Science.gov

Sample records for major histocompatibility gene

  1. Regulation of major histocompatibility complex class II genes

    PubMed Central

    Choi, Nancy M.; Majumder, Parimal; Boss, Jeremy M.

    2010-01-01

    Summary The major histocompatibility complex class II (MHC-II) genes are regulated at the level of transcription. Recent studies have shown that chromatin modification is critical for efficient transcription of these genes, and a number of chromatin modifying complexes recruited to MHC-II genes have been described. The MHC-II genes are segregated from each other by a series of chromatin elements, termed MHC-II insulators. Interactions between MHC-insulators and the promoters of MHC-II genes are mediated by the insulator factor CCCTC-binding protein and are critical for efficient expression. This regulatory mechanism provides a novel view of how the entire MHC-II locus is assembled architecturally and can be coordinately controlled. PMID:20970972

  2. Major Histocompatibility Complex and Background Genes in Chickens Influence Susceptibility to High Pathogenicity Avian Influenza Virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The chicken’s major histocompatibility complex (MHC) haplotype has profound influence on the resistance or susceptibility to certain pathogens such as B21 MHC haplotype confers resistance to Marek’s disease (MD). However, non-MHC genes are also important in disease resistance. For example, both line...

  3. Olfactory receptor-like genes are located in the human major histocompatibility complex

    SciTech Connect

    Fan, W.; Liu, Y.C.; Parimoo, S.

    1995-05-01

    The murine major histocompatibility complex (MHC) includes sequences that are responsible for haplotype-specific odor types that, in turn, influence mating preference. The authors report that there are several olfactory receptor genes or pseudogenes in the Class I region of the human MHC. At least one of these genes is intact, appears to encode an mRNA, and is quite homologous to a previously reported murine olfactory receptor. 14 refs., 4 figs.

  4. Expression Regulation of Major Histocompatibility Complex Class I and Class II Encoding Genes

    PubMed Central

    van den Elsen, Peter J.

    2011-01-01

    Major histocompatibility complex (MHC)-I and MHC-II molecules play an essential role in the immune response to pathogens by virtue of their ability to present peptides to CD8+ and CD4+ T cells, respectively. Given this critical role, MHC-I and MHC-II genes are regulated in a tight fashion at the transcriptional level by a variety of transcription factors that interact with conserved cis-acting regulatory promoter elements. In addition to the activities of these regulatory factors, modification of chromatin also plays an essential role in the efficient transcription of these genes to meet with local requirement for an effective immune response. The focus of this review is on the transcription factors that interact with conserved cis-acting promoter elements and the epigenetic mechanisms that modulate induced and constitutive expression of these MHC genes. PMID:22566838

  5. Cell stress-regulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium.

    PubMed Central

    Groh, V; Bahram, S; Bauer, S; Herman, A; Beauchamp, M; Spies, T

    1996-01-01

    Conventional major histocompatibility complex (MHC) class I genes encode molecules that present intracellular peptide antigens to T cells. They are ubiquitously expressed and regulated by interferon gamma. Two highly divergent human MHC class I genes, MICA and MICB, are regulated by promoter heat shock elements similar to those of HSP70 genes. MICA encodes a cell surface glycoprotein, which is not associated with beta 2-microglobulin, is conformationally stable independent of conventional class I peptide ligands, and almost exclusively expressed in gastrointestinal epithelium. Thus, this MHC class I molecule may function as an indicator of cell stress and may be recognized by a subset of gut mucosal T cells in an unusual interaction. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8901601

  6. Identification of the class I genes of the mouse major histocompatibility complex by DNA-mediated gene transfer.

    PubMed

    Goodenow, R S; McMillan, M; Nicolson, M; Sher, B T; Eakle, K; Davidson, N; Hood, L

    1982-11-18

    DNA-mediated gene transfer was used to identify cloned class I genes from the major histocompatibility complex of the BALB/c mouse. Three genes encoding the transplantation antigens H-2 Kd, Dd and Ld were identified as well as genes encoding the Qa-2,3 and two TL differentiation antigens. As many as 10 putative novel class I genes were detected by the association of their gene products with beta 2-microglobulin. Alloantiserum prepared to one of the novel antigens was used to demonstrate the expression of the previously undetected antigen on spleen cells of various inbred, congeneic, and recombinant congeneic strains of mice. PMID:6815535

  7. Isolation and characterization of major histocompatibility complex class II B genes in cranes.

    PubMed

    Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi

    2015-11-01

    In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution. PMID:26452363

  8. Evolution of mouse major histocompatibility complex genes borne by t chromosomes.

    PubMed Central

    Figueroa, F; Golubić, M; Nizetić, D; Klein, J

    1985-01-01

    Virtually all wild mouse populations carry t haplotypes that cause embryonic lethality or semilethality, distortion of segregation ratios, suppression of crossing-over, and male sterility. The t complex of genes is located on chromosome 17, closely linked to the H-2, the major histocompatibility complex of the mouse. The t haplotypes differ from each other not only in lethal genes they carry but also in their linked H-2 haplotypes. In this study, we compared the class II H-2 genes present on 31 t chromosomes extracted from wild populations in different parts of the world. The comparison was based on the analysis of DNA fragments obtained after digestion with restriction endonucleases. The results reveal the existence of three major groups of class II alleles representing main branches on the evolutionary tree of the t chromosomes. Alleles within each group are similar if not identical, although they are borne by chromosomes that have been separated in time and space. The presence of similar alleles in Mus musculus and Mus domesticus suggests that some of them may have been separated for more than 1 million years. This must also be the minimal age of the t chromosomes but, because at least two of the three main branches appear to be related in their origin, the actual age of t chromosomes could be much greater. The observations support the proposal that H-2 genes evolve slowly. Images PMID:2986138

  9. Isolation and characterization of major histocompatibility complex class IIB genes from the nurse shark.

    PubMed Central

    Bartl, S; Weissman, I L

    1994-01-01

    The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse shark, Ginglymostoma cirratum. Two clones, most probably alleles, encode proteins which differ by 13 amino acids located in the putative antigen-binding cleft. The protein structure and the location of polymorphic residues are similar to their mammalian counterparts. Although these genes appear to encode a typical MHC protein, no T-cell-mediated responses have been demonstrated in cartilaginous fish. The nurse shark represents the most phylogenetically primitive organism in which both class IIA [Kasahara, M., Vazquez, M., Sato, K., McKinney, E.C. & Flajnik, M.F. (1992) Proc. Natl. Acad. Sci USA 89, 6688-6692] and class IIB genes, presumably encoding the alpha/beta heterodimer, have been isolated. Images Fig. 2 PMID:8278377

  10. Major histocompatibility complex and host background genes in chickens influence resistance to high pathogenicity avian influenza virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The chicken’s major histocompatibility complex (MHC) haplotype has a profound influence on the resistance or susceptibility to certain pathogens such as B21 MHC haplotype confers resistance to Marek’s disease (MD). However, non-MHC genes are also important in disease resistance. For example, both li...

  11. Red Queen Processes Drive Positive Selection on Major Histocompatibility Complex (MHC) Genes

    PubMed Central

    Ejsmond, Maciej Jan; Radwan, Jacek

    2015-01-01

    Major Histocompatibility Complex (MHC) genes code for proteins involved in the incitation of the adaptive immune response in vertebrates, which is achieved through binding oligopeptides (antigens) of pathogenic origin. Across vertebrate species, substitutions of amino acids at sites responsible for the specificity of antigen binding (ABS) are positively selected. This is attributed to pathogen-driven balancing selection, which is also thought to maintain the high polymorphism of MHC genes, and to cause the sharing of allelic lineages between species. However, the nature of this selection remains controversial. We used individual-based computer simulations to investigate the roles of two phenomena capable of maintaining MHC polymorphism: heterozygote advantage and host-pathogen arms race (Red Queen process). Our simulations revealed that levels of MHC polymorphism were high and driven mostly by the Red Queen process at a high pathogen mutation rate, but were low and driven mostly by heterozygote advantage when the pathogen mutation rate was low. We found that novel mutations at ABSs are strongly favored by the Red Queen process, but not by heterozygote advantage, regardless of the pathogen mutation rate. However, while the strong advantage of novel alleles increased the allele turnover rate, under a high pathogen mutation rate, allelic lineages persisted for a comparable length of time under Red Queen and under heterozygote advantage. Thus, when pathogens evolve quickly, the Red Queen is capable of explaining both positive selection and long coalescence times, but the tension between the novel allele advantage and persistence of alleles deserves further investigation. PMID:26599213

  12. Persistent Ehrlichia chaffeensis infection occurs in the absence of functional major histocompatibility complex class II genes

    NASA Technical Reports Server (NTRS)

    Ganta, Roman Reddy; Wilkerson, Melinda J.; Cheng, Chuanmin; Rokey, Aaron M.; Chapes, Stephen K.

    2002-01-01

    Human monocytic ehrlichiosis is an emerging tick-borne disease caused by the rickettsia Ehrlichia chaffeensis. We investigated the impact of two genes that control macrophage and T-cell function on murine resistance to E. chaffeensis. Congenic pairs of wild-type and toll-like receptor 4 (tlr4)- or major histocompatibility complex class II (MHC-II)-deficient mice were used for these studies. Wild-type mice cleared the infection within 2 weeks, and the response included macrophage activation and the synthesis of E. chaffeensis-specific Th1-type immunoglobulin G response. The absence of a functional tlr4 gene depressed nitric oxide and interleukin 6 secretion by macrophages and resulted in short-term persistent infections for > or =30 days. In the absence of MHC-II alleles, E. chaffeensis infections persisted throughout the entire 3-month evaluation period. Together, these data suggest that macrophage activation and cell-mediated immunity, orchestrated by CD4(+) T cells, are critical for conferring resistance to E. chaffeensis.

  13. Evolution of major histocompatibility complex class I and class II genes in the brown bear

    PubMed Central

    2012-01-01

    Background Major histocompatibility complex (MHC) proteins constitute an essential component of the vertebrate immune response, and are coded by the most polymorphic of the vertebrate genes. Here, we investigated sequence variation and evolution of MHC class I and class II DRB, DQA and DQB genes in the brown bear Ursus arctos to characterise the level of polymorphism, estimate the strength of positive selection acting on them, and assess the extent of gene orthology and trans-species polymorphism in Ursidae. Results We found 37 MHC class I, 16 MHC class II DRB, four DQB and two DQA alleles. We confirmed the expression of several loci: three MHC class I, two DRB, two DQB and one DQA. MHC class I also contained two clusters of non-expressed sequences. MHC class I and DRB allele frequencies differed between northern and southern populations of the Scandinavian brown bear. The rate of nonsynonymous substitutions (dN) exceeded the rate of synonymous substitutions (dS) at putative antigen binding sites of DRB and DQB loci and, marginally significantly, at MHC class I loci. Models of codon evolution supported positive selection at DRB and MHC class I loci. Both MHC class I and MHC class II sequences showed orthology to gene clusters found in the giant panda Ailuropoda melanoleuca. Conclusions Historical positive selection has acted on MHC class I, class II DRB and DQB, but not on the DQA locus. The signal of historical positive selection on the DRB locus was particularly strong, which may be a general feature of caniforms. The presence of MHC class I pseudogenes may indicate faster gene turnover in this class through the birth-and-death process. South–north population structure at MHC loci probably reflects origin of the populations from separate glacial refugia. PMID:23031405

  14. Characterisation of major histocompatibility complex class I genes at the fetal-maternal interface of marsupials.

    PubMed

    Buentjen, Ina; Drews, Barbara; Frankenberg, Stephen R; Hildebrandt, Thomas B; Renfree, Marilyn B; Menzies, Brandon R

    2015-07-01

    Major histocompatibility complex class I molecules (MHC-I) are expressed at the cell surface and are responsible for the presentation of self and non-self antigen repertoires to the immune system. Eutherian mammals express both classical and non-classical MHC-I molecules in the placenta, the latter of which are thought to modulate the maternal immune response during pregnancy. Marsupials last shared a common ancestor with eutherian mammals such as humans and mice over 160 million years ago. Since, like eutherians, they have an intra-uterine development dependent on a placenta, albeit a short-lived and less invasive one, they provide an opportunity to investigate the evolution of MHC-I expression at the fetal-maternal interface. We have characterised MHC-I mRNA expression in reproductive tissues of the tammar wallaby (Macropus eugenii) from the time of placental attachment to day 25 of the 26.5 day pregnancy. Putative classical MHC-I genes were expressed in the choriovitelline placenta, fetus, and gravid endometrium throughout the whole of this period. The MHC-I classical sequences were phylogenetically most similar to the Maeu-UC (50/100 clones) and Maeu-UA genes (7/100 clones). Expression of three non-classical MHC-I genes (Maeu-UD, Maeu-UK and Maeu-UM) were also present in placental samples. The results suggest that expression of classical and non-classical MHC-I genes in extant marsupial and eutherian mammals may have been necessary for the evolution of the ancestral therian placenta and survival of the mammalian fetus at the maternal-fetal interface. PMID:25957041

  15. The major histocompatibility complex genes impact pain response in DA and DA.1U rats.

    PubMed

    Guo, Yuan; Yao, Fan-Rong; Cao, Dong-Yuan; Li, Li; Wang, Hui-Sheng; Xie, Wen; Zhao, Yan

    2015-08-01

    Our recent studies have shown that the difference in basal pain sensitivity to mechanical and thermal stimulation between Dark-Agouti (DA) rats and a novel congenic DA.1U rats is major histocompatibility complex (MHC) genes dependent. In the present study, we further used DA and DA.1U rats to investigate the role of MHC genes in formalin-induced pain model by behavioral, electrophysiological and immunohistochemical methods. Behavioral results showed biphasic nociceptive behaviors increased significantly following the intraplantar injection of formalin in the hindpaw of DA and DA.1U rats. The main nociceptive behaviors were lifting and licking, especially in DA rats (P<0.001 and P<0.01). The composite pain scores (CPS) in DA rats were significantly higher than those in DA.1U rats in both phases of the formalin test (P<0.01). Electrophysiological results also showed the biphasic increase in discharge rates of C and Aδ fibers of L5 dorsal root in the two strains, and the net change of the discharge rate of DA rats was significantly higher than that of DA.1U rats (P<0.05). The mechanical thresholds decreased after formalin injection in both strains (P<0.01), and the net change in the mechanical threshold in DA was greater than that in DA.1U rats (P<0.05). The expression of RT1-B, representation of MHC class II molecule, in laminae I-II of L4/5 spinal cord in DA rats was significantly higher than that in DA.1U rats in the respective experimental group (P<0.05). These results suggested that both DA and DA.1U rats exhibited nociceptive responses in formalin-induced pain model and DA rats were more sensitive to noxious chemical stimulus than DA.1U rats, indicating that MHC genes might contribute to the difference in pain sensitivity. PMID:25861730

  16. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    PubMed Central

    2010-01-01

    Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene

  17. René Stet's impact on the study of teleost major histocompatibility genes: evolution from loci to populations.

    PubMed

    Dixon, Brian

    2008-02-01

    René Josephus Maria Stet pursued a 35-year-long scientific career contributing to human immunology, shrimp immunity and teleost immunity. His most significant contributions, however, were to the field of teleost major histocompatibility (MH) gene research from 1988 to 2007, a field in which he was a leader and an innovator. This review will discuss his work on these genes, highlighting the impact he had in three temporally overlapping phases of his career that can be characterized as MH gene discovery, MH gene function and evolution and population dynamics of teleost MH genes. PMID:18193417

  18. Cohesin regulates major histocompatibility complex class II genes through interactions with MHC-II insulators1

    PubMed Central

    Majumder, Parimal; Boss, Jeremy M.

    2011-01-01

    Cohesin is a multiprotein ringed complex that is most well known for its role in stabilizing the association of sister chromatids between S phase and M. More recently cohesin was found to be associated with transcriptional insulators, elements that are associated with the organization of chromatin into regulatory domains. The human major histocompatibility complex class II (MHC-II) locuscontains ten intergenic elements, termed MHC-II insulators, which bind the transcriptional insulator protein CCCTC transcription factor (CTCF). MHC-II insulators interact with each other forming a base architecture of discrete loops and potential regulatory domains. When MHC-II genes are expressed, their proximal promoter regulatory regions reorganize to the foci established by the interacting MHC-II insulators. MHC-II insulators also bind cohesin, but the functional role of cohesin in regulating this system is not known. Here we show that the binding of cohesin to MHC-II insulators occurred irrespective of MHC-II expression but was required for optimal expression of the HLA-DR and HLA-DQ genes. In a DNA dependent manner, cohesin subunits interacted with CTCF and the MHC-II specific transcription factors RFX and CIITA. Intriguingly, cohesin subunits were important for DNA looping interactions between the HLA-DRA promoter region and a 5’ MHC-II insulator but were not required for interactions between the MHC-II insulators themselves. This latter observation introduces cohesin as a regulator of MHC-II expression by initiating or stabilizing MHC-II promoter regulatory element interactions with the MHC-II insulator elements; events which are required for maximal MHC-II transcription. PMID:21911605

  19. Regulation of a bovine nonclassical major histocompatibility complex class I gene promoter.

    PubMed

    O'Gorman, Grace M; Al Naib, Abdullah; Naib, Abdullah Al; Ellis, Shirley A; Mamo, Solomon; O'Doherty, Alan M; Lonergan, Pat; Fair, Trudee

    2010-08-01

    Studies have shown in humans and other species that the major histocompatibility complex class I (MHC-I) region is involved at a number of levels in the establishment and maintenance of pregnancy. The aim of this study was to characterize how a bovine nonclassical MHC-I gene (NC1) is regulated. Initial serial deletion experiments of a 2-kb fragment of the NC1 promoter identified regions with positive regulatory elements in the proximal promoter and evidence for a silencer module(s) further upstream that cooperatively contributed to constitutive NC1 expression. The cytokines interferon tau (IFNT), interferon gamma (IFNG), and interleukin 4 (IL4) significantly increased luciferase expression in NC1 promoter reporter constructs and endogenous NC1 mRNA levels in a bovine endometrial cell line. In addition, IFNG, IL3, IL4, and progesterone significantly increased Day 7 bovine blastocyst NC1 mRNA expression when supplemented during in vitro embryo culture. Site-directed mutagenesis analysis identified a STAT6 binding site that conferred IL4 responsiveness in the NC1 proximal promoter. Furthermore, methylation treatment of the proximal promoter, which contains a CpG island, completely abrogated constitutive NC1 expression. Overall, the findings presented here suggest that constitutive NC1 expression is regulated positively by elements in the proximal promoter, which are further controlled by upstream silencer modules. The promoter is responsive to IFNT, IFNG, and IL4, suggesting possible roles for these cytokines in bovine preimplantation embryo survival and/or maternal-fetal tolerance. Our studies also suggest that methylation of the proximal promoter, in particular, could play a significant role in regulating NC1 expression. PMID:20427761

  20. Major histocompatibility complex haplotypes and class II genes in non-Jewish patients with pemphigus vulgaris.

    PubMed Central

    Ahmed, A R; Wagner, R; Khatri, K; Notani, G; Awdeh, Z; Alper, C A; Yunis, E J

    1991-01-01

    Previous studies demonstrated that HLA-DR4 was markedly increased among Ashkenazi Jewish patients with pemphigus vulgaris (PV), almost entirely as the common Jewish extended haplotype [HLA-B38, SC21, DR4, DQw8] or as the haplotype HLA-B35, SC31, DR4, DQw8, and that HLA-DR4, DQw8 was distributed among patients in a manner consistent with dominant expression of a class II (D-region or D-region-linked) susceptibility gene. In the present study of major histocompatibility complex (MHC) haplotypes in 25 non-Jewish PV patients, DR4, DQw8 was found in 12 of the patients and DRw6, DQw5 was found in 15. Only 3 patients had neither. Only 1 of the DR4, DQw8 haplotypes was [HLA-B38, SC21, DR4, DQw8] and 2 were HLA-B35, SC31, DR4, DQw8; most were the presumed fragments (SC31, DR4, DQw8) or (SC21, DR4, DQw8) or DR4, DQw8 with some other complotype. Of the patients with DRw6, DQw5, all were DRw14, DQw5, and 6 had a rare Caucasian haplotype, HLA-Bw55, SB45, DRw14, DQw5. Four of 6 of these were found in patients of Italian extraction, as was the 1 normal example. The non-Jewish patients were of more Southern European extraction than our controls. This suggests that there are two major MHC susceptibility alleles in American patients with PV. The more ancient apparently arose on a haplotype in the Jews, HLA-B38(35), SC21(SC31), DR4, DQw8, and spread to other populations largely as D-region segments. The other arose in or near Italy on the haplotype HLA-Bw55, SB45, DRw14, DQw5 and has also partially fragmented so that many patients carry only DRw14, DQw5. The available data do not permit the specific localization of either the DR4, DQw8- or the DRw14, DQw5-linked susceptibility genes. Images PMID:1675792

  1. Interactions between the Class II Transactivator and CREB Binding Protein Increase Transcription of Major Histocompatibility Complex Class II Genes

    PubMed Central

    Fontes, Joseph D.; Kanazawa, Satoshi; Jean, Dickson; Peterlin, B. Matija

    1999-01-01

    Class II major histocompatibility (class II) genes are regulated in a B-cell-specific and gamma interferon-inducible fashion. The master switch for the expression of these genes is the class II transactivator (CIITA). In this report, we demonstrate that one of the functions of CIITA is to recruit the CREB binding protein (CBP) to class II promoters. Not only functional but also specific binding interactions between CIITA and CBP were demonstrated. Moreover, a dominant negative form of CBP decreased the activity of class II promoters and levels of class II determinants on the surface of cells. Finally, the inhibition of class II gene expression by the glucocorticoid hormone could be attributed to the squelching of CBP by the glucocorticoid receptor. We conclude that CBP, a histone acetyltransferase, plays an important role in the transcription of class II genes. PMID:9858618

  2. Characterization and evolution of major histocompatibility complex class II genes in the aye-aye, Daubentonia madagascariensis.

    PubMed

    Go, Yasuhiro; Rakotoarisoa, Gilbert; Kawamoto, Yoshi; Shima, Taizo; Koyama, Naoki; Randrianjafy, Albert; Mora, Roger; Hirai, Hirohisa

    2005-04-01

    Major histocompatibility complex genes (Mhc-DQB and Mhc-DRB) were sequenced in seven aye-ayes (Daubentonia madagascariecsis), which is an endemic and endangered species in Madagascar. An aye-aye from a north-eastern population showed genetic relatedness to individuals of a north-western population and had a somewhat different repertoire from another north-eastern individual. These observations suggest that the extent of genetic variation in Mhc genes is not excessively small in the aye-aye in spite of recent rapid destruction of their habitat by human activities. In light of Mhc gene evolution, trans-species and allelic polymorphisms can be estimated to have been retained for more than 50 Ma (million years) based on the time scale of lemur evolution. PMID:15322927

  3. Mammalian non-classical major histocompatibility complex I and its receptors: Important contexts of gene, evolution, and immunity

    PubMed Central

    Pratheek, B. M.; Nayak, Tapas K.; Sahoo, Subhransu S.; Mohanty, Prafulla K.; Chattopadhyay, Soma; Chakraborty, Ntiya G.; Chattopadhyay, Subhasis

    2014-01-01

    The evolutionary conserved, less-polymorphic, nonclassical major histocompatibility complex (MHC) class I molecules: Qa-1 and its human homologue human leukocyte antigen-E (HLA-E) along with HLA-F, G and H cross-talk with the T-cell receptors and also interact with natural killer T-cells and other lymphocytes. Moreover, these nonclassical MHC molecules are known to interact with CD94/NKG2 heterodimeric receptors to induce immune responses and immune regulations. This dual role of Qa-1/HLA-E in terms of innate and adaptive immunity makes them more interesting. This review highlights the new updates of the mammalian nonclassical MHC-I molecules in terms of their gene organization, evolutionary perspective and their role in immunity. PMID:25400340

  4. Active suppression of major histocompatibility complex class II gene expression during differentiation from B cells to plasma cells.

    PubMed Central

    Latron, F; Jotterand-Bellomo, M; Maffei, A; Scarpellino, L; Bernard, M; Strominger, J L; Accolla, R S

    1988-01-01

    Constitutive expression of major histocompatibility complex class II genes is acquired very early in B-cell ontogeny and is maintained up to the B-cell blast stage. Terminal differentiation in plasma cells is, however, accompanied by a loss of class II gene expression. In B cells this gene system is under the control of several loci encoding transacting factors with activator function, one of which, the aIr-1 gene product, operates across species barriers. In this report human class II gene expression is shown to be extinguished in somatic cell hybrids between the human class II-positive B-cell line Raji and the mouse class II-negative plasmacytoma cell line P3-U1. Since all murine chromosomes are retained in these hybrids and no preferential segregation of a specific human chromosome is observed, the results are compatible with the presence of suppressor factors of mouse origin, operating across species barriers and inhibiting class II gene expression. Suppression seems to act at the level of transcription or accumulation of class II-specific mRNA, since no human, and very few murine, class II transcripts are detectable in the hybrids. Images PMID:3127829

  5. Localization of eight additional genes in the human major histocompatibility complex, including the gene encoding the casein kinase II {beta} subunit (CSNK2B)

    SciTech Connect

    Albertella, M.R.; Jones, H.; Thomson, W.

    1996-09-01

    A wide range of autoimmune and other diseases are known to be associated with the major histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility complex. Many of these diseases are linked to the genes encoding the polymorphic histocompatibility antigens in the class I and class II regions, but some appear to be more strongly associated with genes in the central 1100-kb class III region, making it important to characterize this region fully for the presence of novel genes. An {approximately}220-kb segment of DNA in the class III region separating the Hsp70 (HSPA1L) and BAT1 (D6S8IE) genes, which was previously known to contain 14 genes. Genomic DNA fragments spanning the gaps between the known genes were used as probes to isolate cDNAs corresponding to five new genes within this region. Evidence from Northern blot analysis and exon trapping experiments that suggested the presence of at least two more new genes was also obtained. Partial cDNA and complete exonic genomic sequencing of one of the new genes has identified it as the casein kinase II{beta} subunit (CSNK2B). Two of the other novel genes lie within a region syntenic to that implicated in susceptibility to experimental allergic orchitis in the mouse, an autoimmune disease of the testis, and represent additional candidates for the Orch-1 locus associated with this disease. In addition, characterization of the 13-kb intergenic gap separating the RD (D6545) and G11 (D6S60E) genes has revealed the presence of a gene encoding a 1246-amino-acid polypeptide that shows significant sequence similarity to the yeast anti-viral Ski2p gene product. 49 refs., 8 figs.

  6. Unusual evolutionary conservation and frequent DNA segment exchange in class I genes of the major histocompatibility complex.

    PubMed Central

    Hayashida, H; Miyata, T

    1983-01-01

    From comparisons of homologous DNA sequences for many different genes, it was shown that the silent positions of protein-encoding regions and introns evolve at high and remarkably similar rates for different genes. In addition, both silent positions and introns behave like clocks; they accumulated base substitutions at approximately constant rates with respect to geological time. The rates of evolution were estimated to be 5.5 X 10(-9), 3.7 X 10(-9), and 5.3 X 10(-9) per site per year for silent positions, short introns (less than approximately equal to 300 base pairs), and long introns (more than approximately equal to 500 base pairs), respectively. Contrary to expectation from the evolutionary clocks, DNA sequence comparison between pHLA 12.4 (a cloned HLA sequence) of man and Ld together with other H-2 genes of mouse, the class I genes of the major histocompatibility complex, revealed a surprisingly small amount of base substitution for both the introns and the silent positions; the degree of divergence is only about 60% of that of standard genes in the same species comparison. Furthermore, several segmental homologies have been observed between the class I genes of mouse, suggesting the frequent occurrence of gene conversion or double unequal crossing-over in evolution. Interrelations between the extreme polymorphism of the class I genes, the low evolutionary drift of the introns and the silent positions, and the frequent gene conversion or unequal crossing-over within the mouse genes are discussed. PMID:6573677

  7. Characterization, Polymorphism and Selection of Major Histocompatibility Complex (MHC) DAB Genes in Vulnerable Chinese Egret (Egretta eulophotes)

    PubMed Central

    Wang, Zeng; Zhou, Xiaoping; Lin, Qingxian

    2013-01-01

    The major histocompatibility complex (MHC) is an excellent molecular marker for the studies of evolutionary ecology and conservation genetics because it is a family of highly polymorphic genes that play a key role in vertebrate immune response. In this study, the functional genes of MHC Class II B (DAB) were isolated for the first time in a vulnerable species, the Chinese egret (Egrettaeulophotes). Using a full length DNA and cDNA produced by PCR and RACE methods, four potential MHC DAB loci were characterized in the genome of this egret and all four were expressed in liver and blood. At least four copies of the MHC gene complex were similar to two copies of the minimal essential MHC complex of chicken, but are less complex than the multiple copies expressed in passerine species. In MHC polymorphism, 19 alleles of exon 2 were isolated from 48 individuals using PCR. No stop codons or frameshift mutations were found in any of the coding regions. The signatures of positive selection detected in potential peptide-binding regions by Bayesian analysis, suggesting that all of these genes were functional. These data will provide the fundamental basis for further studies to elucidate the mechanisms and significance of MHC molecular adaptation in vulnerable Chinese egret and other ardeids. PMID:24019955

  8. Genetic variation of the major histocompatibility complex (MHC class II B gene) in the threatened Hume's pheasant, Syrmaticus humiae.

    PubMed

    Chen, Weicai; Bei, Yongjian; Li, Hanhua

    2015-01-01

    Major histocompatibility complex (MHC) genes are the most polymorphic genes in vertebrates and encode molecules that play a crucial role in pathogen resistance. As a result of their diversity, they have received much attention in the fields of evolutionary and conservation biology. Here, we described the genetic variation of MHC class II B (MHCIIB) exon 2 in a wild population of Hume's pheasant (Syrmaticus humiae), which has suffered a dramatic decline in population over the last three decades across its ranges in the face of heavy exploitation and habitat loss. Twenty-four distinct alleles were found in 73 S. humiae specimens. We found seven shared alleles among four geographical groups as well as six rare MHCIIB alleles. Most individuals displayed between one to five alleles, suggesting that there are at least three MHCIIB loci of the Hume's pheasant. The dN ⁄ dS ratio at putative antigen-binding sites (ABS) was significantly greater than one, indicating balancing selection is acting on MHCIIB exon 2. Additionally, recombination and gene conversion contributed to generating MHCIIB diversity in the Hume's pheasant. One to three recombination events and seventy-five significant gene conversion events were observed within the Hume's pheasant MHCIIB loci. The phylogenetic tree and network analysis revealed that the Hume's pheasant alleles do not cluster together, but are scattered through the tree or network indicating a trans-species evolutionary mode. These findings revealed the evolution of the Hume's pheasant MHC after suffering extreme habitat fragmentation. PMID:25629763

  9. Characterization of class II β chain major histocompatibility complex genes in a family of Hawaiian honeycreepers: 'amakihi (Hemignathus virens).

    PubMed

    Jarvi, Susan I; Bianchi, Kiara R; Farias, Margaret Em; Txakeeyang, Ann; McFarland, Thomas; Belcaid, Mahdi; Asano, Ashley

    2016-07-01

    Hawaiian honeycreepers (Drepanidinae) have evolved in the absence of mosquitoes for over five million years. Through human activity, mosquitoes were introduced to the Hawaiian archipelago less than 200 years ago. Mosquito-vectored diseases such as avian malaria caused by Plasmodium relictum and Avipoxviruses have greatly impacted these vulnerable species. Susceptibility to these diseases is variable among and within species. Due to their function in adaptive immunity, the role of major histocompatibility complex genes (Mhc) in disease susceptibility is under investigation. In this study, we evaluate gene organization and levels of diversity of Mhc class II β chain genes (exon 2) in a captive-reared family of Hawaii 'amakihi (Hemignathus virens). A total of 233 sequences (173 bp) were obtained by PCR+1 amplification and cloning, and 5720 sequences were generated by Roche 454 pyrosequencing. We report a total of 17 alleles originating from a minimum of 14 distinct loci. We detected three linkage groups that appear to represent three distinct haplotypes. Phylogenetic analysis revealed one variable cluster resembling classical Mhc sequences (DAB) and one highly conserved, low variability cluster resembling non-classical Mhc sequences (DBB). High net evolutionary divergence values between DAB and DBB resemble that seen between chicken BLB system and YLB system genes. High amino acid identity among non-classical alleles from 12 species of passerines (DBB) and four species of Galliformes (YLB) was found, suggesting that these non-classical passerine sequences may be related to the Galliforme YLB sequences. PMID:26971289

  10. Major Histocompatibility Complex Genes Map to Two Chromosomes in an Evolutionarily Ancient Reptile, the Tuatara Sphenodon punctatus

    PubMed Central

    Miller, Hilary C.; O’Meally, Denis; Ezaz, Tariq; Amemiya, Chris; Marshall-Graves, Jennifer A.; Edwards, Scott

    2015-01-01

    Major histocompatibility complex (MHC) genes are a central component of the vertebrate immune system and usually exist in a single genomic region. However, considerable differences in MHC organization and size exist between different vertebrate lineages. Reptiles occupy a key evolutionary position for understanding how variation in MHC structure evolved in vertebrates, but information on the structure of the MHC region in reptiles is limited. In this study, we investigate the organization and cytogenetic location of MHC genes in the tuatara (Sphenodon punctatus), the sole extant representative of the early-diverging reptilian order Rhynchocephalia. Sequencing and mapping of 12 clones containing class I and II MHC genes from a bacterial artificial chromosome library indicated that the core MHC region is located on chromosome 13q. However, duplication and translocation of MHC genes outside of the core region was evident, because additional class I MHC genes were located on chromosome 4p. We found a total of seven class I sequences and 11 class II β sequences, with evidence for duplication and pseudogenization of genes within the tuatara lineage. The tuatara MHC is characterized by high repeat content and low gene density compared with other species and we found no antigen processing or MHC framework genes on the MHC gene-containing clones. Our findings indicate substantial differences in MHC organization in tuatara compared with mammalian and avian MHCs and highlight the dynamic nature of the MHC. Further sequencing and annotation of tuatara and other reptile MHCs will determine if the tuatara MHC is representative of nonavian reptiles in general. PMID:25953959

  11. Major Histocompatibility Complex Genes Map to Two Chromosomes in an Evolutionarily Ancient Reptile, the Tuatara Sphenodon punctatus.

    PubMed

    Miller, Hilary C; O'Meally, Denis; Ezaz, Tariq; Amemiya, Chris; Marshall-Graves, Jennifer A; Edwards, Scott

    2015-07-01

    Major histocompatibility complex (MHC) genes are a central component of the vertebrate immune system and usually exist in a single genomic region. However, considerable differences in MHC organization and size exist between different vertebrate lineages. Reptiles occupy a key evolutionary position for understanding how variation in MHC structure evolved in vertebrates, but information on the structure of the MHC region in reptiles is limited. In this study, we investigate the organization and cytogenetic location of MHC genes in the tuatara (Sphenodon punctatus), the sole extant representative of the early-diverging reptilian order Rhynchocephalia. Sequencing and mapping of 12 clones containing class I and II MHC genes from a bacterial artificial chromosome library indicated that the core MHC region is located on chromosome 13q. However, duplication and translocation of MHC genes outside of the core region was evident, because additional class I MHC genes were located on chromosome 4p. We found a total of seven class I sequences and 11 class II β sequences, with evidence for duplication and pseudogenization of genes within the tuatara lineage. The tuatara MHC is characterized by high repeat content and low gene density compared with other species and we found no antigen processing or MHC framework genes on the MHC gene-containing clones. Our findings indicate substantial differences in MHC organization in tuatara compared with mammalian and avian MHCs and highlight the dynamic nature of the MHC. Further sequencing and annotation of tuatara and other reptile MHCs will determine if the tuatara MHC is representative of nonavian reptiles in general. PMID:25953959

  12. Major histocompatibility complex class II A genes in cichlid fishes: identification, expression, linkage relationships, and haplotype variation.

    PubMed

    Murray, B W; Shintani, S; Sültmann, H; Klein, J

    2000-06-01

    Two cichlid species, the haplochromine Aulonocara hansbaenschi and the tilapiine Oreochromis niloticus, were used to study the major histocompatibility complex (Mhc) class II A variation within this group. Multiple class II A sequences were recovered from A. hansbaenschi and O. niloticus cDNA libraries and three sequence families, DAA, DBA, and DCA, were identified. Sets of O. niloticus haploid embryo families were used to determine the linkage relationships of these genes. Two independently assorting linkage groups were detected, DAA and DBA/DCA, neither of which is linked to the previously described Mhc class I gene cluster. Three DCA genes and up to four DBA genes were found to segregate in different haplotypes, whereas DAA occurred as a single locus. Four DBA haplotypes, DBA*H1-H4, were identified and shown to co-segregate with the previously described class II B haplotypes. Four DCA haplotypes, DCA*H1-H4, were found at a distance of 37 cM from the DBA/class II B cluster; in one DCA haplotype, DCA*H5, the genes were tightly linked to the DBA/class II B clusters. Transcripts of DAA and DBA genes were found in O. niloticus hepatopancreas and spleen; transcripts of DCA genes were detected in the A. hansbaenschi cDNA library, but not in O. niloticus. These findings provide a basis for using class II haplotypes as markers in the study of adaptive radiation in the cichlid species flocks of the East African Great Lakes. PMID:10912508

  13. Relationship between target antigens and major histocompatibility complex (MHC) class II genes in producing two pathogenic antibodies simultaneously

    PubMed Central

    Zakka, L R; Keskin, D B; Reche, P; Ahmed, A R

    2010-01-01

    In this report, we present 15 patients with histological and immunopathologically proven pemphigus vulgaris (PV). After a mean of 80 months since the onset of disease, when evaluated serologically, they had antibodies typical of PV and pemphigoid (Pg). Similarly, 18 patients with bullous pemphigoid (BP) and mucous membrane pemphigoid (MMP) were diagnosed on the basis of histology and immunopathology. After a mean of 60 months since the onset of disease, when their sera were evaluated they were found to have Pg and PV autoantibodies. In both groups of patients the diseases were characterized by a chronic course, which included several relapses and recurrences and were non-responsive to conventional therapy. The major histocompatibility complex class II (MHC II) genes were studied in both groups of patients and phenotypes associated typically with them were observed. Hence, in 33 patients, two different pathogenic autoantibodies were detected simultaneously. The authors provide a computer model to show that each MHC II gene has relevant epitopes that recognize the antigens associated with both diseases. Using the databases in these computer models, the authors present the hypothesis that these two autoantibodies are produced simultaneously due to the phenomena of epitope spreading. PMID:21069937

  14. Selection and Trans-Species Polymorphism of Major Histocompatibility Complex Class II Genes in the Order Crocodylia

    PubMed Central

    Jaratlerdsiri, Weerachai; Isberg, Sally R.; Higgins, Damien P.; Miles, Lee G.; Gongora, Jaime

    2014-01-01

    Major Histocompatibility Complex (MHC) class II genes encode for molecules that aid in the presentation of antigens to helper T cells. MHC characterisation within and between major vertebrate taxa has shed light on the evolutionary mechanisms shaping the diversity within this genomic region, though little characterisation has been performed within the Order Crocodylia. Here we investigate the extent and effect of selective pressures and trans-species polymorphism on MHC class II α and β evolution among 20 extant species of Crocodylia. Selection detection analyses showed that diversifying selection influenced MHC class II β diversity, whilst diversity within MHC class II α is the result of strong purifying selection. Comparison of translated sequences between species revealed the presence of twelve trans-species polymorphisms, some of which appear to be specific to the genera Crocodylus and Caiman. Phylogenetic reconstruction clustered MHC class II α sequences into two major clades representing the families Crocodilidae and Alligatoridae. However, no further subdivision within these clades was evident and, based on the observation that most MHC class II α sequences shared the same trans-species polymorphisms, it is possible that they correspond to the same gene lineage across species. In contrast, phylogenetic analyses of MHC class II β sequences showed a mixture of subclades containing sequences from Crocodilidae and/or Alligatoridae, illustrating orthologous relationships among those genes. Interestingly, two of the subclades containing sequences from both Crocodilidae and Alligatoridae shared specific trans-species polymorphisms, suggesting that they may belong to ancient lineages pre-dating the divergence of these two families from the common ancestor 85–90 million years ago. The results presented herein provide an immunogenetic resource that may be used to further assess MHC diversity and functionality in Crocodylia. PMID:24503938

  15. Selection and trans-species polymorphism of major histocompatibility complex class II genes in the order Crocodylia.

    PubMed

    Jaratlerdsiri, Weerachai; Isberg, Sally R; Higgins, Damien P; Miles, Lee G; Gongora, Jaime

    2014-01-01

    Major Histocompatibility Complex (MHC) class II genes encode for molecules that aid in the presentation of antigens to helper T cells. MHC characterisation within and between major vertebrate taxa has shed light on the evolutionary mechanisms shaping the diversity within this genomic region, though little characterisation has been performed within the Order Crocodylia. Here we investigate the extent and effect of selective pressures and trans-species polymorphism on MHC class II α and β evolution among 20 extant species of Crocodylia. Selection detection analyses showed that diversifying selection influenced MHC class II β diversity, whilst diversity within MHC class II α is the result of strong purifying selection. Comparison of translated sequences between species revealed the presence of twelve trans-species polymorphisms, some of which appear to be specific to the genera Crocodylus and Caiman. Phylogenetic reconstruction clustered MHC class II α sequences into two major clades representing the families Crocodilidae and Alligatoridae. However, no further subdivision within these clades was evident and, based on the observation that most MHC class II α sequences shared the same trans-species polymorphisms, it is possible that they correspond to the same gene lineage across species. In contrast, phylogenetic analyses of MHC class II β sequences showed a mixture of subclades containing sequences from Crocodilidae and/or Alligatoridae, illustrating orthologous relationships among those genes. Interestingly, two of the subclades containing sequences from both Crocodilidae and Alligatoridae shared specific trans-species polymorphisms, suggesting that they may belong to ancient lineages pre-dating the divergence of these two families from the common ancestor 85-90 million years ago. The results presented herein provide an immunogenetic resource that may be used to further assess MHC diversity and functionality in Crocodylia. PMID:24503938

  16. Positive selection drives the evolution of a major histocompatibility complex gene in an endangered Mexican salamander species complex.

