Science.gov

Sample records for magna molecular fingerprints

  1. Molecular impact of juvenile hormone agonists on neonatal Daphnia magna.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Miyakawa, Hitoshi; Yatsu, Ryohei; Mizutani, Takeshi; Ogino, Yukiko; Miyagawa, Shinichi; Watanabe, Hajime; Nishide, Hiroyo; Uchiyama, Ikuo; Tatarazako, Norihisa; Iguchi, Taisen

    2014-05-01

    Daphnia magna has been used extensively to evaluate organism- and population-level responses to pollutants in acute toxicity and reproductive toxicity tests. We have previously reported that exposure to juvenile hormone (JH) agonists results in a reduction of reproductive function and production of male offspring in a cyclic parthenogenesis, D. magna. Recent advances in molecular techniques have provided tools to understand better the responses to pollutants in aquatic organisms, including D. magna. DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to JH agonists: methoprene (125, 250 and 500 ppb), fenoxycarb (0.5, 1 and 2 ppb) and epofenonane (50, 100 and 200 ppb). Exposure to these JH analogs resulted in chemical-specific patterns of gene expression. The heat map analyses based on hierarchical clustering revealed a similar pattern between treatments with a high dose of methoprene and with epofenonane. In contrast, treatment with low to middle doses of methoprene resulted in similar profiles to fenoxycarb treatments. Hemoglobin and JH epoxide hydrolase genes were clustered as JH-responsive genes. These data suggest that fenoxycarb has high activity as a JH agonist, methoprene shows high toxicity and epofenonane works through a different mechanism compared with other JH analogs, agreeing with data of previously reported toxicity tests. In conclusion, D. magna DNA microarray is useful for the classification of JH analogs and identification of JH-responsive genes. PMID:24038158

  2. Molecular fingerprints of environmental carcinogens in human cancer.

    PubMed

    Ceccaroli, C; Pulliero, A; Geretto, M; Izzotti, A

    2015-01-01

    Identification of specific molecular changes (fingerprints) is important to identify cancer etiology. Exploitable biomarkers are related to DNA, epigenetics, and proteins. DNA adducts are the turning point between environmental exposures and biological damage. DNA mutational fingerprints are induced by carcinogens in tumor suppressor and oncogenes. In an epigenetic domain, methylation changes occurs in specific genes for arsenic, benzene, chromium, and cigarette smoke. Alteration of specific microRNA has been reported for environmental carcinogens. Benzo(a)pyrene, cadmium, coal, and wood dust hits specific heat-shock proteins and metalloproteases. The multiple analysis of these biomarkers provides information on the carcinogenic mechanisms activated by exposure to environmental carcinogens. PMID:26023758

  3. Pulmonary embolization of immature Fascioloides magna causing fatal hemothorax confirmed by molecular technique in a heifer in the United States.

    PubMed

    Lee, Jung Keun; Rosser, Thomas Graham; Cooley, Jim

    2016-09-01

    The current report describes the use of a molecular technique to identify immature Fascioloides magna An 18-month-old Brangus heifer was found dead in the field without any prior clinical signs. The cause of death was exsanguination into the thoracic cavity associated with pulmonary embolization and infection by immature Fascioloides magna resulting in 2 large foci of pulmonary necrosis and focal arteriolar and lung rupture. The liver had a few random migratory tracts with typical iron and porphyrin fluke exhaust, but no identified fluke larvae. A single immature fluke was found in the lungs, and species level identification as F. magna was confirmed by DNA sequence analysis of the ribosomal internal transcribed spacer regions (ITS1 region, 5.8S rRNA gene, and ITS2) and of partial 28S rRNA gene sequence. This is one of only a few pulmonary fascioloidiasis cases associated with hemothorax in the veterinary literature. PMID:27423736

  4. Fingerprinting Electronic Molecular Complexes in Liquid

    NASA Astrophysics Data System (ADS)

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules.

  5. Fingerprinting Electronic Molecular Complexes in Liquid

    PubMed Central

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules. PMID:26743542

  6. Fingerprinting Electronic Molecular Complexes in Liquid.

    PubMed

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules. PMID:26743542

  7. Systems biology meets stress ecology: linking molecular and organismal stress responses in Daphnia magna

    PubMed Central

    Heckmann, Lars-Henrik; Sibly, Richard M; Connon, Richard; Hooper, Helen L; Hutchinson, Thomas H; Maund, Steve J; Hill, Christopher J; Bouetard, Anthony; Callaghan, Amanda

    2008-01-01

    Background Ibuprofen and other nonsteroidal anti-inflammatory drugs have been designed to interrupt eicosanoid metabolism in mammals, but little is known of how they affect nontarget organisms. Here we report a systems biology study that simultaneously describes the transcriptomic and phenotypic stress responses of the model crustacean Daphnia magna after exposure to ibuprofen. Results Our findings reveal intriguing similarities in the mode of action of ibuprofen between vertebrates and invertebrates, and they suggest that ibuprofen has a targeted impact on reproduction at the molecular, organismal, and population level in daphnids. Microarray expression and temporal real-time quantitative PCR profiles of key genes suggest early ibuprofen interruption of crustacean eicosanoid metabolism, which appears to disrupt signal transduction affecting juvenile hormone metabolism and oogenesis. Conclusion Combining molecular and organismal stress responses provides a guide to possible chronic consequences of environmental stress for population health. This could improve current environmental risk assessment by providing an early indication of the need for higher tier testing. Our study demonstrates the advantages of a systems approach to stress ecology, in which Daphnia will probably play a major role. PMID:18291039

  8. Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting

    PubMed Central

    Khan, Tarik A.; Friedensohn, Simon; de Vries, Arthur R. Gorter; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T.

    2016-01-01

    High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion—the intraclonal diversity index—which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

  9. Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting.

    PubMed

    Khan, Tarik A; Friedensohn, Simon; Gorter de Vries, Arthur R; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T

    2016-03-01

    High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion-the intraclonal diversity index-which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

  10. Linguini Models of Molecular Genetic Mapping and Fingerprinting.

    ERIC Educational Resources Information Center

    Thompson, James N., Jr.; Gray, Stanton B.; Hellack, Jenna J.

    1997-01-01

    Presents an exercise using linguini noodles to demonstrate an aspect of DNA fingerprinting. DNA maps that show genetic differences can be produced by digesting a certain piece of DNA with two or more restriction enzymes both individually and in combination. By rearranging and matching linguini fragments, students can recreate the original pattern…

  11. Telopathes magna gen. nov., spec. nov. (Cnidaria: Anthozoa: Antipatharia: Schizopathidae) from deep waters off Atlantic Canada and the first molecular phylogeny of the deep-sea family Schizopathidae.

    PubMed

    Macisaac, K G; Best, M; Brugler, M R; Kenchington, E L R; Anstey, L J; Jordan, T

    2013-01-01

    A new genus and species of deep-sea antipatharian, Telopathes magna gen. nov., spec. nov., is described from the western North Atlantic off the coast of Canada. Five additional paratypes, consisting ofjuvenile to adult forms, are reported from the New England and Corner Rise Seamounts (NW Atlantic). Preliminary sequencing of a subsection of the nuclear ribosomal cistron confirmed the phylogenetic affinity of T. magna to the order Antipatharia, and in particular the family Schizopathidae. Subsequent sequencing of three mitochondrial DNA segments from nine of the 11 currently-recognized genera within the Schizopathidae revealed a well-supported phylogenetic relationship between T. magna and Stauropathes. This is the first study to use molecular techniques to elucidate the evolutionary relationships of the Schizopathidae, a family of black corals almost exclusively found in the deep sea (depths > 200 m). Telopathes is distinguished from other genera within the family Schizopathidae by its largely pinnulated stalk, sparse branching pattern to the second degree that is not restricted to a single plane, two anterolateral rows of long, simple primary pinnules, arranged alternately to sub-opposite, and colony with an adhesive base. This record of T. magna brings the total number of nominal species of Antipatharia reported to occur off eastern Canada to 12 and represents the third new genus added to the Schizopathidae since a critical review of the family by Dennis Opresko in 2002. PMID:26106725

  12. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  13. [The problem of molecular-genetic identification of sweat and grease deposits in the human fingerprints].

    PubMed

    Faleeva, T G; Ivanov, I N; Mishin, E S; Vnukova, N V; Kornienko, I V

    2016-01-01

    The objective of the present experimental molecular-genetic study of DNA contained in of human fingerprints was to establish the relationship between the reference genetic profiles and the genotypes of the individuals leaving their fingerprints on a smooth metal object. The biological material for the purpose of the investigation was sampled at different time intervals. The were taken using a scotch tape and used to obtain the complete genetic profile immediately after the fingerprints had been left as well as within the next 24 hours and one week. It proved impossible to identify the complete genetic profile one month after the fingerprints had been left. The alleles not typical for reference samples were identified within one week after swabbing the material from the metal surface. The results of the sudy can be explained by the decrease of the concentration of the initial DNA-matrix in the samples due to its degradation in the course of time. It is concluded that the parallel genetic analysis is needed if reliable evidence of identity of the profiles of interest or its absence is to be obtained. PMID:27070033

  14. Exhaled Molecular Fingerprinting in Diagnosis and Monitoring: Validating Volatile Promises.

    PubMed

    Boots, Agnes W; Bos, Lieuwe D; van der Schee, Marc P; van Schooten, Frederik-Jan; Sterk, Peter J

    2015-10-01

    Medical diagnosis and phenotyping increasingly incorporate information from complex biological samples. This has promoted the development and clinical application of non-invasive metabolomics in exhaled air (breathomics). In respiratory medicine, expired volatile organic compounds (VOCs) are associated with inflammatory, oxidative, microbial, and neoplastic processes. After recent proof of concept studies demonstrating moderate to good diagnostic accuracies, the latest efforts in breathomics are focused on optimization of sensor technologies and analytical algorithms, as well as on independent validation of clinical classification and prediction. Current research strategies are revealing the underlying pathophysiological pathways as well as clinically-acceptable levels of diagnostic accuracy. Implementing recent guidelines on validating molecular signatures in medicine will enhance the clinical potential of breathomics and the development of point-of-care technologies. PMID:26432020

  15. Exploring molecular fingerprints of selective PPARδ agonists through comparative and validated chemometric techniques.

    PubMed

    Nandy, A; Roy, K; Saha, A

    2015-01-01

    Peroxysome proliferator-activated receptors (PPARs) have grown greatly in importance due to their role in the metabolic profile. Among three subtypes (α, γ and δ), we here consider the least investigated δ subtype to explore the molecular fingerprints of selective PPARδ agonists. Validated QSAR models (regression based 2D-QSAR, HQSAR and KPLS) and molecular docking with dynamics analyses support the inference of classification-based Bayesian and recursive models. Chemometric studies indicate that the presence of ether linkages and heterocyclic rings has optimum influence in imparting selective bioactivity. Pharmacophore models and docking with molecular dynamics analyses postulate the occurrence of aromatic rings, HB acceptor and a hydrophobic region as crucial molecular fragments for development of PPARδ modulators. Multi-chemometric studies suggest the essential structural requirements of a molecule for imparting potent and selective PPARδ modulation. PMID:25986170

  16. Endoscopic Raman Spectroscopy for Molecular Fingerprinting of Gastric Cancer: Principle to Implementation

    PubMed Central

    2015-01-01

    Currently, positive endoscopic biopsy is the standard criterion for gastric cancer diagnosis but is invasive, often inconsistent, and delayed although early detection and early treatment is the most important policy. Raman spectroscopy is a spectroscopic technique based on inelastic scattering of monochromatic light. Raman spectrum represents molecular composition of the interrogated volume providing a direct molecular fingerprint. Several investigations revealed that Raman spectroscopy can differentiate normal, dysplastic, and adenocarcinoma gastric tissue with high sensitivity and specificity. Moreover, this technique can indentify malignant ulcer and showed the capability to analyze the carcinogenesis process. Automated on-line Raman spectral diagnostic system raised possibility to use Raman spectroscopy in clinical field. Raman spectroscopy can be applied in many fields such as guiding a target biopsy, optical biopsy in bleeding prone situation, and delineating the margin of the lesion. With wide field technology, Raman spectroscopy is expected to have specific role in our future clinical field. PMID:26106612

  17. De novo design of caseinolytic protein proteases inhibitors based on pharmacophore and 2D molecular fingerprints.

    PubMed

    Wu, Guanzhong; Zhang, Zhen; Chen, Hong; Lin, Kejiang

    2015-06-01

    Caseinolytic protein proteases (ClpP) are large oligomeric protein complexes that contribute to cell homeostasis as well as virulence regulation in bacteria. Inhibitors of ClpP can significantly attenuate the capability to produce virulence factors of the bacteria. In this work, we developed a workflow to expand the chemical space of potential ClpP inhibitors based on a set of β-lactones. In our workflow, an artificial pharmacophore model was generated based on HipHop and HYPOGEN method. A de novo compound library based on molecular fingerprints was constructed and virtually screened by the pharmacophore model. The results were further investigated by molecular docking study. The workflow successfully achieved potential ClpP inhibitors. It could be applied to design more novel potential ClpP inhibitors and provide theoretical basis for the further optimization of the hit compounds. PMID:25937012

  18. Quantitative Molecular Assay for Fingerprinting Microbial Communities of Wastewater and Estrogen-Degrading Consortia

    PubMed Central

    Yu, Chang-Ping; Ahuja, Rajiv; Sayler, Gary; Chu, Kung-Hui

    2005-01-01

    A quantitative fingerprinting method, called the real-time terminal restriction fragment length polymorphism (real-time-t-RFLP) assay, was developed for simultaneous determination of microbial diversity and abundance within a complex community. The real-time-t-RFLP assay was developed by incorporating the quantitative feature of real-time PCR and the fingerprinting feature of t-RFLP analysis. The assay was validated by using a model microbial community containing three pure strains, an Escherichia coli strain (gram negative), a Pseudomonas fluorescens strain (gram negative), and a Bacillus thuringiensis strain (gram positive). Subsequently, the real-time-t-RFLP assay was applied to and proven to be useful for environmental samples; the richness and abundance of species in microbial communities (expressed as the number of 16S rRNA gene copies of each ribotype per milliliter) of wastewater and estrogen-degrading consortia (enriched with 17α-estradiol, 17β-estradiol, or estrone) were successfully characterized. The results of this study strongly suggested that the real-time-t-RFLP assay can be a powerful molecular tool for gaining insight into microbial communities in various engineered systems and natural habitats. PMID:15746346

  19. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    NASA Astrophysics Data System (ADS)

    Burgess, Jacob A. J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-09-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

  20. Rotation commensurate echo of asymmetric molecules—Molecular fingerprints in the time domain

    NASA Astrophysics Data System (ADS)

    Chesnokov, E. N.; Kubarev, V. V.; Koshlyakov, P. V.

    2014-12-01

    Using the pulses of terahertz free electron laser and ultra-fast Schottky diode detectors, we observed the coherent transients within a free induction decay of gaseous nitrogen dioxide NO2. The laser excited different sub-bands of rotation spectra of NO2 containing about 50-70 lines. The free induction signal continued more than 30 ns and consisted of many echo-like bursts duration about 0.2 ns. Unlike the similar effect observed previously for linear and symmetric top molecules, the sequence of echo bursts is not periodic. The values for delay of individual echo are stable, and the set of these delays can be considered as a "molecular fingerprint" in the time domain.

  1. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope.

    PubMed

    Burgess, Jacob A J; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-01-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface. PMID:26359203

  2. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    PubMed Central

    Burgess, Jacob A.J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-01-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface. PMID:26359203

  3. Exploring the vibrational fingerprint of the electronic excitation energy via molecular dynamics

    SciTech Connect

    Deyne, Andy Van Yperen-De; Pauwels, Ewald; Ghysels, An; Waroquier, Michel; Van Speybroeck, Veronique; Hemelsoet, Karen; De Meyer, Thierry; De Clerck, Karen

    2014-04-07

    A Fourier-based method is presented to relate changes of the molecular structure during a molecular dynamics simulation with fluctuations in the electronic excitation energy. The method implies sampling of the ground state potential energy surface. Subsequently, the power spectrum of the velocities is compared with the power spectrum of the excitation energy computed using time-dependent density functional theory. Peaks in both spectra are compared, and motions exhibiting a linear or quadratic behavior can be distinguished. The quadratically active motions are mainly responsible for the changes in the excitation energy and hence cause shifts between the dynamic and static values of the spectral property. Moreover, information about the potential energy surface of various excited states can be obtained. The procedure is illustrated with three case studies. The first electronic excitation is explored in detail and dominant vibrational motions responsible for changes in the excitation energy are identified for ethylene, biphenyl, and hexamethylbenzene. The proposed method is also extended to other low-energy excitations. Finally, the vibrational fingerprint of the excitation energy of a more complex molecule, in particular the azo dye ethyl orange in a water environment, is analyzed.

  4. Evaluation of the Orbitrap Mass Spectrometer for the Molecular Fingerprinting Analysis of Natural Dissolved Organic Matter.

    PubMed

    Hawkes, Jeffrey A; Dittmar, Thorsten; Patriarca, Claudia; Tranvik, Lars; Bergquist, Jonas

    2016-08-01

    We investigated the application of the LTQ-Orbitrap mass spectrometer (LTQ-Velos Pro, Thermo Fisher) for resolving complex mixtures of natural aquatic dissolved organic matter (DOM) and compared this technique to the more established state-of-the-art technique, Fourier transform ion cyclotron resonance mass spectrometry (FTICR-MS, Bruker Daltonics), in terms of the distribution of molecular masses detected and the reproducibility of the results collected. The Orbitrap was capable of excellent reproducibility: Bray-Curtis dissimilarity between duplicate measurements was 2.85 ± 0.42% (mean ± standard deviation). The Orbitrap was also capable of the detection of most major ionizable organic molecules in typical aquatic mixtures, with the exception of most sulfur and phosphorus containing masses. This result signifies that the Orbitrap is an appropriate technique for the investigation of very subtle biogeochemical processing of bulk DOM. The lower costs (purchase and maintenance) and wider availability of Orbitrap mass spectrometers in university departments means that the tools necessary for research into DOM processing at the molecular level should be accessible to a much wider group of scientists than before. The main disadvantage of the technique is that substantially fewer molecular formulas can be resolved from a complex mixture (roughly one third as many), meaning some loss of information. In balance, most biogeochemical studies that aim at molecularly fingerprinting the source of natural DOM could be satisfactorily carried out with Orbitrap mass spectrometry. For more targeted metabolomic studies where individual compounds are traced through natural systems, FTICR-MS remains advantageous. PMID:27400998

  5. Highland cattle and Radix labiata, the hosts of Fascioloides magna

    PubMed Central

    2014-01-01

    Background Fascioloides magna is a pathogenic fluke introduced to Europe ca 140 years ago. As it is spreading over the continent, new intermediate and definitive hosts might be involved in transmission of the parasite. In Europe, several studies reported potential new intermediate snail hosts (Radix spp.) for F. magna, and also several cases of fascioloidosis of wild and domestic animals were published. However, the data based on molecular and histological analyses confirming these findings remained unreported. This study aims to refer to unique findings of F. magna in European snails and domestic animals (the first observation in the Czech Republic in the last 30 years) and demonstrate the use of molecular techniques in determination of F. magna. Results Two snails of R. labiata naturally infected with F. magna were found; mature cercariae and daughter rediae were observed. Maturity of cercariae was checked by histological methods, however, their ability to encyst was not confirmed. Co-infection of F. magna and Fasciola hepatica in the liver of two highland cattle bulls was proved. Adult fasciolid flukes producing eggs were found in the liver pseudocysts (F. magna) and the bile ducts (F. hepatica). Identification of intermediate hosts, intramolluscan stages, adult flukes and eggs was performed by sequencing the ITS2 region. Connection of F. magna pseudocysts with the gut (via the bile ducts) was not confirmed by means of histological and coprological examinations. Conclusions For the first time, Radix labiata was confirmed as the snail host for F. magna under natural conditions and, together with the finding of F. magna infection in cattle, we can expect further transmission of F. magna from wildlife to livestock in localities shared by these hosts. PMID:24517409

  6. Molecular fingerprinting reflects different histotypes and brain region in low grade gliomas

    PubMed Central

    2013-01-01

    Background Paediatric low-grade gliomas (LGGs) encompass a heterogeneous set of tumours of different histologies, site of lesion, age and gender distribution, growth potential, morphological features, tendency to progression and clinical course. Among LGGs, Pilocytic astrocytomas (PAs) are the most common central nervous system (CNS) tumours in children. They are typically well-circumscribed, classified as grade I by the World Health Organization (WHO), but recurrence or progressive disease occurs in about 10-20% of cases. Despite radiological and neuropathological features deemed as classic are acknowledged, PA may present a bewildering variety of microscopic features. Indeed, tumours containing both neoplastic ganglion and astrocytic cells occur at a lower frequency. Methods Gene expression profiling on 40 primary LGGs including PAs and mixed glial-neuronal tumours comprising gangliogliomas (GG) and desmoplastic infantile gangliogliomas (DIG) using Affymetrix array platform was performed. A biologically validated machine learning workflow for the identification of microarray-based gene signatures was devised. The method is based on a sparsity inducing regularization algorithm l1l2 that selects relevant variables and takes into account their correlation. The most significant genetic signatures emerging from gene-chip analysis were confirmed and validated by qPCR. Results We identified an expression signature composed by a biologically validated list of 15 genes, able to distinguish infratentorial from supratentorial LGGs. In addition, a specific molecular fingerprinting distinguishes the supratentorial PAs from those originating in the posterior fossa. Lastly, within supratentorial tumours, we also identified a gene expression pattern composed by neurogenesis, cell motility and cell growth genes which dichotomize mixed glial-neuronal tumours versus PAs. Our results reinforce previous observations about aberrant activation of the mitogen-activated protein kinase

  7. Predicting Molecular Targets for Small-Molecule Drugs with a Ligand-Based Interaction Fingerprint Approach.

    PubMed

    Cao, Ran; Wang, Yanli

    2016-06-20

    The computational prediction of molecular targets for small-molecule drugs remains a great challenge. Herein we describe a ligand-based interaction fingerprint (LIFt) approach for target prediction. Together with physics-based docking and sampling methods, we assessed the performance systematically by modeling the polypharmacology of 12 kinase inhibitors in three stages. First, we examined the capacity of this approach to differentiate true targets from false targets with the promiscuous binder staurosporine, based on native complex structures. Second, we performed large-scale profiling of kinase selectivity on the clinical drug sunitinib by means of computational simulation. Third, we extended the study beyond kinases by modeling the cross-inhibition of bromodomain-containing protein 4 (BRD4) for 10 well-established kinase inhibitors. On this basis, we made prospective predictions by exploring new kinase targets for the anticancer drug candidate TN-16, originally known as a colchicine site binder and microtubule disruptor. As a result, p38α was highlighted from a panel of 187 different kinases. Encouragingly, our prediction was validated by an in vitro kinase assay, which showed TN-16 as a low-micromolar p38α inhibitor. Collectively, our results suggest the promise of the LIFt approach in predicting potential targets for small-molecule drugs. PMID:26222196

  8. Molecular fingerprinting with the resolved modes of a femtosecond laser frequency comb.

    PubMed

    Diddams, Scott A; Hollberg, Leo; Mbele, Vela

    2007-02-01

    The control of the broadband frequency comb emitted from a mode-locked femtosecond laser has permitted a wide range of scientific and technological advances--ranging from the counting of optical cycles for next-generation atomic clocks to measurements of phase-sensitive high-field processes. A unique advantage of the stabilized frequency comb is that it provides, in a single laser beam, about a million optical modes with very narrow linewidths and absolute frequency positions known to better than one part in 10(15) (ref. 5). One important application of this vast array of highly coherent optical fields is precision spectroscopy, in which a large number of modes can be used to map internal atomic energy structure and dynamics. However, an efficient means of simultaneously identifying, addressing and measuring the amplitude or relative phase of individual modes has not existed. Here we use a high-resolution disperser to separate the individual modes of a stabilized frequency comb into a two-dimensional array in the image plane of the spectrometer. We illustrate the power of this technique for high-resolution spectral fingerprinting of molecular iodine vapour, acquiring in a few milliseconds absorption images covering over 6 THz of bandwidth with high frequency resolution. Our technique for direct and parallel accessing of stabilized frequency comb modes could find application in high-bandwidth spread-spectrum communications with increased security, high-resolution coherent quantum control, and arbitrary optical waveform synthesis with control at the optical radian level. PMID:17287805

  9. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  10. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  11. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering.

    PubMed

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3'-diethylthiatricarbocyanine iodide] and DTDC [3,3'-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist. PMID:26730189

  12. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering

    PubMed Central

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3′-diethylthiatricarbocyanine iodide] and DTDC [3,3′-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist. PMID:26730189

  13. Virtual fragment screening: discovery of histamine H3 receptor ligands using ligand-based and protein-based molecular fingerprints.

    PubMed

    Sirci, Francesco; Istyastono, Enade P; Vischer, Henry F; Kooistra, Albert J; Nijmeijer, Saskia; Kuijer, Martien; Wijtmans, Maikel; Mannhold, Raimund; Leurs, Rob; de Esch, Iwan J P; de Graaf, Chris

    2012-12-21

    Virtual fragment screening (VFS) is a promising new method that uses computer models to identify small, fragment-like biologically active molecules as useful starting points for fragment-based drug discovery (FBDD). Training sets of true active and inactive fragment-like molecules to construct and validate target customized VFS methods are however lacking. We have for the first time explored the possibilities and challenges of VFS using molecular fingerprints derived from a unique set of fragment affinity data for the histamine H(3) receptor (H(3)R), a pharmaceutically relevant G protein-coupled receptor (GPCR). Optimized FLAP (Fingerprints of Ligands and Proteins) models containing essential molecular interaction fields that discriminate known H(3)R binders from inactive molecules were successfully used for the identification of new H(3)R ligands. Prospective virtual screening of 156,090 molecules yielded a high hit rate of 62% (18 of the 29 tested) experimentally confirmed novel fragment-like H(3)R ligands that offer new potential starting points for the design of H(3)R targeting drugs. The first construction and application of customized FLAP models for the discovery of fragment-like biologically active molecules demonstrates that VFS is an efficient way to explore protein-fragment interaction space in silico. PMID:23140085

  14. Molecular Fingerprint-based Artificial Neural Networks QSAR for Ligand Biological Activity Predictions

    PubMed Central

    Myint, Kyaw-Zeyar; Wang, Lirong; Tong, Qin; Xie, Xiang-Qun

    2012-01-01

    In this manuscript, we have reported a novel 2D fingerprint-based artificial neural network QSAR (FANN-QSAR) method in order to effectively predict biological activities of structurally diverse chemical ligands. Three different types of fingerprints, namely ECFP6, FP2 and MACCS, were used in FANN-QSAR algorithm development, and FANN-QSAR models were compared to known 3D and 2D QSAR methods using five data sets previously reported. In addition, the derived models were used to predict GPCR cannabinoid ligand binding affinities using our manually curated cannabinoid ligand database containing 1699 structurally diverse compounds with reported cannabinoid receptor subtype CB2 activities. To demonstrate its useful applications, the established FANN-QSAR algorithm was used as a virtual screening tool to search a large NCI compound database for lead cannabinoid compounds and we have discovered several compounds with good CB2 binding affinities ranging from 6.70 nM to 3.75 μM. To the best of our knowledge, this is the first report for a fingerprint-based neural network approach validated with a successful virtual screening application in identifying lead compounds. The studies proved that the FANN-QSAR method is a useful approach to predict bioactivities or properties of ligands and to find novel lead compounds for drug discovery research. PMID:22937990

  15. Comparison of molecular species identification for North Sea calanoid copepods (Crustacea) using proteome fingerprints and DNA sequences.

