenous low molecular weight compounds from fingerprints. However, high-mass-accuracy NIMS can be difficult to achieve as time-of-flight (ToF) mass analyzers, which dominate the field, cannot sufficiently compensate for shifts in measured m/z values. Here, we show internal recalibration using a thin layer of silver (Ag) sputter-coated onto functionalized pSi substrates. NIMS peaks for several previously reported fingerprint components were selected and mass accuracy was compared to theoretical values. Mass accuracy was improved by more than an order of magnitude in several cases. This straightforward method should form part of the standard guidelines for NIMS studies for spatial characterization of small molecules. PMID:26460234

  17. Eliminate background interference from latent fingerprints using ultraviolet multispectral imaging

    NASA Astrophysics Data System (ADS)

    Huang, Wei; Xu, Xiaojing; Wang, Guiqiang

    2014-02-01

    Fingerprints are the most important evidence in crime scene. The technology of developing latent fingerprints is one of the hottest research areas in forensic science. Recently, multispectral imaging which has shown great capability in fingerprints development, questioned document detection and trace evidence examination is used in detecting material evidence. This paper studied how to eliminate background interference from non-porous and porous surface latent fingerprints by rotating filter wheel ultraviolet multispectral imaging. The results approved that background interference could be removed clearly from latent fingerprints by using multispectral imaging in ultraviolet bandwidth.

  18. A cancellable and fuzzy fingerprint scheme for mobile computing security

    NASA Astrophysics Data System (ADS)

    Yang, Wencheng; Xi, Kai; Li, Cai

    2012-09-01

    Fingerprint recognition provides an effective user authentication solution for mobile computing systems. However, as a fingerprint template protection scheme, fingerprint fuzzy vault is subject to cross-matching attacks, since the same finger might be registered for various applications. In this paper, we propose a fingerprint-based biometric security scheme named the cancellable and fuzzy fingerprint scheme, which combines a cancellable non-linear transformation with the client/server version of fuzzy vault, to address the cross-matching attack in a mobile computing system. Experimental results demonstrate that our scheme can provide reliable and secure protection to the mobile computing system while achieving an acceptable matching performance.

  19. Supersensitive fingerprinting of explosives by chemically modified nanosensors arrays

    NASA Astrophysics Data System (ADS)

    Lichtenstein, Amir; Havivi, Ehud; Shacham, Ronen; Hahamy, Ehud; Leibovich, Ronit; Pevzner, Alexander; Krivitsky, Vadim; Davivi, Guy; Presman, Igor; Elnathan, Roey; Engel, Yoni; Flaxer, Eli; Patolsky, Fernando

    2014-06-01

    The capability to detect traces of explosives sensitively, selectively and rapidly could be of great benefit for applications relating to civilian national security and military needs. Here, we show that, when chemically modified in a multiplexed mode, nanoelectrical devices arrays enable the supersensitive discriminative detection of explosive species. The fingerprinting of explosives is achieved by pattern recognizing the inherent kinetics, and thermodynamics, of interaction between the chemically modified nanosensors array and the molecular analytes under test. This platform allows for the rapid detection of explosives, from air collected samples, down to the parts-per-quadrillion concentration range, and represents the first nanotechnology-inspired demonstration on the selective supersensitive detection of explosives, including the nitro- and peroxide-derivatives, on a single electronic platform. Furthermore, the ultrahigh sensitivity displayed by our platform may allow the remote detection of various explosives, a task unachieved by existing detection technologies.

  20. Supersensitive fingerprinting of explosives by chemically modified nanosensors arrays.

    PubMed

    Lichtenstein, Amir; Havivi, Ehud; Shacham, Ronen; Hahamy, Ehud; Leibovich, Ronit; Pevzner, Alexander; Krivitsky, Vadim; Davivi, Guy; Presman, Igor; Elnathan, Roey; Engel, Yoni; Flaxer, Eli; Patolsky, Fernando

    2014-01-01

    The capability to detect traces of explosives sensitively, selectively and rapidly could be of great benefit for applications relating to civilian national security and military needs. Here, we show that, when chemically modified in a multiplexed mode, nanoelectrical devices arrays enable the supersensitive discriminative detection of explosive species. The fingerprinting of explosives is achieved by pattern recognizing the inherent kinetics, and thermodynamics, of interaction between the chemically modified nanosensors array and the molecular analytes under test. This platform allows for the rapid detection of explosives, from air collected samples, down to the parts-per-quadrillion concentration range, and represents the first nanotechnology-inspired demonstration on the selective supersensitive detection of explosives, including the nitro- and peroxide-derivatives, on a single electronic platform. Furthermore, the ultrahigh sensitivity displayed by our platform may allow the remote detection of various explosives, a task unachieved by existing detection technologies. PMID:24960270

  1. Plasma fingerprinting with GC-MS in acute coronary syndrome.

    PubMed

    Vallejo, M; García, A; Tuñón, J; García-Martínez, D; Angulo, S; Martin-Ventura, J L; Blanco-Colio, L M; Almeida, P; Egido, J; Barbas, C

    2009-07-01

    New biomarkers of cardiovascular disease are needed to augment the information obtained from traditional indicators and to illuminate disease mechanisms. One of the approaches used in metabolomics/metabonomics for that purpose is metabolic fingerprinting aiming to profile large numbers of chemically diverse metabolites in an essentially nonselective way. In this study, gas chromatography-mass spectrometry was employed to evaluate the major metabolic changes in low molecular weight plasma metabolites of patients with acute coronary syndrome (n = 9) and with stable atherosclerosis (n = 10) vs healthy subjects without significant differences in age and sex (n = 10). Reproducible differences between cases and controls were obtained with pattern recognition techniques, and metabolites accounting for higher weight in the classification have been identified through their mass spectra. On this basis, it seems inherently plausible that even a simple metabolite profile might be able to offer improved clinical diagnosis and prognosis, but in addition, specific markers are being identified. PMID:19172251

  2. Peptide Mass Fingerprinting of Egg White Proteins

    ERIC Educational Resources Information Center

    Alty, Lisa T.; LaRiviere, Frederick J.

    2016-01-01

    Use of advanced mass spectrometry techniques in the undergraduate setting has burgeoned in the past decade. However, relatively few undergraduate experiments examine the proteomics tools of protein digestion, peptide accurate mass determination, and database searching, also known as peptide mass fingerprinting. In this experiment, biochemistry…

  3. Fingerprints for fruit and nut crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We in horticulture should be more aware of the identity of the plants that we use. We appreciate scientists who can determine species and cultivars with their botanical knowledge and keen powers of observation. However, sometimes plant identity is more than meets the eye. Fingerprints serve as a hi...

  4. Compression of gray-scale fingerprint images

    NASA Astrophysics Data System (ADS)

    Hopper, Thomas

    1994-03-01

    The FBI has developed a specification for the compression of gray-scale fingerprint images to support paperless identification services within the criminal justice community. The algorithm is based on a scalar quantization of a discrete wavelet transform decomposition of the images, followed by zero run encoding and Huffman encoding.

  5. Optical security verification for blurred fingerprints

    NASA Astrophysics Data System (ADS)

    Soon, Boon Y.; Karim, Mohammad A.; Alam, Mohammad S.

    1998-12-01

    Optical fingerprint security verification is gaining popularity, as it has the potential to perform correlation at the speed of light. With advancement in optical security verification techniques, authentication process can be almost foolproof and reliable for financial transaction, banking, etc. In law enforcement, when a fingerprint is obtained from a crime scene, it may be blurred and can be an unhealthy candidate for correlation purposes. Therefore, the blurred fingerprint needs to be clarified before it is used for the correlation process. There are a several different types of blur, such as linear motion blur and defocus blur, induced by aberration of imaging system. In addition, we may or may not know the blur function. In this paper, we propose the non-singularity inverse filtering in frequency/power domain for deblurring known motion-induced blur in fingerprints. This filtering process will be incorporated with the pow spectrum subtraction technique, uniqueness comparison scheme, and the separated target and references planes method in the joint transform correlator. The proposed hardware implementation is a hybrid electronic-optical correlator system. The performance of the proposed system would be verified with computer simulation for both cases: with and without additive random noise corruption.

  6. Discrimination among Panax species using spectral fingerprinting

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Spectral fingerprints of samples of three Panax species (P. quinquefolius L., P. ginseng, and P. notoginseng) were acquired using UV, NIR, and MS spectrometry. With principal components analysis (PCA), all three methods allowed visual discrimination between all three species. All three methods wer...

  7. Use of SSR markers for DNA fingerprinting and diversity analysis of Pakistani sugarcane (Saccharum spp. hybrids) cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years SSR markers have been used widely for genetic analysis. The objective of this study was to use an SSR-based marker system to develop the molecular fingerprints and analyze the genetic relationship of sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers wer...

  8. Chemical imaging of latent fingerprints by mass spectrometry based on laser activated electron tunneling.

    PubMed

    Tang, Xuemei; Huang, Lulu; Zhang, Wenyang; Zhong, Hongying

    2015-03-01

    Identification of endogenous and exogenous chemicals contained in latent fingerprints is important for forensic science in order to acquire evidence of criminal identities and contacts with specific chemicals. Mass spectrometry has emerged as a powerful technique for such applications without any derivatization or fluorescent tags. Among these techniques, MALDI (Matrix Assisted Laser Desorption Ionization) provides small beam size but has interferences with MALDI matrix materials, which cause ion suppressions as well as limited spatial resolution resulting from uneven distribution of MALDI matrix crystals with different sizes. LAET (Laser Activated Electron Tunneling) described in this work offers capabilities for chemical imaging through electron-directed soft ionization. A special film of semiconductors has been designed for collection of fingerprints. Nanoparticles of bismuth cobalt zinc oxide were compressed on a conductive metal substrate (Al or Cu sticky tape) under 10 MPa pressure. Resultant uniform thin films provide tight and shining surfaces on which fingers are impressed. Irradiation of ultraviolet laser pulses (355 nm) on the thin film instantly generates photoelectrons that can be captured by adsorbed organic molecules and subsequently cause electron-directed ionization and fragmentation. Imaging of latent fingerprints is achieved by visualization of the spatial distribution of these molecular ions and structural information-rich fragment ions. Atomic electron emission together with finely tuned laser beam size improve spatial resolution. With the LAET technique, imaging analysis not only can identify physical shapes but also reveal endogenous metabolites present in females and males, detect contacts with prohibited substances, and resolve overlapped latent fingerprints. PMID:25647159

  9. Piezoelectric micromachined ultrasonic transducers for fingerprint sensing

    NASA Astrophysics Data System (ADS)

    Lu, Yipeng

    Fingerprint identification is the most prevalent biometric technology due to its uniqueness, universality and convenience. Over the past two decades, a variety of physical mechanisms have been exploited to capture an electronic image of a human fingerprint. Among these, capacitive fingerprint sensors are the ones most widely used in consumer electronics because they are fabricated using conventional complementary metal oxide semiconductor (CMOS) integrated circuit technology. However, capacitive fingerprint sensors are extremely sensitive to finger contamination and moisture. This thesis will introduce an ultrasonic fingerprint sensor using a PMUT array, which offers a potential solution to this problem. In addition, it has the potential to increase security, as it allows images to be collected at various depths beneath the epidermis, providing images of the sub-surface dermis layer and blood vessels. Firstly, PMUT sensitivity is maximized by optimizing the layer stack and electrode design, and the coupling coefficient is doubled via series transduction. Moreover, a broadband PMUT with 97% fractional bandwidth is achieved by utilizing a thinner structure excited at two adjacent mechanical vibration modes with overlapping bandwidth. In addition, we proposed waveguide PMUTs, which function to direct acoustic waves, confine acoustic energy, and provide mechanical protection for the PMUT array. Furthermore, PMUT arrays were fabricated with different processes to form the membrane, including front-side etching with a patterned sacrificial layer, front-side etching with additional anchor, cavity SOI wafers and eutectic bonding. Additionally, eutectic bonding allows the PMUT to be integrated with CMOS circuits. PMUTs were characterized in the mechanical, electrical and acoustic domains. Using transmit beamforming, a narrow acoustic beam was achieved, and high-resolution (sub-100 microm) and short-range (~1 mm) pulse-echo ultrasonic imaging was demonstrated using a steel

  10. Uniqueness: skews bit occurrence frequencies in randomly generated fingerprint libraries.

    PubMed

    Chen, Nelson G

    2016-08-01

    Requiring that randomly generated chemical fingerprint libraries have unique fingerprints such that no two fingerprints are identical causes a systematic skew in bit occurrence frequencies, the proportion at which specified bits are set. Observed frequencies (O) at which each bit is set within the resulting libraries systematically differ from frequencies at which bits are set at fingerprint generation (E). Observed frequencies systematically skew toward 0.5, with the effect being more pronounced as library size approaches the compound space, which is the total number of unique possible fingerprints given the number of bit positions each fingerprint contains. The effect is quantified for varying library sizes as a fraction of the overall compound space, and for changes in the specified frequency E. The cause and implications for this systematic skew are subsequently discussed. When generating random libraries of chemical fingerprints, the imposition of a uniqueness requirement should either be avoided or taken into account. PMID:27230477

  11. Fingerprint indexing based on minutiae-dependent statistical codes

    NASA Astrophysics Data System (ADS)

    Iloanusi, Ogechukwu N.; Osuagwu, Charles C.

    2014-07-01

    Methods based on minutiae matching have been extensively used in fingerprint recognition because minutiae can be reliably extracted from poor quality and noisy fingerprints. However, structures have to be defined due to minutiae displacements and irreproducibility. Some of the structures, though very efficient, incur large computational complexities. In this article, a feature vector of statistically based values derived from the minutiae pattern in a fingerprint is proposed for indexing fingerprints using the incremental search retrieval method. The proposed indexing technique in combination with the incremental retrieval method proves to have an added advantage over certain minutiae-based structures, especially when the minutiae points are numerous in a fingerprint. The feature vector for a fingerprint requires negligible storage resources and, consequently, the computational time in the retrieval of a candidate list for a query fingerprint is very little.

  12. Fingerprint enhancement based on MRF with curve accumulation

    NASA Astrophysics Data System (ADS)

    Huang, Zhongwen; Qi, Feihu

    2001-09-01

    The uniqueness of fingerprints has been used for identification for a long time. Automatic fingerprint identification system (AFIS) depends on minutiae to identify a person that rely heavily on the quality of fingerprint image. This paper presents a novel fingerprint enhancement scheme based on a Markov Random Field (MRF). The MRF model is applied to capture local statistical regularities of ridges and then the curve accumulation based on the MRF model is presented to enhance the fingerprint. Such procedure is repeated until the statistics difference can be got between fingerprint ridges and valleys (accumulation). In the end, the adaptive binarisation is made. The results of experiments show that this method can effectively improve the clarity of ridge and valley structures of input fingerprint images and meanwhile preserve the minutiae very well.

  13. Fast probabilistic file fingerprinting for big data

    PubMed Central

    2013-01-01

    Background Biological data acquisition is raising new challenges, both in data analysis and handling. Not only is it proving hard to analyze the data at the rate it is generated today, but simply reading and transferring data files can be prohibitively slow due to their size. This primarily concerns logistics within and between data centers, but is also important for workstation users in the analysis phase. Common usage patterns, such as comparing and transferring files, are proving computationally expensive and are tying down shared resources. Results We present an efficient method for calculating file uniqueness for large scientific data files, that takes less computational effort than existing techniques. This method, called Probabilistic Fast File Fingerprinting (PFFF), exploits the variation present in biological data and computes file fingerprints by sampling randomly from the file instead of reading it in full. Consequently, it has a flat performance characteristic, correlated with data variation rather than file size. We demonstrate that probabilistic fingerprinting can be as reliable as existing hashing techniques, with provably negligible risk of collisions. We measure the performance of the algorithm on a number of data storage and access technologies, identifying its strengths as well as limitations. Conclusions Probabilistic fingerprinting may significantly reduce the use of computational resources when comparing very large files. Utilisation of probabilistic fingerprinting techniques can increase the speed of common file-related workflows, both in the data center and for workbench analysis. The implementation of the algorithm is available as an open-source tool named pfff, as a command-line tool as well as a C library. The tool can be downloaded from http://biit.cs.ut.ee/pfff. PMID:23445565

  14. Chromosomal assignment of human DNA fingerprint sequences by simultaneous hybridization to arbitrarily primed PCR products from human/rodent monochromosome cell hybrids

    SciTech Connect

    Yasuda, Jun; Sekiya, Takao; Navarro, J.M.

    1996-05-15

    We have developed a technique for the simultaneous chromosomal assignment of multiple human DNA sequences from DNA fingerprints obtained by the arbitrarily primed polymerase chain reaction (AP-PCR). Radioactively labeled human AP-PCR products are hybridized to DNA fingerprints generated with the same arbitrary primer from human/rodent monochromosome cell hybrids after electroblotting to a nylong membrane. Human-specific hybridization bands in the human/rodent fingerprints unambiguously determine their chromosome of origin. We named this method simultaneous hybridization of arbitrarily primed PCR DNA fingerprinting products (SHARP). Using this approach, we determined the chromosomal origins of most major bands of human AP-PCR fingerprints obtained with two arbitrary primers. Altogether, the chromosomal localization of near 50 DNA fragments, comprehensive of all human chromosomes except chromosomes 21 and Y, was achieved in this simple manner. Chromosome assignment of fingerprint bands is essential for molecular karyotyping of cancer by AP-PCR DNA fingerprinting. The SHARP method provides a convenient and powerful tool for this purpose. 23 refs., 3 figs., 2 tabs.

  15. Application of a redox-proteomics toolbox to Daphnia magna challenged with model pro-oxidants copper and paraquat.

    PubMed

    Rainville, Louis-Charles; Coelho, Ana Varela; Sheehan, David

    2015-01-01

    The redox status of cells is involved in the regulation of several cellular stress-response pathways. It is frequently altered by xenobiotics, as well as by environmental stressors. As such, there is an increasing interest in understanding the redox status of proteins in different scenarios. Recent advances in proteomics enable researchers to measure oxidative lesions in a wide range of proteins. This opens the door to the sensitive detection of toxicity targets and helps decipher the molecular impact of pollutants and environmental stressors. The present study applies the measurement of protein carbonyls, the most common oxidative lesion of proteins, to gel-based proteomics in Daphnia magna. Daphnids were exposed to copper and paraquat, 2 well-known pro-oxidants. Catalase activity was decreased by paraquat, whereas global measurement of protein carbonyls and thiols indicated no change with treatment. Despite the absence of observed oxidative stress, 2-dimensional electrophoresis of the daphnid proteins and measurement of their carbonylation status revealed that 32 features were significantly affected by the treatments, showing higher sensitivity than single measurements. Identified proteins affected by copper indicated a decrease in the heat-shock response, whereas paraquat affected glycolysis. The present study demonstrates the applicability of redox-proteomics in daphnids, and indicates that the heat-shock response plays a counterintuitive role in metal resistance in daphnids. PMID:25263122

  16. Reduced PCR Sensitivity Due to Impaired DNA Recovery with the MagNA Pure LC Total Nucleic Acid Isolation Kit

    PubMed Central

    Schuurman, Tim; van Breda, Alex; de Boer, Richard; Kooistra-Smid, Mirjam; Beld, Marcel; Savelkoul, Paul; Boom, René

    2005-01-01

    The increasing demand for molecular diagnostics in clinical microbiology laboratories necessitates automated sample processing. In the present study, we evaluated the performance of the MagNA Pure LC total nucleic acid isolation kit (M extraction) in comparison with the manual method (Si extraction) according to Boom et al. (R. Boom, C. J. A. Sol, M. M. M. Salimans, C. L. Jansen, P. M. Wertheim-van Dillen, and J. van der Noordaa, J. Clin. Microbiol. 28:495-503, 1990) for the detection of viral DNA by competitive quantitative PCR. Reconstruction experiments with HindIII-digested phage lambda DNA and HaeIII-digested φX174 DNA showed that the recovery of DNA from phosphate-buffered saline, cerebrospinal fluid, EDTA-anticoagulated plasma, and EDTA-anticoagulated whole blood by M extraction is, on average, 6.6-fold lower compared to Si extraction. PCR signals of spiked PCR control DNAs for Epstein-Barr virus and varicella-zoster virus were also between 1.9- and 14.2-fold lower after M extraction compared to Si extraction, also suggesting impaired DNA recovery. M extraction of spiked cytomegalovirus strain AD 169 in whole blood showed a 5- to 10-fold reduction in PCR sensitivity compared to Si extraction. This reduction of PCR sensitivity was also observed when clinical whole blood samples were processed by M extraction. Before implementing M extraction, the clinical consequences of the reduced recovery should first be considered, especially when maximal sensitivity is required. PMID:16145116

  17. Linear solvation energy relationships for toxicity of selected organic chemicals to Daphnia pulex and Daphnia magna

    USGS Publications Warehouse

    Passino, Dora R.M.; Hickey, James P.; Frank, Anthony M.

    1988-01-01

    In the Laurentian Great Lakes, more than 300 contaminants have been identified in fish, other biota, water, and sediment. Current hazard assessment of these chemicals by the National Fisheries Research Center-Great Lakes is based on their toxicity, occurrence in the environment, and source. Although scientists at the Center have tested over 70 chemicals with the crustacean Daphnia pulex, the number of experimental data needed to screen the huge array of chemicals in the Great Lakes exceeds the practical capabilities of conducting bioassays. This limitation can be partly circumvented, however, by using mathematical models based on quantitative structure-activity relationships (QSAR) to provide rapid, inexpensive estimates of toxicity. Many properties of chemicals, including toxicity, bioaccumulation and water solubility are well correlated and can be predicted by equations of the generalized linear solvation energy relationships (LSER). The equation we used to model solute toxicity is Toxicity = constant + mVI/100 + s (π* + dδ) + bβm + aαm where VI = intrinsic (Van der Waals) molar volume; π* = molecular dipolarity/polarizability; δ = polarizability 'correction term'; βm = solute hydrogen bond acceptor basicity; and αm = solute hydrogen bond donor acidity. The subscript m designates solute monomer values for α and β. We applied the LSER model to 48-h acute toxicity data (measured as immobilization) for six classes of chemicals detected in Great Lakes fish. The following regression was obtained for Daphnia pulex (concentration = μM): log EC50 = 4.86 - 4.35 VI/100; N = 38, r2 = 0.867, sd = 0.403 We also used the LSER modeling approach to analyze to a large published data set of 24-h acute toxicity for Daphnia magna; the following regression resulted, for eight classes of compounds (concentration = mM): log EC50 = 3.88 - 4.52 VI/100 - 1.62 π* + 1.66 βm - 0.916 αm; N = 62, r2 = 0.859, sd = 0.375 In addition we developed computer software that identifies

  18. Recognition technology research based on 3D fingerprint

    NASA Astrophysics Data System (ADS)

    Tian, Qianxiao; Huang, Shujun; Zhang, Zonghua

    2014-11-01

    Fingerprint has been widely studied and applied to personal recognition in both forensics and civilian. However, the current widespread used fingerprint is identified by 2D (two-dimensional) fingerprint image and the mapping from 3D (three-dimensional) to 2D loses 1D information, which leads to low accurate and even wrong recognition. This paper presents a 3D fingerprint recognition method based on the fringe projection technique. A series of fringe patterns generated by software are projected onto a finger surface through a projecting system. From another viewpoint, the fringe patterns are deformed by the finger surface and captured by a CCD camera. The deformed fringe pattern images give the 3D shape data of the finger and the 3D fingerprint features. Through converting the 3D fingerprints to 2D space, traditional 2D fingerprint recognition method can be used to 3D fingerprints recognition. Experimental results on measuring and recognizing some 3D fingerprints show the accuracy and availability of the developed 3D fingerprint system.

  19. Fingerprint pattern restoration by digital image processing techniques.

    PubMed

    Wen, Che-Yen; Yu, Chiu-Chung

    2003-09-01

    Fingerprint evidence plays an important role in solving criminal problems. However, defective (lacking information needed for completeness) or contaminated (undesirable information included) fingerprint patterns make identifying and recognizing processes difficult. Unfortunately. this is the usual case. In the recognizing process (enhancement of patterns, or elimination of "false alarms" so that a fingerprint pattern can be searched in the Automated Fingerprint Identification System (AFIS)), chemical and physical techniques have been proposed to improve pattern legibility. In the identifying process, a fingerprint examiner can enhance contaminated (but not defective) fingerprint patterns under guidelines provided by the Scientific Working Group on Friction Ridge Analysis, Study and Technology (SWGFAST), the Scientific Working Group on Imaging Technology (SWGIT), and an AFIS working group within the National Institute of Justice. Recently, the image processing techniques have been successfully applied in forensic science. For example, we have applied image enhancement methods to improve the legibility of digital images such as fingerprints and vehicle plate numbers. In this paper, we propose a novel digital image restoration technique based on the AM (amplitude modulation)-FM (frequency modulation) reaction-diffusion method to restore defective or contaminated fingerprint patterns. This method shows its potential application to fingerprint pattern enhancement in the recognizing process (but not for the identifying process). Synthetic and real images are used to show the capability of the proposed method. The results of enhancing fingerprint patterns by the manual process and our method are evaluated and compared. PMID:14535661

  20. Effect of metals on Daphnia magna and cladocerans representatives of the Argentinean fluvial littoral.

    PubMed

    Luciana, Regaldo; Reno, Ulises; Gervasio, Susana; Horacio, Troiani; Gagneten, Ana María

    2014-07-01

    Chronic toxicity tests were conducted to assess the effect of Cu, Cr and Pb on Moinodaphnia macleayi and Ceriodaphnia dubia -two cladoceran species from the Argentinian Fluvial Littoral Zone (AFLZ)- and Daphnia magna -an holarctic species-. The specimens were exposed to three concentrations of each metal. As endpoints, the number of living and dead organisms, molts, neonates released, and the age of first reproduction were recorded. Chronic assays showed that Cu significantly affected the analyzed life history traits in the three species. The lowest Pb and Cr concentrations did not affect survival, molting or fecundity in D. magna. Conversely, in M. macleayi and C. dubia, survival, molting and fecundity showed highly significant differences in all the concentrations tested compared to control assay. The present study stresses the importance of using biological parameters as bioindicators, as well as the study species from the Southern Hemisphere to assess metal pollution. PMID:25004754

  1. Acute toxicity of a mixture of copper and single-walled carbon nanotubes to Daphnia magna.

    PubMed

    Kim, Ki T; Klaine, Stephen J; Lin, Sijie; Ke, Pu C; Kim, Sang D

    2010-01-01

    Nanomaterials released into the environment will interact with many materials including other contaminants. This may influence bioavailability and fate of both the nanoparticles and the other contaminants. The present study examined the effect of a combination of soluble copper and surface-modified single-walled carbon nanotubes (SWNTs) on Daphnia magna. Lysophosphatidylcholine (LPC) was used to modify the surface of SWNTs, reducing the surface hydrophobicity of the tubes and thereby producing a stable aqueous nanoparticle suspension. The toxicity of the nanoparticle-copper (Cu) mixture was determined to be additive. The addition of nontoxic concentration of LPC-SWNTs enhanced the uptake and toxicity of copper. Greater amounts of Cu were shown to accumulate in D. magna upon addition of 0.5 and 1.0 mg/L LPC-SWNTs. PMID:20821426

  2. Effects of physiochemical properties of test media on nanoparticle toxicity to Daphnia magna Straus.

    PubMed

    Seo, Jaehwan; Kim, Soyoun; Choi, Seona; Kwon, Dongwook; Yoon, Tae-Hyun; Kim, Woo-Keun; Park, June-Woo; Jung, Jinho

    2014-09-01

    The physicochemical property of standard test media significantly influenced the aggregation and dissolution of Ag, CuO and ZnO nanoparticles (NPs) and the toxicity of the NPs to Daphnia magna. For all the NPs, the highest amount of metal ions was released from the ISO medium, whereas acute toxicity to D. magna was highest in the moderately hard water medium (EC50 = 4.94, 980, and 1,950 μg L(-1) for Ag, CuO, and ZnO, respectively). By comparing EC50 values based on the total and dissolved concentrations of NPs with those of metal salt solutions, we found that both particulate and dissolved fractions were likely responsible for the toxicity of Ag NPs, whereas the dissolved fraction mostly contributed to the toxicity of CuO and ZnO NPs. PMID:25063370

  3. Differential oxidative stress of octahedral and cubic Cu2O micro/nanocrystals to Daphnia magna.

    PubMed

    Fan, Wenhong; Wang, Xiaolong; Cui, Minming; Zhang, Dongfeng; Zhang, Yuan; Yu, Tao; Guo, Lin

    2012-09-18

    This study attempts to understand the impact of different shapes of an individual micro/nanomaterial on their biotoxicities to aquatic organisms. Two differently shaped Cu(2)O micro/nanocrystals (cubes and octahedrons with side lengths of 900 nm) were exposed to Daphnia magna for 72 h, afterward several antioxidant biomarkers such as reactive oxygen species (ROS), catalase (CAT), total antioxidant capacity (T-AOC), and malondialdehyde (MDA) in D. magna were measured. We demonstrated the differential influences of two crystallographic Cu(2)O nanocrystals on the antioxidant process. Specifically, octahedral Cu(2)O nanocrystals showed a higher level of oxidative stress, possibly because of its larger surface area and higher reaction activity of the octahedron. The biomarker results further showed that the oxidative stress and antioxidant mechanism process involved three stages-antioxidant response, oxidation inhibition, and antioxidant inactivation. Furthermore, the accumulation of MDA was mainly responsible for the ROS-induced toxicity. PMID:22894800

  4. Rapid toxicity screening tests for aquatic biota. 1. Methodology and experiments with Daphnia magna

    SciTech Connect

    Janssen, C.R.; Persoone, G. )

    1993-04-01

    A promising new and rapid toxicity screening test was developed, the concept and principles of which are presented. The method consists of visual observation of in vivo inhibition of an enzymatic process, using a fluorescent substrate. Juvenile Daphnia magna was exposed to a toxicant dilution series for 1 h, after which the substrate was added and the enzymatic inhibition was observed visually, using a long-wave UV light. The 1-h EC50 results of 11 pure compounds are presented and compared to the conventional 24- and 48-h Daphnia magna EC50s. All 1-h fluorescence EC50s were of the same order of magnitude and correlated very well with the 24- and 48-h EC50s. The sensitivity and reproducibility of this cost-effective screening test were compared to those of the Microtox[reg sign] test. The scope for application and the potential of this new rapid toxicity screening test are evaluated.