    PubMed

    Tracy, Karen E; Kiemnec-Tyburczy, Karen M; DeWoody, J Andrew; Parra-Olea, Gabriela; Zamudio, Kelly R

    2015-06-01

    Immune gene evolution can be critical to species survival in the face of infectious disease. In particular, polymorphism in the genes of the major histocompatibility complex (MHC) helps vertebrates combat novel and diverse pathogens by increasing the number of pathogen-derived proteins that can initiate the host's acquired immune response. In this study, we used a combination of presumably adaptive and neutral markers to investigate MHC evolution in populations of five salamander species within the Ambystoma velasci complex, a group consisting of 15 recently diverged species, several of which are endangered. We isolated 31 unique MHC class II β alleles from 75 total individuals from five species in this complex. MHC heterozygosity was significantly lower than expected for all five species, and we found no clear relationship between number of MHC alleles and species range, life history, or level of heterozygosity. We inferred a phylogeny representing the evolutionary history of Ambystoma MHC, with which we found signatures of positive selection on the overall gene, putative peptide-binding residues, and allelic lineages. We identified several instances of trans-species polymorphism, a hallmark of balancing selection observed in other groups of closely related species. In contrast, we did not detect comparable allelic diversity or signatures of selection on neutral loci. Additionally, we identified 17 supertypes among the 44 unique Ambystoma alleles, indicating that these sequences may encode functionally distinct MHC variants. We therefore have strong evidence that positive selection is a major evolutionary force driving patterns of MHC polymorphism in this recently radiated species complex. PMID:25846208

  17. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    SciTech Connect

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-03-05

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a /sup 32/P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family.

  18. Clarifying the association of genes within the major histocompatibility complex with narcolepsy

    SciTech Connect

    Acton, R.T.; Watson, B.; Rivers, C.

    1994-09-01

    HLA-DR2 and DQwl has been reported to be strongly associated with narcolepsy. The particular phenotype and strength of these associations varies between races. For example DQB*0601 has been reported associated with some African American (AA) narcoleptics while some Caucasian American (CA) narcoleptics do not possess DR2 or DQw1. We have sought to clarify the relationship of MHC genes with narcolepsy in the local CA and AA population. There was no significant difference in the frequency of DR phenotypes in CA or AA narcoleptics compared to race, age, sex and geographic region-matched controls. DR2 was increased in CA cataplexy positive (Cat+) narcoleptics compared to controls (p=0.028, odds ratio (OR)=2.4) and to Cat- narcoleptics (p=<0.001, OR=8.8). DR11 was increased in AA Cat+ narcoleptics compared to controls (p=0.004, OR=11.2) and to Cat- narcoleptics (p=0.002). DQB1*0601 was not significantly associated with narcolepsy in our AA population. We have assessed the frequency of the TNFa (13 alleles, 1.1Mb telomeric to DQ{alpha}), D6S105 (13 alleles, 1kb telomeric of HLA-A), and GLP-1R (19 alleles, 18.5 Mb centromeric of DQ{alpha}), dinucleotide repeats in narcoleptics compared to controls. The TNFa allele 117 was increased in CA Cat+ vs. controls (p=0.003). The GLP-1R allele 144 was increased in CA Cat- vs. controls (p=0.02). In AA narcoleptics, the TNFa allele 109 was significantly increased (p=0.04) along with the D6S105 allele 130 (p=0.02) compared to controls. The D6S105 allele 130 was increased in AA Cat- vs. controls (p=0.03). The GLP-1R allele 154 was significantly decreased in AA Cat+ vs. Cat- (p=0.04). These data suggest that DR and/or DQ genes are not responsible for narcolepsy and that cataplexy is associated with different regions around the MHC in various racial groups.

  19. The great diversity of major histocompatibility complex class II genes in Philippine native cattle.

    PubMed

    Takeshima, S N; Miyasaka, T; Polat, M; Kikuya, M; Matsumoto, Y; Mingala, C N; Villanueva, M A; Salces, A J; Onuma, M; Aida, Y

    2014-12-01

    Bovine leukocyte antigens (BoLA) are extensively used as markers for bovine disease and immunological traits. However, none of the BoLA genes in Southeast Asian breeds have been characterized by polymerase chain reaction (PCR)-sequence-based typing (SBT). Therefore, we sequenced exon 2 of the BoLA class II DRB3 gene from 1120 individual cows belonging to the Holstein, Sahiwal, Simbrah, Jersey, Brahman, and Philippine native breeds using PCR-SBT. Several cross-breeds were also examined. BoLA-DRB3 PCR-SBT identified 78 previously reported alleles and five novel alleles. The number of BoLA-DRB3 alleles identified in each breed from the Philippines was higher (71 in Philippine native cattle, 58 in Brahman, 46 in Holstein × Sahiwal, and 57 in Philippine native × Brahman) than that identified in breeds from other countries (e.g., 23 alleles in Japanese Black and 35 in Bolivian Yacumeño cattle). A phylogenetic tree based on the DA distance calculated from the BoLA-DRB3 allele frequency showed that Philippine native cattle from different Philippine islands are closely related, and all of them are closely similar to Philippine Brahman cattle but not to native Japanese and Latin American breeds. Furthermore, the BoLA-DRB3 allele frequency in Philippine native cattle from Luzon Island, located in the Northern Philippines was different from that in cattle from Iloilo, Bohol, and Leyte Islands, which are located in the Southern Philippines. Therefore, we conclude that Philippine native cattle can be divided into two populations, North and South areas. Moreover, a neutrality test revealed that Philippine native cattle from Leyte showed significantly greater genetic diversity, which may be maintained by balancing selection. This study shows that Asian breeds have high levels of BoLA-DRB3 polymorphism. This finding, especially the identification of five novel BoLA-DRB3 alleles, will be helpful for future SBT studies of BoLA-DRB3 alleles in East Asian cattle. PMID:25606401

  20. The great diversity of major histocompatibility complex class II genes in Philippine native cattle

    PubMed Central

    Takeshima, S.N.; Miyasaka, T.; Polat, M.; Kikuya, M.; Matsumoto, Y.; Mingala, C.N.; Villanueva, M.A.; Salces, A.J.; Onuma, M.; Aida, Y.

    2014-01-01

    Bovine leukocyte antigens (BoLA) are extensively used as markers for bovine disease and immunological traits. However, none of the BoLA genes in Southeast Asian breeds have been characterized by polymerase chain reaction (PCR)-sequence-based typing (SBT). Therefore, we sequenced exon 2 of the BoLA class II DRB3 gene from 1120 individual cows belonging to the Holstein, Sahiwal, Simbrah, Jersey, Brahman, and Philippine native breeds using PCR-SBT. Several cross-breeds were also examined. BoLA-DRB3 PCR-SBT identified 78 previously reported alleles and five novel alleles. The number of BoLA-DRB3 alleles identified in each breed from the Philippines was higher (71 in Philippine native cattle, 58 in Brahman, 46 in Holstein × Sahiwal, and 57 in Philippine native × Brahman) than that identified in breeds from other countries (e.g., 23 alleles in Japanese Black and 35 in Bolivian Yacumeño cattle). A phylogenetic tree based on the DA distance calculated from the BoLA-DRB3 allele frequency showed that Philippine native cattle from different Philippine islands are closely related, and all of them are closely similar to Philippine Brahman cattle but not to native Japanese and Latin American breeds. Furthermore, the BoLA-DRB3 allele frequency in Philippine native cattle from Luzon Island, located in the Northern Philippines was different from that in cattle from Iloilo, Bohol, and Leyte Islands, which are located in the Southern Philippines. Therefore, we conclude that Philippine native cattle can be divided into two populations, North and South areas. Moreover, a neutrality test revealed that Philippine native cattle from Leyte showed significantly greater genetic diversity, which may be maintained by balancing selection. This study shows that Asian breeds have high levels of BoLA-DRB3 polymorphism. This finding, especially the identification of five novel BoLA-DRB3 alleles, will be helpful for future SBT studies of BoLA-DRB3 alleles in East Asian cattle. PMID:25606401

  1. Major Histocompatibility Complex Genomics and Human Disease

    PubMed Central

    Trowsdale, John; Knight, Julian C.

    2015-01-01

    Over several decades, various forms of genomic analysis of the human major histocompatibility complex (MHC) have been extremely successful in picking up many disease associations. This is to be expected, as the MHC region is one of the most gene-dense and polymorphic stretches of human DNA. It also encodes proteins critical to immunity, including several controlling antigen processing and presentation. Single-nucleotide polymorphism genotyping and human leukocyte antigen (HLA) imputation now permit the screening of large sample sets, a technique further facilitated by high-throughput sequencing. These methods promise to yield more precise contributions of MHC variants to disease. However, interpretation of MHC-disease associations in terms of the functions of variants has been problematic. Most studies confirm the paramount importance of class I and class II molecules, which are key to resistance to infection. Infection is likely driving the extreme variation of these genes across the human population, but this has been difficult to demonstrate. In contrast, many associations with autoimmune conditions have been shown to be specific to certain class I and class II alleles. Interestingly, conditions other than infections and autoimmunity are also associated with the MHC, including some cancers and neuropathies. These associations could be indirect, owing, for example, to the infectious history of a particular individual and selective pressures operating at the population level. PMID:23875801

  2. The major histocompatibility complex of primates.

    PubMed

    Heise, E R; Cook, D J; Schepart, B S; Manning, C H; McMahan, M R; Chedid, M; Keever, C A

    1987-08-31

    The major histocompatibility complex (MHC) encodes cell surface glycoproteins that function in self-nonself recognition and in allograft rejection. Among primates, the MHC has been well defined only in the human; in the chimpanzee and in two species of macaque monkeys the MHC is less well characterized. Serologic, biochemical and genetic evidence indicates that the basic organization of the MHC linkage group has been phylogenetically conserved. However, the number of genes and their linear relationship on the chromosomes differ between species. Class I MHC loci encode molecules that are the most polymorphic genes known. These molecules are ubiquitous in their tissue distribution and typically are recognized together with nominal antigens by cytotoxic lymphocytes. Class II MHC loci constitute a smaller family of serotypes serving as restricting elements for regulatory T lymphocytes. The distribution of class II antigens is limited mainly to cell types serving immune functions, and their expression is subject to up and down modulation. Class III loci code for components C2, C4 and Factor B (Bf) of the complement system. Interspecies differences in the extent of polymorphism occur, but the significance of this finding in relation to fitness and natural selection is unclear. Detailed information on the structure and regulation of MHC gene expression will be required to understand fully the biologic role of the MHC and the evolutionary relationships between species. Meanwhile, MHC testing has numerous applications to biomedical research, especially in preclinical tissue and organ transplantation studies, the study of disease mechanisms, parentage determination and breeding colony management. In this review, the current status of MHC definition in nonhuman primates will be summarized. Special emphasis is placed on the CyLA system of M. fascicularis which is a major focus in our laboratory. A highly polymorphic cynomolgus MHC has been partially characterized and consists

  3. Gene Conversion in the Evolution of Both the H-2 and Qa Class I Genes of the Murine Major Histocompatibility Complex

    PubMed Central

    Kuhner, M.; Watts, S.; Klitz, W.; Thomson, G.; Goodenow, R. S.

    1990-01-01

    In order to better understand the role of gene conversion in the evolution of the class I gene family of the major histocompatibility complex (MHC), we have used a computer algorithm to detect clustered sequence similarities among 24 class I DNA sequences from the H-2, Qa, and Tla regions of the murine MHC. Thirty-four statistically significant clusters were detected; individual analysis of the clusters suggested at least 25 past gene conversion or recombination events. These clusters are comparable in size to the conversions observed in the spontaneously occurring H-2K(bm) and H-2K(km2) mutations, and are distributed throughout all exons of the class I gene. Thus, gene conversion does not appear to be restricted to the regions of the class I gene encoding their antigen-presentation function. Moreover, both the highly polymorphic H-2 loci and the relatively monomorphic Qa and Tla loci appear to have participated as donors and recipients in conversion events. If gene conversion is not limited to the highly polymorphic loci of the MHC, then another factor, presumably natural selection, must be responsible for maintaining the observed differences in level of variation. PMID:2076814

  4. Major Histocompatibility Complex Heterozygote Superiority during Coinfection

    PubMed Central

    McClelland, Erin E.; Penn, Dustin J.; Potts, Wayne K.

    2003-01-01

    Genes of the major histocompatibility complex (MHC) play a critical role in immune recognition, and many alleles confer susceptibility to infectious and autoimmune diseases. How these deleterious alleles persist in populations is controversial. One hypothesis postulates that MHC heterozygote superiority emerges over multiple infections because MHC-mediated resistance is generally dominant and many allele-specific susceptibilities to pathogens will be masked by the resistant allele in heterozygotes. We tested this hypothesis by using experimental coinfections with Salmonella enterica (serovar Typhimurium C5TS) and Theiler's murine encephalomyelitis virus (TMEV) in MHC-congenic mouse strains where one haplotype was resistant to Salmonella and the other was resistant to TMEV. MHC heterozygotes were superior to both homozygotes in 7 out of 8 comparisons (P = 0.0024), and the mean standardized pathogen load of heterozygotes was reduced by 41% over that of homozygotes (P = 0.01). In contrast, no heterozygote superiority was observed when the MHC haplotype combinations had similar susceptibility profiles to the two pathogens. This is the first experimental evidence for MHC heterozygote superiority against multiple pathogens, a mechanism that would contribute to the evolution of MHC diversity and explain the persistence of alleles conferring susceptibility to disease. PMID:12654829

  5. Evidence for a trans-acting factor that regulates the transcription of class II major histocompatibility complex genes: genetic and functional analysis.

    PubMed Central

    Calman, A F; Peterlin, B M

    1988-01-01

    The study of specific trans-acting transcription factors in prokaryotes and lower eukaryotes has been greatly facilitated by genetic analysis of mutant strains deficient in such factors. We have developed such a system to study mammalian trans-acting factors that regulate the transcription of class II major histocompatibility complex genes, using the mutant cell lines RM2 and RM3. These cells, derived from the human B-cell line Raji, specifically fail to transcribe their class II major histocompatibility complex genes. Here we show that a transfected HLA-DR alpha class II major histocompatibility complex gene, like the endogenous HLA-DR alpha genes, is efficiently transcribed in Raji cells but not in RM2 or RM3 cells, demonstrating that the mutant cells are deficient in a specific trans-acting factor required for transcription of these genes. HLA-DR expression in RM2 and RM3 cells is rescued by fusion to another B-cell line but not by fusion to each other. Thus, the defects in the two cell lines are recessive and noncomplementing and define a locus whose wild-type product we designate TF-X1. We show that TF-X1 influences the activity of a 24-base-pair B-cell-specific cis-acting transcription element in the HLA-DR alpha promoter. However, in three different biochemical assays, we detect no difference between wild-type and mutant cells in the DNA-binding proteins that interact with these DNA sequences. Thus, the defective version of TF-X1 may be a DNA-binding protein that binds to the HLA-DR alpha promoter but fails to activate transcription. Alternatively, TF-X1 may not be a DNA-binding protein at all. Images PMID:3143110

  6. Reproductive failure and the major histocompatibility complex

    SciTech Connect

    Jin, K.; Gill, T.J. III; Ho, H.N.

    1995-06-01

    The association between HLA sharing and recurrent spontaneous abortion (RSA) was tested in 123 couples and the association between HLA sharing, and the outcome of treatment for unexplained infertility by in vitro fertilization (IVF) was tested in 76 couples, by using a new shared-allele test in order to identify more precisely the region of the major histocompatibility complex (MHC) influencing these reproductive defects. The shared-allele test circumvents the problem of rare alleles at HLA loci and at the same time provides a substantial gain in power over the simple {chi}{sup 2} test. Two statistical methods, a corrected homogeneity test and a bootstrap approach, were developed to compare the allele frequencies at each of the HLA-A, HLA-B, HLA-DR, and HLA-DQ loci; they were not statistically different amount the three patient groups and the control group. There was a significant excess of HLA-DR sharing in couples with RSA and a significant excess of HLA-DQ sharing in couples with unexplained infertility who failed treatment by IVF. These findings indicate that genes located in different parts of the class II region of the MHC affect different aspects of reproduction and strongly suggest that the sharing of HLA antigens per se is not the mechanism involved in the reproductive defects. The segment of the MHC that has genes affecting reproduction also has genes associated with different autoimmune diseases, and this juxtaposition may explain the association between reproductive defects and autoimmune diseases. 58 refs., 1 fig., 7 tabs.

  7. Immunoglobulin Heavy Chain Variable Region and Major Histocompatibility Region Genes Are Linked to Induced Graves' Disease in Females From Two Very Large Families of Recombinant Inbred Mice

    PubMed Central

    Aliesky, Holly; Banuelos, Bianca; Magana, Jessica; Williams, Robert W.; Rapoport, Basil

    2014-01-01

    Graves' hyperthyroidism is caused by antibodies to the TSH receptor (TSHR) that mimic thyroid stimulation by TSH. Stimulating TSHR antibodies and hyperthyroidism can be induced by immunizing mice with adenovirus expressing the human TSHR A-subunit. Prior analysis of induced Graves' disease in small families of recombinant inbred (RI) female mice demonstrated strong genetic control but did not resolve trait loci for TSHR antibodies or elevated serum T4. We investigated the genetic basis for induced Graves' disease in female mice of two large RI families and combined data with earlier findings to provide phenotypes for 178 genotypes. TSHR antibodies measured by inhibition of TSH binding to its receptor were highly significantly linked in the BXD set to the major histocompatibility region (chromosome 17), consistent with observations in 3 other RI families. In the LXS family, we detected linkage between T4 levels after TSHR-adenovirus immunization and the Ig heavy chain variable region (Igvh, chromosome 12). This observation is a key finding because components of the antigen binding region of Igs determine antibody specificity and have been previously linked to induced thyroid-stimulating antibodies. Data from the LXS family provide the first evidence in mice of a direct link between induced hyperthyroidism and Igvh genes. A role for major histocompatibility genes has now been established for genetic susceptibility to Graves' disease in both humans and mice. Future studies using arrays incorporating variation in the complex human Ig gene locus will be necessary to determine whether Igvh genes are also linked to Graves' disease in humans. PMID:25051451

  8. Association of major histocompatibility complex class 1 chain-related gene a dimorphism with type 1 diabetes and latent autoimmune diabetes in adults in the Algerian population.

    PubMed

    Raache, Rachida; Belanteur, Khadidja; Amroun, Habiba; Benyahia, Amel; Heniche, Amel; Azzouz, Malha; Mimouni, Safia; Gervais, Thibaud; Latinne, Dominique; Boudiba, Aissa; Attal, Nabila; Abbadi, Mohamed Cherif

    2012-04-01

    Major histocompatibility complex class I chain-related gene A (MICA-129) dimorphism was investigated in 73 autoimmune diabetes patients (type 1 diabetes and latent autoimmune diabetes in adults) and 75 controls from Algeria. Only MICA-129 Val allele and MICA-129 Val/Val genotype frequencies were higher among patients than in the control group. Statistical analysis of the estimated extended HLA-DR-DQ-MICA haplotypes shown that individual effects of MICA alleles on HLA-DQ2-DR3-MICA-129 Val/Val and HLA-DQ8-DR4-MICA-129 Val/Val haplotypes were significantly higher in patients than in the control groups. These preliminary data might suggest a relevant role of MICA-129 Val/Val single nucleotide polymorphism (weak/weak binders of NKG2D receptor) in the pathogenesis of T1D and LADA. PMID:22323559

  9. Association of Major Histocompatibility Complex Class 1 Chain-Related Gene A Dimorphism with Type 1 Diabetes and Latent Autoimmune Diabetes in Adults in the Algerian Population

    PubMed Central

    Belanteur, Khadidja; Amroun, Habiba; Benyahia, Amel; Heniche, Amel; Azzouz, Malha; Mimouni, Safia; Gervais, Thibaud; Latinne, Dominique; Boudiba, Aissa; Attal, Nabila; Abbadi, Mohamed Cherif

    2012-01-01

    Major histocompatibility complex class I chain-related gene A (MICA-129) dimorphism was investigated in 73 autoimmune diabetes patients (type 1 diabetes and latent autoimmune diabetes in adults) and 75 controls from Algeria. Only MICA-129 Val allele and MICA-129 Val/Val genotype frequencies were higher among patients than in the control group. Statistical analysis of the estimated extended HLA-DR-DQ-MICA haplotypes shown that individual effects of MICA alleles on HLA-DQ2-DR3-MICA-129 Val/Val and HLA-DQ8-DR4-MICA-129 Val/Val haplotypes were significantly higher in patients than in the control groups. These preliminary data might suggest a relevant role of MICA-129 Val/Val single nucleotide polymorphism (weak/weak binders of NKG2D receptor) in the pathogenesis of T1D and LADA. PMID:22323559

  10. High-Frequency Stimulation of the Subthalamic Nucleus Counteracts Cortical Expression of Major Histocompatibility Complex Genes in a Rat Model of Parkinson’s Disease

    PubMed Central

    Grieb, Benjamin; Engler, Gerhard; Sharott, Andrew; von Nicolai, Constantin; Streichert, Thomas; Papageorgiou, Ismini; Schulte, Alexander; Westphal, Manfred; Lamszus, Katrin; Engel, Andreas K.

    2014-01-01

    High-frequency stimulation of the subthalamic nucleus (STN-HFS) is widely used as therapeutic intervention in patients suffering from advanced Parkinson’s disease. STN-HFS exerts a powerful modulatory effect on cortical motor control by orthodromic modulation of basal ganglia outflow and via antidromic activation of corticofugal fibers. However, STN-HFS-induced changes of the sensorimotor cortex are hitherto unexplored. To address this question at a genomic level, we performed mRNA expression analyses using Affymetrix microarray gene chips and real-time RT-PCR in sensorimotor cortex of parkinsonian and control rats following STN-HFS. Experimental parkinsonism was induced in Brown Norway rats by bilateral nigral injections of 6-hydroxydopamine and was assessed histologically, behaviorally, and electrophysiologically. We applied prolonged (23h) unilateral STN-HFS in awake and freely moving animals, with the non-stimulated hemisphere serving as an internal control for gene expression analyses. Gene enrichment analysis revealed strongest regulation in major histocompatibility complex (MHC) related genes. STN-HFS led to a cortical downregulation of several MHC class II (RT1-Da, Db1, Ba, and Cd74) and MHC class I (RT1CE) encoding genes. The same set of genes showed increased expression levels in a comparison addressing the effect of 6-hydroxydopamine lesioning. Hence, our data suggest the possible association of altered microglial activity and synaptic transmission by STN-HFS within the sensorimotor cortex of 6-hydroxydopamine treated rats. PMID:24621597

  11. Brief review of the chicken Major Histocompatibility Complex: the genes, their distribution on chromosome 16, and their contributions to disease resistance

    PubMed Central

    Miller, Marcia M.; Taylor, Robert L.

    2016-01-01

    Nearly all genes presently mapped to chicken chromosome 16 (GGA 16) have either a demonstrated role in immune responses or are considered to serve in immunity by reason of sequence homology with immune system genes defined in other species. The genes are best described in regional units. Among these, the best known is the polymorphic major histocompatibility complex-B (MHC-B) region containing genes for classical peptide antigen presentation. Nearby MHC-B is a small region containing two CD1 genes, which encode molecules known to bind lipid antigens and which will likely be found in chickens to present lipids to specialized T cells, as occurs with CD1 molecules in other species. Another region is the MHC-Y region, separated from MHC-B by an intervening region of tandem repeats. Like MHC-B, MHC-Y is polymorphic. It contains specialized class I and class II genes and c-type lectin-like genes. Yet another region, separated from MHC-Y by the single nucleolar organizing region (NOR) in the chicken genome, contains olfactory receptor genes and scavenger receptor genes, which are also thought to contribute to immunity. The structure, distribution, linkages and patterns of polymorphism in these regions, suggest GGA 16 evolves as a microchromosome devoted to immune defense. Many GGA 16 genes are polymorphic and polygenic. At the moment most disease associations are at the haplotype level. Roles of individual MHC genes in disease resistance are documented in only a very few instances. Provided suitable experimental stocks persist, the availability of increasingly detailed maps of GGA 16 genes combined with new means for detecting genetic variability will lead to investigations defining the contributions of individual loci and more applications for immunogenetics in breeding healthy poultry. PMID:26740135

  12. Brief review of the chicken Major Histocompatibility Complex: the genes, their distribution on chromosome 16, and their contributions to disease resistance.

    PubMed

    Miller, Marcia M; Taylor, Robert L

    2016-02-01

    Nearly all genes presently mapped to chicken chromosome 16 (GGA 16) have either a demonstrated role in immune responses or are considered to serve in immunity by reason of sequence homology with immune system genes defined in other species. The genes are best described in regional units. Among these, the best known is the polymorphic major histocompatibility complex-B (MHC-B) region containing genes for classical peptide antigen presentation. Nearby MHC-B is a small region containing two CD1 genes, which encode molecules known to bind lipid antigens and which will likely be found in chickens to present lipids to specialized T cells, as occurs with CD1 molecules in other species. Another region is the MHC-Y region, separated from MHC-B by an intervening region of tandem repeats. Like MHC-B, MHC-Y is polymorphic. It contains specialized class I and class II genes and c-type lectin-like genes. Yet another region, separated from MHC-Y by the single nucleolar organizing region (NOR) in the chicken genome, contains olfactory receptor genes and scavenger receptor genes, which are also thought to contribute to immunity. The structure, distribution, linkages and patterns of polymorphism in these regions, suggest GGA 16 evolves as a microchromosome devoted to immune defense. Many GGA 16 genes are polymorphic and polygenic. At the moment most disease associations are at the haplotype level. Roles of individual MHC genes in disease resistance are documented in only a very few instances. Provided suitable experimental stocks persist, the availability of increasingly detailed maps of GGA 16 genes combined with new means for detecting genetic variability will lead to investigations defining the contributions of individual loci and more applications for immunogenetics in breeding healthy poultry. PMID:26740135

  13. Characterization and genotyping of the DRB1 gene of the major histocompatibility complex (MHC) in the Marmota monax, animal model of hepatitis B.

    PubMed

    Moreno-Cugnon, Leire; Esparza-Baquer, Aitor; Larruskain, Amaia; García-Etxebarria, Koldo; Menne, Stephan; González-Aseguinolaza, Gloria; Jugo, Begoña M

    2015-02-01

    The major histocompatibility complex (MHC)-containing genes are among the most polymorphic in vertebrates. MHC genes code for proteins that are critical in the immune system response. In this study, the polymorphism of the second exon of the MHC class II DRB gene was characterized in the Eastern woodchuck (Marmota monax). Woodchucks chronically infected with the woodchuck hepatitis virus (WHV) represent the best available animal model for the study of chronic hepatitis B infection in humans. In the genotyped animals we found fifteen alleles, which were expressed in two independent loci and that were named DRB1A and DRB1B in this work. The 15 alleles investigated showed an elevated divergence. A significant excess of non-synonymous substitutions was detected, which could indicate that a historical positive selection is acting in the woodchuck DRB1 genes. This hypothesis was confirmed in our study by the high variability in or near the antigen binding sites (ABS) and by the results obtained in sequence variability analyses. This analysis identified the presence of a microsatellite sequence that is located at the start of the second intron, which could further allow the development of a fast and cheap semiautomatic sequencing method. PMID:25458311

  14. Identification of a Colonial Chordate Histocompatibility Gene

    PubMed Central

    Voskoboynik, Ayelet; Newman, Aaron M.; Corey, Daniel M.; Sahoo, Debashis; Pushkarev, Dmitry; Neff, Norma F.; Passarelli, Benedetto; Koh, Winston; Ishizuka, Katherine J.; Palmeri, Karla J.; Dimov, Ivan K.; Keasar, Chen; Fan, H. Christina; Mantalas, Gary L.; Sinha, Rahul; Penland, Lolita; Quake, Stephen R.; Weissman, Irving L.

    2013-01-01

    Histocompatibility is the basis by which multicellular organisms of the same species distinguish self from non-self. Relatively little is known about the mechanisms underlying histocompatibility reactions in lower organisms. Botryllus schlosseri is a colonial urochordate, a sister group of vertebrates, that exhibits a genetically determined natural transplantation reaction, whereby self-recognition between colonies leads to formation of parabionts with a common vasculature, whereas rejection occurs between incompatible colonies. Using genetically defined lines, whole-transcriptome sequencing, and genomics, we identified a single gene that encodes self/non-self and determines “graft” outcomes in this organism. This gene is significantly upregulated in colonies poised to undergo fusion or rejection, is highly expressed in the vasculature, and is functionally linked to histocompatibility outcomes. These findings establish a platform for advancing the science of allorecognition. PMID:23888037

  15. Making the animal model for AIDS research more precise: the impact of major histocompatibility complex (MHC) genes on pathogenesis and disease progression in SIV-infected monkeys.

    PubMed

    Sauermann, U

    2001-09-01

    Experimentally infected rhesus monkeys serve as an indispensable animal model to assess the pathogenesis, to validate therapy approaches and to develop vaccination strategies against viral diseases such as AIDS threatening the human population. Upon infection with simian immunodeficiency virus (SIV), a retrovirus closely related to the human immunodeficiency virus (HIV), macaques develop clinical manifestations similar to those of HIV-infected humans. As in humans, the disease course is variable. Polymorphic genes of the major histocompatibility complex (MHC) are required for the initiation and regulation of a specific immune response and represent a major host factor accounting for the differential outcome of infection. During the last few years, our understanding of the structure and function of the rhesus macaque MHC has increased substantially. Functional studies have led to the identification of specific SIV and HIV peptide epitopes presented by rhesus macaque MHC molecules. The subsequent development of MHC class I tetramers has allowed further insight into the cellular immune response following SIV-infection. Detailed studies demonstrated that viral escape mutants are generated during the acute and chronic phase of infection and explain why control of viral replication ultimately fails. Furthermore, particular MHC haplotypes which influence disease progression have been discovered. Thus, MHC-typing can have a prognostic potential. The further elucidation of the rhesus macaque MHC and the search for other relevant genes will remain an important task for future research and will stimulate all immunologically-related investigations in macaques. PMID:11899095

  16. An interferon gamma-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes.

    PubMed Central

    Driggers, P H; Ennist, D L; Gleason, S L; Mak, W H; Marks, M S; Levi, B Z; Flanagan, J R; Appella, E; Ozato, K

    1990-01-01

    Interferons (IFNs) induce transcription of major histocompatibility complex (MHC) class I genes through the conserved IFN consensus sequence (ICS) that contains an IFN response motif shared by many IFN-regulated genes. By screening mouse lambda ZAP expression libraries with the ICS as a probe, we isolated a cDNA clone encoding a protein that binds the ICS, designated ICSBP. Protein blot analysis with labeled oligonucleotide probes showed that ICSBP binds not only the MHC class I ICS but also IFN response motifs of many IFN-regulated genes, as well as a virus-inducible element of the IFN-beta gene. The ICSBP cDNA encodes 424 amino acids and a long 3' untranslated sequence. The N-terminal 115 amino acids correspond to a putative DNA-binding domain and show significant sequence similarity with other cloned IFN response factors (IRF-1 and IRF-2). Because of the structural similarity and shared binding specificity, we conclude that ICSBP is a third member of the IRF gene family, presumably playing a role in IFN- and virus-mediated regulation of many genes. Although IRF-1 and IRF-2 share some similarity in their C-terminal regions, ICSBP shows no similarity to IRF-1 or IRF-2 in this region, suggesting that it is more distantly related. We show that ICSBP mRNA is expressed predominantly in lymphoid tissues and is inducible preferentially by IFN-gamma. The induction by IFN-gamma appears to be predominant in lymphocytes and macrophages, implying that ICSBP plays a regulatory role in cells of the immune system. The presence of multiple factors that bind common IFN response motifs may partly account for the complexity and diversity of IFN action as well as IFN-regulated gene expression. Images PMID:2111015

  17. Affinity-purified CCAAT-box-binding protein (YEBP) functionally regulates expression of a human class II major histocompatibility complex gene and the herpes simplex virus thymidine kinase gene

    SciTech Connect

    Zeleznik-Le, N.J.; Azizkhan, J.C.; Ting, J.P.Y. )

    1991-03-01

    Efficient major histocompatibility complex class II gene expression requires conseved protein-binding promoter elements, including X and Y elements. The authors affinity purified an HLA-DRA Y-element (CCAAT)-binding protein (YEBP) and used it to reconstitute Y-depleted HLA-DRA in vitro transcription. This directly demonstrates a positive functional role for YEBP in HLA-DRA transcription. The ability of YEBP to regulate divergent CCAAT elements was also assessed; YEBP was found to partially activate the thymidine kinase promoter. This functional analysis of YEBP shows that this protein plays an important role in the regulation of multiple genes.

  18. Identification of two major histocompatibility (MH) class II A genes and their association to Vibrio anguillarum infection in half-smooth tongue sole ( Cynoglossus semilaevis)

    NASA Astrophysics Data System (ADS)

    Li, Chunmei; Wang, Xubo; Zhang, Quanqi; Wang, Zhigang; Qi, Jie; Yi, Qilin; Liu, Zhipeng; Wang, Yanan; Yu, Haiyang

    2012-03-01

    Major histocompatibility complex class II antigens are important in vertebrate immune system. In the present study, the full cDNA sequence of class II A gene was synthesized by RACE-PCR from half-smooth tongue sole ( Cynoglossus semilaevis), and its open reading frame (ORF) polymorphism was studied. The whole cDNA sequence was 992 bp in length, including the ORF with 717 bp. Twenty-five alleles were identified and clustered into two distinct groups according to the specific nucleotides/ amino acids in specific positions. Eleven alleles belonged to Cyse-DAA while fourteen alleles belonged to Cyse-DBA. Four Cyse-DAA alleles were observed in one individual, and three to five Cyse-DBA alleles were observed in each of the three detected individuals, which indicated that at least two loci existed in each gene. Moreover, in order to study the function of the alleles in resistance to infection, 200 individuals were intraperitoneally injected with Vibrio anguillarum and the first 20 dead individuals and 20 surviving ones were selected for genotype analysis. Fifty-six alleles were identified among the 40 individuals. Twenty-nine alleles belonged to Cyse-DAA and the other 27 alleles belonged to Cyse-DBA. Eighteen alleles were selected for studying their function in resistance to infection. Alleles Cyse-DAA*0201, Cyse-DAA*1101, Cyse-DBA*0401, Cyse-DBA*1102, Cyse-DBA*1801 and Cyse-DBA*2201 were identified only in surviving individuals, while alleles Cyse- DAA*0901, Cyse-DBA*1101 and Cyse-DBA*1401 occurred more frequently in dead individuals. This study confirmed the existence and polymorphism of two class II A genes as well as the relationship between alleles of class II A genes and disease susceptibility/ resistance in half-smooth tongue sole.

  19. Genetic Variation of the Major Histocompatibility Complex (MHC Class II B Gene) in the Threatened Hume’s Pheasant, Syrmaticus humiae

    PubMed Central

    Chen, Weicai; Bei, Yongjian; Li, Hanhua

    2015-01-01

    Major histocompatibility complex (MHC) genes are the most polymorphic genes in vertebrates and encode molecules that play a crucial role in pathogen resistance. As a result of their diversity, they have received much attention in the fields of evolutionary and conservation biology. Here, we described the genetic variation of MHC class II B (MHCIIB) exon 2 in a wild population of Hume’s pheasant (Syrmaticus humiae), which has suffered a dramatic decline in population over the last three decades across its ranges in the face of heavy exploitation and habitat loss. Twenty-four distinct alleles were found in 73 S. humiae specimens. We found seven shared alleles among four geographical groups as well as six rare MHCIIB alleles. Most individuals displayed between one to five alleles, suggesting that there are at least three MHCIIB loci of the Hume’s pheasant. The dN ⁄ dS ratio at putative antigen-binding sites (ABS) was significantly greater than one, indicating balancing selection is acting on MHCIIB exon 2. Additionally, recombination and gene conversion contributed to generating MHCIIB diversity in the Hume’s pheasant. One to three recombination events and seventy-five significant gene conversion events were observed within the Hume’s pheasant MHCIIB loci. The phylogenetic tree and network analysis revealed that the Hume’s pheasant alleles do not cluster together, but are scattered through the tree or network indicating a trans-species evolutionary mode. These findings revealed the evolution of the Hume’s pheasant MHC after suffering extreme habitat fragmentation. PMID:25629763

  20. Sequence polymorphism of two major histocompatibility (MH) class II B genes and their association with Vibrio anguillarum infection in half-smooth tongue sole ( Cynoglossus semilaevis)

    NASA Astrophysics Data System (ADS)

    Li, Chunmei; Zhang, Quanqi; Yu, Yan; Li, Shuo; Zhong, Qiwang; Sun, Yeying; Wang, Zhigang; Qi, Jie; Zhai, Jieming; Wang, Xubo

    2011-11-01

    Major histocompatibility complex (MHC) class II B molecules play an important role in the adaptive immune response in fish. Previous study has reported that two highly polymorphic class II B genes, Cyse-DAB and Cyse-DBB exist in half-smooth tongue sole ( Cynoglossus semilaevis). In this study, the polymorphism within exon 2 of the class II B genes following bacterial challenge was evaluated. Two hundred C. semilaevis individuals were injected intraperitoneally with Vibrio anguillarum. Muscle tissue from the first 20 dead and 20 of the survivors was collected for genotyping. Sixty alleles from the 40 individuals were isolated, of which 32 belonged to Cyse-DAB and 28 belonged to Cyse-DBB. The rate of d N (non-synonymous substitution) was higher than that of d S (synonymous substitution) in the PBRs (peptide binding residues) of both class II B genes. Conversely, the rate of d S was higher than d N in the non-PBRs and the complete exon 2 sequence. Thus, the results suggest that positive selection has occurred in the PBRs and purifying selection in the non-PBRs and exon 2. Thirteen class II B alleles were used to study the association between alleles and resistance to infection. Though not significant, alleles Cyse-DAB*0601, Cyse-DAB*0706, and Cyse-DBB*0101, Cyse-DBB*1301 were only found in surviving individuals and may represent alleles that have resistance against V. anguillarum infection. Alleles Cyse-DAB*0701 and Cyse-DAB*1301 were significantly more prevalent in dead individuals than in surviving ones and may represent alleles that are associated with increased susceptibility to V. anguillarum infection.

  1. Effective suppression of class I major histocompatibility complex expression by the US11 or ICP47 genes can be limited by cell type or interferon-gamma exposure.

    PubMed

    Radosevich, Thomas J; Seregina, Tatiana; Link, Charles J

    2003-12-10

    An impediment encountered in many viral-based gene therapy clinical trials has been the rapid destruction of the transgene by the host's immune response. The processing and presentation of antigens through the class I major histocompatibility complex (MHC) pathway is the initial specific response to viral infection. Disruption of the class I MHC pathway by herpes simplex virus (HSV) or the human cytomegalovirus (HCMV) results in a decrease of the CD8(+) cytotoxic T lymphocyte (CTL) response and prolongs survival of infected cells in the host. Two viral immune suppression genes that interfere with the class I MHC presentation pathway, the HSV type I ICP47 gene and HCMV US11 gene, were cloned and each incorporated into a retroviral vector. HSV ICP47 and HCMV US11 transgenes were expressed in multiple cells lines and compared for their abilities to reduce antigen presentation on the cell surface by class I MHC. Retroviral supernatants were used to transduce human, canine, and rat cell lines. Fluorescence-activated cell sorter (FACS) analysis of US11- and ICP47-transduced cell lines demonstrated substantial reductions in class I MHC cell surface expression in most cell lines except in rodent cells where ICP47 is nonfunctional. The decrease in the level of class I MHC expression for ICP47 transduced cell lines ranged from 31-98% relative to negative controls. US11 decreased class I cell surface MHC by 67-96%. When both ICP47 and US11 are expressed in human cells, a further reduction of class I MHC was observed. Next, human A375 melanoma cells were tested to determine if the resulting reduction in cell surface class I MHC would reduce in vitro cytotoxicity by CTL. A375 cells expressing either ICP47 or US11 demonstrated a twofold to threefold reduction of specific lysis by primed CD8(+) CTL. These data clearly establish an ability to convey immune protection to human cells by viral genes. However, further analysis demonstrated that interferon (IFN)-gamma could reverse

  2. MOLECULAR GENETICS OF THE SWINE MAJOR HISTOCOMPATIBILITY COMPLEX, THE SLA COMPLEX

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The swine major histocompatibility complex (MHC) or swine leukocyte antigen (SLA) complex is one of the most gene-dense regions in the swine genome. It consists of three major gene clusters, the SLA class I, class III and class II regions, that span ~1.1, 0.7 and 0.5 Mb, respectively, making the swi...

  3. Characterization and 454 pyrosequencing of Major Histocompatibility Complex class I genes in the great tit reveal complexity in a passerine system

    PubMed Central

    2012-01-01

    Background The critical role of Major Histocompatibility Complex (Mhc) genes in disease resistance and their highly polymorphic nature make them exceptional candidates for studies investigating genetic effects on survival, mate choice and conservation. Species that harbor many Mhc loci and high allelic diversity are particularly intriguing as they are potentially under strong selection and studies of such species provide valuable information as to the mechanisms maintaining Mhc diversity. However comprehensive genotyping of complex multilocus systems has been a major challenge to date with the result that little is known about the consequences of this complexity in terms of fitness effects and disease resistance. Results In this study, we genotyped the Mhc class I exon 3 of the great tit (Parus major) from two nest-box breeding populations near Oxford, UK that have been monitored for decades. Characterization of Mhc class I exon 3 was adopted and bidirectional sequencing was carried using the 454 sequencing platform. Full analysis of sequences through a stepwise variant validation procedure allowed reliable typing of more than 800 great tits based on 214,357 reads; from duplicates we estimated the repeatability of typing as 0.94. A total of 862 alleles were detected, and the presence of at least 16 functional loci was shown - the highest number characterized in a wild bird species. Finally, the functional alleles were grouped into 17 supertypes based on their antigen binding affinities. Conclusions We found extreme complexity at the Mhc class I of the great tit both in terms of allelic diversity and gene number. The presence of many functional loci was shown, together with a pseudogene family and putatively non-functional alleles; there was clear evidence that functional alleles were under strong balancing selection. This study is the first step towards an in-depth analysis of this gene complex in this species, which will help understanding how parasite

  4. Suggestive association of major histocompatibility IB genetic markers with resistance to bacterial cold water disease in rainbow trout (Oncorhynchus mykiss)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes within the major histocompatability complex (MHC) are important for both innate and adaptive immune responses in mammals, but much less is known regarding their contribution in teleost fishes. Here, we examine the involvement of four major histocompatibility (MH) genomic regions in rainbow tro...

  5. Repression of major histocompatibility complex I-A beta gene expression by dbpA and dbpB (mYB-1) proteins.

    PubMed Central

    Lloberas, J; Maki, R A; Celada, A

    1995-01-01

    The induction of major histocompatibility complex class II gene expression is mediated by three DNA elements in the promoters of these genes (W, X, and Y boxes). The Y box contains an inverted CCAAT box sequence, and the binding activity to the CAAT box is mediated by factor NF-Y, which is composed of subunits NF-YA and NF-YB. We have found that transfection of either dbpA or dbpB (mYB-1) or both inhibits I-A beta gene expression. Although the genes for some members of the Y-box family of binding proteins have been isolated by screening an expression library using the Y-box sequence, under our conditions no binding of dbpA or dbpB to the Y box of the I-A beta or I-E alpha promoter was detected. This suggested that repression of I-A beta gene expression by dbpA and dbpB was not due to competition for binding to the Y-box sequence. The results suggest two other mechanisms by which dbpA and dbpB can inhibit transcription from the I-A beta promoter. When dbpA was added, the binding of NF-YA to DNA increased, which could be explained by interaction between these two proteins whose purpose is to increase the binding affinity of NF-YA for DNA. However, this complex was unable to stimulate transcription from the I-A beta promoter. Thus, dbpA competed for the interaction between NF-YA and NF-YB by binding to NF-YA. When dbpB factor was added together with NF-YA and NF-YB, the binding of the NF-YA--NF-YB complex was reduced. This suggested that dbpB may complete with NF-YB for interaction with NF-YA. These results provide an example of how dbpA and dbpB may regulate transcription of promoters that utilize NF-Y as a transcription factor. PMID:7651426

  6. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  7. Major Histocompatibility Complex (MHC) markers in conservation biology.