    PubMed

    Laakmann, S; Gerdts, G; Erler, R; Knebelsberger, T; Martínez Arbizu, P; Raupach, M J

    2013-09-01

    Calanoid copepods play an important role in the pelagic ecosystem making them subject to various taxonomic and ecological studies, as well as indicators for detecting changes in the marine habitat. For all these investigations, valid identification, mainly of sibling and cryptic species as well as early life history stages, represents a central issue. In this study, we compare species identification methods for pelagic calanoid copepod species from the North Sea and adjacent regions in a total of 333 specimens. Morphologically identified specimens were analysed on the basis of nucleotide sequences (i.e. partial mitochondrial cytochrome c oxidase subunit I (COI) and complete 18S rDNA) and on proteome fingerprints using the technology of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). On all three molecular approaches, all specimens were classified to species level indicated by low intraspecific and high interspecific variability. Sequence divergences in both markers revealed a second Pseudocalanus species for the southern North Sea identified as Pseudocalanus moultoni by COI sequence comparisons to GenBank. Proteome fingerprints were valid for species clusters irrespective of high intraspecific variability, including significant differences between early developmental stages and adults. There was no effect of sampling region or time; thus, trophic effect, when analysing the whole organisms, was observed in species-specific protein mass spectra, underlining the power of this tool in the application on metazoan species identification. Because of less sample preparation steps, we recommend proteomic fingerprinting using the MALDI-TOF MS as an alternative or supplementary approach for rapid, cost-effective species identification. PMID:23848968

  16. Spatio-temporal variability of the molecular fingerprint of soil dissolved organic matter in a headwater agricultural catchment

    NASA Astrophysics Data System (ADS)

    Jeanneau, Laurent; Pierson-Wickmann, Anne-Catherine; Jaffrezic, Anne; Lambert, Thibault; Gruau, Gérard

    2013-04-01

    Dissolved organic matter (DOM) is implied in (i) ecosystem services such as the support of biodiversity, (ii) the alteration of the drinkable water quality by formation of trihalomethane and (iii) the transfer of micropollutants from soils to rivers. Moreover, since DOM connects soils and oceans that are interacting with the atmosphere, understanding its biogeochemistry will help in investigating the carbon cycle and in creating strategies to mitigate climate change. DOM in headwater stream ecosystems is mainly inherited from allochtonous inputs with different reservoirs being mobilized during storm and interstorm events at the scale of an hydrological year. Those changes in DOM reservoirs, if accompanied by composition and reactivity changes, may impact DOM ecosystem services and drinking water production processes. Elucidating the compositional changes due to changes in the source of DOM in rivers has thus become a important axis of DOM research. The aim of this study is to test the ability of the molecular tools of the organic geochemistry and more specifically the combination of thermochemiolysis and gas chromatography - mass spectrometry (THM-GC-MS) to (i) link the variability of the river DOM composition to different DOM reservoirs in catchment soils and (ii) provide hypothesis on the nature and the mechanisms of formation (microbial growth, litter decomposition) of those reservoirs. This analytical method seems particularly adapted since it allows the differentiation between vegetal and microbial inputs and the determination of the extent of the biodegradation process of biomolecules such as lignin. To test this method, the molecular fingerprint of soil DOM has been investigated in the wetland area of a small (500 ha) agricultural catchment (the so-called Kervidy-Naizin catchment) located in Brittany, western France. The soil DOM was sampled fortnightly at three depths using zero-tension lysimeters during the hydrological year 2010-2011. The samples were

  17. Molecular evolution of epizootic hemorrhagic disease viruses in North America based on historical isolates using motif fingerprints.

    PubMed

    Wilson, W C; Ruder, M G; Jasperson, D; Smith, T P L; Naraghi-Arani, P; Lenhoff, R; Stallknecht, D E; Valdivia-Granda, W A; Sheoran, D

    2016-08-01

    Epizootic hemorrhagic disease virus (EHDV) is an orbivirus of the Reoviridae family that has significant impact on wild and captive white-tailed deer. Although closely related to bluetongue virus that can cause disease in sheep and cattle, North American EHDV historically has not been associated with disease in cattle or sheep. Severe disease in cattle has been reported with other EHDV strains from East Asia and the Middle East. To understand the potential role of viral genetics in the epidemiology of epizootic hemorrhagic disease, a molecular characterization of North American EHDV strains from 1955 to 2012 was conducted via conventional phylogenetic analysis and a new classification approach using motif fingerprint patterns. Overall, this study indicates that the genetic make-up of EHDV populations in North America have slowly evolved over time. The data also suggested limited reassortment events between serotypes 1 and 2 and introduces a new analysis tool for more detailed sequence pattern analysis. PMID:27107856

  18. Morphological and molecular observations on the status of Crassicauda magna, a parasite of the subcutaneous tissues of the pygmy sperm whale, with a re-evaluation of the systematic relationships of the genus Crassicauda.

    PubMed

    Jabbar, Abdul; Beveridge, Ian; Bryant, Malcolm S

    2015-03-01

    Members of the genus Crassicauda (Nematoda: Spirurida) are parasites of the body tissues of whales and dolphins. Owing to the large size of worms and difficulties in the recovery of entire nematodes from the tissues of hosts, limited information is available on morphological descriptions of both male and female worms. Furthermore, there are currently no available sequence data for this genus to assist with such identifications. This paper describes for the first time features of the anterior extremity and the male tail of Crassicauda magna, suggesting that Crassicauda duguyi may be a synonym of this species. In addition, molecular data are presented for the genus for the first time suggesting that the genus belongs within the superfamily Acuarioidea rather than within the Habronematoidea, in which it is currently placed. PMID:25482860

  19. Molecular Fingerprinting of Cyanobacteria from River Biofilms as a Water Quality Monitoring Tool

    PubMed Central

    Loza, Virginia; Perona, Elvira

    2013-01-01

    Benthic cyanobacterial communities from Guadarrama River (Spain) biofilms were examined using temperature gradient gel electrophoresis (TGGE), comparing the results with microscopic analyses of field-fixed samples and the genetic characterization of cultured isolates from the river. Changes in the structure and composition of cyanobacterial communities and their possible association with eutrophication in the river downstream were studied by examining complex TGGE patterns, band extraction, and subsequent sequencing of 16S rRNA gene fragments. Band profiles differed among sampling sites depending on differences in water quality. The results showed that TGGE band richness decreased in a downstream direction, and there was a clear clustering of phylotypes on the basis of their origins from different locations according to their ecological requirements. Multivariate analyses (cluster analysis and canonical correspondence analysis) corroborated these differences. Results were consistent with those obtained from microscopic observations of field-fixed samples. According to the phylogenetic analysis, morphotypes observed in natural samples were the most common phylotypes in the TGGE sequences. These phylotypes were closely related to Chamaesiphon, Aphanocapsa, Pleurocapsa, Cyanobium, Pseudanabaena, Phormidium, and Leptolyngbya. Differences in the populations in response to environmental variables, principally nutrient concentrations (dissolved inorganic nitrogen and soluble reactive phosphorus), were found. Some phylotypes were associated with low nutrient concentrations and high levels of dissolved oxygen, while other phylotypes were associated with eutrophic-hypertrophic conditions. These results support the view that once a community has been characterized and its genetic fingerprint obtained, this technique could be used for the purpose of monitoring rivers. PMID:23263954

  20. Copper/zinc superoxide dismutase from the Cladoceran Daphnia magna: molecular cloning and expression in response to different acute environmental stressors.

    PubMed

    Lyu, Kai; Zhu, Xuexia; Wang, Qianqian; Chen, Yafen; Yang, Zhou

    2013-08-01

    The copper/zinc superoxide dismutase (Cu/Zn-SOD) is a representative antioxidant enzyme that is responsible for the conversion of superoxide to oxygen and hydrogen peroxide in aerobic organisms. Cu/Zn-SOD mRNAs have been cloned from many species and employed as useful biomarkers of oxidative stresses. In the present study, we cloned Cu/Zn-SOD cDNA from the cladoceran Daphnia magna, analyzed its catalytic properties, and investigated mRNA expression patterns after exposure to known oxidative stressors. The full-length Cu/Zn-SOD of the D. magna (Dm-Cu/Zn-SOD) sequence consisted of 703 bp nucleotides, encoding 178 amino acids, showing well-conserved domains that were required for metal binding and several common characteristics. The deduced amino acid sequence of Dm-Cu/Zn-SOD showed that it shared high identity with Daphnia pulex (88%), Alvinella pompejana (56%), and Cristaria plicata (56%). The phylogenetic analysis indicated that Dm-Cu/Zn-SOD was highly homologous to D. pulex. The variation of Dm-Cu/Zn-SOD mRNA expression was quantified by real-time PCR, and the results indicated that the expression was up-regulated after 48-h exposure to copper, un-ionized ammonia, and low dissolved oxygen. This study shows that the Dm-Cu/Zn-SOD mRNA could be successfully employed as a biomarker of oxidative stress, which is a common mode of toxicity for many other aquatic hazardous materials. PMID:23815380

  1. First certified reference materials for molecular fingerprinting of two approved probiotic Bacillus strains.

    PubMed

    De Baets, L; Van Iwaarden, P; Meeus, N; Schimmel, H; Philipp, W; Emons, H

    2009-01-31

    At present probiotic bacteria are widely used in human and animal nutrition because they beneficially influence the balance of the intestinal flora of the host. Positive effects related to probiotics are various and include enhancement of digestion, strengthening of the immune system and stimulation of vitamin production. Moreover, implementation of probiotics is intended to reduce the use of antibiotics and improve animal growth and feed conversion. To protect human and animal health and to improve consumer confidence, a strict legislation on the use of probiotics exists within the European Union (EU). Official controls by national authorities are performed to ensure verification of compliance with feed and food law. Apart from the risk of using unauthorized strains, mislabelling is a known problem, partly because of the use of phenotyping or genotyping methods with a lack of discriminative power. In addition to official controls, private controls by food and feed producing companies are important in the frame of protection of patented strains and industrial property rights. To support these applications, IRMM has developed certified reference materials (CRMs) consisting of genomic DNA inserts of B. subtilis DSM 5749 and B. licheniformis DSM 5750, two strains that received EU approval. In this study we investigated the use of these CRMs, IRMM-311 and IRMM-312, for the detection and unambiguous discrimination of Bacillus strains by pulsed-field gel electrophoresis (PFGE). Identical fingerprints were obtained for the CRMs and control strains isolated from the feed additive Bioplus 2B. On the other hand a distinction could be made from other not approved B. licheniformis and B. subtilis strains. The reference materials discussed in this study are the first CRMs based on a whole bacterial genome and suitable for PFGE. They offer perspectives for applications in other domains such as analysis of foodborne pathogens in outbreaks or routine analysis. PMID:19062121

  2. Rotation commensurate echo of asymmetric molecules—Molecular fingerprints in the time domain

    SciTech Connect

    Chesnokov, E. N.; Kubarev, V. V.; Koshlyakov, P. V.

    2014-12-29

    Using the pulses of terahertz free electron laser and ultra-fast Schottky diode detectors, we observed the coherent transients within a free induction decay of gaseous nitrogen dioxide NO{sub 2}. The laser excited different sub-bands of rotation spectra of NO{sub 2} containing about 50–70 lines. The free induction signal continued more than 30 ns and consisted of many echo-like bursts duration about 0.2 ns. Unlike the similar effect observed previously for linear and symmetric top molecules, the sequence of echo bursts is not periodic. The values for delay of individual echo are stable, and the set of these delays can be considered as a “molecular fingerprint” in the time domain.

  3. The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

    PubMed

    Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

    2015-01-01

    In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis. PMID:24328820

  4. mRNA-Seq Reveals Novel Molecular Mechanisms and a Robust Fingerprint in Graves' Disease

    PubMed Central

    Sachidanandam, Ravi; Morshed, Syed; Latif, Rauf; Shi, Ruijin; Davies, Terry F.

    2014-01-01

    Context: The immune response in autoimmune thyroid disease has been shown to occur primarily within the thyroid gland in which the most abundant antigens can be found. A variety of capture molecules are known to be expressed by thyroid epithelial cells and serve to attract and help retain an intrathyroidal immune infiltrate. Objective: To explore the entire repertoire of expressed genes in human thyroid tissue, we have deep sequenced the transcriptome (referred to as mRNA-Seq). Design and Patients: We applied mRNA-Seq to thyroid tissue from nine patients with Graves' disease subjected to total thyroidectomy and compared the data with 12 samples of normal thyroid tissue obtained from patients having a thyroid nodule removed. The expression for each gene was calculated from the sequencing data by taking the median of the coverage across the length of the gene. The expression levels were quantile normalized and a gene signature was derived from these. Results: On comparison of expression levels in tissues derived from Graves' patients and controls, there was clear evidence for overexpression of the antigen presentation pathway consisting of HLA and associated genes. We also found a robust disease signature and discovered active innate and adaptive immune signaling networks. Conclusions: These data reveal an active immune defense system in Graves' disease, which involves novel molecular mechanisms in its pathogenesis and development. PMID:24971664

  5. The Molecular Fingerprint of High Grade Serous Ovarian Cancer Reflects Its Fallopian Tube Origin

    PubMed Central

    Kessler, Mirjana; Fotopoulou, Christina; Meyer, Thomas

    2013-01-01

    High grade serous ovarian cancer (HGSC), the most lethal and frequent type of epithelial ovarian cancer (EOC), has poor long term prognosis due to a combination of factors: late detection, great metastatic potential and the capacity to develop resistance to available therapeutic drugs. Furthermore, there has been considerable controversy concerning the etiology of this malignancy. New studies, both clinical and molecular, strongly suggest that HGSC originates not from the surface of the ovary, but from the epithelial layer of the neighboring fallopian tube fimbriae. In this paper we summarize data supporting the central role of fallopian tube epithelium in the development of HGSC. Specifically, we address cellular pathways and regulatory mechanisms which are modulated in the process of transformation, but also genetic changes which accumulate during disease progression. Similarities between fallopian tube mucosa and the malignant tissue of HGSC warrant a closer analysis of homeostatic mechanisms in healthy epithelium in order to elucidate key steps in disease development. Finally, we highlight the importance of the cancer stem cell (CSC) identification and understanding of its niche regulation for improvement of therapeutic strategies. PMID:23528888

  6. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD.

    PubMed

    Sunil Kumar, K N; Maruthi, K R; Alfarhan, A H; Rajakrishnan, R; Thomas, J

    2016-05-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard's coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  7. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD

    PubMed Central

    Sunil Kumar, K.N.; Maruthi, K.R.; Alfarhan, A.H.; Rajakrishnan, R.; Thomas, J.

    2015-01-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard’s coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  8. The culturome of the human nose habitats reveals individual bacterial fingerprint patterns.

    PubMed

    Kaspar, Ursula; Kriegeskorte, André; Schubert, Tanja; Peters, Georg; Rudack, Claudia; Pieper, Dietmar H; Wos-Oxley, Melissa; Becker, Karsten

    2016-07-01

    The complex anatomy of the human nose might offer distinct microbial niches. Microbiota composition may affect nose inflammatory diseases and Staphylococcus aureus carriage. Considering different nasal cavity locations, microbial colonization was analysed across individuals exhibiting chronic nasal inflammatory diseases (n = 18) and those without local inflammation signs (n = 16). Samples were collected systematically during surgery and examined by an extensive culture-based approach and, for a subset, by 16S rRNA gene community profiling. Cultivation yielded 141 taxa with members of Staphylococcus, Corynebacterium and Propionibacterium as most common isolates comprising the nasal core culturome together with Finegoldia magna. Staphylococcus aureus was most frequently found in association with Staphylococcus epidermidis and Propionibacterium acnes, and the posterior vestibules were redefined as S. aureus' principle habitat. Culturome analysis revealed host-specific bacterial 'fingerprints' irrespective of host-driven factors or intranasal sites. Comparisons between cultivable and molecular fingerprints demonstrated that only a small fraction of phylotypes (6.2%) was correlated. While the total number of different phylotypes was higher in the molecular dataset, the total number of identifications down to the species level was higher in the culturomic approach. To determine host-specific microbiomes, the advantages of molecular approaches should be combined with the resolution and reliability of species identification by culturomic analyses. PMID:25923378

  9. Combining molecular fingerprints with multidimensional scaling analyses to identify the source of spilled oil from highly similar suspected oils.

    PubMed

    Zhou, Peiyu; Chen, Changshu; Ye, Jianjun; Shen, Wenjie; Xiong, Xiaofei; Hu, Ping; Fang, Hongda; Huang, Chuguang; Sun, Yongge

    2015-04-15

    Oil fingerprints have been a powerful tool widely used for determining the source of spilled oil. In most cases, this tool works well. However, it is usually difficult to identify the source if the oil spill accident occurs during offshore petroleum exploration due to the highly similar physiochemical characteristics of suspected oils from the same drilling platform. In this report, a case study from the waters of the South China Sea is presented, and multidimensional scaling analysis (MDS) is introduced to demonstrate how oil fingerprints can be combined with mathematical methods to identify the source of spilled oil from highly similar suspected sources. The results suggest that the MDS calculation based on oil fingerprints and subsequently integrated with specific biomarkers in spilled oils is the most effective method with a great potential for determining the source in terms of highly similar suspected oils. PMID:25765488

  10. Complete Mitochondrial Genome of Anoplocephala magna Solidifying the Species

    PubMed Central

    Guo, Aijiang

    2016-01-01

    The 2 species of the genus Anoplocephala (Anoplocephalidae), A. perfoliata and A. magna, are among the most important equine cestode parasites. However, there is little information about their differences at the molecular level. The present study revealed that the mitochondrial (mt) genome of A. magna was 13,759 bp in size and 700 bp shorter than that of A. perfoliata. The 2 species includes 2 rRNA, 22 tRNA, and 12 protein-coding genes each. The size of each of the 36 genes was the same as that of A. perfoliata, except for cox1, rrnL, trnC, trnS2(UCN), trnG, trnH, trnQ, and trnP. In the full mitochondrial genome, the sequence similarity was 87.1%. The divergence in the nucleotide and amino acid sequences of individual protein-coding genes ranged from 11.1% to 16% and 6.8% to 16.4%, respectively. The 2 noncoding regions of the mt genome of A. magna were 199 bp and 271 bp in length, while the equivalent regions in A. perfoliata were 875 bp and 276 bp, respectively. The results of this study support the proposal that A. magna and A. perfoliata are separate species, consistent with previous morphological analyses. PMID:27417096

  11. Fingerprint detection

    DOEpatents

    Saunders, George C.

    1992-01-01

    A method for detection and visualization of latent fingerprints is provided and includes contacting a substrate containing a latent print thereon with a colloidal metal composition for time sufficient to allow reaction of said colloidal metal composition with said latent print, and preserving or recording the observable print. Further, the method for detection and visualization of latent fingerprints can include contacting the metal composition-latent print reaction product with a secondary metal-containing solution for time sufficient to allow precipitation of said secondary metal thereby enhancing the visibility of the latent print, and preserving or recording the observable print.

  12. [Study on action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis based on techniques of gene expression profile and molecular fingerprint].

    PubMed

    Zhou, Wei; Song, Xiang-gang; Chen, Chao; Wang, Shu-mei; Liang, Sheng-wang

    2015-08-01

    Action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis were discussed based on gene expression profile and molecular fingerprint in this paper. First, gene expression profiles of atherosclerotic carotid artery tissues and histologically normal tissues in human body were collected, and were screened using significance analysis of microarray (SAM) to screen out differential gene expressions; then differential genes were analyzed by Gene Ontology (GO) analysis and KEGG pathway analysis; to avoid some genes with non-outstanding differential expression but biologically importance, Gene Set Enrichment Analysis (GSEA) were performed, and 7 chemical ingredients with higher negative enrichment score were obtained by Cmap method, implying that they could reversely regulate the gene expression profiles of pathological tissues; and last, based on the hypotheses that similar structures have similar activities, 336 ingredients of compound Danshen dripping pills were compared with 7 drug molecules in 2D molecular fingerprints method. The results showed that 147 differential genes including 60 up-regulated genes and 87 down regulated genes were screened out by SAM. And in GO analysis, Biological Process ( BP) is mainly concerned with biological adhesion, response to wounding and inflammatory response; Cellular Component (CC) is mainly concerned with extracellular region, extracellular space and plasma membrane; while Molecular Function (MF) is mainly concerned with antigen binding, metalloendopeptidase activity and peptide binding. KEGG pathway analysis is mainly concerned with JAK-STAT, RIG-I like receptor and PPAR signaling pathway. There were 10 compounds, such as hexadecane, with Tanimoto coefficients greater than 0.85, which implied that they may be the active ingredients (AIs) of compound Danshen dripping pills in treatment of carotid atherosclerosis (CAs). The present method can be applied to the research on material

  13. Mid-infrared supercontinuum covering the 1.4-13.3 μm molecular fingerprint region using ultra-high NA chalcogenide step-index fibre

    NASA Astrophysics Data System (ADS)

    Petersen, Christian Rosenberg; Møller, Uffe; Kubat, Irnis; Zhou, Binbin; Dupont, Sune; Ramsay, Jacob; Benson, Trevor; Sujecki, Slawomir; Abdel-Moneim, Nabil; Tang, Zhuoqi; Furniss, David; Seddon, Angela; Bang, Ole

    2014-11-01

    The mid-infrared spectral region is of great technical and scientific interest because most molecules display fundamental vibrational absorptions in this region, leaving distinctive spectral fingerprints. To date, the limitations of mid-infrared light sources such as thermal emitters, low-power laser diodes, quantum cascade lasers and synchrotron radiation have precluded mid-infrared applications where the spatial coherence, broad bandwidth, high brightness and portability of a supercontinuum laser are all required. Here, we demonstrate experimentally that launching intense ultra-short pulses with a central wavelength of either 4.5 μm or 6.3 μm into short pieces of ultra-high numerical-aperture step-index chalcogenide glass optical fibre generates a mid-infrared supercontinuum spanning 1.5 μm to 11.7 μm and 1.4 μm to 13.3 μm, respectively. This is the first experimental demonstration to truly reveal the potential of fibres to emit across the mid-infrared molecularfingerprint region’, which is of key importance for applications such as early cancer diagnostics, gas sensing and food quality control.

  14. Theranostic Profiling for Actionable Aberrations in Advanced High Risk Osteosarcoma with Aggressive Biology Reveals High Molecular Diversity: The Human Fingerprint Hypothesis.

    PubMed

    Egas-Bejar, Daniela; Anderson, Pete M; Agarwal, Rishi; Corrales-Medina, Fernando; Devarajan, Eswaran; Huh, Winston W; Brown, Robert E; Subbiah, Vivek

    2014-03-12

    The survival of patients with advanced osteosarcoma is poor with limited therapeutic options. There is an urgent need for new targeted therapies based on biomarkers. Recently, theranostic molecular profiling services for cancer patients by CLIA-certified commercial companies as well as in-house profiling in academic medical centers have expanded exponentially. We evaluated molecular profiles of patients with advanced osteosarcoma whose tumor tissue had been analyzed by one of the following methods: 1. 182-gene next-generation exome sequencing (Foundation Medicine, Boston, MA), 2. Immunohistochemistry (IHC)/PCR-based panel (CARIS Target Now, Irving, Tx), 3.Comparative genome hybridization (Oncopath, San Antonio, TX). 4. Single-gene PCR assays, PTEN IHC (MDACC CLIA), 5. UT Houston morphoproteomics (Houston, TX). The most common actionable aberrations occur in the PI3K/PTEN/mTOR pathway. No patterns in genomic alterations beyond the above are readily identifiable, and suggest both high molecular diversity in osteosarcoma and the need for more analyses to define distinct subgroups of osteosarcoma defined by genomic alterations. Based on our preliminary observations we hypothesize that the biology of aggressive and the metastatic phenotype osteosarcoma at the molecular level is similar to human fingerprints, in that no two tumors are identical. Further large scale analyses of osteosarcoma samples are warranted to test this hypothesis. PMID:25126591

  15. Theranostic profiling for actionable aberrations in advanced high risk osteosarcoma with aggressive biology reveals high molecular diversity: the human fingerprint hypothesis

    PubMed Central

    Egas-Bejar, Daniela; Anderson, Pete M.; Agarwal, Rishi; Corrales-Medina, Fernando; Devarajan, Eswaran; Huh, Winston W.; Brown, Robert E; Subbiah, Vivek

    2014-01-01

    The survival of patients with advanced osteosarcoma is poor with limited therapeutic options. There is an urgent need for new targeted therapies based on biomarkers. Recently, theranostic molecular profiling services for cancer patients by CLIA-certified commercial companies as well as in-house profiling in academic medical centers have expanded exponentially. We evaluated molecular profiles of patients with advanced osteosarcoma whose tumor tissue had been analyzed by one of the following methods: 1. 182-gene next-generation exome sequencing (Foundation Medicine, Boston, MA), 2. Immunohistochemistry (IHC)/PCR-based panel (CARIS Target Now, Irving, Tx), 3. Comparative genome hybridization (Oncopath, San Antonio, TX). 4. Single-gene PCR assays, PTEN IHC (MDACC CLIA), 5. UT Houston morphoproteomics (Houston, TX). The most common actionable aberrations occur in the PI3K/PTEN/ mTOR pathway. No patterns in genomic alterations beyond the above are readily identifiable, and suggest both high molecular diversity in osteosarcoma and the need for more analyses to define distinct subgroups of osteosarcoma defined by genomic alterations. Based on our preliminary observations we hypothesize that the biology of aggressive and the metastatic phenotype osteosarcoma at the molecular level is similar to human fingerprints, in that no two tumors are identical. Further large scale analyses of osteosarcoma samples are warranted to test this hypothesis. PMID:25126591

  16. Fingerprint Recognition with Identical Twin Fingerprints

    PubMed Central

    Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  17. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  18. Aerogel Fingerprint Media

    SciTech Connect

    Miller, Fred S.; Andresen, Brian D.

    1999-09-21

    A fingerprint medium which is made of an aerogel having a predetermined density. The fingerprint medium may have a midrange density for forming plates or may be crushed forming a powder. The fingerprint medium may further include at least one of a metal and metal oxide to enhance characteristics desirable in a fingerprint medium.

  19. Phenotypic and molecular fingerprinting of fast growing rhizobia of field-grown pigeonpea from the eastern edge of the Brazilian Pantanal.