  5. Environmental effects of dredging. Use of daphnia magna to predict consequences of bioaccumulation

    SciTech Connect

    1987-03-01

    Results reported herein represent a portion of the laboratory research evaluating the relationship between mercury and cadmium tissue residues and biological effects in the freshwater crustacean, Daphnia magna (commonly known as the water flea). Procedures presented here for a 28-day Daphnia magna toxicity test could be used in screening for water-column toxicity resulting from open-water disposal of a specific dredged material. As a part of its regulatory and dredging programs, the U. S. Army Corps of Engineers often conducts, or requires to be conducted, an assessment of the potential for bioaccumulation of environmental contaminants from sediment scheduled for dredging and open-water disposal. There is, at present, no generally accepted guidance available to aid in the interpretation of the biological consequences of bioaccumulation. To provide an initial basis for such guidance, the Environmental Laboratory is conducting both literature database analyses and experimental laboratory studies as part of the Long-Term Effects of Dredging Operations (LEDO) Program.

  6. Chromium toxicity on two linked trophic levels. I. Effects of contaminated algae on Daphnia magna.

    PubMed

    Gorbi, G; Corradi, M G

    1993-02-01

    The effects of feeding Daphnia magna on algae (Scenedesmus acutus) pretreated with different concentrations of Cr(VI) were studied. A positive effect on growth and newborn production rate was observed in the daphnids fed on algae exposed to 1 mg/liter Cr(VI). Fecundity and growth were drastically reduced in daphnids fed on algae exposed to 10 mg/liter Cr(VI). Since the algae, cultured in the presence of these two Cr(VI) concentrations, supplied daphnids with similar amounts of chromium, the observed effects on the population dynamics of D. magna were attributed more to alterations of the nutritional value of the algal food, due to the Cr treatment, than to a toxic effect of the metal. PMID:7682919

  7. Wherefrom and whereabouts of an alien: the American liver fluke Fascioloides magna in Austria: an overview.

    PubMed

    Sattmann, Helmut; Hörweg, Christoph; Gaub, Larissa; Feix, Anna Sophia; Haider, Michaela; Walochnik, Julia; Rabitsch, Wolfgang; Prosl, Heinrich

    2014-04-01

    The giant liver fluke Fascioloides magna, an invasive species originating from North America, was recorded in Austria in the wild for the first time in 2000. Since then, various data concerning the epidemiology in snail intermediate hosts and cervid final hosts have been reported. Galba truncatula acts as snail intermediate host, and red deer, roe deer and fallow deer act as final hosts. G. truncatula is abundant throughout the region, especially along muddy shores of slow-flowing branches of the river system. Prevalence in deer (20-100 %) is much higher than in snails (0.03-0.2 %). Despite medical treatment of parts of the deer population, the parasite has successfully established itself on both sides of the Danube floodplain environments southeast of Vienna. Genetic analysis revealed that the infection of Austrian deer populations apparently originated from foci in the Czech Republic or from populations of Danube tributaries. Areas adjacent southwards, which will soon be joined through wildlife crossings, have not yet evidenced F. magna. Nonetheless, these environments are inhabited by host snails and deer and therefore constitute suitable habitats for F. magna. Invading alien parasites not only threaten native individual hosts but also influence host populations, thus potentially also modifying parasite communities and interactions. The host range of F. magna includes a variety of potential hosts, notably other Lymnaeidae as potential intermediate hosts and various ungulates, including sheep and cattle, as final hosts. Because eradication after medical treatment was unsuccessful, and due to the risk of further spread of the parasite into unaffected regions, enhanced control strategies need to be developed. We recommend assessment of introduction pathways and dispersal, continuous monitoring of host abundance and distribution and the prevalence of flukes in intermediate and final hosts, as well as coordinated and concerted actions with neighbouring countries

  8. Bioavailability of sediment-associated Cu and Zn to Daphnia magna.

    PubMed

    Gillis, P L; Wood, C M; Ranville, J F; Chow-Fraser, P

    2006-05-25

    Exposures to mining-impacted, field-collected sediment (Clear Creek, CO, USA) contaminated with Cu (2.4 mg/g) and Zn (5.2 mg/g) were acutely toxic to juvenile Daphnia magna. Dissolved Cu and Zn in the overlying water (sediment+reference water) were at levels that could cause acute toxicity. To reduce dissolved metals below toxic levels, the sediment was repeatedly rinsed to remove any easily mobilized metals. Washing the sediment reduced dissolved Cu by 60% and Zn by 80%. D. magna exposed to washed sediment experienced higher survival (95%) compared to those exposed to the original sediment (<50%). Cu and Zn that remained associated with suspended sediment after washing were not bioavailable, since survival and tissue metal concentrations in D. magna exposed to both filtered (>0.45 microm) and unfiltered overlying water were statistically similar. Multiple regression analysis indicated that only dissolved Cu significantly contributed to mortality of D. magna whereas particulate Cu, particulate Zn, and dissolved Zn did not. Regression analysis on a combined dataset from all Clear Creek exposures (washed and unwashed), revealed a significant (p < 0.0001, r(2) = 0.76) relationship between the concentration of dissolved copper in the overlying water and the mortality of exposed Daphnia, yielding an estimated LC50 of 26 microg/L dissolved copper (hardness approximately 140 mg/L). The results of this study indicate that if the sediment of Clear Creek was subjected to a resuspension event that there would be a significant efflux of metals from the sediment into the water column, resulting in potentially toxic levels in the water column. PMID:16488492

  9. Chronic effects of contaminated sediment on Daphnia magna and Chironomus tentans (journal version)

    SciTech Connect

    Nebeker, A.V.; Onjukka, S.T.; Cairns, M.A.

    1988-01-01

    Chronic tests were conducted with Daphnia magna (cladoceran) and Chironomus tentans (midge) to determine their usefulness as test organisms for chronic sediment assays, and to estimate the potential long-term impact of contaminated freshwater sediments and contaminated Superfund-site soils on freshwater invertebrates. These two species were used successfully in acute sediment tests and were shown to be useful in chronic tests in water.

  10. Development of miniaturized acute toxicity tests for Daphnia magna and Pimephales promelas

    SciTech Connect

    Powell, R.L.; Kimerle, R.A.; Moser, E.M.; McKee, M.J.

    1995-12-31

    Standard EPA methods for conducting static, 48-hour, acute toxicity tests using Daphnia magna and Pimephales promelas (fathead minnows) can be miniaturized to successfully yield accurate LC50/EC50 values. The screening procedure involves exposing the test organisms to 1 mL of test solution, in test chambers which consist of the wells on 48-well microliter plates. Toxicity of the microliter plates and solvent, DO concentration, organism biomass to test solution ratio, partitioning of the chemicals and dilution of the test solution during transfer of the test organisms were examined. Survival and exposure were not significantly altered using non-standard test chambers. Toxicity of linear alkylbenzene sulfonate (LAS), pentachlorophenol (PCP), kepone, and sodium lauryl sulfate (SLS) was determined using D. magna and fathead minnows. Serial dilutions were made and 1 mL aliquots pipetted into the wells. Daphnia magna, < 24 hours old, and newly hatched fathead minnows, were transferred into the wells, twenty individuals per concentration, one per well. Dose-response curves were established for all test compounds. LC50/EC50`s values obtained using miniaturized methods strongly correlated with those obtained using standard EPA procedures. The tests were repeated a number of times with coefficient of variances for D. magna ranging from 10% with kepone to 64% with SLS. For fathead minnows CVs ranged from 0% with PCP to 23% with kepone. It was concluded that current methods can be miniaturized, yet still provide accurate information regarding toxicity for compounds in limited supply. This method may also be amenable to effluent testing i.e. TIE fractions. Other benefits include reducing the amount of equipment and space needed to conduct a test and the time involved.

  11. Energy allocation in Daphnia magna exposed to xenobiotics: A biochemical approach

    SciTech Connect

    Coen, W.M. De; Janssen, C.R.; Persoone, G.

    1995-12-31

    A new approach to sublethal aquatic toxicity testing based on a biochemical assessment of the energy budget of Daphnia magna was developed and evaluated. With this method energy consumption (E{sub c}) is estimated by measuring the electron transport activity based on the calorimetric measurement of a tetrazolium salt reduction. Total available energy (E{sub a}) is assessed by measuring the lipid, protein and sugar content of the test organism using calorimetric methods. E{sub a} {minus} E{sup c} can subsequently be calculated and represents the ``surplus`` energy available for growth and reproduction. D. magna neonates were exposed to cadmium and 2,4-dichlorophenoxy acetic acid for 4 days after which the electron transport activity and the total lipid, protein and sugar content of the test organisms were determined. Using the enthalpy of combustion of the different macromolecular groups and converting the oxygen consumption into oxyenthalpic equivalents, an estimation of the total energy budget of the test organisms was made. Additionally, the age specific survival and reproduction and the growth of D. magna populations exposed to the same sublethal concentrations was assessed in 21 day life table experiments. Energy allocation patterns of stressed D. magna obtained with the new biochemical approach were similar to those obtained with the conventional Scope for Growth determinations. Although more research is needed, comparison between the suborganismal (biochemical) and supraorganismal (life table) endpoints indicate that the proposed short-term assay based on energy allocation could be used to predict long-term effects on the survival, growth and reproduction of daphnids.

  12. Effects of algal food quality on sexual reproduction of Daphnia magna.

    PubMed

    Choi, Jong-Yun; Kim, Seong-Ki; La, Geung-Hwan; Chang, Kwang-Hyeon; Kim, Dong-Kyun; Jeong, Keon-Young; Park, Min S; Joo, Gea-Jae; Kim, Hyun-Woo; Jeong, Kwang-Seuk

    2016-05-01

    The objective of our study was to investigate sexual reproduction of Daphnia magna associated with mating behaviors and hatching rates, according to different algal food sources. Since a diatom is known to contain more abundant long-chain poly unsaturated fatty acids (PUFAs), we hypothesized that the diatom-consuming D. magna would exhibit more successful reproduction rates. Upon the hypothesis, we designed three experiments using two algal species, a green alga (Chlorella vulgaris) and a diatom (Stephanodiscus hantzschii). From the results, we found that the mating frequency and copulation duration increased in the treatment with S. hantzschii, resulting in a significant increase of hatching rates of resting eggs. In the other two repetitive mating strategies (e.g., one female vs. multiple males, and one male vs. multiple females), we found that the hatching rates of resting eggs were greater in the S. hantzschii treatment. In addition to the mating strategy, male body size significantly increased in the diatom treatment, hence average diameter of penis was also statistically different among the treatments (greater diameter in the S. hantzschii treatment). To examine the effect of algal food quality, we estimated quantity of fatty acids in the two algal species. Our result showed that S. hantzschii had a higher proportion of long-chain PUFAs than C. vulgaris. Furthermore, a stable isotope analysis revealed that carbon and nitrogen originated from S. hantzschii were more assimilated to D. magna. In summary, our study manifested that diatom consumption of D. magna leads to more successful sexual reproduction. We then discussed how the diatom consumption of zooplankton influences food web dynamics in a freshwater ecosystem. PMID:27217941

  13. Evaluation of the ultrasonic method for solubilizing Daphnia magna before liquid scintillation counting

    SciTech Connect

    Dauble, D.D.; Hanf, R.W. Jr.; Carlile, D.W.

    1984-11-01

    Adult Daphnia magna were exposed to /sup 14/C-labeled phenol and tissues analyzed for /sup 14/C uptake by three methods: (1) tissue solubilizer, (2) tissue solubilizer plus sonication, and (3) sonication alone. Analysis by liquid scintillation counting revealed that measurements of total activity among treatments were not significantly different (..cap alpha.. less than or equal to 0.10) at two count levels. Sonicated samples showed less variation than tissue samples that were solubilized. 5 references, 1 table.

  14. Morphological evidence of mechanoreceptive gravity perception in a water flea - Daphnia magna

    NASA Technical Reports Server (NTRS)

    Meyers, D. G.

    1985-01-01

    Hair-like structures or setae located in the basal membrane of the swimming antennae of the water flea, D. magna, were observed by scanning electron microscopy and compared to mechanoreceptors in the Higher Order Crustacea. Similarities in anatomy, size, attachment, number, length, and orientation support the hypothesis that the setae are rheoceptive mechanoreceptors which mediate gravity perception through deflection by water currents during the sink phase of hop-and-sink swimming behavior.

  15. Chronic effects of contaminated sediment on Daphnia magna and Chironomus tentans

    SciTech Connect

    Nebeker, A.V.; Onjukka, S.T.; Cairns, M.A.

    1988-10-01

    Chronic tests were conducted with Daphnia magna (cladoceran) and Chironomus tentans (midge) to determine their usefulness as test organisms for chronic sediment assays, and to estimate the potential long-term impact of contaminated freshwater sediments and contaminated Superfund site soils on freshwater invertebrates. These two species have been used successfully in acute sediment tests, and have been shown to be useful in chronic tests in water--only bioassays.

  16. Life history and biology of Fascioloides magna (Trematoda) and its native and exotic hosts

    PubMed Central

    Malcicka, Miriama

    2015-01-01

    Host–parasite interactions are model systems in a wide range of ecological and evolutionary fields and may be utilized for testing numerous theories and hypotheses in terms of both applied and fundamental research. For instance, they are important in terms of studying coevolutionary arms races, species invasions, and in economic terms the health of livestock and humans. Here, I present a comprehensive description of the life history, biogeography, and biology of the giant liver fluke, Fascioloides magna, and both its intermediate and definitive hosts. F. magna is native to North America where it uses several species of freshwater snails (Lymnaeidae) as intermediate hosts and four main species of ungulates as definitive hosts. The fluke has also been introduced into parts of Europe where it is now established in two lymnaeid snail species and three ungulate species. This study gives a comprehensive description of different developmental stages of the fluke in its two host classes, as well as detailed notes on historical and present distributions of F. magna in North America and Europe as well as in its snail and deer hosts (with range maps provided). Aberrant and dead-end hosts are also discussed in detail, and descriptive phylogenies are provided for all of the organisms. I briefly discuss how F. magna represents a model example of multiple-level ecological fitting, a phenomenon not yet described in the empirical literature. Lastly, I explore possible future scenarios for fluke invasion in Europe, where it is currently expanding its range. PMID:25897378

  17. Toxicity identification evaluation of anaerobically treated swine slurry: a comparison between Daphnia magna and Raphanus sativus.

    PubMed

    Villamar, Cristina A; Silva, Jeannette; Bay-Schmith, Enrique; Vidal, Gladys

    2014-01-01

    Anaerobic digestion does not efficiently reduce ionic compounds present in swine slurry, which could present a potential risk to aquatic ecosystems (surface runoff) and terrestrial ambient (irrigation). The objective of this study was to evaluate the ecotoxicological characteristics of anaerobically treated swine slurry using acute and chronic (epicotyl elongation) toxicity tests with Daphnia magna and Raphanus sativus and identification of suspected toxic compounds using the Toxicity Identification Evaluation (TIE) method. The evaluation was performed in three phases: physicochemical characterization of the slurry; acute/chronic toxicity testing with Daphnia magna and Raphanus sativus for each fraction of the TIE (cation and anion exchange columns, activated carbon, pH modification/aeration and EDTA) and identification of suspected toxic compounds. The anaerobically treated slurry contained concentrations of ammonium of 1,072 mg L(-1), chloride of 815 mg L(-1) and metals below 1 mg L(-1) with a D. magna acute toxicity (48h-LC50) of 5.3% and R. sativus acute toxicity (144h-LC50) of 48.1%. Epicotyl elongation of R. sativus was inhibited at concentrations above 25% (NOEC). The cation exchange reduced the toxicity and free ammonia by more than 90% for both bio-indicators. Moreover, this condition stimulated the epicotyl growth of R. sativus between 10% and 37%. In conclusion, the main compound suspected of causing acute toxicity in D. magna and acute/chronic toxicity in R. sativus is the ammonium. The findings suggest the need the ammonium treatment prior to the agricultural reuse of swine slurry given the high risk to contaminate the aquatic environment by runoff and toxicity of sensitive plants. PMID:25190563

  18. Silver Nanowire Exposure Results in Internalization and Toxicity to Daphnia Magna

    PubMed Central

    Scanlan, Leona D.; Reed, Robert B.; Loguinov, Alexandre V.; Antczak, Philipp; Tagmount, Abderrahmane; Aloni, Shaul; Nowinski, Daniel Thomas; Luong, Pauline; Tran, Christine; Karunaratne, Nadeeka; Pham, Don; Lin, Xin Xin; Falciani, Francesco; Higgins, Chris P.; Ranville, James F.; Vulpe, Chris D.; Gilbert, Benjamin

    2013-01-01

    Nanowires (NWs), high-aspect-ratio nanomaterials, are increasingly used in technological materials and consumer products and may have toxicological characteristics distinct from nanoparticles. We carried out a comprehensive evaluation of the physico-chemical stability of four silver nanowires (AgNWs) of two sizes and coatings and their toxicity to Daphnia magna. Inorganic aluminum-doped silica coatings were less effective than organic poly(vinyl pyrrolidone) coatings at preventing silver oxidation or Ag+ release and underwent a significant morphological transformation within one-hour following addition to low ionic strength Daphnia growth media. All AgNWs were highly toxic to D. magna but less toxic than ionic silver. Toxicity varied as a function of AgNW dimension, coating and solution chemistry. Ag+ release in the media could not account for observed AgNW toxicity. Single-particle inductively coupled plasma mass spectrometry (spICPMS) distinguished and quantified dissolved and nanoparticulate silver in microliter-scale volumes of Daphnia magna hemolymph with a limit of detection of approximately 10 ppb. The silver levels within the hemolymph of Daphnia exposed to both Ag+ and AgNW met or exceeded the initial concentration in the growth medium, indicating effective accumulation during filter feeding. Silver-rich particles were the predominant form of silver in hemolymph following exposure to both AgNWs and Ag+. Scanning electron microscopy (SEM) imaging of dried hemolymph found both AgNWs and silver precipitates that were not present in the AgNW stock or the growth medium. Both organic and inorganic coatings on the AgNW were transformed during ingestion or absorption. Pathway, gene ontology and clustering analyses of gene expression response indicated effects of AgNWs distinct from ionic silver on Daphnia magna. PMID:24099093

  19. How reliable are data for the ecotoxicity of trivalent chromium to Daphnia magna?

    PubMed

    Ponti, Benedetta; Bettinetti, Roberta; Dossi, Carlo; Vignati, Davide Anselmo Luigi

    2014-10-01

    Risk assessments from the European Union and the World Health Organization report values for acute and chronic toxicity of Cr(III) to Daphnia magna in the range of 0.6 mg/L to 111 mg/L and 0.047 mg/L to 3.4 mg/L, respectively. To understand whether factors other than the use of different test media and data reporting contribute to this variability, the authors tested the acute (48-h) and chronic (21-d) toxicities of Cr(III) to D. magna according to Organisation for Economic Co-operation and Development (OECD) methods. Filterable (0.45-µm) chromium concentrations were measured at 0 h, 6 h, 24 h, and 48 h, the latter value corresponding to the total duration of the acute tests and to the interval between medium renewals in chronic tests. In highly alkaline media (4.9 meq/L), Cr concentrations decreased rapidly below the analytical detection limit, and no toxicity was observed. In less alkaline media (approximately 0.8 meq/L), the decrease in filterable Cr concentrations was inversely proportional to the quantity of added Cr(III). The authors concluded that existing data likely underestimate the ecotoxicity of Cr(III) to D. magna. A reliable assessment of the hazard of Cr(III) to D. magna must consider that exposure concentrations can decrease markedly from the beginning to the end of a test and that medium alkalinity strongly influences the outcome of laboratory toxicity tests. PMID:24943496

  20. A comparison of the response of Simocephalus mixtus (Cladocera) and Daphnia magna to contaminated freshwater sediments.

    PubMed

    Martínez-Jerónimo, Fernando; Cruz-Cisneros, Jade Lizette; García-Hernández, Leonardo

    2008-09-01

    The southeast region of Mexico is characterized by intensive oil industry activities carried out by the national public enterprise Petróleos Mexicanos (PEMEX). The freshwater lagoon "El Limón", located in the municipality of Macuspana, state of Tabasco, Mexico, has received over 40 years discharges of untreated waste waters from the Petrochemical Complex "Ciudad PEMEX", located on the border of the lagoon. To assess the toxicity of the sediments and, hence, to obtain information on the biological effects of these contaminating discharges, the cladoceran Simocephalus mixtus was used as a test organism in acute (48h) and chronic (12d) toxicity assays. For comparison purposes, bioassays were also conducted with the reference cladoceran Daphnia magna. The sediments of this lagoon contain important amounts of metals and hydrocarbons that have been accumulated over time; however, the acute tests only registered reduced lethal effects on the test organisms (maxima of 10% and 17% mortality for D. magna and S. mixtus, respectively). This may be due to low bioavailability of the pollutants present in the sediments. On the other hand, partial or total inhibition and delay in the start of reproduction, reduction in clutch sizes, reduced survival, as well as reduction in the size of adults and offspring were recorded in the chronic assays. The most evident chronic effects were found in S. mixtus; in this species, reproduction was inhibited up to 72%, whereas D. magna was only affected by 24%. We determined that S. mixtus is a more sensitive test organism than D. magna to assess whole-sediment toxicity in tropical environments, and that chronic exposure bioassays are required for an integrated sediment evaluation. The sediments from "El Limón" lagoon induced chronic intoxication responses and, therefore, remediation measures are urgently needed to recover environmental conditions suitable for the development of its aquatic biota. PMID:18573528

  1. Chemotherapy and Fingerprint Loss: Beyond Cosmetic

    PubMed Central

    2012-01-01

    Hand–foot syndrome (HFS) is a common adverse reaction to several chemotherapy drugs. Focus has been on the clinically relevant sequelae associated with this condition, with fingerprint loss receiving little attention. We report the case of a 53-year old male patient with terminal metastatic adenocarcinoma of the rectum involving the liver and lungs who developed grade 3 HFS while on capecitabine therapy. This resulted in his inability to process required government papers as a result of the loss of his fingerprints, imposing significant inconvenience and frustration on a person severely challenged by his deteriorating health. We believe clinicians should pay more attention to this possible outcome that can add additional stress in the lives of patients whose quality of life is already severely compromised. PMID:22298801

  2. Chromatographic fingerprint analysis of Pycnogenol dietary supplements.

    PubMed

    Chen, Pei; Song, Fenhong; Lin, Long-Ze

    2009-01-01

    The bark of maritime pine (Pinus pinaster Aiton) has been widely used as a remedy for various degenerative diseases. A standard high-performance liquid chromatographic (HPLC) procedure for Pycnogenol analysis is a method specified in the United States Pharmacopeia (USP) monograph, which requires measurement of peak areas and identification of four components of the extract: caffeic acid, catechin, ferulic acid, and taxifolin. In this study, a fingerprint analysis using an HPLC method based on the USP monograph has been developed to provide additional qualitative information for the analysis of Pycnogenol-containing dietary supplements (PDS). Twelve commercially available PDS samples were purchased and analyzed along with a standard Pycnogenol extract. Their chromatographic fingerprints were analyzed using principal component analysis. The results showed that two of the samples were not consistent with the standard reference Pycnogenol extract. One contained other active ingredients in addition to Pycnogenol, and the other may have resulted from a quality control issue in manufacturing. PMID:19485224

  3. DNA fingerprinting and the substantive law.

    PubMed

    Singh, D

    1994-01-01

    The ability to analyse human DNA has the potential to revolutionize legal proceedings--both civil and criminal--especially those which turn on biological or genetic evidence. Examining the positive and negative aspects of DNA fingerprinting, it would appear that the benefits certainly outweigh any disadvantages. In paternity determinations, DNA fingerprinting renders otiose many of the controversial concerns, particularly regarding the determination of legal probability, providing as it does unequivocal evidence of blood relationship. Furthermore, in criminal law, its value is well-documented. The relevant legislation is already in place, therefore no further legislation is required to enable South African law enforcement agencies to make use of the DNA test. The apparently high cost may, however, frustrate its general application to the civil law but with the assistance of the state and law societies, the envisaged problem could be alleviated. To date no other forensic tests rival the accuracy of the DNA test. PMID:7968306

  4. FBI compression standard for digitized fingerprint images

    NASA Astrophysics Data System (ADS)

    Brislawn, Christopher M.; Bradley, Jonathan N.; Onyshczak, Remigius J.; Hopper, Thomas

    1996-11-01

    The FBI has formulated national standards for digitization and compression of gray-scale fingerprint images. The compression algorithm for the digitized images is based on adaptive uniform scalar quantization of a discrete wavelet transform subband decomposition, a technique referred to as the wavelet/scalar quantization method. The algorithm produces archival-quality images at compression ratios of around 15 to 1 and will allow the current database of paper fingerprint cards to be replaced by digital imagery. A compliance testing program is also being implemented to ensure high standards of image quality and interchangeability of data between different implementations. We will review the current status of the FBI standard, including the compliance testing process and the details of the first-generation encoder.

  5. Reference Device-Assisted Adaptive Location Fingerprinting

    PubMed Central

    Wu, Dongjin; Xia, Linyuan

    2016-01-01

    Location fingerprinting suffers in dynamic environments and needs recalibration from time to time to maintain system performance. This paper proposes an adaptive approach for location fingerprinting. Based on real-time received signal strength indicator (RSSI) samples measured by a group of reference devices, the approach applies a modified Universal Kriging (UK) interpolant to estimate adaptive temporal and environmental radio maps. The modified UK can take the spatial distribution characteristics of RSSI into account. In addition, the issue of device heterogeneity caused by multiple reference devices is further addressed. To compensate the measuring differences of heterogeneous reference devices, differential RSSI metric is employed. Extensive experiments were conducted in an indoor field and the results demonstrate that the proposed approach not only adapts to dynamic environments and the situation of changing APs’ positions, but it is also robust toward measuring differences of heterogeneous reference devices. PMID:27258284

  6. Nanotag luminescent fingerprint anti-counterfeiting technology

    NASA Astrophysics Data System (ADS)

    Johansen, Stefan; Radziwon, Michal; Tavares, Luciana; Rubahn, Horst-Günter

    2012-05-01

    We describe a method to fabricate, transfer and validate via image processing nanofibre-based, unique security marks (`nanotags') for anti-counterfeiting purposes. Epitaxial surface growth of oligophenylenes on a heated muscovite mica crystal results in a thin film of mutually aligned nanofibres with dimensions of tens of nanometres in height, hundreds of nanometres in width and tens to hundreds of micrometres in length. By applying a shadow mask, a film pattern is generated which contains only sparse, randomly grown nanofibres, which in turn represent a unique `fingerprint' of the growth area. This fingerprint can be transferred on an adhesive tape as a label of a product, imaged using low magnification microscopy, digitalised and stored in a database. Infrared surface heating, enforced cooling and load lock transfer makes the fabrication process fast and scalable to mass production.

  7. Transmission fingerprints in quasiperiodic dielectric multilayers

    NASA Astrophysics Data System (ADS)

    Vasconcelos, M. S.; Albuquerque, E. L.

    1999-05-01

    We investigate the optical transmission fingerprints in structures that exhibit deterministic disorders. A class of models that has attracted particular attention in this context are the quasiperiodic dielectric multilayers that obey a substitutional sequence. These substitutional sequence are characterized by the nature of their Fourier spectrum, which can be dense pure point (Fibonacci sequences), singular continuous (Thue-Morse and double-period sequences), and absolutely continuous (Rudin-Shapiro sequence). We use a transfer-matrix approach to derive the optical transmission coefficients. Numerical results are presented to illustrate the self-similar aspect of the spectra, as well as to show the optical fingerprint through a return map of the transmission coefficients.

  8. Metabolic fingerprinting as a diagnostic tool.

    PubMed

    Ellis, David I; Dunn, Warwick B; Griffin, Julian L; Allwood, J William; Goodacre, Royston

    2007-09-01

    Within the framework of systems biology, functional analyses at all 'omic levels have seen an intense level of activity during the first decade of the twenty-first century. These include genomics, transcriptomics, proteomics, metabolomics and lipidomics. It could be said that metabolomics offers some unique advantages over the other 'omics disciplines and one of the core approaches of metabolomics for disease diagnostics is metabolic fingerprinting. This review provides an overview of the main metabolic fingerprinting approaches used for disease diagnostics and includes: infrared and Raman spectroscopy, Nuclear magnetic resonance (NMR) spectroscopy, followed by an introduction to a wide range of novel mass spectrometry-based methods, which are currently under intense investigation and developmental activity in laboratories worldwide. It is hoped that this review will act as a springboard for researchers and clinicians across a wide range of disciplines in this exciting era of multidisciplinary and novel approaches to disease diagnostics. PMID:17924839

  9. Palindromic Genes in the Linear Mitochondrial Genome of the Nonphotosynthetic Green Alga Polytomella magna

    PubMed Central

    Smith, David Roy; Hua, Jimeng; Archibald, John M.; Lee, Robert W.