    PubMed

    Ujvari, Beata; Belov, Katherine

    2011-01-01

    Human impacts through habitat destruction, introduction of invasive species and climate change are increasing the number of species threatened with extinction. Decreases in population size simultaneously lead to reductions in genetic diversity, ultimately reducing the ability of populations to adapt to a changing environment. In this way, loss of genetic polymorphism is linked with extinction risk. Recent advances in sequencing technologies mean that obtaining measures of genetic diversity at functionally important genes is within reach for conservation programs. A key region of the genome that should be targeted for population genetic studies is the Major Histocompatibility Complex (MHC). MHC genes, found in all jawed vertebrates, are the most polymorphic genes in vertebrate genomes. They play key roles in immune function via immune-recognition and -surveillance and host-parasite interaction. Therefore, measuring levels of polymorphism at these genes can provide indirect measures of the immunological fitness of populations. The MHC has also been linked with mate-choice and pregnancy outcomes and has application for improving mating success in captive breeding programs. The recent discovery that genetic diversity at MHC genes may protect against the spread of contagious cancers provides an added impetus for managing and protecting MHC diversity in wild populations. Here we review the field and focus on the successful applications of MHC-typing for conservation management. We emphasize the importance of using MHC markers when planning and executing wildlife rescue and conservation programs but stress that this should not be done to the detriment of genome-wide diversity. PMID:21954351

  8. Major Histocompatibility Complex (MHC) Markers in Conservation Biology

    PubMed Central

    Ujvari, Beata; Belov, Katherine

    2011-01-01

    Human impacts through habitat destruction, introduction of invasive species and climate change are increasing the number of species threatened with extinction. Decreases in population size simultaneously lead to reductions in genetic diversity, ultimately reducing the ability of populations to adapt to a changing environment. In this way, loss of genetic polymorphism is linked with extinction risk. Recent advances in sequencing technologies mean that obtaining measures of genetic diversity at functionally important genes is within reach for conservation programs. A key region of the genome that should be targeted for population genetic studies is the Major Histocompatibility Complex (MHC). MHC genes, found in all jawed vertebrates, are the most polymorphic genes in vertebrate genomes. They play key roles in immune function via immune-recognition and -surveillance and host-parasite interaction. Therefore, measuring levels of polymorphism at these genes can provide indirect measures of the immunological fitness of populations. The MHC has also been linked with mate-choice and pregnancy outcomes and has application for improving mating success in captive breeding programs. The recent discovery that genetic diversity at MHC genes may protect against the spread of contagious cancers provides an added impetus for managing and protecting MHC diversity in wild populations. Here we review the field and focus on the successful applications of MHC-typing for conservation management. We emphasize the importance of using MHC markers when planning and executing wildlife rescue and conservation programs but stress that this should not be done to the detriment of genome-wide diversity. PMID:21954351

  9. Modular variations of the human major histocompatibility complex class III genes for serine/threonine kinase RP, complement component C4, steroid 21-hydroxylase CYP21, and tenascin TNX (the RCCX module). A mechanism for gene deletions and disease associations.

    PubMed

    Yang, Z; Mendoza, A R; Welch, T R; Zipf, W B; Yu, C Y

    1999-04-23

    The frequent variations of human complement component C4 gene size and gene numbers, plus the extensive polymorphism of the proteins, render C4 an excellent marker for major histocompatibility complex disease associations. As shown by definitive RFLPs, the tandemly arranged genes RP, C4, CYP21, and TNX are duplicated together as a discrete genetic unit termed the RCCX module. Duplications of the RCCX modules occurred by the addition of genomic fragments containing a long (L) or a short (S) C4 gene, a CYP21A or a CYP21B gene, and the gene fragments TNXA and RP2. Four major RCCX structures with bimodular L-L, bimodular L-S, monomodular L, and monomodular S are present in the Caucasian population. These modules are readily detectable by TaqI RFLPs. The RCCX modular variations appear to be a root cause for the acquisition of deleterious mutations from pseudogenes or gene segments in the RCCX to their corresponding functional genes. In a patient with congenital adrenal hyperplasia, we discovered a TNXB-TNXA recombinant with the deletion of RP2-C4B-CYP21B. Elucidation of the DNA sequence for the recombination breakpoint region and sequence analyses yielded definitive proof for an unequal crossover between TNXA from a bimodular chromosome and TNXB from a monomodular chromosome. PMID:10207042

  10. Infectious diseases and immunity: special reference to major histocompatibility complex.

    PubMed Central

    Singh, N.; Agrawal, S.; Rastogi, A. K.

    1997-01-01

    Human leukocyte antigens (HLAs) are an inherent system of alloantigens, which are the products of genes of the major histocompatibility complex (MHC). These genes span a region of approximately 4 centimorgans on the short arm of human chromosome 6 at band p 21.3 and encode the HLA class I and class II antigens, which play a central role in cell-to-cell interaction in the immune system. These antigens interact with the antigen-specific cell surface receptors of T lymphocytes (TCR) thus causing activation of the lymphocytes and the resulting immune response. Class I antigens restrict cytotoxic T-cell (CD8+) function thus killing viral infected targets, while class II antigens are involved in presentation of exogenous antigens to T-helper cells (CD4+) by antigen presenting cells (APC). The APC processes the antigens, and the immunogenic peptide is then presented at the cell surface along with the MHC molecule for recognition by the TCR. Since the MHC molecules play a central role in regulating the immune response, they may have an important role in controlling resistance and susceptibility to diseases. In this review we have highlighted studies conducted to look for an association between HLA and infectious diseases; such studies have had a variable degree of success because the pathogenesis of different diseases varies widely, and most diseases have a polygenic etiology. PMID:9126443

  11. Major histocompatibility complex heterozygosity reduces fitness in experimentally infected mice.

    PubMed

    Ilmonen, Petteri; Penn, Dustin J; Damjanovich, Kristy; Morrison, Linda; Ghotbi, Laleh; Potts, Wayne K

    2007-08-01

    It is often suggested that heterozygosity at major histocompatibility complex (MHC) loci confers enhanced resistance to infectious diseases (heterozygote advantage, HA, hypothesis), and overdominant selection should contribute to the evolution of these highly polymorphic genes. The evidence for the HA hypothesis is mixed and mainly from laboratory studies on inbred congenic mice, leaving the importance of MHC heterozygosity for natural populations unclear. We tested the HA hypothesis by infecting mice, produced by crossbreeding congenic C57BL/10 with wild ones, with different strains of Salmonella, both in laboratory and in large population enclosures. In the laboratory, we found that MHC influenced resistance, despite interacting wild-derived background loci. Surprisingly, resistance was mostly recessive rather than dominant, unlike in most inbred mouse strains, and it was never overdominant. In the enclosures, heterozygotes did not show better resistance, survival, or reproductive success compared to homozygotes. On the contrary, infected heterozygous females produced significantly fewer pups than homozygotes. Our results show that MHC effects are not masked on an outbred genetic background, and that MHC heterozygosity provides no immunological benefits when resistance is recessive, and can actually reduce fitness. These findings challenge the HA hypothesis and emphasize the need for studies on wild, genetically diverse species. PMID:17603099

  12. Human X-box-binding protein 1 is required for the transcription of a subset of human class II major histocompatibility genes and forms a heterodimer with c-fos

    SciTech Connect

    Ono, S.J.; Strominger, J.L. ); Hsiouchi Liou; Davidon, R.; Glimcher, L.H. )

    1991-05-15

    A complementary DNA encoding a member of the leucine-zipper class of proteins (human X-box-binding protein, hXBP-1) that binds to the 3{prime} end of the conserved X box (X2) of the HLA-DRA major histocompatibility complex gene was recently described. Further gel-retardation analysis has demonstrated that hXBP-1 also binds to HLA-DPB X2 but not to other X2 sequences. Transient transfection of a mammalian expression vector with the hXBP-1 cDNA inserted in the antisense orientation represses the surface expression of HLA-DR and HLA-DP in Raji cells. Cotransfection of the antisense hXBP-1 vector with a HLA-DRA/chloramphenicol acetyltransferase (but not a HLA-DQB/chloramphenicol acetyltransferase) reporter plasmid decreases chloramphenicol acetyltransferase activity in Raji cells and in {gamma}-interferon-treated HeLa cells relative to cells cotransfected with a control antisense vector. Moreover, hXBP-1 is shown to form a stable heterodimer with the product of the c-fos protooncogene. These data suggest that the hXBP-1 c-fos heterodimer is critical for the transcription of a subset of the human class II major histocompatibility complex genes and that the regulatory mechanisms for the different class II genes are distinct.

  13. From genome-wide to candidate gene: an investigation of variation at the major histocompatibility complex in common bottlenose dolphins exposed to harmful algal blooms.

    PubMed

    Cammen, Kristina M; Wilcox, Lynsey A; Rosel, Patricia E; Wells, Randall S; Read, Andrew J

    2015-02-01

    The role the major histocompatibility complex (MHC) plays in response to exposure to environmental toxins is relatively poorly understood, particularly in comparison to its well-described role in pathogen immunity. We investigated associations between MHC diversity and resistance to brevetoxins in common bottlenose dolphins (Tursiops truncatus). A previous genome-wide association study investigating an apparent difference in harmful algal bloom (HAB) resistance among dolphin populations in the Gulf of Mexico identified genetic variation associated with survival in close genomic proximity to multiple MHC class II loci. Here, we characterized genetic variation at DQA, DQB, DRA, and DRB loci in dolphins from central-west Florida and the Florida Panhandle, including dolphins that died during HABs and dolphins presumed to have survived HAB exposure. We found that DRB and DQB exhibited patterns of genetic differentiation among geographic regions that differed from neutral microsatellite loci. In addition, genetic differentiation at DRB across multiple pairwise comparisons of live and dead dolphins was greater than differentiation observed at neutral loci. Our findings at these MHC loci did not approach the strength of association with survival previously described for a nearby genetic variant. However, the results provide evidence that selective pressures at the MHC vary among dolphin populations that differ in the frequency of HAB exposure and that the overall composition of DRB variants differs between dolphin survivors and non-survivors of HABs. These results may suggest a potential role of MHC diversity in variable survival of bottlenose dolphins exposed to HABs. PMID:25475909

  14. Excess of homozygosity in the major histocompatibility complex in schizophrenia

    PubMed Central

    Mukherjee, Semanti; Guha, Saurav; Ikeda, Masashi; Iwata, Nakao; Malhotra, Anil K.; Pe'er, Itsik; Darvasi, Ariel; Lencz, Todd

    2014-01-01

    Genome-wide association studies (GWAS) in schizophrenia have focused on additive allelic effects to identify disease risk loci. In order to examine potential recessive effects, we applied a novel approach to identify regions of excess homozygosity in an ethnically homogenous cohort: 904 schizophrenia cases and 1640 controls drawn from the Ashkenazi Jewish (AJ) population. Genome-wide examination of runs of homozygosity identified an excess in cases localized to the major histocompatibility complex (MHC). To refine this signal, we used the recently developed GERMLINE algorithm to identify chromosomal segments shared identical-by-descent (IBD) and compared homozygosity at such segments in cases and controls. We found a significant excess of homozygosity in schizophrenia cases compared with controls in the MHC (P-value = 0.003). An independent replication cohort of 548 schizophrenia cases from Japan and 542 matched healthy controls demonstrated similar effects. The strongest case–control recessive effects (P = 8.81 × 10−8) were localized to a 53-kb region near HLA-A, in a segment encompassing three poorly annotated genes, TRIM10, TRIM15 and TRIM40. At the same time, an adjacent segment in the Class I MHC demonstrated clear additive effects on schizophrenia risk, demonstrating the complexity of association in the MHC and the ability of our IBD approach to refine localization of broad signals derived from conventional GWAS. In sum, homozygosity in the classical MHC region appears to convey significant risk for schizophrenia, consistent with the ecological literature suggesting that homozygosity at the MHC locus may be associated with vulnerability to disease. PMID:24943592

  15. Influence of major histocompatibility haplotype on autoimmune disease varies in different inbred families of chickens.

    PubMed Central

    Bacon, L D; Rose, N R

    1979-01-01

    Three partially inbred substrains of Obese strain chickens were studied for the spontaneous development of autoimmune thyroiditis. The influence of the major histocompatibility complex (B haplotype) was marked in one, less marked but still significant in a second, and barely detectable and transient in a third substrain. These differences in the effect of B haplotype may be due to the overriding action of genes other than those within the B haplotype. PMID:286327

  16. Major Histocompatibility Complex and Malaria: Focus on Plasmodium vivax Infection

    PubMed Central

    Lima-Junior, Josué da Costa; Pratt-Riccio, Lilian Rose

    2016-01-01

    The importance of host and parasite genetic factors in malaria resistance or susceptibility has been investigated since the middle of the last century. Nowadays, of all diseases that affect man, malaria still plays one of the highest levels of selective pressure on human genome. Susceptibility to malaria depends on exposure profile, epidemiological characteristics, and several components of the innate and adaptive immune system that influences the quality of the immune response generated during the Plasmodium lifecycle in the vertebrate host. But it is well known that the parasite’s enormous capacity of genetic variation in conjunction with the host genetics polymorphism is also associated with a wide spectrum of susceptibility degrees to complicated or severe forms of the disease. In this scenario, variations in genes of the major histocompatibility complex (MHC) associated with host resistance or susceptibility to malaria have been identified and used as markers in host–pathogen interaction studies, mainly those evaluating the impact on the immune response, acquisition of resistance, or increased susceptibility to infection or vulnerability to disease. However, due to the intense selective pressure, number of cases, and mortality rates, the majority of the reported associations reported concerned Plasmodium falciparum malaria. Studies on the MHC polymorphism and its association with Plasmodium vivax, which is the most widespread Plasmodium and the most prevalent species outside the African continent, are less frequent but equally important. Despite punctual contributions, there are accumulated evidences of human genetic control in P. vivax infection and disease. Herein, we review the current knowledge in the field of MHC and derived molecules (HLA Class I, Class II, TNF-α, LTA, BAT1, and CTL4) regarding P. vivax malaria. We discuss particularly the results of P. vivax studies on HLA class I and II polymorphisms in relation to host susceptibility, naturally

  17. Major histocompatibility complex differentiation in Sacramento River chinook salmon.

    PubMed Central

    Kim, T J; Parker, K M; Hedrick, P W

    1999-01-01

    The chinook salmon of the Sacramento River, California, have been reduced to a fraction of their former abundance because of human impact and use of the river system. Here we examine the genetic variation at a major histocompatibility complex class II exon in the four Sacramento chinook salmon runs. Examination of the alleles found in these and other chinook salmon revealed nucleotide patterns consistent with selection for amino acid replacement at the putative antigen-binding sites. We found a significant amount of variation in each of the runs, including the federally endangered winter run. All of the samples were in Hardy-Weinberg proportions. A significant amount of genetic differentiation between runs was revealed by several measures of differentiation. Winter run was the most genetically divergent, while the spring, late-fall, and fall runs were less differentiated. PMID:10049927

  18. Roles for major histocompatibility complex glycosylation in immune function

    PubMed Central

    Ryan, Sean O.

    2013-01-01

    The major histocompatibility complex (MHC) glycoprotein family, also referred to as human leukocyte antigens, present endogenous and exogenous antigens to T lymphocytes for recognition and response. These molecules play a central role in enabling the immune system to distinguish self from non-self, which is the basis for protective immunity against pathogenic infections and disease while at the same time representing a serious obstacle for tissue transplantation. All known MHC family members, like the majority of secreted, cell surface, and other immune-related molecules, carry asparagine (N)-linked glycans. The immune system has evolved increasing complexity in higher-order organisms along with a more complex pattern of protein glycosylation, a relationship that may contribute to immune function beyond the early protein quality control events in the endoplasmic reticulum that are commonly known. The broad MHC family maintains peptide sequence motifs for glycosylation at sites that are highly conserved across evolution, suggesting importance, yet functional roles for these glycans remain largely elusive. In this review, we will summarize what is known about MHC glycosylation and provide new insight for additional functional roles for this glycoprotein modification in mediating immune responses. PMID:22461020

  19. Clinical Differences between Men and Women with Psoriatic Arthritis: Relevance of the Analysis of Genes and Polymorphisms in the Major Histocompatibility Complex Region and of the Age at Onset of Psoriasis

    PubMed Central

    Queiro, Rubén; Tejón, Patricia; Coto, Pablo; Alonso, Sara; Alperi, Mercedes; Sarasqueta, Cristina; González, Segundo; Martínez-Borra, Jesús; López-Larrea, Carlos; Ballina, Javier

    2013-01-01

    It has been shown that males with spondyloarthritis tend to suffer from more severe spinal disease while females are more likely to have peripheral joint involvement. Nevertheless, gender-related differences have not been thoroughly explored in psoriatic arthritis (PsA). In PsA, males accumulate more peripheral and axial joint damage compared to women. However, it is not clear whether these findings are secondary to differences in occupational physical activity, hormonal changes, or other factors. The present study analyzed the differences in clinical expression of PsA between men and women. We have also evaluated the possible existence of gender-linked differences in the distribution of genes and polymorphisms within the major histocompatibility complex and whether patients' age at the onset of psoriasis established any differences in these aspects. Women suffered more polyarthritis, greater functional impairment, and a larger number of swollen joints during followup. We appreciated a differential expression of certain MHC genes according to gender and age at onset of psoriasis. Our results point to the need to include patient's age at the onset of psoriasis and gender as key stratification elements in future studies of genetic associations in PsA. PMID:23690822

  20. Induction of class II major histocompatibility complex expression in human multiple myeloma cells by retinoid.

    PubMed

    Sanda, Takaomi; Iida, Shinsuke; Kayukawa, Satoshi; Ueda, Ryuzo

    2007-01-01

    Class II major histocompatibility complex (MHC II) is normally silenced in plasma/multiple myeloma (MM) cells at the transcriptional level through downregulation of class II transactivator (CIITA), allowing MM cells to escape from immunological responses. Here we demonstrate that a retinoic acid receptor-alpha/beta-selective retinoid Am80 (tamibarotene) could induce the expression of functional MHC II molecules in human MM cell lines. Am80 upregulated expression of the interferon regulatory factor-1 gene, followed by enhancement of CIITA expression. This is the first report demonstrating that retinoid can induce the expression of MHC II in terminally-differentiated plasma/MM cells. PMID:17229644

  1. Major histocompatibility complex locus DRA polymorphism in the endangered Sorraia horse and related breeds.

    PubMed

    Luís, C; Cothran, E G; Oom, M M; Bailey, E

    2005-02-01

    The major histocompatibility complex (MHC) genes play well-defined roles in eliciting immune responses and combating infectious diseases. This genetic system is among the most polymorphic. The extent of genetic variation within a population has been directly correlated with fitness for many traits. The MHC class II locus DRA polymorphism was analysed in the endangered Sorraia horse, two other Portuguese and four New World horse breeds considered to be historically close to the Sorraia. Comparison of the Sorraia with other breeds demonstrated less MHC variation among Sorraia horses. If DRA polymorphism provides greater disease resistance, selective breeding to increase MHC polymorphism may increase fitness of this population. PMID:16130491

  2. Recovery of CD4+ T Cells in HIV patients with a stable virologic response to antiretroviral therapy is associated with polymorphisms of interleukin-6 and central major histocompatibility complex genes.

    PubMed

    Fernandez, Sonia; Rosenow, Ann A; James, Ian R; Roberts, Steven G; Nolan, Richard C; French, Martyn A; Price, Patricia

    2006-01-01

    We investigated whether polymorphisms in genes associated with HIV disease progression and/or immune activation affect CD4+ T-cell recovery in HIV patients who began combination antiretroviral therapy (ART) with advanced immunodeficiency and achieved stable control of plasma viremia. Patients with CD4 T-cell counts <300 cells/microL (n = 33) and >400 cells/microL (n = 37) on ART were compared. A multiple case-control logistic regression associated carriage of BAT1(1,2) or interleukin (IL)6-174(2,2) with low CD4 T-cell counts (P = 0.012). BAT1*2 uniquely marks the central major histocompatibility complex region of a conserved haplotype (HLA-A1,B8,BAT1*2,TNFA-308*2,DR3,DQ2). There was no association between alleles carried at CCR5Delta32, CCR5 59029, CCR5 59353, CCR2+190 (V64I), SDF1 3'UTR, IL1A+4845, IL1B+3953, IL4-589, IL10-592, IL10-R1+536, IL10-R1+1112, IL12B 3'UTR, TNFA-308, or TNFA-1031 and CD4 T-cell counts. We suggest that immune activation and/or CD4 T-cell apoptosis in HIV patients on effective ART is influenced by genetic factors. PMID:16340466

  3. The chromosomal order of genes controlling the major histocompatibility complex, properdin factor B, and deficiency of the second component of complement.

    PubMed Central

    Raum, D; Glass, D; Carpenter, C B; Alper, C A; Schur, P H

    1976-01-01

    The relationship of the genes coding for HLA to those coding for properdin Factor B allotypes and for deficiency of the second component of complement (C2) was studied in families of patients with connective tissue disorders. Patients were selected because they were heterozygous or homozygous for C2 deficiency. 12 families with 15 matings informative for C2 deficiency were found. Of 57 informative meioses, two crossovers were noted between the C2 deficiency gene and the HLA-B gene, with a recombinant fraction of 0.035. A lod score of 13 was calculated for linkage between C2 deficiency and HLA-B at a maximum likelihood value of the recombinant fraction of 0.04. 18 families with 21 informative matings for both properdin Factor B allotype and HLA-B were found. Of 72 informative meioses, three recombinants were found, giving a recombinant fraction of 0.042. A lod score of 16 between HLA-B and Factor B allotypes was calculated at a maximum likelihood value of the recombinant fraction of 0.04. A crossover was shown to have occurred between genes for Factor B and HLA-D, in which HLA-D segregared with HLA-A and B. These studies suggest that the genes for Factor B and C2 deficiency are located outside those for HLA, that the order of genese is HLA-A, -B, -D, Factor B allotype, C2 deficiency, that the genes coding for C2 deficiency and Factor B allotypes are approximately 3--5 centimorgans from the HLA-A and HLA-B loci, and that the apparent lack of recombinants between the Factor B gene and C2 deficiency gene suggests that these two genes lie in close proximity to one another. PMID:993342

  4. Expression of major histocompatibility antigens in human chronic pancreatitis.

    PubMed

    Jalleh, R P; Gilbertson, J A; Williamson, R C; Slater, S D; Foster, C S

    1993-10-01

    T-lymphocytic infiltration of the exocrine pancreas and liver in patients with chronic pancreatitis has suggested that cell mediated immune mechanisms may play a part in the pathogenesis of this disease. As expression of major histocompatibility (MHC) antigens is a prerequisite for organ specific autoimmunity, the expression of HLA class I (beta 2-microglobulin) and class II (HLA-DR) determinants have been analysed, together with the presence of T-lymphocytes, in 93 patients (64 men and 29 women, mean age 40.6 years) having an operation for chronic pancreatitis. Ethanol (63 patients), recurrent acute pancreatitis (12), congenital lesions (2), and unknown (16) were suggested to be the causes of the disease. Immunohistochemical staining of formalin fixed and paraffin wax embedded tissue sections used conventional immunohistochemical techniques with specific anti-serum samples. No MHC expression was identified in 10 histologically normal pancreatic control specimens or in four cases of chronic pancreatitis secondary to obstruction by neuroendocrine tumours within the head of the pancreas. beta 2-microglobulin expression by pancreatic exocrine epithelial cells was seen in 76 chronic pancreatitis specimens (82%) while HLA-DR was present in 61 (66%). Simultaneous expression of both class I and II determinants was seen in 53 (57%) of cases. MHC determinant expression was not found in 10 cases (11%) of chronic pancreatitis. In the positive specimens, expression was confined to ductal and ductular (interlobular and intralobular) epithelium with no staining of acinar cells. Staining was not related to the suspected cause of the disease or age. T-lymphocytes were more prominent in chronic pancreatitis mean (SEM) (131 (15) cells per high powered field) than controls (5 (1), p < 0.01). Aberrant MHC expression by exocrine pancreatic epithelial cells occurring in the presence of an appreciable T-cell infiltration confirmed that the appropriate cellular conditions were present for

  5. Identification of the transcription factors NF-YA and NF-YB as factors A and B that bound to the promoter of the major histocompatibility complex class II gene I-A beta.

    PubMed Central

    Celada, A; McKercher, S R; Maki, R A

    1996-01-01

    The Y box is a conserved sequence in the promoter of major histocompatibility complex (MHC) class II genes, which contains a CCAAT sequence (CCAAT box). Previously, we partially purified the DNA-binding protein that recognizes the Y box of the I-A beta gene and showed that it consisted of two components (factors A and B) both of which were necessary for optimal DNA binding. The genes for the heteromeric protein NF-Y (NF-YA and NF-YB), which binds to the I-E alpha Y box have been cloned. We subsequently isolated the genes for NF-YA and NF-YB using oligonucleotides designed from the published sequences. NF-YA and NF-YB were tested for binding to the I-A beta and I-E alpha Y boxes. While neither NF-YA or NF-YB alone bound to the Y box, when the components were mixed the complex bound to the I-A beta Y box with high affinity. Moreover, NF-YA and NF-YB could be complemented for binding to DNA by factor B or factor A, respectively. These results suggest that the active binding protein is NF-YA in factor A extracts and NF-YB in factor B extracts. Finally, antibodies against NF-YA and NF-YB were shown to induce a supershift when nuclear extracts were added to the double-stranded oligodeoxynucleotide covering the Y box of the I-A beta gene. Antisense expression constructs of both NF-YA and NF-YB were made and their effect on expression from the I-A beta promoter was tested. Either antisense construction, when transfected into cells, lowered the expression of a reporter gene linked to the I-A beta promoter. This study provides direct evidence of the identification of NF-YA and NF-YB as the previously described factors A and B. Moreover, these results strongly implicate NF-Y in the expression of the MHC class II gene I-A beta. PMID:8760361

  6. Identification of a transcription factor that binds to the S box of the I-A beta gene of the major histocompatibility complex.

    PubMed Central

    Celada, A; Gil, P; McKercher, S R; Maki, R A

    1996-01-01

    Class II genes of the MHC show a striking homology upstream of the transcription start site that is composed of three conserved sequences (S, X and Y boxes, each separated by 15-20 bp). The presence of the S-box sequence in the mouse MHC class II gene I-A Beta was examined for its influence on the expression of this gene. Deletion or mutation of the S box decreased the induction of chloramphenicol acetyltransferase (CAT) activity in B lymphocytes by 32%. In macrophages, deletion or mutation of the S box abolished interferon-gamma (IFN-gamma) inducibility of CAT activity. Using a gel-retardation assay, we have identified a nuclear factor whose binding site overlaps the 7-mer conserved sequence of the S box. This factor is present in lymphocytes, macrophages, mastocytes and fibroblasts. Surprisingly, binding of this nuclear factor to DNA was induced by IFN-gamma in bone-marrow-derived macrophages, but not in macrophage-like cell lines. The binding site for this factor was defined by DNase I footprinting and partially purified by using an affinity column containing double-stranded oligonucleotides containing a sequence of the S box. A prominent protein of 43 kDa was found that bound specifically to the S-box sequence. PMID:8611149

  7. FUNCTIONAL IMPLICATION OF MAJOR HISTOCOMPATIBILITY (MH) VARIATION USING AN ESTUARINE FISH POPULATION

    EPA Science Inventory

    Recently, there has been a dramatic expansion of studies of major histocompatibility complex (MHC) variation aimed at discovering functional differences in immunity across wild populations of diverse vertebrate species. Some species with relatively low genetic diversity or under ...

  8. Domain structures and molecular evolution of class I and class II major histocompatibility gene complex (MHC) products deduced from amino acid and nucleotide sequence homologies

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Domain structures of class I and class II MHC products were analyzed from a viewpoint of amino acid and nucleotide sequence homologies. Alignment statistics revealed that class I (transplantation) antigen H chains consist of four mutually homologous domains, and that class II (HLA-DR) antigen β and α chains are both composed of three mutually homologous ones. The N-terminal three and two domains of class I and class II (both β and α) gene products, respectively, all of which being ˜90 residues long, were concluded to be homologous to β2-microglobulin (β2M). The membraneembedded C-terminal shorter domains of these MHC products were also found to be homologous to one another and to the third domain of class I H chains. Class I H chains were found to be more closely related to class II α chains than to class II β chains. Based on these findings, an exon duplication history from a common ancestral gene encoding a β2M-like primodial protein of one-domain-length up to the contemporary MHC products was proposed.

  9. Lysis of pig endothelium by IL-2 activated human natural killer cells is inhibited by swine and human major histocompatibility complex (MHC) class I gene products.

    PubMed

    Itescu, S; Artrip, J H; Kwiatkowski, P A; Wang, S F; Minanov, O P; Morgenthau, A S; Michler, R E

    1997-01-01

    /ml, where an 8-fold reduction in IL-2 augmented NK lysis was observed (p < 0.01). These results suggest that IL-2 activated human NK lysis of porcine xenografts may be inhibited by strategies which increase PAEC expression of SLA class I molecules, introduce HLA class I genes into PAEC, or use soluble HLA class I peptides. PMID:9869836

  10. A recombinant, soluble, single-chain class I major histocompatibility complex molecule with biological activity.

    PubMed Central

    Mage, M G; Lee, L; Ribaudo, R K; Corr, M; Kozlowski, S; McHugh, L; Margulies, D H

    1992-01-01

    Heterodimeric class I major histocompatibility complex molecules, which consist of a 45-kDa heavy-chain and a 12-kDa beta 2-microglobulin (beta 2m) light chain, bind endogenously synthesized peptides for presentation to antigen-specific T cells. We have synthesized a gene encoding a single-chain, soluble class I molecule derived from mouse H-2Dd, in which the carboxyl terminus of beta 2m is linked via a peptide spacer to the amino terminus of the heavy chain. The chimeric protein is secreted efficiently from transfected L cells, is thermostable, and when loaded with an appropriate antigenic peptide, stimulates an H-2Dd-restricted antigen-specific T-cell hybridoma. Thus, functional binding of peptide does not require the complete dissociation of beta 2m, implying that a heavy chain/peptide complex is not an obligate intermediate in the assembly of the heavy-chain/beta 2m/peptide heterotrimer. Single-chain major histocompatibility complex molecules uniformly loaded with peptide have potential uses for structural studies, toxin or fluor conjugates, and vaccines. Images PMID:1438262

  11. Passive Immunotherapy for Retroviral Disease: Influence of Major Histocompatibility Complex Type and T-Cell Responsiveness

    NASA Astrophysics Data System (ADS)

    Hasenkrug, Kim J.; Brooks, Diane M.; Chesebro, Bruce

    1995-11-01

    Administration of virus-specific antibodies is known to be an effective early treatment for some viral infections. Such immunotherapy probably acts by antibody-mediated neutralization of viral infectivity and is often thought to function independently of T-cell-mediated immune responses. In the present experiments, we studied passive antibody therapy using Friend murine leukemia virus complex as a model for an immunosuppressive retroviral disease in adult mice. The results showed that antibody therapy could induce recovery from a well-established retroviral infection. However, the success of therapy was dependent on the presence of both CD4^+ and CD8^+ T lymphocytes. Thus, cell-mediated responses were required for recovery from infection even in the presence of therapeutic levels of antibody. The major histocompatibility type of the mice was also an important factor determining the relative success of antibody therapy in this system, but it was less critical for low-dose than for high-dose infections. Our results imply that limited T-cell responsiveness as dictated by major histocompatibility genes and/or stage of disease may have contributed to previous immunotherapy failures in AIDS patients. Possible strategies to improve the efficacy of future therapies are discussed.

  12. Characterisation of Major Histocompatibility Complex Class I in the Australian Cane Toad, Rhinella marina

    PubMed Central

    Lillie, Mette; Shine, Richard; Belov, Katherine

    2014-01-01

    The Major Histocompatibility Complex (MHC) class I is a highly variable gene family that encodes cell-surface receptors vital for recognition of intracellular pathogens and initiation of immune responses. The MHC class I has yet to be characterised in bufonid toads (Order: Anura; Suborder: Neobatrachia; Family: Bufonidae), a large and diverse family of anurans. Here we describe the characterisation of a classical MHC class I gene in the Australian cane toad, Rhinella marina. From 25 individuals sampled from the Australian population, we found only 3 alleles at this classical class I locus. We also found large number of class I alpha 1 alleles, implying an expansion of class I loci in this species. The low classical class I genetic diversity is likely the result of repeated bottleneck events, which arose as a result of the cane toad's complex history of introductions as a biocontrol agent and its subsequent invasion across Australia. PMID:25093458

  13. Interferon-γ Induces Major Histocompatibility Class II Transactivator (CIITA) That Mediates Collagen Repression and Major Histocompatibility Class II Activation by Human Aortic Smooth Muscle Cells

    PubMed Central

    Butticè, Giovanna; Miller, Janice; Wang, Lin; Smith, Barbara D.

    2006-01-01

    Chronic inflammation in atherosclerosis is responsible for plaque instability through alterations in extracellular matrix. Previously, we demonstrated that major histocompatibility class II (MHC II) transactivator (CIITA) in a complex with regulatory factor for X box 5 (RFX5) is a crucial protein mediating interferon (IFN)-γ–induced repression of collagen type I gene transcription in fibroblasts. This article demonstrates that, in smooth muscle cells (SMCs), IFN-γ dramatically increases the expression of CIITA isoforms III and IV, with no increase in expression of CIITA isoform I. Expression of CIITA III and IV correlates with decreased collagen type I and increased MHC II gene expression. Exogenous expression of CIITA I, III, and IV, in transiently transfected SMCs, represses collagen type I promoters (COL1A1 and COL1A2) and activates MHC II promoter. Levels of CIITA and RFX5 increase in the nucleus of cells treated with IFN-γ. Moreover, simvastatin lowers the IFN-γ–induced expression of RFX5 and MHC II in addition to repressing collagen expression. However, simvastatin does not block the IFN-γ–induced expression of CIITA III and IV, suggesting a CIITA-independent mechanism. This first demonstration that RFX5 and CIITA isoforms are expressed in SMCs after IFN-γ stimulation suggest that CIITA could be a key factor in plaque stability in atherosclerosis. PMID:16439692

  14. The tammar wallaby major histocompatibility complex shows evidence of past genomic instability

    PubMed Central

    2011-01-01

    Background The major histocompatibility complex (MHC) is a group of genes with a variety of roles in the innate and adaptive immune responses. MHC genes form a genetically linked cluster in eutherian mammals, an organization that is thought to confer functional and evolutionary advantages to the immune system. The tammar wallaby (Macropus eugenii), an Australian marsupial, provides a unique model for understanding MHC gene evolution, as many of its antigen presenting genes are not linked to the MHC, but are scattered around the genome. Results Here we describe the 'core' tammar wallaby MHC region on chromosome 2q by ordering and sequencing 33 BAC clones, covering over 4.5 MB and containing 129 genes. When compared to the MHC region of the South American opossum, eutherian mammals and non-mammals, the wallaby MHC has a novel gene organization. The wallaby has undergone an expansion of MHC class II genes, which are separated into two clusters by the class III genes. The antigen processing genes have undergone duplication, resulting in two copies of TAP1 and three copies of TAP2. Notably, Kangaroo Endogenous Retroviral Elements are present within the region and may have contributed to the genomic instability. Conclusions The wallaby MHC has been extensively remodeled since the American and Australian marsupials last shared a common ancestor. The instability is characterized by the movement of antigen presenting genes away from the core MHC, most likely via the presence and activity of retroviral elements. We propose that the movement of class II genes away from the ancestral class II region has allowed this gene family to expand and diversify in the wallaby. The duplication of TAP genes in the wallaby MHC makes this species a unique model organism for studying the relationship between MHC gene organization and function. PMID:21854592

  15. Evolutionary relationship between human major histocompatibility complex HLA-DR haplotypes

    SciTech Connect

    Svensson, A.C.; Setterblad, N.; Pihlgren, U.; Rask, L.; Andersson, G.

    1996-09-01

    HLA-DR haplotypes of the human major histocompatibility complex are organized in five different groups. They can be identified based on the serological specificity expressed by the polymorphic DRB1 locus and by the presence of a characteristic set of DRB genes. The nucleotide sequences of introns 4 and 5 of the two DRB genes (DRB1*01 and DRB6*01) from a DR1 haplotype and the three DRB genes (DRB1*15, DRB6*15, and DRB5*15), from a DR51 haplotype were determined. This study identified endogenous retroviral long terminal repeat elements (ERV9 LTR) located at identical positions in intron 5 of the DRB1 genes in both the DR1 and DR51 haplotypes. Phylogenetic analyses revealed a close evolutionary relationship between these two haplotypes. The DRB5 gene, unique for the DR51 haplotype, may have been lost by a recent gene deletion event creating the DR1 haplotype. A model for the evolution of the human DR haplotypes involving separate duplication and contraction events is presented. 55 refs., 5 figs., 2 tabs.

  16. Sequences, Annotation and Single Nucleotide Polymorphism of the Major Histocompatibility Complex in the Domestic Cat

    PubMed Central

    Yuhki, Naoya; Mullikin, James C.; Beck, Thomas; Stephens, Robert; O'Brien, Stephen J.

    2008-01-01

    Two sequences of major histocompatibility complex (MHC) regions in the domestic cat, 2.976 and 0.362 Mbps, which were separated by an ancient chromosome break (55–80 MYA) and followed by a chromosomal inversion were annotated in detail. Gene annotation of this MHC was completed and identified 183 possible coding regions, 147 human homologues, possible functional genes and 36 pseudo/unidentified genes) by GENSCAN and BLASTN, BLASTP RepeatMasker programs. The first region spans 2.976 Mbp sequence, which encodes six classical class II antigens (three DRA and three DRB antigens) lacking the functional DP, DQ regions, nine antigen processing molecules (DOA/DOB, DMA/DMB, TAPASIN, and LMP2/LMP7,TAP1/TAP2), 52 class III genes, nineteen class I genes/gene fragments (FLAI-A to FLAI-S). Three class I genes (FLAI-H, I-K, I-E) may encode functional classical class I antigens based on deduced amino acid sequence and promoter structure. The second region spans 0.362 Mbp sequence encoding no class I genes and 18 cross-species conserved genes, excluding class I, II and their functionally related/associated genes, namely framework genes, including three olfactory receptor genes. One previously identified feline endogenous retrovirus, a baboon retrovirus derived sequence (ECE1) and two new endogenous retrovirus sequences, similar to brown bat endogenous retrovirus (FERVmlu1, FERVmlu2) were found within a 140 Kbp interval in the middle of class I region. MHC SNPs were examined based on comparisons of this BAC sequence and MHC homozygous 1.9× WGS sequences and found that 11,654 SNPs in 2.84 Mbp (0.00411 SNP per bp), which is 2.4 times higher rate than average heterozygous region in the WGS (0.0017 SNP per bp genome), and slightly higher than the SNP rate observed in human MHC (0.00337 SNP per bp). PMID:18629345

  17. IMGT/HLA Database—a sequence database for the human major histocompatibility complex

    PubMed Central

    Robinson, James; Waller, Matthew J.; Parham, Peter; Bodmer, Julia G.; Marsh, Steven G. E.

    2001-01-01

    The IMGT/HLA Database (www.ebi.ac.uk/imgt/hla/) specialises in sequences of polymorphic genes of the HLA system, the human major histocompatibility complex (MHC). The HLA complex is located within the 6p21.3 region on the short arm of human chromosome 6 and contains more than 220 genes of diverse function. Many of the genes encode proteins of the immune system and these include the 21 highly polymorphic HLA genes, which influence the outcome of clinical transplantation and confer susceptibility to a wide range of non-infectious diseases. The database contains sequences for all HLA alleles officially recognised by the WHO Nomenclature Committee for Factors of the HLA System and provides users with online tools and facilities for their retrieval and analysis. These include allele reports, alignment tools and detailed descriptions of the source cells. The online IMGT/HLA submission tool allows both new and confirmatory sequences to be submitted directly to the WHO Nomenclature Committee. The latest version (release 1.7.0 July 2000) contains 1220 HLA alleles derived from over 2700 component sequences from the EMBL/GenBank/DDBJ databases. The HLA database provides a model which will be extended to provide specialist databases for polymorphic MHC genes of other species. PMID:11125094

  18. IMGT/HLA Database--a sequence database for the human major histocompatibility complex.

    PubMed

    Robinson, J; Waller, M J; Parham, P; Bodmer, J G; Marsh, S G

    2001-01-01

    The IMGT/HLA Database (www.ebi.ac.uk/imgt/hla/) specialises in sequences of polymorphic genes of the HLA system, the human major histocompatibility complex (MHC). The HLA complex is located within the 6p21.3 region on the short arm of human chromosome 6 and contains more than 220 genes of diverse function. Many of the genes encode proteins of the immune system and these include the 21 highly polymorphic HLA genes, which influence the outcome of clinical transplantation and confer susceptibility to a wide range of non-infectious diseases. The database contains sequences for all HLA alleles officially recognised by the WHO Nomenclature Committee for Factors of the HLA System and provides users with online tools and facilities for their retrieval and analysis. These include allele reports, alignment tools and detailed descriptions of the source cells. The online IMGT/HLA submission tool allows both new and confirmatory sequences to be submitted directly to the WHO Nomenclature Committee. The latest version (release 1.7.0 July 2000) contains 1220 HLA alleles derived from over 2700 component sequences from the EMBL/GenBank/DDBJ databases. The HLA database provides a model which will be extended to provide specialist databases for polymorphic MHC genes of other species. PMID:11125094

  19. Zygosity at the major histocompatibility class IIB locus predicts susceptibility to Renibacterium salmoninarum in Atlantic salmon (Salmo salar L.).