    PubMed

    Costa, F M; Schiavo, J A; Brasil, M S; Leite, J; Xavier, G R; Fernandes, P I

    2014-01-01

    The aim of this study was to evaluate the diversity of rhizobial isolates obtained from root nodules of pigeonpea plants grown at the eastern edge of the Brazilian Pantanal. The bacterial isolates were isolated from root nodules from field-growing pigeonpea grown in two rural settlements of the Aquidauana municipality. The bacterial isolates were characterized phenotypically by means of cultural characterization, intrinsic antibiotic resistance (IAR), salt and high incubation temperature tolerance, and amylolytic and cellulolytic activities. The molecular characterization of the bacterial isolates was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and Box-polymerase chain reaction (PCR) techniques. In addition, the symbiotic performance of selected rhizobial isolates was evaluated in a greenhouse experiment using sterile substrate. The phenotypic characterization revealed that the bacterial strains obtained from pigeonpea root nodules presented characteristics that are uncommon among rhizobial isolates, indicating the presence of new species nodulating the pigeonpea plants in the Brazilian Pantanal. The molecular fingerprinting of these bacterial isolates also showed a highly diverse collection, with both techniques revealing less than 25% similarity among bacterial isolates. The evaluation of symbiotic performance also indicated the presence of microorganisms with high potential to increase the growth and nitrogen content at the shoots of pigeonpea plants. The results obtained in this study indicate the presence of a highly diversified rhizobial community nodulating the pigeonpea at the eastern edge of the Brazilian Pantanal. PMID:24535875

  20. Behavioral response of Daphnia magna to silver salt and nanoparticle exposure

    EPA Science Inventory

    Endpoints in the investigation of the toxicity of metallic nanoparticles have varied from genetic and molecular through whole organism responses such as death and reproduction. The work presented here is an effort to quantify behavioral responses of Daphnia magna to exposure to s...

  1. Advanced Fingerprint Analysis Project Fingerprint Constituents

    SciTech Connect

    GM Mong; CE Petersen; TRW Clauss

    1999-10-29

    The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

  2. “Self” and “Non-Self” in the Control of Phytoalexin Biosynthesis: Plant Phospholipases A2 with Alkaloid-Specific Molecular Fingerprints

    PubMed Central

    Heinze, Michael; Brandt, Wolfgang; Marillonnet, Sylvestre; Roos, Werner

    2015-01-01

    The overproduction of specialized metabolites requires plants to manage the inherent burdens, including the risk of self-intoxication. We present a control mechanism that stops the expression of phytoalexin biosynthetic enzymes by blocking the antecedent signal transduction cascade. Cultured cells of Eschscholzia californica (Papaveraceae) and Catharanthus roseus (Apocynaceae) overproduce benzophenanthridine alkaloids and monoterpenoid indole alkaloids, respectively, in response to microbial elicitors. In both plants, an elicitor-responsive phospholipase A2 (PLA2) at the plasma membrane generates signal molecules that initiate the induction of biosynthetic enzymes. The final alkaloids produced in the respective plant inhibit the respective PLA, a negative feedback that prevents continuous overexpression. The selective inhibition by alkaloids from the class produced in the “self” plant could be transferred to leaves of Nicotiana benthamiana via recombinant expression of PLA2. The 3D homology model of each PLA2 displays a binding pocket that specifically accommodates alkaloids of the class produced by the same plant, but not of the other class; for example, C. roseus PLA2 only accommodates C. roseus alkaloids. The interaction energies of docked alkaloids correlate with their selective inhibition of PLA2 activity. The existence in two evolutionary distant plants of phospholipases A2 that discriminate “self-made” from “foreign” alkaloids reveals molecular fingerprints left in signal enzymes during the evolution of species-specific, cytotoxic phytoalexins. PMID:25670767

  3. Molecular fingerprinting of Salmonella enterica subsp. enterica Typhimurium and Salmonella enterica subsp. enterica derby isolated from tropical seafood in South India.

    PubMed

    Kumar, Rakesh; Surendran, P K; Thampuran, Nirmala

    2008-09-01

    Salmonella enterica subsp. enterica Typhimurium and Salmonella enterica subsp. enterica Derby strains isolated from different seafood were genotyped by PCR-ribotyping and ERIC-PCR assays. This study has ascertained the genetic relatedness among serovars prevalent in tropical seafood. PCR-ribotyping exhibited genetic variation in both Salmonella serovars, and ribotype profile (II) was most predominant, which was observed in 10/18 of Salmonella enterica subsp. enterica Typhimurium and 7/17 Salmonella enterica subsp. enterica Derby isolates. Cluster analysis of ERIC-PCR for Salmonella enterica subsp. enterica Typhimurium strains exhibited nine different banding patterns and four strains showed >95% genetic homology within the cluster pairs. ERIC-PCR produced more genetic variations in Salmonella enterica subsp. enterica Typhimurium; nevertheless, both methods were found to be comparable for Salmonella enterica subsp. enterica Derby isolates. Discrimination index of PCR-ribotyping for Salmonella enterica subsp. enterica Typhimurium isolates was obtained at 0.674 and index value 0.714 was observed for Salmonella enterica subsp. enterica Derby strains. Molecular fingerprinting investigation highlighted the hypothesis of diverse routes of Salmonella contamination in seafood as multiple clones of Salmonella enterica subsp. enterica Typhimurium and Salmonella enterica subsp. enterica Derby were detected in same or different seafood throughout the study period. PMID:18480975

  4. "Self" and "non-self" in the control of phytoalexin biosynthesis: plant phospholipases A2 with alkaloid-specific molecular fingerprints.

    PubMed

    Heinze, Michael; Brandt, Wolfgang; Marillonnet, Sylvestre; Roos, Werner

    2015-02-01

    The overproduction of specialized metabolites requires plants to manage the inherent burdens, including the risk of self-intoxication. We present a control mechanism that stops the expression of phytoalexin biosynthetic enzymes by blocking the antecedent signal transduction cascade. Cultured cells of Eschscholzia californica (Papaveraceae) and Catharanthus roseus (Apocynaceae) overproduce benzophenanthridine alkaloids and monoterpenoid indole alkaloids, respectively, in response to microbial elicitors. In both plants, an elicitor-responsive phospholipase A2 (PLA2) at the plasma membrane generates signal molecules that initiate the induction of biosynthetic enzymes. The final alkaloids produced in the respective plant inhibit the respective PLA, a negative feedback that prevents continuous overexpression. The selective inhibition by alkaloids from the class produced in the "self" plant could be transferred to leaves of Nicotiana benthamiana via recombinant expression of PLA2. The 3D homology model of each PLA2 displays a binding pocket that specifically accommodates alkaloids of the class produced by the same plant, but not of the other class; for example, C. roseus PLA2 only accommodates C. roseus alkaloids. The interaction energies of docked alkaloids correlate with their selective inhibition of PLA2 activity. The existence in two evolutionary distant plants of phospholipases A2 that discriminate "self-made" from "foreign" alkaloids reveals molecular fingerprints left in signal enzymes during the evolution of species-specific, cytotoxic phytoalexins. PMID:25670767

  5. Isolation and expression analysis of partial sequences of heavy metal transporters from Brassica juncea by coupling high throughput cloning with a molecular fingerprinting technique.

    PubMed

    Das, Soumita; Sen, Monali; Saha, Chinmay; Chakraborty, Debjani; Das, Antara; Banerjee, Manidipa; Seal, Anindita

    2011-07-01

    Heavy metal transporters play a key role in regulating metal accumulation and transport in plants. These are important candidate genes to study in metal tolerant and accumulator plants for their potential use in environmental clean up. We coupled a degenerate primer-based RT-PCR approach with a molecular fingerprinting technique based on amplified rDNA restriction analysis (ARDRA) to identify novel ESTs corresponding to heavy metal transporters from metal accumulator Brassica juncea. We utilized this technique to clone several family members of natural resistance-associated macrophage proteins (NRAMP) and yellow stripe-like proteins (YSL) in a high throughput manner to distinguish between closely related isoforms and/or allelic variants from the allopolyploid B. juncea. Partial clones of 23 Brassica juncea NRAMPs and 27 YSLs were obtained with similarity to known Arabidopsis thaliana and Noccaea (Thlaspi) caerulescens NRAMP and YSL genes. The cloned transporters showed Brassica-specific changes in domains, which can have important functional consequences. Semi-quantitative RT-PCR-based expression analysis of chosen members indicated that even closely related isoforms/allelic variants of BjNRAMP and BjYSL have distinct tissue-specific and metal-dependent expressions which might be essential for adaptive fitness and heavy metal tolerance. Consistent to this, BjYSL6.1 and BjYSL5.8 were found to show elevated expressions specifically in cadmium-treated shoots and lead-treated roots of B. juncea, respectively. PMID:21394470

  6. QSAR for RNases and theoretic-experimental study of molecular diversity on peptide mass fingerprints of a new Leishmania infantum protein.

    PubMed

    González-Díaz, Humberto; Dea-Ayuela, María A; Pérez-Montoto, Lázaro G; Prado-Prado, Francisco J; Agüero-Chapín, Guillermín; Bolas-Fernández, Francisco; Vazquez-Padrón, Roberto I; Ubeira, Florencio M

    2010-05-01

    The toxicity and low success of current treatments for Leishmaniosis determines the search of new peptide drugs and/or molecular targets in Leishmania pathogen species (L. infantum and L. major). For example, Ribonucleases (RNases) are enzymes relevant to several biologic processes; then, theoretical and experimental study of the molecular diversity of Peptide Mass Fingerprints (PMFs) of RNases is useful for drug design. This study introduces a methodology that combines QSAR models, 2D-Electrophoresis (2D-E), MALDI-TOF Mass Spectroscopy (MS), BLAST alignment, and Molecular Dynamics (MD) to explore PMFs of RNases. We illustrate this approach by investigating for the first time the PMFs of a new protein of L. infantum. Here we report and compare new versus old predictive models for RNases based on Topological Indices (TIs) of Markov Pseudo-Folding Lattices. These group of indices called Pseudo-folding Lattice 2D-TIs include: Spectral moments pi ( k )(x,y), Mean Electrostatic potentials xi ( k )(x,y), and Entropy measures theta ( k )(x,y). The accuracy of the models (training/cross-validation) was as follows: xi ( k )(x,y)-model (96.0%/91.7%)>pi ( k )(x,y)-model (84.7/83.3) > theta ( k )(x,y)-model (66.0/66.7). We also carried out a 2D-E analysis of biological samples of L. infantum promastigotes focusing on a 2D-E gel spot of one unknown protein with M<20, 100 and pI <7. MASCOT search identified 20 proteins with Mowse score >30, but not one >52 (threshold value), the higher value of 42 was for a probable DNA-directed RNA polymerase. However, we determined experimentally the sequence of more than 140 peptides. We used QSAR models to predict RNase scores for these peptides and BLAST alignment to confirm some results. We also calculated 3D-folding TIs based on MD experiments and compared 2D versus 3D-TIs on molecular phylogenetic analysis of the molecular diversity of these peptides. This combined strategy may be of interest in drug development or target identification

  7. Fluorescence fingerprints and Cu2+-complexing ability of individual molecular size fractions in soil- and waste-borne DOM.

    PubMed

    Knoth de Zarruk, K; Scholer, G; Dudal, Y

    2007-09-01

    Land spreading of organic materials introduces large amounts of dissolved organic matter (DOM) into the soil. DOM has the ability to form stable complexes with heavy metals and can facilitate their transport towards the groundwater. The effects on soil processes are difficult to assess, because different DOM components might react differently towards metal ions. The objective of this study was to investigate the fluorescence signature and the Cu2+-binding capacity of individual molecular size fractions of DOM from various sources. DOM extracted from leaf compost, chicken manure, sugar cane vinasse and a fulvic hypercalcaric cambisol was fractionated by the means of dialysis into four molecular size classes: MW<500, 50012000-14000 Da. Vinasse and leaf compost contained around 80% and 70%, respectively, of the total organic carbon in the fractions with low molecular weight (MW<3500 Da); in chicken manure and soil these fractions accounted for 40% and 50% only. Fluorescence was highest in the fraction MW>12000 Da for leaf compost, chicken manure and soil. The opposite result was obtained for vinasse, where the fractions with low molecular weight showed highest fluorescence intensities, distinguishing it from all other samples. Vinasse showed the greatest ability to bind Cu2+ with a resulting complex concentration of 6.31mgl(-1) while in contact with an excess of Cu2+. Leaf compost, soil and chicken manure followed with 2.69, 1.12, and 0.85mgl(-1), respectively. Within vinasse, the fraction MW<500 Da was able to form the most DOM-Cu complexes, indicating the importance of low molecular weight fractions in metal binding. PMID:17498777

  8. Development of 3D-QSAR Model for Acetylcholinesterase Inhibitors Using a Combination of Fingerprint, Molecular Docking, and Structure-Based Pharmacophore Approaches.

    PubMed

    Lee, Sehan; Barron, Mace G

    2015-11-01

    Acetylcholinesterase (AChE), a serine hydrolase vital for regulating the neurotransmitter acetylcholine in animals, has been used as a target for drugs and pesticides. With the increasing availability of AChE crystal structures, with or without ligands bound, structure-based approaches have been successfully applied to AChE inhibitors (AChEIs). The major limitation of these approaches has been the small applicability domain due to the lack of structural diversity in the training set. In this study, we developed a 3 dimensional quantitative structure-activity relationship (3D-QSAR) for inhibitory activity of 89 reversible and irreversible AChEIs including drugs and insecticides. A 3D-fingerprint descriptor encoding protein-ligand interactions was developed using molecular docking and structure-based pharmacophore to rationalize the structural requirements responsible for the activity of these compounds. The obtained 3D-QSAR model exhibited high correlation value (R(2) = 0.93) and low mean absolute error (MAE = 0.32 log units) for the training set (n = 63). The model was predictive across a range of structures as shown by the leave-one-out cross-validated correlation coefficient (Q(2) = 0.89) and external validation results (n = 26, R(2) = 0.89, and MAE = 0.38 log units). The model revealed that the compounds with high inhibition potency had proper conformation in the active site gorge and interacted with key amino acid residues, in particular Trp84 and Phe330 at the catalytic anionic site, Trp279 at the peripheral anionic site, and Gly118, Gly119, and Ala201 at the oxyanion hole. The resulting universal 3D-QSAR model provides insight into the multiple molecular interactions determining AChEI potency that may guide future chemical design and regulation of toxic AChEIs. PMID:26202430

  9. On latent fingerprint enhancement

    NASA Astrophysics Data System (ADS)

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K.

    2010-04-01

    Automatic feature extraction in latent fingerprints is a challenging problem due to poor quality of most latents, such as unclear ridge structures, overlapped lines and letters, and overlapped fingerprints. We proposed a latent fingerprint enhancement algorithm which requires manually marked region of interest (ROI) and singular points. The core of the proposed enhancement algorithm is a novel orientation field estimation algorithm, which fits orientation field model to coarse orientation field estimated from skeleton outputted by a commercial fingerprint SDK. Experimental results on NIST SD27 latent fingerprint database indicate that by incorporating the proposed enhancement algorithm, the matching accuracy of the commercial matcher was significantly improved.

  10. Purification and studies on characteristics of cholinesterases from Daphnia magna *

    PubMed Central

    Yang, Yan-xia; Niu, Li-zhi; Li, Shao-nan

    2013-01-01

    Due to their significant value in both economy and ecology, Daphnia had long been employed to investigate in vivo response of cholinesterase (ChE) in anticholinesterase exposures, whereas the type constitution and property of the enzyme remained unclear. A type of ChE was purified from Daphnia magna using a three-step procedure, i.e., Triton X-100 extraction, ammonium sulfate precipitation, and diethylaminoethyl (DEAE)-Sepharose™-Fast-Flow chromatography. According to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), molecular mass of the purified ChE was estimated to be 84 kDa. Based on substrate studies, the purified enzyme preferred butyrylthiocholine iodide (BTCh) [with maximum velocity (V max)/Michaelis constant (K m)=8.428 L/(min·mg protein)] to acetylthiocholine iodide (ATCh) [with V max/K m=5.346 L/(min·mg protein)] as its substrate. Activity of the purified enzyme was suppressed by high concentrations of either ATCh or BTCh. Inhibitor studies showed that the purified enzyme was more sensitive towards inhibition by tetraisopropylpyrophosphoramide (iso-OMPA) than by 1,5-bis(4-allyldimethylammoniumphenyl) pentan-3-one dibromide (BW284C51). Result of the study suggested that the purified ChE was more like a type of pseudocholinesterase, and it also suggested that Daphnia magna contained multiple types of ChE in their bodies. PMID:23549850

  11. Conversion of the pathogenic fungus Colletotrichum magna to a nonpathogenic, endophytic mutualist by gene disruption

    USGS Publications Warehouse

    Redman, R.S.; Ranson, J.C.; Rodriguez, R.J.

    1999-01-01

    Hygromycin-resistant transformants of the cucurbit pathogen Colletotrichum magna (teleomorph: Glomerella magna) were generated by restriction enzyme-mediated integration (REMI) transformation. A rapid pathogenicity assay involving watermelon (Citrullus lanatus) seedlings was developed and 14,400 REMI transformants were screened and assessed for their ability to cause disease, colonize plant tissues, and confer disease resistance against wild-type C. magna. A total of 176 nonpathogenic REMI mutants capable of colonizing cucurbit plants were isolated and assigned to three groups based on their ability to confer disease resistance: phenotype A, 80 to 100% disease protection; phenotype B, 10 to 65% disease protection; and phenotype C, 0 to 4% disease protection. Molecular and genetic analyses of one REMI mutant (R1) indicated that the nonpathogenic phenotype A resulted from a single-site integration. R1 showed a 1:1 segregation of hygromycin resistance and nonpathogenicity and all hygromycin-resistant progeny were nonpathogenic. The integrated vector and 5.5 kb of flanking fungal genomic DNA were isolated from R1 and designated pGMR1. To verify that pGMR1 contained pathogenicity gene sequences, a wild-type isolate of C. magna was transformed with pGMR1 to induce gene disruptions by homologous integration. Approximately 47% of the pGMR1 transformants expressed phenotype A, indicating homologous integration and gene disruption.

  12. How fingerprints came into use for personal identification.

    PubMed

    Caplan, R M

    1990-07-01

    The use of fingerprints for personal identification became widespread early in this century. How the fingerprints slowly became standardized involves many persons, including Nathaniel Grew, Johannes Purkinje, William Herschel, Henry Faulds, Charles Darwin, Francis Galton, Mark Twain, Juan Vucetich, Edward Henry, and J. Edgar Hoover. Although fingerprints have been noted and used since antiquity, a 25-year burst of activity that secured adoption of their use for identification began in about 1880. New modifications and applications have continued to the present. The history of fingerprints offers an excellent example of how society adopts innovations. This story also includes a bitter struggle for appropriate credit for various crucial steps in developing and adopting this important tool. More recent technical advances, including computers and molecular biology, now supplement the ease and usefulness of fingerprints, although the word fingerprinting continues in use by metaphoric extension. PMID:2195070

  13. Comparing Bacterial DNA Microarray Fingerprints

    SciTech Connect

    Willse, Alan R.; Chandler, Darrell P.; White, Amanda M.; Protic, Miroslava; Daly, Don S.; Wunschel, Sharon C.

    2005-08-15

    Detecting subtle genetic differences between microorganisms is an important problem in molecular epidemiology and microbial forensics. In a typical investigation, gel electrophoresis is used to compare randomly amplified DNA fragments between microbial strains, where the patterns of DNA fragment sizes are proxies for a microbe's genotype. The limited genomic sample captured on a gel is often insufficient to discriminate nearly identical strains. This paper examines the application of microarray technology to DNA fingerprinting as a high-resolution alternative to gel-based methods. The so-called universal microarray, which uses short oligonucleotide probes that do not target specific genes or species, is intended to be applicable to all microorganisms because it does not require prior knowledge of genomic sequence. In principle, closely related strains can be distinguished if the number of probes on the microarray is sufficiently large, i.e., if the genome is sufficiently sampled. In practice, we confront noisy data, imperfectly matched hybridizations, and a high-dimensional inference problem. We describe the statistical problems of microarray fingerprinting, outline similarities with and differences from more conventional microarray applications, and illustrate the statistical fingerprinting problem for 10 closely related strains from three Bacillus species, and 3 strains from non-Bacillus species.

  14. Physics and fingerprints

    NASA Astrophysics Data System (ADS)

    Voss-de Haan, Patrick

    2006-08-01

    This article discusses a variety of aspects in the detection and development of fingerprints and the physics involved in it. It gives an introduction to some basic issues like composition and properties of fingerprint deposits and a rudimentary framework of dactyloscopy; it covers various techniques for the visualization of latent fingerprints; and it concludes with a view of current research topics. The techniques range from very common procedures, such as powdering and cyanoacrylate fuming, to more demanding methods, for example luminescence and vacuum metal deposition, to fairly unusual approaches like autoradiography. The emphasis is placed on the physical rather than the forensic aspects of these topics while trying to give the physicist—who is not dealing with fingerprinting and forensic science on a daily basis—a feeling for the problems and solutions in the visualization of latent fingerprints.

  15. Advanced fingerprint verification software

    NASA Astrophysics Data System (ADS)

    Baradarani, A.; Taylor, J. R. B.; Severin, F.; Maev, R. Gr.

    2016-05-01

    We have developed a fingerprint software package that can be used in a wide range of applications from law enforcement to public and private security systems, and to personal devices such as laptops, vehicles, and door- locks. The software and processing units are a unique implementation of new and sophisticated algorithms that compete with the current best systems in the world. Development of the software package has been in line with the third generation of our ultrasonic fingerprinting machine1. Solid and robust performance is achieved in the presence of misplaced and low quality fingerprints.

  16. Longitudinal study of fingerprint recognition

    PubMed Central

    Yoon, Soweon; Jain, Anil K.

    2015-01-01

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject’s age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis. PMID:26124106

  17. Altered fingerprints: analysis and detection.

    PubMed

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K

    2012-03-01

    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem. PMID:21808092

  18. Fingerprinting of music scores

    NASA Astrophysics Data System (ADS)

    Irons, Jonathan; Schmucker, Martin

    2004-06-01

    Publishers of sheet music are generally reluctant in distributing their content via the Internet. Although online sheet music distribution's advantages are numerous the potential risk of Intellectual Property Rights (IPR) infringement, e.g. illegal online distributions, disables any innovation propensity. While active protection techniques only deter external risk factors, additional technology is necessary to adequately treat further risk factors. For several media types including music scores watermarking technology has been developed, which ebeds information in data by suitable data modifications. Furthermore, fingerprinting or perceptual hasing methods have been developed and are being applied especially for audio. These methods allow the identification of content without prior modifications. In this article we motivate the development of watermarking and fingerprinting technologies for sheet music. Outgoing from potential limitations of watermarking methods we explain why fingerprinting methods are important for sheet music and address potential applications. Finally we introduce a condept for fingerprinting of sheet music.

  19. Online fingerprint verification.

    PubMed

    Upendra, K; Singh, S; Kumar, V; Verma, H K

    2007-01-01

    As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications. PMID:17365425

  20. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  1. Biokinetics and tolerance development of toxic metals in Daphnia magna.

    PubMed

    Tsui, Martin Tsz-Ki; Wang, Wen-Xiong

    2007-05-01

    Daphnia magna is widespread in many freshwater systems of temperate regions and frequently is used to test metal toxicity. Recently, studies have been performed to determine metal biokinetics and development of tolerance in this important zooplankton species. In the present paper, we review the recent progress in these areas and suggest possible directions for future studies. Substantial differences exist in aqueous uptake, dietary assimilation, and elimination of several metals (Cd, Se, Zn, Ag, Hg, and MeHg) by D. magna. The routes of uptake are metal-specific, with Se and MeHg being accumulated predominantly through diet. All metals except Ag can be biomagnified from algae to D. magna, providing that metal concentrations in algae and algal food density are relatively low. Methylmercury is biomagnified in all situations. As a route for metal elimination in D. magna, maternal transfer is especially important for Se, Zn, and MeHg. On the other hand, the effect of single-generation exposure to metals on D. magna is very different from multigeneration exposure, which often results in a significantly higher metal tolerance. Moreover, D. magna easily loses metal tolerance developed through long-term exposure. Recovery from metal stress can temporarily increase the sensitivity of D. magna to metal toxicity. Finally, metallothionein-like protein is responsible for minimizing metal toxicity in D. magna. The results inferred from these studies can be extrapolated to other aquatic invertebrates as well as to other pollutants in the aquatic environment. PMID:17521151

  2. Development of resistance to cyfluthrin and naphthalene among Daphnia magna.

    PubMed

    Brausch, John M; Smith, Philip N

    2009-07-01

    In this study, Daphnia magna were exposed to a pyrethroid insecticide (cyfluthrin) or a polycyclic aromatic hydrocarbon (naphthalene) for 12 generations to evaluate development of resistance followed by a 12 generation recovery period. Twenty-four hour old D. magna were exposed to concentrations of each chemical resulting in 50-70% mortality to select for the least sensitive individuals. LC50 values, survival, reproductive output, and time to first brood in stressor-exposed and control D. magna were recorded for each generation. Significant changes in LC50 values were observed after 4 generations and then declined after 6-10 generations post-exposure. D. magna were 5 times less sensitive to cyfluthrin and 3 times less sensitive to naphthalene as compared to controls after 12 generations of exposure. There were no differences in survival, time to first brood, or total number of offspring produced between control and either of the resistant F13 D. magna. Cyfluthrin exposed D. magna exhibited cross-resistance to DDT and methyl parathion, and naphthalene resistant D. magna were less sensitive than controls to both pyrene and benz(a)anthracene. When the cytochrome P450 inhibitor piperonyl butoxide was used in conjunction with cyfluthrin and naphthalene the sensitivity of resistant and control D. magna were equal, suggesting P450s were responsible for conveying resistance. This study demonstrates that life history and organisms' capacity to develop resistance is important to consider ensuring accuracy of ecological risk assessments. PMID:19399609

  3. A DAPHNIA MAGNA SHORT-TERM SURVIVAL AND GROWTH TEST

    EPA Science Inventory

    With the change in acceptable test temperatures for invertebrate toxicity tests from <20oC to 25oC, it is now possible to use Daphnia magna for short-term chronic testing. When cultured at 25oC the dry weight of <24 hr old D. magna ranges from 7 to 15 g depending upon nutrition,...

  4. Teaching Magna Carta in American History: Land, Law, and Legacy

    ERIC Educational Resources Information Center

    Saxe, David W.