    2013-01-01

    Organelle DNA is no stranger to palindromic repeats. But never has a mitochondrial or plastid genome been described in which every coding region is part of a distinct palindromic unit. While sequencing the mitochondrial DNA of the nonphotosynthetic green alga Polytomella magna, we uncovered precisely this type of genic arrangement. The P. magna mitochondrial genome is linear and made up entirely of palindromes, each containing 1–7 unique coding regions. Consequently, every gene in the genome is duplicated and in an inverted orientation relative to its partner. And when these palindromic genes are folded into putative stem-loops, their predicted translational start sites are often positioned in the apex of the loop. Gel electrophoresis results support the linear, 28-kb monomeric conformation of the P. magna mitochondrial genome. Analyses of other Polytomella taxa suggest that palindromic mitochondrial genes were present in the ancestor of the Polytomella lineage and lost or retained to various degrees in extant species. The possible origins and consequences of this bizarre genomic architecture are discussed. PMID:23940100

  10. Clinical Improvement of Alpha-mannosidosis Cat Following a Single Cisterna Magna Infusion of AAV1.

    PubMed

    Yoon, Sea Young; Bagel, Jessica H; O'Donnell, Patricia A; Vite, Charles H; Wolfe, John H

    2016-02-01

    Lysosomal storage diseases (LSDs) are debilitating neurometabolic disorders for most of which long-term effective therapies have not been developed. Gene therapy is a potential treatment but a critical barrier to treating the brain is the need for global correction. We tested the efficacy of cisterna magna infusion of adeno-associated virus type 1 (AAV1) expressing feline alpha-mannosidase gene in the postsymptomatic alpha-mannosidosis (AMD) cat, a homologue of the human disease. Lysosomal alpha-mannosidase (MANB) activity in the cerebrospinal fluid (CSF) and serum were increased above the control values in untreated AMD cats. Clinical neurological signs were delayed in onset and reduced in severity. The lifespan of the treated cats was significantly extended. Postmortem histopathology showed resolution of lysosomal storage lesions throughout the brain. MANB activity in brain tissue was significantly above the levels of untreated tissues. The results demonstrate that a single cisterna magna injection of AAV1 into the CSF can mediate widespread neuronal transduction of the brain and meaningful clinical improvement. Thus, cisterna magna gene delivery by AAV1 appears to be a viable strategy for treatment of the whole brain in AMD and should be applicable to many of the neurotropic LSDs as well as other neurogenetic disorders. PMID:26354342

  11. Combined effects of water quality parameters on mixture toxicity of copper and chromium toward Daphnia magna.

    PubMed

    Jo, Hun-Je; Son, Jino; Cho, Kijong; Jung, Jinho

    2010-11-01

    In this study, a central composite design (CCD) was employed to evaluate the combined effects of pH, hardness and dissolved organic carbon (DOC) on the toxicity of a mixture of Cu(II) and Cr(VI) toward Daphnia magna. Overall, the results showed that increases in pH, hardness and DOC concentration led to decreased mixture toxicity of Cu(II) and Cr(VI) by reducing the concentrations of toxic species such as Cu(2+) and HCrO(4)(-). In addition, empirical models for the prediction of 24-h and 48-h mortalities of D. magna were developed and validated by using three different sources of dissolved organic matter (DOM). Because the DOMs had different Cu(II)-binding capacities, the empirical models were revised using the ligand concentration of DOMs instead of the DOC concentration; however, the prediction capability of these models did not differ significantly. These results suggest that it is not likely that the chemical property of DOM is important for prediction of the mixture toxicity of Cu(II) and Cr(VI) toward D. magna when the ligand concentration of DOMs greatly exceed the Cu(II) concentration. PMID:20875667

  12. Chronic toxicity of silver nitrate to Ceriodaphnia dubia and Daphnia magna, and potential mitigating factors.

    PubMed

    Naddy, Rami B; Gorsuch, Joseph W; Rehner, Anita B; McNerney, Gina R; Bell, Russell A; Kramer, James R

    2007-08-15

    We investigated the chronic toxicity of Ag, as silver nitrate, using two freshwater aquatic cladoceran species, Ceriodaphnia dubia and Daphnia magna, to generate data for the development of a chronic ambient water quality criterion for Ag. Preliminary studies with C. dubia showed variable results which were related to the equilibration time between food and silver. Follow-up testing was conducted using a 3h equilibration time, which stabilized dissolved Ag concentrations and the toxicity of Ag(+). Results with C. dubia conducted individually (1 per cup, n=10) and in mass (30 per chamber, n=2) gave similar results once similar standardized equilibration times were used. The maximum acceptable toxicant concentration (MATC) of Ag to C. dubia and D. magna was 9.61 and 3.00microg dissolved Ag/L, respectively. The chronic toxicity of Ag(+) to C. dubia was also evaluated in the presence of: (1) dissolved organic carbon (DOC) and (2) sulfide. The addition of DOC (0.4mg/L) resulted in a approximately 50% decrease in toxicity while the addition of sulfide (75.4nM) deceased toxicity by 42%. Whole-body Ag concentration in D. magna was positively correlated with increased levels of Ag exposure, however; we observed a non-statistical decrease in whole-body Na levels, an estimator of sodium homeostasis. PMID:17658626

  13. Acute toxicity of leachates of tire wear material to Daphnia magna--variability and toxic components.

    PubMed

    Wik, Anna; Dave, Göran

    2006-09-01

    Large amounts of tire rubber are deposited along the roads due to tread wear. Several compounds may leach from the rubber and cause toxicity to aquatic organisms. To investigate the toxic effects of tire wear material from different tires, rubber was abraded from the treads of twenty-five tires. Leachates were prepared by allowing the rubber to equilibrate with dilution water at 44 degrees C for 72 h. Then the rubber was filtered from the leachates, and test organisms (Daphnia magna) were added. Forty-eight hour EC50s ranged from 0.5 to >10.0 g l(-1). The toxicity identification evaluation (TIE) indicated that non-polar organic compounds caused most of the toxicity. UV exposure of the filtered tire leachates caused no significant increase in toxicity. However, when tested as unfiltered leachates (the rubber was not filtered from the leachates before addition of D. magna) photo-enhanced toxicity was considerable for some tires, which means that test procedures are important when testing tire leachates for aquatic (photo) toxicity. The acute toxicity of tire wear for Daphnia magna was found to be <40 times a predicted environmental concentration based on reports on the concentration of a tire component found in environmental samples, which emphasizes the need for a more extensive risk assessment of tire wear for the environment. PMID:16466775

  14. Cohorts and populations in chronic toxicity studies with Daphnia magna: a cadmium example

    SciTech Connect

    van Leeuwen, C.J.; Luttmer, W.J.; Griffioen, P.S.

    1985-02-01

    Two semistatic life table experiments with Daphnia magna were carried out on reconstituted and Lake Ijssel water. The nontoxic concentrations for cadmium with respect to the intrinsic rate of natural increase, derived from age-specific survival and fecundity were 1 and 3.2 micrograms/liter, respectively. Body length appeared to be a sensitive parameter. A third intermittent-flow experiment was started with small, exponentially growing populations. These populations had a stable age distribution, were composed of cohorts of different ages and showed an almost perfect logistic growth. Cadmium was shown to reduce the upper numerical limit (carrying capacity) for D. magna and was inversely related to this parameter: log Y = 2.85 -0.20 log (Cd); r = -0.99. A nontoxic concentration could not be established. Based on the background concentration of cadmium, a freshwater quality criterion of 0.1 microgram/liter is proposed. The results are used to discuss several shortcomings of the current methods. Finally it is stated that the introduction of the concepts of population dynamics in reproduction tests with D. magna is a realistic step towards ecotoxicology.

  15. Toxicity Thresholds for Diclofenac, Acetaminophen and Ibuprofen in the Water Flea Daphnia magna.

    PubMed

    Du, Juan; Mei, Cheng-Fang; Ying, Guang-Guo; Xu, Mei-Ying

    2016-07-01

    Non-steroid anti-inflammatory drugs (NSAIDs) have been frequently detected in aquatic ecosystem and posed a huge risk to non-target organisms. The aim of this study was to evaluate the toxic effects of three typical NSAIDs, diclofenac (DFC), acetaminophen (APAP) and ibuprofen (IBP), toward the water flea Daphnia magna. All three NSAIDs showed remarkable time-dependent and concentration-dependent effects on D. magna, with DFC the highest and APAP the lowest toxic. Survival, growth and reproduction data of D. magna from all bioassays were used to determine the LC10 and LC50 (10 % lethal and median lethal concentrations) values of NSAIDs, as well as the EC10 and EC50 (10 % effect and median effect concentrations) values. Concentrations for the lethal and sublethal toxicity endpoints were mainly in the low ppm-range, of which reproduction was the most sensitive one, indicating that non-target organisms might be adversely affected by relevant ambient low-level concentrations of NSAIDs after long-time exposures. PMID:27098253

  16. Identification of multiple steroid hydroxylases in Daphnia magna and their modulation by xenobiotics

    SciTech Connect

    Baldwin, W.S.; LeBlanc, G.A. . Dept. of Toxicology)

    1994-07-01

    Steroid hydroxylase activities were characterized in Daphnia magna and evaluated for potential use as biomarkers of xenobiotic exposure. Microsomes prepared from Daphnia magna generated as single NADPH-dependent metabolite of [[sup 14]C] testosterone. However, intact daphnids excreted at least 10 polar metabolites of [[sup 14]C] testosterone into the test medium. Six of these metabolites were identified as 2[alpha]-, 16[beta]-, 6[beta]-, 6[alpha]-, 7[alpha]-, and 15[alpha]-[[sup 14]C]hydroxytestosterone. The unidentified metabolites are also presumed to be hydroxylated products of testosterone, based on their relative migrations during TLC. The inefficient metabolism of [[sup 14]C] testosterone during the in vitro microsomal incubations may have been due to the release of P450 inhibitors during microsome preparation. Exposure of daphnids to the P450 modulators phenobarbital, [beta]-naphthoflavone, piperonyl butoxide, and malathion differentially inhibited the steroid hydroxylase activities. Results from this study indicate that Daphnia magna expresses several P450 enzymes and that these enzymes are differentially modulated by xenobiotic exposure. Steroid hydroxylase activities may serve not only as a biomarker of toxicant exposure, but also as a predictor of toxicant effects involving perturbations of steroid hormone homeostasis.

  17. Assessment of the effects of the carbamazepine on the endogenous endocrine system of Daphnia magna.

    PubMed

    Oropesa, A L; Floro, A M; Palma, P

    2016-09-01

    In the present study, the endocrine activity of the antiepileptic pharmaceutical carbamazepine (CBZ) in the crustacean Daphnia magna was assessed. To assess the hormonal activity of the drug, we exposed maternal daphnids and embryos to environmental relevant concentrations of CBZ (ranging from 10 to 200 μg/L) and to mixtures of CBZ with fenoxycarb (FEN; 1 μg/L). Chronic exposure to CBZ significantly decreased the reproductive output and the number of molts of D. magna at 200 μg/L. This compound induced the production of male offspring (12 ± 1.7 %), in a non-concentration-dependent manner, acting as a weak juvenile hormone analog. Results showed that this substance, at tested concentrations, did not antagonize the juvenoid action of FEN. Further, CBZ has shown to be toxic to daphnid embryos through maternal exposure interfering with their normal gastrulation and organogenesis stages but not producing direct embryo toxicity. These findings suggest that CBZ could act as an endocrine disruptor in D. magna as it decreases the reproductive output, interferes with sex determination, and causes development abnormality in offspring. Therefore, CBZ could directly affect the population sustainability. PMID:27225007

  18. The influence of benthic fish bioturbation on cadmium bioavailability to Daphnia magna

    SciTech Connect

    Wall, S.B.; Isely, J.J.; La Point, T.W.

    1994-12-31

    The authors are interested in how benthic fish bioturbation of contaminated sediments influences bioaccumulation into planktonic and, ultimately, nektonic organisms. They performed a series of exposures with cadmium-spiked sediment, 1 {mu}g/g nominal concentration, and koi carp Cyprinus carpio. Daphnia magna were placed in exposure aquaria with and without carp for six days and bioaccumulation after 48 h was measured. Preliminary results indicate that carp increased total suspended solids from 0.0 mg/L to 44.4 mg/L and mean total cadmium water concentrations, 1.4 {mu}g/L and 2.8 {mu}g/L, without and with fish, respectively. However, body burdens of Daphnia magna did not reflect the water concentration trend. Mean Cd residues of daphnids exposed without fish, 9.377 {mu}g/g, were not statistically different from those in the with-fish exposure, 8.348 {mu}g/g. Similarity in daphnid body burdens was probably due to cadmium binding with suspended sediment particles and dissolved organic carbon in the exposure chambers, therefore minimizing Cd bioavailability to D. magna. The present focus is on determining the bioavailable cadmium concentration.

  19. Miocene-Pliocene mantle depletion event in the northern Fossa Magna, western NE Japan

    NASA Astrophysics Data System (ADS)

    Okamura, Satoshi; Inaba, Mitsuru; Adachi, Yoshiko; Shinjo, Ryuichi

    2016-07-01

    New isotopic and trace element data presented here imply a temporal change in magma sources and thermal conditions beneath the northern Fossa Magna of NE Japan from the Miocene to the Pliocene. Less radiogenic 176Hf/177Hf and 143Nd/144Nd, high Zr/Hf, and little or no Hf anomaly characterize the Early Miocene volcanism in the northern Fossa Magna region. The mantle wedge consisted of chemically heterogeneous mantle source. Based on out isotope proxies, we propose that during the onset of subduction, influx of hot asthenospheric mantle provided sufficient heat to partially melt newly subducting sediment. Geochemical modeling demonstrates that slab-derived melt mixed with mantle wedge produces the observed isotopic and trace elemental characteristics. In the Middle Miocene, the injection of hot and depleted asthenospheric material replaced the mantle beneath the northern Fossa Magna region of NE Japan. This caused the isotopic signature of the rocks to change from enriched to depleted. Then, the mantle wedge was gradually cooled during the Middle Miocene to the Pliocene with back-arc opening ending in the Late Miocene. Slab surface temperatures were still high enough for sediments to melt but not too high (<∼780 °C) to lose zircon as a residual phase. The Late Miocene and Pliocene volcanism at the post stage of the back-arc opening is best explained by a partial melting of subducted metasediment saturated with trace quantities of zircon and rutile.

  20. The use of cohorts and populations in chronic toxicity studies with Daphnia magna: a cadmium example.

    PubMed

    van Leeuwen, C J; Luttmer, W J; Griffioen, P S

    1985-02-01

    Two semistatic life table experiments with Daphnia magna were carried out on reconstituted and Lake IJssel water. The "nontoxic concentrations" for cadmium with respect to the intrinsic rate of natural increase, derived from age-specific survival and fecundity were 1 and 3.2 micrograms/liter, respectively. Body length appeared to be a sensitive parameter. A third intermittent-flow experiment was started with small, exponentially growing populations. These populations had a stable age distribution, were composed of cohorts of different ages and showed an almost perfect logistic growth. Cadmium was shown to reduce the upper numerical limit (carrying capacity) for D. magna and was inversely related to this parameter: log Y = 2.85 -0.20 log [Cd]; r = -0.99. A "nontoxic concentration" could not be established. Based on the "background" concentration of cadmium, a freshwater quality criterion of 0.1 microgram/liter is proposed. The results are used to discuss several shortcomings of the current methods. Finally it is stated that the introduction of the concepts of population dynamics in reproduction tests with D. magna is a realistic step towards ecotoxicology. PMID:3987588

  1. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    SciTech Connect

    Redman, R.S.; Rodriguez, R.J. Univ. of Washington, Seattle, WA . Dept. of Botany); Clifton, D.R.; Morrel, J.; Brown, G. ); Freeman, S. . Dept. of Plant Pathology)

    1999-02-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) plant-defense response were investigated in anthracnose-resistant and-susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1-colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  2. Inactivation mechanism of chlorination in Escherichia coli internalized in Limnoithona sinensis and Daphnia magna.

    PubMed

    Lin, Tao; Chen, Wei; Cai, Bo

    2016-02-01

    Zooplankton may harbor microorganisms in the aquatic environment, thus protecting them from disinfection during drinking water treatment. However, few studies have evaluated the protective effect of internalization by zooplankton against bacterial disinfection. In this study, we investigated the role of zooplankton (Limnoithona sinensis and Daphnia magna) as a refuge for ingested bacteria against inactivation by chlorination. Only 30% of chlorine reached the internalized bacteria inside the digestive tract of zooplankton. However, this was sufficient to achieve 1.4 log inactivation of internalized Escherichia coli in L. sinensis and 1.2 log inactivation in D. magna at Ct values of 80 mg min/L. Inactivation of internalized bacteria was achieved through the active transfer of free chlorine in the bulk water into the zooplankton digestive tract during grazing activity. D. magna was more sensitive to hypochlorous acid than L. sinensis, and its grazing behavior was inhibited during the inactivation experiment. PMID:26624518

  3. Biochemical Analysis of Plant Protection Afforded by a Nonpathogenic Endophytic Mutant of Colletotrichum magna1

    PubMed Central

    Redman, Regina S.; Freeman, Stanley; Clifton, David R.; Morrel, Jed; Brown, Gayle; Rodriguez, Rusty J.

    1999-01-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) “plant-defense” response were investigated in anthracnose-resistant and -susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1-colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection. PMID:9952476

  4. Effects of the artificial sweetener sucralose on Daphnia magna and Americamysis bahia survival, growth and reproduction.

    PubMed

    Huggett, D B; Stoddard, K I

    2011-10-01

    The artificial sweetener sucralose has been detected in municipal wastewater effluent and surface waters at concentrations ranging from ng/L to low μg/L. Few chronic ecotoxicological data are available in the peer reviewed literature with respect to sucralose. To address this data gap, 21 d Daphnia magna and 28 d Americamysis bahia (mysid shrimp) studies were conducted to assess the effects of sucralose on the survival, growth and reproduction of these organisms. Concentrations ⩽1800mg/L resulted in no statistically significant reduction in D. magna survival or reproduction. Survival, growth and reproduction of mysid shrimp were unaffected by ⩽93mg/L sucralose. The no observable effect concentration (NOEC) and lowest observable effect concentration (LOEC) for the D. magna study were 1800 and >1800mg/L, respectively. The NOEC and LOEC for the mysid study were 93 and >93mg/L, respectively. Collectively, these data suggest that the concentrations of sucralose detected in the environment are well below those required to elicit chronic effects in freshwater or marine invertebrates. PMID:21742009

  5. Palindromic genes in the linear mitochondrial genome of the nonphotosynthetic green alga Polytomella magna.

    PubMed

    Smith, David Roy; Hua, Jimeng; Archibald, John M; Lee, Robert W

    2013-01-01

    Organelle DNA is no stranger to palindromic repeats. But never has a mitochondrial or plastid genome been described in which every coding region is part of a distinct palindromic unit. While sequencing the mitochondrial DNA of the nonphotosynthetic green alga Polytomella magna, we uncovered precisely this type of genic arrangement. The P. magna mitochondrial genome is linear and made up entirely of palindromes, each containing 1-7 unique coding regions. Consequently, every gene in the genome is duplicated and in an inverted orientation relative to its partner. And when these palindromic genes are folded into putative stem-loops, their predicted translational start sites are often positioned in the apex of the loop. Gel electrophoresis results support the linear, 28-kb monomeric conformation of the P. magna mitochondrial genome. Analyses of other Polytomella taxa suggest that palindromic mitochondrial genes were present in the ancestor of the Polytomella lineage and lost or retained to various degrees in extant species. The possible origins and consequences of this bizarre genomic architecture are discussed. PMID:23940100

  6. Life-Cycle Traits of Paraleucilla magna, a Calcareous Sponge Invasive in a Coastal Mediterranean Basin

    PubMed Central

    Longo, Caterina; Pontassuglia, Carmen; Corriero, Giuseppe; Gaino, Elda

    2012-01-01

    The calcareous sponge Paraleucilla magna, originally observed along the Brazilian coast (Atlantic Ocean), is the only allochthonous invasive species of Porifera reported in the Mediterranean Sea. A 1-year investigation of the population dynamics and life-cycle of this exotic species in the Mar Piccolo di Taranto (southern Italy, central Mediterranean Sea) has provided a good opportunity to test how environmental variations can influence its life-cycle and to ascertain what strategy can be adopted to successfully colonize a new environment. In the Mar Piccolo di Taranto, P. magna exhibits marked temporal changes in biomass. The studied specimens reproduce almost all year round, showing a seasonal pattern that peaks during warm months. This prolonged sexual activity allows P. magna to continuously produce young specimens, with repeated recruitment events taking place throughout the year, thus offsetting the seasonal mortality of adult specimens. This r-strategy enables the non-indigenous sponge to achieve a high degree of maintenance over relatively long periods (ten years at least). PMID:22905128

  7. Evaluation of a high-hardness COMBO medium and frozen algae for Daphnia magna.

    PubMed

    Baer, K N; Goulden, C E

    1998-03-01

    A new high-hardness (H-H) COMBO medium for long-term culturing and bioassay testing of Daphnia magna was evaluated in 21-day survival, growth, and reproduction studies. The COMBO medium originally designed for softwater daphnid species (i.e., D. pulicaria) was modified for the hardwater species D. magna. This medium also allowed continuous culturing of a green algal food source for daphnids, Ankistrodesmus falcatus. After 12 generations of culturing in H-H COMBO medium, the mean fecundity was 128 +/- 12 (coefficient of variation = 9.4%). No significant observations of dead young, aborted eggs, or reduced antennas were made during the 6 months of continuous culturing. The no-observable-effect concentration (NOEC) for a reference toxicant standard, 3,4-dichloroaniline (3,4-DCA), was 8.3 micrograms/liter, which is similar to published values. These studies demonstrate that H-H COMBO is an acceptable medium for use for culturing and bioassay testing with D. magna. Additional experiments using frozen aliquots of A. falcatus were conducted. Although mean fecundity (64 +/- 7) and adult length were significantly decreased from the values for daphnids fed fresh algae, the NOEC for 3,4-DCA was > 25 micrograms/liter. The use of this alternative food source in bioassay testing appears promising, but further optimization of feeding rates is warranted. PMID:9570911

  8. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    USGS Publications Warehouse

    Redman, R.S.; Freeman, S.; Clifton, D.R.; Morrel, J.; Brown, G.; Rodriguez, R.J.

    1999-01-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) 'plant-defense' response were investigated in anthracnose-resistant and -susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1 colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  9. Effects of six fasciolicides against Fascioloides magna In white-tailed deer.

    PubMed

    Foreyt, W J; Todd, A C

    1976-07-01

    Thirty-three white-tailed deer (Odocoileus virginianus) of various ages, both sexes, and in good physical condition were captured for anthelmintic evaluation of six compounds against the large American liver fluke, Fascioloides magna. Based on fluke mortality, hexachlorophene administered at the rate of 12 to 26 mg/kg of body weight was lethal to 5 of 10 mature flukes in seven deer. Nitroxynil at 11 to 24 mg/kg inhibited egg production, but did not kill mature flukes in eight deer. Rafoxanide at 12 to 25 mg/kg killed 6 of 8 (75%) immature flukes in eight deer, but was not effective against 17 mature flukes. Clioxanide at 16 to 38 mg/kg, diamphenethide at 255 to 280 mg/kg, and hexachloroethane at 463 to 629 mg/kg were not effective against F. magna in four, two and four deer, respectively. There was no indication that treatment with fasciolicides at the higher dose rates was more efficacious than at the lower dose rates. Detection of fluke eggs in the feces was a reliable method for diagnosing the presence of mature F. magna in deer prior to treatment, but was not reliable for measuring fasciolicidal activity of all compounds tested. PMID:16498878

  10. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.

    PubMed

    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely

    2014-08-01

    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna. PMID:24747829

  11. Hard X-ray nanoprobe investigations of the subtissue metal distributions within Daphnia magna.

    PubMed

    De Samber, B; De Schamphelaere, K A C; Janssen, C R; Vekemans, B; De Rycke, R; Martinez-Criado, G; Tucoulou, R; Cloetens, P; Vincze, L

    2013-07-01

    The unique potential of nanoscale elemental imaging of major/minor and trace-level elemental distributions within thin biological tissue sections of the ecotoxicological model organism Daphnia magna is demonstrated by synchrotron radiation nano-X-ray fluorescence (nano-XRF). The applied highly specialized sample preparation method, coupled with the high spatial resolution (∼180 nm) and high X-ray photon flux (6 × 10(11) photons/s) available at the European Synchrotron Radiation Facility (ESRF) ID22NI beamline proved to be critical for the high-quality visualization of (trace-)metal distributions on the submicron level within the target structures of interest. These include the branchial sacs on the thoracic appendages (epipodites) of D. magna, which are osmoregulatory regions where ion exchange occurs. For the main element of interest (Zn), detection limits of 0.7 ppm (3 ag) was reached in fast-scanning mode using an acquisition time of 0.3 s/pixel. As demonstrated, synchrotron radiation nano-XRF revealed the elemental distributions of Ca, Fe, and Zn within this osmoregulatory region on the submicron scale, aiding the exploration of possible detoxification mechanisms of Zn within D. magna at the subtissue level. PMID:23681201

  12. [HPLC fingerprint of liuwei dihuang soft capsule].

    PubMed

    Shi, Wei; Li, Jia-Chun; Yang, Su-De; Li, Yun; Jin, Rui-Ting; Sun, Xian-Ling; Wang, Zhen-Zhong; Bi, Yu-An; Xiao, Wei

    2014-12-01

    In order to establish HPLC fingerprint of Liuwei Dihuang soft capsule, and to provide certain reference for an quality control of it, the HPLC method was performed on an Agilent C18 (4.6 mm x 250 mm, 5 μm) column with acetonitrile-0.02% trifluoroacetic acid as mobile phase, gradient elution volume flow of 1.0 mL x min(-1), column temperature was 30 degrees C, detection wavelength: 0-60 min, 238 nm, 60-70 min, 210 nm. The software for chromatographic fingerprint was applied to analysis different batches of Liuwei Dihuang soft capsule samples. Sixteen mutual peaks were selected as the fingerprint peaks in 12 samples with loganin as the reference peak, and all of the detected peaks were separated effectively. Cluster analysis (HCA) and similarity analysis (SA) were done based on data of 12 samples clustering analysis of 12 batches of samples were divided into 2 categories. Including 7 for the first class, the rest was second, similarities calculated by SA were all above 0.92, indicating a good similarity between the reference and twelve batches of samples, also, the analysis results of HCA and SA basically the same. This method is simple with good precision, repeatability and stability, and provides the basis for Liuwei Dihuang soft capsule quality control. PMID:25911813

  13. Security analysis for fingerprint fuzzy vaults

    NASA Astrophysics Data System (ADS)

    Hartloff, Jesse; Bileschi, Maxwell; Tulyakov, Sergey; Dobler, Jimmy; Rudra, Atri; Govindaraju, Venu

    2013-05-01

    In this work we place some of the traditional biometrics work on fingerprint verification via the fuzzy vault scheme within a cryptographic framework. We show that the breaking of a fuzzy vault leads to decoding of Reed-Solomon codes from random errors, which has been proposed as a hard problem in the cryptography community. We provide a security parameter for the fuzzy vault in terms of the decoding problem, which gives context for the breaking of the fuzzy vault, whereas most of the existing literature measures the strength of the fuzzy vault in terms of its resistance to pre-defined attacks or by the entropy of the vault. We keep track of our security parameter, and provide it alongside ROC statistics. We also aim to be more aware of the nature of the fingerprints when placing them in the fuzzy vault, noting that the distribution of minutiae is far from uniformly random. The results we show provide additional support that the fuzzy vault can be a viable scheme for secure fingerprint verification.

  14. Laser speckle decorrelation for fingerprint acquisition

    NASA Astrophysics Data System (ADS)

    Schirripa Spagnolo, Giuseppe; Cozzella, Lorenzo

    2012-09-01

    Biometry is gaining popularity as a physical security approach in situations where a high level of security is necessary. Currently, biometric solutions are embedded in a very large and heterogeneous group of applications. One of the most sensible is for airport security access to boarding gates. More airports are introducing biometric solutions based on face, fingerprint or iris recognition for passenger identification. In particular, fingerprints are the most widely used biometric, and they are mandatorily included in electronic identification documents. One important issue, which is difficult to address in traditional fingerprint acquisition systems, is preventing contact between subsequent users; sebum, which can be a potential vector for contagious diseases. Currently, non-contact devices are used to overcome this problem. In this paper, a new contact device based on laser speckle decorrelation is presented. Our system has the advantage of being compact and low-cost compared with an actual contactless system, allowing enhancement of the sebum pattern imaging contrast in a simple and low-cost way. Furthermore, it avoids the spreading of contagious diseases.