    PubMed

    Turner, S M; Faisal, M; DeWoody, J A

    2007-10-01

    Major histocompatibility (MH) class II genes play an important role in the vertebrate immune response. Here, we investigate the relationship between Atlantic salmon (Salmo salar) MH class IIB zygosity and susceptibility to Renibacterium salmoninarum, the causal agent of bacterial kidney disease. By combining DNA sequences from the salmon MH class IIB gene with quantitative ELISA data on R. salmoninarum antigen levels, we found that MH class IIB homozygotes were significantly more susceptible to R. salmoninarum than heterozygotes. These findings are discussed in the context of current evolutionary theory. PMID:17627802

  20. DNA variation of the mammalian major histocompatibility complex reflects genomic diversity and population history.

    PubMed Central

    Yuhki, N; O'Brien, S J

    1990-01-01

    The major histocompatibility complex (MHC) is a multigene complex of tightly linked homologous genes that encode cell surface antigens that play a key role in immune regulation and response to foreign antigens. In most species, MHC gene products display extreme antigenic polymorphism, and their variability has been interpreted to reflect an adaptive strategy for accommodating rapidly evolving infectious agents that periodically afflict natural populations. Determination of the extent of MHC variation has been limited to populations in which skin grafting is feasible or for which serological reagents have been developed. We present here a quantitative analysis of restriction fragment length polymorphism of MHC class I genes in several mammalian species (cats, rodents, humans) known to have very different levels of genetic diversity based on functional MHC assays and on allozyme surveys. When homologous class I probes were employed, a notable concordance was observed between the extent of MHC restriction fragment variation and functional MHC variation detected by skin grafts or genome-wide diversity estimated by allozyme screens. These results confirm the genetically depauperate character of the African cheetah, Acinonyx jubatus, and the Asiatic lion, Panthera leo persica; further, they support the use of class I MHC molecular reagents in estimating the extent and character of genetic diversity in natural populations. Images PMID:1967831

  1. Major histocompatibility complex loci are associated with susceptibility of Atlantic salmon to infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Miller, Kristina M.; Winton, James R.; Schulze, Angela D.; Purcell, Maureen K.; Ming, Tobi J.

    2004-01-01

    Infectious hematopoietic necrosis virus (IHNV) is one of the most significant viral pathogens of salmonids and is a leading cause of death among cultured juvenile fish. Although several vaccine strategies have been developed, some of which are highly protective, the delivery systems are still too costly for general use by the aquaculture industry. More cost effective methods could come from the identification of genes associated with IHNV resistance for use in selective breeding. Further, identification of susceptibility genes may lead to an improved understanding of viral pathogenesis and may therefore aid in the development of preventive and therapeutic measures. Genes of the major histocompatibility complex (MHC), involved in the primary recognition of foreign pathogens in the acquired immune response, are associated with resistance to a variety of diseases in vertebrate organisms. We conducted a preliminary analysis of MHC disease association in which an aquaculture strain of Atlantic salmon was challenged with IHNV at three different doses and individual fish were genotyped at three MHC loci using denaturing gradient gel electrophoresis (PCR-DGGE), followed by sequencing of all differentiated alleles. Nine to fourteen alleles per exon-locus were resolved, and alleles potentially associated with resistance or susceptibility were identified. One allele (Sasa-B-04) from a potentially non-classical class I locus was highly associated with resistance to infectious hematopoietic necrosis (p < 0.01). This information can be used to design crosses of specific haplotypes for family analysis of disease associations.

  2. DNA variation of the mammalian major histocompatibility complex reflects genomic diversity and population history

    SciTech Connect

    Yuhki, Naoya; O'Brien, S.J. )

    1990-01-01

    The major histocompatibility complex (MHC) is a multigene complex of tightly linked homologous genes that encode cell surface antigens that play a key role in immune regulation and response to foreign antigens. In most species, MHC gene products display extreme antigenic polymorphism, and their variability has been interpreted to reflect an adaptive strategy for accommodating rapidly evolving infectious agents that periodically afflict natural populations. Determination of the extent of MHC variation has been limited to populations in which skin grafting is feasible or for which serological reagents have been developed. The authors present here a quantitative analysis of restriction fragment length polymorphism of MHC class I genes in several mammalian species (cats, rodents, humans) known to have very different levels of genetic diversity based on functional MHC assays and on allozyme surveys. When homologous class I probes were employed, a notable concordance was observed between the extent of MHC restriction fragment variation and functional MHC variation detected by skin grafts or genome-wide diversity estimated by allozyme screens. These results confirm the genetically depauperate character of the African cheetah, Acinonyx jubatus, and the Asiatic lion, Panthera leo persica; further, they support the use of class I MHC molecular reagents in estimating the extent and character of genetic diversity in natural populations.

  3. Porcine major histocompatibility complex (MHC) class I molecules and analysis of their peptide-binding specificities

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In all vertebrate animals, CD8+ cytotoxic T lymphocytes (CTLs) are controlled by major histocompatibility complex class I (MHC-I) molecules, which are highly polymorphic peptide receptors selecting and presenting endogenously derived epitopes to circulating cytotoxic lymphocytes (CTLs). The polymorp...

  4. Sequence-based evidence for major histocompatibility complex-disassortative mating in a colonial seabird

    PubMed Central

    Juola, Frans A.; Dearborn, Donald C.

    2012-01-01

    The major histocompatibility complex (MHC) is a polymorphic gene family associated with immune defence, and it can play a role in mate choice. Under the genetic compatibility hypothesis, females choose mates that differ genetically from their own MHC genotypes, avoiding inbreeding and/or enhancing the immunocompetence of their offspring. We tested this hypothesis of disassortative mating based on MHC genotypes in a population of great frigatebirds (Fregata minor) by sequencing the second exon of MHC class II B. Extensive haploid cloning yielded two to four alleles per individual, suggesting the amplification of two genes. MHC similarity between mates was not significantly different between pairs that did (n = 4) or did not (n = 42) exhibit extra-pair paternity. Comparing all 46 mated pairs to a distribution based on randomized re-pairings, we observed the following (i): no evidence for mate choice based on maximal or intermediate levels of MHC allele sharing (ii), significantly disassortative mating based on similarity of MHC amino acid sequences, and (iii) no evidence for mate choice based on microsatellite alleles, as measured by either allele sharing or similarity in allele size. This suggests that females choose mates that differ genetically from themselves at MHC loci, but not as an inbreeding-avoidance mechanism. PMID:21613297

  5. Comparative genome organization of the major histocompatibility complex: lessons from the Felidae.

    PubMed

    O'Brien, S J; Yuhki, N

    1999-02-01

    The mammalian major histocompatibility complex (MHC) has taught both immunologists and evolutionary biologists a great deal about the patterns and processes that have led to immune defenses. Driven principally by human and mouse studies, comparative MHC projects among other mammalian species offer certain advantages in connecting MHC genome characters to natural situations. We have studied the MHC in the domestic cat and in several wild species of Felidae. Our observations affirm class I and class II homology with other mammalian orders, derivative gene duplications during the Felidae radiation, abundant persistent trans-species allele polymorphism, recombination-derived amino acid motifs, and inverted ratios of non-synonymous to silent substitutions in the MHC peptide-binding regions, consistent with overdominant selection in class I and II genes. MHC diversity as quantified in population studies is a powerful barometer of historic demographic reduction for several endangered species including cheetahs, Asiatic lions, Florida panthers and tigers. In two cases (Florida panther and cheetah), reduced MHC variation may be contributing to uniform population sensitivity to emerging infectious pathogens. The Felidae species, nearly all endangered and monitored for conservation concerns, have allowed a glimpse of species adaptation, mediated by MHC divergence, using comparative inferences drawn from human and mouse models. PMID:10319256

  6. Induction of embryonic major histocompatibility complex antigen expression by gamma-IFN.

    PubMed

    Warner, C M; Almquist, C D; Toulimat, M H; Xu, Y

    1993-07-01

    Preimplantation mouse embryos were incubated in vitro with mouse recombinant gamma-interferon (IFN). The effect of the gamma-IFN on major histocompatibility complex (MHC) class I antigen expression was tested using an ELISA procedure. It was found that there is a doubling of Db antigens and a tripling of Qa-2 antigens on C57BL/6 mouse embryos cultured from the 8-cell stage for 24 h in the presence of 10(5) units/ml gamma-IFN. The effect of gamma-IFN on the rate of preimplantation embryonic development was tested by culturing 2-cell embryos for 48 h and 8-cell embryos for 24 h in the presence of varying concentrations of gamma-IFN up to 10(6) units/ml. Two methods were used to assess the cell number per embryo after the culture period: incorporation of [3H]thymidine into DNA, and direct counting of nuclei in fixed and stained embryos. Both methods showed that treatment with gamma-IFN increases the rate of development of preimplantation mouse embryos. Since rate of preimplantation embryonic development is genetically controlled by the Ped gene, it is suggested that gamma-IFN has a direct effect on the Ped gene phenotype of preimplantation mouse embryos. PMID:8229991

  7. Engineering an intracellular pathway for major histocompatibility complex class II presentation of antigens.

    PubMed Central

    Wu, T C; Guarnieri, F G; Staveley-O'Carroll, K F; Viscidi, R P; Levitsky, H I; Hedrick, L; Cho, K R; August, J T; Pardoll, D M

    1995-01-01

    The presentation of antigenic peptides by major histocompatibility complex (MHC) class II molecules to CD4+ T cells is critical to the function of the immune system. In this study, we have utilized the sorting signal of the lysosomal-associated membrane protein LAMP-1 to target a model antigen, human papillomavirus 16 E7 (HPV-16 E7), into the endosomal and lysosomal compartments. The LAMP-1 sorting signal reroutes the antigen into the MHC class II processing pathway, resulting in enhanced presentation to CD4+ cells in vitro. In vivo immunization experiments in mice demonstrated that vaccinia containing the chimeric E7/LAMP-1 gene generated greater E7-specific lymphoproliferative activity, antibody titers, and cytotoxic T-lymphocyte activities than vaccinia containing the wild-type HPV-16 E7 gene. These results suggest that specific targeting of an antigen to the endosomal and lysosomal compartments enhances MHC class II presentation and vaccine potency. Images Fig. 2 Fig. 3 PMID:8524826

  8. Sexual selection and the evolutionary dynamics of the major histocompatibility complex

    PubMed Central

    Jan Ejsmond, Maciej; Radwan, Jacek; Wilson, Anthony B.

    2014-01-01

    The genes of the major histocompatibility complex (MHC) are a key component of the adaptive immune system and among the most variable loci in the vertebrate genome. Pathogen-mediated natural selection and MHC-based disassortative mating are both thought to structure MHC polymorphism, but their effects have proven difficult to discriminate in natural systems. Using the first model of MHC dynamics incorporating both survival and reproduction, we demonstrate that natural and sexual selection produce distinctive signatures of MHC allelic diversity with critical implications for understanding host–pathogen dynamics. While natural selection produces the Red Queen dynamics characteristic of host–parasite interactions, disassortative mating stabilizes allele frequencies, damping major fluctuations in dominant alleles and protecting functional variants against drift. This subtle difference generates a complex interaction between MHC allelic diversity and population size. In small populations, the stabilizing effects of sexual selection moderate the effects of drift, whereas pathogen-mediated selection accelerates the loss of functionally important genetic diversity. Natural selection enhances MHC allelic variation in larger populations, with the highest levels of diversity generated by the combined action of pathogen-mediated selection and disassortative mating. MHC-based sexual selection may help to explain how functionally important genetic variation can be maintained in populations of conservation concern. PMID:25339723

  9. Major histocompatibility complex variation and mate choice in a lekking bird, the great snipe (Gallinago media).

    PubMed

    Ekblom, R; Saether, S A; Grahn, M; Fiske, P; Kålås, J A; Höglund, J

    2004-12-01

    Genes of the major histocompatibility complex (MHC) play a major part in the activation of the vertebrate immune system. In addition, they also appear to function as cues for mate choice. In mammals especially, several kinds of MHC-dependent mate choice have been hypothesized and observed. These include choice of mates that share no or few alleles with the choosing individual, choice of mates with alleles that differ as much as possible from the choosing individual, choice of heterozygous mates, choice of certain genotypes and choice of rare alleles. We investigated these different aspects of mate choice in relation to MHC in a lekking bird species, the great snipe (Gallinago media). We found no evidence for MHC disassortative mating, no preference for males with many MHC alleles and no preference for rare alleles. However, we did find that some allelic lineages were more often found in males with mating success than in males without mating success. Females do not seem to use themselves as references for the MHC-dependent mate choice, rather they seem to prefer males with certain allele types. We speculate that these alleles may be linked to resistance to common parasites. PMID:15548294

  10. Reconsidering the association between the major histocompatibility complex and bipolar disorder.

    PubMed

    Figueiredo, Thalita Cristina; de Oliveira, João Ricardo Mendes

    2012-05-01

    Bipolar disorder (BD) is a cyclical and chronic affective disorder, globally recognized as an important public health problem and characterized by mood changes with recurring phases such as mania and depression. It is considered a complex disease, depending on the interaction of genetic and environmental triggers (stressors factors), but with a poorly known pathogenesis. Recent studies have implicated immune factors in the pathogenesis of BD and more particularly associated with different human major histocompatibility complex (MHC) regions. A major consortium study have recently linked BD to hundreds of variations with stronger associations in the MHC region, such as the rs3130297 SNP, located in the NOTCH4 gene, with an additional overlapping association with schizophrenia. This short review focuses on studies that investigated the association between bipolar disorder and the MHC, and the involvement of the immune system in the pathogenesis of the disease, in order to provide further information for additional diagnostic and therapeutic strategies. Fully understanding the etiology and pathophysiology of BD is extremely important to define new approaches for intervention and prevention, maybe through the modulation of the immune system. PMID:21987052

  11. Pervasive haplotypic variation in the spliceo-transcriptome of the human major histocompatibility complex.

    PubMed

    Vandiedonck, Claire; Taylor, Martin S; Lockstone, Helen E; Plant, Katharine; Taylor, Jennifer M; Durrant, Caroline; Broxholme, John; Fairfax, Benjamin P; Knight, Julian C

    2011-07-01

    The human major histocompatibility complex (MHC) on chromosome 6p21 is a paradigm for genomics, showing remarkable polymorphism and striking association with immune and non-immune diseases. The complex genomic landscape of the MHC, notably strong linkage disequilibrium, has made resolving causal variants very challenging. A promising approach is to investigate gene expression levels considered as tractable intermediate phenotypes in mapping complex diseases. However, how transcription varies across the MHC, notably relative to specific haplotypes, remains unknown. Here, using an original hybrid tiling and splice junction microarray that includes alternate allele probes, we draw the first high-resolution strand-specific transcription map for three common MHC haplotypes (HLA-A1-B8-Cw7-DR3, HLA-A3-B7-Cw7-DR15, and HLA-A26-B18-Cw5-DR3-DQ2) strongly associated with autoimmune diseases including type 1 diabetes, systemic lupus erythematosus, and multiple sclerosis. We find that haplotype-specific differences in gene expression are common across the MHC, affecting 96 genes (46.4%), most significantly the zing finger protein gene ZFP57. Differentially expressed probes are correlated with polymorphisms between haplotypes, consistent with cis effects that we directly demonstrate for ZFP57 in a cohort of healthy volunteers (P = 1.2 × 10(-14)). We establish that alternative splicing is significantly more frequent in the MHC than genome-wide (72.5% vs. 62.1% of genes, P ≤ 1 × 10(-4)) and shows marked haplotypic differences. We also unmask novel and abundant intergenic transcription involving 31% of transcribed blocks identified. Our study reveals that the renowned MHC polymorphism also manifests as transcript diversity, and our novel haplotype-based approach marks a new step toward identification of regulatory variants involved in the control of MHC-associated phenotypes and diseases. PMID:21628452

  12. Fine Mapping Major Histocompatibility Complex Associations in Psoriasis and Its Clinical Subtypes

    PubMed Central

    Okada, Yukinori; Han, Buhm; Tsoi, Lam C.; Stuart, Philip E.; Ellinghaus, Eva; Tejasvi, Trilokraj; Chandran, Vinod; Pellett, Fawnda; Pollock, Remy; Bowcock, Anne M.; Krueger, Gerald G.; Weichenthal, Michael; Voorhees, John J.; Rahman, Proton; Gregersen, Peter K.; Franke, Andre; Nair, Rajan P.; Abecasis, Gonçalo R.; Gladman, Dafna D.; Elder, James T.; de Bakker, Paul I.W.; Raychaudhuri, Soumya

    2014-01-01

    Psoriasis vulgaris (PsV) risk is strongly associated with variation within the major histocompatibility complex (MHC) region, but its genetic architecture has yet to be fully elucidated. Here, we conducted a large-scale fine-mapping study of PsV risk in the MHC region in 9,247 PsV-affected individuals and 13,589 controls of European descent by imputing class I and II human leukocyte antigen (HLA) genes from SNP genotype data. In addition, we imputed sequence variants for MICA, an MHC HLA-like gene that has been associated with PsV, to evaluate association at that locus as well. We observed that HLA-C∗06:02 demonstrated the lowest p value for overall PsV risk (p = 1.7 × 10−364). Stepwise analysis revealed multiple HLA-C∗06:02-independent risk variants in both class I and class II HLA genes for PsV susceptibility (HLA-C∗12:03, HLA-B amino acid positions 67 and 9, HLA-A amino acid position 95, and HLA-DQα1 amino acid position 53; p < 5.0 × 10−8), but no apparent risk conferred by MICA. We further evaluated risk of two major clinical subtypes of PsV, psoriatic arthritis (PsA; n = 3,038) and cutaneous psoriasis (PsC; n = 3,098). We found that risk heterogeneity between PsA and PsC might be driven by HLA-B amino acid position 45 (pomnibus = 2.2 × 10−11), indicating that different genetic factors underlie the overall risk of PsV and the risk of specific PsV subphenotypes. Our study illustrates the value of high-resolution HLA and MICA imputation for fine mapping causal variants in the MHC. PMID:25087609

  13. Fine mapping major histocompatibility complex associations in psoriasis and its clinical subtypes.

    PubMed

    Okada, Yukinori; Han, Buhm; Tsoi, Lam C; Stuart, Philip E; Ellinghaus, Eva; Tejasvi, Trilokraj; Chandran, Vinod; Pellett, Fawnda; Pollock, Remy; Bowcock, Anne M; Krueger, Gerald G; Weichenthal, Michael; Voorhees, John J; Rahman, Proton; Gregersen, Peter K; Franke, Andre; Nair, Rajan P; Abecasis, Gonçalo R; Gladman, Dafna D; Elder, James T; de Bakker, Paul I W; Raychaudhuri, Soumya

    2014-08-01

    Psoriasis vulgaris (PsV) risk is strongly associated with variation within the major histocompatibility complex (MHC) region, but its genetic architecture has yet to be fully elucidated. Here, we conducted a large-scale fine-mapping study of PsV risk in the MHC region in 9,247 PsV-affected individuals and 13,589 controls of European descent by imputing class I and II human leukocyte antigen (HLA) genes from SNP genotype data. In addition, we imputed sequence variants for MICA, an MHC HLA-like gene that has been associated with PsV, to evaluate association at that locus as well. We observed that HLA-C(∗)06:02 demonstrated the lowest p value for overall PsV risk (p = 1.7 × 10(-364)). Stepwise analysis revealed multiple HLA-C(∗)06:02-independent risk variants in both class I and class II HLA genes for PsV susceptibility (HLA-C(∗)12:03, HLA-B amino acid positions 67 and 9, HLA-A amino acid position 95, and HLA-DQα1 amino acid position 53; p < 5.0 × 10(-8)), but no apparent risk conferred by MICA. We further evaluated risk of two major clinical subtypes of PsV, psoriatic arthritis (PsA; n = 3,038) and cutaneous psoriasis (PsC; n = 3,098). We found that risk heterogeneity between PsA and PsC might be driven by HLA-B amino acid position 45 (Pomnibus = 2.2 × 10(-11)), indicating that different genetic factors underlie the overall risk of PsV and the risk of specific PsV subphenotypes. Our study illustrates the value of high-resolution HLA and MICA imputation for fine mapping causal variants in the MHC. PMID:25087609

  14. Diversity at the major histocompatibility complex Class II in the platypus, Ornithorhynchus anatinus.

    PubMed

    Lillie, Mette; Woodward, Rachael E; Sanderson, Claire E; Eldridge, Mark D B; Belov, Katherine

    2012-07-01

    The platypus (Ornithorhynchus anatinus) is the sole survivor of a previously widely distributed and diverse lineage of ornithorhynchid monotremes. Its dependence on healthy water systems imposes an inherent sensitivity to habitat degradation and climate change. Here, we compare genetic diversity at the major histocompatibility complex (MHC) Class II-DZB gene and 3 MHC-associated microsatellite markers with diversity at 6 neutral microsatellite markers in 70 platypuses from across their range, including the mainland of Australia and the isolated populations of Tasmania, King Island, and Kangaroo Island. Overall, high DZB diversity was observed in the platypus, with 57 DZB β1 alleles characterized. Significant positive selection was detected within the DZB peptide-binding region, promoting variation in this domain. Low levels of genetic diversity were detected at all markers in the 2 island populations, King Island (endemic) and Kangaroo Island (introduced), with the King Island platypuses monomorphic at the DZB locus. Loss of MHC diversity on King Island is of concern, as the population may have compromised immunological fitness and reduced ability to resist changing environmental conditions. PMID:22563128

  15. Measuring complexity, nonextensivity and chaos in the DNA sequence of the Major Histocompatibility Complex

    NASA Astrophysics Data System (ADS)

    Pavlos, G. P.; Karakatsanis, L. P.; Iliopoulos, A. C.; Pavlos, E. G.; Xenakis, M. N.; Clark, Peter; Duke, Jamie; Monos, D. S.

    2015-11-01

    We analyze 4 Mb sequences of the Major Histocompatibility Complex (MHC), which is a DNA segment on chromosome 6 with high gene density, controlling many immunological functions and associated with many diseases. The analysis is based on modern theoretical and mathematical tools of complexity theory, such as nonlinear time series analysis and Tsallis non-extensive statistics. The results revealed that the DNA complexity and self-organization can be related to fractional dynamical nonlinear processes with low-dimensional deterministic chaotic and non-extensive statistical character, which generate the DNA sequences under the extremization of Tsallis q-entropy principle. While it still remains an open question as to whether the DNA walk is a fractional Brownian motion (FBM), a static anomalous diffusion process or a non-Gaussian dynamical fractional anomalous diffusion process, the results of this study testify for the latter, providing also a possible explanation for the previously observed long-range power law correlations of nucleotides, as well as the long-range correlation properties of coding and non-coding sequences present in DNA sequences.

  16. Individual odor recognition in procellariiform chicks: potential role for the major histocompatibility complex.

    PubMed

    O'Dwyer, Terence W; Nevitt, Gabrielle A

    2009-07-01

    Since the groundbreaking work of Wenzel, Bang, and Grubb in the 1960s, enormous progress has been made toward elucidating the sense of smell in procellariiform seabirds. Although it is now well established that adult procellariiforms use olfaction in many behaviors, such as for foraging, nest relocation, and mate recognition, the olfactory abilities of petrel chicks are less well understood. Recent studies have shown that petrel chicks can recognize prey-related odors and odors associated with their nest before leaving their burrow for the first time. The recognition of burrow odors by petrel chicks is unlikely to be used for homing, and we have suggested that chicks may be learning personal odors associated with the nest's occupants for use later in life in the context of kin recognition or mate choice. The source of personal odors in petrels is unknown. However, in other vertebrates, the major histocompatibility complex influences body odors, which in turn influence mating preferences. It is not currently known whether this highly polymorphic gene region influences body odors and individual recognition in the procellariiforms, but this could be a fruitful area of future research. PMID:19686174

  17. Genetic variation of major histocompatibility complex (MHC) in wild Red Junglefowl (Gallus gallus).

    PubMed

    Nguyen-Phuc, Hoa; Fulton, Janet E; Berres, Mark E

    2016-02-01

    The major histocompatibility complex (MHC) is a multi-family gene cluster that encodes proteins with immuno-responsive function. While studies of MHC in domesticated poultry are relatively common, very little is known about this highly polymorphic locus in wild Red Junglefowl (Gallus gallus), the natural progenitor of domestic chickens. We investigated the diversity of MHC within and among four wild Red Junglefowl populations across diversified natural habitats in South Central Vietnam. Based on a SNP panel of 84 sites spanning 210 Kb of the MHC-B locus, we identified 310 unique haplotypes in 398 chromosomes. None of these haplotypes have been described before and we did not observe any of the wild Red Junglefowl haplotypes in domesticated chickens. Analysis of molecular variance (AMOVA) revealed that 94.51% of observed haplotype variation was accounted for at the within individual level. Little genetic variance was apportioned within and among populations, the latter accounting only for 0.83%. We also found evidence of increased recombination, including numerous hotspots, and limited linkage disequilibrium among the 84 SNP sites. Compared to an average haplotype diversity of 3.55% among seventeen lines of domestic chickens, our results suggest extraordinarily high haplotype diversity remains in wild Red Junglefowl and is consistent with a pattern of balancing selection. Wild Red Junglefowl in Vietnam, therefore, represent a rich resource of natural genomic variation independent from artificial selection. PMID:26839415

  18. Cryptic female choice favours sperm from major histocompatibility complex-dissimilar males.

    PubMed

    Løvlie, Hanne; Gillingham, Mark A F; Worley, Kirsty; Pizzari, Tommaso; Richardson, David S

    2013-10-22

    Cryptic female choice may enable polyandrous females to avoid inbreeding or bias offspring variability at key loci after mating. However, the role of these genetic benefits in cryptic female choice remains poorly understood. Female red junglefowl, Gallus gallus, bias sperm use in favour of unrelated males. Here, we experimentally investigate whether this bias is driven by relatedness per se, or by similarity at the major histocompatibility complex (MHC), genes central to vertebrate acquired immunity, where polymorphism is critical to an individual's ability to combat pathogens. Through experimentally controlled natural matings, we confirm that selection against related males' sperm occurs within the female reproductive tract but demonstrate that this is more accurately predicted by MHC similarity: controlling for relatedness per se, more sperm reached the eggs when partners were MHC--dissimilar. Importantly, this effect appeared largely owing to similarity at a single MHC locus (class I minor). Further, the effect of MHC similarity was lost following artificial insemination, suggesting that male phenotypic cues might be required for females to select sperm differentially. These results indicate that postmating mechanisms that reduce inbreeding may do so as a consequence of more specific strategies of cryptic female choice promoting MHC diversity in offspring. PMID:24004935

  19. Volatile signals of the major histocompatibility complex in male mouse urine.

    PubMed

    Singer, A G; Beauchamp, G K; Yamazaki, K

    1997-03-18

    Variation in the genes of the major histocompatibility complex (MHC) contributes to unique individual odors (odortypes) in mice, as demonstrated by the ability of trained mice in a Y-maze olfactometer to discriminate nearly identical inbred mice that differ genetically only at the MHC (MHC congenic mice), while they cannot distinguish genetically identical inbred mice. Similar distinctions are possible with urine, a substance that is involved in many facets of mouse chemical communication. This paper reports results supporting the hypothesis that the MHC-determined urinary odor is composed of a mixture of volatile carboxylic acids occurring in relative concentrations that are characteristic of the odortype. Y-maze behavioral testing of urine fractions from anion exchange chromatography indicates that volatile acids are necessary and sufficient to convey MHC odortype information. Diethyl ether extracts, which are expected to contain the more volatile, less polar organic acids, were also discriminable in the Y-maze olfactometer. Ether extracts of 12 different urine samples from each of two panels of MHC congenic mice were analyzed by gas chromatography. No compounds unique to urine of either genotype were detected, but compounds did appear to occur in characteristic ratios in most of the samples of each type. Nonparametric statistical analysis of the gas chromatographic data showed that eight of the peaks occurred in significantly different relative concentrations in the congenic samples. One of the peaks was shown to represent phenylacetic acid, which has implications for the mechanism of the MHC specification of odortype. PMID:9122173

  20. Plasticity of empty major histocompatibility complex class I molecules determines peptide-selector function.

    PubMed

    van Hateren, Andy; Bailey, Alistair; Werner, Jörn M; Elliott, Tim

    2015-12-01

    Major histocompatibility complex class I (MHC I) proteins provide protection from intracellular pathogens and cancer via each of a cell's MHC I molecules binding and presenting a peptide to cytotoxic T lymphocytes. MHC I genes are highly polymorphic and can have significant diversity, with polymorphisms predominantly localised in the peptide-binding groove where they can change peptide-binding specificity. However, polymorphic residues may also determine other functional properties, such as how dependent MHC I alleles are on the peptide-loading complex for optimal acquisition of peptide cargo. We describe how differences in the peptide-binding properties of two MHC I alleles correlates with altered conformational flexibility in the peptide-empty state. We hypothesise that plasticity is an intrinsic property encoded by the protein sequence, and that co-ordinated movements of the membrane-proximal and membrane-distal domains collectively determines how dependent MHC I are on the peptide-loading complex for efficient assembly with high affinity peptides. PMID:25818313

  1. Broadly targeted CD8+ T cell responses restricted by major histocompatibility complex E

    DOE PAGESBeta

    Hansen, Scott G.; Wu, Helen L.; Burwits, Benjamin J.; Hughes, Colette M.; Hammond, Katherine B.; Ventura, Abigail B.; Reed, Jason S.; Gilbride, Roxanne M.; Ainslie, Emily; Morrow, David W.; et al

    2016-02-12

    Major histocompatibility complex (MHC)-E is a highly conserved, ubiquitously expressed, nonclassical, MHC-Ib molecule with limited polymorphism primarily involved in regulation of NK cell reactivity via interaction with NKG2/CD94 receptors. We found that vaccination of rhesus macaques with Rh157.5/.4 gene-deleted rhesus Cytomegalovirus (RhCMV) vectors uniquely diverts MHC-E function to presentation of highly diverse peptide epitopes to CD8α/β+ T cells, approximately 4 distinct epitopes per 100 amino acids, in all tested protein antigens. Computational structural analysis revealed that a relatively stable, open binding groove in MHC-E attains broad peptide binding specificity by imposing a similar backbone configuration on bound peptides with fewmore » restrictions based on amino acid side chains. Since MHC-E is up-regulated on cells infected with HIV/SIV and other persistent viruses to evade NK cell activity, MHC-E-restricted CD8+ T cell responses have the potential to exploit pathogen immune evasion adaptations, a capability that might endow these unconventional responses with superior efficacy.« less

  2. Cryptic female choice favours sperm from major histocompatibility complex-dissimilar males

    PubMed Central

    Løvlie, Hanne; Gillingham, Mark A. F.; Worley, Kirsty; Pizzari, Tommaso; Richardson, David S.

    2013-01-01

    Cryptic female choice may enable polyandrous females to avoid inbreeding or bias offspring variability at key loci after mating. However, the role of these genetic benefits in cryptic female choice remains poorly understood. Female red junglefowl, Gallus gallus, bias sperm use in favour of unrelated males. Here, we experimentally investigate whether this bias is driven by relatedness per se, or by similarity at the major histocompatibility complex (MHC), genes central to vertebrate acquired immunity, where polymorphism is critical to an individual's ability to combat pathogens. Through experimentally controlled natural matings, we confirm that selection against related males' sperm occurs within the female reproductive tract but demonstrate that this is more accurately predicted by MHC similarity: controlling for relatedness per se, more sperm reached the eggs when partners were MHC-dissimilar. Importantly, this effect appeared largely owing to similarity at a single MHC locus (class I minor). Further, the effect of MHC similarity was lost following artificial insemination, suggesting that male phenotypic cues might be required for females to select sperm differentially. These results indicate that postmating mechanisms that reduce inbreeding may do so as a consequence of more specific strategies of cryptic female choice promoting MHC diversity in offspring. PMID:24004935

  3. Spatial variation and low diversity in the major histocompatibility complex in walrus (Odobenus rosmarus)

    USGS Publications Warehouse

    Sonsthagen, Sarah A.; Fales, Krystal; Jay, Chadwick V.; Sage, George K.; Talbot, Sandra L.

    2014-01-01

    Increased global temperature and associated changes to Arctic habitats will likely result in the northward advance of species, including an influx of pathogens novel to the Arctic. How species respond to these immunological challenges will depend in part on the adaptive potential of their immune response system. We compared levels of genetic diversity at a gene associated with adaptive immune response [Class II major histocompatibility complex (MHC), DQB exon 2] between populations of walrus (Odobenus rosmarus), a sea ice-dependent Arctic species. Walrus was represented by only five MHC DQB alleles, with frequency differences observed between Pacific and Atlantic populations. MHC DQB alleles appear to be under balancing selection, and most (80 %; n = 4/5) of the alleles were observed in walruses from both oceans, suggesting broad scale differences in the frequency of exposure and diversity of pathogens may be influencing levels of heterozygosity at DQB in walruses. Limited genetic diversity at MHC, however, suggests that walrus may have a reduced capacity to respond to novel immunological challenges associated with shifts in ecological communities and environmental stressors predicted for changing climates. This is particularly pertinent for walrus, since reductions in summer sea ice may facilitate both northward expansion of marine species and associated pathogens from more temperate regions, and exchange of marine mammals and associated pathogens through the recently opened Northwest Passage between the Atlantic and Pacific Oceans in the Canadian high Arctic.

  4. Major histocompatibility complex similarity and sexual selection: different does not always mean attractive.

    PubMed

    Gasparini, Clelia; Congiu, Leonardo; Pilastro, Andrea

    2015-08-01

    Females that mate multiply have the possibility to exert postcopulatory choice and select more compatible sperm to fertilize eggs. Prior work suggests that dissimilarity in major histocompatibility complex (MHC) plays an important role in determining genetic compatibility between partners. Favouring a partner with dissimilar MHC alleles would result in offspring with high MHC diversity and therefore with enhanced survival thanks to increased resistance to pathogens and parasites. The high variability of MHC genes may further allow discrimination against the sperm from related males, reducing offspring homozygosity and inbreeding risk. Despite the large body of work conducted at precopulatory level, the role of MHC similarity between partners at postcopulatory level has been rarely investigated. We used an internal fertilizing fish with high level of multiple matings (Poecilia reticulata) to study whether MHC similarity plays a role in determining the outcome of fertilization when sperm from two males compete for the same set of eggs. We also controlled for genomewide similarity by determining similarity at 10 microsatellite loci. Contrary to prediction, we found that the more MHC-similar male sired more offspring while similarity at the microsatellite loci did not predict the outcome of sperm competition. Our results suggest that MHC discrimination may be involved in avoidance of hybridization or outbreeding rather than inbreeding avoidance. This, coupled with similar findings in salmon, suggests that the preference for MHC-dissimilar mates is far from being unanimous and that pre- and postcopulatory episodes of sexual selection can indeed act in opposite directions. PMID:25940673

  5. Ancient, highly polymorphic human major histocompatibility complex DQA1 intron sequence

    SciTech Connect

    McGinnis, M.D.; Quinn, D.L.; Lebo, R.V.; Simons, M.J.

    1994-10-01

    A 438 basepair intron 1 sequence adjacent to exon 2 in the human major histocompatibility complex DQA1 gene defined 16 allelic variants in 69 individuals from wide ethnic backgrounds. In contrast, the most variable coding region spanned by the 247 basepair exon 2 defined 11 allelic variants. Our phylogenetic human intron 1 tree derived by the Bootstrap algorithm reflects the same relative allelic relationships as the reported DQA1 exon 2 have cosegregated since divergence of the human races. Comparison of human alleles to a Rhesus monkey DQA1 first intron sequence found only 10 nucleotide substitutions unique to Rhesus, with the other 428 positions (98%) found in at least one human allele. This high degree of homology reflects the evolutionary stability of intron sequences since these two species diverged over 20 million years ago. Because more intron 1 alleles exist than exon 2 alleles, these polymorphic introns can be used to improve tissue typing for transplantation, paternity testing, and forensics and to derive more complete phylogenetic trees. These results suggest that introns represent a previously underutilized polymorphic resource. 42 refs., 3 figs., 1 tab.

  6. Alloreactivity and Association of Human Natural Killer Cells with the Major Histocompatibility Complex

    PubMed Central

    Mavoungou, Elie; Sall, Aicha; Poaty-Mavoungou, Virginie; Toure, Fousseyni S.; Yaba, Philippe; Delicat, Andre; Lansoud-Soukate, Joseph

    1999-01-01

    All NK cells potentially lytic for autologous cells but not expressing self-major histocompatibility complex (MHC)-reactive receptors could be eliminated by a negative selection mechanism during ontogeny. This idea is based on the existence of a NK cell subset expressing a specific inhibitory receptor for allogeneic MHC alleles. As ancestral haplotypes of the MHC appear to define identical MHC haplotypes in unrelated individuals, unrelated individuals having the same ancestral haplotype should also have the same NK-defined allospecificities that have been shown to map to the human MHC. To test this prediction, multiple cell lines from unrelated individuals having the same ancestral haplotypes were tested for the NK-defined allospecificities. It was found that cells having the same ancestral haplotypes do have the same NK-defined specificities. Furthermore, the NK-defined phenotype of cells that possess two different ancestral haplotypes can be predicted from the NK-defined phenotypes of unrelated cells that are homozygous for the ancestral haplotypes concerned. Although the group 1 and 2 NK-defined allospecificities can be explained to some extent by HLA-C alleles, evidence is presented that additional genes may modify the phenotype conferred by HLA-C. PMID:10066663

  7. Broadly targeted CD8⁺ T cell responses restricted by major histocompatibility complex E.

    PubMed

    Hansen, Scott G; Wu, Helen L; Burwitz, Benjamin J; Hughes, Colette M; Hammond, Katherine B; Ventura, Abigail B; Reed, Jason S; Gilbride, Roxanne M; Ainslie, Emily; Morrow, David W; Ford, Julia C; Selseth, Andrea N; Pathak, Reesab; Malouli, Daniel; Legasse, Alfred W; Axthelm, Michael K; Nelson, Jay A; Gillespie, Geraldine M; Walters, Lucy C; Brackenridge, Simon; Sharpe, Hannah R; López, César A; Früh, Klaus; Korber, Bette T; McMichael, Andrew J; Gnanakaran, S; Sacha, Jonah B; Picker, Louis J

    2016-02-12

    Major histocompatibility complex E (MHC-E) is a highly conserved, ubiquitously expressed, nonclassical MHC class Ib molecule with limited polymorphism that is primarily involved in the regulation of natural killer (NK) cells. We found that vaccinating rhesus macaques with rhesus cytomegalovirus vectors in which genes Rh157.5 and Rh157.4 are deleted results in MHC-E-restricted presentation of highly varied peptide epitopes to CD8αβ(+) T cells, at ~4 distinct epitopes per 100 amino acids in all tested antigens. Computational structural analysis revealed that MHC-E provides heterogeneous chemical environments for diverse side-chain interactions within a stable, open binding groove. Because MHC-E is up-regulated to evade NK cell activity in cells infected with HIV, simian immunodeficiency virus, and other persistent viruses, MHC-E-restricted CD8(+) T cell responses have the potential to exploit pathogen immune-evasion adaptations, a capability that might endow these unconventional responses with superior efficacy. PMID:26797147

  8. Recognition of Major Histocompatibility Complex Antigens on Cultured Human Biliary Epithelial Cells by Alloreactive Lymphocytes

    PubMed Central

    Saidman, Susan L.; Duquesnoy, Rene J.; Zeevi, Adriana; Fung, John J.; Starzl, Thomas E.; Demetris, A. Jake

    2010-01-01

    We have developed an in vitro system to study the interactions between biliary epithelium and lymphocytes using cultured human biliary epithelial cells. No class II antigens were detected by immunoperoxidase staining of the normal biliary epithelial cells, but alloactivated lymphocyte culture supernatants were able to induce class II expression. The activity of the supernatants was blocked with an anti-γ-interferon monoclonal antibody. In addition, recombinant human γ-interferon alone induced the expression of class II antigens and increased the intensity of class I staining of cultured biliary epithelial cells. Biliary epithelial cell–induced proliferation of alloreactive T lymphocytes demonstrated that the major histocompatibility complex molecules carry functional lymphocyte-activating determinants. The recognition of major histocompatibility complex determinants was confirmed by monoclonal antibody–blocking studies and by stimulation of an alloreactive T-cell clone. However, the biliary epithelial cells were much less potent stimulators than arterial endothelial cells tested in the same assay system. PMID:1704868

  9. Complex architecture of major histocompatibility complex class II promoters: reiterated motifs and conserved protein-protein interactions.

    PubMed Central

    Jabrane-Ferrat, N; Fontes, J D; Boss, J M; Peterlin, B M

    1996-01-01

    The S box (also known as at the H, W, or Z box) is the 5'-most element of the conserved upstream sequences in promoters of major histocompatibility complex class II genes. It is important for their B-cell-specific and interferon gamma-inducible expression. In this study, we demonstrate that the S box represents a duplication of the downstream X box. First, RFX, which is composed of the RFX5-p36 heterodimer that binds to the X box, also binds to the S box and its 5'-flanking sequence. Second, NF-Y, which binds to the Y box and increases interactions between RFX and the X box, also increases the binding of RFX to the S box. Third, RFXs bound to S and X boxes interact with each other in a spatially constrained manner. Finally, we confirmed these protein-protein and protein-DNA interactions by expressing a hybrid RFX5-VP16 protein in cells. We conclude that RFX binds to S and X boxes and that complex interactions between RFX and NF-Y direct B-cell-specific and interferon gamma-inducible expression or major histocompatibility complex class II genes. PMID:8756625

  10. Major histocompatibility complex class II genetic variation in forest musk deer (Moschus berezovskii) in China.

    PubMed

    Yao, Gang; Zhu, Ying; Wan, Qiu-Hong; Fang, Sheng-Guo

    2015-10-01

    The major histocompatibility complex (MHC) plays an important role in the immune system of vertebrates. We used the second exon of four MHC class II genes (DRA, DQA1, DQA2 and DRB3) to assess the overall MHC variation in forest musk deer (Moschus berezovskii). We also compared the MHC variation in captive and wild populations. We observed 22 alleles at four loci (four at DRA, four at DQA1, four at DQA2 and 10 at DRB3), 15 of which were newly identified alleles. Results suggest that forest musk deer maintain relatively high MHC variation, which may result from balancing selection. Moreover, considerable diversity was observed at the DRA locus. We found a high frequency of Mobe-DRA*02, Mobe-DQA1*01 and Mobe-DQA2*05 alleles, which may be important for pathogen resistance. A Ewens-Watterson test showed that the DRB3 locus in the wild population had experienced recent balancing selection. We detected a small divergence at the DRA locus, suggesting the effect of weak positive selection on the DRA gene. Alternatively, this locus may be young and not yet adapted a wide spectrum of alleles for pathogen resistance. The significant heterozygosity deficit observed at the DQA1 and DRB3 loci in the captive population and at all four loci in the wild population may be the result of a population bottleneck. Additionally, MHC genetic diversity was higher in the wild population than in the captive, suggesting that the wild population may have the ability to respond to a wider range of pathogens. PMID:26370614

  11. Introgression from Domestic Goat Generated Variation at the Major Histocompatibility Complex of Alpine Ibex

    PubMed Central

    Grossen, Christine; Keller, Lukas; Biebach, Iris; Croll, Daniel

    2014-01-01

    The major histocompatibility complex (MHC) is a crucial component of the vertebrate immune system and shows extremely high levels of genetic polymorphism. The extraordinary genetic variation is thought to be ancient polymorphisms maintained by balancing selection. However, introgression from related species was recently proposed as an additional mechanism. Here we provide evidence for introgression at the MHC in Alpine ibex (Capra ibex ibex). At a usually very polymorphic MHC exon involved in pathogen recognition (DRB exon 2), Alpine ibex carried only two alleles. We found that one of these DRB alleles is identical to a DRB allele of domestic goats (Capra aegagrus hircus). We sequenced 2489 bp of the coding and non-coding regions of the DRB gene and found that Alpine ibex homozygous for the goat-type DRB exon 2 allele showed nearly identical sequences (99.8%) to a breed of domestic goats. Using Sanger and RAD sequencing, microsatellite and SNP chip data, we show that the chromosomal region containing the goat-type DRB allele has a signature of recent introgression in Alpine ibex. A region of approximately 750 kb including the DRB locus showed high rates of heterozygosity in individuals carrying one copy of the goat-type DRB allele. These individuals shared SNP alleles both with domestic goats and other Alpine ibex. In a survey of four Alpine ibex populations, we found that the region surrounding the DRB allele shows strong linkage disequilibria, strong sequence clustering and low diversity among haplotypes carrying the goat-type allele. Introgression at the MHC is likely adaptive and introgression critically increased MHC DRB diversity in the genetically impoverished Alpine ibex. Our finding contradicts the long-standing view that genetic variability at the MHC is solely a consequence of ancient trans-species polymorphism. Introgression is likely an underappreciated source of genetic diversity at the MHC and other loci under balancing selection. PMID:24945814

  12. Sampling strategies for accurate computational inferences of gametic phase across highly polymorphic major histocompatibility complex loci

    PubMed Central

    2011-01-01

    Background Genes of the Major Histocompatibility Complex (MHC) are very popular genetic markers among evolutionary biologists because of their potential role in pathogen confrontation and sexual selection. However, MHC genotyping still remains challenging and time-consuming in spite of substantial methodological advances. Although computational haplotype inference has brought into focus interesting alternatives, high heterozygosity, extensive genetic variation and population admixture are known to cause inaccuracies. We have investigated the role of sample size, genetic polymorphism and genetic structuring on the performance of the popular Bayesian PHASE algorithm. To cover this aim, we took advantage of a large database of known genotypes (using traditional laboratory-based techniques) at single MHC class I (N = 56 individuals and 50 alleles) and MHC class II B (N = 103 individuals and 62 alleles) loci in the lesser kestrel Falco naumanni. Findings Analyses carried out over real MHC genotypes showed that the accuracy of gametic phase reconstruction improved with sample size as a result of the reduction in the allele to individual ratio. We then simulated different data sets introducing variations in this parameter to define an optimal ratio. Conclusions Our results demonstrate a critical influence of the allele to individual ratio on PHASE performance. We found that a minimum allele to individual ratio (1:2) yielded 100% accuracy for both MHC loci. Sampling effort is therefore a crucial step to obtain reliable MHC haplotype reconstructions and must be accomplished accordingly to the degree of MHC polymorphism. We expect our findings provide a foothold into the design of straightforward and cost-effective genotyping strategies of those MHC loci from which locus-specific primers are available. PMID:21615903

  13. Association of hypothyroid disease in Doberman Pinscher dogs with a rare major histocompatibility complex DLA class II haplotype.