    2010-01-01

    Magna Carta, that great cornerstone of American liberty, has been in the news lately. Put up for sale by three-time U.S. Presidential candidate Ross Perot in December 2007, the 1297 version of Magna Carta displayed in the National Archives was sold to financier David Rubenstein for $21.3 million. While its sale demonstrates the cash value of the…

  5. Compounds altering fat storage in Daphnia magna.

    PubMed

    Jordão, Rita; Garreta, Elba; Campos, Bruno; Lemos, Marco F L; Soares, Amadeu M V M; Tauler, Romà; Barata, Carlos

    2016-03-01

    The analysis of lipid disruptive effects in invertebrates is limited by our poor knowledge of the lipid metabolic pathways. A recent study showed that tributyltin activated the ecdysteroid, juvenile hormone and retinoic X receptor signaling pathways, and disrupted the dynamics of neutral lipids in the crustacean Daphnia magna impairing the transfer of triacylglycerols to eggs and hence promoting their accumulation in post-spawning females. Tributyltin disruptive effects correlated with lower fitness for offspring and adults. The present study aims to addresses effects of existing compounds on storage lipids in post-spawning females and their health effects. D. magna individuals were exposed 12 chemicals that included vertebrate obesogens (tributyltin, triphenyltin, bisphenol A, nonylphenol, di-2-ethylhexyl phthalate), other contaminants known to affect arthropods (pyriproxyfen, fenarimol, methoprene, emamectin benzoate and fluoxetine), as well as the natural hormones methyl farnesoate and 20-hydroxyecdysone. Reproductive effects were also assessed. Quantitative changes in storage lipids accumulated in lipid droplets were studied using Nile red staining, which showed a close relationship with whole organism levels of triacylglycerols. Ten compounds altered storage lipids in a concentration related manner enhancing (tributyltin, bisphenol A, methyl farnesoate, pyriproxyfen and 20-hydroxyecdysone) or decreasing (nonylphenol, fenarimol, emamectin benzoate, methoprene and fluoxetine) their levels in post-spawning females. Eight compounds that altered lipid levels also had detrimental effects on growth and/or reproduction. PMID:26747981

  6. Toxicity of the cyanobacterium Cylindrospermopsis raciborskii to Daphnia magna.

    PubMed

    Nogueira, Isabel C G; Saker, Martin L; Pflugmacher, Stephan; Wiegand, Claudia; Vasconcelos, Vítor M

    2004-10-01

    The effect of two strains of Cylindrospermopsis raciborskii on the survivorship, somatic growth, and detoxification processes of juvenile Daphnia magna were investigated. Both strains of C. raciborskii (and also Ankistrodesmus falcatus, used as the control) were given to newborn D. magna at equivalent biovolumes. The survival curves for D. magna subjected to the two C. raciborskii treatments differed from those of the starved and fed treatments. After 48 h of exposure, the percentage of D. magna surviving after exposure to Cylin-A (a cylindrospermopsin-producing strain isolated from Australia) and Cylin-P (a non-cylindrospermopsin-producing strain isolated from Portugal) was 10.00% and 93.33%, respectively. The strain that produces cylindrospermopsin caused the greatest toxic effect in juvenile D. magna. Statistically significant differences in D. magna body size between the four treatments (Cylin-A, Cylin-P, A. falcatus, and starved) were detected after 48 h of exposure. The juvenile D. magna that received the two C. raciborskii treatments showed an increase in size (relative to their size at T(0)) of 2.54% and 38.14%, respectively. These values were statistically significantly different than those of the A. falcatus-fed control (55.54%) and the starved control (11.47%). In both C. raciborskii treatments there was a tendency for increased GST enzyme activities after 24 h of exposure. Cylindrospermopsin was detected (HPLC-MS/MS) in D. magna tissues after 24 and 48 h (0.025 and 0.02 ng animal(-)1, respectively). The results of this study indicate that C. raciborskii can affect the fitness and growth potential of juvenile D. magna. PMID:15352261

  7. An Introduction to DNA Fingerprinting.

    ERIC Educational Resources Information Center

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  8. Fingerprinting with Wow

    NASA Astrophysics Data System (ADS)

    Yu, Eugene; Craver, Scott

    2006-02-01

    Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

  9. Small scale mass culture of Daphnia magna Straus

    SciTech Connect

    Rees, J.T.; Oldfather, J.M.

    1980-02-01

    Daphnia magna Straus 1820 was raised on a defined medium in 4-liter flasks with controlled light intensity, temperature, and algal food species. Adult D. magna tolerated high levels of ammonia (up to 108 ..mu..M) at high pH (> 10), although at these levels parthenogenic reproduction may be inhibited. Scenedesmus quadricauda and Ankistrodesmus sp. were satisfactory food sources, and by utilizing Ankistrodesmus densities greater than one animal per ml were achieved. Maintaining the pH at about 7 to 8 seems to be important for successful D. magna culture.

  10. Historeceptomic Fingerprints for Drug-Like Compounds

    PubMed Central

    Shmelkov, Evgeny; Grigoryan, Arsen; Swetnam, James; Xin, Junyang; Tivon, Doreen; Shmelkov, Sergey V.; Cardozo, Timothy

    2015-01-01

    Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology). The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300,000 experimentally determined bioactivity values from the ChEMBL database and 4.2 billion molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics) scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic, in vivo picture of the mechanism of any drug's action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at drugable.org for access through a user-friendly web site. PMID:26733872

  11. Vulnerabilities of fingerprint reader to fake fingerprints attacks.

    PubMed

    Espinoza, Marcela; Champod, Christophe; Margot, Pierre

    2011-01-30

    The purpose of this research is to assess the vulnerabilities of a high resolution fingerprint sensor when confronted with fake fingerprints. The study has not been focused on the decision outcome of the biometric device, but essentially on the scores obtained following the comparison between a query (genuine or fake) and a template using an AFIS system. To do this, fake fingerprints of 12 subjects have been produced with and without their cooperation. These fake fingerprints have been used alongside with real fingers. The study led to three major observations: First, genuine fingerprints produced scores higher than fake fingers (translating a closer proximity) and this tendency is observed considering each subject separately. Second, scores are however not sufficient as a single measure to differentiate these samples (fake from genuine) given the variation due to the donors themselves. That explains why fingerprint readers without vitality detection can be fooled. Third, production methods and subjects greatly influence the scores obtained for fake fingerprints. PMID:21216360

  12. Fingerprinting digital elevation maps

    NASA Astrophysics Data System (ADS)

    Gou, Hongmei; Wu, Min

    2006-02-01

    Digital elevation maps (DEMs) provide a digital representation of 3-D terrain information. In civilian applications, high-precision DEMs carry a high commercial value owing to the large amount of effort in acquiring them; and in military applications, DEMs are often used to represent critical geospatial information in sensitive operations. These call for new technologies to prevent unauthorized distribution and to trace traitors in the event of information leak related to DEMs. In this paper, we propose a new digital fingerprinting technique to protect DEM data from illegal re-distribution. The proposed method enables reliable detection of fingerprints from both 3-D DEM data set and its 2-D rendering, whichever format that is available to a detector. Our method starts with extracting from a DEM a set of critical contours either corresponding to important topographic features of the terrain or having application-dependent importance. Fingerprints are then embedded into these critical contours by employing parametric curve modeling and spread spectrum embedding. Finally, a fingerprinted DEM is constructed to incorporate the marked 2-D contours. Through experimental results, we demonstrate the robustness of the proposed method against a number of challenging attacks applied to either DEMs or their contour representations.

  13. An assessment of the bioaccumulation of estrone in Daphnia magna.

    PubMed

    Gomes, Rachel L; Deacon, Hannah E; Lai, Ka M; Birkett, Jason W; Scrimshaw, Mark D; Lester, John N

    2004-01-01

    The bioaccumulation of estrone by Daphnia magna was determined. Direct uptake via the aqueous medium occurred within the first 16 h. A bioconcentration factor of 228 was established over all temporal periods. Ingestion via Chlorella vulgaris gave a partitioning factor of 24, which may approximate to a biomagnification factor assuming steady state conditions. These preliminary results indicate that the partitioning to Daphnia magna via the food source, C. vulgaris is less significant than bioconcentration. PMID:14768873

  14. Effects of acid precipitation on Daphnia magna

    SciTech Connect

    Parent, S.; Cheetham, R.D.

    1980-08-01

    Pollutants derived from fossil fuel combustion and precipitated from the atmosphere have substantially increased in the past decades. These materials, precipitated in such industrialized areas as southeastern Canada, have caused considerable alterations in aquatic ecosystems. Precipitation over most of the eastern United States is presently 10 to 500 times more acidic than is natural. Most affected aquatic ecosystems contain oligotrophic waters in regions of thin poorly buffered soils. Zooplankton are an important link in food chains of aquatic ecosystems and their disappearance or decline could drastically affect trophic relationships. Declines in zooplankton density in response to acid precipitation have been reported and short term survival of Daphnia pulex between pH 4.3 and 10.4; however, its potential for reproduction was limited to a fairly narrow range. Anderson (1944) noted the advantages of using daphnia as test organisms, and concluded that Daphnia magna was representative of other abundant zooplankton in sensitivity to toxic substances.

  15. DNA-based molecular fingerprinting of eukaryotic protists and cyanobacteria contributing to sinking particle flux at the Bermuda Atlantic time-series study

    NASA Astrophysics Data System (ADS)

    Amacher, Jessica; Neuer, Susanne; Lomas, Michael

    2013-09-01

    We used denaturing gradient gel electrophoresis (DGGE) to examine the protist and cyanobacterial communities in the euphotic zone (0-120 m) and in corresponding 150 m particle interceptor traps at the Bermuda Atlantic Time-series Study (BATS) in a two-year monthly time-series from May 2008 to April 2010. Dinoflagellates were the most commonly detected taxa in both water column and trap samples throughout the time series. Diatom sequences were found only eight times in the water column, and only four times in trap material. Small-sized eukaryotic taxa, including the prasinophyte genera Ostreococcus, Micromonas, and Bathycoccus, were present in trap samples, as were the cyanobacteria Prochlorococcus and Synechococcus. Synechococcus was usually overrepresented in trap material, whereas Prochlorococcus was underrepresented compared to the water column. Both seasonal and temporal variability affected patterns of ribosomal DNA found in sediment traps. The two years of this study were quite different hydrographically, with higher storm activity and the passing of a cyclonic eddy causing unusually deep mixing in winter 2010. This was reflected in the DGGE fingerprints of the water column, which showed greater phylotype richness of eukaryotes and a lesser richness of cyanobacteria in winter of 2010 compared with the winter of 2009. Increases in eukaryotic richness could be traced to increased diversity of prasinophytes and prymnesiophytes. The decrease in cyanobacterial richness was in turn reflected in the trap composition, but the increase in eukaryotes was not, indicating a disproportionate contribution of certain taxa to sinking particle flux.

  16. Characterizing the toxicity of pulsed selenium exposure to Daphnia magna.

    PubMed

    Hoang, Tham C; Klaine, Stephen J

    2008-03-01

    The acute toxicity of selenium (Se) to aquatic biota has been studied extensively for decades. However, most studies have used a constant concentration aqueous exposure of Se to an invertebrate species. Since constant concentration exposure of toxicants to invertebrates is unusual in the environment, episodic exposure or pulsed exposures may represent true risk to aquatic biota more accurately. This research was designed to characterize the toxicity effects of pulsed Se exposure to Daphnia magna. Selenium exposure was varied during a 21-d chronic toxicity test to examine the effects of exposure concentration, duration, and recovery on survival, growth, and reproduction of D. magna. While D. magna did not die during exposures, latent mortality was observed. Latent mortality increased with exposure concentration and duration. Hence, standard toxicity test using continuous exposures would underestimate Se toxicity. Risk assessment method using results of continuous exposure would underestimate risk of Se to biota. For double-pulse exposures, cumulative mortality on day 21 was higher when time interval between pulses was shorter. With the same total exposure time, continuous exposure caused higher toxicity than did pulsed exposures due to recovery and tolerance development in D. magna after earlier pulses. Growth and reproduction of surviving D. magna were not affected by pulsed Se exposure due to recovery of D. magna after removal of the pulses. Based on these results, risk assessment for Se should take latent effects and the effect of recovery in to account. PMID:18190947

  17. Distribution of Virulence Factors and Molecular Fingerprinting of Aeromonas Species Isolates from Water and Clinical Samples: Suggestive Evidence of Water-to-Human Transmission ▿ †

    PubMed Central

    Khajanchi, Bijay K.; Fadl, Amin A.; Borchardt, Mark A.; Berg, Richard L.; Horneman, Amy J.; Stemper, Mary E.; Joseph, Sam W.; Moyer, Nelson P.; Sha, Jian; Chopra, Ashok K.

    2010-01-01

    A total of 227 isolates of Aeromonas obtained from different geographical locations in the United States and different parts of the world, including 28 reference strains, were analyzed to determine the presence of various virulence factors. These isolates were also fingerprinted using biochemical identification and pulse-field gel electrophoresis (PFGE). Of these 227 isolates, 199 that were collected from water and clinical samples belonged to three major groups or complexes, namely, the A. hydrophila group, the A. caviae-A. media group, and the A. veronii-A. sobria group, based on biochemical profiles, and they had various pulsotypes. When virulence factor activities were examined, Aeromonas isolates obtained from clinical sources had higher cytotoxic activities than isolates obtained from water sources for all three Aeromonas species groups. Likewise, the production of quorum-sensing signaling molecules, such as N-acyl homoserine lactone, was greater in clinical isolates than in isolates from water for the A. caviae-A. media and A. hydrophila groups. Based on colony blot DNA hybridization, the heat-labile cytotonic enterotoxin gene and the DNA adenosine methyltransferase gene were more prevalent in clinical isolates than in water isolates for all three Aeromonas groups. Using colony blot DNA hybridization and PFGE, we obtained three sets of water and clinical isolates that had the same virulence signature and had indistinguishable PFGE patterns. In addition, all of these isolates belonged to the A. caviae-A. media group. The findings of the present study provide the first suggestive evidence of successful colonization and infection by particular strains of certain Aeromonas species after transmission from water to humans. PMID:20154106

  18. Gabor filter based fingerprint image enhancement

    NASA Astrophysics Data System (ADS)

    Wang, Jin-Xiang

    2013-03-01

    Fingerprint recognition technology has become the most reliable biometric technology due to its uniqueness and invariance, which has been most convenient and most reliable technique for personal authentication. The development of Automated Fingerprint Identification System is an urgent need for modern information security. Meanwhile, fingerprint preprocessing algorithm of fingerprint recognition technology has played an important part in Automatic Fingerprint Identification System. This article introduces the general steps in the fingerprint recognition technology, namely the image input, preprocessing, feature recognition, and fingerprint image enhancement. As the key to fingerprint identification technology, fingerprint image enhancement affects the accuracy of the system. It focuses on the characteristics of the fingerprint image, Gabor filters algorithm for fingerprint image enhancement, the theoretical basis of Gabor filters, and demonstration of the filter. The enhancement algorithm for fingerprint image is in the windows XP platform with matlab.65 as a development tool for the demonstration. The result shows that the Gabor filter is effective in fingerprint image enhancement technology.

  19. Fingerprinting of Materials

    NASA Technical Reports Server (NTRS)

    Workman, Gary L

    1992-01-01

    Recent issues emerging in our fiscal and ecological environments have promulgated that federal agencies shall promote activities which respond to the improvement of both. In response to these developments, the National Aeronautics and Space Administration (NASA) has undertaken an innovative approach to improve the control of materials used in all NASA manufacturing activities. In concert with this goal, NASA is requiring that its contractors and their sub-contractors perform a more intensive consolidation of technologies that can provide an accounting of materials, which includes in-coming materials, materials in process, end-products and waste materials. The purpose of this handbook is to provide guidelines to NASA and its contractor personnel for the planning and implementation of chemical fingerprinting programs and to illustrate the chemical and statistical fundamentals needed for successful use of chemical fingerprinting.

  20. Fingerprints in the Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1

    This graph, or spectrum, shows the light from a dusty, distant galaxy located 11 billion light-years away. The galaxy is invisible to optical telescopes, but NASA's Spitzer Space Telescope was able to capture the light from it and dozens of other similar galaxies using heat-seeking infrared eyes.

    Spectra are created when an instrument called a spectrograph spreads light out into its basic parts, like a prism turning sunlight into a rainbow. They contain the signatures, or 'fingerprints,' of molecules that contribute to an object's light.

    In this case, the galaxy's spectrum reveals the fingerprint for silicate dust (large dip at right), a planetary building block like sand, only smaller. This particular fingerprint is important because it helped astronomers determine how far away the galaxy lies, or more specifically, how much the galaxy's light had stretched, or 'redshifted,' during its journey to Spitzer's eyes. Because the universe is expanding, a galaxy's light will shift toward reddish wavelengths as it moves away from us. This galaxy was found to have a redshift of 1.95, which means that its light took about 11 billion years to get here.

    The presence of the silicate fingerprint is also significant because it implies that galaxies were ripe for planetary formation 11 billion years ago - back to a time when the universe was 3 billion years old. The universe is currently believed to be 13.5 billion years old. This is the furthest back in time that silicate dust has been detected around a galaxy.

    These data were taken by Spitzer's infrared spectrograph in July, 2004.

  1. Fingerprint + Iris = IrisPrint

    NASA Astrophysics Data System (ADS)

    Othman, Asem; Ross, Arun

    2015-05-01

    We consider the problem of generating a biometric image from two different traits. Specifically, we focus on generating an IrisPrint that inherits its structure from a fingerprint image and an iris image. To facilitate this, the continuous phase of the fingerprint image, characterizing its ridge flow, is first extracted. Next, a scheme is developed to extract "minutiae" from an iris image. Finally, an IrisPrint, that resembles a fingerprint, is created by mixing the ridge flow of the fingerprint with the iris minutiae. Preliminary experiments suggest that the new biometric image (i.e., IrisPrint) (a) can potentially be used for authentication by an existing fingerprint matcher, and (b) can potentially conceal and preserve the privacy of the original fingerprint and iris images.

  2. Petroleum fingerprinting with organic markers

    USGS Publications Warehouse

    Hostettler, Frances D.; Lorenson, T.D.; Bekins, Barbara A.

    2013-01-01

    Petroleum fingerprinting is an invaluable tool in forensic geochemistry. This article summarizes applications of fingerprinting in several oil spills and natural oil seepages that we have studied during the last 25 years. It shows how each unique chemical fingerprint can be used to correlate or differentiate oils. Fingerprints can provide information about processes in the environment that impact oils such as weathering and microbial degradation. They can be used to evaluate organic matter that contributed to oils, and classify oils with regard to the geological framework of their source, such as evaluating geological facies, age, lithology, and depositional environment.

  3. Fingerprinting of Materials: Technical Supplement

    NASA Technical Reports Server (NTRS)

    Workman, Gary L.

    1992-01-01

    This supplement to the Guidelines for Maintaining a Chemical Fingerprinting Program has been developed to assist NASA personnel, contractors, and sub-contractors in defining the technical aspects and basic concepts which can be used in chemical fingerprinting programs. This material is not meant to be totally inclusive to all chemical fingerprinting programs, but merely to present current concepts. Each program will be tailored to meet the needs of the individual organizations using chemical fingerprinting to improve their quality and reliability in the production of aerospace systems.

  4. Development of a Daphnia magna DNA microarray for evaluating the toxicity of environmental chemicals.

    PubMed

    Watanabe, Hajime; Takahashi, Eri; Nakamura, Yuko; Oda, Shigeto; Tatarazako, Norihisa; Iguchi, Taisen

    2007-04-01

    Toxic chemical contaminants have a variety of detrimental effects on various species, and the impact of pollutants on ecosystems has become an urgent issue. However, the majority of studies regarding the effects of chemical contaminants have focused on vertebrates. Among aquatic organisms, Daphnia magna has been used extensively to evaluate organism- and population-level responses of invertebrates to pollutants in acute toxicity or reproductive toxicity tests. Although these types of tests can provide information concerning hazardous concentrations of chemicals, they provide no information about their mode of action. Recent advances in molecular genetic techniques have provided tools to better understand the responses of aquatic organisms to pollutants. In the present study, we adapted some of the techniques of molecular genetics to develop new tools, which form the basis for an ecotoxicogenomic assessment of D. magna. Based on a Daphnia expressed sequence tag database, we developed an oligonucleotide-based DNA microarray with high reproducibility. The DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to several different chemicals: Copper sulfate, hydrogen peroxide, pentachlorophenol, or beta-naphthoflavone. Exposure to these chemicals resulted in characteristic patterns of gene expression that were chemical-specific, indicating that the Daphnia DNA microarray can be used for classification of toxic chemicals and for development of a mechanistic understanding of chemical toxicity on a common freshwater organism. PMID:17447551

  5. Sucralose Induces Biochemical Responses in Daphnia magna

    PubMed Central

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena

    2014-01-01

    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001–5 mg L−1). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology. PMID:24699280

  6. Antineoplastic Agents 553. The Texas Grasshopper Brachystola magna1

    PubMed Central

    Pettit, George R.; Meng, Yanhui; Herald, Delbert L.; Knight, John C.; Day, John F.

    2011-01-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) -guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2) and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis (a.k.a. Pancratium littorale Jacq) and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study a crystal of pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1–3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed. PMID:16124772

  7. Antineoplastic agents. 553. The Texas grasshopper Brachystola magna.

    PubMed

    Pettit, George R; Meng, Yanhui; Herald, Delbert L; Knight, John C; Day, John F

    2005-08-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2), and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis), and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1-3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed. PMID:16124772

  8. Fossa navicularis magna detection on cone-beam computed tomography.

    PubMed

    Syed, Ali Z; Mupparapu, Mel

    2016-03-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed. PMID:27051639

  9. Responses of Daphnia magna to pulsed exposures of arsenic.

    PubMed

    Hoang, Tham C; Gallagher, Jeffrey S; Klaine, Stephen J

    2007-06-01

    Research on the toxicity of arsenic has focused on sublethal effects that do not provide sufficient information for risk estimation. While most studies have focused on organism response to constant arsenic exposures, organisms in nature are exposed to fluctuating As concentrations. Consequently, results obtained from standardized bioassays with constant exposures may not adequately characterize risk to indigenous biota. This research was designed to characterize the response of Daphnia magna to fluctuating arsenic exposures during 21-day experiments. At concentrations > or =3000 microg/L As, 21-day pulsed exposure mortality increased as a function of exposure concentration and duration. In addition, 21-day pulsed exposure mortality increased with increasing recovery time. Pulsed As exposure did not affect the growth of D. magna over 21 days. Twenty-one day accumulative reproduction of D. magna was only affected by pulsed exposures of high As concentration and long durations. PMID:17497644

  10. SMALL SCALE MASS CULTURE OF DAPHNIA MAGNA STRAUS

    SciTech Connect

    Rees, John T.; Oldfather, Joan M.

    1980-03-01

    Daphnia magna Straus 1820 was reared on a defined medium in 4-liter flasks under controlled conditions of light, temperature and species of algal food. Adult D. magna were found to be tolerant to high levels of ammonia, up to 108 {micro}M, at high pH (>10), although parthenogenic reproduction may be inhibited at these high levels. Scenedesmus quadricauda and Ankistrodesmus sp. were found to be satisfactory food sources. Densities of greater than one animal per ml in culture were attained utilizing Ankistrodesmus sp. as a food source at a pH of 7.7. Maintenance of pH at around 7-8 appears to be important to successful D. magna culture.

  11. Fossa navicularis magna detection on cone-beam computed tomography

    PubMed Central

    Mupparapu, Mel

    2016-01-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed. PMID:27051639

  12. Chronic toxicity of 14 phthalate esters to Daphnia magna and rainbow trout (Oncorhynchus mykiss)

    SciTech Connect

    Rhodes, J.E.; Adams, W.J.; Biddinger, G.R.; Robillard, K.A.; Gorsuch, J.W.

    1995-11-01

    Chronic toxicity studies were performed with commercial phthalate esters and Daphnia magna (14 phthalates) and rainbow trout (Oncorhynchus mykiss) (six phthalates). For the lower-molecular-weight phthalate esters--dimethyl phthalate (DMP), diethyl phthalate (DEP), di-n-butyl phthalate (DBP), and butylbenzyl phthalate (BBP)--the results of the studies indicated a general trend in which toxicity for both species increased as water solubility decreased. The geometric mean maximum acceptable toxicant concentration(GM-MATC) for D. magna ranged from 0.63 to 34.8 mg/L. For the higher-molecular-weight phthalate esters--dihexyl phthalate (DHP), butyl 2-ethylhexyl phthalate (BOP), di-(n-hexyl, n-octyl, n-decyl) phthalate (610P), di-(2-ethylhexyl) phthalate (DEHP), diisooctyl phthalate (DIOP), diisononyl phthalate (DINP), di-(heptyl, nonyl, undecyl) phthalate (711P), diisodecyl phthalate (DIDP), diundecyl phthalate (DUP), and ditridecyl phthalate (DTDP)--the GM-MATC values ranged from 0.042 to 0.15 mg/L. Survival was equally sensitive and sometimes more sensitive than reproduction. The observed toxicity to daphnids with most of the higher-molecular-weight phthalate esters appeared to be due to surface entrapment or a mode of toxicity that is not due to exposure to dissolved aqueous-phase chemical. Early life-stage toxicity studies with rainbow trout indicated that survival (DMP) and growth (DBP) were affected at 24 and 0.19 mg/L, respectively. This pattern of observed toxicity with the lower-molecular-weight phthalate esters and not the higher-molecular-weight phthalate esters is consistent with previously reported acute toxicity studies for several aquatic species.