  15. Rapidly Probing Antibacterial Activity of Graphene Oxide by Mass Spectrometry-based Metabolite Fingerprinting

    PubMed Central

    Zhang, Ning; Hou, Jian; Chen, Suming; Xiong, Caiqiao; Liu, Huihui; Jin, Yulong; Wang, Jianing; He, Qing; Zhao, Rui; Nie, Zongxiu

    2016-01-01

    Application of nanomaterials as anti-bacteria agents has aroused great attention. To investigate the antibacterial activity and antibacterial mechanism of nanomaterials from a molecular perspective is important for efficient developing of nanomaterial antibiotics. In the current work, a new mass spectrometry-based method was established to investigate the bacterial cytotoxicity of graphene oxide (GO) by the metabolite fingerprinting of microbes. The mass spectra of extracted metabolites from two strains DH5α and ATCC25922 were obtained before and after the incubation with nanomaterials respectively. Then principal component analysis (PCA) of these spectra was performed to reveal the relationship between the metabolism disorder of microbes and bactericidal activity of GO. A parameter “D” obtained from PCA scores was proposed that is capable to quantitatively evaluate the antibacterial activity of GO in concentration and time-dependent experiments. Further annotation of the fingerprinting spectra shows the variabilities of important metabolites such as phosphatidylethanolamine, phosphatidylglycerol and glutathione. This metabolic perturbation of E. coli indicates cell membrane destruction and oxidative stress mechanisms for anti-bacteria activity of graphene oxide. It is anticipated that this mass spectrometry-based metabolite fingerprinting method will be applicable to other antibacterial nanomaterials and provide more clues as to their antibacterial mechanism at molecular level. PMID:27306507

  16. Rapidly Probing Antibacterial Activity of Graphene Oxide by Mass Spectrometry-based Metabolite Fingerprinting.

    PubMed

    Zhang, Ning; Hou, Jian; Chen, Suming; Xiong, Caiqiao; Liu, Huihui; Jin, Yulong; Wang, Jianing; He, Qing; Zhao, Rui; Nie, Zongxiu

    2016-01-01

    Application of nanomaterials as anti-bacteria agents has aroused great attention. To investigate the antibacterial activity and antibacterial mechanism of nanomaterials from a molecular perspective is important for efficient developing of nanomaterial antibiotics. In the current work, a new mass spectrometry-based method was established to investigate the bacterial cytotoxicity of graphene oxide (GO) by the metabolite fingerprinting of microbes. The mass spectra of extracted metabolites from two strains DH5α and ATCC25922 were obtained before and after the incubation with nanomaterials respectively. Then principal component analysis (PCA) of these spectra was performed to reveal the relationship between the metabolism disorder of microbes and bactericidal activity of GO. A parameter "D" obtained from PCA scores was proposed that is capable to quantitatively evaluate the antibacterial activity of GO in concentration and time-dependent experiments. Further annotation of the fingerprinting spectra shows the variabilities of important metabolites such as phosphatidylethanolamine, phosphatidylglycerol and glutathione. This metabolic perturbation of E. coli indicates cell membrane destruction and oxidative stress mechanisms for anti-bacteria activity of graphene oxide. It is anticipated that this mass spectrometry-based metabolite fingerprinting method will be applicable to other antibacterial nanomaterials and provide more clues as to their antibacterial mechanism at molecular level. PMID:27306507

  17. A network identity authentication system based on Fingerprint identification technology

    NASA Astrophysics Data System (ADS)

    Xia, Hong-Bin; Xu, Wen-Bo; Liu, Yuan

    2005-10-01

    Fingerprint verification is one of the most reliable personal identification methods. However, most of the automatic fingerprint identification system (AFIS) is not run via Internet/Intranet environment to meet today's increasing Electric commerce requirements. This paper describes the design and implementation of the archetype system of identity authentication based on fingerprint biometrics technology, and the system can run via Internet environment. And in our system the COM and ASP technology are used to integrate Fingerprint technology with Web database technology, The Fingerprint image preprocessing algorithms are programmed into COM, which deployed on the internet information server. The system's design and structure are proposed, and the key points are discussed. The prototype system of identity authentication based on Fingerprint have been successfully tested and evaluated on our university's distant education applications in an internet environment.

  18. A fluorescence-based hydrolytic enzyme activity assay for quantifying toxic effects of Roundup® to Daphnia magna.

    PubMed

    Ørsted, Michael; Roslev, Peter

    2015-08-01

    Daphnia magna is a widely used model organism for aquatic toxicity testing. In the present study, the authors investigated the hydrolytic enzyme activity of D. magna after exposure to toxicant stress. In vivo enzyme activity was quantified using 15 fluorogenic enzyme probes based on 4-methylumbelliferyl or 7-amino-4-methylcoumarin. Probing D. magna enzyme activity was evaluated using short-term exposure (24-48 h) to the reference chemical K2 Cr2 O7 or the herbicide formulation Roundup®. Toxicant-induced changes in hydrolytic enzyme activity were compared with changes in mobility (International Organization for Standardization standard 6341). The results showed that hydrolytic enzyme activity was quantifiable as a combination of whole body fluorescence of D. magna and the fluorescence of the surrounding water. Exposure of D. magna to lethal and sublethal concentrations of Roundup resulted in loss of whole body enzyme activity and release of cell constituents, including enzymes and DNA. Roundup caused comparable inhibition of mobility and alkaline phosphatase activity with median effective concentration values at 20 °C of 8.7 mg active ingredient (a.i.)/L to 11.7 mg a.i./L. Inhibition of alkaline phosphatase activity by Roundup was lowest at 14 °C and greater at 20 °C and 26 °C. The results suggest that the fluorescence-based hydrolytic enzyme activity assay (FLEA assay) can be used as an index of D. magna stress. Combining enzyme activity with fluorescence measurements may be applied as a simple and quantitative supplement for toxicity testing with D. magna. PMID:25809520

  19. 8-Bit Gray Scale Images of Fingerprint Image Groups

    National Institute of Standards and Technology Data Gateway

    NIST 8-Bit Gray Scale Images of Fingerprint Image Groups (PC database for purchase)   The NIST database of fingerprint images contains 2000 8-bit gray scale fingerprint image pairs. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  20. Molecular Fingerprints Identify Historic Pear Trees in US National Parks

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The U.S. Department of Interior, National Park Service (NPS) has developed conservation plans for historic orchards within National Park boundaries. Variety identification of significant fruit trees is an important part of these plans. The U.S. Department of Agriculture, Agricultural Research Servic...

  1. Fingerprinting and Genetic Stability of Rubus Using Molecular Markers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    DNA markers were used to identify raspberries and blackberries and to evaluate genetic stability of four cryopreserved Rubus accessions following 12 years of storage in liquid nitrogen. In the first study, 12 genomic Simple Sequence Repeat (SSR) markers and one Expressed Sequence Tag- (EST)-SSR wer...

  2. Trophic transfer of differently functionalized zinc oxide nanoparticles from crustaceans (Daphnia magna) to zebrafish (Danio rerio).

    PubMed

    Skjolding, L M; Winther-Nielsen, M; Baun, A

    2014-12-01

    The potential uptake and trophic transfer of nanoparticles (NP) is not well understood so far and for ZnO NP the data presented in peer-reviewed literature is limited. In this paper the influence of surface functionalization on the uptake and depuration behavior of ZnO NP, ZnO-OH NP and ZnO-octyl NP in D. magna was studied. Bulk ZnO particles (≤5 μm) and ZnCl2 were used as references for uptake of particles and dissolved species of Zn, respectively. Furthermore, the trophic transfer of ZnO NP and ZnO-octyl NP from daphnids (Daphnia magna) to zebra fish (Danio rerio) was studied. For ZnO NP and ZnO-octyl NP fast uptakes in D. magna were observed, whereas no measurable uptake took place for ZnO-OH NP. Lower body burden of ZnCl2 was found compared to both ZnO NP and ZnO-octyl. Contrary, the body burden for bulk ZnO was higher than that of ZnO NP but lower than ZnO-octyl. The higher body burdens found for functionalized ZnO-octyl NP than for non-functionalized ZnO NP showed that that the functionalization of the NP has a high influence on the uptake and depuration behavior. Though no mortality was observed, the resulting body burdens were 9.6 times (ZnO NP) and 47 times (ZnO-octyl NP) higher than toxic levels reported for zinc in D. magna. Consequently, the zinc recovered in the animals was not solely due to soluble zinc, but agglomerates/aggregates of ZnO NP or ZnO-octyl NP contributed to the body burdens. The trophic transfer study showed uptake of both ZnO NP and ZnO-octyl NP reaching more than tenfold higher levels than those obtained through aqueous exposure in other studies. This study contributes to expand the available data on uptake behavior of differently functionalized ZnO NP in D. magna and the potential trophic transfer from zooplankton to fish. PMID:25456224

  3. Development of latent fingerprints using preferential DC sputter deposition.

    PubMed

    Kent, K; Stoilovic, M

    1995-03-21

    It was shown that a DC metal sputtering process with thermalised atoms, preferentially deposits metal onto fingerprint ridges. This method can be successfully used for the development of latent fingerprints. Four target metals were tested--copper, zinc, platinum, and gold--with platinum showing superior results for latent fingerprint development on clear polythene substrates. A comparison of platinum sputtering and cyanoacrylate fuming followed by rhodamine-6G staining, was conducted for 1-year-old fingerprint deposits. Platinum sputtering showed significantly higher sensitivity, and produced better overall results. PMID:7705733

  4. Plain and Rolled Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Plain and Rolled Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 29 is being distributed for use in development and testing fingerprint matching systems. The data consist of 216 ten-print fingerprint card pairs with both the rolled and plains (from a bottom of the fingerprint card) scanned at 19.7 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  5. Columnar-thin-film acquisition of fingerprint topology

    NASA Astrophysics Data System (ADS)

    Shaler, Robert C.; Lakhtakia, Akhlesh; Rogers, Jessica W.; Pulsifer, Drew P.; Martín-Palma, Raúl J.

    2011-01-01

    Fingerprint visualization obtained from physical evidence taken from crime scenes for subsequent comparison typically requires the use of physical and chemical techniques. One physical technique to visualize or develop sebaceous fingerprints on various surfaces employs the deposition of metals such as gold and zinc thereon. We have developed a different vacuum technology: the conformal-evaporated-film-by-rotation technique to deposit dense columnar thin films (CTFs) on latent fingerprints on different types of surfaces. Sample fingerprints, acting as nonplanar substrates, deposited on different surfaces were placed in a vacuum chamber with the fingerprint side facing a boat containing an evaporant material such as chalcogenide glass. Thermal evaporation of the solid material led to the formation of a dense CTF on the fingerprint, thereby capturing the topographical texture with high resolution. Our results show that it is possible to acquire the topology of latent fingerprints on nonporous surfaces. Additionally, deposition of CTFs on overlapping fingerprints suggested ours may be a technique for elucidating the sequence of deposition of the fingerprints at the scene.

  6. Mated Fingerprint Card Pairs (Volumes 1-5)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs (Volumes 1-5) (PC database for purchase)   The NIST database of mated fingerprint card pairs (Special Database 9) consists of multiple volumes. Currently five volumes have been released. Each volume will be a 3-disk set with each CD-ROM containing 90 mated card pairs of segmented 8-bit gray scale fingerprint images (900 fingerprint image pairs per CD-ROM). A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  7. Supplemental Fingerprint Card Data (SFCD) for NIST Special Database 9

    National Institute of Standards and Technology Data Gateway

    Supplemental Fingerprint Card Data (SFCD) for NIST Special Database 9 (PC database for purchase)   NIST Special Database 10 (Supplemental Fingerprint Card Data for Special Database 9 - 8-Bit Gray Scale Images) provides a larger sample of fingerprint patterns that have a low natural frequency of occurrence and transitional fingerprint classes in NIST Special Database 9. The software is the same code used with NIST Special Database 4 and 9. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  8. Comparative study of minutiae selection algorithms for ISO fingerprint templates

    NASA Astrophysics Data System (ADS)

    Vibert, B.; Charrier, C.; Le Bars, J.-M.; Rosenberger, C.

    2015-03-01

    We address the selection of fingerprint minutiae given a fingerprint ISO template. Minutiae selection plays a very important role when a secure element (i.e. a smart-card) is used. Because of the limited capability of computation and memory, the number of minutiae of a stored reference in the secure element is limited. We propose in this paper a comparative study of 6 minutiae selection methods including 2 methods from the literature and 1 like reference (No Selection). Experimental results on 3 fingerprint databases from the Fingerprint Verification Competition show their relative efficiency in terms of performance and computation time.

  9. Capacity and optimal collusion attack channels for Gaussian fingerprinting games

    NASA Astrophysics Data System (ADS)

    Wang, Ying; Moulin, Pierre

    2007-02-01

    In content fingerprinting, the same media covertext - image, video, audio, or text - is distributed to many users. A fingerprint, a mark unique to each user, is embedded into each copy of the distributed covertext. In a collusion attack, two or more users may combine their copies in an attempt to "remove" their fingerprints and forge a pirated copy. To trace the forgery back to members of the coalition, we need fingerprinting codes that can reliably identify the fingerprints of those members. Researchers have been focusing on designing or testing fingerprints for Gaussian host signals and the mean square error (MSE) distortion under some classes of collusion attacks, in terms of the detector's error probability in detecting collusion members. For example, under the assumptions of Gaussian fingerprints and Gaussian attacks (the fingerprinted signals are averaged and then the result is passed through a Gaussian test channel), Moulin and Briassouli1 derived optimal strategies in a game-theoretic framework that uses the detector's error probability as the performance measure for a binary decision problem (whether a user participates in the collusion attack or not); Stone2 and Zhao et al. 3 studied average and other non-linear collusion attacks for Gaussian-like fingerprints; Wang et al. 4 stated that the average collusion attack is the most efficient one for orthogonal fingerprints; Kiyavash and Moulin 5 derived a mathematical proof of the optimality of the average collusion attack under some assumptions. In this paper, we also consider Gaussian cover signals, the MSE distortion, and memoryless collusion attacks. We do not make any assumption about the fingerprinting codes used other than an embedding distortion constraint. Also, our only assumptions about the attack channel are an expected distortion constraint, a memoryless constraint, and a fairness constraint. That is, the colluders are allowed to use any arbitrary nonlinear strategy subject to the above

  10. Bioaccumulation and biomarker responses of cubic and octahedral Cu2O micro/nanocrystals in Daphnia magna.

    PubMed

    Fan, Wenhong; Shi, Zhiwei; Yang, Xiuping; Cui, Minming; Wang, Xiaolong; Zhang, Dongfeng; Liu, Hong; Guo, Lin

    2012-11-15

    Great progress has been made in the controlled fabrication of nanomaterials with given sizes, shapes, and geometries. However, how such changes in structure potentially affect the bioavailability and toxicity of metal nanoparticles to aquatic organisms remains mostly unknown. The present study reports the different behaviors of two types of Cu(2)O micro/nanocrystals (micro/nano-Cu(2)O) with different shapes (cubic and octahedral) and crystallographies (with exposed surfaces as {100} or {111}). The bioaccumulation, median lethal concentration, and biomarker responses of Daphnia magna exposed to the two micro/nanocrystals are also investigated. The Cu accumulation, production of metallothionein (MT), and inhibition ratio of D. magna increased gradually with increasing micro/nano-Cu(2)O concentration. The two crystals showed slight Cu accumulation differences toward D. magna, and their biomarker responses and toxicities to D. magna differed significantly as well. The octahedral Cu(2)O micro/nanocrystals were more toxic to D. magna compared with the cubic micro/nanocrystals probably because of the higher surface activities of the {111} facets compared with those of the {100} facets for cuprites. Food ingestion was the main entry pathway of the micro/nanocrystals into organisms, and toxicity was consequently determined based on the dissolution behavior of the micro/nanocrystals in vivo. PMID:22999974

  11. β-N-methylamino-L-alanine (BMAA) uptake by the animal model, Daphnia magna and subsequent oxidative stress.

    PubMed

    Esterhuizen-Londt, Maranda; Wiegand, Claudia; Downing, Tim G

    2015-06-15

    β-N-methylamino-l-alanine (BMAA), produced by cyanobacteria, is a neurotoxin implicated in Amyotrophic lateral sclerosis/Parkinsonism dementia complex (ALS/PDC). BMAA concentrations in cyanobacteria are lower than those thought to be necessary to result in neurological damage thus bioaccumulation or biomagnification is required to achieve concentrations able to cause neurodegeneration. Many cyanobacteria produce BMAA and uptake routes into the food web require examination. In this study we investigate the uptake of BMAA by adult phytoplanktivorus Daphnia magna via exposure to dissolved pure BMAA and BMAA containing cyanobacteria, as well as the subsequent oxidative stress response in the daphnia. Free BMAA and protein-associated BMAA were quantified by LC-MS/MS. Dissolved BMAA was taken up and was found as free BMAA in D. magna. No protein-associated BMAA was detected in D. magna after a 24-h exposure period. No BMAA was detectable in D. magna after exposure to BMAA containing cyanobacteria. BMAA inhibited the oxidative stress defence and biotransformation enzymes within 24-h exposure in the tested Daphnia and could therefore impair the oxidant status and the capability of detoxifying other substances in D. magna. PMID:25841344

  12. The response of European Daphnia magna Straus and Australian Daphnia carinata King to changes in geomagnetic field.

    PubMed

    Krylov, Viacheslav V; Bolotovskaya, Irina V; Osipova, Elena A

    2013-03-01

    This study investigates the effects of lifelong exposure to reversed geomagnetic and zero geomagnetic fields (the latter means absence of geomagnetic field) on the life history of Daphnia carinata King from Australia and Daphnia magna Straus from Europe. Considerable deviation in the geomagnetic field from the usual strength, leads to a decrease in daphnia size and life span. Reduced brood sizes and increased body length of neonates are observed in D. magna exposed to unusual magnetic background. The most apparent effects are induced by zero geomagnetic field in both species of Daphnia. A delay in the first reproduction in zero geomagnetic field is observed only in D. magna. No adaptive maternal effects to reversed geomagnetic field are found in a line of D. magna maintained in these magnetic conditions for eight generations. Integrally, the responses of D. magna to unusual geomagnetic conditions are more extensive than that in D. carinata. We suggest that the mechanism of the effects of geomagnetic field reversal on Daphnia may be related to differences in the pattern of distribution of the particles that have a magnetic moment, or to moving charged organic molecules owing to a change in combined outcome and orientation of the geomagnetic field and Earth's gravitational field. The possibility of modulation of self-oscillating processes with changes in geomagnetic field is also discussed. PMID:23320498

  13. A New Approach for Fingerprint Image Compression

    SciTech Connect

    Mazieres, Bertrand

    1997-12-01

    The FBI has been collecting fingerprint cards since 1924 and now has over 200 million of them. Digitized with 8 bits of grayscale resolution at 500 dots per inch, it means 2000 terabytes of information. Also, without any compression, transmitting a 10 Mb card over a 9600 baud connection will need 3 hours. Hence we need a compression and a compression as close to lossless as possible: all fingerprint details must be kept. A lossless compression usually do not give a better compression ratio than 2:1, which is not sufficient. Compressing these images with the JPEG standard leads to artefacts which appear even at low compression rates. Therefore the FBI has chosen in 1993 a scheme of compression based on a wavelet transform, followed by a scalar quantization and an entropy coding : the so-called WSQ. This scheme allows to achieve compression ratios of 20:1 without any perceptible loss of quality. The publication of the FBI specifies a decoder, which means that many parameters can be changed in the encoding process: the type of analysis/reconstruction filters, the way the bit allocation is made, the number of Huffman tables used for the entropy coding. The first encoder used 9/7 filters for the wavelet transform and did the bit allocation using a high-rate bit assumption. Since the transform is made into 64 subbands, quite a lot of bands receive only a few bits even at an archival quality compression rate of 0.75 bit/pixel. Thus, after a brief overview of the standard, we will discuss a new approach for the bit-allocation that seems to make more sense where theory is concerned. Then we will talk about some implementation aspects, particularly for the new entropy coder and the features that allow other applications than fingerprint image compression. Finally, we will compare the performances of the new encoder to those of the first encoder.

  14. Raman Fingerprints of Atomically Precise Graphene Nanoribbons

    PubMed Central

    2016-01-01

    Bottom-up approaches allow the production of ultranarrow and atomically precise graphene nanoribbons (GNRs) with electronic and optical properties controlled by the specific atomic structure. Combining Raman spectroscopy and ab initio simulations, we show that GNR width, edge geometry, and functional groups all influence their Raman spectra. The low-energy spectral region below 1000 cm–1 is particularly sensitive to edge morphology and functionalization, while the D peak dispersion can be used to uniquely fingerprint the presence of GNRs and differentiates them from other sp2 carbon nanostructures. PMID:26907096

  15. Raman Fingerprints of Atomically Precise Graphene Nanoribbons.

    PubMed

    Verzhbitskiy, Ivan A; Corato, Marzio De; Ruini, Alice; Molinari, Elisa; Narita, Akimitsu; Hu, Yunbin; Schwab, Matthias G; Bruna, Matteo; Yoon, Duhee; Milana, Silvia; Feng, Xinliang; Müllen, Klaus; Ferrari, Andrea C; Casiraghi, Cinzia; Prezzi, Deborah

    2016-06-01

    Bottom-up approaches allow the production of ultranarrow and atomically precise graphene nanoribbons (GNRs) with electronic and optical properties controlled by the specific atomic structure. Combining Raman spectroscopy and ab initio simulations, we show that GNR width, edge geometry, and functional groups all influence their Raman spectra. The low-energy spectral region below 1000 cm(-1) is particularly sensitive to edge morphology and functionalization, while the D peak dispersion can be used to uniquely fingerprint the presence of GNRs and differentiates them from other sp(2) carbon nanostructures. PMID:26907096

  16. Fingerprints of topological defects in a metasurface.

    PubMed

    Kang, Ming; Li, Yongnan; Wang, Hui-Tian

    2014-08-15

    Singularity, representing a structurally stable topological defect (TD), plays a pivotal role in various physical systems. Here we theoretically present the fingerprints of TDs and uncover the resulting exotic optical properties in a tailored metasurface system. The presence of the TDs results in coherent perfect absorption, and dramatic optical property transition from slow to superluminal light behavior when the parameters cross the TD. Our investigation provides a new route to explore many phenomena of the TDs, extends the capabilities of metasurface, and offers benefits to develop potential nanophotonic applications based on the design of the metasurface. PMID:25121898

  17. Raman Fingerprints of Atomically Precise Graphene Nanoribbons

    NASA Astrophysics Data System (ADS)

    Verzhbitskiy, Ivan A.; Corato, Marzio De; Ruini, Alice; Molinari, Elisa; Narita, Akimitsu; Hu, Yunbin; Schwab, Matthias G.; Bruna, Matteo; Yoon, Duhee; Milana, Silvia; Feng, Xinliang; Müllen, Klaus; Ferrari, Andrea C.; Casiraghi, Cinzia; Prezzi, Deborah

    2016-06-01

    Bottom-up approaches allow the production of ultra-narrow and atomically precise graphene nanoribbons (GNRs), with electronic and optical properties controlled by the specific atomic structure. Combining Raman spectroscopy and ab-initio simulations, we show that GNR width, edge geometry and functional groups all influence their Raman spectra. The low-energy spectral region below 1000 cm-1 is particularly sensitive to edge morphology and functionalization, while the D peak dispersion can be used to uniquely fingerprint the presence of GNRs, and differentiates them from other sp2 carbon nanostructures.

  18. Method for characterization of adhesion properties of trace explosives in fingerprints and fingerprint simulations.

    PubMed

    Phares, D J; Holt, J K; Smedley, G T; Flagan, R C

    2000-07-01

    The near inevitable transfer of explosive particulate matter through fingerprints makes it possible to detect concealed explosives through surface sampling. Repeatable and well-characterized fingerprint simulation facilitates quantitative comparison between particulate sampling methods for subsequent detection of trace explosive residues. This study employs a simple, but reproducible sampling system to determine the accuracy of a fingerprint simulation. The sampling system uses a gas jet to entrain particles from a substrate and the resulting airborne particles are then aspirated onto a Teflon filter. A calibrated Barringer IonScan 400 ion mobility spectrometer was used to determine the mass of explosive material collected on the filter. The IonScan 400 was calibrated with known masses of 2,4,6-trinitrotoluene (TNT). The resulting calibration curve is in good agreement with that obtained by Garofolo et al. (1994) for an earlier model of the instrument. The collection efficiency of the sampling system was measured for three particle sizes (8.0. 10.0, and 13.0 microm) using spherical polystyrene particles laced with known quantities of TNT. Collection efficiency ranged from less than 1% for the larger particles to 5% for the smaller particles. Particle entrainment from the surface was monitored with dark field imaging of the remaining particles. The sampling system was then applied to two C4 test samples--a fingerprint transfer and a dry Teflon transfer. Over 100 ng of RDX was collected from the dry transfer sample, while less than 1 ng was collected from the fingerprint transfer. Possible explanations for this large difference are presented based on the system calibration. PMID:10914570

  19. Study of noninvasive detection of latent fingerprints using UV laser

    NASA Astrophysics Data System (ADS)

    Li, Hong-xia; Cao, Jing; Niu, Jie-qing; Huang, Yun-gang; Mao, Lin-jie; Chen, Jing-rong

    2011-06-01

    Latent fingerprints present a considerable challenge in forensics, and noninvasive procedure that captures a digital image of the latent fingerprints is significant in the field of criminal investigation. The capability of photography technologies using 266nm UV Nd:YAG solid state laser as excitation light source to provide detailed images of unprocessed latent fingerprints is demonstrated. Unprocessed latent fingerprints were developed on various non-absorbent and absorbing substrates. According to the special absorption, reflection, scattering and fluorescence characterization of the various residues in fingerprints (fatty acid ester, protein, and carbosylic acid salts etc) to the UV light to weaken or eliminate the background disturbance and increase the brightness contrast of fingerprints with the background, and using 266nm UV laser as excitation light source, fresh and old latent fingerprints on the surface of four types of non-absorbent objects as magazine cover, glass, back of cellphone, wood desktop paintwork and two types of absorbing objects as manila envelope, notebook paper were noninvasive detected and appeared through reflection photography and fluorescence photography technologies, and the results meet the fingerprint identification requirements in forensic science.

  20. A Practical Workshop for Generating Simple DNA Fingerprints of Plants

    ERIC Educational Resources Information Center

    Rouziere, A.-S.; Redman, J. E.

    2011-01-01

    Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of…

  1. Transplanted fingerprints: a preliminary case report 40 months posttransplant.

    PubMed

    Szajerka, T; Jurek, B; Jablecki, J

    2010-11-01

    For the past century, fingerprints have been considered permanent and specific for each individual. However, with the advances in transplantology, fingerprints have lost their permanence. Because no study has yet been described, we examined possible changes in the fingerprint pattern of a transplanted hand. In 2006, we performed a hand transplantation on a 32-year-old man. The donor was revealed to have had a criminal record; his fingerprints were stored in the Polish automated fingerprint identification system. A forensic technician fingerprinted the transplanted hand nine times between June 2006 and September 2009. The appearance of minutiae and white lines and the change in the distance between papillary ridges were assessed in the thumbprints of the transplanted hand. The appearance of white lines was only temporary; at no point did they impair fingerprint identification. No significant changes occurred in the distance between the friction ridges. The observed small differences were ascribed to the two techniques used to collect the prints (spoon vs rolling). The number of minutiae ranged from 1 to 3, reaching a maximum in the third posttransplant month. A 40-month observation showed no significant changes in the fingerprints of the transplanted hand. Nevertheless, a long-term study is needed because of the risk of chronic rejection. The noninvasiveness of dactylography argues for inspecting its application to diagnose acute rejection. Finally, lawmakers should be made aware of the personal-protection issues related to the growing number of hand-transplant recipients. PMID:21094851

  2. Development of a multiplexed fingerprinting set in blackberry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A reliable and fast method for confirming identity and paternity in blackberry is needed. Microsatellite markers or simple sequence repeats (SSRs) are ideal for cultivar fingerprinting, paternity testing and identity certification. The objective of this study was to develop a multiplexed fingerprint...

  3. Jan Evangelista Purkynje (1787-1869): first to describe fingerprints.

    PubMed

    Grzybowski, Andrzej; Pietrzak, Krzysztof

    2015-01-01

    Fingerprints have been used for years as the accepted tool in criminology and for identification. The first system of classification of fingerprints was introduced by Jan Evangelista Purkynje (1787-1869), a Czech physiologist, in 1823. He divided the papillary lines into nine types, based on their geometric arrangement. This work, however, was not recognized internationally for many years. In 1858, Sir William Herschel (1833-1917) registered fingerprints for those signing documents at the Indian magistrate's office in Jungipoor. Henry Faulds (1843-1930) in 1880 proposed using ink for fingerprint determination and people identification, and Francis Galton (1822-1911) collected 8000 fingerprints and developed their classification based on the spirals, loops, and arches. In 1892, Juan Vucetich (1858-1925) created his own fingerprint identification system and proved that a woman was responsible for killing two of her sons. In 1896, a London police officer Edward Henry (1850-1931) expanded on earlier systems of classification and used papillary lines to identify criminals; it was his system that was adopted by the forensic world. The work of Jan Evangelista Purkynje (1787-1869) (Figure 1), who in 1823 was the first to describe in detail fingerprints, is almost forgotten. He also established their classification. The year 2013 marked the 190th anniversary of the publication of his work on this topic. Our contribution is an attempt to introduce the reader to this scientist and his discoveries in the field of fingerprint identification. PMID:25530005

  4. DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

    ERIC Educational Resources Information Center

    Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

    2008-01-01

    This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

  5. Method and apparatus for imaging and documenting fingerprints

    DOEpatents

    Fernandez, Salvador M.

    2002-01-01

    The invention relates to a method and apparatus for imaging and documenting fingerprints. A fluorescent dye brought in intimate proximity with the lipid residues of a latent fingerprint is caused to fluoresce on exposure to light energy. The resulting fluorescing image may be recorded photographically.