    PubMed

    Kennedy, L J; Huson, H J; Leonard, J; Angles, J M; Fox, L E; Wojciechowski, J W; Yuncker, C; Happ, G M

    2006-01-01

    Canine hypothyroid disease is similar to Hashimoto's disease in humans, which has been shown to be associated with human major histocompatibility complex (MHC) genes. We have collected 27 Doberman Pinschers affected with primary hypothyroid disease and compared their MHC class II haplotypes with 129 unaffected Doberman Pinschers. Three dog-leucocyte antigen (DLA) genes, DLA-DRB1, DQA1 and DQB1, were characterized by sequence-based typing and assigned to haplotypes for each dog. One rare haplotype was found at an increased frequency in the affected dogs compared to the unaffected dogs (Odds ratio = 2.43, P < 0.02). This haplotype has only been found in Doberman Pinschers and Labradors to date. PMID:16451201

  14. Macrophage cell lines derived from major histocompatibility complex II-negative mice

    NASA Technical Reports Server (NTRS)

    Beharka, A. A.; Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1998-01-01

    Two bone-marrow-derived macrophage cell lines, C2D and C2Dt, were isolated from major histocompatibility class II negative knock-out mice. The C2D cell line was stabilized by continuous culture in colony-stimulating factor-1 and the C2Dt cell line was transformed with SV40 virus large T antigen. These cells exhibited phenotypic properties of macrophages including morphology and expression of Mac 1 and Mac 2 cell surface molecules. These cells also had comparable growth to the bone-marrow-derived macrophage cell line B6MP102. These new cell lines were not spontaneously cytotoxic and were only capable of modest killing of F5b tumor cells when stimulated with LPS and interferon-gamma, but not when stimulated with LPS alone or with staphylococcal exotoxin. C2D and C2Dt cells phagocytosed labeled Staphylococcus aureus similarly to B6MP102 cells but less well than C2D peritoneal macrophages. These cell lines secreted interleukin-6, but not tumor necrosis factor or nitric oxide in response to LPS or staphlococcal enterotoxins A or B C2D(t) cells were tumorigenic in C2D and C57BL/6J mice but C2D cells were not. These data suggest that macrophage cell lines can be established from bone marrow cells of major histocompatibility complex II-negative mice.

  15. IMGT/HLA database--a sequence database for the human major histocompatibility complex.

    PubMed

    Robinson, J; Malik, A; Parham, P; Bodmer, J G; Marsh, S G

    2000-03-01

    The IMGT/HLA Database is a specialist database for sequences of the human major histocompatibility (MHC) system. It includes all the HLA sequences officially recognised and named by the WHO Nomenclature Committee for Factors of the HLA System. The database provides users with online tools and facilities for the retrieval and analysis of these sequences. These include allele reports, alignment tools and a detailed database of all source cells. The online IMGT/HLA submission tool allows the submission of both new and confirmatory allele sequences directly to the WHO Nomenclature Committee for Factors of the HLA System. The latest version (release 1.4.1, November 1999) contains 1,015 HLA alleles from over 2,270 component sequences derived from the EMBL/GenBank/DDBJ databases. From its release in December 1998 until December 1999 the IMGT/HLA website received approximately 100,000 hits. The database currently focuses on the human major histocompatibility complex but will be used as a model system to provide specialist databases for the MHC sequences of other species. PMID:10777106

  16. MH2c: Characterization of major histocompatibility α-helices - an information criterion approach

    NASA Astrophysics Data System (ADS)

    Hischenhuber, B.; Frommlet, F.; Schreiner, W.; Knapp, B.

    2012-07-01

    Major histocompatibility proteins share a common overall structure or peptide binding groove. Two binding groove domains, on the same chain for major histocompatibility class I or on two different chains for major histocompatibility class II, contribute to that structure that consists of two α-helices (“wall”) and a sheet of eight anti-parallel beta strands (“floor”). Apart from the peptide presented in the groove, the major histocompatibility α-helices play a central role for the interaction with the T cell receptor. This study presents a generalized mathematical approach for the characterization of these helices. We employed polynomials of degree 1 to 7 and splines with 1 to 2 nodes based on polynomials of degree 1 to 7 on the α-helices projected on their principal components. We evaluated all models with a corrected Akaike Information Criterion to determine which model represents the α-helices in the best way without overfitting the data. This method is applicable for both the stationary and the dynamic characterization of α-helices. By deriving differential geometric parameters from these models one obtains a reliable method to characterize and compare α-helices for a broad range of applications. Catalogue identifier: AELX_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AELX_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 327 565 No. of bytes in distributed program, including test data, etc.: 17 433 656 Distribution format: tar.gz Programming language: Matlab Computer: Personal computer architectures Operating system: Windows, Linux, Mac (all systems on which Matlab can be installed) RAM: Depends on the trajectory size, min. 1 GB (Matlab) Classification: 2.1, 4.9, 4.14 External routines: Curve Fitting Toolbox and Statistic Toolbox of

  17. Organization and characteristics of the major histocompatibility complex class II region in the Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis)

    PubMed Central

    Ruan, Rui; Ruan, Jue; Wan, Xiao-Ling; Zheng, Yang; Chen, Min-Min; Zheng, Jin-Song; Wang, Ding

    2016-01-01

    Little is known about the major histocompatibility complex (MHC) in the genome of Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis) (YFP) or other cetaceans. In this study, a high-quality YFP bacterial artificial chromosome (BAC) library was constructed. We then determined the organization and characterization of YFP MHC class II region by screening the BAC library, followed by sequencing and assembly of positive BAC clones. The YFP MHC class II region consists of two segregated contigs (218,725 bp and 328,435 bp respectively) that include only eight expressed MHC class II genes, three pseudo MHC genes and twelve non-MHC genes. The YFP has fewer MHC class II genes than ruminants, showing locus reduction in DRB, DQA, DQB, and loss of DY. In addition, phylogenic and evolutionary analyses indicated that the DRB, DQA and DQB genes might have undergone birth-and-death evolution, whereas the DQB gene might have evolved under positive selection in cetaceans. These findings provide an essential foundation for future work, such as estimating MHC genetic variation in the YFP or other cetaceans. This work is the first report on the MHC class II region in cetaceans and offers valuable information for understanding the evolution of MHC genome in cetaceans. PMID:26932528

  18. Organization and characteristics of the major histocompatibility complex class II region in the Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis).

    PubMed

    Ruan, Rui; Ruan, Jue; Wan, Xiao-Ling; Zheng, Yang; Chen, Min-Min; Zheng, Jin-Song; Wang, Ding

    2016-01-01

    Little is known about the major histocompatibility complex (MHC) in the genome of Yangtze finless porpoise (Neophocaena asiaeorientalis asiaeorientalis) (YFP) or other cetaceans. In this study, a high-quality YFP bacterial artificial chromosome (BAC) library was constructed. We then determined the organization and characterization of YFP MHC class II region by screening the BAC library, followed by sequencing and assembly of positive BAC clones. The YFP MHC class II region consists of two segregated contigs (218,725 bp and 328,435 bp respectively) that include only eight expressed MHC class II genes, three pseudo MHC genes and twelve non-MHC genes. The YFP has fewer MHC class II genes than ruminants, showing locus reduction in DRB, DQA, DQB, and loss of DY. In addition, phylogenic and evolutionary analyses indicated that the DRB, DQA and DQB genes might have undergone birth-and-death evolution, whereas the DQB gene might have evolved under positive selection in cetaceans. These findings provide an essential foundation for future work, such as estimating MHC genetic variation in the YFP or other cetaceans. This work is the first report on the MHC class II region in cetaceans and offers valuable information for understanding the evolution of MHC genome in cetaceans. PMID:26932528

  19. Genetic Variation of Major Histocompatibility Complex and Microsatellite Loci: A Comparison in Bighorn Sheep

    PubMed Central

    Boyce, W. M.; Hedrick, P. W.; Muggli-Cockett, N. E.; Kalinowski, S.; Penedo, MCT.; Ramey-II, R. R.

    1997-01-01

    Examining and comparing genetic variation for major histocompatibility complex (MHC) and microsatellite (MS) loci in the same individuals provides an opportunity to understand the forces influencing genetic variation. We examined five MHC and three MS loci in 235 bighorn sheep (Ovis canadensis) from 14 populations and found that both types of loci were highly variable and were in Hardy-Weinberg proportions. Mean F(ST) values for both markers were very similar and MHC and MS genetic variability was predominantly distributed within rather than among populations. However, analyses of genetic distances and tree topologies revealed different spatial patterns of variation for the two types of loci. Collectively, these results indicated that neutral forces substantially influenced MS and MHC variation, and they provided limited evidence for selection acting on the MHC. PMID:9071595

  20. Quantitative online prediction of peptide binding to the major histocompatibility complex.

    PubMed

    Hattotuwagama, Channa K; Guan, Pingping; Doytchinova, Irini A; Zygouri, Christianna; Flower, Darren R

    2004-01-01

    With its implications for vaccine discovery, the accurate prediction of T cell epitopes is one of the key aspirations of computational vaccinology. We have developed a robust multivariate statistical method, based on partial least squares, for the quantitative prediction of peptide binding to major histocompatibility complexes (MHC), the principal checkpoint on the antigen presentation pathway. As a service to the immunobiology community, we have made a Perl implementation of the method available via a World Wide Web server. We call this server MHCPred. Access to the server is freely available from the URL: http://www.jenner.ac.uk/MHCPred. We have exemplified our method with a model for peptides binding to the common human MHC molecule HLA-B*3501. PMID:14629978

  1. Establishment of major histocompatibility complex homozygous gnotobiotic miniature swine colony for xenotransplantation.

    PubMed

    Hwang, Jeong Ho; Gupta, Mukesh Kumar; Park, Chan Kyu; Kim, Yoon Berm; Lee, Hoon Taek

    2015-04-01

    To overcome shortages of human donor organs for organ failure patients, we made a commitment to develop gnotobiotic miniature swine as an alternative organ donor source for xenotransplantation. For this, we have constructed an absolute barrier-sustained gnotobiotic facility. Pregnant sows of gnotobiotic miniature swine, were procured and germfree piglets were obtained by hysterectomy. These were maintained in germfree isolators for about 4 weeks, deprived of colostrum and were fed sterilized soybean milk. They were associated with di-flora, anaerobic Lactobacillus sp. and Streptococcus sp. After confirmation of successful associations, gnotobiotic piglets were transferred into the facility aseptically. The piglets are maintained on high-efficiency particle air-filtered air in and out; maintaining constant room air pressure of 33 ± 3 mmAq, and sterile water and diet. In 10 sessions of hysterectomy, 18 male and 32 female piglets were obtained of which piglets (M six, F eight) died within 5 days. Among live piglets, piglets (M eight, F 12) were confirmed to be germfree by microbiological monitoring. For research of xenotransplantation, one consistent experimental result was essential. Therefore, major histocompatibility complex class II which related innate immunity, homozygotic gnotobiotic miniature swine was developed. As a result, genotyping revealed 14 individuals to be homozygous for major histocompatibility complex class II (DRB, DQB) as 0301, three individuals were homozygous as 0201 and each of two were homozygous for DQB as 0701 and DRB as 0404, respectively. Genetic modifications and immunological research for ideal alternative organ sources are in progress. PMID:25491717

  2. The Use of Peptide–Major-Histocompatibility-Complex Multimers in Type 1 Diabetes Mellitus

    PubMed Central

    Gojanovich, Greg S; Murray, Sabrina L; Buntzman, Adam S; Young, Ellen F; Vincent, Benjamin G; Hess, Paul R; DVM

    2012-01-01

    Major histocompatibility complex (MHC) class I and MHC class II molecules present short peptides that are derived from endogenous and exogenous proteins, respectively, to cognate T-cell receptors (TCRs) on the surface of T cells. The exquisite specificity with which T cells recognize particular peptide–major-histocompatibility-complex (pMHC) combinations has permitted development of soluble pMHC multimers that bind exclusively to selected T-cell populations. Because the pathogenesis of type 1 diabetes mellitus (T1DM) is driven largely by islet-reactive T-cell activity that causes β-cell death, these reagents are useful tools for studying and, potentially, for treating this disease. When coupled to fluorophores or paramagnetic nanoparticles, pMHC multimers have been used to visualize the expansion and islet invasion of T-cell effectors during diabetogenesis. Administration of pMHC multimers to mice has been shown to modulate T-cell responses by signaling through the TCR or by delivering a toxic moiety that deletes the targeted T cell. In the nonobese diabetic mouse model of T1DM, a pMHC-I tetramer coupled to a potent ribosome-inactivating toxin caused long-term elimination of a specific diabetogenic cluster of differentiation 8+ T-cell population from the pancreatic islets and delayed the onset of diabetes. This review will provide an overview of the development and use of pMHC multimers, particularly in T1DM, and describe the therapeutic promise these reagents have as an antigen-specific means of ameliorating deleterious T-cell responses in this autoimmune disease. PMID:22768881

  3. Molecular characterization by high-resolution isoelectric focusing of the products encoded by the class II region loci of the major histocompatibility complex in humans. I. DR and DQ gene variants.

    PubMed

    Rodriguez de Cordoba, S; Nunez-Roldan, A; Winchester, R; Marshall, P; Carrier, C; Mollen, N; Walker, M; Ginsberg-Fellner, F; Rubinstein, P

    1987-09-01

    We describe a new approach to the analysis of the structural polymorphism of the DR beta, DQ alpha, and DQ beta polypeptide chains of human histocompatibility class II antigens. In comparison to conventional two-dimensional gel studies, this method provides sharper definition of the protein bands and side-by-side comparisons within the same gel, thereby permitting the detection of minor differences in the isoelectric points of the protein chains. Using this methodology we have analyzed the IEF polymorphism and the variability in the number of the DR beta chains encoded by different DR haplotypes. Twenty DR beta chain variants, which include the products of no less than two separate DR beta loci, have been thus far identified. Alleles at one of these loci are assumed to code for DR beta chains carrying the DR alloespecificities DR1, DR2, DR3, DR4, DR5, DRw6, DR7, and DR8. Alleles at a second DR beta locus encode DR beta chains that may be shared by serologically DR-different haplotypes and carry supertypic serologic specificities (i.e., DRw52 and DRw53). We also demonstrate here that the structural polymorphisms of the DQ alpha and DQ beta chains are more extensive than previously thought, report the characterization of 14 DQ beta variants, and define their relationship to the previously described DQw serologic specificities. In addition, we describe the class II haplotype associations observed for the different DR and DQ variants characterized. PMID:3679903

  4. Two putative subunits of a peptide pump encoded in the human major histocompatability complex class 2 region

    SciTech Connect

    Bahram, S.; Arnold, D.; Bresnahan, M.; Strominger, J.L.; Spies, T. )

    1991-11-15

    The class 2 region of the human major histocompatibility complex (MHC) may encode several genes controlling the processing of endogenous antigen and the presentation of peptide epitopes by MHC class 1 molecules to cytotoxic T lymphocytes. A previously described peptide supply factor (PSF1) is a member of the multidrug-resistance family of transporters and may pump cytosolic peptides into the membrane-bound compartment where class 1 molecules assemble. A second transporter gene, PSF2, was identified 10 kilobases (kb) from PSF1, near the class 2 DOB gene. The complete sequences of PSF1 and PSF2 were determined from cDNA clones. The translation products are closely related in sequence and predicted secondary structure. Both contain a highly conserved ATP-binding fold and share 25% homology in a hydrophobic domain with a tentative number of eight membrane-spanning segments. Based on the principle dimeric organization of these two domains in other transporters, PSF1 and PSF2 may function as complementary subunits, independently as homodimers, or both. Taken together with previous genetic evidence, the coregulation of PSF1 and PSF2 by {gamma} interferon and the to-some-degree coordinate transcription of these genes suggest a common role in peptide-loading of class 1 molecules, although a distinct function of PSF2 cannot be ruled out.

  5. Critical role of the major histocompatibility complex and IL-10 in matrilin-1-induced relapsing polychondritis in mice.

    PubMed

    Hansson, Ann-Sofie; Johansson, Asa C M; Holmdahl, Rikard

    2004-01-01

    Relapsing polychondritis (RP) is an autoimmune disease that affects extra-articular cartilage. Matrilin-1-induced relapsing polychondritis (MIRP) is a model for RP and is useful for studies of the pathogenic mechanisms in this disease. There are indications that the major histocompatibility complex (MHC) class II plays a major role in RP, since DR4+ patients are more commonly affected than controls. We have now addressed the role of the MHC region, as well as the non-MHC contribution, using congenic mouse strains. Of the MHC congenic strains, B10.Q (H2q) was the most susceptible, the B10.P (H2p) and B10.R (H2r) strains developed mild disease, while B10 strains carrying the v, b, f, or u H2 haplotypes were resistant. A slight variation of susceptibility of H2q strains (B10.Q> C3H.Q> DBA/1) was observed and the (B10.Q x DBA/1)F1 was the most susceptible of all strains. Furthermore, macrophages and CD4+ T cells were the most prominent cell types in inflammatory infiltrates of the tracheal cartilage. Macrophages are the major source of many cytokines, such as interleukin-10 (IL-10), which is currently being tested as a therapeutic agent in several autoimmune diseases. We therefore investigated B10.Q mice devoid of IL-10 through gene deletion and found that they developed a significantly more severe disease, with an earlier onset, than their heterozygous littermates. In conclusion, MHC genes, as well as non-MHC genes, are important for MIRP induction, and IL-10 plays a major suppressive role in cartilage inflammation of the respiratory tract. PMID:15380048

  6. Sexual selection explains more functional variation in the mammalian major histocompatibility complex than parasitism

    PubMed Central

    Winternitz, J. C.; Minchey, S. G.; Garamszegi, L. Z.; Huang, S.; Stephens, P. R.; Altizer, S.

    2013-01-01

    Understanding drivers of genetic diversity at the major histocompatibility complex (MHC) is vitally important for predicting how vertebrate immune defence might respond to future selection pressures and for preserving immunogenetic diversity in declining populations. Parasite-mediated selection is believed to be the major selective force generating MHC polymorphism, and while MHC-based mating preferences also exist for multiple species including humans, the general importance of mate choice is debated. To investigate the contributions of parasitism and sexual selection in explaining among-species variation in MHC diversity, we applied comparative methods and meta-analysis across 112 mammal species, including carnivores, bats, primates, rodents and ungulates. We tested whether MHC diversity increased with parasite richness and relative testes size (as an indicator of the potential for mate choice), while controlling for phylogenetic autocorrelation, neutral mutation rate and confounding ecological variables. We found that MHC nucleotide diversity increased with parasite richness for bats and ungulates but decreased with parasite richness for carnivores. By contrast, nucleotide diversity increased with relative testes size for all taxa. This study provides support for both parasite-mediated and sexual selection in shaping functional MHC polymorphism across mammals, and importantly, suggests that sexual selection could have a more general role than previously thought. PMID:23966643

  7. Does the major histocompatibility complex serve as a specific receptor for Semliki Forest virus?

    PubMed Central

    Oldstone, M B; Tishon, A; Dutko, F J; Kennedy, S I; Holland, J J; Lampert, P W

    1980-01-01

    Murine F9 and PCC4 teratoma cells do not express H-2 major transplantation antigens according to virus-specific T-lymphocyte cytotoxic or serological assays. However, such cells can be infected with and readily replicate many types of viruses (coxsackie B 3, mouse hepatitis, Sindbis, Semliki Forest [SFV], lymphocytic choriomeningitis, Pichinde, vesicular stomatitis, herpes simplex type 1) to the same extent as do murine F12 teratoma cells and mouse embryo fibroblasts, all of which express the H-2 determinants. In contrast, F9 and PCC4 cells are not productively infected with murine cytomegalovirus, whereas F12 and mouse embryo fibroblast cells are. In addition to replicating in H-2-negative murine teratoma cells, SFV replicates in H-2-negative murine lymphoblastoid cells. The ability of SFV to infect cells without H-2 antigens and then to effect viral antigenic expression in the cells' cytoplasm and on their surface with similar kinetics and in equivalent amounts as cells with H-2 antigens indicates that the H-2 receptor is not needed for SFV infection. Daudi cells, which lack HLA antigens, block the replication of SFV. This occurs at some point after receptor binding, as demonstrated by diminished viral mRNA. In addition, a possible membrane defect precludes viral exit in Daudi cells transfected with SFV infectious RNA. These results indicate that a cell's possession of H-2 antigens is not a requirement for SFV infection and that major histocompatibility complex antigens are not specific receptors for this virus. Images PMID:7373708

  8. Myelin-oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex

    SciTech Connect

    Pham-Dinh, D.; Dautigny, A. ); Mattei, M.G.; Roeckel, N. ); Nussbaum, J.H.; Roussel, G. ); Pontarotti, P. ); Mather, I.H. ); Artzt, K. ); Lindahl, K.F. )

    1993-09-01

    Myelin/oligodendrocyte glycoprotein (MOG) is found on the surface of myelinating oligodendrocytes and external lamellae of myelin sheaths in the central nervous system, and it is target antigen in experimental autoimmune encephalomyelitis and multiple sclerosis. The authors have isolated bovine, mouse, and rat MOG cDNA clones and shown that the developmental pattern of MOG expression in the rat central nervous system coincides with the late stages of myelination. The amino-terminal, extracellular domain of MOG has characteristics of an immunoglobulin variable domain and is 46% and 41% identical with the amino terminus of bovine butyrophilin (expressed in the lactating mammary gland) and B-G antigens of the chicken major histocompatibility complex (MHC), respectively; these proteins thus form a subset of the immunoglobulin superfamily. The homology between MOG and B-G extends beyond their structure and genetic mapping to their ability to induce strong antibody responses and has implications for the role of MOG in pathological, autoimmune conditions. The authors colocalized the MOG and BT genes to the human MHC on chromosome 6p21.3-p22. The mouse MOG gene was mapped to the homologous band C of chromosome 17, within the M region of the mouse MHC. 38 refs., 6 figs.

  9. Myelin/oligodendrocyte glycoprotein is a member of a subset of the immunoglobulin superfamily encoded within the major histocompatibility complex.

    PubMed

    Pham-Dinh, D; Mattei, M G; Nussbaum, J L; Roussel, G; Pontarotti, P; Roeckel, N; Mather, I H; Artzt, K; Lindahl, K F; Dautigny, A

    1993-09-01

    Myelin/oligodendrocyte glycoprotein (MOG) is found on the surface of myelinating oligodendrocytes and external lamellae of myelin sheaths in the central nervous system, and it is a target antigen in experimental autoimmune encephalomyelitis and multiple sclerosis. We have isolated bovine, mouse, and rat MOG cDNA clones and shown that the developmental pattern of MOG expression in the rat central nervous system coincides with the late stages of myelination. The amino-terminal, extracellular domain of MOG has characteristics of an immunoglobulin variable domain and is 46% and 41% identical with the amino terminus of bovine butyrophilin (expressed in the lactating mammary gland) and B-G antigens of the chicken major histocompatibility complex (MHC), respectively; these proteins thus form a subset of the immunoglobulin superfamily. The homology between MOG and B-G extends beyond their structure and genetic mapping to their ability to induce strong antibody responses and has implications for the role of MOG in pathological, autoimmune conditions. We colocalized the MOG and BT genes to the human MHC on chromosome 6p21.3-p22. The mouse MOG gene was mapped to the homologous band C of chromosome 17, within the M region of the mouse MHC. PMID:8367453

  10. A temporal analysis shows major histocompatibility complex loci in the Scandinavian wolf population are consistent with neutral evolution.

    PubMed

    Seddon, J M; Ellegren, H

    2004-11-01

    The major histocompatibility complex (MHC) has an integral role in the immune system, and hence diversity at its genes may be of particular importance for the health of populations. In large populations, balancing selection maintains diversity in MHC genes, but theoretical expectations indicate that this form of selection is absent or inefficient in small populations. We examine the level of diversity at three MHC class II loci in the wolf population of Scandinavia, a population naturally recolonized with a genetic contribution from as few as three founders, and in four neighbouring wolf populations. In the Scandinavian wolf population, two alleles were found for each locus and the distribution of alleles is compatible with their linkage into two haplotypes. Changes in the level of heterozygosity over time since recolonization demonstrate the effects of the proposed arrival of an immigrant wolf. The maintenance of diversity is shown to be compatible with a neutral, random allocation of alleles, in conjunction with crossing between packs. A total of 15 DRB1, seven DQA and 10 DQB1 alleles are found in four neighbouring wolf populations, with substantial sharing across populations. Even in these larger populations, bottlenecks and fragmentation with consequent genetic drift are likely to have resulted in few indicators for balancing selection and significant differentiation of populations. PMID:15539354

  11. A complex alloantigen system in Florida sandhill cranes, Grus canadensis pratensis: Evidence for the major histocompatibility (B) system

    USGS Publications Warehouse

    Jarvi, S.I.; Gee, G.F.; Miller, M.M.; Briles, W.E.

    1995-01-01

    The B blood group system constitutes the major histocompatibility complex (Mhc) in birds. The Mhc is a cluster of genes largely devoted to the processing and presentation of antigen. The Mhc is highly polymorphic in many species and, thus, useful in the evaluation of genetic diversity for fitness traits within populations of a variety of animals. Correlations found between particular Mhc haplotypes and resistance to certain diseases emphasize the importance of understanding the functional significance of diversity of the Mhc, particularly in species threatened with extinction. As part of studies focused on genetic diversity in wild birds, serological techniques were used to define a highly polymorphic alloantigen system in seven families of Florida sandhill cranes (Grus canadensis pratensis). The results of analyses with antisera produced within the crane families and with chicken Mhc antigen-specific reagents revealed a single major alloantigen system that is likely the Mhc of the Florida sandhill crane. Preliminary experiments indicate that these crane alloantisera will provide a means of defining .the Mhc in other species of cranes.

  12. Role of major histocompatibility complex class II in resistance of mice to naturally acquired infection with Syphacia obvelata

    NASA Technical Reports Server (NTRS)

    Stewart, Patricia W.; Chapes, Stephen K.

    2003-01-01

    Genetics plays a substantial role in host resistance in many host-parasite interactions. We examined the prevalence of naturally acquired infection with Syphacia obvelata in a number of mouse strains housed in a non-barrier facility. These mice, which included cross-bred and congenic, inbred strains on various genetic backgrounds, differ in the loci for the immune function genes--major histocompatibility complex class II (MHCII), toll-like receptor 4 (Tlr4), and solute carrier family 11, member 1 (Slc11a1)--which allowed comparisons of the impact of these genes on resistance to pinworm infection. Male and female mice of various ages were sampled over an 18-month period; infection was determined by use of the cellophane tape test. Results indicated that mice that were MHCII+/+ had a significantly lower prevalence of infection than did mice that were MHCII-/-. Differences were not seen between male and female mice. Although MHCII+/+ mice had an age-associated decrease in infection prevalence, such decrease was not seen in MHCII-/- mice. In contrast, infection prevalence in mice with the normal Tlr4 gene (Tlr4(LPS-n/LPS-n)) gene did not differ significantly compared with that in mice that were homozygous for either the point mutation (Tlr4(LPS-d/LPS-d)) or deletion (Tlr4(LPS-del/LPS-del)) of that gene. Likewise, the presence (Sle11a1r/r) or absence (Slc11a1s/s) of functional alleles for Slc11a1 had no effect on the prevalence of infection with S. obvelata. In conclusion, presence of MHCII, but not Tlr4 or Slc11a1 significantly influences prevalence of naturally acquired infection with S. obvelata. These data justify further comprehensive analyses of the immune components that are involved in pinworm resistance.

  13. Rhinovirus infection induces major histocompatibility complex class I and costimulatory molecule upregulation on respiratory epithelial cells.

    PubMed

    Papi, A; Stanciu, L A; Papadopoulos, N G; Teran, L M; Holgate, S T; Johnston, S L

    2000-05-01

    Human respiratory epithelial cells may act as antigen-presenting cells during respiratory viral infections. In addition to major histocompatibility complex (MHC) molecules, antigen presentation requires participation of costimulatory molecules. Here the authors investigated class I and class II antigens and B7-1 and B7-2 costimulatory molecule expression in human A549 pulmonary epithelial cells and primary bronchial epithelial cells (HBECs) at baseline and after rhinovirus infection. Constitutive expression of MHC class I and B7-1 molecules was observed on both cell types. MHC class I molecules were up-regulated by rhinovirus infection, while B7-1 was up-regulated only on A549 cells. B7-2 molecules were constitutively expressed at a low level and were up-regulated by rhinovirus only on HBECs. Rhinovirus induction of antigen-presenting molecule expression on A549 cells was accompanied by cellular activation in terms of induction of release of the chemokines RANTES and Groalpha. These data show that respiratory epithelium expresses full antigen-presentation machinery and that rhinovirus infection up-regulates this expression. PMID:10823784

  14. Cytokines Regulate Proteolysis in Major Histocompatibility Complex Class II–Dependent Antigen Presentation by Dendritic Cells

    PubMed Central

    Fiebiger, Edda; Meraner, Paul; Weber, Ekkehard; Fang, I-Fei; Stingl, Georg; Ploegh, Hidde; Maurer, Dieter

    2001-01-01

    Endo/lysosomal proteases control two key events in antigen (Ag) presentation: the degradation of protein Ag and the generation of peptide-receptive major histocompatibility complex (MHC) class II molecules. Here we show that the proinflammatory cytokines tumor necrosis factor α and interleukin (IL)-1β rapidly increase the activity of cathepsin (cat) S and catB in human dendritic cells (DCs). As a consequence, a wave of MHC class II sodium dodecyl sulfate stable dimer formation ensues in a catS-dependent fashion. In contrast, the antiinflammatory cytokine IL-10 renders DCs incapable of upregulating catS and catB activity and in fact, attenuates the level of both enzymes. Suppressed catS and catB activity delays MHC class II sodium dodecyl sulfate stable dimer formation and impairs Ag degradation. In DCs exposed to tetanus toxoid, IL-10 accordingly reduces the number of MHC class II–peptide complexes accessible to tetanus toxoid–specific T cell receptors, as analyzed by measuring T cell receptor downregulation in Ag-specific T cell clones. Thus, the control of protease activity by pro- and antiinflammatory cytokines is an essential feature of the Ag presentation properties of DCs. PMID:11304549

  15. Binding and activation of major histocompatibility complex class II-deficient macrophages by staphylococcal exotoxins

    NASA Technical Reports Server (NTRS)

    Beharka, A. A.; Armstrong, J. W.; Iandolo, J. J.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Macrophages from C2D transgenic mice deficient in the expression of major histocompatibility complex (MHC) class II proteins were used to identify binding sites for superantigens distinct from the MHC class II molecule. Iodinated staphylococcal enterotoxins A and B (SEA and SEB) and exfoliative toxins A and B (ETA and ETB) bound to C2D macrophages in a concentration-dependent and competitive manner. All four toxins increased F-actin concentration within 30 s of their addition to C2D macrophages, indicating that signal transduction occurred in response to toxin in the absence of class II MHC. Furthermore, ETA, ETB, SEA, and, to a lesser extent, SEB induced C2D macrophages to produce interleukin 6. Several molecular species on C2D macrophages with molecular masses of 140, 97, 61, 52, 43, and 37 kDa bound SEA in immunoprecipitation experiments. These data indicate the presence of novel, functionally active toxin binding sites on murine macrophages distinct from MHC class II molecules.

  16. Diacylglycerol Kinase α Regulates Tubular Recycling Endosome Biogenesis and Major Histocompatibility Complex Class I Recycling*

    PubMed Central

    Xie, Shuwei; Naslavsky, Naava; Caplan, Steve

    2014-01-01

    Major histocompatibility complex class I (MHC I) presents intracellular-derived peptides to cytotoxic T lymphocytes and its subcellular itinerary is important in regulating the immune response. While a number of diacylglycerol kinase isoforms have been implicated in clathrin-dependent internalization, MHC I lacks the typical motifs known to mediate clathrin-dependent endocytosis. Here we show that depletion of diacylglycerol kinase α (DGKα), a kinase devoid of a clathrin-dependent adaptor protein complex 2 binding site, caused a delay in MHC I recycling to the plasma membrane without affecting the rate of MHC I internalization. We demonstrate that DGKα knock-down causes accumulation of intracellular and surface MHC I, resulting from decreased degradation. Furthermore, we provide evidence that DGKα is required for the generation of phosphatidic acid required for tubular recycling endosome (TRE) biogenesis. Moreover, we show that DGKα forms a complex with the TRE hub protein, MICAL-L1. Given that MICAL-L1 and the F-BAR-containing membrane-tubulating protein Syndapin2 associate selectively with phosphatidic acid, we propose a positive feedback loop in which DGKα generates phosphatidic acid to drive its own recruitment to TRE via its interaction with MICAL-L1. Our data support a novel role for the involvement of DGKα in TRE biogenesis and MHC I recycling. PMID:25248744

  17. Covalent assembly of a soluble T cell receptor-peptide-major histocompatibility class I complex.

    PubMed Central

    Grégoire, C; Lin, S Y; Mazza, G; Rebai, N; Luescher, I F; Malissen, B

    1996-01-01

    We used stepwise photochemical cross-linking for specifically assembling soluble and covalent complexes made of a T-cell antigen receptor (TCR) and a class I molecule of the major histocompatibility complex (MHC) bound to an antigenic peptide. For that purpose, we have produced in myeloma cells a single-chain Fv construct of a TCR specific for a photoreactive H-2Kd-peptide complex. Photochemical cross-linking of this TCR single-chain Fv with a soluble form of the photoreactive H-2Kd-peptide ligand resulted in the formation of a ternary covalent complex. We have characterized the soluble ternary complex and showed that it reacted with antibodies specific for epitopes located either on the native TCR or on the Kd molecules. By preventing the fast dissociation kinetics observed with most T cell receptors, this approach provides a means of preparing soluble TCR-peptide-MHC complexes on large-scale levels. Images Fig. 3 Fig. 4 PMID:8692966

  18. Recombination and selection in the major histocompatibility complex of the endangered forest musk deer (Moschus berezovskii).

    PubMed

    Cai, Ruibo; Shafer, Aaron B A; Laguardia, Alice; Lin, Zhenzhen; Liu, Shuqiang; Hu, Defu

    2015-01-01

    The forest musk deer (Moschus berezovskii) is a high elevation species distributed across western China and northern Vietnam. Once abundant, habitat loss and poaching has led to a dramatic decrease in population numbers prompting the IUCN to list the species as endangered. Here, we characterized the genetic diversity of a Major Histocompatibility Complex (MHC) locus and teased apart driving factors shaping its variation. Seven DRB exon 2 alleles were identified among a group of randomly sampled forest musk deer from a captive population in the Sichuan province of China. Compared to other endangered or captive ungulates, forest musk deer have relatively low levels of MHC genetic diversity. Non-synonymous substitutions primarily occurred in the putative peptide-binding region (PBR), with analyses suggesting that recombination and selection has shaped the genetic diversity across the locus. Specifically, inter-allelic recombination generated novel allelic combinations, with evidence for both positive selection acting on the PBR and negative selection on the non-PBR. An improved understanding of functional genetic variability of the MHC will facilitate better design and management of captive breeding programs for this endangered species. PMID:26603338

  19. Structure and function of the non-classical major histocompatibility complex molecule MR1.

    PubMed

    Krovi, S Harsha; Gapin, Laurent

    2016-08-01

    Polymorphic major histocompatibility complex (MHC) molecules play a central role in the vertebrate adaptive immune system. By presenting short peptides derived from pathogen-derived proteins, these "classical" MHC molecules can alert the T cell branch of the immune system of infected cells and clear the pathogen. There exist other "non-classical" MHC molecules, which while similar in structure to classical MHC proteins, are contrasted by their limited polymorphism. While the functions of many class Ib MHC molecules have still to be elucidated, the nature and diversity of antigens (if any) that some of them might present to the immune system is expected to be more restricted and might function as another approach to distinguish self from non-self. The MHC-related 1 (MR1) molecule is a member of this family of non-classical MHC proteins. It was recently shown to present unique antigens in the form of vitamin metabolites found in certain microbes. MR1 is strongly conserved genetically, structurally, and functionally through mammalian evolution, indicating its necessity in ensuring an effective immune system for members of this class. Although MR1 will be celebrating 21 years this year since its discovery, most of our understanding of how this molecule functions has only been uncovered in the past decade. Herein, we discuss where MR1 is expressed, how it selectively is able to bind to its appropriate antigens and how it, then, is able to specifically activate a distinct population of T cells. PMID:27448212

  20. Effects of major histocompatibility complex class II knockout on mouse bone mechanical properties during development.

    PubMed

    Simske, Steven J; Bateman, Ted A; Smith, Erin E; Ferguson, Virginia L; Chapes, Stephen K

    2002-01-01

    We investigated the effect of major histocompatibility complex class II (MHC II) knockout on the development of the mouse peripheral skeleton. These C2D mice had less skeletal development at 8, 12 and 16 weeks of age compared to wild-type C57BL/6J (B6) male mice. The C2D mice had decreased femur mechanical, geometric and compositional measurements compared to wild type mice at each of these ages. C2D femur stiffness (S), peak force in 3-pt bending (Pm), and mineral mass (Min-M) were 74%, 64% and 66%, respectively, of corresponding B6 values at 8 weeks of age. Similar differences were measured at 12 weeks (for which C2D femoral S, Pm and Min-M were 71%, 72% and 73%, respectively, of corresponding B6 values) and at 16 weeks (for which C2D femoral S, Pm and Min-M were 80%, 66% and 61%, respectively, of corresponding B6 values). MHC II knockout delays the development of adult bone properties and is accompanied by lower body mass compared to wild-type controls. PMID:12085652

  1. High-Resolution Patterns of Meiotic Recombination across the Human Major Histocompatibility Complex

    PubMed Central

    Cullen, Michael; Perfetto, Stephen P.; Klitz, William; Nelson, George; Carrington, Mary

    2002-01-01

    Definitive characteristics of meiotic recombination events over large (i.e., >1 Mb) segments of the human genome remain obscure, yet they are essential for establishing the haplotypic structure of the genome and for efficient mapping of complex traits. We present a high-resolution map of recombination at the kilobase level across a 3.3-Mb interval encompassing the major histocompatibility complex (MHC). Genotyping of 20,031 single sperm from 12 individuals resulted in the identification and fine mapping of 325 recombinant chromosomes within genomic intervals as small as 7 kb. Several principal characteristics of recombination in this region were observed: (1) rates of recombination can differ significantly between individuals; (2) intense hot spots of recombination occur at least every 0.8 Mb but are not necessarily evenly spaced; (3) distribution in the location of recombination events can differ significantly among individuals; (4) between hot spots, low levels of recombination occur fairly evenly across 100-kb segments, suggesting the presence of warm spots of recombination; and (5) specific sequence motifs associate significantly with recombination distribution. These data provide a plausible model for recombination patterns of the human genome overall. PMID:12297984

  2. Major histocompatibility complex selection dynamics in pathogen-infected túngara frog (Physalaemus pustulosus) populations.

    PubMed

    Kosch, Tiffany A; Bataille, Arnaud; Didinger, Chelsea; Eimes, John A; Rodríguez-Brenes, Sofia; Ryan, Michael J; Waldman, Bruce

    2016-08-01

    Pathogen-driven selection can favour major histocompatibility complex (MHC) alleles that confer immunological resistance to specific diseases. However, strong directional selection should deplete genetic variation necessary for robust immune function in the absence of balancing selection or challenges presented by other pathogens. We examined selection dynamics at one MHC class II (MHC-II) locus across Panamanian populations of the túngara frog, Physalaemus pustulosus, infected by the amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd). We compared MHC-II diversity in highland túngara frog populations, where amphibian communities have experienced declines owing to Bd, with those in the lowland region that have shown no evidence of decline. Highland region frogs had MHC variants that confer resistance to Bd. Variant fixation appeared to occur by directional selection rather than inbreeding, as overall genetic variation persisted in populations. In Bd-infected lowland sites, however, selective advantage may accrue to individuals with only one Bd-resistance allele, which were more frequent. Environmental conditions in lowlands should be less favourable for Bd infection, which may reduce selection for specific Bd resistance in hosts. Our results suggest that MHC selection dynamics fluctuate in túngara frog populations as a function of the favourability of habitat to pathogen spread and the vulnerability of hosts to infection. PMID:27531158

  3. Neurotrophins inhibit major histocompatibility class II inducibility of microglia: Involvement of the p75 neurotrophin receptor

    PubMed Central

    Neumann, Harald; Misgeld, Thomas; Matsumuro, Kenji; Wekerle, Hartmut

    1998-01-01

    Major histocompatibility complex (MHC) molecules are rare in the healthy brain tissue, but are heavily expressed on microglial cells after inflammatory or neurodegenerative processes. We studied the conditions leading to the induction of MHC class II molecules in microglia by using explant cultures of neonatal rat hippocampus, a model of interacting neuronal networks. Interferon-γ (IFN-γ)-dependent MHC class II inducibility in microglia cells was very low, but strongly increased in the hippocampal slices after the blockade of neuronal activity by neurotoxins [tetrodotoxin (TTX), ω-conotoxin] or glutamate antagonists. None of these agents acted directly on isolated microglia cells. We found that neurotrophins modulate microglial MHC class II expression. MHC class II inducibility was enhanced by neutralization of neurotrophins produced locally within the cultured tissues and was inhibited by the addition of nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), or neurotrophin-3 (NT3). NGF and, to a lower extent, NT3 acted directly on isolated microglia via the p75 neurotrophin receptor and inhibited MHC class II inducibility as shown by blockade of the p75 neurotrophin receptor with antibodies. Our data suggest that neurotrophins secreted by electrically active neurons control the antigen-presenting potential of microglia cells, and indicate that this effect is mediated partly via the p75 neurotrophin receptor. PMID:9576961

  4. Efficient major histocompatibility complex class I presentation of exogenous antigen upon phagocytosis by macrophages.