  13. Vibrational fingerprints of the Mn4CaO5 cluster in Photosystem II by mixed quantum-classical molecular dynamics.

    PubMed

    Bovi, Daniele; Capone, Matteo; Narzi, Daniele; Guidoni, Leonardo

    2016-10-01

    A detailed knowledge of the structures of the catalytic steps along the Kok-Joliot cycle of Photosystem II may help to understand the strategies adopted by this unique enzyme to achieve water oxidation. Vibrational spectroscopy has probed in the last decades the intermediate states of the catalytic cycle, although the interpretation of the data turned out to be often problematic. In the present work we use QM/MM molecular dynamics on the S2 state to obtain the vibrational density of states at room temperature. To help the interpretation of the computational and experimental data we propose a decomposition of the Mn4CaO5 moiety into five separate parts, composed by "diamond" motifs involving four atoms. The spectral signatures arising from this analysis can be easily interpreted to assign experimentally known bands to specific molecular motions. In particular, we focused in the low frequency region of the vibrational spectrum of the S2 state. We can therefore identify the observed bands around 600-620cm(-1) as characteristic for the stretching vibrations involving Mn1-O1-Mn2 or Mn3-O5 moieties. PMID:27444240

  14. Importance of metallothioneins in the cadmium detoxification process in Daphnia magna.

    PubMed

    Fraysse, B; Geffard, O; Berthet, B; Quéau, H; Biagianti-Risbourg, S; Geffard, A

    2006-11-01

    Good knowledge of the relationship between toxic metals and biological systems, particularly the sub-cellular fraction, could be a suitable early indicator of toxic effects. These effects and the sub-cellular behaviour of cadmium were studied with a widely used species in freshwater toxicity bioassays, Daphnia magna. In spite of this very commonplace usage in ecotoxicological studies, very few data are available on its toxicant metabolism and in particular metal homeostasis. Combining multi-tools analysis, a soluble protein was found: it is heat-stable, rich in sulfhydryl groups (differential pulse polarography), characterised by a molecular mass of approximately 6.5 kDa, with a G-75 chromatographic profile corresponding to the rabbit metallothioneins monomer, with few if any aromatic-containing amino acids, it binds metals (e.g. Cd, Cu), and its concentration increases with Cd exposure. This evidence led us to hypothesise that metallothioneins (MTs) are present in D. magna. Up to 75% of the Cd body burden with Cd exposure is bound to the MTs fraction. The increase in the Cd concentration in the surrounding medium and concomitantly in daphnids induces sub-cellular reorganisation of essential metals such as Cu and Zn. The rate of metals in the soluble cellular fraction and associated with MTs increases with the Cd body burden. Monitoring sub-cellular distribution of metals after exposure in the natural environment could be very useful for ecotoxicological assessment. PMID:17113354

  15. Fluorescence fingerprints of Eisenia fetida and Eisenia andrei.

    PubMed

    Albani, J R; Demuynck, S; Grumiaux, F; Leprêtre, A

    2003-12-01

    We describe a fluorescent method that allows to differentiate the worms Eisenia fetida and Eisenia andrei. In fact, the coelomic fluid of E. andrei displays specific fluorescence absent in that of E. fetida. The two species do not metabolize the same types of molecules and thus can be differentiated at the molecular level. Each species has specific fluorescence fingerprints. PMID:14743869

  16. Video-Based Fingerprint Verification

    PubMed Central

    Qin, Wei; Yin, Yilong; Liu, Lili

    2013-01-01

    Conventional fingerprint verification systems use only static information. In this paper, fingerprint videos, which contain dynamic information, are utilized for verification. Fingerprint videos are acquired by the same capture device that acquires conventional fingerprint images, and the user experience of providing a fingerprint video is the same as that of providing a single impression. After preprocessing and aligning processes, “inside similarity” and “outside similarity” are defined and calculated to take advantage of both dynamic and static information contained in fingerprint videos. Match scores between two matching fingerprint videos are then calculated by combining the two kinds of similarity. Experimental results show that the proposed video-based method leads to a relative reduction of 60 percent in the equal error rate (EER) in comparison to the conventional single impression-based method. We also analyze the time complexity of our method when different combinations of strategies are used. Our method still outperforms the conventional method, even if both methods have the same time complexity. Finally, experimental results demonstrate that the proposed video-based method can lead to better accuracy than the multiple impressions fusion method, and the proposed method has a much lower false acceptance rate (FAR) when the false rejection rate (FRR) is quite low. PMID:24008283

  17. Molecular Fingerprinting by PCR-Denaturing Gradient Gel Electrophoresis Reveals Differences in the Levels of Microbial Diversity for Musty-Earthy Tainted Corks ▿

    PubMed Central

    Prat, Chantal; Ruiz-Rueda, Olaya; Trias, Rosalia; Anticó, Enriqueta; Capone, Dimitra; Sefton, Mark; Bañeras, Lluís

    2009-01-01

    The microbial community structure of cork with marked musty-earthy aromas was analyzed using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Cork stoppers and discs were used for DNA extraction and were analyzed by using selective primers for bacteria and fungi. Stoppers clearly differed from discs harboring a different fungal community. Moreover, musty-earthy samples of both types were shown to have a specific microbiota. The fungi Penicillium glabrum and Neurospora spp. were present in all samples and were assumed to make only a small contribution to off-odor development. In contrast, Penicillium islandicum and Penicillium variabile were found almost exclusively in 2,4,6-trichloroanisole (TCA) tainted discs. Conversely, Rhodotorula minuta and Rhodotorula sloofiae were most common in cork stoppers, where only small amounts of TCA were detected. Alpha- and gammaproteobacteria were the most commonly found bacteria in either control or tainted cork stoppers. Specific Pseudomonas and Actinobacteria were detected in stoppers with low amounts of TCA and 2-methoxy-3,5-dimethylpyrazine. These results are discussed in terms of biological degradation of taint compounds by specific microorganisms. Reliable and straightforward microbial identification methods based on a molecular approach provided useful data to determine and evaluate the risk of taint formation in cork. PMID:19201983

  18. Influence of skin diseases on fingerprint recognition.

    PubMed

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  19. Influence of Skin Diseases on Fingerprint Recognition

    PubMed Central

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  20. Magna Carta: Teaching Medieval Topics for Historical Significance

    ERIC Educational Resources Information Center

    Metzger, Scott Alan

    2010-01-01

    The Middle Ages are an immensely important era in the Western experience. Unfortunately, medieval studies are often marginalized or trivialized in school curriculum. With the approach of the 800th anniversary of Magna Carta, the famous charter of rights from medieval England, one has a timely and useful example for considering what a focus on…

  1. Magna Carta at 800: Ten Key Questions Answered

    ERIC Educational Resources Information Center

    Kaplan, Howard

    2014-01-01

    2015 marks the 800th anniversary of Magna Carta. For Americans, this iconic document is a formative element of our own legal and political heritage. This "Lessons on the Law" column offers an overview of the "Great Charter," why it is significant, and what students and teachers should know about it. The article also highlights…

  2. Coprologically diagnosing Anoplocephala perfoliata in the presence of A. magna.

    PubMed

    Bohórquez, Alejandro; Meana, Aránzazu; Pato, Nélida F; Luzón, Mónica

    2014-08-29

    Current copro-diagnostic tests for Anoplocephala perfoliata show high variation in their sensitivity and given the morphological similarity of Anoplocephala spp. eggs, this could be related to the presence of Anoplocephala magna alone or co-existing with A. perfoliata. In the present study, coprology was significantly more sensitive (p<0.01) at detecting A. magna than A. perfoliata. This difference was independent of the parasite burden and was greater when testing was limited to horses with mature or gravid tapeworms. A. magna infection was strongly linked to young horses (≤ 2 years). The eggs of A. magna are smaller. Using 15 and 70 μm cut-offs for oncosphere diameter and the major shell bisector length, respectively, the eggs of A. perfoliata were identified with 100% sensitivity, 97% specificity and 98% sensitivity, 84% specificity. The use of these two morphometric variables would therefore be useful for the copro-identification of A. perfoliata in countries where both species coexist. PMID:24877786

  3. Efficacy of clorsulon against Fascioloides magna infection in sheep.

    PubMed

    Conboy, G A; Stromberg, B E; Schlotthauer, J C

    1988-04-01

    In a study to evaluate the efficacy of clorsulon against Fascioloides magna infection in sheep, 12 ewes were inoculated orally with 100 metacercariae of F magna, and 6 were treated with clorsulon (15 mg/kg of body weight) 8 weeks after inoculation. The sheep were euthanatized 16 weeks after inoculation, flukes were recovered, and the liver and other tissues were subjectively scored for the severity of lesions (0 to 4+). The number of flukes recovered from the clorsulon-treated group (3.8 +/- 1.2 flukes) was significantly (P = 0.025) lower than the number of flukes recovered from the group of untreated controls (10.0 +/- 6.6 flukes). The severity of lesions was significantly (P = 0.004) reduced (45.9%) in the treated group (2.0 +/- 1.1), compared with that in the untreated controls (3.7 +/- 0.5). In the untreated group, 3 sheep died and 1 became moribund 14 to 16 weeks after inoculation. The data suggested that a single treatment with clorsulon at a dosage of 15 mg/kg 8 weeks after inoculation was not effective in preventing F magna infection in sheep, because the survival of only a few F magna is potentially fatal in sheep within 6 months after infection. PMID:3366676

  4. Fingerprinting dark energy

    SciTech Connect

    Sapone, Domenico; Kunz, Martin

    2009-10-15

    Dark energy perturbations are normally either neglected or else included in a purely numerical way, obscuring their dependence on underlying parameters like the equation of state or the sound speed. However, while many different explanations for the dark energy can have the same equation of state, they usually differ in their perturbations so that these provide a fingerprint for distinguishing between different models with the same equation of state. In this paper we derive simple yet accurate approximations that are able to characterize a specific class of models (encompassing most scalar-field models) which is often generically called 'dark energy'. We then use the approximate solutions to look at the impact of the dark energy perturbations on the dark matter power spectrum and on the integrated Sachs-Wolfe effect in the cosmic microwave background radiation.

  5. Single-qubit optical quantum fingerprinting.

    PubMed

    Horn, Rolf T; Babichev, S A; Marzlin, Karl-Peter; Lvovsky, A I; Sanders, Barry C

    2005-10-01

    We analyze and demonstrate the feasibility and superiority of linear optical single-qubit fingerprinting over its classical counterpart. For one-qubit fingerprinting of two-bit messages, we prepare "tetrahedral" qubit states experimentally and show that they meet the requirements for quantum fingerprinting to exceed the classical capability. We prove that shared entanglement permits 100% reliable quantum fingerprinting, which will outperform classical fingerprinting even with arbitrary amounts of shared randomness. PMID:16241707

  6. DNA fingerprinting of medically important microorganisms by use of PCR.

    PubMed Central

    van Belkum, A

    1994-01-01

    Selected segments of any DNA molecule can be amplified exponentially by PCR. This technique provides a powerful tool to detect and identify minimal numbers of microorganisms. PCR is applicable both in diagnosis and in epidemiology. By amplification of hypervariable DNA domains, differences can be detected even among closely related strains. PCR fingerprinting is a valuable tool for medical microbiologists, epidemiologists, and microbial taxonomists. The current state of PCR-mediated genotyping is reviewed, and a comparison with conventional molecular typing methods is included. Because of its speed and versatility, PCR fingerprinting will play an important role in microbial genetics, epidemiology, and systematics. Images PMID:8055466

  7. Fascioloides magna--epizootiology in a deer farm in Germany.

    PubMed

    Plötz, Cornelia; Rehbein, Steffen; Bamler, Helmut; Reindl, Hubert; Pfister, Kurt; Scheuerle, Miriam C

    2015-01-01

    After initial observations of suspicious cases in 2009, the occurrence of Fascioloides (F.) magna in deer of a deer farm located in northeastern Bavaria, Germany, at the border to the Czech Republic was confirmed in autumn 2011. In March 2012, the deer were treated for fascioloidosis with triclabendazole. To monitor the epizootiology of fascioloidosis in the farm, 80-100 faecal samples were examined for Fascioloides eggs at monthly intervals from June 2012 to June 2013 inclusive. In addition, livers of 27 red deer and one sika deer collected during winter 2012/2013 were examined for gross lesions suspicious for F. magna infection and 21 of the 28 livers were dissected for F. magna recovery. Fascioloides eggs were recorded in 63 (4.9%) of 1280 faecal samples (range 0.4 to 355 eggs per gram). Both, number of Fascioloides-egg positive samples and egg counts were low during the first eight months of the study but increased notably since February 2013. While Fascioloides egg-positive faecal samples were obtained from red deer (46/948,4.9%) and fallow deer (17/166, 10.2%), no Fascioloides eggs were demonstrated in the 166 samples obtained from sika deer. Livers of five red deer and the sika deer showed gross lesions characteristic for fascioloidosis, and F. magna were recovered from three of the five affected red deer livers (range, five to seven flukes). Results of this study confirm that F. magna is endemic in the deer farm, and measures should be implemented to minimize the transmission of the parasite. PMID:26054221

  8. Filterbank-based fingerprint matching.

    PubMed

    Jain, A K; Prabhakar, S; Hong, L; Pankanti, S

    2000-01-01

    With identity fraud in our society reaching unprecedented proportions and with an increasing emphasis on the emerging automatic personal identification applications, biometrics-based verification, especially fingerprint-based identification, is receiving a lot of attention. There are two major shortcomings of the traditional approaches to fingerprint representation. For a considerable fraction of population, the representations based on explicit detection of complete ridge structures in the fingerprint are difficult to extract automatically. The widely used minutiae-based representation does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Further, minutiae-based matching has difficulty in quickly matching two fingerprint images containing a different number of unregistered minutiae points. The proposed filter-based algorithm uses a bank of Gabor filters to capture both local and global details in a fingerprint as a compact fixed length FingerCode. The fingerprint matching is based on the Euclidean distance between the two corresponding FingerCodes and hence is extremely fast. We are able to achieve a verification accuracy which is only marginally inferior to the best results of minutiae-based algorithms published in the open literature. Our system performs better than a state-of-the-art minutiae-based system when the performance requirement of the application system does not demand a very low false acceptance rate. Finally, we show that the matching performance can be improved by combining the decisions of the matchers based on complementary (minutiae-based and filter-based) fingerprint information. PMID:18255456

  9. A multi-fingerprint browser for the ZINC database

    PubMed Central

    Awale, Mahendra; Reymond, Jean-Louis

    2014-01-01

    To confirm the activity of an initial small molecule ‘hit compound’ from an activity screening, one needs to probe the structure–activity relationships by testing close analogs. The multi-fingerprint browser presented here (http://dcb-reymond23.unibe.ch:8080/MCSS/) enables one to rapidly identify such close analogs among commercially available compounds in the ZINC database (>13 million molecules). The browser retrieves nearest neighbors of any query molecule in multi-dimensional chemical spaces defined by four different fingerprints, each of which represents relevant structural and pharmacophoric features in a different way: sFP (substructure fingerprint), ECFP4 (extended connectivity fingerprint), MQNs (molecular quantum numbers) and SMIfp (SMILES fingerprint). Distances are calculated using the city-block distance, a similarity measure that performs as well as Tanimoto similarity but is much faster to compute. The list of up to 1000 nearest neighbors of any query molecule is retrieved by the browser and can be then clustered using the K-means clustering algorithm to produce a focused list of analogs with likely similar bioactivity to be considered for experimental evaluation. PMID:24782520

  10. Spectral fingerprinting of soil organic matter composition

    NASA Astrophysics Data System (ADS)

    Cecillon, L.; Certini, G.; Lange, H.; Forte, C.; Strand, L. T.

    2009-04-01

    The determination of soil organic matter (SOM) composition relies on a variety of chemical and physical methods, most of them time consuming and expensive. Hitherto, such methodological limitations have hampered the use of detailed SOM composition in process-based models of SOM dynamics, which usually include only three poorly defined carbon pools. Here we show a novel approach merging both near and mid infrared spectroscopy into a single fingerprint for an expeditious prediction of the molecular composition of organic materials in soil, as inferred from a molecular mixing model (MMM) based on 13C nuclear magnetic resonance (NMR), which describes SOM as a mixture of common biologically derived polymers. Infrared and solid-state 13C NMR spectroscopic measurements were performed on a set of mineral and organic soil samples presenting a wide range of organic carbon content (2 to 500 g kg-1), collected in a boreal heathland (Storgama, Norway). The implementation of the MMM using 13C NMR spectra allowed the calculation of five main biochemical components (carbohydrate, protein, lignin, lipids and black carbon) for each sample. Partial least squares regression models were developed for the five biopolymers using outer product analysis of near and mid infrared spectra (Infrared-OPA). All models reached ratios of performance to deviation (RPD) above 2 and specific infrared wavenumbers associated to each biochemical component were identified. Our results demonstrate that Infrared-OPA provides a robust and cost-effective fingerprint of SOM composition that could be useful for the routine assessment of soil carbon pools.

  11. Accumulation of dieldrin in an alga (Scenedesmus obliquus), Daphnia magna, and the guppy (Poecilia reticulata)

    USGS Publications Warehouse

    Reinert, Robert E.

    1972-01-01

    Scenedesmus obliquus, Daphnia magna, and Poecilia reticulata accumulated dieldrin directly from water; average concentration factors (concentration in organism, dry weight, divided by concentration in water) were 1282 for the alga, 13,954 for D. magna, and 49,307 (estimated) for the guppy. The amount accumulated by each species at equilibrium (after about 1.5, 3-4, and 18 days, respectively) was directly proportional to the concentration of dieldrin in the water. Daphnia magna and guppies accumulated more dieldrin from water than from food that had been exposed to similar concentrations in water. When guppies were fed equal daily rations of D. magna containing different concentrations of insecticide, the amounts of dieldrin accumulated by the fish were directly proportional to the concentration in D. magna; when two lots of guppies were fed different quantities of D. magna (10 and 20 organisms per day) containing identical concentrations of dieldrin, however, the amounts accumulated did not differ substantially.

  12. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    PubMed

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  13. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis

    PubMed Central

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F.; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  14. Robust efficient video fingerprinting

    NASA Astrophysics Data System (ADS)

    Puri, Manika; Lubin, Jeffrey

    2009-02-01

    We have developed a video fingerprinting system with robustness and efficiency as the primary and secondary design criteria. In extensive testing, the system has shown robustness to cropping, letter-boxing, sub-titling, blur, drastic compression, frame rate changes, size changes and color changes, as well as to the geometric distortions often associated with camcorder capture in cinema settings. Efficiency is afforded by a novel two-stage detection process in which a fast matching process first computes a number of likely candidates, which are then passed to a second slower process that computes the overall best match with minimal false alarm probability. One key component of the algorithm is a maximally stable volume computation - a three-dimensional generalization of maximally stable extremal regions - that provides a content-centric coordinate system for subsequent hash function computation, independent of any affine transformation or extensive cropping. Other key features include an efficient bin-based polling strategy for initial candidate selection, and a final SIFT feature-based computation for final verification. We describe the algorithm and its performance, and then discuss additional modifications that can provide further improvement to efficiency and accuracy.

  15. Effect of Fascioloides magna (Digenea) on fecundity, shell height, and survival rate of Pseudosuccinea columella (Lymnaeidae).

    PubMed

    Pankrác, Jan; Novobilský, Adam; Rondelaud, Daniel; Leontovyč, Roman; Syrovátka, Vít; Rajský, Dušan; Horák, Petr; Kašný, Martin

    2016-08-01

    Infection with Fascioloides magna (Digenea) causes serious damage to liver tissue in definitive hosts represented by ruminants, especially cervids. The distribution of F. magna includes the indigenous areas in North America, and the areas to which F. magna was introduced-Central Europe, Southeast Europe, and Italy. The North American intermediate host of F. magna, the freshwater snail Pseudosuccinea columella (Lymnaeidae), is an invasive species recorded in South America, the Caribbean, Africa, Australia, and west and Southeast Europe. In Europe, Galba truncatula is the snail serving for transmission, but P. columella has potential to become here a new intermediate host of F. magna. Little is known about interactions between F. magna and P. columella. In this study, the susceptibility of P. columella (Oregon, USA) to the infection by a single miracidium of the Czech strain of F. magna and the influence of F. magna on snail fecundity, shell height, and survival were evaluated. The data show that the Oregon strain of P. columella is a highly suitable host for the Czech strain of F. magna, with the infection rate of 74 %. In addition, a negative effect on survival rate of infected snails was recorded only in the late phase of infection. The infection was accompanied by a major reduction in egg mass production and by a decrease in the number of eggs per egg mass. The shell height of infected snails did not significantly differ from that in unexposed controls. PMID:27098161

  16. Multigenerational cadmium acclimation and biokinetics in Daphnia magna.

    PubMed

    Guan, Rui; Wang, Wen-Xiong

    2006-05-01

    A Cd exposure (3 microg L(-1)) experiment was conducted for six successive generations to investigate the responses to chronic Cd stress in Daphnia magna. We observed a biphasic accumulation of Cd in the six generations and suggested a similar pattern with respect to daphnids' tolerance. Cd assimilation efficiencies, daphnid growth, and reproduction corresponded to the changes of tolerance, which was partially accounted for by metallothionein induction. When maternally exposed neonates grew in Cd-free water for one or two generations, their growth, MT concentration and biokinetic parameters partially or totally recovered. The rapid recovery suggests the high potential for ecological restoration from Cd pollution. Our results indicate that the tolerance of sensitive D. magna clones to Cd was dependent on long-term or multigenerational exposure. The tolerance developed within the first several generations might not be maintained, and the animals may become even more sensitive to Cd stress in subsequent generations. PMID:16202491

  17. Effect of lindane on the clearance rate of daphnia magna

    PubMed

    Hartgers; Heugens; Deneer

    1999-05-01

    The impact of the insecticide lindane (gamma-hexachlorocyclohexane) on the clearance rate (CR) of Daphnia magna was investigated using artificial beads. CR (24-h EC50: 65 &mgr;g L-1) was found to be a more sensitive endpoint than acute lethality for D. magna (48-h LC50: 516 &mgr;g L-1). The onset of the effect was rapid; after 2 h of exposure to approximately 241 &mgr;g L-1 of lindane a significant decrease in CR was observed. Daphnids recovered rapidly after transfer to clean water; after 24 h of exposure to approximately 250 &mgr;g L-1 lindane, transfer into clean water resulted in recovery to 80% of control levels within 2 h and complete recovery within 24 h. PMID:10227859

  18. Chronic toxicity of biphenyl to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Bartlett, E.A.; Murphy, P.G.; Milazzo, D.P. )

    1989-09-01

    The US Environmental Protection Agency (EPA) issued a final test rule (1985) for biphenyl on the authority of Section 4(a) of the Toxic Substances Control Act (TSCA). Contained within this rule was the requirement for generating chronic daphnid toxicity data for biphenyl. Biphenyl is used primarily to produce dye carriers, heat-transfer fluids and alkylated biphenyls. The acute toxicity of biphenyl to Daphnia magna has been reported. The 48-hr LC50 values were 4.7 and 2.1 mg/L, respectively. To date, the chronic toxicity of biphenyl to fish and aquatic invertebrates has not been investigated. The objective of this study was to determine the chronic toxicity of biphenyl to D. magna. The daphnid chronic toxicity test is designed to estimate the maximum acceptable toxicant concentration (MATC). The MATC is defined as the concentration falling between the highest concentration showing no effect and the next higher concentration showing a toxic effect when compared to the controls.

  19. Chapelieria magna, a new species of Rubiaceae from eastern Madagascar

    PubMed Central

    Kainulainen, Kent; Razafimandimbison, Sylvain G.

    2015-01-01

    Abstract A new species of Chapelieria was discovered during a recent field trip to the Masoala National Park in eastern Madagascar, and is described here as Chapelieria magna Kainul., sp. nov. This species is readily distinguishable from previously described species of the genus by its quadrangular shoots, triangular-calyptrate stipules, sessile leaves, pubescent styles, and ridged fruits. It also differs in the larger number of ovules and the much larger size of leaves and fruits. PMID:25698895

  20. Acute toxicity and QSAR of chlorophenols on Daphnia magna

    SciTech Connect

    Devillers, J.; Chambon, P.

    1986-10-01

    Chlorophenols which are released into natural waters from various industrial processes and from agricultural uses have been recognized as a group of chemical substances potentially hazardous to the aquatic environment. Therefore it is important to estimate their toxic impact on biota. Thus, the scope of this research was to obtain acute toxicity data for seventeen chlorophenols towards Daphnia magna and to explore the possibilities of deriving QSAR's (quantitative structure-activity relationship) from the above values.

  1. Spectral Fingerprints of Habitability

    NASA Astrophysics Data System (ADS)

    Kaltenegger, L.; Selsis, F.

    2010-01-01

    The emerging field of extrasolar planet search has shown an extraordinary ability to combine research by astrophysics, chemistry, biology and geophysics into a new and exciting interdisciplinary approach to understand our place in the universe. Are there other worlds like ours? How can we characterize those planets and assess if they are habitable? After a decade rich in giant exoplanet detections, observation techniques have now reached the ability to find planets of less than 10 M_Earth (so called Super-Earths) that may potentially be habitable. The detection and characterization of Earth-like planet is approaching rapidly with dedicated space observatories already in operation (Corot) or in development phase (Kepler, James Webb Space Telescope, Extremely Large Telescope (ELT), Darwin/TPF). Space missions like CoRoT (CNES, Rouan et al. 1998) and Kepler (NASA, Borucki et al. 1997) will give us statistics on the number, size, period and orbital distance of planets, extending to terrestrial planets on the lower mass range end as a first step, while missions like Darwin/TPF are designed to characterize their atmospheres. In this chapter we discuss how we can read a planet's spectral fingerprint and characterize if it is potentially habitable. We discuss the first steps to detect a habitable planet and set biomarker detection in context in Section 1. In Section 2 we focus on biomarkers, their signatures at different wavelengths, abiotic sources and cryptic photosynthesis - using Earth as our primary example - the only habitable planet we know of so far. Section 3 concentrates on planets around different stars, and Section 4 summarizes the chapter.

  2. Daphnia magna ecotoxicogenomics provides mechanistic insights into metal toxicity.

    PubMed

    Poynton, Helen C; Varshavsky, Julia R; Chang, Bonnie; Cavigiolio, Giorgio; Chan, Sarah; Holman, Patricia S; Loguinov, Alexandre V; Bauer, Darren J; Komachi, Kelly; Theil, Elizabeth C; Perkins, Edward J; Hughes, Owen; Vulpe, Chris D

    2007-02-01

    Toxicogenomics has provided innovative approaches to chemical screening, risk assessment, and predictive toxicology. If applied to ecotoxicology, genomics tools could greatly enhance the ability to understand the modes of toxicity in environmentally relevant organisms. Daphnia magna, a small aquatic crustacean, is considered a "keystone" species in ecological food webs and is an indicator species for toxicant exposure. Our objective was to demonstrate the potential utility of gene expression profiling in ecotoxicology by identifying novel biomarkers and uncovering potential modes of action in D. magna. Using a custom D. magna cDNA microarray, we identified distinct expression profiles in response to sublethal copper, cadmium, and zinc exposures and discovered specific biomarkers of exposure including two probable metallothioneins, and a ferritin mRNA with a functional IRE. The gene expression patterns support known mechanisms of metal toxicity and reveal novel modes of action including zinc inhibition of chitinase activity. By integrating gene expression profiling into an environmentally important organism, this study provides experimental support for the utility of ecotoxicogenomics. PMID:17328222

  3. Fingerprint fake detection by optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

    2013-03-01

    The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

  4. Phototoxic effects of titanium dioxide nanoparticles on Daphnia magna

    NASA Astrophysics Data System (ADS)

    Mansfield, Charles M.

    Titanium dioxide nanoparticles (TiO2-NP) are one of the most abundantly utilized nanomaterials in the world. Studies have demonstrated the mechanism of acute toxicity in TiO2-NP to be the production of reactive oxygen species (ROS) leading to oxidative stress and mortality in exposed organisms. It has also been demonstrated that the anatase crystalline conformation is capable of catalyzing the cleavage of water molecules to further increase the concentration of ROS in the presence of ultraviolet radiation. This photoenhanced toxicity significantly lowers the toxicity threshold of TiO2-NP to environmentally relevant concentrations (ppb). The goal of this study was to determine whether dietary uptake and accumulation of TiO2-NP in the aquatic filter feeder Daphnia magna resulted in photoenhanced toxicity. D. magna and S. caprincornatum were exposed to aqueous solutions of 20ppm and 200ppm TiO2-NP for 24hrs and then transferred to clean moderately hard water. Samples were taken at various time points, dried, and TiO 2 quantified using ICP-MS. Toxicity assays were run on D. magna using three TiO2-NP (20ppm, 200ppm) exposure protocols and two ultraviolet radiation treatments. The first exposure group was exposed to aqueous solutions of TiO2-NP for the duration of the test. The second exposure group was exposed to TiO2-NP for an hour and then transferred to clean water. The third exposure group was fed S. capricornatum that had been allowed to adsorb TiO2-NP. All samples were then placed in an outdoor UV exposure system and exposed to either full spectrum sunlight (with UV) or filtered sunlight (no UV). Here we show that TiO2 uptake peaked at one hour of exposure likely due to sedimentation of the particles out of suspension, thus decreasing bioavailability for the duration of the test. Interestingly, when D. magna were moved to clean water, aqueous concentrations of TiO2 increase as a result of depuration from the gut tract. Data also suggests these excreted particles

  5. Forensic Chemistry: The Revelation of Latent Fingerprints

    ERIC Educational Resources Information Center

    Friesen, J. Brent

    2015-01-01

    The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

  6. Detection and Rectification of Distorted Fingerprints.

    PubMed

    Si, Xuanbin; Feng, Jianjiang; Zhou, Jie; Luo, Yuxuan

    2015-03-01

    Elastic distortion of fingerprints is one of the major causes for false non-match. While this problem affects all fingerprint recognition applications, it is especially dangerous in negative recognition applications, such as watchlist and deduplication applications. In such applications, malicious users may purposely distort their fingerprints to evade identification. In this paper, we proposed novel algorithms to detect and rectify skin distortion based on a single fingerprint image. Distortion detection is viewed as a two-class classification problem, for which the registered ridge orientation map and period map of a fingerprint are used as the feature vector and a SVM classifier is trained to perform the classification task. Distortion rectification (or equivalently distortion field estimation) is viewed as a regression problem, where the input is a distorted fingerprint and the output is the distortion field. To solve this problem, a database (called reference database) of various distorted reference fingerprints and corresponding distortion fields is built in the offline stage, and then in the online stage, the nearest neighbor of the input fingerprint is found in the reference database and the corresponding distortion field is used to transform the input fingerprint into a normal one. Promising results have been obtained on three databases containing many distorted fingerprints, namely FVC2004 DB1, Tsinghua Distorted Fingerprint database, and the NIST SD27 latent fingerprint database. PMID:26353261

  7. Group-Oriented Fingerprinting for Multimedia Forensics

    NASA Astrophysics Data System (ADS)

    Wang, Z. Jane; Wu, Min; Trappe, Wade; Liu, K. J. Ray

    2004-12-01

    Digital fingerprinting of multimedia data involves embedding information in the content signal and offers protection to the digital rights of the content by allowing illegitimate usage of the content to be identified by authorized parties. One potential threat to fingerprinting is collusion, whereby a group of adversaries combine their individual copies in an attempt to remove the underlying fingerprints. Former studies indicate that collusion attacks based on a few dozen independent copies can confound a fingerprinting system that employs orthogonal modulation. However, in practice an adversary is more likely to collude with some users than with other users due to geographic or social circumstances. To take advantage of prior knowledge of the collusion pattern, we propose a two-tier group-oriented fingerprinting scheme where users likely to collude with each other are assigned correlated fingerprints. Additionally, we extend our construction to represent the natural social and geographic hierarchical relationships between users by developing a more flexible tree-structure-based fingerprinting system. We also propose a multistage colluder identification scheme by taking advantage of the hierarchial nature of the fingerprints. We evaluate the performance of the proposed fingerprinting scheme by studying the collusion resistance of a fingerprinting system employing Gaussian-distributed fingerprints. Our results show that the group-oriented fingerprinting system provides the superior collusion resistance over a system employing orthogonal modulation when knowledge of the potential collusion pattern is available.