  6. Teaching DNA Fingerprinting using a Hands-on Simulation.

    ERIC Educational Resources Information Center

    Schug, Thatcher

    1998-01-01

    Presents an inexpensive hands-on lesson in DNA fingerprinting that can be completed in a single class period. Involves students in solving a murder in which a drop of blood is fingerprinted and matched with the blood of the murderer. (DDR)

  7. Utilizing AFIS searching tools to reduce errors in fingerprint casework.

    PubMed

    Langenburg, Glenn; Hall, Carey; Rosemarie, Quincy

    2015-12-01

    Fifty-six (56) adjudicated, property crime cases involving fingerprint evidence were reviewed using a case-specific AFIS database tool. This tool allowed fingerprint experts to search latent prints in the cases against a database of friction ridge exemplars limited to only the individuals specific to that particular case. We utilized three different methods to encode and search the latent prints: automatic feature extraction, manual encoding performed by a student intern, and manual encoding performed by a fingerprint expert. Performance in the study was strongest when the encoding was conducted by the fingerprint expert. The results of the study showed that while the AFIS tools failed to locate all of the identifications originally reported by the initial fingerprint expert that worked the case, the AFIS tools helped to identify 7 additional latent prints that were not reported by the initial fingerprint expert. We conclude that this technology, when combined with fingerprint expertise, will reduce the number of instances where an erroneous exclusion could occur, increase the efficiency of a fingerprint unit, and be a useful tool for reviewing active or cold cases for missed opportunities to report identifications. PMID:26295930

  8. Evaluating the ameliorative effect of natural dissolved organic matter (DOM) quality on copper toxicity to Daphnia magna: improving the BLM.

    PubMed

    Al-Reasi, Hassan A; Smith, D Scott; Wood, Chris M

    2012-03-01

    Various quality predictors of seven different natural dissolved organic matter (DOM) and humic substances were evaluated for their influence on protection of Daphnia magna neonates against copper (Cu) toxicity. Protection was examined at 3 and 6 mg l(-1) of dissolved organic carbon (DOC) of each DOM isolate added to moderately hard, dechlorinated water. Other water chemistry parameters (pH, concentrations of DOC, calcium, magnesium and sodium) were kept relatively constant. Predictors included absorbance ratios Abs(254/365) (index of molecular weight) and Abs-octanol(254)/Abs-water(254) (index of lipophilicity), specific absorption coefficient (SAC(340); index of aromaticity), and fluorescence index (FI; index of source). In addition, the fluorescent components (humic-like, fulvic-like, tryptophan-like, and tyrosine-like) of the isolates were quantified by parallel factor analysis (PARAFAC). Up to 4-fold source-dependent differences in protection were observed amongst the different DOMs. Significant correlations in toxicity amelioration were found with Abs(254/365), Abs-octanol(254)/Abs-water(254), SAC(340), and with the humic-like fluorescent component. The relationships with FI were not significant and there were no relationships with the tryptophan-like or tyrosine-like fluorescent components at 3 mg C l(-1), whereas a negative correlation was seen with the fulvic-like component. In general, the results indicate that larger, optically dark, more lipophilic, more aromatic DOMs of terrigenous origin, with higher humic-like content, are more protective against Cu toxicity. A method for incorporating SAC(340) as a DOM quality indicator into the Biotic Ligand Model is presented; this may increase the accuracy for predicting Cu toxicity in natural waters. PMID:22072428

  9. Bioavailability and toxicity of trace metals to the cladoceran Daphnia magna in relation to cadmium exposure history

    NASA Astrophysics Data System (ADS)

    Guan, Rui

    The cladoceran Daphnia magna is widely used in freshwater bioassessments and ecological risk assessments. This study designed a series of experiments employing radiotracer methodology to quantify the trace metals (mainly Cd and Zn) biokinetics in D. magna under different environmental and biological conditions and to investigate the influences of different Cd exposure histories on the bioavailability and toxicity of trace metals to D. magna. A bioenergetic-based kinetic model was finally applied in predicting the Cd accumulation dynamics in D. magna and the model validity under non-steady state was assessed. Cd assimilation was found in this study to be influenced by the food characteristics (e.g., metal concentration in food particles), the metal exposure history of the animals, and the genetic characteristics. Some of these influences could be interpreted by the capacity and/or competition of those metal binding sites within the digestive tract and/or the detoxifying proteins metallothionein (MT). My study demonstrated a significant induction of MT in response to Cd exposure and it was the dominant fraction in sequestering the internal nonessential trace metals in D. magna. The ratio of Cd body burden to MT might better predict the Cd toxicity on the digestion systems of D. magna than the Cd tissue burden alone within one-generational exposure to Cd. It was found that metal elimination (rate constant and contribution of different release routes) was independent of the food concentration and the dietary metal concentration, implying that the elimination may not be metabolically controlled. The incorporation of the bioenergetic-based kinetic model, especially under non-steady state, is invaluable in helping to understand the fate of trace metals in aquatic systems and potential environmental risks. The dependence of biokinetic parameters on environmental factors rather than on genotypes implies a great potential of using biokinetics in inter-laboratory comparisons.

  10. Toxic effect of selenium on the zooplankton, Daphnia magna and Daphnia pulicaria, in water and the food source (Chlamydomonas reinhardtii)

    SciTech Connect

    Boyum, K.W.

    1984-01-01

    Acute and chronic toxicity experiments were performed on the zooplankton, Daphnia magna and Daphnia pulicaria, to investigate the toxicity of selenium on these aquatic invertebrates. The acute 48 h LC/sub 50/ of sodium selenate for Daphnia magna and Daphnia pulicaria were 1.01 and 0.25 mg Se/1, respectively. The 48 h LC/sub 50/ of sodium selenite for D. magna and D. pulicaria were 0.45 and 0.006 mg Se/1, respectively. Chronic 28-day toxicity tests were performed on D. magna at 0.05, 0.10, 0.50, and 1.00 mg Se/1 as sodium selenate in the water and with two food types. One food type was algae raised in clean Lake Michigan water and the second treatment was algae raised in media with selenium concentrations corresponding to those in the water cited above. When compared to Daphnia fed selenium-free algae, D. magna fed selenium-laden algae had greater survival, a greater number of offspring produced, and a greater intrinsic growth rate, r, at the toxicant concentration in the water of 0.05, 0.10, and 0.50 mg Se/1. These parameters were, however, lower than those observed in the controls. Uptake of /sup 75/Se as sodium selenate in D. magna was reduced in the presence of selenium-laden algae and DL-selenomethionine, while L-methionine increased the uptake of /sup 75/Se. Selenium bound to an amino acid such as Dl-selenomethionine or organically bound within an algal food source appears to be preferentially incorporated thereby reducing the uptake of inorganic forms from the water.

  11. Gas Chromatography/Atmospheric Pressure Chemical Ionization Tandem Mass Spectrometry for Fingerprinting the Macondo Oil Spill.

    PubMed

    Lobodin, Vladislav V; Maksimova, Ekaterina V; Rodgers, Ryan P

    2016-07-01

    We report the first application of a new mass spectrometry technique (gas chromatography combined to atmospheric pressure chemical ionization tandem mass spectrometry, GC/APCI-MS/MS) for fingerprinting a crude oil and environmental samples from the largest accidental marine oil spill in history (the Macondo oil spill, the Gulf of Mexico, 2010). The fingerprinting of the oil spill is based on a trace analysis of petroleum biomarkers (steranes, diasteranes, and pentacyclic triterpanes) naturally occurring in crude oil. GC/APCI enables soft ionization of petroleum compounds that form abundant molecular ions without (or little) fragmentation. The ability to operate the instrument simultaneously in several tandem mass spectrometry (MS/MS) modes (e.g., full scan, product ion scan, reaction monitoring) significantly improves structural information content and sensitivity of analysis. For fingerprinting the oil spill, we constructed diagrams and conducted correlation studies that measure the similarity between environmental samples and enable us to differentiate the Macondo oil spill from other sources. PMID:27281271

  12. Dynamical fingerprints for probing individual relaxation processes in biomolecular dynamics with simulations and kinetic experiments

    SciTech Connect

    Noe, F; Diadone, Isabella; Lollmann, Marc; Sauer, Marcus; Chondera, John D; Smith, Jeremy C

    2011-01-01

    There is a gap between kinetic experiment and simulation in their views of the dynamics of complex biomolecular systems. Whereas experiments typically reveal only a few readily discernible exponential relaxations, simulations often indicate complex multistate behavior. Here, a theoretical framework is presented that reconciles these two approaches. The central concept is dynamical fingerprints which contain peaks at the time scales of the dynamical processes involved with amplitudes determined by the experimental observable. Fingerprints can be generated from both experimental and simulation data, and their comparison by matching peaks permits assignment of structural changes present in the simulation to experimentally observed relaxation processes. The approach is applied here to a test case interpreting single molecule fluorescence correlation spectroscopy experiments on a set of fluorescent peptides with molecular dynamics simulations. The peptides exhibit complex kinetics shown to be consistent with the apparent simplicity of the experimental data. Moreover, the fingerprint approach can be used to design new experiments with site-specific labels that optimally probe specific dynamical processes in the molecule under investigation.

  13. New Horizons for Ninhydrin: Colorimetric Determination of Gender from Fingerprints.

    PubMed

    Brunelle, Erica; Huynh, Crystal; Le, Anh Minh; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2016-02-16

    In the past century, forensic investigators have universally accepted fingerprinting as a reliable identification method via pictorial comparison. One of the most traditional detection methods uses ninhydrin, a chemical that reacts with amino acids in the fingerprint content to produce the blue-purple color known as Ruhemann's purple. It has recently been demonstrated that the amino acid content in fingerprints can be used to differentiate between male and female fingerprints. Here, we present a modified approach to the traditional ninhydrin method. This new approach for using ninhydrin is combined with an optimized extraction protocol and the concept of determining gender from fingerprints. In doing so, we are able to focus on the biochemical material rather than exclusively the physical image. PMID:26753919

  14. Quantitative Oligonucleotide Microarray Fingerprinting of Salmonella enterica isolates

    SciTech Connect

    Willse, Alan R.; Straub, Tim M.; Wunschel, Sharon C.; Small, Jack A.; Call, Douglas R.; Daly, Don S.; Chandler, Darrell P.

    2004-03-22

    We report on a genome-independent microbial fingerprinting method using nucleic acid microarrays for microbial forensics and epidemiology applications. We demonstrate that the microarray method provides high-resolution differentiation between closely related microorganisms using Salmonella enterica strains. In replicate trials we used a simple 192-probe nonamer array to construct a fingerprint library of 25 closely related Salmonella isolates. Controlling false discovery rate for multiple testing at alpha =.05, at least 295 of 300 pairs of S. enterica isolate fingerprints were found to be statistically distinct using a modified Hotelling Tsquared test. Although we find most pairs of Salmonella fingerprints to be distinct, forensic applications will also require a protocol for library construction and reliable microbial classification against a fingerprint library. We outline additional steps required to produce a protocol for library construction and reliable classification of unknown organisms.

  15. Privacy Preserving Facial and Fingerprint Multi-biometric Authentication

    NASA Astrophysics Data System (ADS)

    Anzaku, Esla Timothy; Sohn, Hosik; Ro, Yong Man

    The cases of identity theft can be mitigated by the adoption of secure authentication methods. Biohashing and its variants, which utilizes secret keys and biometrics, are promising methods for secure authentication; however, their shortcoming is the degraded performance under the assumption that secret keys are compromised. In this paper, we extend the concept of Biohashing to multi-biometrics - facial and fingerprint traits. We chose these traits because they are widely used, howbeit, little research attention has been given to designing privacy preserving multi-biometric systems using them. Instead of just using a single modality (facial or fingerprint), we presented a framework for using both modalities. The improved performance of the proposed method, using face and fingerprint, as against either facial or fingerprint trait used in isolation is evaluated using two chimerical bimodal databases formed from publicly available facial and fingerprint databases.

  16. Identification and Quality Assessment of Chrysanthemum Buds by CE Fingerprinting

    PubMed Central

    Xing, Xiaoping; Li, Dan

    2015-01-01

    A simple and efficient fingerprinting method for chrysanthemum buds was developed with the aim of establishing a quality control protocol based on biochemical makeup. Chrysanthemum bud samples were successively extracted by water and alcohol. The fingerprints of the chrysanthemum buds samples were obtained using capillary electrophoresis and electrochemical detection (CE-ED) employing copper and carbon working electrodes to capture all of the chemical information. 10 batches of chrysanthemum buds were collected from different regions and various factories to establish the baseline fingerprint. The experimental data of 10 batches electropherogram buds by CE were analyzed by correlation coefficient and the included angle cosine methods. A standard chrysanthemum bud fingerprint including 24 common peaks was established, 12 from each electrode, which was successfully applied to identify and distinguish between chrysanthemum buds from 2 other chrysanthemum species. These results demonstrate that fingerprint analysis can be used as an important criterion for chrysanthemum buds quality control. PMID:26064777

  17. Multigenerational acclimation of Daphnia magna to mercury: relationships between biokinetics and toxicity.

    PubMed

    Tsui, Martin T K; Wang, Wen-Xiong

    2005-11-01

    We examined the effects of multigenerational exposure of mercury (Hg) on Hg toxicity and biokinetics in a population of Daphnia magna. After chronic Hg exposure at 3.8 microg Hg/L, the first generation (F0) adults had an elevated 24-h median lethal concentration (LC50) of Hg (76 microg/L) when compared to the control adults (56 microg/L). The dissolved influx rate of Hg was depressed significantly in the Hg-treated adults, which was accompanied by a reduced ingestion rate and enhanced induction of metallothionein-like proteins (MTLP). The second-generation (F1) juveniles originating from the control and exposed lines had no major differences in these parameters (except the dietary assimilation efficiency). Recovery from Hg stress enhanced the vulnerability of F1 adults to Hg toxicity, with a reduced 48-h LC50 (44 microg/L) and a decreased concentration of MTLP (80% of control). Nevertheless, Hg-treated F1 adults had similar tolerance (in terms of LC50s) as the control line, indicating that D. magna acclimated to Hg stress after the first generation of exposure. No major difference occurred in the Hg biokinetics and toxicity among different groups of F2 daphnids. However, the F2 neonates produced by the Hg-treated F1 adults had much higher 48-h LC50 (149 microg/L) and MTLP concentration (148% of control) when there was continuous Hg exposure after birth. We concluded that acclimation to Hg stress occurred quickly in D. magna, though animals recovering from Hg stress were more vulnerable to Hg toxicity. Both ingestion rate and MTLP may not be good biomarkers of Hg stress in the field, because acclimation can be achieved through multigenerational exposure to elevated Hg concentrations. PMID:16398130

  18. Deciphering mechanisms of malathion toxicity under pulse exposure of the freshwater cladoceran Daphnia magna.

    PubMed

    Trac, Lam Ngoc; Andersen, Ole; Palmqvist, Annemette

    2016-02-01

    The organophosphate pesticide (OP) malathion is highly toxic to freshwater invertebrates, including the cladoceran Daphnia magna, a widely used test organism in ecotoxicology. To assess whether toxic effects of malathion are driven primarily by exposure concentration or exposure duration, D. magna was pulse exposed to equivalent integrated doses (duration × concentration): 3 h × 16 μg/L, 24 h × 2 μg/L, and 48 h × 1 μg/L. After recovery periods of 3 h, 24 h, and 48 h, the toxicity of malathion on different biological levels in D. magna was examined by analyzing the following endpoints: survival and immobilization; enzyme activities of acetylcholinesterase (AChE), carboxylesterase (CbE), and glutathione S-transferase (GST); and AChE gene expression. The results showed no difference in survival among equivalent integrated doses. Adverse sublethal effects were driven by exposure concentration rather than pulse duration. Specifically, short pulse exposure to a high concentration of malathion resulted in more immobilized daphnids, lower AChE and CbE activities, and a higher transcript level of AChE gene compared with long pulse exposure to low concentration. The expression of the AChE gene was up-regulated, indicating a compensatory mechanism to cope with enzyme inhibition. The study shows the need for obtaining a better understanding of the processes underlying toxicity under realistic exposure scenarios, so this can be taken into account in environmental risk assessment of pesticides. PMID:26419489

  19. Population level effects of multiwalled carbon nanotubes in Daphnia magna exposed to pulses of triclocarban.

    PubMed

    Simon, Anne; Preuss, Thomas G; Schäffer, Andreas; Hollert, Henner; Maes, Hanna M

    2015-08-01

    Due to the rapid increase of carbon nanotubes (CNT) applications and their inevitable release into the aquatic environment, CNT may interact with and further influence the fate and transport of other pollutants such as triclocarban (TCC). TCC is a high-production-volume chemical that is widely used as an antimicrobial agent, is continually released into the aquatic environment, and is biologically active and persistent. In the present study, the population test with Daphnia magna was performed over 93 days. Different treatments were examined: (a) control, (b) solvent control, (c) 1 mg CNT/L from the beginning, (d) 1 mg CNT/L as of day 14, (e) control with a 2-day pulse of 25 µg TCC/L on day 14, 41 µg TCC/L (day 54), and 61 µg TCC/L (day 68) and (f) same pulses of TCC with co-exposure to 1 mg CNT/L. Significant changes in all three size classes were observed as a result of the long-term exposure to 1 mg CNT/L. Increasing in number of neonates, and decreasing in number of juveniles and adults were observed. Moreover, daphnids were significantly smaller when they were exposed to MWCNT. The exposure with TCC led to size-dependent mortality in Daphnia magna populations and a subsequent recovery. Lower toxicity of TCC was observed, with the presence of MWCNT in the medium. The reported effects of TCC on population level were compared to the output of an individual-based Daphnia magna population model, in order to verify the model predictions with laboratory data. PMID:26003833

  20. Acute and chronic effects of pulse exposure of Daphnia magna to dimethoate and pirimicarb.

    PubMed

    Andersen, Tobias Henrik; Tjørnhøj, Rikke; Wollenberger, Leah; Slothuus, Tina; Baun, Anders

    2006-05-01

    Short-term (<48 h) and long-term (21 d) effects of dimethoate and pirimicarb were studied in Daphnia magna exposed to pulses of 0.5 to 8 h in duration. During a 21-d postexposure observation period, the following parameters were monitored: Mortality, mobility, day for first offspring, animal size, weight of offspring and adults, and number of offspring produced. In general, animals exposed to a single pulse of dimethoate or pirimicarb regained mobility after 24 to 48 h in clean media. Animals exposed to repeated pulses of dimethoate did not recover mobility during a 48-h postexposure observation period, and mortality was significantly increased. Animals exposed to two pulses of pirimicarb showed less recovery of mobility compared with those exposed to one pulse. Exposure of D. magna to 30 mg/L of dimethoate or 100 microg/L of pirimicarb for 2 to 6 h resulted in a significant reduction in the number of offspring and in the average weight of offspring. The average body length was reduced after pulse exposure to 30 mg/L of dimethoate for 3 h or 70 microg/L of pirimicarb for 4 h, and these exposure concentrations caused a delay in the day for first offspring at exposure durations of 2 to 6 h. The most important new findings in the present study are that short-term (<4 h) pulse exposure of neonates to acetylcholinesterase-inhibiting pesticides caused reproductive damage in D. magna and that repeated-pulse exposure significantly increased mortality in animals that apparently had recovered after a single-pulse exposure. PMID:16704047

  1. Fish bioturbation of cadmium-contaminated sediments: Factors affecting Cd availability to Daphnia magna

    SciTech Connect

    Wall, S.B.; La Point, T.W.; Isely, J.J.

    1996-03-01

    Benthic fish bioturbation of contaminated sediments is thought to enhance exposure and, potentially, bioaccumulation into planktonic organisms. Exposures were conducted with cadmium-spiked sediment, 1.0 mg/kg nominal concentrations, and koi carp (Cyprinus carpio). Daphnia magna were placed in aquaria with and without fish for 6 d and Cd bioaccumulation was measured every 48 h. Koi carp bioturbation increased mean total suspended solids (TSS) in two trials from 0.001 mg/L to 44.4 mg/L and 19.2 mg/L to 762.4 mg/L. Mean aqueous Cd concentrations increased from1.4 {micro}g/L to 2.8 {micro}g/L, and from 1.6 {micro}g/L to 13.2 {micro}g/L. Cadmium binding capacity increased from 28.9 {micro}g/L to 169.8 {micro}g/L in with-fish treatments when compared to controls. However, Daphnia magna body burdens did not increase. Mean Cd residues of daphnids exposed with fish, 9.2 {micro}g/g, were not statistically different from without-fish exposures, 8.0 {micro}g/g. Body burdens slightly decreased in the first trial after the with-fish treatment, 9.4 {micro}g/g to 8.3 {micro}g/g. Fish size was partially correlated with TSS and aqueous Cd concentrations and TSS positively correlated with binding capacity. Because increased TSS in the with-fish treatment resulted in increased binding capacity, it is probable that cadmium bioavailability decreased. Although koi carp were capable of remobilizing Cd from sediment, Cd bioaccumulation into Daphnia magna was not significant.

  2. Aminomethylphosphonic acid has low chronic toxicity to Daphnia magna and Pimephales promelas.

    PubMed

    Levine, Steven L; von Mérey, Georg; Minderhout, Tui; Manson, Philip; Sutton, Peter

    2015-06-01

    Aminomethylphosphonic acid (AMPA) is the simplest member of a class of compounds known as aminomethylenephosphonates and the only environmental metabolite measured in significant amounts during the degradation of the herbicide glyphosate in soil. However, there are additional sources of AMPA in the environment, originating from organic phosphonates which are used in water treatment to inhibit scale formation and corrosion. Like glyphosate, AMPA has low acute toxicity to aquatic animals, and the no-observed-adverse effect concentration (NOAEC) obtained from a fish full-life cycle study for glyphosate was determined to be 26 mg/L. However, the chronic toxicity of AMPA to aquatic animals has not been evaluated before. The purpose of the present study was to assess the potential for chronic toxicity of AMPA to fathead minnow (Pimephales promelas) and Daphnia magna. Chronic toxicity to P. promelas was evaluated in a fish early-life stage study. The primary endpoints were larval survival, growth, and development. The NOAEC for P. promelas was determined to be 12 mg/L, the highest concentration tested. The chronic toxicity to D. magna was evaluated in a Daphnia reproduction test. The primary endpoints were survival, growth, and reproduction. The no-observed-effect concentration for D. magna was determined to be 15 mg/L. Conservatively predicted environmental surface water concentrations for AMPA from typical foliar agricultural application rates and values from surface water monitoring programs are 100 to 1000 times less than the NOAEC values from both studies. Consequently, there is a large and highly protective margin of safety between realistic environmental exposures to AMPA and chronic toxicity to aquatic vertebrates and invertebrates. PMID:25690938

  3. DIAGNOSIS AND THERAPY OF LIVER FLUKE (FASCIOLOIDES MAGNA) INFECTION IN FALLOW DEER (DAMA DAMA) IN SERBIA.

    PubMed

    Trailović, Saša M; Marinković, Darko; Kulišić, Zoran

    2016-04-28

    Giant liver fluke ( Fascioloides magna ) infection is an important health problem of cervids in southeastern Europe. We measured the prevalence and intensity of infection with F. magna in a fenced area near the Danube River in the South Bačka District of Serbia. Parasitologic, pathomorphologic, and histopathologic examinations were conducted from November 2007 to February 2008, beginning with a population of 127 adult fallow deer ( Dama dama ). After a positive diagnosis, therapy with triclabendazole-medicated corn was applied. Deer were treated at four baiting stations, using medicated feed providing triclabendazole at an estimated dose of 10-14 mg/kg of body weight per deer. Treatment lasted for 7 d in early February 2008 and an additional 7 d 2 wk later. For the complete success of pharmacotherapy it was necessary to prevent any contact of deer with the snail intermediate host ( Galba truncatula ). Intervention in the habitat, removing grass and low vegetation, and draining ponds reduces the possibility of contact. Six months after the treatment, livers of hunted deer were reddish, with fibrous tracks; pigmentation and cysts in the parenchyma were surrounded by a fibrous capsule and their fecal samples contained no eggs of F. magna . Over the following years, livers of hunted deer were negative, and the last control cull in March 2015 confirmed complete absence of infection. We reconfirmed the presence of giant liver flukes in fallow deer in Serbia, apparently the result of natural spread across the Danube from Hungary and Croatia. We also report that the treatment of deer with triclabendazole-medicated corn is an effective method for administration of therapeutic doses of drug in semicaptive deer. Interventions in the environment are necessary to prevent recontact of deer with habitats used by the snail intermediate host, and enable the success of the therapy. PMID:26967130

  4. Obesogens beyond Vertebrates: Lipid Perturbation by Tributyltin in the Crustacean Daphnia magna

    PubMed Central

    Jordão, Rita; Casas, Josefina; Fabrias, Gemma; Campos, Bruno; Piña, Benjamín; Lemos, Marco F.L.; Soares, Amadeu M.V.M.; Tauler, Romà

    2015-01-01

    Background The analysis of obesogenic effects in invertebrates is limited by our poor knowledge of the regulatory pathways of lipid metabolism. Recent data from the crustacean Daphnia magna points to three signaling hormonal pathways related to the molting and reproductive cycles [retinoic X receptor (RXR), juvenile hormone (JH), and ecdysone] as putative targets for exogenous obesogens. Objective The present study addresses the disruptive effects of the model obesogen tributyltin (TBT) on the lipid homeostasis in Daphnia during the molting and reproductive cycle, its genetic control, and health consequences of its disruption. Methods D. magna individuals were exposed to low and high levels of TBT. Reproductive effects were assessed by Life History analysis methods. Quantitative and qualitative changes in lipid droplets during molting and the reproductive cycle were studied using Nile red staining. Lipid composition and dynamics were analyzed by ultra-performance liquid chromatography coupled to a time-of-flight mass spectrometer. Relative abundances of mRNA from different genes related to RXR, ecdysone, and JH signaling pathways were studied by qRT-PCR. Results and Conclusions TBT disrupted the dynamics of neutral lipids, impairing the transfer of triacylglycerols to eggs and hence promoting their accumulation in adult individuals. TBT’s disruptive effects translated into a lower fitness for offspring and adults. Co-regulation of gene transcripts suggests that TBT activates the ecdysone, JH, and RXR receptor signaling pathways, presumably through the already proposed interaction with RXR. These findings indicate the presence of obesogenic effects in a nonvertebrate species. Citation Jordão R, Casas J, Fabrias G, Campos B, Piña B, Lemos MF, Soares AM, Tauler R, Barata C. 2015. Obesogens beyond vertebrates: lipid perturbation by tributyltin in the crustacean Daphnia magna. Environ Health Perspect 123:813–819; http://dx.doi.org/10.1289/ehp.1409163 PMID

  5. Whole effluent toxicity (WET) tests on wastewater treatment plants with Daphnia magna and Selenastrum capricornutum.

    PubMed

    Ra, Jin Sung; Kim, Hyun Koo; Chang, Nam Ik; Kim, Sang Don

    2007-06-01

    Whole effluent toxicity (WET) tests, with Daphnia magna and Selenastrum capricornutum, were introduced to evaluate the biological toxicities of effluents from the wastewater treatment plants (WWTPs) in Korea. In WET tests of WWTPs effluents, 33.3% (33/99) for D. magna and 92.6% (75/81) for S. capricornutum revealed greater than 1 toxic unit (TU), even though all the treatment plants investigated were operating in compliance with the regulations, as assessed using conventional monitoring methods (i.e., BOD and total concentration of N or P, etc). There were only minor differences in toxicities according to the types of influents (municipal and agro-industrial) in all treatment plants. However, the effluents treated by an activated sludge treatment process were found to exhibit significantly lower toxicity than those treated by rotating biological contactor (RBC) and extended aeration processes. The seasonal variations in the toxicity were lower in the summer compared to winter, which may have been due to the rainfall received to the sewage intake system during the former period. The impact of WET on river water was also investigated based on the discharge volume. At sites A and B, the total impact of toxicity to stream and river waters was observed to be 70.9% and 90.4% for D. magna and S. capricornutum, respectively. The other four small treatment plants (sites F, G, H and I), with relative discharging volumes between 0.001 and 0.002, contribute less than 1% to the total toxicity. PMID:17106776

  6. Comparison of nanosilver and ionic silver toxicity in Daphnia magna and Pimephales promelas.

    PubMed

    Hoheisel, Sarah M; Diamond, Steve; Mount, David

    2012-11-01

    The increasing use of nanosilver in consumer products and the likelihood of environmental exposure warrant investigation into the toxicity of nanosilver to aquatic organisms. A series of studies were conducted comparing the potency of nanosilver to ionic silver (Ag(+)) at acute and sublethal levels using two test organisms (Daphnia magna and Pimephales promelas). The 48-h D. magna median lethal concentration (LC50) of multiple sizes (10, 20, 30, and 50 nm) of commercially prepared nanosilver (nanoComposix) ranged from 4.31 to 30.36 µg total Ag L(-1) with increasing toxicity associated with decreasing particle size. A strong relationship between estimated specific particle surface area and acute toxicity was observed. Nanosilver suspensions (10 nm) treated with cation exchange resin to reduce the concentration of Ag(+) associated with it were approximately equally toxic to D. magna compared to untreated nanosilver (48-h LC50s were 2.15 and 2.79 µg total Ag L(-1), respectively). The 96-h LC50 and 7-d sublethal 20% effective concentrations (EC20s) for P. promelas were 89.4 and 46.1 µg total Ag L(-1), respectively, for 10 nm nanosilver and 4.70 and 1.37 µg total Ag L(-1), respectively, for Ag(+); the resulting ratios of 96-h LC50 to 7-d EC20 were not significantly different for nanosilver and ionic silver. Overall, these studies did not provide strong evidence that nanosilver either acts by a different mechanism of toxicity than ionic silver, or is likely to cause acute or lethal toxicity beyond that which would be predicted by mass concentration of total silver. This in turn suggests that regulatory approaches based on the toxicity of ionic silver to aquatic life would not be underprotective for environmental releases of nanosilver. PMID:22887018

  7. Panventriculomegaly with a wide foramen of Magendie and large cisterna magna.

    PubMed

    Kageyama, Hiroshi; Miyajima, Masakazu; Ogino, Ikuko; Nakajima, Madoka; Shimoji, Kazuaki; Fukai, Ryoko; Miyake, Noriko; Nishiyama, Kenichi; Matsumoto, Naomichi; Arai, Hajime

    2016-06-01

    OBJECT The authors' goal in this paper is to provide the first clinical, radiological, and genetic studies of panventriculomegaly (PaVM) defined by a wide foramen of Magendie and large cisterna magna. METHODS Clinical and brain imaging data from 28 PaVM patients (including 10 patients from 5 families) were retrospectively studied. Five children were included. In adult patients, the age at onset was 56.0 ± 16.7 years. Tetraventricular dilation, aqueductal opening with flow void on T2-weighted images, and a wide foramen of Magendie and large cisterna magna (wide cerebrospinal fluid space at the fourth ventricle outlet) were essential MRI findings for PaVM diagnosis. 3D fast asymmetrical spin echo sequences were used for visualization of cistern membranes. Time-spatial labeling inversion pulse examination was performed to analyze cerebrospinal fluid movement. Copy number variations were determined using high-resolution microarray and were validated by quantitative polymerase chain reaction with breakpoint sequencing. RESULTS Adult patients showed gait disturbance, urinary dysfunction, and cognitive dysfunction. Five infant patients exhibited macrocranium. Patients were divided into 2 subcategories, those with or without downward bulging third ventricular floors and membranous structures in the prepontine cistern. Patients with bulging floors were successfully treated with endoscopic third ventriculostomy. Genetic analysis revealed a deletion in DNAH14 that encodes a dynein heavy chain protein associated with motile cilia function, and which co-segregated with patients in a family without a downward bulging third ventricular floor. CONCLUSIONS Panventriculomegaly with a wide foramen of Magendie and a large cisterna magna may belong to a subtype of congenital hydrocephalus with familial accumulation, younger age at onset, and symptoms of normal pressure hydrocephalus. In addition, a family with PaVM has a gene mutation associated with dysfunction of motile cilia. PMID

  8. Discrepancies in expert decision-making in forensic fingerprint examination.

    PubMed

    Mustonen, Virpi; Hakkarainen, Kai; Tuunainen, Juha; Pohjola, Pasi

    2015-09-01

    The purpose of the present study was to analyse professional fingerprint examiners' investigative practices in the context of discrepancy decisions concerning challenging latents during fingerprint analysis and identification. The participants were fingerprint experts from the Forensic Laboratory of the Finnish National Bureau of Investigation. The data were from five audio-recorded "discrepancy meetings" where two examiners were discussing the rationale and justification for their differing interpretations of challenging and distorted fingerprint evidence. The meetings were chaired by the quality manager of the fingerprint group, who also in the first author of this article. The research questions addressed were as follows: What does the examiner see in the latent fingerprints? What does the examiner actively do with the latents? How were decisions made during the investigative process? In accordance with Goodwin's professional vision framework, the results revealed how the participants used partial and limited information in making judgments about the difficult and distorted latents. The examiners appeared to be involved in active, constructive efforts, mentally, to repair poor latents by supplementing with missing information. They also highlighted various aspects of latents by colour coding as well as manipulated fingerprint images in several ways so as to make the significant patterns easier to recognize. Because the methods and practices of characterizing latents were only vaguely specified, the examiners used locally developed ad hoc practices to facilitate their investigations, ending up with different interpretations. It is concluded in the article that the fingerprint community in Finland should make strong efforts to develop the methods of fingerprint investigation and determine clearer criteria for decision making and documentation practices. Furthermore, the interpretations made by fingerprint experts should be made more transparent to the customers

  9. Comparison of ethanol toxicity to Daphnia magna and Ceriodaphnia dubia tested at two different temperatures: static acute toxicity test results

    SciTech Connect

    Takahashi, I.T.; Cowgill, U.M.; Murphy, P.G.