    PubMed Central

    Kovacsovics-Bankowski, M; Clark, K; Benacerraf, B; Rock, K L

    1993-01-01

    Antigens in extracellular fluids can be processed and presented with major histocompatibility complex (MHC) class I molecules by a subset of antigen presenting cells (APCs). Chicken egg ovalbumin (Ova) linked to beads was presented with MHC class I molecules by these cells up to 10(4)-fold more efficiently than soluble Ova. This enhanced presentation was observed with covalently or noncovalently linked Ova and with beads of different compositions. A key parameter in the activity of these conjugates was the size of the beads. The APC that is responsible for this form of presentation is a macrophage. These cells internalize the antigen constructs through phagocytosis, since cytochalasin B inhibited presentation. Processing of the antigen and association with MHC class I molecules appears to occur intracellularly as presentation was observed under conditions where there was no detectable release of peptides into the extracellular fluids. When injected in vivo in C57BL/6 mice, Ova-beads, but not soluble Ova, primed CD4- CD8+ cytotoxic T lymphocytes (CTLs). Similar results were obtained in BALB/c mice immunized with beta-galactosidase-beads. The implications of these findings for development of nonliving vaccines that stimulate CTL immunity are discussed. PMID:8506338

  5. Adaptive tolerance to a pathogenic fungus drives major histocompatibility complex evolution in natural amphibian populations

    PubMed Central

    Savage, Anna E.; Zamudio, Kelly R.

    2016-01-01

    Amphibians have been affected globally by the disease chytridiomycosis, caused by the fungus Batrachochytrium dendrobatidis (Bd), and we are just now beginning to understand how immunogenetic variability contributes to disease susceptibility. Lineages of an expressed major histocompatibility complex (MHC) class II locus involved in acquired immunity are associated with chytridiomycosis susceptibility in controlled laboratory challenge assays. Here, we extend these findings to natural populations that vary both in exposure and response to Bd. We find that MHC alleles and supertypes associated with Bd survival in the field show a molecular signal of positive selection, while those associated with susceptibility do not, supporting the hypothesis that heritable Bd tolerance is rapidly evolving. We compare MHC supertypes to neutral loci to demonstrate where selection versus demography is shaping MHC variability. One population with Bd tolerance in nature shows a significant signal of directional selection for the same allele (allele Q) that was significantly associated with survival in an earlier laboratory study. Our findings indicate that selective pressure for Bd survival drives rapid immunogenetic adaptation in some natural populations, despite differences in environment and demography. Our field-based analysis of immunogenetic variation confirms that natural amphibian populations have the evolutionary potential to adapt to chytridiomycosis. PMID:27009220

  6. T cell receptor reversed polarity recognition of a self-antigen major histocompatibility complex.

    PubMed

    Beringer, Dennis X; Kleijwegt, Fleur S; Wiede, Florian; van der Slik, Arno R; Loh, Khai Lee; Petersen, Jan; Dudek, Nadine L; Duinkerken, Gaby; Laban, Sandra; Joosten, Antoinette; Vivian, Julian P; Chen, Zhenjun; Uldrich, Adam P; Godfrey, Dale I; McCluskey, James; Price, David A; Radford, Kristen J; Purcell, Anthony W; Nikolic, Tatjana; Reid, Hugh H; Tiganis, Tony; Roep, Bart O; Rossjohn, Jamie

    2015-11-01

    Central to adaptive immunity is the interaction between the αβ T cell receptor (TCR) and peptide presented by the major histocompatibility complex (MHC) molecule. Presumably reflecting TCR-MHC bias and T cell signaling constraints, the TCR universally adopts a canonical polarity atop the MHC. We report the structures of two TCRs, derived from human induced T regulatory (iT(reg)) cells, complexed to an MHC class II molecule presenting a proinsulin-derived peptide. The ternary complexes revealed a 180° polarity reversal compared to all other TCR-peptide-MHC complex structures. Namely, the iT(reg) TCR α-chain and β-chain are overlaid with the α-chain and β-chain of MHC class II, respectively. Nevertheless, this TCR interaction elicited a peptide-reactive, MHC-restricted T cell signal. Thus TCRs are not 'hardwired' to interact with MHC molecules in a stereotypic manner to elicit a T cell signal, a finding that fundamentally challenges our understanding of TCR recognition. PMID:26437244

  7. Inhibition of selective signaling events in natural killer cells recognizing major histocompatibility complex class I.

    PubMed Central

    Kaufman, D S; Schoon, R A; Robertson, M J; Leibson, P J

    1995-01-01

    Many studies have characterized the transmembrane signaling events initiated after T-cell antigen receptor recognition of major histocompatibility complex (MHC)-bound peptides. Yet, little is known about signal transduction from a set of MHC class I recognizing receptors on natural killer (NK) cells whose ligation dramatically inhibits NK cell-mediated killing. In this study we evaluated the influence of MHC recognition on the proximal signaling events in NK cells binding tumor targets. We utilized two experimental models where NK cell-mediated cytotoxicity was fully inhibited by the recognition of specific MHC class I molecules. NK cell binding to either class I-deficient or class I-transfected target cells initiated rapid protein tyrosine kinase activation. In contrast, whereas NK cell binding to class I-deficient targets led to inositol phosphate release and increased intracellular free calcium ([Ca2+]i), NK recognition of class I-bearing targets did not induce the activation of these phospholipase C-dependent signaling events. The recognition of class I by NK cells clearly had a negative regulatory effect since blocking this interaction using anti-class I F(ab')2 fragments increased inositol 1,4,5-trisphosphate release and [Ca2+]i and increased the lysis of the targets. These results suggest that one of the mechanisms by which NK cell recognition of specific MHC class I molecules can block the development of cell-mediated cytotoxicity is by inhibiting specific critical signaling events. Images Fig. 2 Fig. 4 PMID:7604018

  8. Major Histocompatibility Complex I Expression by Motor Neurons and Its Implication in Amyotrophic Lateral Sclerosis

    PubMed Central

    Nardo, Giovanni; Trolese, Maria Chiara; Bendotti, Caterina

    2016-01-01

    Neuronal expression of major histocompatibility complex I (MHCI)-related molecules in adults and during CNS diseases is involved in the synaptic plasticity and axonal regeneration with mechanisms either dependent or independent of their immune functions. Motor neurons are highly responsive in triggering the expression of MHCI molecules during normal aging or following insults and diseases, and this has implications in the synaptic controls, axonal regeneration, and neuromuscular junction stability of these neurons. We recently reported that MHCI and immunoproteasome are strongly activated in spinal motor neurons and their peripheral motor axon in a mouse model of familial amyotrophic lateral sclerosis (ALS) during the course of the disease. This response was prominent in ALS mice with slower disease progression in which the axonal structure and function was better preserved than in fast-progressing mice. This review summarizes and discusses our observations in the light of knowledge about the possible role of MHCI in motor neurons providing additional insight into the pathophysiology of ALS. PMID:27379008

  9. Adaptive tolerance to a pathogenic fungus drives major histocompatibility complex evolution in natural amphibian populations.

    PubMed

    Savage, Anna E; Zamudio, Kelly R

    2016-03-30

    Amphibians have been affected globally by the disease chytridiomycosis, caused by the fungus Batrachochytrium dendrobatidis (Bd), and we are just now beginning to understand how immunogenetic variability contributes to disease susceptibility. Lineages of an expressed major histocompatibility complex (MHC) class II locus involved in acquired immunity are associated with chytridiomycosis susceptibility in controlled laboratory challenge assays. Here, we extend these findings to natural populations that vary both in exposure and response to Bd We find that MHC alleles and supertypes associated with Bd survival in the field show a molecular signal of positive selection, while those associated with susceptibility do not, supporting the hypothesis that heritable Bd tolerance is rapidly evolving. We compare MHC supertypes to neutral loci to demonstrate where selection versus demography is shaping MHC variability. One population with Bd tolerance in nature shows a significant signal of directional selection for the same allele (allele Q) that was significantly associated with survival in an earlier laboratory study. Our findings indicate that selective pressure for Bd survival drives rapid immunogenetic adaptation in some natural populations, despite differences in environment and demography. Our field-based analysis of immunogenetic variation confirms that natural amphibian populations have the evolutionary potential to adapt to chytridiomycosis. PMID:27009220

  10. Major histocompatibility complex peptide ligands as olfactory cues in human body odour assessment

    PubMed Central

    Milinski, Manfred; Croy, Ilona; Hummel, Thomas; Boehm, Thomas

    2013-01-01

    In many animal species, social communication and mate choice are influenced by cues encoded by the major histocompatibility complex (MHC). The mechanism by which the MHC influences sexual selection is a matter of intense debate. In mice, peptide ligands of MHC molecules activate subsets of vomeronasal and olfactory sensory neurons and influence social memory formation; in sticklebacks, such peptides predictably modify the outcome of mate choice. Here, we examine whether this evolutionarily conserved mechanism of interindividual communication extends to humans. In psychometric tests, volunteers recognized the supplementation of their body odour by MHC peptides and preferred ‘self’ to ‘non-self’ ligands when asked to decide whether the modified odour smelled ‘like themselves’ or ‘like their favourite perfume’. Functional magnetic resonance imaging indicated that ‘self’-peptides specifically activated a region in the right middle frontal cortex. Our results suggest that despite the absence of a vomeronasal organ, humans have the ability to detect and evaluate MHC peptides in body odour. This may provide a basis for the sensory evaluation of potential partners during human mate choice. PMID:23345577

  11. Expression of major histocompatibility complex class II antigens in porcine leptospiral nephritis.

    PubMed

    Radaelli, E; Del Piero, F; Aresu, L; Sciarrone, F; Vicari, N; Mattiello, S; Tagliabue, S; Fabbi, M; Scanziani, E

    2009-09-01

    Class II major histocompatibility complex (MHCII) is required for the presentation of antigens to CD4 helper T cells. During nephritis, not only primary antigen presenting cells such as histiocytes and lymphocytes, but also cytokine-stimulated tubular epithelial cells express MHCII. Leptospirosis in fattening pigs is characterized by several degrees of nephritis, from absence of lesions to severe multifocal tubulo-interstitial inflammation. Renal tissue from 20 8-month-old pigs with spontaneous nephritis and 6 control pigs without renal lesions were investigated for leptospirosis by indirect immunohistochemistry (IHC) and polymerase chain reaction (PCR). IHC for MHCII also was performed on renal samples. Serum samples were tested for different serovars of Leptospira interrogans. Control pigs were free of interstitial nephritis and negative for leptospirosis by all tests. In pigs with nephritis, serology was positive for serovar Pomona in 19/20 pigs. In 16 of these 19 pigs, leptospiral renal infection was confirmed by PCR and/or indirect IHC. Nephritic lesions were classified histologically into perivascular lymphocytic (4 pigs), lymphofollicular (6 pigs), lymphohistiocytic (8 pigs), and neutrophilic (2 pigs) pattern. MHCII expression by histiocytes and lymphocytes was observed in all lesions. Prominent MHCII expression in regenerating tubular epithelium was observed in lymphofollicular and lymphohistiocytic nephritis. No tubular colocalization between leptospiral and MHCII antigen was observed. Results suggest that during leptospiral nephritis, MHCII contributes to the intensity of the inflammatory response. Furthermore de novo MHCII expression in regenerating tubules may play a role in the defence mechanism against leptospiral tubular colonization. PMID:19179617

  12. Effects of major histocompatibility complex class II knockout on mouse bone mechanical properties during development

    NASA Technical Reports Server (NTRS)

    Simske, Steven J.; Bateman, Ted A.; Smith, Erin E.; Ferguson, Virginia L.; Chapes, Stephen K.

    2002-01-01

    We investigated the effect of major histocompatibility complex class II (MHC II) knockout on the development of the mouse peripheral skeleton. These C2D mice had less skeletal development at 8, 12 and 16 weeks of age compared to wild-type C57BL/6J (B6) male mice. The C2D mice had decreased femur mechanical, geometric and compositional measurements compared to wild type mice at each of these ages. C2D femur stiffness (S), peak force in 3-pt bending (Pm), and mineral mass (Min-M) were 74%, 64% and 66%, respectively, of corresponding B6 values at 8 weeks of age. Similar differences were measured at 12 weeks (for which C2D femoral S, Pm and Min-M were 71%, 72% and 73%, respectively, of corresponding B6 values) and at 16 weeks (for which C2D femoral S, Pm and Min-M were 80%, 66% and 61%, respectively, of corresponding B6 values). MHC II knockout delays the development of adult bone properties and is accompanied by lower body mass compared to wild-type controls.

  13. Major histocompatibility complex diversity influences parasite resistance and innate immunity in sticklebacks.

    PubMed

    Kurtz, Joachim; Kalbe, Martin; Aeschlimann, Peter B; Häberli, Michael A; Wegner, K Mathias; Reusch, Thorsten B H; Milinski, Manfred

    2004-01-22

    Proteins of the major histocompatibility complex (MHC) play a central role in the presentation of antigens to the adaptive immune system. The MHC also influences the odour-based choice of mates in humans and several animal taxa. It has recently been shown that female three-spined sticklebacks (Gasterosteus aculeatus) aim at a moderately high MHC diversity in their offspring when choosing a mate. Do they optimize the immune systems of their offspring? Using three-spined sticklebacks that varied in their individual numbers of MHC class IIB molecules, we tested, experimentally, whether allelic diversity at the MHC influences parasite resistance and immune parameters. We found that sticklebacks with low MHC diversity suffered more from parasite infection after experimental exposure to Schistocephalus solidus tapeworms and Glugea anomala microsporidians. They also showed the highest proportion of granulocytes and the strongest respiratory burst reaction, which are correlates of innate immunity. This indicates a strong activity of the innate immune system after challenge by parasites when MHC diversity is suboptimal. Individuals with very high allelic diversity at the MHC seemed inferior to those with moderately high diversity. Such a pattern is consistent with theoretical expectations of an optimal balance between the number of recognizable antigens and self-tolerance. PMID:15058398

  14. Recombination and selection in the major histocompatibility complex of the endangered forest musk deer (Moschus berezovskii)

    PubMed Central

    Cai, Ruibo; Shafer, Aaron B.A.; Laguardia, Alice; Lin, Zhenzhen; Liu, Shuqiang; Hu, Defu

    2015-01-01

    The forest musk deer (Moschus berezovskii) is a high elevation species distributed across western China and northern Vietnam. Once abundant, habitat loss and poaching has led to a dramatic decrease in population numbers prompting the IUCN to list the species as endangered. Here, we characterized the genetic diversity of a Major Histocompatibility Complex (MHC) locus and teased apart driving factors shaping its variation. Seven DRB exon 2 alleles were identified among a group of randomly sampled forest musk deer from a captive population in the Sichuan province of China. Compared to other endangered or captive ungulates, forest musk deer have relatively low levels of MHC genetic diversity. Non-synonymous substitutions primarily occurred in the putative peptide-binding region (PBR), with analyses suggesting that recombination and selection has shaped the genetic diversity across the locus. Specifically, inter-allelic recombination generated novel allelic combinations, with evidence for both positive selection acting on the PBR and negative selection on the non-PBR. An improved understanding of functional genetic variability of the MHC will facilitate better design and management of captive breeding programs for this endangered species. PMID:26603338

  15. Enhanced Direct Major Histocompatibility Complex Class I Self-Antigen Presentation Induced by Chlamydia Infection

    PubMed Central

    Cram, Erik D.; Simmons, Ryan S.; Palmer, Amy L.; Hildebrand, William H.; Rockey, Daniel D.

    2015-01-01

    The direct major histocompatibility complex (MHC) class I antigen presentation pathway ensures intracellular peptides are displayed at the cellular surface for recognition of infected or transformed cells by CD8+ cytotoxic T lymphocytes. Chlamydia spp. are obligate intracellular bacteria and, as such, should be targeted by CD8+ T cells. It is likely that Chlamydia spp. have evolved mechanisms to avoid the CD8+ killer T cell responses by interfering with MHC class I antigen presentation. Using a model system of self-peptide presentation which allows for posttranslational control of the model protein's stability, we tested the ability of various Chlamydia species to alter direct MHC class I antigen presentation. Infection of the JY lymphoblastoid cell line limited the accumulation of a model host protein and increased presentation of the model-protein-derived peptides. Enhanced self-peptide presentation was detected only when presentation was restricted to defective ribosomal products, or DRiPs, and total MHC class I levels remained unaltered. Skewed antigen presentation was dependent on a bacterial synthesized component, as evidenced by reversal of the observed phenotype upon preventing bacterial transcription, translation, and the inhibition of bacterial lipooligosaccharide synthesis. These data suggest that Chlamydia spp. have evolved to alter the host antigen presentation machinery to favor presentation of defective and rapidly degraded forms of self-antigen, possibly as a mechanism to diminish the presentation of peptides derived from bacterial proteins. PMID:26597986

  16. Activated rat T cells synthesize and express functional major histocompatibility class II antigens.

    PubMed Central

    Broeren, C P; Wauben, M H; Lucassen, M A; Van Meurs, M; Van Kooten, P J; Boog, C J; Claassen, E; Van Eden, W

    1995-01-01

    In the present report, we studied the presence and functional significance of major histocompatibility complex (MHC) class II antigen on rat T cells. Most rat T-cell lines cultured in vitro were found to be MHC class II+. Also, these T-cell lines were shown to synthesize MHC class II molecules. Immunohistochemical and flow cytometric double stainings for T-cell receptor (TCR) and MHC class II showed that in vivo as well a large proportion of T cells was MHC class II+. The immunohistochemical staining of spleen sections enabled us to characterize the MHC class II+ and MHC class II- T cells. It was shown that resting T cells in vivo were MHC class II-. In contrast, activated T cells, as determined by their localization in the marginal zone of the spleen, proved to be MHC class II+. Finally, T-cell clones were found to be able to present peptidic antigens, but could only poorly present more complex exogenous antigens, probably due to inefficient uptake of such antigens. These features would endow activated rat T cells with the capacity to present cell-specific self-proteins, such as TCR, to regulatory CD4+ MHC class II-restricted T cells, as was described by our group elsewhere. Images Figure 2 Figure 5 PMID:7750994

  17. Major histocompatibility complex peptide ligands as olfactory cues in human body odour assessment.

    PubMed

    Milinski, Manfred; Croy, Ilona; Hummel, Thomas; Boehm, Thomas

    2013-03-22

    In many animal species, social communication and mate choice are influenced by cues encoded by the major histocompatibility complex (MHC). The mechanism by which the MHC influences sexual selection is a matter of intense debate. In mice, peptide ligands of MHC molecules activate subsets of vomeronasal and olfactory sensory neurons and influence social memory formation; in sticklebacks, such peptides predictably modify the outcome of mate choice. Here, we examine whether this evolutionarily conserved mechanism of interindividual communication extends to humans. In psychometric tests, volunteers recognized the supplementation of their body odour by MHC peptides and preferred 'self' to 'non-self' ligands when asked to decide whether the modified odour smelled 'like themselves' or 'like their favourite perfume'. Functional magnetic resonance imaging indicated that 'self'-peptides specifically activated a region in the right middle frontal cortex. Our results suggest that despite the absence of a vomeronasal organ, humans have the ability to detect and evaluate MHC peptides in body odour. This may provide a basis for the sensory evaluation of potential partners during human mate choice. PMID:23345577

  18. Cyclophilin C Participates in the US2-Mediated Degradation of Major Histocompatibility Complex Class I Molecules

    PubMed Central

    Chapman, Daniel C.; Stocki, Pawel; Williams, David B.

    2015-01-01

    Human cytomegalovirus uses a variety of mechanisms to evade immune recognition through major histocompatibility complex class I molecules. One mechanism mediated by the immunoevasin protein US2 causes rapid disposal of newly synthesized class I molecules by the endoplasmic reticulum-associated degradation pathway. Although several components of this degradation pathway have been identified, there are still questions concerning how US2 targets class I molecules for degradation. In this study we identify cyclophilin C, a peptidyl prolyl isomerase of the endoplasmic reticulum, as a component of US2-mediated immune evasion. Cyclophilin C could be co-isolated with US2 and with the class I molecule HLA-A2. Furthermore, it was required at a particular expression level since depletion or overexpression of cyclophilin C impaired the degradation of class I molecules. To better characterize the involvement of cyclophilin C in class I degradation, we used LC-MS/MS to detect US2-interacting proteins that were influenced by cyclophilin C expression levels. We identified malectin, PDIA6, and TMEM33 as proteins that increased in association with US2 upon cyclophilin C knockdown. In subsequent validation all were shown to play a functional role in US2 degradation of class I molecules. This was specific to US2 rather than general ER-associated degradation since depletion of these proteins did not impede the degradation of a misfolded substrate, the null Hong Kong variant of α1-antitrypsin. PMID:26691022

  19. Structure and Polymorphism of the Major Histocompatibility Complex Class II Region in the Japanese Crested Ibis, Nipponia nippon

    PubMed Central

    Taniguchi, Yukio; Matsumoto, Keisuke; Matsuda, Hirokazu; Yamada, Takahisa; Sugiyama, Toshie; Homma, Kosuke; Kaneko, Yoshinori; Yamagishi, Satoshi; Iwaisaki, Hiroaki

    2014-01-01

    The major histocompatibility complex (MHC) is a highly polymorphic genomic region that plays a central role in the immune system. Despite its functional consistency, the genomic structure of the MHC differs substantially among organisms. In birds, the MHC-B structures of Galliformes, including chickens, have been well characterized, but information about other avian MHCs remains sparse. The Japanese Crested Ibis (Nipponia nippon, Pelecaniformes) is an internationally conserved, critically threatened species. The current Japanese population of N. nippon originates from only five founders; thus, understanding the genetic diversity among these founders is critical for effective population management. Because of its high polymorphism and importance for disease resistance and other functions, the MHC has been an important focus in the conservation of endangered species. Here, we report the structure and polymorphism of the Japanese Crested Ibis MHC class II region. Screening of genomic libraries allowed the construction of three contigs representing different haplotypes of MHC class II regions. Characterization of genomic clones revealed that the MHC class II genomic structure of N. nippon was largely different from that of chicken. A pair of MHC-IIA and -IIB genes was arranged head-to-head between the COL11A2 and BRD2 genes. Gene order in N. nippon was more similar to that in humans than to that in chicken. The three haplotypes contained one to three copies of MHC-IIA/IIB gene pairs. Genotyping of the MHC class II region detected only three haplotypes among the five founders, suggesting that the genetic diversity of the current Japanese Crested Ibis population is extremely low. The structure of the MHC class II region presented here provides valuable insight for future studies on the evolution of the avian MHC and for conservation of the Japanese Crested Ibis. PMID:25247679

  20. Selection, trans-species polymorphism, and locus identification of major histocompatibility complex class IIβ alleles of New World ranid frogs

    USGS Publications Warehouse

    Kiemnec-Tyburczy, Karen M.; Richmond, Jonathan Q.; Savage, Anna E.; Zamudio, Kelly R.

    2010-01-01

    Genes encoded by the major histocompatibility complex (MHC) play key roles in the vertebrate immune system. However, our understanding of the evolutionary processes and underlying genetic mechanisms shaping these genes is limited in many taxa, including amphibians, a group currently impacted by emerging infectious diseases. To further elucidate the evolution of the MHC in frogs (anurans) and develop tools for population genetics, we surveyed allelic diversity of the MHC class II ??1 domain in both genomic and complementary DNA of seven New World species in the genus Rana (Lithobates). To assign locus affiliation to our alleles, we used a "gene walking" technique to obtain intron 2 sequences that flanked MHC class II?? exon 2. Two distinct intron sequences were recovered, suggesting the presence of at least two class II?? loci in Rana. We designed a primer pair that successfully amplified an orthologous locus from all seven Rana species. In total, we recovered 13 alleles and documented trans-species polymorphism for four of the alleles. We also found quantitative evidence of selection acting on amino acid residues that are putatively involved in peptide binding and structural stability of the ??1 domain of anurans. Our results indicated that primer mismatch can result in polymerase chain reaction (PCR) bias, which influences the number of alleles that are recovered. Using a single locus may minimize PCR bias caused by primer mismatch, and the gene walking technique was an effective approach for generating single-copy orthologous markers necessary for future studies of MHC allelic variation in natural amphibian populations. ?? 2010 Springer-Verlag.

  1. Major histocompatibility complex class II deficiency complicated by Mycobacterium avium complex in a boy of mixed ethnicity.

    PubMed

    Dimitrova, Dimana; Ong, Peck Y; O'Gorman, Maurice R G; Church, Joseph A

    2014-08-01

    Major histocompatibility complex class II (MHCII) deficiency represents a rare form of severe immunodeficiency associated with increased susceptibility to viral, bacterial, and fungal pathogens and commonly leads to failure to thrive and early death. This autosomal recessive disorder is caused by mutations in MHCII transcription regulator genes, resulting in impaired expression of MHCII, and it is usually seen in consanguineous populations. Our patient presented at age 15 months with a history of developmental delay, multiple respiratory infections and skin abscesses, and recently, at 5 years of age, he was found to have disseminated Mycobacterium avium complex. His mother is Mexican-American, and his father is Persian. Laboratory investigations showed hypogammaglobulinemia, modest T-lymphopenia, borderline mitogen responses, absent tetanus toxoid and candida antigen lymphoproliferative assays, and absent tetanus toxoid and Haemophilus influenzae type b antibody levels. Flow cytometry demonstrated absent HLA-DR antigen on monocytes and B-cells, and a diagnosis of MHCII deficiency was made. Genetic analysis yielded a homozygous pathogenic class II transactivator (CIITA) mutation. The same mutation was found in both parents. Coincidently, an Xq28 microduplication was identified and likely was the cause of the patient's developmental delay. This patient demonstrated some of the typical features of MHCII deficiency with the addition of several unique findings: disseminated M. avium complex, homozygosity in a CIITA mutation despite remarkably diverse parental ethnicity, and coincident Xq28 microdeletion with mild intellectual disability. PMID:24789686

  2. Biosynthesis of major histocompatibility complex molecules and generation of T cells in Ii TAP1 double-mutant mice.

    PubMed Central

    Tourne, S; van Santen, H M; van Roon, M; Berns, A; Benoist, C; Mathis, D; Ploegh, H

    1996-01-01

    Major histocompatibility complex (MHC) class I and II molecules are loaded with peptides in distinct subcellular compartments. The transporter associated with antigen processing (TAP) is responsible for delivering peptides derived from cytosolic proteins to the endoplasmic reticulum, where they bind to class I molecules, while the invariant chain (Ii) directs class II molecules to endosomal compartments, where they bind peptides originating mostly from exogenous sources. Mice carrying null mutations of the TAP1 or Ii genes (TAP10) or Ii0, respectively) have been useful tools for elucidating the two MHC/peptide loading pathways. To evaluate to what extent these pathways functionally intersect, we have studied the biosynthesis of MHC molecules and the generation of T cells in Ii0TAP10 double-mutant mice. We find that the assembly and expression of class II molecules in Ii0 and Ii0TAP10 animals are indistinguishable and that formation and display of class I molecules is the same in TAP10 and Ii0TAP10 animals. Thymic selection in the double mutants is as expected, with reduced numbers of both CD4+ CD8- and CD4- CD8+ thymocyte compartments. Surprisingly, lymph node T-cell populations look almost normal; we propose that population expansion of peripheral T cells normalizes the numbers of CD4+ and CD8+ cells in Ii0TAP10 mice. Images Fig. 1 Fig. 2 PMID:8643655

  3. Human chromosome 16 encodes a factor involved in induction of class II major histocompatibility antigens by interferon gamma.

    PubMed Central

    Bono, M R; Alcaïde-Loridan, C; Couillin, P; Letouzé, B; Grisard, M C; Jouin, H; Fellous, M

    1991-01-01

    Interferon gamma (IFN-gamma) induces expression of class II major histocompatibility complex (MHC)-encoded antigens in immunocompetent cells. To gain further insight into the mechanism of this induction, we prepared somatic cell hybrids between different human cell lines and a murine cell line, RAG, that does not express murine class II MHC antigens before or after treatment with murine IFN-gamma. Some of the resulting cell hybrids express murine class II MHC antigens when treated with murine IFN-gamma. This inducible phenotype is correlated with the presence of human chromosome 16. It has been shown previously that the induction of class I MHC antigens by human IFN-gamma in human-rodent hybrids requires the presence of species-specific factors encoded by chromosome 6, which bears the gene for the human IFN-gamma receptor, and chromosome 21, whose product(s) is necessary for the transduction of human IFN-gamma signals. In this report, we show that the induction of murine class II MHC antigens by human IFN-gamma in the human-RAG cell hybrids requires, likewise, the presence of human chromosomes 6 and 21, in addition to chromosome 16. In some of these hybrids, when all three of these human chromosomes were present, induction of cell-surface HLA-DR antigens was also observed. Our results demonstrate that human chromosome 16 encodes a non-species-specific factor involved in the induction of class II MHC antigens by IFN-gamma. Images PMID:1906174

  4. Characterization of the human CD4(+) T-cell repertoire specific for major histocompatibility class I-restricted antigens.

    PubMed

    Legoux, François; Gautreau, Laetitia; Hesnard, Leslie; Leger, Alexandra; Moyon, Melinda; Devilder, Marie-Claire; Bonneville, Marc; Saulquin, Xavier

    2013-12-01

    While CD4(+) T lymphocytes usually recognize antigens in the context of major histocompatibility (MHC) class II alleles, occurrence of MHC class-I restricted CD4(+) T cells has been reported sporadically. Taking advantage of a highly sensitive MHC tetramer-based enrichment approach allowing detection and isolation of scarce Ag-specific T cells, we performed a systematic comparative analysis of HLA-A*0201-restricted CD4(+) and CD8(+) T-cell lines directed against several immunodominant viral or tumoral antigens. CD4(+) T cells directed against every peptide-MHC class I complexes tested were detected in all donors. These cells yielded strong cytotoxic and T helper 1 cytokine responses when incubated with HLA-A2(+) target cells carrying the relevant epitopes. HLA-A2-restricted CD4(+) T cells were seldom expanded in immune HLA-A2(+) donors, suggesting that they are not usually engaged in in vivo immune responses against the corresponding peptide-MHC class I complexes. However, these T cells expressed TCR of very high affinity and were expanded following ex vivo stimulation by relevant tumor cells. Therefore, we describe a versatile and efficient strategy for generation of MHC class-I restricted T helper cells and high affinity TCR that could be used for adoptive T-cell transfer- or TCR gene transfer-based immunotherapies. PMID:23963968

  5. Elevation of soluble major histocompatibility complex class I related chain A protein in malignant and infectious diseases in Chinese patients

    PubMed Central

    2012-01-01

    Background Elevation of soluble major histocompatibility complex class I chain-related gene A (sMICA) products in serum has been linked to tissue/organ transplantation, autoimmune diseases and some malignant disorders. Cells infected by microbiological pathogens may release sMICA, whereas less is known whether and to what extent serum sMICA levels may change in infectious diseases. Methods The present study determined serum sMICA levels by enzyme-linked immunosorbent assay (ELISA) in a southern China population, including patients (n = 1041) suffering from several types of malignant and infectious diseases and healthy controls (n = 141). Results Relative to controls, serum sMICA elevation was significant in patients of hepatic cancer, and was approaching statistical significance in patients with lung, gastric and nasopharyngeal cancers. sMICA elevation was also associated with some bacterial (Enterobacteriaceae, Mycobacterium tuberculosis, non-fermenting Gram-negative bacteria and Gram-positive cocci), viral (hepatitis B and C) and the Microspironema pallidum infections. Conclusion Serum sMICA levels may be informative for the diagnosis of some malignant and infectious diseases. The results also indicate that microbiological infections should be considered as a potential confounding clinical condition causing serum sMICA elevation while using this test to evaluate the status of other disorders, such as cancers, host-graft response and autoimmune diseases. PMID:23181907

  6. Duplication and population dynamics shape historic patterns of selection and genetic variation at the major histocompatibility complex in rodents

    PubMed Central

    Winternitz, Jamie C; Wares, John P

    2013-01-01

    Genetic variation at the major histocompatibility complex (MHC) is vitally important for wildlife populations to respond to pathogen threats. As natural populations can fluctuate greatly in size, a key issue concerns how population cycles and bottlenecks that could reduce genetic diversity will influence MHC genes. Using 454 sequencing, we characterized genetic diversity at the DRB Class II locus in montane voles (Microtus montanus), a North American rodent that regularly undergoes high-amplitude fluctuations in population size. We tested for evidence of historic balancing selection, recombination, and gene duplication to identify mechanisms maintaining allelic diversity. Counter to our expectations, we found strong evidence of purifying selection acting on the DRB locus in montane voles. We speculate that the interplay between population fluctuations and gene duplication might be responsible for the weak evidence of historic balancing selection and strong evidence of purifying selection detected. To further explore this idea, we conducted a phylogenetically controlled comparative analysis across 16 rodent species with varying demographic histories and MHC duplication events (based on the maximum number of alleles detected per individual). On the basis of phylogenetic generalized linear model-averaging, we found evidence that the estimated number of duplicated loci was positively related to allelic diversity and, surprisingly, to the strength of purifying selection at the DRB locus. Our analyses also revealed that species that had undergone population bottlenecks had lower allelic richness than stable species. This study highlights the need to consider demographic history and genetic structure alongside patterns of natural selection to understand resulting patterns of genetic variation at the MHC. PMID:23789067

  7. Duplication and population dynamics shape historic patterns of selection and genetic variation at the major histocompatibility complex in rodents.

    PubMed

    Winternitz, Jamie C; Wares, John P

    2013-06-01

    Genetic variation at the major histocompatibility complex (MHC) is vitally important for wildlife populations to respond to pathogen threats. As natural populations can fluctuate greatly in size, a key issue concerns how population cycles and bottlenecks that could reduce genetic diversity will influence MHC genes. Using 454 sequencing, we characterized genetic diversity at the DRB Class II locus in montane voles (Microtus montanus), a North American rodent that regularly undergoes high-amplitude fluctuations in population size. We tested for evidence of historic balancing selection, recombination, and gene duplication to identify mechanisms maintaining allelic diversity. Counter to our expectations, we found strong evidence of purifying selection acting on the DRB locus in montane voles. We speculate that the interplay between population fluctuations and gene duplication might be responsible for the weak evidence of historic balancing selection and strong evidence of purifying selection detected. To further explore this idea, we conducted a phylogenetically controlled comparative analysis across 16 rodent species with varying demographic histories and MHC duplication events (based on the maximum number of alleles detected per individual). On the basis of phylogenetic generalized linear model-averaging, we found evidence that the estimated number of duplicated loci was positively related to allelic diversity and, surprisingly, to the strength of purifying selection at the DRB locus. Our analyses also revealed that species that had undergone population bottlenecks had lower allelic richness than stable species. This study highlights the need to consider demographic history and genetic structure alongside patterns of natural selection to understand resulting patterns of genetic variation at the MHC. PMID:23789067

  8. Class I and class II major histocompatibility molecules play a role in bone marrow-derived macrophage development

    NASA Technical Reports Server (NTRS)

    Armstrong, J. W.; Simske, S. J.; Beharka, A. A.; Balch, S.; Luttges, M. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Class I and class II major histocompatibility complex (MHC) molecules play significant roles in T cell development and immune function. We show that MHCI- and MHCII-deficient mice have low numbers of macrophage precursors and circulating monocytes, as well as abnormal bone marrow cell colony-stimulating factor type 1 secretion and bone composition. We suggest that MHCI and MHCII molecules play a significant role in macrophage development.

  9. Major histocompatibility complex alleles associated with parasite susceptibility in wild giant pandas.

    PubMed

    Zhang, L; Wu, Q; Hu, Y; Wu, H; Wei, F

    2015-01-01

    Major histocompatibility complex (MHC) polymorphism is thought to be driven by antagonistic coevolution between pathogens and hosts, mediated through either overdominance or frequency-dependent selection. However, investigations under natural conditions are still rare for endangered mammals which often exhibit depleted variation, and the mechanism of selection underlying the maintenance of characteristics remains a considerable debate. In this study, 87 wild giant pandas were used to investigate MHC variation associated with parasite load. With the knowledge of the MHC profile provided by the genomic data of the giant panda, seven DRB1, seven DQA1 and eight DQA2 alleles were identified at each single locus. Positive selection evidenced by a significantly higher number of non-synonymous substitutions per non-synonymous codon site relative to synonymous substitutions per synonymous codon site could only be detected at the DRB1 locus, which leads to the speculation that DRB1 may have a more important role in dealing with parasite infection for pandas. Coprological analyses revealed that 55.17% of individuals exhibited infection with 1-2 helminthes and 95.3% of infected pandas carried Baylisascaris shroederi. Using a generalized linear model, we found that Aime-DRB1*10 was significantly associated with parasite infection, but no resistant alleles could be detected. MHC heterozygosity of the pandas was found to be uncorrelated with the infection status or the infection intensity. These results suggested that the possible selection mechanisms in extant wild pandas may be frequency dependent rather than being determined by overdominance selection. Our findings could guide the candidate selection for the ongoing reintroduction or translocation of pandas. PMID:25248466

  10. Microsatellite and major histocompatibility complex variation in an endangered rattlesnake, the Eastern Massasauga (Sistrurus catenatus).

    PubMed

    Jaeger, Collin P; Duvall, Melvin R; Swanson, Bradley J; Phillips, Christopher A; Dreslik, Michael J; Baker, Sarah J; King, Richard B

    2016-06-01

    Genetic diversity is fundamental to maintaining the long-term viability of populations, yet reduced genetic variation is often associated with small, isolated populations. To examine the relationship between demography and genetic variation, variation at hypervariable loci (e.g., microsatellite DNA loci) is often measured. However, these loci are selectively neutral (or near neutral) and may not accurately reflect genomewide variation. Variation at functional trait loci, such as the major histocompatibility complex (MHC), can provide a better assessment of adaptive genetic variation in fragmented populations. We compared patterns of microsatellite and MHC variation across three Eastern Massasauga (Sistrurus catenatus) populations representing a gradient of demographic histories to assess the relative roles of natural selection and genetic drift. Using 454 deep amplicon sequencing, we identified 24 putatively functional MHC IIB exon 2 alleles belonging to a minimum of six loci. Analysis of synonymous and nonsynonymous substitution rates provided evidence of historical positive selection at the nucleotide level, and Tajima's D provided support for balancing selection in each population. As predicted, estimates of microsatellite allelic richness, observed, heterozygosity, and expected heterozygosity varied among populations in a pattern qualitatively consistent with demographic history and abundance. While MHC allelic richness at the population and individual levels revealed similar trends, MHC nucleotide diversity was unexpectedly high in the smallest population. Overall, these results suggest that genetic variation in the Eastern Massasauga populations in Illinois has been shaped by multiple evolutionary mechanisms. Thus, conservation efforts should consider both neutral and functional genetic variation when managing captive and wild Eastern Massasauga populations. PMID:27516858

  11. Major histocompatibility complex alleles associated with parasite susceptibility in wild giant pandas

    PubMed Central

    Zhang, L; Wu, Q; Hu, Y; Wu, H; Wei, F

    2015-01-01

    Major histocompatibility complex (MHC) polymorphism is thought to be driven by antagonistic coevolution between pathogens and hosts, mediated through either overdominance or frequency-dependent selection. However, investigations under natural conditions are still rare for endangered mammals which often exhibit depleted variation, and the mechanism of selection underlying the maintenance of characteristics remains a considerable debate. In this study, 87 wild giant pandas were used to investigate MHC variation associated with parasite load. With the knowledge of the MHC profile provided by the genomic data of the giant panda, seven DRB1, seven DQA1 and eight DQA2 alleles were identified at each single locus. Positive selection evidenced by a significantly higher number of non-synonymous substitutions per non-synonymous codon site relative to synonymous substitutions per synonymous codon site could only be detected at the DRB1 locus, which leads to the speculation that DRB1 may have a more important role in dealing with parasite infection for pandas. Coprological analyses revealed that 55.17% of individuals exhibited infection with 1–2 helminthes and 95.3% of infected pandas carried Baylisascaris shroederi. Using a generalized linear model, we found that Aime-DRB1*10 was significantly associated with parasite infection, but no resistant alleles could be detected. MHC heterozygosity of the pandas was found to be uncorrelated with the infection status or the infection intensity. These results suggested that the possible selection mechanisms in extant wild pandas may be frequency dependent rather than being determined by overdominance selection. Our findings could guide the candidate selection for the ongoing reintroduction or translocation of pandas. PMID:25248466

  12. Major Histocompatibility Complex, demographic, and environmental predictors of antibody presence in a free-ranging mammal.