  8. Fingerprints in the Dust

    NASA Technical Reports Server (NTRS)

    2001-01-01

    These MISR nadir-camera images of eastern China compare a somewhat hazy summer view from July 9, 2000 (left) with a spectacularly dusty spring view from April 7, 2001 (middle). The left-hand and middle images are from Terra orbits 2967 and 6928, respectively, and extend from central Manchuria near the top to portions of North and South Korea at the bottom. They are approximately 380 kilometers in width.

    Asia's desert areas are prone to soil erosion, as underground water tables are lowered by prolonged drought and by industrial and agricultural water use. Heavy winds blowing eastward across the arid and sparsely vegetated surfaces of Mongolia and western China pick up large quantities of yellow dust. Airborne dust clouds from the April 2001 storm blew across the Pacific Ocean and were carried as far as North America. The minerals transported in this manner are believed to provide nutrients for both oceanic and land ecosystems.

    According to the Xinhua News Agency in China, nearly one million tons of Gobi Desert dust blow into Beijing each year. During a similar dust outbreak last year, the Associated Press reported that the visibility in Beijing had been reduced the point where buildings were barely visible across city streets, and airline schedules were significantly disrupted. The dust has also been implicated in adverse health effects such as respiratory discomfort and eye irritation.

    The image on the right is a higher resolution MISR nadir-camera view of a portion of the April 7, 2001 dust cloud. It covers an area roughly 250 kilometers wide by 470 kilometers high. When viewed at full magnification, a number of atmospheric wave features, like the ridges and valleys of a fingerprint, are apparent. These are probably induced by surface topography, which can disturb the wind flow. A few small cumulus clouds are also visible, and are casting shadows on the thick lower dust layer.

    Analyses of images such as these constitute one phase of MISR

  9. Evolving transcriptomic fingerprint based on genome‐wide data as prognostic tools in prostate cancer

    PubMed Central

    Schliekelman, Mark; Shin, Heesun; Erho, Nicholas; Davicioni, Elai

    2015-01-01

    Background Information Prostate cancer (PCa) is a common disease but only a small subset of patients are at risk of developing metastasis and lethal disease, and identifying which patients will progress is challenging because of the heterogeneity underlying tumour progression. Understanding this heterogeneity at the molecular level and the resulting clinical impact is a critical step necessary for risk stratification. Defining genomic fingerprint elucidates molecular variation and may improve PCa risk stratification, providing more accurate prognostic information of tumour aggressiveness (or lethality) for prognostic biomarker development. Therefore, we explored transcriptomic differences between patients with indolent disease outcome and patients who developed metastasis post‐radical prostatectomy using genome‐wide expression data in the post radical prostatectomy clinical space before metastatic spread. Results Based on differential expression analysis, patients with adverse pathological findings who are at higher risk of developing metastasis have a distinct transcriptomic fingerprint that can be detected on surgically removed prostate specimens several years before metastasis detection. Nearly half of the transcriptomic fingerprint features were non‐coding RNA highlighting their pivotal role in PCa progression. Protein‐coding RNA features in the fingerprint are involved in multiple pathways including cell cycle, chromosome structure maintenance and cytoskeleton organisation. The metastatic transcriptomic fingerprint was determined in independent cohorts verifying the association between the fingerprint and metastatic patients. Further, the fingerprint was confirmed in metastasis lesions demonstrating that the fingerprint represents early metastatic transcriptomic changes, suggesting its utility as a prognostic tool to predict metastasis and provide clinical value in the early radical prostatectomy setting. Conclusions Here, we show that transcriptomic

  10. Network fingerprint: a knowledge-based characterization of biomedical networks

    PubMed Central

    Cui, Xiuliang; He, Haochen; He, Fuchu; Wang, Shengqi; Li, Fei; Bo, Xiaochen

    2015-01-01

    It can be difficult for biomedical researchers to understand complex molecular networks due to their unfamiliarity with the mathematical concepts employed. To represent molecular networks with clear meanings and familiar forms for biomedical researchers, we introduce a knowledge-based computational framework to decipher biomedical networks by making systematic comparisons to well-studied “basic networks”. A biomedical network is characterized as a spectrum-like vector called “network fingerprint”, which contains similarities to basic networks. This knowledge-based multidimensional characterization provides a more intuitive way to decipher molecular networks, especially for large-scale network comparisons and clustering analyses. As an example, we extracted network fingerprints of 44 disease networks in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The comparisons among the network fingerprints of disease networks revealed informative disease-disease and disease-signaling pathway associations, illustrating that the network fingerprinting framework will lead to new approaches for better understanding of biomedical networks. PMID:26307246

  11. Interspecific Differences between D. pulex and D. magna in Tolerance to Cyanobacteria with Protease Inhibitors

    PubMed Central

    Kuster, Christian J.; Von Elert, Eric

    2013-01-01

    It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids’ tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC− contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC−, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease inhibitors. PMID:23650523

  12. Acute toxicity of 50 metals to Daphnia magna.

    PubMed

    Okamoto, Akira; Yamamuro, Masumi; Tatarazako, Norihisa

    2015-07-01

    Metals are essential for human life and physiological functions but may sometimes cause disorders. Therefore, we conducted acute toxicity testing of 50 metals in Daphnia magna: EC50s of seven elements (Be, Cu, Ag, Cd, Os, Au and Hg) were < 100 µg l(-1) ; EC50s of 13 elements (Al, Sc, Cr, Co, Ni, Zn, Se, Rb, Y, Rh, Pt, Tl and Pb) were between 100 and 1000 µg l(-1) ; EC50s of 14 elements (Li, V, Mn, Fe, Ge, As, In, Sn, Sb, Te, Cs, Ba, W and Ir) were between 1,001 and 100,000 µg l(-1) ; EC50s of six elements (Na, Mg, K, Ca, Sr and Mo) were > 100,000 µg l(-1) ; and. 7 elements (Ti, Zr, Bi, Nb, Hf, Re and Ta) did not show EC50 at the upper limit of respective aqueous solubility, and EC50s were not obtained. Ga, Ru and Pd adhered to the body of D. magna and physically retarded the movement of D. magna. These metals formed hydroxides after adjusting the pH. Therefore, here, we distinguished this physical effect from the physiological toxic effect. The acute toxicity results of 40 elements obtained in this study were not correlated with electronegativity. Similarly, the acute toxicity results of metals including the rare metals were also not correlated with first ionization energy, atomic weight, atomic number, covalent radius, atomic radius or ionic radius. PMID:25382633

  13. Protective effects of ectoine on heat-stressed Daphnia magna.

    PubMed

    Adam, Bownik; Zofia, Stępniewska; Tadeusz, Skowroński

    2014-12-01

    Ectoine (ECT) is an amino acid produced and accumulated by halophilic bacteria in stressful conditions in order to prevent the loss of water from the cell. There is a lack of knowledge on the effects of ECT in heat-stressed aquatic animals. The purpose of our study was to determine the influence of ECT on Daphnia magna subjected to heat stress with two temperature gradients: 1 and 0.1 °C/min in the range of 23-42 °C. Time to immobilisation, survival during recovery, swimming performance, heart rate, thoracic limb movement and the levels of heat shock protein 70 kDa 1A (HSP70 1A), catalase (CAT) and nitric oxide species (NOx) were determined in ECT-exposed and unexposed daphnids; we showed protective effects of ECT on Daphnia magna subjected to heat stress. Time to immobilisation of daphnids exposed to ECT was longer when compared to the unexposed animals. Also, survival rate during the recovery of daphnids previously treated with ECT was higher. ECT significantly attenuated a rapid increase of mean swimming velocity which was elevated in the unexposed daphnids. Moreover, we observed elevation of thoracic limb movement and modulation of heart rate in ECT-exposed animals. HSP70 1A and CAT levels were reduced in the presence of ECT. On the other hand, NOx level was slightly elevated in both ECT-treated and unexposed daphnids, however slightly higher NOx level was found in ECT-treated animals. We conclude that the exposure to ectoine has thermoprotective effects on Daphnia magna, however their mechanisms are not associated with the induction of HSP70 1A. PMID:25223383

  14. Increasing toxicity of enrofloxacin over four generations of Daphnia magna.

    PubMed

    Dalla Bona, Mirco; Lizzi, Francesca; Borgato, Arianna; De Liguoro, Marco

    2016-10-01

    The effects of both continuous and alternate exposure to 2mgL(-1) of enrofloxacin (EFX) on survival, growth and reproduction were evaluated over four generations of Daphnia magna. Mortality increased, reaching 100% in most groups by the end of the third generation. Growth inhibition was detected in only one group of the fourth generation. Reproduction inhibition was >50% in all groups and, in second and third generations, groups transferred to pure medium showed a greater inhibition of reproduction than those exposed to EFX. To verify whether the effects observed in these groups could be explained by the perinatal exposure to the antibacterial, a reproduction test with daphnids obtained from in vitro exposed D. magna embryos was also carried out. Perinatal exposure to EFX seemed to act as an 'all-or-nothing' toxicity effect as 31.4% of embryos died, but the surviving daphnids did not show any inhibition of reproduction activity. However, the embryonic mortality may at least partially justify the inhibition of reproduction observed in exposed groups along the multigenerational test. Concluding, the multigenerational test with D. magna did show disruption to a population that cannot be evidenced by the official tests. The increasing deterioration across generations might be inferred as the consequence of heritable alterations. Whilst the concentration tested was higher than those usually detected in the natural environment, the increasing toxicity of EFX across generations and the possible additive toxicity of fluoroquinolone mixtures, prevent harm to crustacean populations by effects in the real context from being completely ruled out. PMID:27379980

  15. Statistical validation of structured population models for Daphnia magna

    PubMed Central

    Adoteye, Kaska; Banks, H.T.; Cross, Karissa; Eytcheson, Stephanie; Flores, Kevin B.; LeBlanc, Gerald A.; Nguyen, Timothy; Ross, Chelsea; Smith, Emmaline; Stemkovski, Michael; Stokely, Sarah

    2016-01-01

    In this study we use statistical validation techniques to verify density-dependent mechanisms hypothesized for populations of Daphnia magna. We develop structured population models that exemplify specific mechanisms, and use multi-scale experimental data in order to test their importance. We show that fecundity and survival rates are affected by both time-varying density-independent factors, such as age, and density-dependent factors, such as competition. We perform uncertainty analysis and show that our parameters are estimated with a high degree of confidence. Further, we perform a sensitivity analysis to understand how changes in fecundity and survival rates affect population size and age-structure. PMID:26092608

  16. Effects of metal salt mixtures on Daphnia magna reproduction

    SciTech Connect

    Biesinger, K.E.; Christensen, G.M.; Fiandt, J.T.

    1986-02-01

    Three binary metal experiments were conducted using a complete block design; testing the chlorides of Cd, Hg, and Zn individually and in combinations of Cd-Hg, Cd-Zn, and Zn-Hg on Daphnia magna reproduction. These mixtures were tested at one-half, once, and twice the 16% reproductive impairment concentration previously determined for individual metals. The Cd-Hg, Cd-Zn, and Zn-Hg mixtures all showed significant reductions in reproduction at concentrations where the metal salts alone caused no significant effect.

  17. Orientation field estimation for latent fingerprint enhancement.

    PubMed

    Feng, Jianjiang; Zhou, Jie; Jain, Anil K

    2013-04-01

    Identifying latent fingerprints is of vital importance for law enforcement agencies to apprehend criminals and terrorists. Compared to live-scan and inked fingerprints, the image quality of latent fingerprints is much lower, with complex image background, unclear ridge structure, and even overlapping patterns. A robust orientation field estimation algorithm is indispensable for enhancing and recognizing poor quality latents. However, conventional orientation field estimation algorithms, which can satisfactorily process most live-scan and inked fingerprints, do not provide acceptable results for most latents. We believe that a major limitation of conventional algorithms is that they do not utilize prior knowledge of the ridge structure in fingerprints. Inspired by spelling correction techniques in natural language processing, we propose a novel fingerprint orientation field estimation algorithm based on prior knowledge of fingerprint structure. We represent prior knowledge of fingerprints using a dictionary of reference orientation patches. which is constructed using a set of true orientation fields, and the compatibility constraint between neighboring orientation patches. Orientation field estimation for latents is posed as an energy minimization problem, which is solved by loopy belief propagation. Experimental results on the challenging NIST SD27 latent fingerprint database and an overlapped latent fingerprint database demonstrate the advantages of the proposed orientation field estimation algorithm over conventional algorithms. PMID:22826508

  18. Optical wavelet transform for fingerprint identification

    NASA Astrophysics Data System (ADS)

    MacDonald, Robert P.; Rogers, Steven K.; Burns, Thomas J.; Fielding, Kenneth H.; Warhola, Gregory T.; Ruck, Dennis W.

    1994-03-01

    The Federal Bureau of Investigation (FBI) has recently sanctioned a wavelet fingerprint image compression algorithm developed for reducing storage requirements of digitized fingerprints. This research implements an optical wavelet transform of a fingerprint image, as the first step in an optical fingerprint identification process. Wavelet filters are created from computer- generated holograms of biorthogonal wavelets, the same wavelets implemented in the FBI algorithm. Using a detour phase holographic technique, a complex binary filter mask is created with both symmetry and linear phase. The wavelet transform is implemented with continuous shift using an optical correlation between binarized fingerprints written on a Magneto-Optic Spatial Light Modulator and the biorthogonal wavelet filters. A telescopic lens combination scales the transformed fingerprint onto the filters, providing a means of adjusting the biorthogonal wavelet filter dilation continuously. The wavelet transformed fingerprint is then applied to an optical fingerprint identification process. Comparison between normal fingerprints and wavelet transformed fingerprints shows improvement in the optical identification process, in terms of rotational invariance.

  19. A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

    PubMed Central

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  20. A support vector machine approach for truncated fingerprint image detection from sweeping fingerprint sensors.

    PubMed

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  1. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    NASA Astrophysics Data System (ADS)

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-07-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm-1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light-matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon-phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications.

  2. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    PubMed Central

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-01-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm−1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light–matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon–phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications. PMID:27460765

  3. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons.

    PubMed

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-01-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm(-1), is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light-matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon-phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications. PMID:27460765

  4. Graphene Nanopres for DNA Fingerprinting

    NASA Astrophysics Data System (ADS)

    Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

    2013-03-01

    The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

  5. Identification of chemical-specific protein profiles in Daphnia magna using neural networks

    SciTech Connect

    Iamonte, T.; Broadt, T.; Bradley, B.

    1995-12-31

    One dimensional gel electrophoresis was performed on whole-animal homogenates of 10 Daphnia magna exposed for 48 hours to one toxic and one non-toxic concentration of 2,4-dinitrophenol and sodium pentachlorophenate, two uncouplers of oxidative phosphorylation; malathion, an organophosphate; and permethrine, a pyrethroid, along with culture water and solvent controls, as appropriate. Ten randomized complete block exposures were conducted to minimize among-cohort variability. The 10-animal samples were gel electrophoresed, visualized using neutral silver staining and digitized with a Molecular Dynamics personal laser densitometer equipped with ImageQuant software. Densitometric data were used in a commercial neural network software package to construct a learning set, or database, of the protein profiles induced by the known chemical treatments. Novel data sets were then presented to the neural network program for assignment to treatment categories. Although no differences in protein profile between controls and chemical treatments and among chemical treatments could be detected visually in one dimensional gels, the neural network was able to correctly assign each sample to the appropriate learned treatment category about 70 percent of the time. Key proteins used by the neural network software to learn the protein profile of each chemical were identified by molecular weight and assigned a relative importance for identification of that chemical.

  6. Influence of organism age on metal toxicity to Daphnia magna.

    PubMed

    Hoang, Tham C; Klaine, Stephen J

    2007-06-01

    Aquatic organisms living in surface water experience contaminant exposure at different life stages. While some investigators have examined the influence of organism age on the toxicity of pollutants, the general assumption in toxicology has been that young organisms were more sensitive than older organisms. In fact, some standardized toxicity tests call for the use of organisms less than 24 h old. This research characterized the age sensitivity of the water flea Daphnia magna to copper, zinc, selenium, and arsenic. During 21-d toxicity tests, organisms were exposed to a single 12-h pulse of either 70 microg/L Cu, 750 microg/L Zn, 1000 microg/L Se, or 5000 microg/L As at different ages ranging from 3 h to 10 d old. Mortality and reproduction were compiled over 21 d. During the juvenile stage, mortality increased and cumulative reproduction decreased with age, respectively. However, mortality decreased and cumulative reproduction increased with age when organisms became adult. Peak sensitivity occurred in 4-d-old organisms exposed to Cu and Zn, while 2- to 3-d-old organisms were most sensitive to As and Se. Growth of D. magna over 21 d was not affected by the 12-h pulse of Cu, Zn, Se, or As given at any organism age. This indicates the recovery of the organisms after exposure termination. PMID:17571686

  7. TALEN-mediated homologous recombination in Daphnia magna

    PubMed Central

    Nakanishi, Takashi; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2015-01-01

    Transcription Activator-Like Effector Nucleases (TALENs) offer versatile tools to engineer endogenous genomic loci in various organisms. We established a homologous recombination (HR)-based knock-in using TALEN in the crustacean Daphnia magna, a model for ecological and toxicological genomics. We constructed TALENs and designed the 67 bp donor insert targeting a point deletion in the eyeless mutant that shows eye deformities. Co-injection of the TALEN mRNA with donor DNA into eggs led to the precise integration of the donor insert in the germ line, which recovered eye deformities in offspring. The frequency of HR events in the germ line was 2% by using both plasmid and single strand oligo DNA with 1.5 kb and 80 nt homology to the target. Deficiency of ligase 4 involved in non-homologous end joining repair did not increase the HR efficiency. Our data represent efficient HR-based knock-in by TALENs in D. magna, which is a promising tool to understand Daphnia gene functions. PMID:26674741

  8. Toxicity of new generation flame retardants to Daphnia magna.

    PubMed

    Waaijers, Susanne L; Hartmann, Julia; Soeter, A Marieke; Helmus, Rick; Kools, Stefan A E; de Voogt, Pim; Admiraal, Wim; Parsons, John R; Kraak, Michiel H S

    2013-10-01

    There is a tendency to substitute frequently used, but relatively hazardous brominated flame retardants (BFRs) with halogen-free flame retardants (HFFRs). Consequently, information on the persistence, bioaccumulation and toxicity (PBT) of these HFFRs is urgently needed, but large data gaps and inconsistencies exist. Therefore, in the present study the toxicity of a wide range of HFFRs to the water flea Daphnia magna was investigated. Our results revealed that four HFFRs were showing no effect at their Sw (saturated water concentration) and three had a low toxicity (EC50>10 mg L(-1)), suggesting that these compounds are not hazardous. Antimony trioxide had a moderate toxicity (EC50=3.01 mg L(-1), 95% CL: 2.76-3.25) and triphenyl phosphate and the brominated reference compound tetra bromobisphenol A were highly toxic to D. magna (EC50=0.55 mg L(-1), 95% CL: 0.53-0.55 and EC50=0.60 mg L(-1), 95% CL: 0.24-0.97 respectively). Aluminum trihydroxide and bisphenol A bis(diphenyl phosphate) caused limited mortality at Sw (26 and 25% respectively) and have a low solubility (<10 mg L(-1)). Hence, increased toxicity of these compounds may be observed when for instance decreasing pH could increase solubility. By testing all compounds under identical conditions we provided missing insights in the environmental hazards of new generation flame retardants and propose as best candidates for BFR replacements: APP, ALPI, DOPO, MHO, MPP, ZHS and ZS. PMID:23886749

  9. FROG - Fingerprinting Genomic Variation Ontology.

    PubMed

    Abinaya, E; Narang, Pankaj; Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: "FingeRprinting Ontology of Genomic variations" is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog. PMID:26244889

  10. A Computational Discriminability Analysis on Twin Fingerprints

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Srihari, Sargur N.

    Sharing similar genetic traits makes the investigation of twins an important study in forensics and biometrics. Fingerprints are one of the most commonly found types of forensic evidence. The similarity between twins’ prints is critical establish to the reliability of fingerprint identification. We present a quantitative analysis of the discriminability of twin fingerprints on a new data set (227 pairs of identical twins and fraternal twins) recently collected from a twin population using both level 1 and level 2 features. Although the patterns of minutiae among twins are more similar than in the general population, the similarity of fingerprints of twins is significantly different from that between genuine prints of the same finger. Twins fingerprints are discriminable with a 1.5%~1.7% higher EER than non-twins. And identical twins can be distinguished by examine fingerprint with a slightly higher error rate than fraternal twins.

  11. A novel approach for fingerprinting mummified hands.

    PubMed

    Fields, Roy; Molina, D Kimberley

    2008-07-01

    Fingerprinting has long been used as a method for identifying bodies and, since first discovered, many advances have been made in both fingerprint acquisition and interpretation. However, in the field of forensic pathology, the attainment of fingerprints from mummified bodies has remained difficult. The most common technique historically used to obtain fingerprints in these cases usually employs the amputation of the fingers combined with soaking and/or injecting the fingers with various solutions in order to enhance the fingerprints. A novel approach to fingerprinting mummified fingers is presented which involves removal and rehydration of the fingerpads (including the epidermal, dermal, and adipose tissues) followed by inking and rolling, using a gloved finger for support. The technique presented produces a superior quality of print without amputation of the finger, yielding excellent results and assisting in obtaining positive identification. PMID:18489553

  12. Chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Milazzo, D.P.

    1988-01-01

    Data generated from daphnid chronic toxicity tests are used by various regulatory agencies for the development of water quality criteria. Two chemicals which are lacking reported chronic data are aniline and 2,4-dichlorophenol. The acute toxicity of 2,4-dichlorophenol to Daphnia magna has been reported; the toxicity of aniline to D. magna also has been reported. Chronic data for these chemicals are lacking for invertebrates. The objective of this study was to estimate the chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus, using a standard 21-day static renewal procedure.

  13. A registration problem for functional fingerprinting.

    PubMed

    Kaplan, David M; Craver, Carl F

    2016-01-01

    Functional fingerprints aggregate over heterogeneous tasks, protocols, and controls. The appearance of functional diversity might be explained by task heterogeneity and conceptual imprecision. PMID:27561900

  14. On relative distortion in fingerprint comparison.

    PubMed

    Kalka, Nathan D; Hicklin, R Austin

    2014-11-01

    When fingerprints are deposited, non-uniform pressure in conjunction with the inherent elasticity of friction ridge skin often causes linear and non-linear distortions in the ridge and valley structure. The effects of these distortions must be considered during analysis of fingerprint images. Even when individual prints are not notably distorted, relative distortion between two prints can have a serious impact on comparison. In this paper we discuss several metrics for quantifying and visualizing linear and non-linear fingerprint deformations, and software tools to assist examiners in accounting for distortion in fingerprint comparisons. PMID:25216456

  15. TV system for detection of latent fingerprints

    NASA Astrophysics Data System (ADS)

    Li, Ping; Ban, Xianfu; Liu, Shaowu; Ding, Zhenfang

    1993-04-01

    A fingerprint is reliable evidence for recognizing criminals in detecting cases. There are many conventional chemical and physical methods in detecting fingerprints. In this paper, a newly developed portable TV system for detecting a latent fingerprint is described. This system is suited for field reconnaissance of cases as well as for laboratory testing. It can display a latent fingerprint, which is hard to identify and even cannot be displayed by conventional methods, and it can detect prints or stamps which are faded, altered, or falsified, etc.

  16. Microorganism Identification Based On MALDI-TOF-MS Fingerprints

    NASA Astrophysics Data System (ADS)

    Elssner, Thomas; Kostrzewa, Markus; Maier, Thomas; Kruppa, Gary

    Advances in MALDI-TOF mass spectrometry have enabled the ­development of a rapid, accurate and specific method for the identification of bacteria directly from colonies picked from culture plates, which we have named the MALDI Biotyper. The picked colonies are placed on a target plate, a drop of matrix solution is added, and a pattern of protein molecular weights and intensities, "the protein fingerprint" of the bacteria, is produced by the MALDI-TOF mass spectrometer. The obtained protein mass fingerprint representing a molecular signature of the microorganism is then matched against a database containing a library of previously measured protein mass fingerprints, and scores for the match to every library entry are produced. An ID is obtained if a score is returned over a pre-set threshold. The sensitivity of the techniques is such that only approximately 104 bacterial cells are needed, meaning that an overnight culture is sufficient, and the results are obtained in minutes after culture. The improvement in time to result over biochemical methods, and the capability to perform a non-targeted identification of bacteria and spores, potentially makes this method suitable for use in the detect-to-treat timeframe in a bioterrorism event. In the case of white-powder samples, the infectious spore is present in sufficient quantity in the powder so that the MALDI Biotyper result can be obtained directly from the white powder, without the need for culture. While spores produce very different patterns from the vegetative colonies of the corresponding bacteria, this problem is overcome by simply including protein fingerprints of the spores in the library. Results on spores can be returned within minutes, making the method suitable for use in the "detect-to-protect" timeframe.

  17. Fingerprinting Codes for Multimedia Data against Averaging Attack

    NASA Astrophysics Data System (ADS)

    Yagi, Hideki; Matsushima, Toshiyasu; Hirasawa, Shigeichi

    Code construction for digital fingerprinting, which is a copyright protection technique for multimedia, is considered. Digital fingerprinting should deter collusion attacks, where several fingerprinted copies of the same content are mixed to disturb their fingerprints. In this paper, we consider the averaging attack, which is known to be effective for multimedia fingerprinting with the spread spectrum technique. We propose new methods for constructing fingerprinting codes to increase the coding rate of conventional fingerprinting codes, while they guarantee to identify the same number of colluders. Due to the new fingerprinting codes, the system can deal with a larger number of users to supply digital contents.