    1987-08-01

    Ethanol is a commonly used solvent in toxicity testing, yet there are few studies in the literature devoted to its toxicity to zooplankton. The purpose of this study was to compare the response of Daphnia magna Straus 1820 and Ceriodaphnia dubia J. Richard 1894 to ethanol. Two temperatures were selected because most toxicity data involving D. magna has been carried out at 20/sup 0/C while all discussions concerning C. dubia appear to relate to temperatures oscillating around 25/sup 0/C. Thus, the response of these two organisms to ethanol was examined at 20/sup 0/C and at 24/sup 0/C.r

  10. Community fingerprinting in a sequencing world.

    PubMed

    van Dorst, Josie; Bissett, Andrew; Palmer, Anne S; Brown, Mark; Snape, Ian; Stark, Jonathan S; Raymond, Ben; McKinlay, John; Ji, Mukan; Winsley, Tristrom; Ferrari, Belinda C

    2014-08-01

    Despite decreasing costs, generating large-scale, well-replicated and multivariate microbial ecology investigations with sequencing remains an expensive and time-consuming option. As a result, many microbial ecology investigations continue to suffer from a lack of appropriate replication. We evaluated two fingerprinting approaches - terminal restriction fragment length polymorphism (T-RFLP) and automated ribosomal intergenic spacer analysis (ARISA) against 454 pyrosequencing, by applying them to 225 polar soil samples from East Antarctica and the high Arctic. By incorporating local and global spatial scales into the dataset, our aim was to determine whether various approaches differed in their ability and hence utility, to identify ecological patterns. Through the reduction in the 454 sequencing data to the most dominant OTUs, we revealed that a surprisingly small proportion of abundant OTUs (< 0.25%) was driving the biological patterns observed. Overall, ARISA and T-RFLP had a similar capacity as sequencing to separate samples according to distance at a local scale, and to correlate environmental variables with microbial community structure. Pyrosequencing had a greater resolution at the global scale but all methods were capable of significantly differentiating the polar sites. We conclude fingerprinting remains a legitimate approach to generating large datasets as well as a cost-effective rapid method to identify samples for elucidating taxonomic information or diversity estimates with sequencing methods. PMID:24580036

  11. Multiscale fingerprinting of neuronal functional connectivity.

    PubMed

    Song, Gang; Tin, Chung; Poon, Chi-Sang

    2015-09-01

    Current cellular-based connectomics approaches aim to delineate the functional or structural organizations of mammalian brain circuits through neuronal activity mapping and/or axonal tracing. To discern possible connectivity between functionally identified neurons in widely distributed brain circuits, reliable and efficient network-based approaches of cross-registering or cross-correlating such functional-structural data are essential. Here, a novel cross-correlation approach that exploits multiple timing-specific, response-specific, and cell-specific neuronal characteristics as coincident fingerprint markers at the systems, network, and cellular levels is proposed. Application of this multiscale temporal-cellular coincident fingerprinting assay to the respiratory central pattern generator network in rats revealed a descending excitatory pathway with characteristic activity pattern and projecting from a distinct neuronal population in pons to its counterparts in medulla that control the post-inspiratory phase of the respiratory rhythm important for normal breathing, airway protection, and respiratory-vocalization coordination. This enabling neurotracing approach may prove valuable for functional connectivity mapping of other brain circuits. PMID:25056933

  12. Ranking search for probabilistic fingerprinting codes

    NASA Astrophysics Data System (ADS)

    Schäfer, Marcel; Berchtold, Waldemar; Steinebach, Martin

    2012-03-01

    Digital transaction watermarking today is a widely accepted mechanism to discourage illegal distribution of multimedia. The transaction watermark is a user-specific message that is embedded in all copies of one content and thus makes it individual. Therewith it allows to trace back copyright infringements. One major threat on transaction watermarking are collusion attacks. Here, multiple individualized copies of the work are compared and/or combined to attack the integrity or availability of the embedded watermark message. One solution to counter such attacks are mathematical codes called collusion secure fingerprinting codes. Problems arise when applying such codes to multimedia files with small payload, e.g. short audio tracks or images. Therefore the code length has to be shortened which increases the error rates and/or the effort of the tracing algorithm. In this work we propose an approach whether to use as an addition to probabilistic fingerprinting codes for a reduction of the effort and increment of security, as well as a new separate method providing shorter codes at a very fast and high accurate tracing algorithm.

  13. AFLP: a new technique for DNA fingerprinting.

    PubMed Central

    Vos, P; Hogers, R; Bleeker, M; Reijans, M; van de Lee, T; Hornes, M; Frijters, A; Pot, J; Peleman, J; Kuiper, M

    1995-01-01

    A novel DNA fingerprinting technique called AFLP is described. The AFLP technique is based on the selective PCR amplification of restriction fragments from a total digest of genomic DNA. The technique involves three steps: (i) restriction of the DNA and ligation of oligonucleotide adapters, (ii) selective amplification of sets of restriction fragments, and (iii) gel analysis of the amplified fragments. PCR amplification of restriction fragments is achieved by using the adapter and restriction site sequence as target sites for primer annealing. The selective amplification is achieved by the use of primers that extend into the restriction fragments, amplifying only those fragments in which the primer extensions match the nucleotides flanking the restriction sites. Using this method, sets of restriction fragments may be visualized by PCR without knowledge of nucleotide sequence. The method allows the specific co-amplification of high numbers of restriction fragments. The number of fragments that can be analyzed simultaneously, however, is dependent on the resolution of the detection system. Typically 50-100 restriction fragments are amplified and detected on denaturing polyacrylamide gels. The AFLP technique provides a novel and very powerful DNA fingerprinting technique for DNAs of any origin or complexity. Images PMID:7501463

  14. Watermarking and fingerprinting for electronic music delivery

    NASA Astrophysics Data System (ADS)

    van der Veen, Michiel; Lemma, Aweke N.; Kalker, Ton

    2004-06-01

    In recent years we have seen many initiatives to provide electronic music delivery (EMD) services. We observe that a key success factor in EMD is the transparency of the distribution service. We could compare it with the traditional music distribution via compact discs. By buying a CD, a user acquires a 'free' control of the content, i.e. he can copy it, he can play it multiple times etc. In the electronic equivalent, the usage and digital rights management rules should be transparent, and preferably comparable to the classical method of distributing contents. It is the goal of this paper to describe a technology concept that facilitates, from a consumer perspective simple EMD service. Digital watermarking and fingerprinting are the two key technologies involved. The watermarking technology is used to convey the information that uniquely identifies a specific transaction, and the fingerprint technology is adopted for key management and security purposes. In this paper, we discuss how these two technologies are integrated in such a way that watermark security (i.e. the inability to maliciously alter the watermark) and distribution efficiency (i.e. the ability to serve multiple consumers with one distribution PC) are maximized.

  15. A Framework for Reproducible Latent Fingerprint Enhancements.

    PubMed

    Carasso, Alfred S

    2014-01-01

    Photoshop processing of latent fingerprints is the preferred methodology among law enforcement forensic experts, but that appproach is not fully reproducible and may lead to questionable enhancements. Alternative, independent, fully reproducible enhancements, using IDL Histogram Equalization and IDL Adaptive Histogram Equalization, can produce better-defined ridge structures, along with considerable background information. Applying a systematic slow motion smoothing procedure to such IDL enhancements, based on the rapid FFT solution of a Lévy stable fractional diffusion equation, can attenuate background detail while preserving ridge information. The resulting smoothed latent print enhancements are comparable to, but distinct from, forensic Photoshop images suitable for input into automated fingerprint identification systems, (AFIS). In addition, this progressive smoothing procedure can be reexamined by displaying the suite of progressively smoother IDL images. That suite can be stored, providing an audit trail that allows monitoring for possible loss of useful information, in transit to the user-selected optimal image. Such independent and fully reproducible enhancements provide a valuable frame of reference that may be helpful in informing, complementing, and possibly validating the forensic Photoshop methodology. PMID:26601028

  16. Fingerprint matching based on global comprehensive similarity.

    PubMed

    He, Yuliang; Tian, Jie; Li, Liang; Chen, Hong; Yang, Xin

    2006-06-01

    This paper introduces a novel algorithm based on global comprehensive similarity with three steps. To describe the Euclidean space-based relative features among minutiae, we first build a minutia-simplex that contains a pair of minutiae as well as their associated textures, with its transformation-variant and invariant relative features employed for the comprehensive similarity measurement and parameter estimation, respectively. By the second step, we use the ridge-based nearest neighborhood among minutiae to represent the ridge-based relative features among minutiae. With these ridge-based relative features, minutiae are grouped according to their affinity with a ridge. The Euclidean space-based and ridge-based relative features among minutiae reinforce each other in the representation of a fingerprint. Finally, we model the relationship between transformation and the comprehensive similarity between two fingerprints in terms of histogram for initial parameter estimation. Through these steps, our experiment shows that the method mentioned above is both effective and suitable for limited memory AFIS owing to its less than 1k byte template size. PMID:16724581

  17. A Framework for Reproducible Latent Fingerprint Enhancements

    PubMed Central

    Carasso, Alfred S.

    2014-01-01

    Photoshop processing1 of latent fingerprints is the preferred methodology among law enforcement forensic experts, but that appproach is not fully reproducible and may lead to questionable enhancements. Alternative, independent, fully reproducible enhancements, using IDL Histogram Equalization and IDL Adaptive Histogram Equalization, can produce better-defined ridge structures, along with considerable background information. Applying a systematic slow motion smoothing procedure to such IDL enhancements, based on the rapid FFT solution of a Lévy stable fractional diffusion equation, can attenuate background detail while preserving ridge information. The resulting smoothed latent print enhancements are comparable to, but distinct from, forensic Photoshop images suitable for input into automated fingerprint identification systems, (AFIS). In addition, this progressive smoothing procedure can be reexamined by displaying the suite of progressively smoother IDL images. That suite can be stored, providing an audit trail that allows monitoring for possible loss of useful information, in transit to the user-selected optimal image. Such independent and fully reproducible enhancements provide a valuable frame of reference that may be helpful in informing, complementing, and possibly validating the forensic Photoshop methodology. PMID:26601028

  18. The relationship of total copper 48-h LC50s to Daphnia magna dry weight

    SciTech Connect

    Lazorchak, J.M. ); Waller, W.T. )

    1993-05-01

    A study was conducted with Daphnia magna to determine the effect of neonate weight loss or lack of weight gain on experimentally derived copper 48-h LC50s. Standard unfed tests as well as algal-fed (Selenastrum capricornutum) tests were used to look at weight loss and gain. No significant relationship was found between amount of weight loss and copper LC50s. However, dry weight of unfed and algal-fed control organisms could be used to predict total copper LC50s.

  19. Usefulness of the lipid index for biouptake studies with Daphnia magna

    SciTech Connect

    Dauble, D.D.; Klopfer, D.C.; Carlile, D.W.; Hanf, R.W.

    1984-04-01

    Adult Daphnia magna were starved and monitored for lipid content and brood production. Mean lipid index values declined for 72 hours to less than 50% of 24 hour values. Number of hatched young was inversely related to lipid storage and ovary production. Uptake kinetics of /sup 14/C-labelled quinoline was compared between two daphnid test groups with mean lipid scores of 5.4 and 2.8, respectively. Total /sup 14/C counts were significantly higher for the high lipid group at 8 hour. Our studies indicated that lipid reserves of daphnid test populations can be routinely monitored as an indicator of environmental stress.

  20. Effect of nutrient limitation of cyanobacteria on protease inhibitor production and fitness of Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Sadler, Thomas; Von Elert, Eric

    2013-10-01

    Herbivore-plant interactions have been well studied in both terrestrial and aquatic ecosystems as they are crucial for the trophic transfer of energy and matter. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is to a large extent represented by Daphnia and cyanobacteria. The occurrence of cyanobacterial blooms in lakes and ponds has, at least partly, been attributed to cyanotoxins, which negatively affect the major grazer of planktonic cyanobacteria, i.e. Daphnia. Among these cyanotoxins are the widespread protease inhibitors. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the gut of Daphnia, i.e. trypsins and chymotrypsins, and to reduce Daphnia growth. In this study we grew cultures of the cyanobacterium Microcystis sp. strain BM25 on nutrient-replete, N-depleted or P-depleted medium. We identified three different micropeptins to be the cause for the inhibitory activity of BM25 against chymotrypsins. The micropeptin content depended on nutrient availability: whereas N limitation led to a lower concentration of micropeptins per biomass, P limitation resulted in a higher production of these chymotrypsin inhibitors. The altered micropeptin content of BM25 was accompanied by changed effects on the fitness of Daphnia magna: a higher content of micropeptins led to lower IC50 values for D. magna gut proteases and vice versa. Following expectations, the lower micropeptin content in the N-depleted BM25 caused higher somatic growth of D. magna. Therefore, protease inhibitors can be regarded as a nutrient-dependent defence against grazers. Interestingly, although the P limitation of the cyanobacterium led to a higher micropeptin content, high growth of D. magna was observed when they were fed with P-depleted BM25. This might be due to reduced digestibility of P-depleted cells with putatively thick mucilaginous sheaths. These findings indicate that

  1. Programmable pump for the administration of morphine in the cisterna magna. A new approach.

    PubMed

    Narváez, Manuel Juliá; Bulnes, José Manuel Galicia; Elena, José Manuel Montero; Rivas, Javier Márquez; Márquez, Bernarda Márquez

    2002-07-01

    The implantation of a drug (opioid) infusion system catheter at the level of the cisterna magna, connected to an implanted programmable pump (Synchromed pump, 8611-H, Medtronic, Minneapolis, MN) is the procedure we use most commonly for the treatment of craniofacial and upper cervical pain. Our implantation technique, which we consider simple and easy to perform, is discussed in this article. Our results have been extremely encouraging, without untoward effects occurring. Adverse effects are prevented by the close proximity of the catheter tip to the pain receptors. PMID:22150811

  2. Evidence evaluation in fingerprint comparison and automated fingerprint identification systems--modelling within finger variability.

    PubMed

    Egli, Nicole M; Champod, Christophe; Margot, Pierre

    2007-04-11

    Recent challenges and errors in fingerprint identification have highlighted the need for assessing the information content of a papillary pattern in a systematic way. In particular, estimation of the statistical uncertainty associated with this type of evidence is more and more called upon. The approach used in the present study is based on the assessment of likelihood ratios (LRs). This evaluative tool weighs the likelihood of evidence given two mutually exclusive hypotheses. The computation of likelihood ratios on a database of marks of known sources (matching the unknown and non-matching the unknown mark) allows an estimation of the evidential contribution of fingerprint evidence. LRs are computed taking advantage of the scores obtained from an automated fingerprint identification system and hence are based exclusively on level II features (minutiae). The AFIS system attributes a score to any comparison (fingerprint to fingerprint, mark to mark and mark to fingerprint), used here as a proximity measure between the respective arrangements of minutiae. The numerator of the LR addresses the within finger variability and is obtained by comparing the same configurations of minutiae coming from the same source. Only comparisons where the same minutiae are visible both on the mark and on the print are therefore taken into account. The denominator of the LR is obtained by cross-comparison with a database of prints originating from non-matching sources. The estimation of the numerator of the LR is much more complex in terms of specific data requirements than the estimation of the denominator of the LR (that requires only a large database of prints from an non-associated population). Hence this paper addresses specific issues associated with the numerator or within finger variability. This study aims at answering the following questions: (1) how a database for modelling within finger variability should be acquired; (2) whether or not the visualisation technique or the

  3. A reliable and reproducible technique for DNA fingerprinting in biorepositories: a pilot study from BioBIM.

    PubMed

    Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Ialongo, Cristiano; Leone, Barbara; Lopez, Nadia; Valente, Maria Giovanna; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

    2013-01-01

    Standard operating procedures (SOPs) optimization for nucleic acid extraction from stored samples is of crucial importance in a biological repository, considering the large number of collected samples and their future downstream molecular and biological applications. However, the validity of molecular studies using stored specimens depends not only on the integrity of the biological samples, but also on the procedures that ensure the traceability of the same sample, certifying its uniqueness, and ensuring the identification of potential sample contaminations. With this aim, we have developed a rapid, reliable, low-cost, and simple DNA fingerprinting tool for a routine use in quality control of biorepositories samples. The method consists of a double ALU insertion/deletion genotyping panel suitable for uniqueness, identification of sample contaminations, and gender validation. Preliminary data suggest that this easy-to-use DNA fingerprinting protocol could routinely provide assurances of DNA identity and quality in a biorepository setting. PMID:23873620

  4. Standardized molecular typing.

    PubMed

    Müller, F M; Lischewski, A; Harmsen, D; Hacker, J

    1999-01-01

    Molecular typing methods are useful tools in molecular mycology. The results of these biotyping procedures may help to identify pathogenic strains in order to detect sources of nosocomial infection and for the investigation of epidemiological relationships. With respect to the facultative pathogen, Candida albicans, various methods such as pulse-field gel electrophoresis (PFGE), restriction fragment length polymorphism (RFLP), DNA fingerprinting methods and hybridization with repetitive DNA elements have been described as useful tools in molecular epidemiology. The previously described hybridization method with the Candida albicans specific CARE-2 probe and subsequent rehybridization with a molecular size marker is a standardized reproducible typing method for comparison of results obtained in different laboratories. In a larger epidemiological study conducted at the University Hospital of Würzburg analysing clinical C. albicans isolates, we were able to describe relationships between sequential patient isolates. These findings demonstrate that standardized molecular typing methods are a powerful tool in molecular mycology studies. PMID:10865907

  5. Recognition of explosives fingerprints on objects for courier services using machine learning methods and laser-induced breakdown spectroscopy.

    PubMed

    Moros, J; Serrano, J; Gallego, F J; Macías, J; Laserna, J J

    2013-06-15

    During recent years laser-induced breakdown spectroscopy (LIBS) has been considered one of the techniques with larger ability for trace detection of explosives. However, despite of the high sensitivity exhibited for this application, LIBS suffers from a limited selectivity due to difficulties in assigning the molecular origin of the spectral emissions observed. This circumstance makes the recognition of fingerprints a latent challenging problem. In the present manuscript the sorting of six explosives (chloratite, ammonal, DNT, TNT, RDX and PETN) against a broad list of potential harmless interferents (butter, fuel oil, hand cream, olive oil, …), all of them in the form of fingerprints deposited on the surfaces of objects for courier services, has been carried out. When LIBS information is processed through a multi-stage architecture algorithm built from a suitable combination of 3 learning classifiers, an unknown fingerprint may be labeled into a particular class. Neural network classifiers trained by the Levenberg-Marquardt rule were decided within 3D scatter plots projected onto the subspace of the most useful features extracted from the LIBS spectra. Experimental results demonstrate that the presented algorithm sorts fingerprints according to their hazardous character, although its spectral information is virtually identical in appearance, with rates of false negatives and false positives not beyond of 10%. These reported achievements mean a step forward in the technology readiness level of LIBS for this complex application related to defense, homeland security and force protection. PMID:23618183

  6. An Application Instance of Fingerprint Identification in the School Office Access Control System

    NASA Astrophysics Data System (ADS)

    Yu, Lijun

    This paper designs the school office access control system by using the fingerprint identification method, and introduces the software design and the adopted hardware modules. These include fingerprint collection, fingerprint image processing, and fingerprint identification and verification. As proved in the experimental results, this design can fully meet the expectation.

  7. Detection and analysis of diamond fingerprinting feature and its application

    NASA Astrophysics Data System (ADS)

    Li, Xin; Huang, Guoliang; Li, Qiang; Chen, Shengyi

    2011-01-01

    Before becoming a jewelry diamonds need to be carved artistically with some special geometric features as the structure of the polyhedron. There are subtle differences in the structure of this polyhedron in each diamond. With the spatial frequency spectrum analysis of diamond surface structure, we can obtain the diamond fingerprint information which represents the "Diamond ID" and has good specificity. Based on the optical Fourier Transform spatial spectrum analysis, the fingerprinting identification of surface structure of diamond in spatial frequency domain was studied in this paper. We constructed both the completely coherent diamond fingerprinting detection system illuminated by laser and the partially coherent diamond fingerprinting detection system illuminated by led, and analyzed the effect of the coherence of light source to the diamond fingerprinting feature. We studied rotation invariance and translation invariance of the diamond fingerprinting and verified the feasibility of real-time and accurate identification of diamond fingerprint. With the profit of this work, we can provide customs, jewelers and consumers with a real-time and reliable diamonds identification instrument, which will curb diamond smuggling, theft and other crimes, and ensure the healthy development of the diamond industry.

  8. Resistance to a bacterial parasite in the crustacean Daphnia magna shows Mendelian segregation with dominance.

    PubMed

    Luijckx, P; Fienberg, H; Duneau, D; Ebert, D

    2012-05-01

    The influence of host and parasite genetic background on infection outcome is a topic of great interest because of its pertinence to theoretical issues in evolutionary biology. In the present study, we use a classical genetics approach to examine the mode of inheritance of infection outcome in the crustacean Daphnia magna when exposed to the bacterial parasite Pasteuria ramosa. In contrast to previous studies in this system, we use a clone of P. ramosa, not field isolates, which allows for a more definitive interpretation of results. We test parental, F1, F2, backcross and selfed parental clones (total 284 genotypes) for susceptibility against a clone of P. ramosa using two different methods, infection trials and the recently developed attachment test. We find that D. magna clones reliably exhibit either complete resistance or complete susceptibility to P. ramosa clone C1 and that resistance is dominant, and inherited in a pattern consistent with Mendelian segregation of a single-locus with two alleles. The finding of a single host locus controlling susceptibility to P. ramosa suggests that the previously observed genotype-genotype interactions in this system have a simple genetic basis. This has important implications for the outcome of host-parasite co-evolution. Our results add to the growing body of evidence that resistance to parasites in invertebrates is mostly coded by one or few loci with dominance. PMID:22167056

  9. Chronic effects of cyanobacterial toxins on Daphnia magna and their offspring.

    PubMed

    Dao, Thanh Son; Do-Hong, Lan-Chi; Wiegand, Claudia

    2010-06-15

    The zooplankton grazer Daphnia magna endures living in water bodies up to moderate densities of cyanobacteria, such as Microcystis spp., known for producing toxic secondary metabolites. Although daphnids are affected via decreased food filtering, inhibition of digestive proteases and lethality, development of tolerance against cyanobacterial toxins has also been observed. Aim of our study was to investigate in detail chronic effects of cyanobacterial toxins, with emphasis on microcystin, on D. magna. The animals were exposed chronically for two generations to either microcystin-LR in 5 or 50 microg L(-1), or to cyanobacterial crude extract containing the same amount of total microcystin, starting at neonate stadium. Survival, growth, maturation and fecundity were observed for the first generation during two months. In the offspring survival, maturation, and growth were followed for the first week. Low concentration of microcystin-LR slightly affected the growth and reproduction of parent daphnids. Survivorship decreased during chronic exposure with increasing microcystin concentration. Age to maturity of the offspring increased and their survival decreased after parent generation was exposed to the toxin, even if the offspring were raised in control medium. Besides, cessation of the eggs/embryos was observed and malformation of neonates caused by cyanobacterial toxins was firstly recorded. PMID:20132836

  10. Two-generational effects of contaminants in Daphnia magna: Effects of offspring quality.

    PubMed

    Campos, Bruno; Jordão, Rita; Rivetti, Claudia; Lemos, M F L; Soares, A M V M; Tauler, Roma; Barata, Carlos

    2016-06-01

    The authors set up a protocol to perform a 2-generational ring test using the existing guidelines for the Daphnia magna reproduction test. It is well known in ecology that size and quality of offspring vary across the first clutches in D. magna and that certain chemicals affect offspring quality. Therefore, the origin of the second generation is an important factor to consider. Two-generational effects across first, second, and third clutches were evaluated using 4-nonylphenol; those across first and third clutches were evaluated using tributyltin, and those across the third clutch were evaluated using piperonyl butoxide. The compound showing the greatest aggravation of toxic effects between the parental and second generations was piperonyl butoxide, followed by 4-nonylphenol, whereas intergenerational effects of tributyltin varied across experiments. The studied chemicals affected the quantity and quality of the offspring produced by exposed females of the parental generation, those effects being greater in third-clutch neonates. Therefore, when third-clutch offspring were further exposed, they turned out to be more sensitive than the parental generation. The results are in line with those obtained in multigenerational studies using mammalian tests, which showed that, in many cases, effects on the second generation can be predicted by evaluating the quality of the offspring produced. Environ Toxicol Chem 2016;35:1470-1477. © 2015 SETAC. PMID:26505489

  11. Postexposure feeding depression: a new toxicity endpoint for use in laboratory studies with Daphnia magna.

    PubMed

    McWilliam, Ruth A; Baird, Donald J

    2002-06-01

    In situ bioassays with daphnids currently employ lethality as an endpoint, and although sublethal responses (reproduction and feeding rate) can be measured in the field, such endpoints pose major practical challenges. Previous studies have indicated that Daphnia magna exposed to toxic substances can exhibit delayed recovery in feeding behavior (postexposure feeding depression). This simple, robust response has the potential to be an ecologically relevant and potentially diagnostic endpoint. This study developed and tested the use of postexposure feeding depression as a toxicity endpoint in the laboratory environment. First, replicate numbers were manipulated to produce statistically reliable results. Second, postexposure feeding depression in D. magna was studied under laboratory conditions, by employing toxic substances with differing modes of action. Although most substances caused feeding inhibition during direct exposure, not all substances produced postexposure feeding depression. However, the use of lethality as a supplementary endpoint provided an alternative measure when no feeding depression was apparent after exposure. In combination, these endpoints offer a potentially more sensitive, ecologically relevant alternative to the use of lethality alone for in situ bioassay studies. PMID:12069303

  12. Population dynamics in Daphnia magna as modified by chronic tetradifon stress.

    PubMed

    Villarroel, M J; Ferrando, M D; Sancho, E; Andreu, E

    2000-03-01

    Two Daphnia magna offsprings (animals from the first and third brood) whose parentals (F0-generation) were exposed during 21 days to different tetradifon (4-chlorophenyl 2,4,5-trichlophenyl sulfone) concentrations, were transferred to a pesticide free medium during 21 days (recovery period). The algae Nannochloris oculata (5 x 10(5) cells/mL) was used as food. In this recovery study, survival, growth and reproduction (mean total young per female, mean brood size, onset of reproduction and mean number broods per female) were assessed as individual parameters and the intrinsic rate of natural increase (r) as population parameter, for F1 generation (1st and 3rd broods). Reproduction was still reduced in F1 (1st and 3rd broods) generation daphnids from parentals (F0) exposed to 0.18 mg/L tetradifon and higher concentrations even after 21 days in clean water. However, survival was not significantly different (p > 0.05) in those F1 offsprings from parentals pre-exposed to the acaricide. Growth was still reduced in F1 daphnids from parentals pre-exposed to 0.10-0.44 mg/L tetradifon. The intrinsic rate of natural increase (r) was still affected in F1 generation daphnids, specially in those from the third brood. Therefore, F1 generation D. magna offsprings from a parental generation (F0) previously exposed to the acaricide tetradifon were not able to recuperate completely when a recovery period of 21 days was allowed. PMID:10736770

  13. The chronic toxicity of CuO nanoparticles and copper salt to Daphnia magna.

    PubMed

    Adam, Nathalie; Vakurov, Alexander; Knapen, Dries; Blust, Ronny

    2015-01-01

    In this study, the effects of CuO nanoparticles and CuCl2·2H2O were tested on Daphnia magna under chronic exposure scenarios. During a 21-day exposure to the nanoparticles and salt, the reproduction was followed by a daily count of the number of offspring. After the exposure, the adult Daphnia length and uptake of copper was measured. The dissolved, nanoparticle and aggregated fractions were distinguished in the exposure medium. The results showed that only a small fraction of the nanoparticles dissolved, while the majority of the particles formed large aggregates (>450 nm). The dissolved fraction of the nanoparticles corresponded with the dissolved fraction of the copper salt. The effects of the nanoparticles (reproduction EC10: 0.546 mg Cu/l, EC20: 0.693 mg Cu/l, EC50: 1.041 mg Cu/l) on reproduction and length were much lower than the effects of the copper salts (reproduction EC10: 0.017 mg Cu/l, EC20: 0.019 mg Cu/l, EC50: 0.022 mg Cu/l). Based upon total body analysis, the Daphnia copper concentration appeared much higher when exposed to the nanoparticles than when exposed to the salt. These combined results indicate that the toxicity of CuO nanoparticles to D. magna is caused by copper ions formed during dissolution of the nanoparticles in the exposure medium. PMID:25464278

  14. Changes of chemical chronic toxicity to Daphnia magna under different food regimes.

    PubMed

    Pavlaki, Maria D; Ferreira, Abel L G; Soares, Amadeu M V M; Loureiro, Susana

    2014-11-01

    In aquatic ecosystems several stressors may act together and affect the life traits of organisms. Pesticide runoffs are usually associated with high inputs of organic matter and depletion of oxygen in aquatic systems. This study aimed at combining anthropogenic stress (chemicals) and natural stress (food availability) and evaluates their joint effect to the life traits of Daphnia magna. The neonicotinoid insecticide imidacloprid and the heavy metal nickel chloride were used and a 21 d chronic test was carried out to obtain reproduction and growth data. The conceptual model Independent action, usually used for assessing response patterns in chemical mixtures, was used for data interpretation. Results showed an increase in the reproduction and growth pattern of D. magna as food levels increased. Both chemicals significantly impaired the reproduction as well as the somatic growth of the organism while the same happened with food concentrations lower than 3×10(5) cells/mL. It was also observed that food availability did not change the toxicity of imidacloprid and nickel chloride when food levels were higher than 3×10(5) cells/mL. When combined with low food levels, imidacloprid showed a slight increase in toxicity, showing that daphnids become more sensitive with reduced food availability, however in a non-significant way. However, toxicity of nickel appeared to be independent of the food level. Both chemicals induced mortality to the organisms exposed in the absence of food only at the end of the test. PMID:25164202

  15. Surface binding of contaminants by algae: Consequences for lethal toxicity and feeding to Daphnia magna straus

    SciTech Connect

    Taylor, G. |; Baird, D.J.; Soares, A.M.V.M.