    PubMed

    Ruiz-López, María José; Monello, Ryan J; Schuttler, Stephanie G; Lance, Stacey L; Gompper, Matthew E; Eggert, Lori S

    2014-12-01

    Major Histocompatibility Complex (MHC) variability plays a key role in pathogen resistance, but its relative importance compared to environmental and demographic factors that also influence resistance is unknown. We analyzed the MHC II DRB exon 2 for 165 raccoons (Procyon lotor) in Missouri (USA). For each animal we also determined the presence of immunoglobulin G (IgG) and immunoglobulin M (IgM) antibodies to two highly virulent pathogens, canine distemper virus (CDV) and parvovirus. We investigated the role of MHC polymorphism and other demographic and environmental factors previously associated with predicting seroconversion. In addition, using an experimental approach, we studied the relative importance of resource availability and contact rates. We found important associations between IgG antibody presence and several MHC alleles and supertypes but not between IgM antibody presence and MHC. No effect of individual MHC diversity was found. For CDV, supertype S8, one allele within S8 (Prlo-DRB(∗)222), and a second allele (Prlo-DRB(∗)204) were positively associated with being IgG+, while supertype S4 and one allele within the supertype (Prlo-DRB(∗)210) were negatively associated with being IgG+. Age, year, and increased food availability were also positively associated with being IgG+, but allele Prlo-DRB(∗)222 was a stronger predictor. For parvovirus, only one MHC allele was negatively associated with being IgG+ and age and site were stronger predictors of seroconversion. Our results show that negative-frequency dependent selection is likely acting on the raccoon MHC and that while the role of MHC in relation to other factors depends on the pathogen of interest, it may be one of the most important factors predicting successful immune response. PMID:25446941

  13. Sequence variation at the major histocompatibility complex locus DQ beta in beluga whales (Delphinapterus leucas)

    PubMed

    Murray, B W; Malik, S; White, B N

    1995-07-01

    Genetic variation at the Major Histocompatibility Complex locus DQ beta was analyzed in 233 beluga whales (Delphinapterus leucas) from seven populations: St. Lawrence Estuary, eastern Beaufort Sea, eastern Chukchi Sea, western Hudson Bay, eastern Hudson Bay, southeastern Baffin Island, and High Arctic and in 12 narwhals (Monodon monoceros) sympatric with the High Arctic beluga population. Variation was assessed by amplification of the exon coding for the peptide binding region via the polymerase chain reaction, followed by either cloning and DNA sequencing or single-stranded conformation polymorphism analysis. Five alleles were found across the beluga populations and one in the narwhal. Pairwise comparisons of these alleles showed a 5:1 ratio of nonsynonymous to synonymous substitutions per site leading to eight amino acid differences, five of which were nonconservative substitutions, centered around positions previously shown to be important for peptide binding. Although the amount of allelic variation is low when compared with terrestrial mammals, the nature of the substitutions in the peptide binding sites indicates an important role for the DQ beta locus in the cellular immune response of beluga whales. Comparisons of allele frequencies among populations show the High Arctic population to be different (P < or = .005) from the other beluga populations surveyed. In these other populations an allele, Dele-DQ beta*0101-2, was found in 98% of the animals, while in the High Arctic it was found in only 52% of the animals. Two other alleles were found at high frequencies in the High Arctic population, one being very similar to the single allele found in narwhal. PMID:7659014

  14. Major histocompatibility complex linked databases and prediction tools for designing vaccines.

    PubMed

    Singh, Satarudra Prakash; Mishra, Bhartendu Nath

    2016-03-01

    Presently, the major histocompatibility complex (MHC) is receiving considerable interest owing to its remarkable role in antigen presentation and vaccine design. The specific databases and prediction approaches related to MHC sequences, structures and binding/nonbinding peptides have been aggressively developed in the past two decades with their own benchmarks and standards. Before using these databases and prediction tools, it is important to analyze why and how the tools are constructed along with their strengths and limitations. The current review presents insights into web-based immunological bioinformatics resources that include searchable databases of MHC sequences, epitopes and prediction tools that are linked to MHC based vaccine design, including population coverage analysis. In T cell epitope forecasts, MHC class I binding predictions are very accurate for most of the identified MHC alleles. However, these predictions could be further improved by integrating proteasome cleavage (in conjugation with transporter associated with antigen processing (TAP) binding) prediction, as well as T cell receptor binding prediction. On the other hand, MHC class II restricted epitope predictions display relatively low accuracy compared to MHC class I. To date, pan-specific tools have been developed, which not only deliver significantly improved predictions in terms of accuracy, but also in terms of the coverage of MHC alleles and supertypes. In addition, structural modeling and simulation systems for peptide-MHC complexes enable the molecular-level investigation of immune processes. Finally, epitope prediction tools, and their assessments and guidelines, have been presented to immunologist for the design of novel vaccine and diagnostics. PMID:26585361

  15. NetMHCcons: a consensus method for the major histocompatibility complex class I predictions.

    PubMed

    Karosiene, Edita; Lundegaard, Claus; Lund, Ole; Nielsen, Morten

    2012-03-01

    A key role in cell-mediated immunity is dedicated to the major histocompatibility complex (MHC) molecules that bind peptides for presentation on the cell surface. Several in silico methods capable of predicting peptide binding to MHC class I have been developed. The accuracy of these methods depends on the data available characterizing the binding specificity of the MHC molecules. It has, moreover, been demonstrated that consensus methods defined as combinations of two or more different methods led to improved prediction accuracy. This plethora of methods makes it very difficult for the non-expert user to choose the most suitable method for predicting binding to a given MHC molecule. In this study, we have therefore made an in-depth analysis of combinations of three state-of-the-art MHC-peptide binding prediction methods (NetMHC, NetMHCpan and PickPocket). We demonstrate that a simple combination of NetMHC and NetMHCpan gives the highest performance when the allele in question is included in the training and is characterized by at least 50 data points with at least ten binders. Otherwise, NetMHCpan is the best predictor. When an allele has not been characterized, the performance depends on the distance to the training data. NetMHCpan has the highest performance when close neighbours are present in the training set, while the combination of NetMHCpan and PickPocket outperforms either of the two methods for alleles with more remote neighbours. The final method, NetMHCcons, is publicly available at www.cbs.dtu.dk/services/NetMHCcons , and allows the user in an automatic manner to obtain the most accurate predictions for any given MHC molecule. PMID:22009319

  16. Hypoexpression of major histocompatibility complex molecules on Legionella pneumophila phagosomes and phagolysosomes.

    PubMed Central

    Clemens, D L; Horwitz, M A

    1993-01-01

    Legionella pneumophila is a facultative intracellular pathogen that parasitizes host mononuclear phagocytes. Cell-mediated immunity is pivotal to host defense against L. pneumophila, and the infected host cell may play a central role in processing and presenting parasite antigens to lymphocytes mediating cell-mediated immune response. However, in the case of L. pneumophila and intracellular parasites in general, little is known about the intracellular trafficking of parasite antigens, the influence of parasite infection on major histocompatibility complex (MHC) expression, or the relationship of MHC molecules to sites of parasite replication. To learn more about this, we have used flow cytometry to study the expression of HLA-DR by monocytes infected with L. pneumophila and cryosection immunogold electron microscopy to study the distribution of MHC class I and II molecules on L. pneumophila phagosomes. Flow cytometry analysis demonstrated that L. pneumophila infection has little effect on the overall expression of HLA-DR by monocytes. Cryosection immunogold studies revealed abundant staining for MHC class I and II molecules on the plasma membrane of infected monocytes but little or no staining on the membranes of mature L. pneumophila phagosomes. Cryosection immunogold studies of an avirulent mutant of L. pneumophila that, unlike the wild type, does not inhibit phagosome-lysosome fusion and subsequently survives but does not multiply in a phagolysosome yielded similar results. We have previously found that MHC class I and II molecules are excluded from nascent phagosomes during coiling and conventional phagocytosis. The present work demonstrates that MHC molecules do not accumulate appreciably in the L. pneumophila phagosome as it matures and at a point in the life cycle of the organism in which it is replicating and producing immunoprotective T-cell antigens. This suggests that L. pneumophila does not reside in a typical endosomal compartment in the host cell and

  17. Remarkably low affinity of CD4/peptide-major histocompatibility complex class II protein interactions.

    PubMed

    Jönsson, Peter; Southcombe, Jennifer H; Santos, Ana Mafalda; Huo, Jiandong; Fernandes, Ricardo A; McColl, James; Lever, Melissa; Evans, Edward J; Hudson, Alexander; Chang, Veronica T; Hanke, Tomáš; Godkin, Andrew; Dunne, Paul D; Horrocks, Mathew H; Palayret, Matthieu; Screaton, Gavin R; Petersen, Jan; Rossjohn, Jamie; Fugger, Lars; Dushek, Omer; Xu, Xiao-Ning; Davis, Simon J; Klenerman, David

    2016-05-17

    The αβ T-cell coreceptor CD4 enhances immune responses more than 1 million-fold in some assays, and yet the affinity of CD4 for its ligand, peptide-major histocompatibility class II (pMHC II) on antigen-presenting cells, is so weak that it was previously unquantifiable. Here, we report that a soluble form of CD4 failed to bind detectably to pMHC II in surface plasmon resonance-based assays, establishing a new upper limit for the solution affinity at 2.5 mM. However, when presented multivalently on magnetic beads, soluble CD4 bound pMHC II-expressing B cells, confirming that it is active and allowing mapping of the native coreceptor binding site on pMHC II. Whereas binding was undetectable in solution, the affinity of the CD4/pMHC II interaction could be measured in 2D using CD4- and adhesion molecule-functionalized, supported lipid bilayers, yielding a 2D Kd of ∼5,000 molecules/μm(2) This value is two to three orders of magnitude higher than previously measured 2D Kd values for interacting leukocyte surface proteins. Calculations indicated, however, that CD4/pMHC II binding would increase rates of T-cell receptor (TCR) complex phosphorylation by threefold via the recruitment of Lck, with only a small, 2-20% increase in the effective affinity of the TCR for pMHC II. The affinity of CD4/pMHC II therefore seems to be set at a value that increases T-cell sensitivity by enhancing phosphorylation, without compromising ligand discrimination. PMID:27114505

  18. Human-specific evolution of killer cell immunoglobulin-like receptor recognition of major histocompatibility complex class I molecules.

    PubMed

    Parham, Peter; Norman, Paul J; Abi-Rached, Laurent; Guethlein, Lisbeth A

    2012-03-19

    In placental mammals, natural killer (NK) cells are a population of lymphocytes that make unique contributions to immune defence and reproduction, functions essential for survival of individuals, populations and species. Modulating these functions are conserved and variable NK-cell receptors that recognize epitopes of major histocompatibility complex (MHC) class I molecules. In humans, for example, recognition of human leucocyte antigen (HLA)-E by the CD94:NKG2A receptor is conserved, whereas recognition of HLA-A, B and C by the killer cell immunoglobulin-like receptors (KIRs) is diversified. Competing demands of the immune and reproductive systems, and of T-cell and NK-cell immunity-combined with the segregation on different chromosomes of variable NK-cell receptors and their MHC class I ligands-drive an unusually rapid evolution that has resulted in unprecedented levels of species specificity, as first appreciated from comparison of mice and humans. Counterparts to human KIR are present only in simian primates. Observed in these species is the coevolution of KIR and the four MHC class I epitopes to which human KIR recognition is restricted. Unique to hominids is the emergence of the MHC-C locus as a supplier of specialized and superior ligands for KIR. This evolutionary trend is most highly elaborated in the chimpanzee. Unique to the human KIR locus are two groups of KIR haplotypes that are present in all human populations and subject to balancing selection. Group A KIR haplotypes resemble chimpanzee KIR haplotypes and are enriched for genes encoding KIR that bind HLA class I, whereas group B KIR haplotypes are enriched for genes encoding receptors with diminished capacity to bind HLA class I. Correlating with their balance in human populations, B haplotypes favour reproductive success, whereas A haplotypes favour successful immune defence. Evolution of the B KIR haplotypes is thus unique to the human species. PMID:22312047

  19. A Genome Wide Association Study for Coronary Artery Disease Identifies a Novel Susceptibility Locus in the Major Histocompatibility Complex

    PubMed Central

    Davies, Robert W.; Wells, George A.; Stewart, Alexandre F.R.; Erdmann, Jeanette; Shah, Svati H.; Ferguson, Jane F.; Hall, Alistair S.; Anand, Sonia S.; Burnett, Mary S.; Epstein, Stephen E.; Dandona, Sonny; Chen, Li; Nahrstaedt, Janja; Loley, Christina; König, Inke R.; Kraus, William E.; Granger, Christopher B.; Engert, James C.; Hengstenberg, Christian; Wichmann, H.-Erich; Schreiber, Stefan; Tang, W. H. Wilson; Ellis, Stephen G.; Rader, Daniel J.; Hazen, Stanley L.; Reilly, Muredach P.; Samani, Nilesh J.; Schunkert, Heribert; Roberts, Robert; McPherson, Ruth

    2012-01-01

    Background Recent genome-wide association studies (GWAS) have identified several novel loci that reproducibly associate with CAD and/or MI risk. However, known common CAD risk variants explain only 10% of the predicted genetic heritability of the disease, suggesting that important genetic signals remain to be discovered. Methods and Results We performed a discovery meta-analysis of 5 GWASs involving 13,949 subjects (7123 cases, 6826 controls) imputed at approximately 5 million SNPs using pilot 1000 Genomes based haplotypes. Promising loci were followed up in an additional 5 studies with 11,032 subjects (5211 cases, 5821 controls). A novel CAD locus on chromosome 6p21.3 in the major histocompatibility complex (MHC) between HCG27 and HLA-C was identified and achieved genome wide significance in the combined analysis (rs3869109; pdiscovery=3.3×10−7, preplication=5.3×10−4 pcombined=1.12×10−9). A sub-analysis combining discovery GWASs showed an attenuation of significance when stringent corrections for European population structure were employed (p=4.1×10−10 versus 3.2×10−7) suggesting the observed signal is partly confounded due to population stratification. This gene dense region plays an important role in inflammation, immunity and self cell recognition. To determine whether the underlying association was driven by MHC class I alleles, we statistically imputed common HLA alleles into the discovery subjects; however, no single common HLA type contributed significantly or fully explained the observed association. Conclusion We have identified a novel locus in the MHC associated with CAD. MHC genes regulate inflammation and T cell responses that contribute importantly to the initiation and propagation of atherosclerosis. Further laboratory studies will be required to understand the biological basis of this association and identify the causative allele(s). PMID:22319020

  20. Staphylococcus-mediated T-cell activation and spontaneous natural killer cell activity in the absence of major histocompatibility complex class II molecules

    NASA Technical Reports Server (NTRS)

    Chapes, S. K.; Hoynowski, S. M.; Woods, K. M.; Armstrong, J. W.; Beharka, A. A.; Iandolo, J. J.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    We used major histocompatibility complex class II antigen-deficient transgenic mice to show that in vitro natural killer cell cytotoxicity and T-cell activation by staphylococcal exotoxins (superantigens) are not dependent upon the presence of major histocompatibility complex class II molecules. T cells can be activated by exotoxins in the presence of exogenously added interleukin 1 or 2 or in the presence of specific antibody without exogenously added cytokines.

  1. Ancestral polymorphism at the major histocompatibility complex (MHCIIß) in the Nesospiza bunting species complex and its sister species (Rowettia goughensis)

    PubMed Central

    2012-01-01

    Background The major histocompatibility complex (MHC) is an important component of the vertebrate immune system and is frequently used to characterise adaptive variation in wild populations due to its co-evolution with pathogens. Passerine birds have an exceptionally diverse MHC with multiple gene copies and large numbers of alleles compared to other avian taxa. The Nesospiza bunting species complex (two species on Nightingale Island; one species with three sub-species on Inaccessible Island) represents a rapid adaptive radiation at a small, isolated archipelago, and is thus an excellent model for the study of adaptation and speciation. In this first study of MHC in Nesospiza buntings, we aim to characterize MHCIIß variation, determine the strength of selection acting at this gene region and assess the level of shared polymorphism between the Nesospiza species complex and its putative sister taxon, Rowettia goughensis, from Gough Island. Results In total, 23 unique alleles were found in 14 Nesospiza and 2 R. goughensis individuals encoding at least four presumably functional loci and two pseudogenes. There was no evidence of ongoing selection on the peptide binding region (PBR). Of the 23 alleles, 15 were found on both the islands inhabited by Nesospiza species, and seven in both Nesospiza and Rowettia; indications of shared, ancestral polymorphism. A gene tree of Nesospiza MHCIIß alleles with several other passerine birds shows three highly supported Nesospiza-specific groups. All R. goughensis alleles were shared with Nesospiza, and these alleles were found in all three Nesospiza sequence groups in the gene tree, suggesting that most of the observed variation predates their phylogenetic split. Conclusions Lack of evidence of selection on the PBR, together with shared polymorphism across the gene tree, suggests that population variation of MHCIIß among Nesospiza and Rowettia is due to ancestral polymorphism rather than local selective forces. Weak or no

  2. Major histocompatibility complex class II DAB alleles associated with intestinal parasite load in the vulnerable Chinese egret (Egretta eulophotes).

    PubMed

    Lei, Wei; Zhou, Xiaoping; Fang, Wenzhen; Lin, Qingxian; Chen, Xiaolin

    2016-07-01

    The maintenance of major histocompatibility complex (MHC) polymorphism has been hypothesized to result from many mechanisms such as rare-allele advantage, heterozygote advantage, and allele counting. In the study reported herein, 224 vulnerable Chinese egrets (Egretta eulophotes) were used to examine these hypotheses as empirical results derived from bird studies are rare. Parasite survey showed that 147 (65.63%) individuals were infected with 1-3 helminths, and 82.31% of these infected individuals carried Ascaridia sp. Using asymmetric polymerase chain reaction technique, 10 DAB1, twelve DAB2, and three DAB3 exon 2 alleles were identified at each single locus. A significant association of the rare allele Egeu-DAB2*05 (allele frequency: 0.022) with helminth resistance was found for all helminths, as well as for the most abundant morphotype Ascaridia sp. in the separate analyses. Egeu-DAB2*05 occurred frequently in uninfected individuals, and individuals carrying Egeu-DAB2*05 had significantly lower helminth morphotypes per individual (HMI) (the number of HMI) and the fecal egg count values. Further, the parasite infection measurements were consistently lower in individuals with an intermediate number of different alleles in the duplicated DAB loci. Significantly, heterozygosity within each DAB locus was not correlated with any parasite infection measurements. These results indicate that the diversity in MHC Egeu-DAB gene is associated with intestinal parasite load and maintained by pathogen-driven selection that probably operate through both the rare-allele advantage and the allele counting strategy, and suggest that Egeu-DAB2*05 might be a valuable indicator of better resistance to helminth diseases in the vulnerable Chinese egret. PMID:27386085

  3. Haplotype-specific pattern of association of human major histocompatibility complex with non-Hodgkin's lymphoma outcome.

    PubMed

    Nowak, J; Kalinka-Warzocha, E; Juszczyński, P; Mika-Witkowska, R; Zajko, M; Graczyk-Pol, E; Coiffier, B; Salles, G; Warzocha, K

    2008-01-01

    In the previous studies, some human major histocompatibility complex (MHC) genes such as TNF, LTA and human leukocyte antigen (HLA)-DR2 genes and A1-B8-TNF(-308A) haplotype were implied in non-Hodgkin's lymphoma (NHL) outcome. In the current study, we have assigned most probable six-locus haplotypes determined by HLA-A, -Cw, -B and -DRB1 highly polymorphic genes and non-HLA LTA(+252) and TNF(-308) single nucleotide polymorphisms (SNPs) in 152 NHL Caucasian French patients. We have broadly mapped the MHC region by its component blocks and tagging alleles. Ten frequent (with haplotype frequency >1%) six-locus extended haplotypes (EHs) were revealed in NHL patients. The only two adjacent locus fragment of 8.1 EH associated with shortened freedom from progression (FFP) was B*08-LTA(+252G) (P= 0.0084, RR = 2.45). Interestingly, 305-kbp-long, four-locus fragment of 8.1 EH, Cw*07-B*08-LTA(+252G)-TNF(-308A) block was much strongly associated with shortened FFP (P= 0.00045, RR = 3.26). The analysis of further extended haploblocks comprising five or six loci showed weaker association with outcome measures, suggesting linkage disequilibrium to be the cause of DRB1*03 and A*01 allele associations. In contrast, all fragments of 7.1 EH influenced FFP favorably with top association of TNF(-308G) allele. In multivariate analysis, only Cw*07-B*08-LTA(+252G)-TNF(-308A) and TNF(-308G)-DRB1*01 haplotypes remained predictive for shortened FFP (P= 0.024 and 0.027, respectively) and independent of International Prognostic Index (P= 0.00044). This study reveals that the block composition of EHs may cause important functional differences for NHL outcomes. Further study will be required in NHL patients by fine mapping with dense microsatellite or SNP tags to define susceptibility genes in associating regions. PMID:17971052

  4. Specialized functions of major histocompatibility complex class I molecules. II. Hmt binds N-formylated peptides of mitochondrial and prokaryotic origin

    PubMed Central

    1991-01-01

    The physiological functions of the mouse telomeric major histocompatibility complex (MHC) class I molecules, including Hmt, are unknown. Hmt presents a polymorphic, N-formylated peptide encoded by the mitochondrial gene ND1 forming the cell surface maternally transmitted antigen (Mta). Because the N-formyl moiety is required for Hmt binding, we proposed that Hmt may function generally in presentation of N-formylated antigens. This hypothesis was validated by a competitive binding assay, demonstrating that synthetic N-formyl peptides from other mitochondrial genes also bound Hmt. Bacteria similarly initiate protein synthesis with N-formylmethionine; indeed, we established that Hmt can also present prokaryotic peptides in an N- formyl-dependent manner. These results indicate biochemical specialization of this MHC-peptide interaction and suggest a unique role for Hmt in prokaryotic host defenses. PMID:1919442

  5. Enriched HLA-DQ3 phenotype and decreased class I major histocompatibility complex antigen expression in recurrent respiratory papillomatosis.

    PubMed Central

    Bonagura, V R; Siegal, F P; Abramson, A L; Santiago-Schwarz, F; O'Reilly, M E; Shah, K; Drake, D; Steinberg, B M

    1994-01-01

    Respiratory papillomas, caused by human papillomaviruses, are benign tumors that recur following removal. We evaluated immune function and major histocompatibility complex (MHC) phenotype and expression in these patients. MHC-independent immune function appeared normal. The frequency of peripheral blood MHC class II phenotypes was highly enriched for DQ3 and DR11, one split of DR5. Class I MHC antigen expression on papilloma tissue was markedly reduced. Together, these phenomena may facilitate papillomavirus evasion of the cellular immune response. Images PMID:7496977

  6. A recombinant antibody with the antigen-specific, major histocompatibility complex-restricted specificity of T cells.

    PubMed Central

    Andersen, P S; Stryhn, A; Hansen, B E; Fugger, L; Engberg, J; Buus, S

    1996-01-01

    Specific recognition of peptide/major histocompatibility complex (MHC) molecule complexes by the T-cell receptor is a key reaction in the specific immune response. Antibodies against peptide/MHC complexes would therefore be valuable tools in studying MHC function and T-cell recognition and might lead to novel approaches in immunotherapy. However, it has proven difficult to generate antibodies with the specificity of T cells by conventional hybridoma techniques. Here we report that the phage display technology is a feasible alternative to generate antibodies recognizing specific, predetermined peptide/MHC complexes. Images Fig. 2 PMID:8700842

  7. Mechanism for Amyloid Precursor-like Protein 2 Enhancement of Major Histocompatibility Complex Class I Molecule Degradation*

    PubMed Central

    Tuli, Amit; Sharma, Mahak; Capek, Haley L.; Naslavsky, Naava; Caplan, Steve; Solheim, Joyce C.

    2009-01-01

    Earlier studies have demonstrated interaction of the murine major histocompatibility complex (MHC) class I molecule Kd with amyloid precursor-like protein 2 (APLP2), a ubiquitously expressed member of the amyloid precursor protein family. Our current findings indicate that APLP2 is internalized in a clathrin-dependent manner, as shown by utilization of inhibitors of the clathrin pathway. Furthermore, we demonstrated that APLP2 and Kd bind at the cell surface and are internalized together. The APLP2 cytoplasmic tail contains two overlapping consensus motifs for binding to the adaptor protein-2 complex, and mutation of a tyrosine shared by both motifs severely impaired APLP2 internalization and ability to promote Kd endocytosis. Upon increased expression of wild type APLP2, Kd molecules were predominantly directed to the lysosomes rather than recycled to the plasma membrane. These findings suggest a model in which APLP2 binds Kd at the plasma membrane, facilitates uptake of Kd in a clathrin-dependent manner, and routes the endocytosed Kd to the lysosomal degradation pathway. Thus, APLP2 has a multistep trafficking function that influences the expression of major histocompatibility complex class I molecules at the plasma membrane. PMID:19808674

  8. Natural selection of the major histocompatibility complex (Mhc) in Hawaiian honeycreepers (Drepanidinae)

    USGS Publications Warehouse

    Jarvi, S.I.; Tarr, C.L.; Mcintosh, C.E.; Atkinson, C.T.; Fleischer, R.C.

    2004-01-01

    The native Hawaiian honeycreepers represent a classic example of adaptive radiation and speciation, but currently face one the highest extinction rates in the world. Although multiple factors have likely influenced the fate of Hawaiian birds, the relatively recent introduction of avian malaria is thought to be a major factor limiting honeycreeper distribution and abundance. We have initiated genetic analyses of class II ?? chain Mhc genes in four species of honeycreepers using methods that eliminate the possibility of sequencing mosaic variants formed by cloning heteroduplexed polymerase chain reaction products. Phylogenetic analyses group the honeycreeper Mhc sequences into two distinct clusters. Variation within one cluster is high, with dN > d S and levels of diversity similar to other studies of Mhc (B system) genes in birds. The second cluster is nearly invariant and includes sequences from honeycreepers (Fringillidae), a sparrow (Emberizidae) and a blackbird (Emberizidae). This highly conserved cluster appears reminiscent of the independently segregating Rfp-Y system of genes defined in chickens. The notion that balancing selection operates at the Mhc in the honeycreepers is supported by transpecies polymorphism and strikingly high dN/dS ratios at codons putatively involved in peptide interaction. Mitochondrial DNA control region sequences were invariant in the i'iwi, but were highly variable in the 'amakihi. By contrast, levels of variability of class II ?? chain Mhc sequence codons that are hypothesized to be directly involved in peptide interactions appear comparable between i'iwi and 'amakihi. In the i'iwi, natural selection may have maintained variation within the Mhc, even in the face of what appears to a genetic bottleneck.

  9. Low major histocompatibility complex diversity in the Tasmanian devil predates European settlement and may explain susceptibility to disease epidemics.

    PubMed

    Morris, Katrina; Austin, Jeremy J; Belov, Katherine

    2013-02-23

    The Tasmanian devil (Sarcophilus harrisii) is at risk of extinction owing to the emergence of a contagious cancer known as devil facial tumour disease (DFTD). The emergence and spread of DFTD has been linked to low genetic diversity in the major histocompatibility complex (MHC). We examined MHC diversity in historical and ancient devils to determine whether loss of diversity is recent or predates European settlement in Australia. Our results reveal no additional diversity in historical Tasmanian samples. Mainland devils had common modern variants plus six new variants that are highly similar to existing alleles. We conclude that low MHC diversity has been a feature of devil populations since at least the Mid-Holocene and could explain their tumultuous history of population crashes. PMID:23221872

  10. Low major histocompatibility complex diversity in the Tasmanian devil predates European settlement and may explain susceptibility to disease epidemics

    PubMed Central

    Morris, Katrina; Austin, Jeremy J.; Belov, Katherine

    2013-01-01

    The Tasmanian devil (Sarcophilus harrisii) is at risk of extinction owing to the emergence of a contagious cancer known as devil facial tumour disease (DFTD). The emergence and spread of DFTD has been linked to low genetic diversity in the major histocompatibility complex (MHC). We examined MHC diversity in historical and ancient devils to determine whether loss of diversity is recent or predates European settlement in Australia. Our results reveal no additional diversity in historical Tasmanian samples. Mainland devils had common modern variants plus six new variants that are highly similar to existing alleles. We conclude that low MHC diversity has been a feature of devil populations since at least the Mid-Holocene and could explain their tumultuous history of population crashes. PMID:23221872

  11. New horizons in mouse immunoinformatics: reliable in silico prediction of mouse class I histocompatibility major complex peptide binding affinity.

    PubMed

    Hattotuwagama, Channa K; Guan, Pingping; Doytchinova, Irini A; Flower, Darren R

    2004-11-21

    Quantitative structure-activity relationship (QSAR) analysis is a main cornerstone of modern informatic disciplines. Predictive computational models, based on QSAR technology, of peptide-major histocompatibility complex (MHC) binding affinity have now become a vital component of modern day computational immunovaccinology. Historically, such approaches have been built around semi-qualitative, classification methods, but these are now giving way to quantitative regression methods. The additive method, an established immunoinformatics technique for the quantitative prediction of peptide-protein affinity, was used here to identify the sequence dependence of peptide binding specificity for three mouse class I MHC alleles: H2-D(b), H2-K(b) and H2-K(k). As we show, in terms of reliability the resulting models represent a significant advance on existing methods. They can be used for the accurate prediction of T-cell epitopes and are freely available online ( http://www.jenner.ac.uk/MHCPred). PMID:15534705

  12. Transcriptome analysis reveals an activation of major histocompatibility complex 1 and 2 pathways in chicken trachea immunized with infectious laryngotracheitis virus vaccine.

    PubMed

    Luo, Juan; Carrillo, José A; Menendez, Kimberly R; Tablante, Nathaniel L; Song, Jiuzhou

    2014-04-01

    Infectious laryngotracheitis is an acute, contagious, upper respiratory disease of chickens caused by gallid herpes virus 1. Due to mortality rates that can reach up to 70% depending on the virulence of the virus, the disease is of great economic importance to the poultry industry. In this study, 15-d-old specific pathogen-free White Leghorn chickens were used to perform transcriptome analysis of chicken trachea immunized with infectious laryngotracheitis virus vaccine. Myosin and several collagen-related genes were downregulated in the immunized group, suggesting that normal function and structure may be compromised. In addition, we identified some cytokine receptors and several immune genes, such as Granzyme A (GZMA), CD4 molecule (CD4), CD8a molecule (CD8A), and CD8b molecule (CD8B), that were upregulated upon vaccination. The gene ontology analysis shows that genes included in the biological process cluster were related to antigen processing and presentation, positive regulation of immune system processes, T cell selection, and positive regulation of T cell activation. In conclusion, chicken embryo origin vaccine activation of the major histocompatibility complex 1 and 2 pathways provides insight for evaluation and design of infectious laryngotracheitis vaccines. PMID:24706961

  13. Activation of cytomegalovirus-specific CD8+ T-cell response by antibody-mediated peptide-major histocompatibility class I complexes

    PubMed Central

    Schmittnaegel, Martina; Klein, Christian; Levitsky, Victor; Knoetgen, Hendrik

    2016-01-01

    Imposing antigenicity on tumor cells is a key step toward successful cancer-immunotherapy. A cytomegalovirus-derived peptide recombinantly fused to a major histocompatibility class I complex and a monoclonal antibody can be targeted to tumor cells by antibody-mediated delivery and activate a strong and specific CD8+ T cell response. PMID:26942061

  14. Expression of bovine non-classical major histocompatibility complex class 1 proteins in mouse P815 and human K562 cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Major histocompatibility complex class I (MHC-I) proteins can be expressed as cell surface or secreted proteins. To investigate whether bovine non-classical MHC-I proteins are expressed as cell surface or secreted proteins, and to assess the reactivity pattern of monoclonal antibodies with non-class...

  15. Dominating expression of negative regulatory factors downmodulates major histocompatibility complex Class-II expression on dendritic cells in chronic hepatitis C infection

    PubMed Central

    Tomer, Shallu; Chawla, Yogesh K; Duseja, Ajay; Arora, Sunil K

    2016-01-01

    AIM: To elucidate the molecular mechanisms leading to development of functionally impaired dendritic cells (DCs) in chronic hepatitis C (CHC) patients infected with genotype 3 virus. METHODS: This prospective study was conducted on the cohorts of CHC individuals identified as responders or non-responders to antiviral therapy. Myeloid DCs were isolated from the peripheral blood of each subject using CD1c (BDCA1)+ DC isolation Kit. Monocytes from healthy donor were cultured with DC growth factors such as IL-4 and GM-CSF either in the presence or absence of hepatitis C virus (HCV) viral proteins followed by LPS stimulation. Phenotyping was done by flowcytometry and gene expression profiling was evaluated by real-time PCR. RESULTS: Non-responders [sustained virological response (SVR)-ve] to conventional antiviral therapy had significantly higher expression of genes associated with interferon responsive element such as IDO1 and PD-L1 (6-fold) and negative regulators of JAK-STAT pathway such as SOCS (6-fold) as compared to responders (SVR+ve) to antiviral therapy. The down-regulated genes in non-responders included factors involved in antigen processing and presentation mainly belonging to major histocompatibility complex (MHC) Class-II family as HLA-DP, HLA-DQ (2-fold) and superoxide dismutase (2-fold). Cells grown in the presence of HCV viral proteins had genes down-regulated for factors involved in innate response, interferon signaling, DC maturation and co-stimulatory signaling to T-cells, while the genes for cytokine signaling and Toll-like receptors (4-fold) were up-regulated as compared to cells grown in absence of viral proteins. CONCLUSION: Underexpressed MHC class-II genes and upregulated negative regulators in non-responders indicate diminished capacity to present antigen and may constitute mechanism of functionally defective state of DCs. PMID:27298560

  16. Pathogenicity of Bovine Neonatal Pancytopenia-associated vaccine-induced alloantibodies correlates with Major Histocompatibility Complex class I expression

    PubMed Central

    Benedictus, Lindert; Luteijn, Rutger D.; Otten, Henny; Jan Lebbink, Robert; van Kooten, Peter J. S.; Wiertz, Emmanuel J. H. J.; Rutten, Victor P. M. G.; Koets, Ad P.

    2015-01-01

    Bovine Neonatal Pancytopenia (BNP), a fatal bleeding syndrome of neonatal calves, is caused by maternal alloantibodies absorbed from colostrum and is characterized by lymphocytopenia, thrombocytopenia and bone marrow hypoplasia. An inactivated viral vaccine is the likely source of alloantigens inducing BNP-associated alloantibodies in the dam. In this study the specificity of BNP alloantibodies was assessed and was linked to the pathology of BNP. We demonstrated that Major Histocompatibility Complex class I (MHC I) and Very Late Antigen-3, an integrin α3/β1 heterodimer, were the major targets of BNP alloantibodies. However, alloantibody binding to various bovine cell types correlated with MHC I expression, rather than integrin β1 or α3 expression. Likewise, alloantibody-dependent complement-mediated cell lysis correlated strongly with MHC I expression. Examination of several tissues of third trimester bovine foetuses revealed that cells, shown to be affected in calves with BNP, were characterized by high MHC class I expression and high levels of alloantibody binding. We conclude that in spite of the heterogeneous specificity of BNP associated maternal alloantibodies, MHC I-specific antibodies mediate the pathogenicity of BNP in the calf and that cells with high MHC I expression were preferentially affected in BNP. PMID:26235972

  17. Class II major histocompatibility complex antigen expression on peripheral blood monocytes in patients with inflammatory bowel disease.

    PubMed Central

    Gardiner, K R; Crockard, A D; Halliday, M I; Rowlands, B J

    1994-01-01

    Macrophage major histocompatibility complex (MHC) class II antigen expression is associated with defective antigen presentation to T lymphocytes in animals and is predictive of patient outcome after major trauma or sepsis. In this study, class II antigen (HLA-DR and DQ) expression on peripheral blood monocytes was investigated in patients with inflammatory bowel disease in relation to disease activity and outcome. The percentage positivity and fluorescent intensity of expression of HLA-DR and DQ antigens on monocytes were determined in whole blood samples using dual colour immunofluorescence labelling and flow cytometry. Disease activity was assessed using clinical and laboratory indices. There was no significant difference in percentage positivity or fluorescent intensity of class II antigen expression between patients with Crohn's disease, those with ulcerative colitis, and healthy volunteers. The percentage of monocytes displaying HLA-DR positivity was significantly decreased in patients with active ulcerative colitis (active %: 49.5 (5.6); inactive %: 78.9 (6.9); p = 0.01). Data expressed as mean (SEM). In patients requiring surgical resection of diseased bowel, the percentage of monocytes displaying HLA-DR positivity (51.9 (4.0) %) was significantly reduced compared with patients receiving medical treatment alone (81.1 (3.5) %; p < 0.001). Reduced monocyte HLA-DR expression is therefore associated with disease activity and seems to predict outcome in patients with inflammatory bowel disease. PMID:8174990

  18. Low Major Histocompatibility Complex Class II Variation in the Endangered Indo-Pacific Humpback Dolphin (Sousa chinensis): Inferences About the Role of Balancing Selection.

    PubMed

    Zhang, Xiyang; Lin, Wenzhi; Zhou, Ruilian; Gui, Duan; Yu, Xinjian; Wu, Yuping

    2016-03-01

    It has been widely reported that the major histocompatibility complex (MHC) is under balancing selection due to its immune function across terrestrial and aquatic mammals. The comprehensive studies at MHC and other neutral loci could give us a synthetic evaluation about the major force determining genetic diversity of species. Previously, a low level of genetic diversity has been reported among the Indo-Pacific humpback dolphin (Sousa chinensis) in the Pearl River Estuary (PRE) using both mitochondrial marker and microsatellite loci. Here, the expression and sequence polymorphism of 2 MHC class II genes (DQB and DRB) in 32 S. chinensis from PRE collected between 2003 and 2011 were investigated. High ratios of non-synonymous to synonymous substitution rates, codon-based selection analysis, and trans-species polymorphism (TSP) support the hypothesis that balancing selection acted on S. chinensis MHC sequences. However, only 2 haplotypes were detected at either DQB or DRB loci. Moreover, the lack of deviation from the Hardy-Weinberg expectation at DRB locus combined with the relatively low heterozygosity at both DQB locus and microsatellite loci suggested that balancing selection might not be sufficient, which further suggested that genetic drift associated with historical bottlenecks was not mitigated by balancing selection in terms of the loss of MHC and neutral variation in S. chinensis. The combined results highlighted the importance of maintaining the genetic diversity of the endangered S. chinensis. PMID:26787544

  19. A High-Resolution Linkage-Disequilibrium Map of the Human Major Histocompatibility Complex and First Generation of Tag Single-Nucleotide Polymorphisms

    PubMed Central

    Miretti, Marcos M.; Walsh, Emily C.; Ke, Xiayi; Delgado, Marcos; Griffiths, Mark; Hunt, Sarah; Morrison, Jonathan; Whittaker, Pamela; Lander, Eric S.; Cardon, Lon R.; Bentley, David R.; Rioux, John D.; Beck, Stephan; Deloukas, Panos

    2005-01-01

    Autoimmune, inflammatory, and infectious diseases present a major burden to human health and are frequently associated with loci in the human major histocompatibility complex (MHC). Here, we report a high-resolution (1.9 kb) linkage-disequilibrium (LD) map of a 4.46-Mb fragment containing the MHC in U.S. pedigrees with northern and western European ancestry collected by the Centre d'Etude du Polymorphisme Humain (CEPH) and the first generation of haplotype tag single-nucleotide polymorphisms (tagSNPs) that provide up to a fivefold increase in genotyping efficiency for all future MHC-linked disease-association studies. The data confirm previously identified recombination hotspots in the class II region and allow the prediction of numerous novel hotspots in the class I and class III regions. The region of longest LD maps outside the classic MHC to the extended class I region spanning the MHC-linked olfactory-receptor gene cluster. The extended haplotype homozygosity analysis for recent positive selection shows that all 14 outlying haplotype variants map to a single extended haplotype, which most commonly bears HLA-DRB1*1501. The SNP data, haplotype blocks, and tagSNPs analysis reported here have been entered into a multidimensional Web-based database (GLOVAR), where they can be accessed and viewed in the context of relevant genome annotation. This LD map allowed us to give coordinates for the extremely variable LD structure underlying the MHC. PMID:15747258

  20. Assignment of Rfp-Y to the chicken major histocompatibility complex/NOR microchromosome and evidence for high-frequency recombination associated with the nucleolar organizer region.

    PubMed Central

    Miller, M M; Goto, R M; Taylor, R L; Zoorob, R; Auffray, C; Briles, R W; Briles, W E; Bloom, S E

    1996-01-01

    Rfp-Y is a second region in the genome of the chicken containing major histocompatibility complex (MHC) class I and II genes. Haplotypes of Rfp-Y assort independently from haplotypes of the B system, a region known to function as a MHC and to be located on chromosome 16 (a microchromosome) with the single nucleolar organizer region (NOR) in the chicken genome. Linkage mapping with reference populations failed to reveal the location of Rfp-Y, leaving Rfp-Y unlinked in a map containing >400 markers. A possible location of Rfp-Y became apparent in studies of chickens trisomic for chromosome 16 when it was noted that the intensity of restriction fragments associated with Rfp-Y increased with increasing copy number of chromosome 16. Further evidence that Rfp-Y might be located on chromosome 16 was obtained when individuals trisomic for chromosome 16 were found to transmit three Rfp-Y haplotypes. Finally, mapping of cosmid cluster III of the molecular map of chicken MHC genes (containing a MHC class II gene and two rRNA genes) to Rfp-Y validated the assignment of Rfp-Y to the MHC/NOR microchromosome. A genetic map can now be drawn for a portion of chicken chromosome 16 with Rfp-Y, encompassing two MHC class I and three MHC class II genes, separated from the B system by a region containing the NOR and exhibiting highly frequent recombination. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8632997

  1. Major histocompatibility complex-unrestricted cytolytic activity of human T cells: analysis of precursor frequency and effector phenotype

    SciTech Connect

    Patel, S.S.; Thiele, D.L.; Lipsky, P.E.

    1987-12-01

    The frequency and phenotype of human T cells that mediate major histocompatibility complex (MHC)-unrestricted cytolysis were analyzed. T cell clones were generated by culturing adherent cell-depleted peripheral blood mononuclear cells at a density of 0.3 cell/well with phytohemagglutinin, recombinant interleukin 2 (rIL-2), and irradiated autologous peripheral blood mononuclear cells and/or Epstein-Barr virus-transformed lymphoblastoid cell lines. All of the 198 clones generated by this method were T cells (CD2/sup +/, CD3/sup +/, CD4/sup +/ or CD2/sup +/, CD3/sup +/, CD8/sup +/) that possessed potent lytic activity against K562, an erythroleukemia line sensitive to lysis by human natural killer cells, and Cur, a renal carcinoma cell line resistant to human natural killer activity. Cytolysis, measured by /sup 51/Cr release, was MHC-unrestricted, since the clones were able to lyse MHC class I or class II negative targets, as well as MHC class I and class II negative targets. Although the clones produced tissue necrosis factor/lymphotoxin-like molecules, lysis of Cur of K562 was not mediated by a soluble factor secreted by the clones. These data indicate that the capacity for MHC-unrestricted tumoricidal activity and expression of NKH1 and CD11b, but not CD 16, are properties common to all or nearly all human peripheral blood-derived T cell clones regardless of CD4 or CD8 phenotype.

  2. Cross-linking staphylococcal enterotoxin A bound to major histocompatibility complex class I is required for TNF-alpha secretion

    NASA Technical Reports Server (NTRS)

    Wright, A. D.; Chapes, S. K.

    1999-01-01

    The mechanism of how superantigens function to activate cells has been linked to their ability to bind and cross-link the major histocompatibility complex class II (MHCII) molecule. Cells that lack the MHCII molecule also respond to superantigens, however, with much less efficiency. Therefore, the purpose of this study was to confirm that staphylococcal enterotoxin A (SEA) could bind the MHCI molecule and to test the hypothesis that cross-linking SEA bound to MHCII-deficient macrophages would induce a more robust cytokine response than without cross-linking. We used a capture enzyme-linked immunosorbent assay and an immunprecipitation assay to directly demonstrate that MHCI molecules bind SEA. Directly cross-linking MHCI using monoclonal antibodies or cross-linking bound SEA with an anti-SEA antibody or biotinylated SEA with avidin increased TNF-alpha and IL-6 secretion by MHCII(-/-) macrophages. The induction of a vigorous macrophage cytokine response by SEA/anti-SEA cross-linking of MHCI offers a mechanism to explain how MHCI could play an important role in superantigen-mediated pathogenesis. Copyright 1999 Academic Press.