  18. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    PubMed

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

  19. DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

    PubMed Central

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

  20. Recurrent abscesses due to Finegoldia magna, Dermabacter hominis and Staphylococcus aureus in an immunocompetent patient.

    PubMed

    Martin, J; Bemer, P; Touchais, S; Asseray, N; Corvec, S

    2009-10-01

    A case of recurrent abscesses in an immunocompetent patient is reported, involving the opportunistic human pathogen Dermabacter hominis, the virulent anaerobic pathogen Finegoldia magna and Staphylococcus aureus. PMID:19332143

  1. Molecular tools used in agriculture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A summary of molecular tools used for research in agriculture were presented. Examples of DNA sequencing, library preparation, use of fingerprinting for pathogens and plant crops, high throughput sequencing, whole-genome amplification, reporter genes, and other methods....

  2. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    SciTech Connect

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  3. Acute toxicity of cyanogen chloride to Daphnia magna

    SciTech Connect

    Kononen, D.W.

    1988-09-01

    The destruction of cyanide in waste waters by chlorination has been shown to result in the formation of the extremely toxic compound, cyanogen chloride. Industrial cyanide-containing waste waters may be treated by a batch chlorination process under highly alkaline conditions prior to being discharged into a receiving water systems. Alternatively, if the concentration of cyanide is relatively low, and such waste waters may be diverted to municipal waste treatment facilities where they may be subjected to a process of chlorination which may not be sufficient for the complete oxidative destruction of the available cyanide. Although a large body of literature exists concerning the toxicity of HCN and metallic cyanide compounds to aquatic organisms, there is a comparative scarcity of information concerning cyanogen chloride toxicity. This study was designed to determine the acute toxicity of CNCl to Daphnia magna neonates under static bioassay conditions.

  4. Chemical Fingerprinting Program for RSRM Critical Materials

    NASA Technical Reports Server (NTRS)

    McClennen, William H.; Fife, Dennis J.; Killpack, Michael O.; Golde, Rick P.; Cash, Steve (Technical Monitor)

    2002-01-01

    This viewgraph presentation provides information on the chemical fingerprinting of RSRM (Reusable Sold Rocket Motor) components. A chemical fingerprint can be used to identify a material, to differentiate it from similar looking materials, or lead to its source. It can also identify unexpected changes to a vendor or supplier's material, and monitor aging.

  5. Tools for quality control of fingerprint databases

    NASA Astrophysics Data System (ADS)

    Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

    2010-04-01

    Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

  6. DNA Fingerprinting in a Forensic Teaching Experiment

    ERIC Educational Resources Information Center

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  7. Genes mirror geography in Daphnia magna.

    PubMed

    Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

    2015-09-01

    Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history. PMID:26190313

  8. Diofenolan induces male offspring production through binding to the juvenile hormone receptor in Daphnia magna.

    PubMed

    Abe, Ryoko; Toyota, Kenji; Miyakawa, Hitoshi; Watanabe, Haruna; Oka, Tomohiro; Miyagawa, Shinichi; Nishide, Hiroyo; Uchiyama, Ikuo; Tollefsen, Knut Erik; Iguchi, Taisen; Tatarazako, Norihisa

    2015-02-01

    Juvenile hormone (JH) and JH agonists have been reported to induce male offspring production in various daphnid species including Daphnia magna. We recently established a short-term in vivo screening assay to detect chemicals having male offspring induction activity in adult D. magna. Diofenolan has been developed as a JH agonist for insect pest control, but its male offspring induction activity in daphnids has not been investigated yet. In this study, we found that the insect growth regulator (IGR) diofenolan exhibited a potent male offspring induction activity at low ng/L to μg/L concentrations, as demonstrated by the short-term in vivo screening assay and the recently developed TG211 ANNEX 7 test protocol. A two-hybrid assay performed using the D. magna JH receptor confirmed that diofenolan had a strong JH activity. Global whole body transcriptome analysis of D. magna exposed to 10 ng/L diofenolan showed an up-regulation of JH-responsive genes and modulation of several genes involved in the ecdysone receptor signaling pathway. These results clearly demonstrate that diofenolan has strong JH activity and male offspring induction activity, and that a combination of modified standardized regulatory testing protocols and rapid in vitro and in vivo screening assays are able to identify potential endocrine disruptors in D. magna. The observation that diofenolan modulates multiple endocrine signaling pathways in D. magna suggests that further investigation of potential interference with growth, development and reproduction is warranted. PMID:25506888

  9. Effects of Microcystis aeruginosa on life history of water flea Daphnia magna

    NASA Astrophysics Data System (ADS)

    Liu, Liping; Li, Kang; Chen, Taoying; Dai, Xilin; Jiang, Min; Diana, James S.

    2011-07-01

    Cyanobacterial blooms in eutrophic freshwater systems are a worldwide problem, creating adverse effects for many aquatic organisms by producing toxic microcystins and deteriorating water quality. In this study, microcystins (MCs) in Microcystis aeruginosa, and Daphnia magna exposed to M. aeruginosa, were analyzed by HPLC-MS, and the effects of M. aeruginosa on D. magna were investigated. When D. magna was exposed to M. aeruginosa for more than 2 h, Microcystin-LR (MC-LR) was detected. When exposed to 1.5 × 106, 3 × 106, 0.75 × 107, and 1.5 × 107 cell/mL of M. aeruginosa for 96 h, average survival of D. magna for treatments were 23.33%, 33.33%, 13.33%, 16.67%, respectively, which were significantly lower than the average 100% survival in the control group ( P < 0.05). The adverse effects of M. aeruginosa on body length, time for the first brood, brood numbers, gross fecundity, lifespan, and population growth of D. magna were density-dependent. These results suggest that the occurrence of M. aeruginosa blooms could strongly inhibit the population growth of D. magna through depression of survival, individual growth and gross fecundity. In the most serious situations, M. aeruginosa blooms could undermine the food web by eliminating filter-feeding zooplankton, which would destroy the ecological balance of aquaculture water bodies.

  10. Spectroscopic fingerprint of tea varieties by surface enhanced Raman spectroscopy.

    PubMed

    Buyukgoz, Guluzar Gorkem; Soforoglu, Mehmet; Basaran Akgul, Nese; Boyaci, Ismail Hakki

    2016-03-01

    The fingerprinting method is generally performed to determine specific molecules or the behavior of specific molecular bonds in the desired sample content. A novel, robust and simple method based on surface enhanced Raman spectroscopy (SERS) was developed to obtain the full spectrum of tea varieties for detection of the purity of the samples based on the type of processing and cultivation. For this purpose, the fingerprint of seven different varieties of tea samples (herbal tea (rose hip, chamomile, linden, green and sage tea), black tea and earl grey tea) combined with silver colloids was obtained by SERS in the range of 200-2000 cm(-1) with an analysis time of 20 s. Each of the thirty-nine tea samples tested showed its own specific SERS spectra. Principal Component Analysis (PCA) was also applied to separate of each tea variety and different models developed for tea samples including three different models for the herbal teas and two different models for black and earl grey tea samples. Herbal tea samples were separated using mean centering, smoothing and median centering pre-processing steps while baselining and derivatisation pre-processing steps were applied to SERS data of black and earl grey tea. The novel spectroscopic fingerprinting technique combined with PCA is an accurate, rapid and simple methodology for the assessment of tea types based on the type of processing and cultivation differences. This method is proposed as an alternative tool in order to determine the characteristics of tea varieties. PMID:27570296

  11. Integrated fingerprinting in secure digital cinema projection

    NASA Astrophysics Data System (ADS)

    Delannay, Damien; Delaigle, Jean-Francois; Macq, Benoit M. M.; Quisquater, Jean-Jacques; Mas Ribes, Joan M.; Boucqueau, Jean M.; Nivart, Jean-Francois

    2001-12-01

    This paper describes the functional model of a combined conditional access and fingerprinting copyright (-or projectionright) protection system in a digital cinema framework. In the cinema industry, a large part of early movie piracy comes from copies made in the theater itself with a camera. The evolution towards digital cinema broadcast enables watermark based fingerprinting protection systems. Besides an appropriate fingerprinting technology, a number of well defined security/cryptographic tools are integrated in order to guaranty the integrity of the whole system. The requirements are two-fold: On one side, we must ensure that the media content is only accessible at exhibition time (under specific authorization obtained after an ad-hoc film rental agreement) and contains the related exhibition fingerprint. At the other end, we must prove our ability to retrieve the fingerprint information from an illegal copy of the media.

  12. DNA fingerprints come to court

    SciTech Connect

    Not Available

    1988-04-15

    DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person.

  13. DNA fingerprinting in zoology: past, present, future.

    PubMed

    Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

    2014-01-01

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work. PMID:24490906

  14. Detection of a novel arginine vasopression defect by dideoxy fingerprinting

    SciTech Connect

    Krishnamani, M.R.S.; Phillips, J.A. III; Copeland, K.C. Univ. of Vermont College of Medicine, Burlington, VT )

    1993-09-01

    Autosomal dominant neurohypophyseal diabetes insipidus is a familial form of diabetes insipidus. This disorder is associated with variable levels of arginine vasopressin (AVP) and diabetes insipidus of varying severity, which responds to exogenous AVP. To determine the molecular basis of autosomal dominant neurohypophyseal diabetes insipidus, the AVP genes of members of a large kindred were analyzed. A new method, called dideoxy fingerprinting, was used to detect an AVP mutation that was characterized by DNA sequencing. The novel defect found changes the last codon of the AVP signal peptide from alanine to threonine, which should perturb cleavage of mature AVP from its precursor protein and inhibit its secretion or action. 18 refs., 3 figs.

  15. Fingerprints of polycyclic aromatic hydrocarbons (PAHs) in infrared absorption spectroscopy

    NASA Astrophysics Data System (ADS)

    Tommasini, Matteo; Lucotti, Andrea; Alfè, Michela; Ciajolo, Anna; Zerbi, Giuseppe

    2016-01-01

    We have analyzed a set of 51 PAHs whose structures have been hypothesized from mass spectrometry data collected on samples extracted from carbon particles of combustion origin. We have obtained relationships between infrared absorption signals in the fingerprint region (mid-IR) and the chemical structures of PAHs, thus proving the potential of IR spectroscopy for the characterization of the molecular structure of aromatic combustion products. The results obtained here for the spectroscopic characterization of PAHs can be also of interest in Materials Science and Astrophysics.

  16. Fingerprints of polycyclic aromatic hydrocarbons (PAHs) in infrared absorption spectroscopy.

    PubMed

    Tommasini, Matteo; Lucotti, Andrea; Alfè, Michela; Ciajolo, Anna; Zerbi, Giuseppe

    2016-01-01

    We have analyzed a set of 51 PAHs whose structures have been hypothesized from mass spectrometry data collected on samples extracted from carbon particles of combustion origin. We have obtained relationships between infrared absorption signals in the fingerprint region (mid-IR) and the chemical structures of PAHs, thus proving the potential of IR spectroscopy for the characterization of the molecular structure of aromatic combustion products. The results obtained here for the spectroscopic characterization of PAHs can be also of interest in Materials Science and Astrophysics. PMID:26208268

  17. Fingerprint Minutiae from Latent and Matching Tenprint Images

    National Institute of Standards and Technology Data Gateway

    NIST Fingerprint Minutiae from Latent and Matching Tenprint Images (PC database for purchase)   NIST Special Database 27 contains latent fingerprints from crime scenes and their matching rolled fingerprint mates. This database can be used to develop and test new fingerprint algorithms, test commercial and research AFIS systems, train latent examiners, and promote the ANSI/NIST file format standard.

  18. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  19. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  20. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  1. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  2. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  3. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  4. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  5. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  6. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  7. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  8. Composition and stability of the microbial community inside the digestive tract of the aquatic crustacean Daphnia magna.

    PubMed

    Freese, Heike M; Schink, Bernhard

    2011-11-01

    Small filter-feeding zooplankton organisms like the cladoceran Daphnia spp. are key members of freshwater food webs. Although several interactions between Daphnia and bacteria have been investigated, the importance of the microbial communities inside Daphnia guts has been studied only poorly so far. In the present study, we characterised the bacterial community composition inside the digestive tract of a laboratory-reared clonal culture of Daphnia magna using 16S rRNA gene libraries and terminal-restriction length polymorphism fingerprint analyses. In addition, the diversity and stability of the intestinal microbial community were investigated over time, with different food sources as well as under starvation stress and death, and were compared to the community in the cultivation water. The diversity of the Daphnia gut microbiota was low. The bacterial community consisted mainly of Betaproteobacteria (e.g. Limnohabitans sp.), few Gammaproteobacteria (e.g. Pseudomonas sp.) and Bacteroidetes that were related to facultatively anaerobic bacteria, but did not contain typical fermentative or obligately anaerobic gut bacteria. Rather, the microbiota was constantly dominated by Limnohabitans sp. which belongs to the Lhab-A1 tribe (previously called R-BT065 cluster) that is abundant in various freshwaters. Other bacterial groups varied distinctly even under constant cultivation conditions. Overall, the intestinal microbial community did not reflect the community in the surrounding cultivation water and clustered separately when analysed via the Additive Main Effects and Multiplicative Interaction model. In addition, the microbiota proved to be stable also when Daphnia were exposed to bacteria associated with a different food alga. After starvation, the community in the digestive tract was reduced to stable members. After death of the host animals, the community composition in the gut changed distinctly, and formerly undetected bacteria were activated. Our results suggest

  9. Disturbances in energy metabolism of Daphnia magna after exposure to tebuconazole.

    PubMed

    Sancho, E; Villarroel, M J; Andreu, E; Ferrando, M D

    2009-03-01

    This study was conducted to investigate the change of some biochemical parameters in the aquatic invertebrate Daphnia magna following exposure to the fungicide tebuconazole and to determine the most sensitive biomarker among the ones tested in this species. Four biochemical biomarkers (protein, glycogen, lipids and caloric content) were correlated with feeding behaviour studies of D. magna after fungicide exposure. Juveniles of D. magna were exposed to four sublethal concentrations of tebuconazole (0.41, 0.52, 0.71 and 1.14 mgL(-1)) for 5d. Daphnid samples were taken from each test and control group at 24, 48, 72, 96 and 120 h after the start of the experiment. Tebuconazole EC(50) values were calculated on D. magna in our laboratory as 56.83 and 40.10 mgL(-1) at 24 and 48 h, respectively. Results showed that daphnid energy content decreased as tebuconazole concentration increased, especially after 96-120 h of exposure to 0.52 mgL(-1) and higher fungicide concentrations. The data suggest that tebuconazole is moderately toxic to D. magna but also that it seriously impairs the metabolic functions, resulting in alterations in biochemical constituents. In the D. magna feeding study, algae feeding rates were inhibited after fungicide exposure. Such findings indicate the importance of feeding studies in laboratory toxicity test as well as their relationship with others studies. The results emphasize the importance of considering different kind of biomarkers to identify and evaluate the biological effect of a fungicide in the aquatic environment. Although the biochemical biomarkers used resulted good indicators of tebuconazole toxicity, feeding rates in D. magna decreased after only 5h exposure to the fungicide resulting in the most sensitive parameter of daphnid fungicide exposure. PMID:19135699

  10. A low-rate fingerprinting code and its application to blind image fingerprinting

    NASA Astrophysics Data System (ADS)

    Jourdas, Jean-Francois; Moulin, Pierre

    2008-02-01

    In fingerprinting, a signature, unique to each user, is embedded in each distributed copy of a multimedia content, in order to identify potential illegal redistributors. This paper investigates digital fingerprinting problems involving millions of users and a handful of colluders. In such problems the rate of the fingerprinting code is often well below fingerprinting capacity, and the use of codes with large minimum distance emerges as a natural design. However, optimal decoding is a formidable computational problem. We investigate a design based on a Reed-Solomon outer code modulated onto an orthonormal constellation, and the Guruswami-Sudan decoding algorithm. We analyze the potential and limitations of this scheme and assess its performance by means of Monte-Carlo simulations. In the second part of this paper, we apply this scheme to a blind image fingerprinting problem, using a linear cancellation technique for embedding in the wavelet domain. Dramatic improvements are obtained over previous blind image fingerprinting algorithms.

  11. Mated Fingerprint Card Pairs 2 (MFCP2)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs 2 (MFCP2) (PC database for purchase)   NIST Special Database 14 is being distributed for use in development and testing of automated fingerprint classification and matching systems on a set of images which approximate a natural horizontal distribution of the National Crime Information Center (NCIC) fingerprint classes. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  12. The detection of drugs of abuse in fingerprints using Raman spectroscopy I: latent fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-02-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in latent fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were studied in both sweat-rich and sebum-rich latent fingerprints. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in latent fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in sweat-rich latent fingerprints were of a similar quality to spectra that obtained from the substances under normal sampling conditions. Interfering Raman bands arising from latent fingerprint material were present in the spectra obtained from the substances in sebum-rich fingerprints. These bands did not prevent identification of the substances and could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in latent fingerprints was visually locating the substance in the fingerprint in order to obtain a Raman spectrum.

  13. Dual Resolution Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Dual Resolution Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  14. Forensic Identification of Gender from Fingerprints.

    PubMed

    Huynh, Crystal; Brunelle, Erica; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2015-11-17

    In the past century, forensic investigators have universally accepted fingerprinting as a reliable identification method, which relies mainly on pictorial comparisons. Despite developments to software systems in order to increase the probability and speed of identification, there has been limited success in the efforts that have been made to move away from the discipline's absolute dependence on the existence of a prerecorded matching fingerprint. Here, we have revealed that an information-rich latent fingerprint has not been used to its full potential. In our approach, the content present in the sweat left behind-namely the amino acids-can be used to determine physical such as gender of the originator. As a result, we were able to focus on the biochemical content in the fingerprint using a biocatalytic assay, coupled with a specially designed extraction protocol, for determining gender rather than focusing solely on the physical image. PMID:26460203

  15. Chemical characterization of components in fingerprints

    SciTech Connect

    Jarboe, S.G.; Asano, K.G.; Buchanan, M.V.; Bohanan, A.

    1997-12-31

    Investigations into the chemical composition of fingerprints were initiated after it was observed that the latent fingerprints of children disappear more rapidly from surfaces than those of adults. Initial work included the use of GUMS for the identification of compounds present in fingerprints. The relative concentrations of fatty acids and alkyl esters in children and adults appear to contribute to the higher rate of disappearance of prints from the younger subjects. The presence of alkyl esters is linked to sebaceous excretions originating from the face, which increase markedly after puberty. This work has been expanded to include characterization of other classes of components, including amino acids and triacylglycerols. This research is part of an ongoing project to identify various components of fingerprints and explore possible clinical and forensic applications. Through large sampling pools, trends that can indicate personal characteristics (i.e., gender, age), habits (smoking, drug use), and health-related issues (diabetes) are being investigated.

  16. Combined experimental and theoretical study on photoinduced toxicity of an anthraquinone dye intermediate to Daphnia magna.

    PubMed

    Wang, Ying; Chen, Jingwen; Lin, Jing; Wang, Zhen; Bian, Haitao; Cai, Xiyun; Hao, Ce

    2009-04-01

    The toxicity of chemicals can be enhanced by light through two photochemical pathways: Photomodification to more toxic substances and photosensitization. In the present study, the reactive oxygen species (ROS) mechanism for photoinduced acute toxicity of 1-amino-2,4-dibromoanthraquinone (ADBAQ) to Daphnia magna was clarified by experiment and theoretical calculation. The results of the present study show that ADBAQ exhibited high toxicity to D. magna under simulated solar radiation (SSR), with a median effective concentration of 1.23 +/- 0.19 nM (mean +/- standard deviation). The photomodified ADBAQ (mixtures of ADBAQ and its photoproducts) was less phototoxic than the intact ADBAQ. The SSR-only or ADBAQ-only treatments did not affect the ROS level in D. magna, whereas increased ROS levels were observed in the presence of SSR and ADBAQ. The ROS in vivo were determined by measuring the fluorescence of 2',7'-dichlorofluorescein, which is a useful technique to assess toxicity of chemicals to aquatic organisms. The antioxidants, including vitamin C, vitamin E, and beta-carotene, decreased the photoinduced oxidative damage to D. magna, probably by scavenging ROS. These experimental results demonstrate that photosensitization is the potential mechanism of photoinduced toxicity of ADBAQ to D. magna. Proposed phototoxic pathways of ADBAQ were elucidated by means of time-dependent density functional theory. The theoretical calculation indicates that superoxide anion and singlet oxygen are able to be generated through electron transfer or energy transfer in the photosensitization reactions. PMID:19391687

  17. Reduced fitness of Daphnia magna fed a Bt-transgenic maize variety.

    PubMed

    Bøhn, Thomas; Primicerio, Raul; Hessen, Dag O; Traavik, Terje

    2008-11-01

    Genetically modified (GM) maize expressing the Bt-toxin Cry1Ab (Bt-maize) was tested for effects on survival, growth, and reproduction of the water flea Daphnia magna, a crustacean arthropod commonly used as a model organism in ecotoxicological studies. In three repeated experiments, D. magna were fed 100% ground maize in suspension, using either GM or isogenic unmodified (UM) maize. D. magna fed GM-maize showed a significantly reduced fitness performance: The mortality was higher, a lower proportion of females reached sexual maturation, and the overall egg production was lower compared to D. magna fed UM isogenic maize. We conclude that the tested variety of Bt-maize and its UM counterpart do not have the same quality as food sources for this widely used model organism. The combination of a reduced fitness performance combined with earlier onset of reproduction of D. magna fed Bt-maize indicates a toxic effect rather than a lower nutritional value of the GM-maize. PMID:18347840

  18. Petroleum fingerprinting: Dating a gasoline release

    SciTech Connect

    Johnson, M.D.; Morrison, R.D.

    1996-09-01

    Dating a gasoline releases is particularly important in situations involving a contaminated gasoline service station. Often the station begins under the control of a major oil company, and as it ages and deteriorates it may be operated by a series of smaller operators. When facing a claim for contamination, often operators blame former operators. Fingerprinting is one of several successful methods used to date petroleum releases on contaminated sites. The topics covered in this article are inventory reconciliation; reverse groundwater modeling; hydrocarbon fingerprinting.

  19. On the statistics of the "genetic fingerprint".

    PubMed

    Ritter, H

    1991-01-01

    In analogy to the polygene determined morphological features, the DNA-fingerprint is also not suitable for statistical processing. Statements about the individuality are merely speculative. Frequencies of genes cannot be found, since it is impossible to determine which combinations of bands belong to one gene locus. Hence the DNA fingerprint enables the recognition of exclusions from paternity; it does not, however, allow a statistical analysis, no matter which method be employed. PMID:1685896

  20. Devascularizing complications of free fibula harvest: peronea arteria magna.

    PubMed

    Rosson, Gedge D; Singh, Navin K

    2005-11-01

    The authors present a case report of devascularizing complications following free fibula harvest. A retrospective review of 93 consecutively imaged limbs demonstrated a peronea arteria magna (PAM) prevalence of 5.3 percent in an urban population, which was used to perform a cost-effectiveness analysis for preoperative vascular imaging of the donor limb using magnetic resonance angiography (MRA) and traditional angiography (TA). Donor-site complications of fibula harvest range from 15 to 30 percent, but are rarely limb-threatening. Limb loss is a dreaded complication of congenital PAM, which can be present with a normal vascular exam. Some microsurgery groups advocate using no preoperative imaging of the donor limb; they rely on intraoperative assessment of the vascular anatomy. An aborted harvest due to aberrant anatomy leads to both direct and indirect added costs. The authors believe that MRA imaging of the donor limb, being minimally invasive, is cost-effective and indicated for free fibula transfers. For equivocal results, conversion to more invasive and costly TA may be necessary. PMID:16292729

  1. Toxicokinetic and toxicodynamic model for diazinon toxicity--mechanistic explanation of differences in the sensitivity of Daphnia magna and Gammarus pulex.

    PubMed

    Kretschmann, Andreas; Ashauer, Roman; Hollender, Juliane; Escher, Beate I

    2012-09-01

    A mechanistic toxicokinetic and toxicodynamic model for acute toxic effects (immobilization, mortality) of the organothiophosphate insecticide diazinon in Daphnia magna is presented. The model was parameterized using measured external and internal (whole-body) concentrations of diazinon, its toxic metabolite diazoxon, and the inactive metabolite 2-isopropyl-6-methyl-4-pyrimidinol, plus acetylcholinesterase (AChE) activity measured during exposure to diazinon in vivo. The toxicokinetic and toxicodynamic model provides a coherent picture from exposure to the resulting toxic effect on an organism level through internally formed metabolites and the effect on a molecular scale. A very fast reaction of diazoxon with AChE (pseudo first-order inhibition rate constant k(i) = 3.3 h(-1)) compared with a slow formation of diazoxon (activation rate constant k(act) = 0.014 h(-1)) was responsible for the high sensitivity of D. magna toward diazinon. Recovery of AChE activity from inhibition was slow and rate-determining (99% recovery within 16 d), compared with a fast elimination of diazinon (99% elimination within 17 h). The obtained model parameters were compared with toxicokinetic and toxicodynamic parameters of Gammarus pulex exposed to diazinon from previous work. This comparison revealed that G. pulex is less sensitive because of a six times faster detoxification of diazinon and diazoxon and an approximately 400 times lower rate for damage accrual. These differences overcompensate the two times faster activation of diazinon to diazoxon in G. pulex compared to D. magna. The present study substantiates theoretical considerations that mechanistically based effect models are helpful to explain sensitivity differences among different aquatic invertebrates. PMID:22653849

  2. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  3. Linguistically informed digital fingerprints for text

    NASA Astrophysics Data System (ADS)

    Uzuner, Özlem

    2006-02-01

    Digital fingerprinting, watermarking, and tracking technologies have gained importance in the recent years in response to growing problems such as digital copyright infringement. While fingerprints and watermarks can be generated in many different ways, use of natural language processing for these purposes has so far been limited. Measuring similarity of literary works for automatic copyright infringement detection requires identifying and comparing creative expression of content in documents. In this paper, we present a linguistic approach to automatically fingerprinting novels based on their expression of content. We use natural language processing techniques to generate "expression fingerprints". These fingerprints consist of both syntactic and semantic elements of language, i.e., syntactic and semantic elements of expression. Our experiments indicate that syntactic and semantic elements of expression enable accurate identification of novels and their paraphrases, providing a significant improvement over techniques used in text classification literature for automatic copy recognition. We show that these elements of expression can be used to fingerprint, label, or watermark works; they represent features that are essential to the character of works and that remain fairly consistent in the works even when works are paraphrased. These features can be directly extracted from the contents of the works on demand and can be used to recognize works that would not be correctly identified either in the absence of pre-existing labels or by verbatim-copy detectors.

  4. [HPLC fingerprints in seed of Celosia argentea].