    1998-03-01

    Freshwater algae, as with all suspended particulate matter in the water column, exhibit a net negative charge resulting in an affinity for positively charged species, such as toxic metal cations, which will readily adsorb to algal cell surfaces. In this study, the adsorption of a representative toxic metal cadmium cation (Cd{sup 2+}) to a freshwater algal species, Chlorella vulgaris, was investigated using environmentally realistic concentrations of both. A further study of the effects of this particulate adsorption of Cd{sup 2+} on lethal toxicity and feeding in Daphnia magna was conducted. Two apparently contrasting effects were observed. For the D. magna feeding study, cell ingestion was inhibited, leading to reduced growth and reproduction. Experiments comparing the effect of algal-bound cadmium and dissolved forms of cadmium demonstrate that this inhibition is almost entirely due to the surface-bound fraction of ions. However, at concentrations of dissolved cadmium that are lethal to Daphnia, algal cells were found to reduce toxicity. Such findings indicate the importance of food ration in laboratory-based toxicity tests as well as the difficulty in predicting the environmental fate and effect of contaminants using such tests.

  16. Use of daphnia magna to assess potentially contaminated buildings. Final report, April 1990-March 1991

    SciTech Connect

    Haley, M.V.; Kurnas, C.W.

    1992-06-01

    Random concrete core samples taken from a loading dock were used in determining the toxicity of concrete to Daphnia magna. The cores were ground to powder and analyzed for volatiles and chemical agents before being subjected to aquatic toxicology studies using Daphnia magna. Particle size, pH, and ion exchange mechanisms were investigated as par of methodology development. No effects were observed in daphnia exposed to concrete concentrations up to 4000 mg/L after the pH was adjusted. It was determined that an ion exchange reaction between sodium bicarbonate and concrete caused the water hardness to drop. Concrete spiked with sodium lauryl sulfate, copper sulfate, and Beta-aminoethylarylthiosulfonate were investigated to determine if concrete would alter the toxicity. The resulting EC50s were 17.2, 1.42, and 17.3 mg/L, respectively. The copper sulfate toxicity was reduced by two orders of magnitude. The changes in sodium lauryl sulfate and Beta-aminoethylarylthiosulfonate were not significant.

  17. Effects of suspended solids on the acute toxicity of zinc to Daphnia magna and Pimephales promelas

    SciTech Connect

    Hall, W.S.; Dickson, K.L.; Saleh, F.Y.; Rodgers, J.H. Jr.; Wilcox, D.; Entazami, A.

    1986-12-01

    Current procedures for setting site-specific water quality criteria consider abiotic and biotic factors. Suspended solids were shown to be important in reducing zinc toxicity to water column organisms. At zinc concentrations of approx. = 1 mg/L in solutions with < 100 mg/L of all suspended solids tested, zinc toxicity to D. magna was reduced. Sorption of zinc to suspended solids and/or changes in water chemistry due to the addition of suspended solids appear to have been the factors causing reductions in zinc toxicity to D. magna. Only suspended solids levels of 483-734 mg/L of a type that increased total alkalinity, total hardness, and total dissolved carbon clearly reduced the toxicity of approx. = 20 mg/L zinc to P. promelas. The toxic form of zinc to these organisms appears to reside in the aqueous phase. Characteristics of suspended solids did not influence the partition coefficient of zinc in sorption experiments of less than or equal to 96 h. The slopes of dose-response curves proved to be useful for assessing the potential of an organism to respond to changes in aqueous phase zinc concentrations, and may be a useful biological parameter when considering site-specific water quality criteria for chemicals.

  18. Multigenerational effect of perfluorooctane sulfonate (PFOS) on the individual fitness and population growth of Daphnia magna.

    PubMed

    Jeong, Tae-Yong; Yuk, Min-Su; Jeon, Junho; Kim, Sang Don

    2016-11-01

    We investigated the multigenerational effect of PFOS to individual fitness (e.g., body weight, acetylcholinesterase and glutathione S-transferase) and population growth (e.g., offspring number and time to first brood) of Daphnia magna during continuous and discontinuous exposures. The intrinsic rate of population growth was also calculated. In the continuous exposure, population growth-related adverse effects were detected during all test periods, and the adverse effect tended to be weaker in later generations. On the other hand, individual fitness-related adverse effects were observed from F1 not in F0 and deteriorated as the generation number increased. These results imply that individual fitness worsens although the population growth is restored in later generations. Upon discontinuous exposure, a few but significant adverse effects were observed during the non-exposure period and highest effects were detected during the re-exposure period. This encourages the study of different exposure scenarios, which may result in unexpected and higher PFOS toxicity. Consequently, this study confirms adverse effects of PFOS to Daphnia magna in multigenerational period and supports reasons for studies linking individual fitness changes to population dynamics and covering diverse exposure scenarios to evaluate the risk of PFOS in a water environment. PMID:27396314

  19. Ecotoxicological assessment of grey water treatment systems with Daphnia magna and Chironomus riparius.

    PubMed

    Hernández Leal, L; Soeter, A M; Kools, S A E; Kraak, M H S; Parsons, J R; Temmink, H; Zeeman, G; Buisman, C J N

    2012-03-15

    In order to meet environmental quality criteria, grey water was treated in four different ways: 1) aerobic 2) anaerobic+aerobic 3) aerobic+activated carbon 4) aerobic+ozone. Since each treatment has its own specific advantages and disadvantages, the aim of this study was to compare the ecotoxicity of differently treated grey water using Chironomus riparius (96 h test) and Daphnia magna (48 h and 21d test) as test organisms. Grey water exhibited acute toxicity to both test organisms. The aerobic and combined anaerobic+aerobic treatment eliminated mortality in the acute tests, but growth of C. riparius was still affected by these two effluents. Post-treatment by ozone and activated carbon completely removed the acute toxicity from grey water. In the chronic toxicity test the combined anaerobic+aerobic treatment strongly affected D. magna population growth rate (47%), while the aerobic treatment had a small (9%) but significant effect. Hence, aerobic treatment is the best option for biological treatment of grey water, removing most of the toxic effects of grey water. If advanced treatment is required, the treatment with either ozone or GAC were shown to be very effective in complete removal of toxicity from grey water. PMID:22197265

  20. Daphnia magna negatively affected by chronic exposure to purified Cry-toxins.

    PubMed

    Bøhn, Thomas; Rover, Carina Macagnan; Semenchuk, Philipp Robert

    2016-05-01

    Cry-toxin genes originating from Bacillus thuringiensis are inserted into genetically modified (GM) plants, often called Bt-plants, to provide insect resistance to pests. Significant amounts of Bt-plant residues, and thus Cry-toxins, will be shed to soil and aquatic environments. We exposed Daphnia magna to purified Cry1Ab and Cry2Aa toxins for the full life-span of the animals. We used single toxins in different doses and combinations of toxins and Roundup(®), another potential stressor on the rise in agricultural ecosystems. Animals exposed to 4.5 mg/L (ppm) of Cry1Ab, Cry2Aa and the combination of both showed markedly higher mortality, smaller body size and very low juvenile production compared to controls. Animals exposed to 0.75 mg/L also showed a tendency towards increased mortality but with increased early fecundity compared to the controls. Roundup(®) stimulated animals to strong early reproductive output at the cost of later rapid mortality. We conclude that i) purified Cry-toxins in high concentrations are toxic to D. magna, indicating alternative modes-of-action for these Cry-toxins; ii) Cry-toxins act in combination, indicating that 'stacked events' may have stronger effects on non-target organisms; iii) further studies need to be done on combinatorial effects of multiple Cry-toxins and herbicides that co-occur in the environment. PMID:26993955

  1. Predicting the toxicity of permethrin to Daphnia magna in water using SPME fibers.

    PubMed

    Harwood, Amanda D; Bunch, Aubrey R; Flickinger, Dallas L; You, Jing; Lydy, Michael J

    2012-04-01

    Multiple factors can influence bioavailability, which can make predictions of toxicity in natural systems difficult. The current study examined the potential use of solid-phase microextraction fibers as a matrix-independent approach to predict the toxicity of permethrin to Daphnia magna across various water sources, including a laboratory reconstituted water, two natural waters, and a modified natural water. Water source strongly affected the toxicity of permethrin as well as the concentration-response relationships. Although permethrin concentrations in the water were predictive of toxicity to D. magna for individual water sources, there was no relationship between permethrin concentrations among water sources and mortality. This indicated that compositional differences among water sources can greatly influence toxicity, suggesting that benchmarks established using reconstituted water may be overly conservative for some natural waters. In addition, although permethrin tissue residues were predictive of mortality for individual waters, the correlation among waters was not as clear. Finally, both 48-h and equilibrium-based SPME fiber concentrations adequately predicted toxicity independent of water properties. This demonstrated that bioavailability-based estimates provided a more accurate prediction of toxicity than water concentrations and that SPME fibers could be used in environmental monitoring as a rapid and accurate means of predicting toxicity in natural waters. PMID:22037820

  2. Small RNA Sequencing Based Identification of MiRNAs in Daphnia magna

    PubMed Central

    2015-01-01

    Small RNA molecules are short, non-coding RNAs identified for their crucial role in post-transcriptional regulation. A well-studied example includes miRNAs (microRNAs) which have been identified in several model organisms including the freshwater flea and planktonic crustacean Daphnia. A model for epigenetic-based studies with an available genome database, the identification of miRNAs and their potential role in regulating Daphnia gene expression has only recently garnered interest. Computational-based work using Daphnia pulex, has indicated the existence of 45 miRNAs, 14 of which have been experimentally verified. To extend this study, we took a sequencing approach towards identifying miRNAs present in a small RNA library isolated from Daphnia magna. Using Perl codes designed for comparative genomic analysis, 815,699 reads were obtained from 4 million raw reads and run against a database file of known miRNA sequences. Using this approach, we have identified 205 putative mature miRNA sequences belonging to 188 distinct miRNA families. Data from this study provides critical information necessary to begin an investigation into a role for these transcripts in the epigenetic regulation of Daphnia magna. PMID:26367422

  3. AAV9-mediated central nervous system–targeted gene delivery via cisterna magna route in mice

    PubMed Central

    Lukashchuk, Vera; Lewis, Katherine E; Coldicott, Ian; Grierson, Andrew J; Azzouz, Mimoun

    2016-01-01

    Current barriers to the use of adeno-associated virus serotype 9 (AAV9) in clinical trials for treating neurological disorders are its high expression in many off-target tissues such as liver and heart, and lack of cell specificity within the central nervous system (CNS) when using ubiquitous promoters such as human cytomegalovirus (CMV) or chicken-β-actin hybrid (CAG). To enhance targeting the transgene expression in CNS cells, self-complementary (sc) AAV9 vectors, scAAV9-GFP vectors carrying neuronal Hb9 and synapsin 1, and nonspecific CMV and CAG promoters were constructed. We demonstrate that synapsin 1 and Hb9 promoters exclusively targeted neurons in vitro, although their strengths were up to 10-fold lower than that of CMV. In vivo analyses of mouse tissue after scAAV9-GFP vector delivery via the cisterna magna revealed a significant advantage of synapsin 1 promoter over both Hb9 variants in targeting neurons throughout the brain, since Hb9 promoters were driving gene expression mainly within the motor-related areas of the brain stem. In summary, this study demonstrates that cisterna magna administration is a safe alternative to intracranial or intracerebroventricular vector delivery route using scAAV9, and introduces a novel utility of the Hb9 promoter for the targeted gene expression for both in vivo and in vitro applications. PMID:26942208

  4. Toxicity of various silver nanoparticles compared to silver ions in Daphnia magna

    PubMed Central

    2012-01-01

    Background To better understand the potential ecotoxicological impacts of silver nanoparticles released into freshwater environments, the Daphnia magna 48-hour immobilization test was used. Methods The toxicities of silver nitrate, two types of colloidal silver nanoparticles, and a suspension of silver nanoparticles were assessed and compared using standard OECD guidelines. Also, the swimming behavior and visible uptake of the nanoparticles by Daphnia were investigated and compared. The particle suspension and colloids used in the toxicity tests were well-characterized. Results The results obtained from the exposure studies showed that the toxicity of all the silver species tested was dose and composition dependent. Plus, the silver nanoparticle powders subsequently suspended in the exposure water were much less toxic than the previously prepared silver nanoparticle colloids, whereas the colloidal silver nanoparticles and AgNO3 were almost similar in terms of mortality. The silver nanoparticles were ingested by the Daphnia and accumulated under the carapace, on the external body surface, and connected to the appendages. All the silver species in this study caused abnormal swimming by the D. magna. Conclusion According to the present results, silver nanoparticles should be classified according to GHS (Globally Harmonized System of classification and labeling of chemicals) as "category acute 1" to Daphnia neonates, suggesting that the release of nanosilver into the environment should be carefully considered. PMID:22472056

  5. Increased risk of phosphorus limitation at higher temperatures for Daphnia magna.

    PubMed

    Persson, Jonas; Wojewodzic, Marcin Włodzimierz; Hessen, Dag Olav; Andersen, Tom

    2011-01-01

    Invertebrate herbivores frequently face growth rate constraints due to their high demands for phosphorus (P) and nitrogen (N). Temperature is a key modulator of growth rate, yet the interaction between temperature and P limitation on somatic growth rate is scarcely known. To investigate this interaction, we conducted a study on the somatic growth rate (SGR) of the cladoceran Daphnia magna, known to be susceptible to P-limitation. We determined the SGR across a broad range of dietary P content of algae (carbon (C):P ratios (125-790), and at different temperatures (10-25°C). There was a strong impact of both temperature and C:P ratio on the SGR of D. magna, and also a significant interaction between both factors was revealed. The negative effect of dietary C:P on growth rate was reduced with decreased temperature. We found no evidence of P limitation at lowest temperature, suggesting that enzyme kinetics or other measures of food quality overrides the demands for P to RNA and protein synthesis at low temperatures. These findings also indicate an increased risk of P limitation and thus reduced growth efficiency at high temperatures. PMID:20803219

  6. Vaccination of rabbits against coccidiosis using precocious lines of Eimeria magna and Eimeria media in Benin.

    PubMed

    Akpo, Y; Kpodékon, M T; Djago, Y; Licois, D; Youssao, I A K

    2012-02-28

    Three groups of twelve 35-day-old rabbits were used for the experiment. Two groups were vaccinated with a mixture of precocious lines of Eimeria magna and Eimeria media originating from corresponding wild strains isolated in Benin. One group benefited of a booster whereas the second one was kept without booster. A third non-vaccinated group was used as control. All groups were challenged per os with an equal mixture of the wild strains of E. magna and E. media at a dose of 104 oocysts per animal. Three weeks after the challenge inoculation, no case of diarrhoea was recorded in the two groups of vaccinated rabbits, as compared to the non-vaccinated rabbits that developed diarrhoea. No mortality was recorded in the three groups. During the patent period, oocyst output of vaccinated rabbits was significantly lower than that of control animals (P<0.01), confirming a good immunogenic characteristic of the precocious lines. No booster effect was noticed for the boost vaccinated group. The daily weigh gain of the two groups of vaccinated rabbits was significantly higher than that of the non-vaccinated rabbits (P<0.05). Consequently the precocious lines of Benin origin turned out to be immunogenic and therefore constitute good potential candidates for vaccine production for this country. PMID:21890276

  7. Rapid evolution of antioxidant defence in a natural population of Daphnia magna.

    PubMed

    Oexle, S; Jansen, M; Pauwels, K; Sommaruga, R; De Meester, L; Stoks, R

    2016-07-01

    Natural populations can cope with rapid changes in stressors by relying on sets of physiological defence mechanisms. Little is known onto what extent these physiological responses reflect plasticity and/or genetic adaptation, evolve in the same direction and result in an increased defence ability. Using resurrection ecology, we studied how a natural Daphnia magna population adjusted its antioxidant defence to ultraviolet radiation (UVR) during a period with increasing incident UVR reaching the water surface. We demonstrate a rapid evolution of the induction patterns of key antioxidant enzymes under UVR exposure in the laboratory. Notably, evolutionary changes strongly differed among enzymes and mainly involved the evolution of UV-induced plasticity. Whereas D. magna evolved a strong plastic up-regulation of glutathione peroxidase under UVR, it evolved a lower plastic up-regulation of glutathione S-transferase and superoxide dismutase and a plastic down-regulation of catalase. The differentially evolved antioxidant strategies were collectively equally effective in dealing with oxidative stress because they resulted in the same high levels of oxidative damage (to lipids, proteins and DNA) and lowered fitness (intrinsic growth rate) under UVR exposure. The lack of better protection against UVR may suggest that the UVR exposure did not increase between both periods. Predator-induced evolution to migrate to lower depths that occurred during the same period may have contributed to the evolved defence strategy. Our results highlight the need for a multiple trait approach when focusing on the evolution of defence mechanisms. PMID:27018861

  8. Salinity tolerance of Daphnia magna and potential use for estuarine sediment toxicity tests.

    PubMed

    Schuytema, G S; Nebeker, A V; Stutzman, T W

    1997-08-01

    Daphnia magna Straus, a common organism used for freshwater sediment toxicity tests, was evaluated to determine its tolerance to salinity and suitability for tests with estuarine water and sediments. Daphnids were exposed for 2 to 21 days to salinity in a variety of water-only tests, in tests with freshwater sediment overlain by salt water, and in tests with estuarine sediments overlain by freshwater. Daphnid age, test length, and temperature seemed to have little effect upon the range of LC50, NOAEL, and LOAEL values. LC50s for all tests ranged from 5.10 to 7.81 g/L, with a mean of 6.6 g/L salinity (measured conductivity 10.0 mS/cm) [corrected]. The mean NOAEL and LOAEL values based on production of young were 4.6 and 6.9 g/L salinity (measured conductivity 7.1 and 10.5 mS/cm) [corrected], respectively. The results indicate that D. magna will survive and reproduce well in water with salinities below 4 g/L and demonstrate the potential usefulness of this organism in monitoring sediment toxicity from both freshwater and estuarine wetland sites. PMID:9294248

  9. Liposomes as an alternative delivery system for investigating dietary metal toxicity to Daphnia magna.

    PubMed

    Evens, Roel; De Schamphelaere, Karel A C; Balcaen, Lieve; Wang, Yingying; De Roy, Karen; Resano, Martín; Flórez, María del Rosario; Van der Meeren, Paul; Boon, Nico; Vanhaecke, Frank; Janssen, Colin R

    2011-10-01

    Dietary metal toxicity studies with invertebrates such as Daphnia magna are often performed using metal-contaminated algae as a food source. A drawback of this approach is that it is difficult to distinguish between the direct toxicity of the metal and indirect effects caused by a reduced essential nutrient content in the metal-contaminated diet, due to prior exposure of the algae to the metal. This hampers the study of the mechanisms of dietary metal toxicity in filter-feeding freshwater invertebrates. The aim of the present study was to develop a technique for producing metal-contaminated liposomes as an alternative delivery system of dietary metals. These liposomes are not vulnerable to metal-induced shifts in nutrient quality. Liposomes were prepared by the hydration of phosphatidylcholine in media containing either 0 (control) or 50mg Ni/L. The liposomes had average diameters of 19.31 (control) and 10.48 μm (Ni-laden), i.e., a size appropriate for ingestion by D. magna. The liposome particles were then mixed with uncontaminated green algae in a 1/10 ratio (on a dry wt. basis) to make up two diets that differed in Ni content (i.e., 2.0 μg Ni/g dry wt. in the control and 144.2 μg Ni/g dry wt. in the Ni-contaminated diet, respectively). This diet was then fed to D. magna during a 21-day chronic bioassay. The experiment showed that the Ni content and the size distribution of the liposomes were stable for at least 7 days. Also the use of phosphatidylcholine as a liposome component did not affect the reproduction of the daphnids. Exposure to increased level of dietary Ni resulted in 100% mortality after 14 days of exposure and in an increased whole-body Ni concentration in D. magna of 14.9 and 20.4 μg Ni/g dry wt. after 7 and 14 days of exposure, respectively. The Ni-exposed daphnids also exhibited a reduced size (i.e., 30% smaller than the control) after 7 days and a completely halted growth between day 7 and day 14. In terms of reproduction, the size of the

  10. Experimental quantum fingerprinting with weak coherent pulses

    NASA Astrophysics Data System (ADS)

    Xu, Feihu; Arrazola, Juan Miguel; Wei, Kejin; Wang, Wenyuan; Palacios-Avila, Pablo; Feng, Chen; Sajeed, Shihan; Lütkenhaus, Norbert; Lo, Hoi-Kwong

    2015-10-01

    Quantum communication holds the promise of creating disruptive technologies that will play an essential role in future communication networks. For example, the study of quantum communication complexity has shown that quantum communication allows exponential reductions in the information that must be transmitted to solve distributed computational tasks. Recently, protocols that realize this advantage using optical implementations have been proposed. Here we report a proof-of-concept experimental demonstration of a quantum fingerprinting system that is capable of transmitting less information than the best-known classical protocol. Our implementation is based on a modified version of a commercial quantum key distribution system using off-the-shelf optical components over telecom wavelengths, and is practical for messages as large as 100 Mbits, even in the presence of experimental imperfections. Our results provide a first step in the development of experimental quantum communication complexity.

  11. Volatile fingerprints of cancer specific genetic mutations

    PubMed Central

    Peled, Nir; Barash, Orna; Tisch, Ulrike; Ionescu, Radu; Broza, Yoav Y.; Ilouze, Maya; Mattei, Jane; Bunn, Paul A.; Hirsch, Fred R.; Haick, Hossam

    2014-01-01

    We report on a new concept for profiling genetic mutations of (lung) cancer cells, based on the detection of patterns of volatile organic compounds (VOCs) emitted from cell membranes, using an array of nanomaterial-based sensors. In this in-vitro pilot study we have derived a volatile fingerprint assay for representative genetic mutations in cancer cells that are known to be associated with targeted cancer therapy. Five VOCs were associated with the studied oncogenes, using complementary chemical analysis, and were discussed in terms of possible metabolic pathways. The reported approach could lead to the development of novel methods for guiding treatments, so that patients could benefit from safer, more timely and effective interventions that improve survival and quality of life while avoiding unnecessary invasive procedures. Studying clinical samples (tissue/blood/breath) will be required as next step in order to determine whether this cell-line study can be translated into a clinically useful tool. PMID:23428987

  12. Experimental quantum fingerprinting with weak coherent pulses.

    PubMed

    Xu, Feihu; Arrazola, Juan Miguel; Wei, Kejin; Wang, Wenyuan; Palacios-Avila, Pablo; Feng, Chen; Sajeed, Shihan; Lütkenhaus, Norbert; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds the promise of creating disruptive technologies that will play an essential role in future communication networks. For example, the study of quantum communication complexity has shown that quantum communication allows exponential reductions in the information that must be transmitted to solve distributed computational tasks. Recently, protocols that realize this advantage using optical implementations have been proposed. Here we report a proof-of-concept experimental demonstration of a quantum fingerprinting system that is capable of transmitting less information than the best-known classical protocol. Our implementation is based on a modified version of a commercial quantum key distribution system using off-the-shelf optical components over telecom wavelengths, and is practical for messages as large as 100 Mbits, even in the presence of experimental imperfections. Our results provide a first step in the development of experimental quantum communication complexity. PMID:26515586

  13. Experimental quantum fingerprinting with weak coherent pulses

    PubMed Central

    Xu, Feihu; Arrazola, Juan Miguel; Wei, Kejin; Wang, Wenyuan; Palacios-Avila, Pablo; Feng, Chen; Sajeed, Shihan; Lütkenhaus, Norbert; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds the promise of creating disruptive technologies that will play an essential role in future communication networks. For example, the study of quantum communication complexity has shown that quantum communication allows exponential reductions in the information that must be transmitted to solve distributed computational tasks. Recently, protocols that realize this advantage using optical implementations have been proposed. Here we report a proof-of-concept experimental demonstration of a quantum fingerprinting system that is capable of transmitting less information than the best-known classical protocol. Our implementation is based on a modified version of a commercial quantum key distribution system using off-the-shelf optical components over telecom wavelengths, and is practical for messages as large as 100 Mbits, even in the presence of experimental imperfections. Our results provide a first step in the development of experimental quantum communication complexity. PMID:26515586

  14. Fingerprint verification on medical image reporting system.

    PubMed

    Chen, Yen-Cheng; Chen, Liang-Kuang; Tsai, Ming-Dar; Chiu, Hou-Chang; Chiu, Jainn-Shiun; Chong, Chee-Fah

    2008-03-01

    The healthcare industry is recently going through extensive changes, through adoption of robust, interoperable healthcare information technology by means of electronic medical records (EMR). However, a major concern of EMR is adequate confidentiality of the individual records being managed electronically. Multiple access points over an open network like the Internet increases possible patient data interception. The obligation is on healthcare providers to procure information security solutions that do not hamper patient care while still providing the confidentiality of patient information. Medical images are also part of the EMR which need to be protected from unauthorized users. This study integrates the techniques of fingerprint verification, DICOM object, digital signature and digital envelope in order to ensure that access to the hospital Picture Archiving and Communication System (PACS) or radiology information system (RIS) is only by certified parties. PMID:18178287

  15. THE GOOD, THE BAD, AND THE TOXIC: APPROACHING HORMESIS IN DAPHNIA MAGNA EXPOSED TO AN ENERGETIC COMPOUND

    PubMed Central

    Stanley, Jacob K.; Perkins, Edward J.; Habib, Tanwir; Sims, Jerre G.; Chappell, Pornsawan; Escalon, B. Lynn; Wilbanks, Mitchell; Garcia-Reyero, Natàlia

    2014-01-01

    A hormetic response is characterized by an opposite effect in small and large doses of chemical exposure, often resulting in seemingly beneficial effects at low doses. Here, we examined the potential mechanisms underlying the hormetic response of Daphnia magna to the energetic trinitrotoluene (TNT). Daphnia magna were exposed to TNT for 21 days and a significant increase in adult length and number of neonates was identified at low concentrations (0.002 – 0.22 mg/L TNT) while toxic effects were identified at high concentrations (0.97 mg/L TNT and above). Microarray analysis of D. magna exposed to 0.004, 0.12, and 1.85 mg/L TNT identified effects on lipid metabolism as a potential mechanism underlying hormetic effects. Lipidomic analysis of exposed D. magna supported the hypothesis that TNT exposure affected lipid and fatty acid metabolism, showing that hormetic effects could be related to changes in polyunsaturated fatty acids known to be involved in Daphnia growth and reproduction. Our results show that Daphnia exposed to low levels of TNT presented hormetic growth and reproduction enhancement while higher TNT concentrations had an opposite effect. Our results also show how a systems approach can help elucidate potential mechanisms of action and adverse outcomes. PMID:23898970

  16. Effects of multigenerational exposure to elevated temperature on reproduction, oxidative stress, and Cu toxicity in Daphnia magna.

    PubMed

    Bae, Eunhye; Samanta, Palas; Yoo, Jisu; Jung, Jinho

    2016-10-01

    This study evaluated the effect of temperature (20 and 25°C) on reproduction, oxidative stress, and copper (Cu) toxicity in Daphnia magna across three generations (F0, F1, and F2). Exposing D. magna to elevated temperature significantly decreased the number of offspring per female per day, the time to first brood, and body length compared to exposure to the optimal temperature (p<0.05). In addition, elevated temperature induced a significantly higher production of reactive oxygen species and lipid peroxidation (p<0.05). These findings suggest that D. magna likely responded to thermal stress by investing more energy into defense mechanisms, rather than growth and reproduction. In addition, oxidative stress at the elevated temperature gradually increased with each generation, possibly owing to the reduced fitness of the offspring. Exposing D. magna to 25°C (EC50=34±3µgL(-1)) substantially increased the median effective concentration of Cu in all generations compared to exposure to 20°C (EC50=25±3µgL(-1)), indicating a decrease in acute toxicity at elevated temperature. However, elevated temperature significantly increased the oxidative stress induced by a sublethal concentration of Cu (10µgL(-1)). The interaction between elevated temperature and Cu exposure appears to be synergistic; however, this needs to be confirmed using multiple generations in a long-term experiment. PMID:27376351

  17. A comparative study of toxicity identification using Daphnia magna and Tigriopus japonicus: implications of establishing effluent discharge limits in Korea.

    PubMed

    Kang, Sung-Wook; Seo, Jaehwan; Han, Jeonghoon; Lee, Jae-Seong; Jung, Jinho

    2011-01-01

    In Korea, the new permission criteria for industrial effluents based on Daphnia magna acute toxicity tests will be gradually implemented starting from 2011. Thus, in this study, toxicity assessment and identification using a marine species (Tigriopus japonicus) and the freshwater species (D. magna) was comparatively investigated. Effluent from an acid mine drainage treatment plant showed acute toxicity toward both organisms due to low pH, which was removed by neutralization of the effluent. Additionally, evaluation of the effluent of an electronics company revealed that Cu was attributable to the observed toxicity, and the effluent was more toxic toward T. japonicus than D. magna. Moreover, effluents from a metal plating factory were acutely toxic toward D. magna (6.50 TU), while they were not toxic against T. japonicus. Toxicity identification revealed that the high level of Cl- (12,841 mg L(-1)) was the cause of toxicity. Thus, the effluents had no effect on the marine species, T. japonicus. These findings suggest that a marine species rather than a freshwater species is more desirable for toxicity assessment of industrial effluent discharged into the saltwater, and thus should be considered in the legislation of toxicity-based discharge limits in Korea. PMID:21172718

  18. Effects from Filtration, Capping Agents, and Presence/Absence of Food on the Toxicity of Silver Nanoparticles to Daphnia Magna

    EPA Science Inventory

    Relatively little is known regarding the behavior and toxicity of nanoparticles in the environment. The objectives of the work presented here include establishing the toxicity of a variety of silver nanoparticles (AgNPs) to Daphnia magna neonates, assessing the applicability of ...

  19. Toxicity of sodium molybdate and sodium dichromate to Daphnia magna straus evaluated in acute, chronic, and acetylcholinesterase inhibition tests.

    PubMed

    Diamantino, T C; Guilhermino, L; Almeida, E; Soares, A M

    2000-03-01

    As a result of a widespread application in numerous industrial processes, chromium is a contaminant of many environmental systems. Chromium and their compounds are toxic to both invertebrates and vertebrates and, for this reason, there has been a search for suitable and less toxic alternatives. Molybdenum compounds have been studied as alternative to chromium compounds for some industrial applications. The toxicity of chromium is well known but the effects of molybdenum and molybdenum mining on natural populations and communities of freshwater invertebrates have not often been studied. However, chromium, and molybdenum (and their compounds) are included in the same list (List II) of European Union dangerous substances. In this study, the acute and chronic effects of sodium molybdate and sodium dichromate to Daphnia magna Straus were evaluated. Furthermore, in vitro and in vivo effects of these two metals on acetylcholinesterase (AChE) activity of D. magna Straus were investigated. LC(50) values determined at 48 h were 0.29 and 2847.5 mg L(-1) for chromium (as sodium dichromate) and molybdenum (as sodium molybdate), respectively. No significant in vitro effects of both metals on AChE were found. However, both toxicants inhibited AChE in vivo at concentrations under the respective 48-h LC(50) values. Both sodium dichromate and sodium molybdate inhibited the reproduction and growth of D. magna, but the concentrations inducing significant effects were different for the two chemicals. Sodium molybdate had significant lower toxicity to D. magna Straus than sodium dichromate. PMID:10702344

  20. Identification of multi-level toxicity of liquid crystal display wastewater toward Daphnia magna and Moina macrocopa.

    PubMed

    Kim, Sae-Bom; Kim, Woong-Ki; Chounlamany, Vanseng; Seo, Jaehwan; Yoo, Jisu; Jo, Hun-Je; Jung, Jinho

    2012-08-15

    Toxicity-based regulations of industrial effluent have been adopted to complement the conventional discharge limits based on chemical analyses. In this study, multi-level toxicity including acute toxicity, feeding rate inhibition and oxidative stress of effluent from a liquid crystal display (LCD) wastewater treatment plant (WWTP) to Daphnia magna (reference species) and Moina macrocopa (native species) were periodically monitored from April 2010 to April 2011. Raw wastewater was acutely toxic to both D. magna and M. macrocopa, but the toxicity reached less than 1 TU in the final effluent (FE) as treatment proceeded. Although acute toxicity was not observed in the FE, the feeding rate of daphnids was significantly inhibited. Additionally, the antioxidant enzyme activity of catalase, superoxide dismutase and glutathione peroxidase (GPx) in D. magna increased significantly when compared to the control, while only GPx activity was increased significantly in M. macrocopa (p<0.05). A toxicity identification evaluation using D. magna showed that Cu was the key toxicant in the FE, which was not effectively removed by the coagulation/flocculation process in the LCD WWTP. In addition, Al originating from the coagulant seemed to increase toxicity of the FE. PMID:22677053

  1. Population Growth of the Cladoceran, Daphnia magna: A Quantitative Analysis of the Effects of Different Algal Food

    PubMed Central

    Choi, Jong-Yun; Kim, Seong-Ki; Chang, Kwang-Hyeon; Kim, Myoung-Chul; La, Geung-Hwan; Joo, Gea-Jae; Jeong, Kwang-Seuk

    2014-01-01

    In this study, we examined the effects of two phytoplankton species, Chlorella vulgaris and Stephanodiscus hantzschii, on growth of the zooplankton Daphnia magna. Our experimental approach utilized stable isotopes to determine the contribution of food algae to offspring characteristics and to the size of adult D. magna individuals. When equal amounts of food algae were provided (in terms of carbon content), the size of individuals, adult zooplankton, and their offspring increased significantly following the provision of S. hantzschii, but not after the provision of C. vulgaris or of a combination of the two species. Offspring size was unaffected when C. vulgaris or a mixture of the two algal species was delivered, whereas providing only S. hantzschii increased the production of larger-sized offspring. Stable isotope analysis revealed significant assimilation of diatom-derived materials that was important for the growth of D. magna populations. Our results confirm the applicability of stable isotope approaches for clarifying the contribution of different food algae and elucidate the importance of food quality for growth of D. magna individuals and populations. Furthermore, we expect that stable isotope analysis will help to further precisely examine the contribution of prey to predators or grazers in controlled experiments. PMID:24752042

  2. The Sea Level Fingerprints of Global Change

    NASA Astrophysics Data System (ADS)

    Mitrovica, J. X.; Hay, C.; Kopp, R. E., III; Morrow, E.

    2014-12-01

    It may be difficult to persuade those living in northern Europe that the sea level changes that their coastal communities face depends less on the total melting of polar ice sheets and glaciers than on the individual contributions to this total. In particular, melting of a specific ice sheet or mountain glacier drives deformational, gravitational and rotational perturbations to the Earth system that are manifest in a unique geometry, or fingerprint, of global sea level change. For example, melting from the Greenland Ice Sheet equivalent to 1 mm/yr of global mean sea level (GMSL) rise will lead to sea level rise of ~0 mm/yr in Dublin, ~0.2 mm/yr in Amsterdam, ~0.4 mm/yr in Boston and ~1.2 mm/yr in Cape Town. In contrast, if the same volume of ice melted from the West Antarctic Ice Sheet, all of the above sites would experience a sea level rise in the range 1.1-1.2 mm/yr. These fingerprints of modern ice melting, together with ocean thermal expansion and dynamic effects, and the ongoing signal from glacial isostatic adjustment in response to the last ice age, combine to produce a sea level field with significant geographic variability. In this talk I will highlight an analysis of global tide gauge records that takes full advantage of this variability to estimate both GMSL and the sources of meltwater over the last century, and to project GMSL to the end of the current century.

  3. Environmental Sex Determination in the Branchiopod Crustacean Daphnia magna: Deep Conservation of a Doublesex Gene in the Sex-Determining Pathway

    PubMed Central

    Kato, Yasuhiko; Kobayashi, Kaoru; Watanabe, Hajime; Iguchi, Taisen

    2011-01-01

    Sex-determining mechanisms are diverse among animal lineages and can be broadly divided into two major categories: genetic and environmental. In contrast to genetic sex determination (GSD), little is known about the molecular mechanisms underlying environmental sex determination (ESD). The Doublesex (Dsx) genes play an important role in controlling sexual dimorphism in genetic sex-determining organisms such as nematodes, insects, and vertebrates. Here we report the identification of two Dsx genes from Daphnia magna, a freshwater branchiopod crustacean that parthenogenetically produces males in response to environmental cues. One of these genes, designated DapmaDsx1, is responsible for the male trait development when expressed during environmental sex determination. The domain organization of DapmaDsx1 was similar to that of Dsx from insects, which are thought to be the sister group of branchiopod crustaceans. Intriguingly, the molecular basis for sexually dimorphic expression of DapmaDsx1 is different from that of insects. Rather than being regulated sex-specifically at the level of pre–mRNA splicing in the coding region, DapmaDsx1 exhibits sexually dimorphic differences in the abundance of its transcripts. During embryogenesis, expression of DapmaDsx1 was increased only in males and its transcripts were primarily detected in male-specific structures. Knock-down of DapmaDsx1 in male embryos resulted in the production of female traits including ovarian maturation, whereas ectopic expression of DapmaDsx1 in female embryos resulted in the development of male-like phenotypes. Expression patterns of another D. magna Dsx gene, DapmaDsx2, were similar to those of DapmaDsx1, but silencing and overexpression of this gene did not induce any clear phenotypic changes. These results establish DapmaDsx1 as a key regulator of the male phenotype. Our findings reveal how ESD is implemented by selective expression of a fundamental genetic component that is functionally conserved

  4. Fusion-based, high-volume automated fingerprint identification system (AFIS)

    NASA Astrophysics Data System (ADS)

    Thomopoulos, Stelios C.; Reisman, James G.

    1994-02-01

    Automated Fingerprint Identification System (AFIS) provide a means for non-manual fingerprint database searches. Future AFIS applications demand greater fingerprint match request throughput, and for larger fingerprint databases. Barriers to the implementation of a high volume AFIS are analyzed. Data-fusion methods are proposed as a method to maximize integration of fingerprint feature information with limited computational resources. Preliminary results from a prototype AFIS system are presented.

  5. Development and validation of a novel protein-ligand fingerprint to mine chemogenomic space: application to G protein-coupled receptors and their ligands.

    PubMed

    Weill, Nathanael; Rognan, Didier

    2009-04-01

    The present study introduces a novel low-dimensionality fingerprint encoding both ligand and target properties which is suitable to mine protein-ligand chemogenomic space. Whereas ligand properties have been represented by standard descriptors, protein cavities are encoded by a fixed length bit string describing pharmacophoric properties of a definite number of binding site residues. In order to simplify the cavity fingerprint, the concept was applied here to a unique family of targets (G protein-coupled receptors) with a homogeneous cavity description. Particular attention was given to set up data sets of really diverse protein-ligand pairs covering as exhaustively as possible both ligand and target spaces. Several machine learning classification algorithms were trained on two sets of roughly 200000 receptor-ligand fingerprints with a different definition of inactive decoys. Cross-validated models show excellent precision (>0.9) in distinguishing true from false pairs with a particular preference for support vector machine classifiers. When applied to two external test sets of GPCR ligands, the most predictive models were not those performing the best in the previous cross-validation. The ability to recover true GPCR ligands (ligand prediction mode) or true GPCRs (receptor prediction mode) depends on multiple parameters: the molecular complexity of the ligands, the chemical space from which ligand decoys are selected to generate false protein-ligand pairs, and the target space under consideration. In most cases, predicting ligands is easier than predicting receptors. Although receptor profiling is possible, it probably requires a more detailed description of the ligand-binding site. Noteworthy, protein-ligand fingerprints outperform the corresponding ligand fingerprints in mining the GPCR-ligand space. Since they can be applied to a much larger number of receptors than ligand-based fingerprints, protein-ligand fingerprints represent a novel and promising way to

  6. Daphnia magna's sense of competition: intra-specific interactions (ISI) alter life history strategies and increase metals toxicity.

    PubMed

    Gust, Kurt A; Kennedy, Alan J; Melby, Nicolas L; Wilbanks, Mitchell S; Laird, Jennifer; Meeks, Barbara; Muller, Erik B; Nisbet, Roger M; Perkins, Edward J

    2016-08-01

    This work investigates whether the scale-up to multi-animal exposures that is commonly applied in genomics studies provides equivalent toxicity outcomes to single-animal experiments of standard Daphnia magna toxicity assays. Specifically, we tested the null hypothesis that intraspecific interactions (ISI) among D. magna have neither effect on the life history strategies of this species, nor impact toxicological outcomes in exposure experiments with Cu and Pb. The results show that ISI significantly increased mortality of D. magna in both Cu and Pb exposure experiments, decreasing 14 day LC50 s and 95 % confidence intervals from 14.5 (10.9-148.3) to 8.4 (8.2-8.7) µg Cu/L and from 232 (156-4810) to 68 (63-73) µg Pb/L. Additionally, ISI potentiated Pb impacts on reproduction eliciting a nearly 10-fold decrease in the no-observed effect concentration (from 236 to 25 µg/L). As an indication of environmental relevance, the effects of ISI on both mortality and reproduction in Pb exposures were sustained at both high and low food rations. Furthermore, even with a single pair of Daphnia, ISI significantly increased (p < 0.05) neonate production in control conditions, demonstrating that ISI can affect life history strategy. Given these results we reject the null hypothesis and conclude that results from scale-up assays cannot be directly applied to observations from single-animal assessments in D. magna. We postulate that D. magna senses chemical signatures of conspecifics which elicits changes in life history strategies that ultimately increase susceptibility to metal toxicity. PMID:27151402

  7. Bioavailability of Pyrene Associated with Suspended Sediment of Different Grain Sizes to Daphnia magna as Investigated by Passive Dosing Devices.

    PubMed

    Zhang, Xiaotian; Xia, Xinghui; Li, Husheng; Zhu, Baotong; Dong, Jianwei

    2015-08-18

    Suspended sediment (SPS) is widely present in rivers around the world. However, the bioavailability of hydrophobic organic compounds (HOCs) associated with SPS is not well understood. In this work, the influence of SPS grain size on the bioavailability of SPS-associated pyrene to Daphnia magna was studied using a passive dosing device, which maintained a constant freely dissolved pyrene concentration (Cfree) in the exposure systems. The immobilization and protein as well as enzymatic activities of Daphnia magna were investigated to study the bioavailability of SPS-associated pyrene. With Cfree of pyrene ranging from 20.0 to 60.0 μg L(-1), the immobilization of Daphnia magna in the presence of 1 g L(-1) SPS was 1.11-2.89 times that in the absence of SPS. The immobilization caused by pyrene associated with different grain size SPS was on the order of 50-100 μm > 0-50 μm > 100-150 μm. When pyrene Cfree was 20.0 μg L(-1), the immobilization caused by pyrene associated with 50-100 μm SPS was 1.42 and 2.43 times that with 0-50 and 100-150 μm SPS, respectively. The protein and enzymatic activities of Daphnia magna also varied with the SPS grain size. The effect of SPS grain size on the bioavailability of SPS-associated pyrene was mainly due to the difference in SPS ingestion by Daphnia magna and SPS composition, especially the organic carbon type, among the three size fractions. This study suggests that not only the concentration but also the size distribution of SPS should be considered for the development of a biological effect database and establishment of water quality criteria for HOCs in natural waters. PMID:26199982

  8. Hierarchical minutiae matching for fingerprint and palmprint identification.

    PubMed

    Chen, Fanglin; Huang, Xiaolin; Zhou, Jie

    2013-12-01

    Fingerprints and palmprints are the most common authentic biometrics for personal identification, especially for forensic security. Previous research have been proposed to speed up the searching process in fingerprint and palmprint identification systems, such as those based on classification or indexing, in which the deterioration of identification accuracy is hard to avert. In this paper, a novel hierarchical minutiae matching algorithm for fingerprint and palmprint identification systems is proposed. This method decomposes the matching step into several stages and rejects many false fingerprints or palmprints on different stages, thus it can save much time while preserving a high identification rate. Experimental results show that the proposed algorithm can save almost 50% searching time compared with traditional methods and illustrate its effectiveness. PMID:24002001

  9. Chemical characterization of fingerprints from adults and children

    SciTech Connect

    Buchanan, M.V.; Asano, K.; Bohanon, A.

    1996-12-31

    Observation that children`s fingerprints disappear from surfaces more quickly than adults`, initiated a study to characterize the chemical components in fingerprints. Samples were obtained from about 50 individuals ranging in age from 3 to 64 by extracting chemicals from the fingertips using rubbing alcohol. Using combined gas chromatography/mass spectrometry, a wide range of compounds were identified. Samples from children contained higher levels of relatively volatile free fatty acids, while those from adults had higher levels of less volatile long chain esters of fatty acids. These esters are thought to originate from sebaceous glands located on the face and levels of these compounds increase substantially after puberty. Also, other compounds were observed that could be used to develop improved methods for fingerprint detection at a crime scene. Further, observation of specific compounds raises the possibility of being able to identify personal traits (gender, habits, diseases, etc. ) via analysis of components in fingerprints and/or skin.

  10. Using environmental radionuclides as fingerprints to study streambank erosion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The identification of sediment source areas in the watershed is a key component for designing management strategies to reduce sediment and chemical loads from the watershed. Potential sediment sources in a watershed can be characterized (fingerprinted) using diagnostic environmental radionuclides, ...

  11. Highly Informative Simple Sequence Repeat (SSR) Markers for Fingerprinting Hazelnut

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Simple sequence repeat (SSR) or microsatellite markers have many applications in breeding and genetic studies of plants, including fingerprinting of cultivars and investigations of genetic diversity, and therefore provide information for better management of germplasm collections. They are repeatab...

  12. GENETIC VARIATION IN CLONAL VERTEBRATES DETECTED BY SIMPLE SEQUENCE FINGERPRINTING

    EPA Science Inventory

    Measurement of clonal heterogeneity is central to understanding evolutionary and population genetics of roughly 50 species of vertebrates lack effective genetic recombination. imple-sequence DNA fingerprinting with oligonucleotide probes (CAG)5 and (GACA)4 was used to detect hete...

  13. Using environmental radionuclides as fingerprints to study streambank erosion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The identification of sediment source areas in the watershed is a key component for designing management strategies to reduce sediment and chemical loads from watersheds. Potential sediment sources in watersheds can be characterized (fingerprinted) using diagnostic environmental radionuclides, chem...

  14. Understanding the Mechanism of Cyanoacrylate Polymerization in Latent Fingerprinting

    NASA Astrophysics Data System (ADS)

    Wargacki, Steve; Dadmun, Mark; Lewis, Linda; Devault, Gerald

    2002-03-01

    The fuming of cynaoacrylate esters (superglue) provides an effective means for developing latent fingerprints. In this process, the polymerization of cyanoacrylate esters is initiated by entities in the fingerprint. Thus, the development of polymer chains at the site of the fingerprint serves to highlight or "develop" the fingerprint. The use of this technique in law enforcement investigations has been subject to scrutiny due to variations in the visual characteristics of the prints. The observed variations in print quality appear to be a result of changes in the chemical nature of the initiating species. In order to elucidate the microscopic effects that an initiating species has on the resultant polymer, mass analysis and SEC are used to study the growth of the cyanoacrylate ester over time at pH’s that favor one initiating species over another. The kinetic information will then be used to infer information regarding the specific mechanisms of the polymerization in an attempt to explain the observed morphologies.

  15. Performance characterization of structured light-based fingerprint scanner

    NASA Astrophysics Data System (ADS)

    Hassebrook, Laurence G.; Wang, Minghao; Daley, Raymond C.

    2013-05-01

    Our group believes that the evolution of fingerprint capture technology is in transition to include 3-D non-contact fingerprint capture. More specifically we believe that systems based on structured light illumination provide the highest level of depth measurement accuracy. However, for these new technologies to be fully accepted by the biometric community, they must be compliant with federal standards of performance. At present these standards do not exist for this new biometric technology. We propose and define a set of test procedures to be used to verify compliance with the Federal Bureau of Investigation's image quality specification for Personal Identity Verification single fingerprint capture devices. The proposed test procedures include: geometric accuracy, lateral resolution based on intensity or depth, gray level uniformity and flattened fingerprint image quality. Several 2-D contact analogies, performance tradeoffs and optimization dilemmas are evaluated and proposed solutions are presented.

  16. Fingerprint image segmentation based on multi-features histogram analysis

    NASA Astrophysics Data System (ADS)

    Wang, Peng; Zhang, Youguang

    2007-11-01

    An effective fingerprint image segmentation based on multi-features histogram analysis is presented. We extract a new feature, together with three other features to segment fingerprints. Two of these four features, each of which is related to one of the other two, are reciprocals with each other, so features are divided into two groups. These two features' histograms are calculated respectively to determine which feature group is introduced to segment the aim-fingerprint. The features could also divide fingerprints into two classes with high and low quality. Experimental results show that our algorithm could classify foreground and background effectively with lower computational cost, and it can also reduce pseudo-minutiae detected and improve the performance of AFIS.

  17. Interspecies quantitative structure-toxicity-toxicity (QSTTR) relationship modeling of ionic liquids. Toxicity of ionic liquids to V. fischeri, D. magna and S. vacuolatus.

    PubMed

    Das, Rudra Narayan; Roy, Kunal; Popelier, Paul L A

    2015-12-01

    Considering the increasing uses of ionic liquids (ILs) in various industrial processes and chemical engineering operations, a complete assessment of their hazardous profile is essential. In the absence of adequate experimental data, in silico modeling might be helpful in filling data gaps for the toxicity of ILs towards various ecological indicator organisms. Using the rationale of taxonomic relatedness, the development of predictive quantitative structure-toxicity-toxicity relationship (QSTTR) models allows predicting the toxicity of ILs to a particular species using available experimental toxicity data towards a different species. Such studies may employ, along with the available experimental toxicity data to a species, molecular structure features and physicochemical properties of chemicals as independent variables for prediction of the toxicity profile against another closely related species. A few such interspecies toxicity correlation models have been reported in the literature for diverse chemicals in general, but this approach has been rarely applied to the class of ionic liquids. The present study involves the use of IL toxicity data towards the bacteria Vibrio fischeri along with molecular structure derived information or computational descriptors like extended topochemical atom (ETA) indices, quantum topological molecular similarity (QTMS) descriptors and computed lipophilicity measure (logk0) for the interspecies exploration of the toxicity data towards green algae S. vacuolatus and crustacea Daphnia magna, separately. This modeling study has been performed in accordance with the OECD guidelines. Finally, predictions for a true external set have been performed to fill the data gap of toxicity towards daphnids and algae using the Vibrio toxicity data and molecular structure attributes. PMID:26414597

  18. A novel fingerprint for the characterization of protein folds.

    PubMed

    Mezei, Mihaly

    2003-10-01

    A novel fingerprint, defined without the use of distances, is introduced to characterize protein folds. It is of the form of binary matrices whose elements are defined by angles between the C=O direction, the backbone axis and the line connecting the alpha-carbons of the various residues. It is shown that matches in the fingerprint matrices correspond to low r.m.s.d. PMID:14600199

  19. Fingerprint image enhancement method using directional median filter

    NASA Astrophysics Data System (ADS)

    Wu, Chaohong; Shi, Zhixin; Govindaraju, Venu

    2004-08-01

    The performance of any fingerprint recognizer highly depends on the fingerprint image quality. Different types of noises in the fingerprint images pose greater difficulty for recognizers. Most Automatic Fingerprint Identification Systems (AFIS) use some form of image enhancement. Although several methods have been described in the literature, there is still scope for improvement. In particular, effective methodology of cleaning the valleys between the ridge contours are lacking. We observe that noisy valley pixels and the pixels in the interrupted ridge flow gap are "impulse noises". Therefore, this paper describes a new approach to fingerprint image enhancement, which is based on integration of Anisotropic Filter and directional median filter(DMF). Gaussian-distributed noises are reduced effectively by Anisotropic Filter, "impulse noises" are reduced efficiently by DMF. Usually, traditional median filter is the most effective method to remove pepper-and-salt noise and other small artifacts, the proposed DMF can not only finish its original tasks, it can also join broken fingerprint ridges, fill out the holes of fingerprint images, smooth irregular ridges as well as remove some annoying small artifacts between ridges. The enhancement algorithm has been implemented and tested on fingerprint images from FVC2002. Images of varying quality have been used to evaluate the performance of our approach. We have compared our method with other methods described in the literature in terms of matched minutiae, missed minutiae, spurious minutiae, and flipped minutiae(between end points and bifurcation points). Experimental results show our method to be superior to those described in the literature.

  20. Response of biochemical biomarkers in the aquatic crustacean Daphnia magna exposed to silver nanoparticles.

    PubMed

    Ulm, Lea; Krivohlavek, Adela; Jurašin, Darija; Ljubojević, Marija; Šinko, Goran; Crnković, Tea; Žuntar, Irena; Šikić, Sandra; Vinković Vrček, Ivana

    2015-12-01

    The proliferation of silver nanoparticle (AgNP) production and use owing to their antimicrobial properties justifies the need to examine the resulting environmental impacts. The discharge of biocidal nanoparticles to water bodies may pose a threat to aquatic species. This study evaluated the effects of citrate-coated AgNPs on the standardized test organism Daphnia magna Straus clone MBP996 by means of biochemical biomarker response. AgNP toxicity was compared against the toxic effect of Ag(+). The toxicity endpoints were calculated based upon measured Ag concentrations in exposure media. For AgNPs, the NOAEC and LOAEC values at 48 h were 5 and 7 μg Ag/L, respectively, while these values were 0.5 and 1 μg Ag/L, respectively, for Ag(+). The EC50 at 48 h was computed to be 12.4 ± 0.6 and 2.6 ± 0.1 μg Ag/L for AgNPs and Ag(+), respectively, with 95 % confidence intervals of 12.1-12.8 and 2.3-2.8 μg Ag/L, respectively. These results indicate significant less toxicity of AgNP compared to free Ag(+) ions. Five biomarkers were evaluated in Daphnia magna neonates after acute exposure to Ag(+) or AgNPs, including glutathione (GSH) level, reactive oxygen species (ROS) content, and catalase (CAT), acetylcholinesterase (AChE), and superoxide dismutase (SOD) activity. AgNPs induced toxicity and oxidative stress responses in D. magna neonates at tenfold higher concentrations than Ag. Biochemical methods revealed a clear increase in AChE activity, decreased ROS level, increased GSH level and CAT activity, but no significant changes in SOD activity. As Ag(+) may dissolve from AgNPs, these two types of Ag could act synergistically and produce a greater toxic response. The observed remarkably high toxicity of AgNPs (in the parts-per-billion range) to crustaceans indicates that these organisms are a vulnerable link in the aquatic food chain with regard to contamination by nanosilver. Graphical Abstract ᅟ. PMID:26296504