    PubMed

    Wang, Ying; Guo, Mei-Li; Wang, Xiao-Kang; Yin, Jun

    2008-01-01

    For preferable authentication and regulation of material quality of Celosia argentea, HPLC fingerprints of different habitats were studied. Analysis was carried out on a Hypersil ODS2 column (4.6 mm x 250 mm, 5 microm) with acetonitrile-0.1% glacial acetic acid as the mobile phase, and eluates were detected by an evaporative light scattering detector (ELSD). The similarity evaluation system for chromatographic fingerprint of traditional Chinese medicine ( Version 2004 A) was applied to analyses the similarity of the fingerprint of diverse habitats. The similarity results were verified by SPSS. The chromatographic profiles of the samples from different regions were very similar. HPLC fingerprints of Semen C. argentea 12 common peaks and each peak in the fingerprint was well separated under the chromatographic condition above. The different habitats of C. argentea can be grouped to two types: the middle region and the south region. The chemical constituents of C. argentea vary with different habitats so selection of material habitat is very important for quality control of C. argentea. The fingerprint with high individuality and specificity could be applied in the identification and quality control of the material of C. argentea. PMID:18338620

  5. Privacy protection schemes for fingerprint recognition systems

    NASA Astrophysics Data System (ADS)

    Marasco, Emanuela; Cukic, Bojan

    2015-05-01

    The deployment of fingerprint recognition systems has always raised concerns related to personal privacy. A fingerprint is permanently associated with an individual and, generally, it cannot be reset if compromised in one application. Given that fingerprints are not a secret, potential misuses besides personal recognition represent privacy threats and may lead to public distrust. Privacy mechanisms control access to personal information and limit the likelihood of intrusions. In this paper, image- and feature-level schemes for privacy protection in fingerprint recognition systems are reviewed. Storing only key features of a biometric signature can reduce the likelihood of biometric data being used for unintended purposes. In biometric cryptosystems and biometric-based key release, the biometric component verifies the identity of the user, while the cryptographic key protects the communication channel. Transformation-based approaches only a transformed version of the original biometric signature is stored. Different applications can use different transforms. Matching is performed in the transformed domain which enable the preservation of low error rates. Since such templates do not reveal information about individuals, they are referred to as cancelable templates. A compromised template can be re-issued using a different transform. At image-level, de-identification schemes can remove identifiers disclosed for objectives unrelated to the original purpose, while permitting other authorized uses of personal information. Fingerprint images can be de-identified by, for example, mixing fingerprints or removing gender signature. In both cases, degradation of matching performance is minimized.

  6. Development of Quantitative Structure-Activity Relationship Models for Predicting Chronic Toxicity of Substituted Benzenes to Daphnia Magna.

    PubMed

    Fan, Deling; Liu, Jining; Wang, Lei; Yang, Xianhai; Zhang, Shenghu; Zhang, Yan; Shi, Lili

    2016-05-01

    The chronic toxicity of anthropogenic molecules such as substituted benzenes to Daphnia magna is a basic eco-toxicity parameter employed to assess their environmental risk. As the experimental methods are laborious, costly, and time-consuming, development in silico models for predicting the chronic toxicity is vitally important. In this study, on the basis of five molecular descriptors and 48 compounds, a quantitative structure-property relationship model that can predict the chronic toxicity of substituted benzenes were developed by employing multiple linear regressions. The correlation coefficient (R (2)) and root-mean square error (RMSE) for the training set were 0.836 and 0.390, respectively. The developed model was validated by employing 10 compounds tested in our lab. The R EXT (2) and RMSE EXT for the validation set were 0.736 and 0.490, respectively. To further characterizing the toxicity mechanism of anthropogenic molecules to Daphnia, comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) models were developed. PMID:27016939

  7. Toward Surface-Enhanced Raman Imaging of Latent Fingerprints

    SciTech Connect

    Connatser, Raynella M; Prokes, Sharka M.; Glembocki, Orest; Schuler, Rebecca A.; Gardner, Charles W.; Lewis Sr, Samuel Arthur; Lewis, Linda A

    2010-01-01

    Exposure to light or heat, or simply a dearth of fingerprint material, renders some latent fingerprints undetectable using conventional methods. We begin to address such elusive fingerprints using detection targeting photo- and thermally stable fingerprint constituents: surface-enhanced Raman spectroscopy (SERS). SERS can give descriptive vibrational spectra of amino acids, among other robust fingerprint constituents, and good sensitivity can be attained by improving metal-dielectric nanoparticle substrates. With SERS chemical imaging, vibrational bands intensities recreate a visual of fingerprint topography. The impact of nanoparticle synthesis route, dispersal methodology-deposition solvent, and laser wavelength are discussed, as are data from enhanced vibrational spectra of fingerprint components. SERS and Raman chemical images of fingerprints and realistic contaminants are shown. To our knowledge, this represents the first SERS imaging of fingerprints. In conclusion, this work progresses toward the ultimate goal of vibrationally detecting latent prints that would otherwise remain undetected using traditional development methods.

  8. Correlation between heavy metal acute toxicity values in Daphnia magna and fish

    SciTech Connect

    Khangarot, B.S.; Ray, P.K.

    1987-04-01

    In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species have been of recent interest as test models due to the need for developing nonmammalian tests system. The cladoceran Daphnia magna bioassays have several practical advantages. D. magna has been used as a useful test species and its sensitivity to environmental pollutants have been recognized as a general representative of other freshwater zooplankton species. The objectives of this study were to determine the acute toxicity of various heavy metals to Daphnia magna for 48 h of exposure and to compare these values with the existing LC50 values for rainbow trout (Salmo gairdneri); which is commonly used as a test animal in aquatic bioassay studies.

  9. A comparison of the toxicity of 30 reference chemicals to Daphnia magna and Daphnia pulex

    SciTech Connect

    Lilius, H.; Haestbacka, T.; Isomaa, B.

    1995-12-01

    To determine whether significant differences exist in the sensitivity of different Daphnia species to toxicants, the acute toxicity of the first 30 MEIC (multicenter evaluation of in vitro cytotoxicity) reference chemicals was determined in two species of Daphnia: D. magna and D. pulex. Correlation and regression analysis of the EC50 data for immobilization showed a very good concordance (r = 0.97, slope = 1.02). A comparison between the EC50 data obtained for D. magna by two laboratories independently for the 50 MEIC chemicals also showed a good concordance (r = 0.93, slope = 0.91). In both comparisons the regression line did not differ significantly from the regression line for a 1:1 regression. The authors conclude that their study, including a set of reference chemicals, indicates that is no difference in the overall sensitivity of the two Daphnia species and the two clones of D. magna.

  10. The detection of drugs of abuse in fingerprints using Raman spectroscopy II: cyanoacrylate-fumed fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-07-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in cyanoacrylate-fumed fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. These fingerprints were enhanced by cyanoacrylate fuming, a process in which a layer of white cyanoacrylate polymer is deposited on the fingerprint material, enabling visual detection. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were used. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in cyanoacrylate-fumed fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in cyanoacrylate-fumed fingerprints were of a similar quality to spectra obtained from the substances under normal sampling conditions, however, interfering Raman bands arising from the cyanoacrylate polymer were present in the spectra. In most cases the only interfering band was the CN stretching mode of the polymer, and there were no cases where the interfering bands prevented identification of the substances. If necessary, the interfering bands could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in cyanoacrylate-fumed fingerprints was visually locating the substance in the fingerprint beneath the polymer layer in order to obtain a Raman spectrum.

  11. Exploring methods for compositional and particle size analysis of noble metal nanoparticles in Daphnia magna.

    PubMed

    Krystek, Petra; Brandsma, Sicco; Leonards, Pim; de Boer, Jacob

    2016-01-15

    The identification and quantification of the bioaccumulation of noble metal engineered nanoparticles (ENPs) by aquatic organisms is of great relevance to understand the exposure and potential toxicity mechanisms of nanoscale materials. Four analytical scenarios were investigated in relation to various sized and composed noble metal (gold (Au), platinum (Pt) and silver (Ag)) ENPs during acute, short-term exposure of Daphnia (D.) magna. Next to the total elemental quantification of absorbed ENPs by D. magna, especially information on the size and particle distribution of ENPs in D. magna is of relevance. Dissolution of the exposed biological material prior to measurement by asymmetric flow field flow fractionation coupled to inductively coupled plasma mass spectrometry (AF4-ICPMS) is challenging because the ENPs must stay stable regarding to particle size and composition. Next to dissolution of exposed D. magna by tetra methyl ammonium hydroxide (TMAH), a new enzymatic dissolution approach was explored by using trypsin. The presence of various sized and composed ENPs has been confirmed by AF4-ICPMS but the chosen dissolution medium was crucial for the results. TMAH and trypsin led to comparable results for medium-sized (50nm) noble metals ENPs in exposed D. magna. But it was also shown that the dissolution of biological materials with smaller (<5nm) ENPs led to different results in particle size and elemental concentration depending on the selected dissolution medium. A significant uptake of Au and Pt ENPs by D. magna or adsorption to particles occurred because only 1-5% of the exposed ENPs remained in the exposure medium. PMID:26592609

  12. A Study on the D. magna and V. fischeri Toxicity Relationship of Industrial Wastewater from Korea

    NASA Astrophysics Data System (ADS)

    Pyo, S.; Lee, S.; Chun Sang, H.; Park, T. J.; Kim, M. S.

    2015-12-01

    It is well known that high concentration of TDS (total dissolved solid) in industrial effluent gives rise to the toxicity to the Daphnia magna toxicity test. D. magna is vulnerable to relatively low TDS concentration showing the 24-hr EC50 of Salinity 0.6% (as the sea salt concentration). Recently, standard mandatory toxicity testing using Daphnia magna has been used to monitor industrial effluent toxicity according to Korea standard method (Acute Toxicity Test Method of the Daphnia magna Straus (Cladocera, Crustacea), ES 04704. 1a) under regulation. Since only one acute toxicity testing is applied in the present, we are trying to introduce microbial battery for more complete toxicity assessment. In this study, the acute toxicities between daphnids and microbes were compared. The results of D. magna and Vibrio fischeri toxicity test from 165 industrial wastewater effluents showed high positive correlation. In addition, the possibility of predicting daphnia toxicity from the bacterial toxicity data amounts to 92.6% if we consider salinity effect (>5ppt) together. From this study, we found that the V. fischeri toxicity test is a powerful battery tool to assess the industrial wastewater toxicity. Here, we suggest that luminescent bacteria toxicity test be useful not only for complete toxicity assessment which can't be obtained by daphnia toxicity testing only but also for the reduction cost, time, and labor in the Korean society. Keywords : D. magna, V. fischeri, Industrial waste water, battery test Acknowledgement This research was supported by a grant (15IFIP-B089908-02) from Plant Research Program funded by Ministry of Land, Infrastructure and Transport of Korean government

  13. Development of an NMR microprobe procedure for high-throughput environmental metabolomics of Daphnia magna.

    PubMed

    Nagato, Edward G; Lankadurai, Brian P; Soong, Ronald; Simpson, André J; Simpson, Myrna J

    2015-09-01

    Nuclear magnetic resonance (NMR) is the primary platform used in high-throughput environmental metabolomics studies because its non-selectivity is well suited for non-targeted approaches. However, standard NMR probes may limit the use of NMR-based metabolomics for tiny organisms because of the sample volumes required for routine metabolic profiling. Because of this, keystone ecological species, such as the water flea Daphnia magna, are not commonly studied because of the analytical challenges associated with NMR-based approaches. Here, the use of a 1.7-mm NMR microprobe in analyzing tissue extracts from D. magna is tested. Three different extraction procedures (D2O-based buffer, Bligh and Dyer, and acetonitrile : methanol : water) were compared in terms of the yields and breadth of polar metabolites. The D2O buffer extraction yielded the most metabolites and resulted in the best reproducibility. Varying amounts of D. magna dry mass were extracted to optimize metabolite isolation from D. magna tissues. A ratio of 1-1.5-mg dry mass to 40 µl of extraction solvent provided excellent signal-to-noise and spectral resolution using (1)H NMR. The metabolite profile of a single daphnid was also investigated (approximately 0.2 mg). However, the signal-to-noise of the (1)H NMR was considerably lower, and while feasible for select applications would likely not be appropriate for high-throughput NMR-based metabolomics. Two-dimensional NMR experiments on D. magna extracts were also performed using the 1.7-mm NMR probe to confirm (1)H NMR metabolite assignments. This study provides an NMR-based analytical framework for future metabolomics studies that use D. magna in ecological and ecotoxicity studies. PMID:25891518

  14. Dental DNA fingerprinting in identification of human remains

    PubMed Central

    Girish, KL; Rahman, Farzan S; Tippu, Shoaib R

    2010-01-01

    The recent advances in molecular biology have revolutionized all aspects of dentistry. DNA, the language of life yields information beyond our imagination, both in health or disease. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. It is being increasingly used in analyzing various scenarios related to forensic science. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. DNA is an excellent means for identification of unidentified human remains. As dental pulp is surrounded by dentin and enamel, which forms dental armor, it offers the best source of DNA for reliable genetic type in forensic science. This paper summarizes the recent literature on use of this technique in identification of unidentified human remains. PMID:21731342

  15. Social media fingerprints of unemployment.

    PubMed

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

  16. Social Media Fingerprints of Unemployment

    PubMed Central

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

  17. Metabolomic fingerprinting of plant extracts.

    PubMed

    Mattoli, L; Cangi, F; Maidecchi, A; Ghiara, C; Ragazzi, E; Tubaro, M; Stella, L; Tisato, F; Traldi, P

    2006-12-01

    The standardization and quality control of plant extracts is an important topic, in particular, when such extracts are used for medicinal purposes. Consequently, the development of fast and effective analytical methods for metabolomic fingerprinting of plant extracts is of high interest. In this investigation, electrospray mass spectrometry (ESI-MS) and (1)H NMR techniques were employed with further statistical analyses of the acquired data. The results showed that negative ion mode ESI-MS is particularly effective for characterization of plant extracts. Different samples of the same species appear well-clustered and separated from the other species. To verify the effectiveness of the method, two other batches of extracts from a species, in which the principal components were already identified (Cynara scolymus), were analyzed, and the components that were verified by the principal component analysis (PCA) were found to be within the region identified as characteristic of Cynara Scolymus extracts. The data from extracts of the other species were well separated from those pertaining to the species previously characterized. Only the case of a species that was strictly correlated from a botanical point of view, with extracts that were previously analyzed, showed overlapping. PMID:17051519

  18. Iron-Tolerant Cyanobacteria: Ecophysiology and Fingerprinting

    NASA Technical Reports Server (NTRS)

    Brown, I. I.; Mummey, D.; Lindsey, J.; McKay, D. S.

    2006-01-01

    Although the iron-dependent physiology of marine and freshwater cyanobacterial strains has been the focus of extensive study, very few studies dedicated to the physiology and diversity of cyanobacteria inhabiting iron-depositing hot springs have been conducted. One of the few studies that have been conducted [B. Pierson, 1999] found that cyanobacterial members of iron depositing bacterial mat communities might increase the rate of iron oxidation in situ and that ferrous iron concentrations up to 1 mM significantly stimulated light dependent consumption of bicarbonate, suggesting a specific role for elevated iron in photosynthesis of cyanobacteria inhabiting iron-depositing hot springs. Our recent studies pertaining to the diversity and physiology of cyanobacteria populating iron-depositing hot springs in Great Yellowstone area (Western USA) indicated a number of different isolates exhibiting elevated tolerance to Fe(3+) (up to 1 mM). Moreover, stimulation of growth was observed with increased Fe(3+) (0.02-0.4 mM). Molecular fingerprinting of unialgal isolates revealed a new cyanobacterial genus and species Chroogloeocystis siderophila, an unicellular cyanobacterium with significant EPS sheath harboring colloidal Fe(3+) from iron enriched media. Our preliminary data suggest that some filamentous species of iron-tolerant cyanobacteria are capable of exocytosis of iron precipitated in cytoplasm. Prior to 2.4 Ga global oceans were likely significantly enriched in soluble iron [Lindsay et al, 2003], conditions which are not conducive to growth of most contemporary oxygenic cyanobacteria. Thus, iron-tolerant CB may have played important physiological and evolutionary roles in Earths history.

  19. Near Catastrophic Accelerated Structural Degeneration of the Perimount Magna Pericardial Bioprosthesis in Children.

    PubMed

    Philip, Ranjit; Kumar, T K Susheel; Waller, B Rush; McCoy, Mia; Knott-Craig, Christopher J

    2016-07-01

    Experience with pericardial bioprostheses in young patients is limited. Accelerated degeneration of the Mitroflow valve has recently been reported. We report early accelerated structural valve degeneration with the Perimount Magna bioprosthesis, which has not been previously reported. Young patients with the Magna bioprosthesis are at high risk for rapid progression to severe stenosis, which underscores their need for more vigilant surveillance. The benefits and risks of these bioprosthetic valves must be weighed carefully when options for replacement in these young patients are discussed. PMID:27343502

  20. Free ionic nickel accumulation and localization in the freshwater zooplankter, Daphnia magna

    SciTech Connect

    Hall, T.M.

    1982-01-01

    The processes which lead to the accumulation of free ionic nickel (radioactive) from solution by Daphnia magna were studied and incorporated into a model which describes accummulation at different concentrations. Adsorption proved to be a relatively small component of nickel accummulation. The accummulation rate eventually approached zero, which represented an equilibrium between uptake and loss of nickel. However, elimination experiments did reveal a pool of relatively static nickel. The appearance and distribution of nickel within five body parts (body fluid, carapace, gut, filtering appendages, and eggs) of D. magna supported the accummulation data and added to the understanding of the pathways of nickel through the organism.

  1. Reproducibility of a life-cycle toxicity test with Daphnia magna

    SciTech Connect

    Parkhurst, B.R.; Forte, J.L.; Wright, G.P.

    1981-01-01

    Standardized chronic life-cycle toxicity testing procedures for aquatic species are described. The reproducibility of chronic toxicity and points using the static-renewal method with Daphnia magna are investigated. The objectives were to determine if the lowest rejected concentrations tested (LRCTs) obtained for six different toxicity criteria in static-renewal tests with acridine were reproducible over time and to determine the relative sensitivity and variability of the toxicity criteria. Two of the six toxicity criteria, numbers of young per brood and the young produced per female, were found to be reliable and sensitive for estimating the LRCT for acridine to D. magna. (RJC)

  2. Evaluation of clorsulon against immature Fascioloides magna in cattle and sheep.

    PubMed

    Foreyt, W J

    1988-07-01

    Efficacy of clorsulon was evaluated against infection with immature Fascioloides magna in 24 cattle and 12 sheep. Infections were induced by oral administration of 600 metacercariae/host. In cattle, clorsulon at dosages of 7 and 21 mg/kg of body weight was 65 and 100% effective against 8-week-old flukes, and 20 and 74% effective against 16-week-old flukes, respectively. In sheep, clorsulon at a dosage of 21 mg/kg was 92% effective against 8-week-old flukes. Significantly (P less than 0.05) more F magna were recovered from untreated sheep than from untreated cattle. PMID:3421522

  3. Multispectral fingerprint imaging for spoof detection

    NASA Astrophysics Data System (ADS)

    Nixon, Kristin A.; Rowe, Robert K.

    2005-03-01

    Fingerprint systems are the most widespread form of biometric authentication. Used in locations such as airports and in PDA's and laptops, fingerprint readers are becoming more common in everyday use. As they become more familiar, the security weaknesses of fingerprint sensors are becoming better known. Numerous websites now exist describing in detail how to create a fake fingerprint usable for spoofing a biometric system from both a cooperative user and from latent prints. While many commercial fingerprint readers claim to have some degree of spoof detection incorporated, they are still generally susceptible to spoof attempts using various artificial fingerprint samples made from gelatin or silicone or other materials and methods commonly available on the web. This paper describes a multispectral sensor that has been developed to collect data for spoof detection. The sensor has been designed to work in conjunction with a conventional optical fingerprint reader such that all images are collected during a single placement of the finger on the sensor. The multispectral imaging device captures sub-surface information about the finger that makes it very difficult to spoof. Four attributes of the finger that are collected with the multispectral imager will be described and demonstrated in this paper: spectral qualities of live skin, chromatic texture of skin, sub-surface image of live skin, and blanching on contact. Each of these attributes is well suited to discriminating against particular kinds of spoofing samples. A series of experiments was conducted to demonstrate the capabilities of the individual attributes as well as the collective spoof detection performance.

  4. Statistical quality assessment of a fingerprint

    NASA Astrophysics Data System (ADS)

    Hwang, Kyungtae

    2004-08-01

    The quality of a fingerprint is essential to the performance of AFIS (Automatic Fingerprint Identification System). Such a quality may be classified by clarity and regularity of ridge-valley structures.1,2 One may calculate thickness of ridge and valley to measure the clarity and regularity. However, calculating a thickness is not feasible in a poor quality image, especially, severely damaged images that contain broken ridges (or valleys). In order to overcome such a difficulty, the proposed approach employs the statistical properties in a local block, which involve the mean and spread of the thickness of both ridge and valley. The mean value is used for determining whether a fingerprint is wet or dry. For example, the black pixels are dominant if a fingerprint is wet, the average thickness of ridge is larger than one of valley, and vice versa on a dry fingerprint. In addition, a standard deviation is used for determining severity of damage. In this study, the quality is divided into three categories based on two statistical properties mentioned above: wet, good, and dry. The number of low quality blocks is used to measure a global quality of fingerprint. In addition, a distribution of poor blocks is also measured using Euclidean distances between groups of poor blocks. With this scheme, locally condensed poor blocks decreases the overall quality of an image. Experimental results on the fingerprint images captured by optical devices as well as by a rolling method show the wet and dry parts of image were successfully captured. Enhancing an image by employing morphology techniques that modifying the detected poor quality blocks is illustrated in section 3. However, more work needs to be done on designing a scheme to incorporate the number of poor blocks and their distributions for a global quality.

  5. Uncovering Cryptic Asexuality in Daphnia magna by RAD Sequencing.

    PubMed

    Svendsen, Nils; Reisser, Celine M O; Dukić, Marinela; Thuillier, Virginie; Ségard, Adeline; Liautard-Haag, Cathy; Fasel, Dominique; Hürlimann, Evelin; Lenormand, Thomas; Galimov, Yan; Haag, Christoph R

    2015-11-01

    The breeding systems of many organisms are cryptic and difficult to investigate with observational data, yet they have profound effects on a species' ecology, evolution, and genome organization. Genomic approaches offer a novel, indirect way to investigate breeding systems, specifically by studying the transmission of genetic information from parents to offspring. Here we exemplify this method through an assessment of self-fertilization vs. automictic parthenogenesis in Daphnia magna. Self-fertilization reduces heterozygosity by 50% compared to the parents, but under automixis, whereby two haploid products from a single meiosis fuse, the expected heterozygosity reduction depends on whether the two meiotic products are separated during meiosis I or II (i.e., central vs. terminal fusion). Reviewing the existing literature and incorporating recombination interference, we derive an interchromosomal and an intrachromosomal prediction of how to distinguish various forms of automixis from self-fertilization using offspring heterozygosity data. We then test these predictions using RAD-sequencing data on presumed automictic diapause offspring of so-called nonmale producing strains and compare them with "self-fertilized" offspring produced by within-clone mating. The results unequivocally show that these offspring were produced by automixis, mostly, but not exclusively, through terminal fusion. However, the results also show that this conclusion was only possible owing to genome-wide heterozygosity data, with phenotypic data as well as data from microsatellite markers yielding inconclusive or even misleading results. Our study thus demonstrates how to use the power of genomic approaches for elucidating breeding systems, and it provides the first demonstration of automictic parthenogenesis in Daphnia. PMID:26341660

  6. Activity-relevant similarity values for fingerprints and implications for similarity searching

    PubMed Central

    Jasial, Swarit; Hu, Ye; Vogt, Martin; Bajorath, Jürgen

    2016-01-01

    A largely unsolved problem in chemoinformatics is the issue of how calculated compound similarity relates to activity similarity, which is central to many applications. In general, activity relationships are predicted from calculated similarity values. However, there is no solid scientific foundation to bridge between calculated molecular and observed activity similarity. Accordingly, the success rate of identifying new active compounds by similarity searching is limited. Although various attempts have been made to establish relationships between calculated fingerprint similarity values and biological activities, none of these has yielded generally applicable rules for similarity searching. In this study, we have addressed the question of molecular versus activity similarity in a more fundamental way. First, we have evaluated if activity-relevant similarity value ranges could in principle be identified for standard fingerprints and distinguished from similarity resulting from random compound comparisons. Then, we have analyzed if activity-relevant similarity values could be used to guide typical similarity search calculations aiming to identify active compounds in databases. It was found that activity-relevant similarity values can be identified as a characteristic feature of fingerprints. However, it was also shown that such values cannot be reliably used as thresholds for practical similarity search calculations. In addition, the analysis presented herein helped to rationalize differences in fingerprint search performance. PMID:27127620

  7. DNA fingerprinting in botany: past, present, future

    PubMed Central

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined “Fingerprint News” was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on “DNA fingerprinting: approaches and applications”. Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting (“the past”) was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as “DNA fingerprinting in the present”, and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA

  8. DNA fingerprinting in botany: past, present, future.

    PubMed

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  9. Changes in iTRAQ-Based Proteomic Profiling of the Cladoceran Daphnia magna Exposed to Microcystin-Producing and Microcystin-Free Microcystis aeruginosa.

    PubMed

    Lyu, Kai; Meng, Qingguo; Zhu, Xuexia; Dai, Daoxin; Zhang, Lu; Huang, Yuan; Yang, Zhou

    2016-05-01

    Global warming and increased nutrient fluxes cause cyanobacterial blooms in freshwater ecosystems. These phenomena have increased the concern for human health and ecosystem services. The mass occurrences of toxic cyanobacteria strongly affect freshwater zooplankton communities, especially the unselective filter feeder Daphnia. However, the molecular mechanisms of cyanobacterial toxicity remain poorly understood. This study is the first to combine the established body growth rate (BGR), which is an indicator of life-history fitness, with differential peptide labeling (iTRAQ)-based proteomics in Daphnia magna influenced by microcystin-producing (MP) and microcystin-free (MF) Microcystis aeruginosa. A significant decrease in BGR was detected when D. magna was exposed to MP or MF M. aeruginosa. Conducting iTRAQ proteomic analyses, we successfully identified and quantified 211 proteins with significant changes in expression. A cluster of orthologous groups revealed that M. aeruginosa-affected differential proteins were strongly associated with lipid, carbohydrate, amino acid, and energy metabolism. These parameters could potentially explain the reduced fitness based on the cost of the substance metabolism. PMID:27057760

  10. Protein fingerprint diversification of rice seeds

    NASA Astrophysics Data System (ADS)

    Lu, Weihong; Sun, Yeqing; Zheng, Qi; Guan, Shuanghong

    To study protein fingerprint diversification of rice seeds induced by space environment we selected three series mutants induced in Chinese recoverable satellite in 1996 for 15 days including 1 Series 971 971ck the control sample in ground 971-5 and 971-4 samples after space derivation 2 Series 972 972ck the control sample in ground 972-4 and 972-1 samples after space derivation 3 Series 974 974ck the control sample in ground 974-5 and 974-8 samples after space derivation The proteins were extracted and separated to 4 groups Albumin Globulin Prolamine and Glutelin from the seeds of ground control group and inducted by space environment group Using RPLC method Reference peak was selected in every group and its relative retention time was 1 000 The relative retention time of other peaks was the ratio Calculate the contents due to the peak areas and draw a conclusion that some contents of protein were changed in the seeds of the mutant varieties There are character peaks among different varieties as the fingerprint Comparative analysis the fingerprint of Albumin Globulin and Prolamine can find the different in varieties identify The protein express abundance and easy be detected in the seeds So using RPLC method the Protein Fingerprint can identify breed handily and steadily Keywords rice seeds Space environment Protein Fingerprint