  3. T cell receptor recognition of a 'super-bulged' major histocompatibility complex class I-bound peptide

    SciTech Connect

    Tynan, Fleur E; Burrows, Scott R; Buckle, Ashley M; Clements, Craig S; Borg, Natalie A; Miles, John J; Beddoe, Travis; Whisstock, James C; Wilce, Matthew C; Silins, Sharon L; Burrows, Jacqueline M; Kjer-Nielsen, Lars; Kostenko, Lyudmila; Purcell, Anthony W; McCluskey, James; Rossjohn, Jamie

    2010-07-20

    Unusually long major histocompatibility complex (MHC) class I-restricted epitopes are important in immunity, but their 'bulged' conformation represents a potential obstacle to {alpha}{beta} T cell receptor (TCR)-MHC class I docking. To elucidate how such recognition is achieved while still preserving MHC restriction, we have determined here the structure of a TCR in complex with HLA-B*3508 presenting a peptide 13 amino acids in length. This complex was atypical of TCR-peptide-MHC class I interactions, being dominated at the interface by peptide-mediated interactions. The TCR assumed two distinct orientations, swiveling on top of the centrally bulged, rigid peptide such that only limited contacts were made with MHC class I. Although the TCR-peptide recognition resembled an antibody-antigen interaction, the TCR-MHC class I contacts defined a minimal 'generic footprint' of MHC-restriction. Thus our findings simultaneously demonstrate the considerable adaptability of the TCR and the 'shape' of MHC restriction.

  4. Major histocompatibility complex harbors widespread genotypic variability of non-additive risk of rheumatoid arthritis including epistasis.

    PubMed

    Wei, Wen-Hua; Bowes, John; Plant, Darren; Viatte, Sebastien; Yarwood, Annie; Massey, Jonathan; Worthington, Jane; Eyre, Stephen

    2016-01-01

    Genotypic variability based genome-wide association studies (vGWASs) can identify potentially interacting loci without prior knowledge of the interacting factors. We report a two-stage approach to make vGWAS applicable to diseases: firstly using a mixed model approach to partition dichotomous phenotypes into additive risk and non-additive environmental residuals on the liability scale and secondly using the Levene's (Brown-Forsythe) test to assess equality of the residual variances across genotype groups per marker. We found widespread significant (P < 2.5e-05) vGWAS signals within the major histocompatibility complex (MHC) across all three study cohorts of rheumatoid arthritis. We further identified 10 epistatic interactions between the vGWAS signals independent of the MHC additive effects, each with a weak effect but jointly explained 1.9% of phenotypic variance. PTPN22 was also identified in the discovery cohort but replicated in only one independent cohort. Combining the three cohorts boosted power of vGWAS and additionally identified TYK2 and ANKRD55. Both PTPN22 and TYK2 had evidence of interactions reported elsewhere. We conclude that vGWAS can help discover interacting loci for complex diseases but require large samples to find additional signals. PMID:27109064

  5. Major histocompatibility complex harbors widespread genotypic variability of non-additive risk of rheumatoid arthritis including epistasis

    PubMed Central

    Wei, Wen-Hua; Bowes, John; Plant, Darren; Viatte, Sebastien; Yarwood, Annie; Massey, Jonathan; Worthington, Jane; Eyre, Stephen

    2016-01-01

    Genotypic variability based genome-wide association studies (vGWASs) can identify potentially interacting loci without prior knowledge of the interacting factors. We report a two-stage approach to make vGWAS applicable to diseases: firstly using a mixed model approach to partition dichotomous phenotypes into additive risk and non-additive environmental residuals on the liability scale and secondly using the Levene’s (Brown-Forsythe) test to assess equality of the residual variances across genotype groups per marker. We found widespread significant (P < 2.5e-05) vGWAS signals within the major histocompatibility complex (MHC) across all three study cohorts of rheumatoid arthritis. We further identified 10 epistatic interactions between the vGWAS signals independent of the MHC additive effects, each with a weak effect but jointly explained 1.9% of phenotypic variance. PTPN22 was also identified in the discovery cohort but replicated in only one independent cohort. Combining the three cohorts boosted power of vGWAS and additionally identified TYK2 and ANKRD55. Both PTPN22 and TYK2 had evidence of interactions reported elsewhere. We conclude that vGWAS can help discover interacting loci for complex diseases but require large samples to find additional signals. PMID:27109064

  6. Generation of a genomic tiling array of the human Major Histocompatibility Complex (MHC) and its application for DNA methylation analysis

    PubMed Central

    Tomazou, Eleni M; Rakyan, Vardhman K; Lefebvre, Gregory; Andrews, Robert; Ellis, Peter; Jackson, David K; Langford, Cordelia; Francis, Matthew D; Bäckdahl, Liselotte; Miretti, Marcos; Coggill, Penny; Ottaviani, Diego; Sheer, Denise; Murrell, Adele; Beck, Stephan

    2008-01-01

    Background The major histocompatibility complex (MHC) is essential for human immunity and is highly associated with common diseases, including cancer. While the genetics of the MHC has been studied intensively for many decades, very little is known about the epigenetics of this most polymorphic and disease-associated region of the genome. Methods To facilitate comprehensive epigenetic analyses of this region, we have generated a genomic tiling array of 2 Kb resolution covering the entire 4 Mb MHC region. The array has been designed to be compatible with chromatin immunoprecipitation (ChIP), methylated DNA immunoprecipitation (MeDIP), array comparative genomic hybridization (aCGH) and expression profiling, including of non-coding RNAs. The array comprises 7832 features, consisting of two replicates of both forward and reverse strands of MHC amplicons and appropriate controls. Results Using MeDIP, we demonstrate the application of the MHC array for DNA methylation profiling and the identification of tissue-specific differentially methylated regions (tDMRs). Based on the analysis of two tissues and two cell types, we identified 90 tDMRs within the MHC and describe their characterisation. Conclusion A tiling array covering the MHC region was developed and validated. Its successful application for DNA methylation profiling indicates that this array represents a useful tool for molecular analyses of the MHC in the context of medical genomics. PMID:18513384

  7. In situ detection of autoreactive CD4 T cells in brain and heart using major histocompatibility complex class II dextramers.

    PubMed

    Massilamany, Chandirasegaran; Gangaplara, Arunakumar; Jia, Ting; Elowsky, Christian; Li, Qingsheng; Zhou, You; Reddy, Jay

    2014-01-01

    This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin proteolipid protein (PLP) 139-151-induced experimental autoimmune encephalomyelitis (EAE) in SJL mice and cardiac myosin heavy chain-α (Myhc) 334-352-induced experimental autoimmune myocarditis (EAM) in A/J mice. Two sets of cocktails of dextramer reagents were used, where dextramers(+) cells were analyzed by laser scanning confocal microscope (LSCM): EAE, IA(s)/PLP 139-151 dextramers (specific)/anti-CD4 and IA(s)/Theiler's murine encephalomyelitis virus (TMEV) 70-86 dextramers (control)/anti-CD4; and EAM, IA(k)/Myhc 334-352 dextramers/anti-CD4 and IA(k)/bovine ribonuclease (RNase) 43-56 dextramers (control)/anti-CD4. LSCM analysis of brain sections obtained from EAE mice showed the presence of cells positive for CD4 and PLP 139-151 dextramers, but not TMEV 70-86 dextramers suggesting that the staining obtained with PLP 139-151 dextramers was specific. Likewise, heart sections prepared from EAM mice also revealed the presence of Myhc 334-352, but not RNase 43-56-dextramer(+) cells as expected. Further, a comprehensive method has also been devised to quantitatively analyze the frequencies of antigen-specific CD4 T cells in the 'Z' serial images. PMID:25145797

  8. Gastrointestinal helminths in indigenous and exotic chickens in Vietnam: association of the intensity of infection with the Major Histocompatibility Complex.

    PubMed

    Schou, T W; Permin, A; Juul-Madsen, H R; Sørensen, P; Labouriau, R; Nguyên, T L H; Fink, M; Pham, S L

    2007-04-01

    This study compared the prevalence and intensity of infections of helminths in 2 chicken breeds in Vietnam, the indigenous Ri and the exotic Luong Phuong. Also, possible correlations with the Major Histocompatibility Complex (MHC) were tested. The most prevalent helminths were Ascaridia galli, Heterakis beramporia, Tetrameres mothedai, Capillaria obsignata, Raillietina echinobothrida and Raillietina tetragona. Differences in prevalence and intensity of infection were found between the 2 breeds. Comparing the 2 groups of adult birds, Ri chickens were observed to have higher prevalence and infection intensities of several species of helminths, as well as a higher mean number of helminth species. In contrast, A. galli and C. obsignata were shown to be more prevalent in Luong Phuong chickens. Furthermore, an age-dependent difference was indicated in the group of Ri chickens in which the prevalence and the intensity of infection was higher for the adult than the young chickens for most helminths. The most notable exception was the significantly lower prevalence and intensities of A. galli in the group of adult chickens. In contrast, the prevalence and intensity were very similar in both age groups of Luong Phuong chickens. Using a genetic marker located in the MHC, a statistically significant correlation between several MHC haplotypes and the infection intensity of different helminth species was inferred. This is the first report of an association of MHC haplotype with the intensity of parasite infections in chickens. PMID:17166322

  9. In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

    PubMed Central

    Massilamany, Chandirasegaran; Gangaplara, Arunakumar; Jia, Ting; Elowsky, Christian; Li, Qingsheng; Zhou, You; Reddy, Jay

    2014-01-01

    This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin proteolipid protein (PLP) 139-151-induced experimental autoimmune encephalomyelitis (EAE) in SJL mice and cardiac myosin heavy chain-α (Myhc) 334-352-induced experimental autoimmune myocarditis (EAM) in A/J mice. Two sets of cocktails of dextramer reagents were used, where dextramers+ cells were analyzed by laser scanning confocal microscope (LSCM): EAE, IAs/PLP 139-151 dextramers (specific)/anti-CD4 and IAs/Theiler’s murine encephalomyelitis virus (TMEV) 70-86 dextramers (control)/anti-CD4; and EAM, IAk/Myhc 334-352 dextramers/anti-CD4 and IAk/bovine ribonuclease (RNase) 43-56 dextramers (control)/anti-CD4. LSCM analysis of brain sections obtained from EAE mice showed the presence of cells positive for CD4 and PLP 139-151 dextramers, but not TMEV 70-86 dextramers suggesting that the staining obtained with PLP 139-151 dextramers was specific. Likewise, heart sections prepared from EAM mice also revealed the presence of Myhc 334-352, but not RNase 43-56-dextramer+ cells as expected. Further, a comprehensive method has also been devised to quantitatively analyze the frequencies of antigen-specific CD4 T cells in the ‘Z’ serial images. PMID:25145797

  10. Constraints within major histocompatibility complex class I restricted peptides: Presentation and consequences for T-cell recognition

    SciTech Connect

    Theodossis, Alex; Guillonneau, Carole; Welland, Andrew; Ely, Lauren K.; Clements, Craig S.; Williamson, Nicholas A.; Webb, Andrew I.; Wilce, Jacqueline A.; Mulder, Roger J.; Dunstone, Michelle A.; Doherty, Peter C.; McCluskey, James; Purcell, Anthony W.; Turner, Stephen J.; Rossjohn, Jamie

    2010-03-24

    Residues within processed protein fragments bound to major histocompatibility complex class I (MHC-I) glycoproteins have been considered to function as a series of 'independent pegs' that either anchor the peptide (p) to the MHC-I and/or interact with the spectrum of {alpha}{beta}-T-cell receptors (TCRs) specific for the pMHC-I epitope in question. Mining of the extensive pMHC-I structural database established that many self- and viral peptides show extensive and direct interresidue interactions, an unexpected finding that has led us to the idea of 'constrained' peptides. Mutational analysis of two constrained peptides (the HLA B44 restricted self-peptide (B44DP{alpha}-EEFGRAFSF)) and an H2-D{sup b} restricted influenza peptide (D{sup b}PA, SSLENFRAYV) demonstrated that the conformation of the prominently exposed arginine in both peptides was governed by interactions with MHC-I-orientated flanking residues from the peptide itself. Using reverse genetics in a murine influenza model, we revealed that mutation of an MHC-I-orientated residue (SSLENFRAYV {yields} SSLENARAYV) within the constrained PA peptide resulted in a diminished cytotoxic T lymphocyte (CTL) response and the recruitment of a limited pMHC-I specific TCR repertoire. Interactions between individual peptide positions can thus impose fine control on the conformation of pMHC-I epitopes, whereas the perturbation of such constraints can lead to a previously unappreciated mechanism of viral escape.

  11. Proteasome Subtypes and Regulators in the Processing of Antigenic Peptides Presented by Class I Molecules of the Major Histocompatibility Complex

    PubMed Central

    Vigneron, Nathalie; Van den Eynde, Benoît J.

    2014-01-01

    The proteasome is responsible for the breakdown of cellular proteins. Proteins targeted for degradation are allowed inside the proteasome particle, where they are cleaved into small peptides and released in the cytosol to be degraded into amino acids. In vertebrates, some of these peptides escape degradation in the cytosol, are loaded onto class I molecules of the major histocompatibility complex (MHC) and displayed at the cell surface for scrutiny by the immune system. The proteasome therefore plays a key role for the immune system: it provides a continued sampling of intracellular proteins, so that CD8-positive T-lymphocytes can kill cells expressing viral or tumoral proteins. Consequently, the repertoire of peptides displayed by MHC class I molecules at the cell surface depends on proteasome activity, which may vary according to the presence of proteasome subtypes and regulators. Besides standard proteasomes, cells may contain immunoproteasomes, intermediate proteasomes and thymoproteasomes. Cells may also contain regulators of proteasome activity, such as the 19S, PA28 and PA200 regulators. Here, we review the effects of these proteasome subtypes and regulators on the production of antigenic peptides. We also discuss an unexpected function of the proteasome discovered through the study of antigenic peptides: its ability to splice peptides. PMID:25412285

  12. Trophoblast Major Histocompatibility Complex Class I Expression Is Associated with Immune-Mediated Rejection of Bovine Fetuses Produced by Cloning.

    PubMed

    Rutigliano, Heloisa M; Thomas, Aaron J; Wilhelm, Amanda; Sessions, Benjamin R; Hicks, Brady A; Schlafer, Donald H; White, Kenneth L; Davies, Christopher J

    2016-08-01

    Trophoblast cells from bovine somatic cell nuclear transfer (SCNT) conceptuses express major histocompatibility complex class I (MHC-I) proteins early in gestation, and this may be one cause of the significant first-trimester embryonic mortality observed in these pregnancies. MHC-I homozygous-compatible (n = 9), homozygous-incompatible (n = 8), and heterozygous-incompatible (n = 5) SCNT pregnancies were established. The control group consisted of eight pregnancies produced by artificial insemination. Uterine and placental samples were collected on Day 35 ± 1 of pregnancy, and expression of MHC-I, leukocyte markers, and cytokines were examined by immunohistochemistry. Trophoblast cells from all SCNT pregnancies expressed MHC-I, while trophoblast cells from age-matched control pregnancies were negative for MHC-I expression. Expression of MHC-I antigens by trophoblast cells from SCNT pregnancies was associated with lymphocytic infiltration in the endometrium. Furthermore, MHC-I-incompatible conceptuses, particularly the heterozygous-incompatible ones, induced a more pronounced lymphocytic infiltration than MHC-I-compatible conceptuses. Cells expressing cluster of differentiation (CD) 3, gamma/deltaTCR, and MHC-II were increased in the endometrium of SCNT pregnancies compared to the control group. CD4(+) lymphocytes were increased in MHC-I-incompatible pregnancies compared to MHC-I-compatible and control pregnancies. CD8(+), FOXP3(+), and natural killer cells were increased in MHC-I heterozygous-incompatible SCNT pregnancies compared to homozygous SCNT and control pregnancies. PMID:27385783

  13. A single peptide-major histocompatibility complex ligand triggers digital cytokine secretion in CD4(+) T cells.

    PubMed

    Huang, Jun; Brameshuber, Mario; Zeng, Xun; Xie, Jianming; Li, Qi-jing; Chien, Yueh-hsiu; Valitutti, Salvatore; Davis, Mark M

    2013-11-14

    We have developed a single-molecule imaging technique that uses quantum-dot-labeled peptide-major histocompatibility complex (pMHC) ligands to study CD4(+) T cell functional sensitivity. We found that naive T cells, T cell blasts, and memory T cells could all be triggered by a single pMHC to secrete tumor necrosis factor-α (TNF-α) and interleukin-2 (IL-2) cytokines with a rate of ∼1,000, ∼10,000, and ∼10,000 molecules/min, respectively, and that additional pMHCs did not augment secretion, indicating a digital response pattern. We also found that a single pMHC localized to the immunological synapse induced the slow formation of a long-lasting T cell receptor (TCR) cluster, consistent with a serial engagement mechanism. These data show that scaling up CD4(+) T cell cytokine responses involves increasingly efficient T cell recruitment rather than greater cytokine production per cell. PMID:24120362

  14. Dissociation of β2-microglobulin determines the surface quality control of major histocompatibility complex class I molecules.

    PubMed

    Montealegre, Sebastián; Venugopalan, Vaishnavi; Fritzsche, Susanne; Kulicke, Corinna; Hein, Zeynep; Springer, Sebastian

    2015-07-01

    Major histocompatibility complex class I proteins, which present antigenic peptides to cytotoxic T lymphocytes at the surface of all nucleated cells, are endocytosed and destroyed rapidly once their peptide ligand has dissociated. The molecular mechanism of this cellular quality control process, which prevents rebinding of exogenous peptides and thus erroneous immune responses, is unknown. To identify the nature of the decisive step in endocytic sorting of class I molecules and its location, we have followed the removal of optimally and suboptimally peptide-loaded murine H-2K(b) class I proteins from the cell surface. We find that the binding of their light chain, β2-microglobulin (β2m), protects them from endocytic destruction. Thus, the extended survival of suboptimally loaded K(b) molecules at 25°C is attributed to decreased dissociation of β2m. Because all forms of K(b) are constantly internalized but little β2m-receptive heavy chain is present at the cell surface, it is likely that β2m dissociation and recognition of the heavy chain for lysosomal degradation take place in an endocytic compartment. PMID:25782992

  15. Potent T Cell Activation with Dimeric Peptide–Major Histocompatibility Complex Class II Ligand: The Role of CD4 Coreceptor

    PubMed Central

    Hamad, Abdel Rahim A.; O'Herrin, Sean M.; Lebowitz, Michael S.; Srikrishnan, Ananth; Bieler, Joan; Schneck, Jonathan; Pardoll, Drew

    1998-01-01

    The interaction of the T cell receptor (TCR) with its cognate peptide–major histocompatibility complex (MHC) on the surface of antigen presenting cells (APCs) is a primary event during T cell activation. Here we used a dimeric IEk-MCC molecule to study its capacity to activate antigen-specific T cells and to directly analyze the role of CD4 in physically stabilizing the TCR–MHC interaction. Dimeric IEk-MCC stably binds to specific T cells. In addition, immobilized dimeric IEk-MCC can induce TCR downregulation and activate antigen-specific T cells more efficiently than anti-CD3. The potency of the dimeric IEk-MCC is significantly enhanced in the presence of CD4. However, CD4 does not play any significant role in stabilizing peptide-MHC–TCR interactions as it fails to enhance binding of IEk-MCC to specific T cells or influence peptide-MHC–TCR dissociation rate or TCR downregulation. Moreover, these results indicate that dimerization of peptide-MHC class II using an IgG molecular scaffold significantly increases its binding avidity leading to an enhancement of its stimulatory capacity while maintaining the physiological properties of cognate peptide–MHC complex. These peptide-MHC–IgG chimeras may, therefore, provide a novel approach to modulate antigen-specific T cell responses both in vitro and in vivo. PMID:9802975

  16. Zinc Induces Dimerization of the Class II Major Histocompatibility Complex Molecule That Leads to Cooperative Binding to a Superantigen

    SciTech Connect

    Li,H.; Zhao, Y.; Guo, Y.; Li, Z.; Eislele, L.; Mourad, W.

    2007-01-01

    Dimerization of class II major histocompatibility complex (MHC) plays an important role in the MHC biological function. Mycoplasma arthritidis-derived mitogen (MAM) is a superantigen that can activate large fractions of T cells bearing specific T cell receptor V{beta} elements. Here we have used structural, sedimentation, and surface plasmon resonance detection approaches to investigate the molecular interactions between MAM and the class II MHC molecule HLA-DR1 in the context of a hemagglutinin peptide-(306-318) (HA). Our results revealed that zinc ion can efficiently induce the dimerization of the HLA-DR1/HA complex. Because the crystal structure of the MAM/HLA-DR1/hemagglutinin complex in the presence of EDTA is nearly identical to the structure of the complex crystallized in the presence of zinc ion, Zn{sup 2+} is evidently not directly involved in the binding between MAM and HLA-DR1. Sedimentation and surface plasmon resonance studies further revealed that MAM binds the HLA-DR1/HA complex with high affinity in a 1:1 stoichiometry, in the absence of Zn{sup 2+}. However, in the presence of Zn{sup 2+}, a dimerized MAM/HLA-DR1/HA complex can arise through the Zn{sup 2+}-induced DR1 dimer. In the presence of Zn{sup 2+}, cooperative binding of MAM to the DR1 dimer was also observed.

  17. Female major histocompatibility complex type affects male testosterone levels and sperm number in the horse (Equus caballus)

    PubMed Central

    Burger, D.; Dolivo, G.; Marti, E.; Sieme, H.; Wedekind, C.

    2015-01-01

    Odours of vertebrates often contain information about the major histocompatibility complex (MHC), and are used in kin recognition, mate choice or female investment in pregnancy. It is, however, still unclear whether MHC-linked signals can also affect male reproductive strategies. We used horses (Equus caballus) to study this question under experimental conditions. Twelve stallions were individually exposed either to an unfamiliar MHC-similar mare and then to an unfamiliar MHC-dissimilar mare, or vice versa. Each exposure lasted over a period of four weeks. Peripheral blood testosterone levels were determined weekly. Three ejaculates each were collected in the week after exposure to both mares (i.e. in the ninth week) to determine mean sperm number and sperm velocity. We found high testosterone levels when stallions were kept close to MHC-dissimilar mares and significantly lower ones when kept close to MHC-similar mares. Mean sperm number per ejaculate (but not sperm velocity) was positively correlated to mean testosterone levels and also affected by the order of presentation of mares: sperm numbers were higher if MHC-dissimilar mares were presented last than if MHC-similar mares were presented last. We conclude that MHC-linked signals influence testosterone secretion and semen characteristics, two indicators of male reproductive strategies. PMID:25904670

  18. Major Histocompatibility Complex I Mediates Immunological Tolerance of the Trophoblast during Pregnancy and May Mediate Rejection during Parturition

    PubMed Central

    Rapacz-Leonard, Anna; Dąbrowska, Małgorzata; Janowski, Tomasz

    2014-01-01

    During pregnancy in larger mammals, the maternal immune system must tolerate the fetus for months while resisting external infection. This tolerance is facilitated by immunological communication between the fetus and the mother, which is mediated by Major Histocompatibility Complex I (MHC I) proteins, by leukocytes, and by the cytokines secreted by the leukocytes. Fetal-maternal immunological communication also supports pregnancy by inducing physiological changes in the mother. If the mother “misunderstands” the signal sent by the fetus during pregnancy, the fetus will be miscarried or delivered preterm. Unlike any other maternal organ, the placenta can express paternal antigens. At parturition, paternal antigens are known to be expressed in cows and may be expressed in horses, possibly so that the maternal immune system will reject the placenta and help to expel it. This review compares fetal-maternal crosstalk that is mediated by the immune system in three species with pregnancies that last for nine months or longer: humans, cattle, and horses. It raises the possibility that immunological communication early in pregnancy may prepare the mother for successful expulsion of fetal membranes at parturition. PMID:24812442

  19. Effects of messenger RNA structure and other translational control mechanisms on major histocompatibility complex-I mediated antigen presentation

    PubMed Central

    Murat, Pierre; Tellam, Judy

    2015-01-01

    Effective T-cell surveillance of antigen-presenting cells is dependent on the expression of an array of antigenic peptides bound to major histocompatibility complex (MHC) class I (MHC-I) or class II (MHC-II) molecules. Pathogens co-evolving with their hosts exploit crucial translational regulatory mechanisms in order to evade host immune recognition and thereby sustain their infection. Evasion strategies that downregulate viral protein synthesis and thereby restrict antigen presentation to cytotoxic T-cells through the endogenous MHC-I pathway have been implicated in the pathogenesis of viral-associated malignancies. An understanding of the mechanisms by which messenger RNA (mRNA) structure modulates both viral mRNA translation and the antigen processing machinery to escape immune surveillance, will stimulate the development of alternative therapeutic strategies focused on RNA-directed drugs designed to enhance immune responses against infected cells. In this review, we discuss regulatory aspects of the MHC-I pathway and summarize current knowledge of the role attributed by mRNA structure and other translational regulatory mechanisms in immune evasion. In particular we highlight the impact of recently identified G-quadruplex structures within virally encoded transcripts as unique regulatory signals for translational control and antigen presentation. WIREs RNA 2015, 6:157–171. doi: 10.1002/wrna.1262 PMID:25264139

  20. Major Histocompatibility Complex class I proteins are critical for maintaining neuronal structural complexity in the aging brain.

    PubMed

    Lazarczyk, Maciej J; Kemmler, Julia E; Eyford, Brett A; Short, Jennifer A; Varghese, Merina; Sowa, Allison; Dickstein, Daniel R; Yuk, Frank J; Puri, Rishi; Biron, Kaan E; Leist, Marcel; Jefferies, Wilfred A; Dickstein, Dara L

    2016-01-01

    Major histocompatibility complex class I (MHCI) proteins have been implicated in neuronal function through the modulation of neuritogenesis, synaptogenesis, synaptic plasticity, and memory consolidation during development. However, the involvement of MHCI in the aged brain is unclear. Here we demonstrate that MHCI deficiency results in significant dendritic atrophy along with an increase in thin dendritic spines and a reduction in stubby spines in the hippocampus of aged (12 month old) mice. Ultrastructural analyses revealed a decrease in spine head diameter and post synaptic density (PSD) area, as well as an increase in overall synapse density, and non-perforated, small spines. Interestingly, we found that the changes in synapse density and morphology appear relatively late (after the age of 6 months). Finally, we found a significant age dependent increase in the levels of the glutamate receptor, GluN2B in aged MHCI knockout mice, with no change in GluA2/3, VGluT1, PSD95 or synaptophysin. These results indicate that MHCI may be also be involved in maintaining brain integrity at post-developmental stages notably in the modulation of neuronal and spine morphology and synaptic function during non-pathological aging which could have significant implications for cognitive function. PMID:27229916

  1. Major Histocompatibility Complex class I proteins are critical for maintaining neuronal structural complexity in the aging brain

    PubMed Central

    Lazarczyk, Maciej J.; Kemmler, Julia E.; Eyford, Brett A.; Short, Jennifer A.; Varghese, Merina; Sowa, Allison; Dickstein, Daniel R.; Yuk, Frank J.; Puri, Rishi; Biron, Kaan E.; Leist, Marcel; Jefferies, Wilfred A.; Dickstein, Dara L.

    2016-01-01

    Major histocompatibility complex class I (MHCI) proteins have been implicated in neuronal function through the modulation of neuritogenesis, synaptogenesis, synaptic plasticity, and memory consolidation during development. However, the involvement of MHCI in the aged brain is unclear. Here we demonstrate that MHCI deficiency results in significant dendritic atrophy along with an increase in thin dendritic spines and a reduction in stubby spines in the hippocampus of aged (12 month old) mice. Ultrastructural analyses revealed a decrease in spine head diameter and post synaptic density (PSD) area, as well as an increase in overall synapse density, and non-perforated, small spines. Interestingly, we found that the changes in synapse density and morphology appear relatively late (after the age of 6 months). Finally, we found a significant age dependent increase in the levels of the glutamate receptor, GluN2B in aged MHCI knockout mice, with no change in GluA2/3, VGluT1, PSD95 or synaptophysin. These results indicate that MHCI may be also be involved in maintaining brain integrity at post-developmental stages notably in the modulation of neuronal and spine morphology and synaptic function during non-pathological aging which could have significant implications for cognitive function. PMID:27229916

  2. Predictions of T-cell receptor- and major histocompatibility complex-binding sites on staphylococcal enterotoxin C1.

    PubMed Central

    Hoffmann, M L; Jablonski, L M; Crum, K K; Hackett, S P; Chi, Y I; Stauffacher, C V; Stevens, D L; Bohach, G A

    1994-01-01

    We have focused on regions of staphylococcal enterotoxin C1 (SEC1) causing immunomodulation. N-terminal deletion mutants lacking residues 6 through 13 induced T-cell proliferation similar to that induced by native toxin. However, mutants with residues deleted between positions 19 and 33, although nonmitogenic themselves, were able to inhibit both SEC1-induced T-cell proliferation and binding of the native toxin to major histocompatibility complex (MHC) class II. Presumably, these deletions define a part of SEC1 that interacts with the T-cell receptor. Three synthetic peptides containing residues located in a region analogous to the alpha 5 groove of SEC3 had residual mitogenic activity or blocked T-cell proliferation induced by SEC1 and appear to recognize the same site as SEC1 on a receptor for the toxin, presumably MHC class II. We conclude that isolated portions of the SEC1 molecule can retain residual mitogenic activity but that the entire protein is needed to achieve maximal superantigenic stimulation. Our results, together with the results of other investigators, support a model in which SEC1 binds to an alpha helix of MHC class II through a central groove in the toxin and thereby promotes or stabilizes the interaction between antigen-presenting cells and T cells. Images PMID:8039910

  3. Assembly and Function of the Major Histocompatibility Complex (MHC) I Peptide-loading Complex Are Conserved Across Higher Vertebrates*

    PubMed Central

    Hinz, Andreas; Jedamzick, Johanna; Herbring, Valentina; Fischbach, Hanna; Hartmann, Jessica; Parcej, David; Koch, Joachim; Tampé, Robert

    2014-01-01

    Antigen presentation to cytotoxic T lymphocytes via major histocompatibility complex class I (MHC I) molecules depends on the heterodimeric transporter associated with antigen processing (TAP). For efficient antigen supply to MHC I molecules in the ER, TAP assembles a macromolecular peptide-loading complex (PLC) by recruiting tapasin. In evolution, TAP appeared together with effector cells of adaptive immunity at the transition from jawless to jawed vertebrates and diversified further within the jawed vertebrates. Here, we compared TAP function and interaction with tapasin of a range of species within two classes of jawed vertebrates. We found that avian and mammalian TAP1 and TAP2 form heterodimeric complexes across taxa. Moreover, the extra N-terminal domain TMD0 of mammalian TAP1 and TAP2 as well as avian TAP2 recruits tapasin. Strikingly, however, only TAP1 and TAP2 from the same taxon can form a functional heterodimeric translocation complex. These data demonstrate that the dimerization interface between TAP1 and TAP2 and the tapasin docking sites for PLC assembly are conserved in evolution, whereas elements of antigen translocation diverged later in evolution and are thus taxon specific. PMID:25320083

  4. Amino Acid Polymorphisms in Hepatitis C Virus Core Affect Infectious Virus Production and Major Histocompatibility Complex Class I Molecule Expression.

    PubMed

    Tasaka-Fujita, Megumi; Sugiyama, Nao; Kang, Wonseok; Masaki, Takahiro; Masaski, Takahiro; Murayama, Asako; Yamada, Norie; Sugiyama, Ryuichi; Tsukuda, Senko; Watashi, Koichi; Asahina, Yasuhiro; Sakamoto, Naoya; Wakita, Takaji; Shin, Eui-Cheol; Kato, Takanobu

    2015-01-01

    Amino acid (aa) polymorphisms in the hepatitis C virus (HCV) genotype 1b core protein have been reported to be a potent predictor for poor response to interferon (IFN)-based therapy and a risk factor for hepatocarcinogenesis. We investigated the effects of these polymorphisms with genotype 1b/2a chimeric viruses that contained polymorphisms of Arg/Gln at aa 70 and Leu/Met at aa 91. We found that infectious virus production was reduced in cells transfected with chimeric virus RNA that had Gln at aa 70 (aa70Q) compared with RNA with Arg at aa 70 (aa70R). Using flow cytometry analysis, we confirmed that HCV core protein accumulated in aa70Q clone transfected cells, and it caused a reduction in cell-surface expression of major histocompatibility complex (MHC) class I molecules induced by IFN treatment through enhanced protein kinase R phosphorylation. We could not detect any effects due to the polymorphism at aa 91. In conclusion, the polymorphism at aa 70 was associated with efficiency of infectious virus production, and this deteriorated virus production in strains with aa70Q resulted in the intracellular accumulation of HCV proteins and attenuation of MHC class I molecule expression. These observations may explain the strain-associated resistance to IFN-based therapy and hepatocarcinogenesis of HCV. PMID:26365522

  5. Hard wiring of T cell receptor specificity for the major histocompatibility complex is underpinned by TCR adaptability

    SciTech Connect

    Burrows, Scott R.; Chen, Zhenjun; Archbold, Julia K.; Tynan, Fleur E.; Beddoe, Travis; Kjer-Nielsen, Lars; Miles, John J.; Khanna, Rajiv; Moss, Denis J.; Liu, Yu Chih; Gras, Stephanie; Kostenko, Lyudmila; Brennan, Rebekah M.; Clements, Craig S.; Brooks, Andrew G.; Purcell, Anthony W.; McCluskey, James; Rossjohn, Jamie

    2010-07-07

    {alpha}{beta} T cell receptors (TCRs) are genetically restricted to corecognize peptide antigens bound to self-major histocompatibility complex (pMHC) molecules; however, the basis for this MHC specificity remains unclear. Despite the current dogma, evaluation of the TCR-pMHC-I structural database shows that the nongermline-encoded complementarity-determining region (CDR)-3 loops often contact the MHC-I, and the germline-encoded CDR1 and -2 loops frequently participate in peptide-mediated interactions. Nevertheless, different TCRs adopt a roughly conserved docking mode over the pMHC-I, in which three MHC-I residues (65, 69, and 155) are invariably contacted by the TCR in one way or another. Nonetheless, the impact of mutations at these three positions, either individually or together, was not uniformly detrimental to TCR recognition of pHLA-B*0801 or pHLA-B*3508. Moreover, when TCR-pMHC-I recognition was impaired, this could be partially restored by expression of the CD8 coreceptor. The structure of a TCR-pMHC-I complex in which these three (65, 69, and 155) MHC-I positions were all mutated resulted in shifting of the TCR footprint relative to the cognate complex and formation of compensatory interactions. Collectively, our findings reveal the inherent adaptability of the TCR in maintaining peptide recognition while accommodating changes to the central docking site on the pMHC-I.

  6. Small organic compounds enhance antigen loading of class II major histocompatibility complex proteins by targeting the polymorphic P1 pocket.

    PubMed

    Höpner, Sabine; Dickhaut, Katharina; Hofstätter, Maria; Krämer, Heiko; Rückerl, Dominik; Söderhäll, J Arvid; Gupta, Shashank; Marin-Esteban, Viviana; Kühne, Ronald; Freund, Christian; Jung, Günther; Falk, Kirsten; Rötzschke, Olaf

    2006-12-15

    Major histocompatibility complex (MHC) molecules are a key element of the cellular immune response. Encoded by the MHC they are a family of highly polymorphic peptide receptors presenting peptide antigens for the surveillance by T cells. We have shown that certain organic compounds can amplify immune responses by catalyzing the peptide loading of human class II MHC molecules HLA-DR. Here we show now that they achieve this by interacting with a defined binding site of the HLA-DR peptide receptor. Screening of a compound library revealed a set of adamantane derivatives that strongly accelerated the peptide loading rate. The effect was evident only for an allelic subset and strictly correlated with the presence of glycine at the dimorphic position beta86 of the HLA-DR molecule. The residue forms the floor of the conserved pocket P1, located in the peptide binding site of MHC molecule. Apparently, transient occupation of this pocket by the organic compound stabilizes the peptide-receptive conformation permitting rapid antigen loading. This interaction appeared restricted to the larger Gly(beta86) pocket and allowed striking enhancements of T cell responses for antigens presented by these "adamantyl-susceptible" MHC molecules. As catalysts of antigen loading, compounds targeting P1 may be useful molecular tools to amplify the immune response. The observation, however, that the ligand repertoire can be affected through polymorphic sites form the outside may also imply that environmental factors could induce allergic or autoimmune reactions in an allele-selective manner. PMID:17005558

  7. Association of smoking behavior with an odorant receptor allele telomeric to the human major histocompatibility complex.

    PubMed

    Santos, Pablo Sandro Carvalho; Füst, George; Prohászka, Zoltán; Volz, Armin; Horton, Roger; Miretti, Marcos; Yu, Chack-Yung; Beck, Stephan; Uchanska-Ziegler, Barbara; Ziegler, Andreas

    2008-12-01

    Smoking behavior has been associated in two independent European cohorts with the most common Caucasian human leukocyte antigen (HLA) haplotype (A1-B8-DR3). We aimed to test whether polymorphic members of the two odorant receptor (OR) clusters within the extended HLA complex might be responsible for the observed association, by genotyping a cohort of Hungarian women in which the mentioned association had been found. One hundred and eighty HLA haplotypes from Centre d'Etude du Polymorphisme Humain families were analyzed in silico to identify single-nucleotide polymorphisms (SNPs) within OR genes that are in linkage disequilibrium with the A1-B8-DR3 haplotype, as well as with two other haplotypes indirectly linked to smoking behavior. A nonsynonymous SNP within the OR12D3 gene (rs3749971(T)) was found to be linked to the A1-B8-DR3 haplotype. This polymorphism leads to a (97)Thr --> Ile exchange that affects a putative ligand binding region of the OR12D3 protein. Smoking was found to be associated in the Hungarian cohort with the rs3749971(T) allele (p = 1.05 x 10(-2)), with higher significance than with A1-B8-DR3 (p = 2.38 x 10(-2)). Our results link smoking to a distinct OR allele, and demonstrate that the rs3749971(T) polymorphism is associated with the HLA haplotype-dependent differential recognition of cigarette smoke components, at least among Caucasian women. PMID:18939942

  8. The PANE1 gene encodes a novel human minor histocompatibility antigen that is selectively expressed in B-lymphoid cells and B-CLL

    PubMed Central

    Brickner, Anthony G.; Evans, Anne M.; Mito, Jeffrey K.; Xuereb, Suzanne M.; Feng, Xin; Nishida, Tetsuya; Fairfull, Liane; Ferrell, Robert E.; Foon, Kenneth A.; Hunt, Donald F.; Shabanowitz, Jeffrey; Engelhard, Victor H.; Riddell, Stanley R.; Warren, Edus H.

    2006-01-01

    Minor histocompatibility antigens (mHAg's) are peptides encoded by polymorphic genes that are presented by major histocompatibility complex (MHC) molecules and recognized by T cells in recipients of allogeneic hematopoietic cell transplants. Here we report that an alternative transcript of the proliferation-associated nuclear element 1 (PANE1) gene encodes a novel human leukocyte antigen (HLA)-A*0301-restricted mHAg that is selectively expressed in B-lymphoid cells. The antigenic peptide is entirely encoded within a unique exon not present in other PANE1 transcripts. Sequencing of PANE1 alleles in mHAg-positive and mHAg-negative cells demonstrates that differential T-cell recognition is due to a single nucleotide polymorphism within the variant exon that replaces an arginine codon with a translation termination codon. The PANE1 transcript that encodes the mHAg is expressed at high levels in resting CD19+ B cells and B-lineage chronic lymphocytic leukemia (B-CLL) cells, and at significantly lower levels in activated B cells. Activation of B-CLL cells through CD40 ligand (CD40L) stimulation decreases expression of the mHAg-encoding PANE1 transcript and reciprocally increases expression of PANE1 transcripts lacking the mHAg-encoding exon. These studies suggest distinct roles for different PANE1 isoforms in resting compared with activated CD19+ cells, and identify PANE1 as a potential therapeutic target in B-CLL. PMID:16391015

  9. Respiratory Syncytial Virus Infection Upregulates NLRC5 and Major Histocompatibility Complex Class I Expression through RIG-I Induction in Airway Epithelial Cells

    PubMed Central

    Guo, Xuancheng; Liu, Taixiang; Shi, Hengfei; Wang, Jingjing; Ji, Ping; Wang, Hongwei; Hou, Yayi; Tan, Ren Xiang

    2015-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of acute respiratory tract viral infection in infants, causing bronchiolitis and pneumonia. The host antiviral response to RSV acts via retinoic acid-inducible gene I (RIG-I). We show here that RSV infection upregulates major histocompatibility complex class I (MHC-I) expression through the induction of NLRC5, a NOD-like, CARD domain-containing intracellular protein that has recently been identified as a class I MHC transactivator (CITA). RSV infection of A549 cells promotes upregulation of NLRC5 via beta interferon (IFN-β) production, since the NLRC5-inducing activity in a conditioned medium from RSV-infected A549 cells was removed by antibody to IFN-β, but not by antibody to IFN-γ. RSV infection resulted in RIG-I upregulation and induction of NLRC5 and MHC-I. Suppression of RIG-I induction significantly blocked NLRC5, as well as MHC-I, upregulation and diminished IRF3 activation. Importantly, Vero cells deficient in interferon production still upregulated MHC-I following introduction of the RSV genome by infection or transfection, further supporting a key role for RIG-I. A model is therefore proposed in which the host upregulates MHC-I expression during RSV infection directly via the induction of RIG-I and NLRC5 expression. Since elevated expression of MHC-I molecules can sensitize host cells to T lymphocyte-mediated cytotoxicity or immunopathologic damage, the results have significant implications for the modification of immunity in RSV disease. IMPORTANCE Human respiratory syncytial virus (RSV) is the leading cause of bronchiolitis and pneumonia in infants and young children worldwide. Infection early in life is linked to persistent wheezing and allergic asthma in later life, possibly related to upregulation of major histocompatibility class I (MHC-I) on the cell surface, which facilitates cytotoxic T cell activation and antiviral immunity. Here, we show that RSV infection of lung epithelial

  10. Major histocompatibility complex associations of ankylosing spondylitis are complex and involve further epistasis with ERAP1

    PubMed Central

    Cortes, Adrian; Pulit, Sara L.; Leo, Paul J.; Pointon, Jenny J.; Robinson, Philip C.; Weisman, Michael H.; Ward, Michael; Gensler, Lianne S.; Zhou, Xiaodong; Garchon, Henri-Jean; Chiocchia, Gilles; Nossent, Johannes; Lie, Benedicte A.; Førre, Øystein; Tuomilehto, Jaakko; Laiho, Kari; Bradbury, Linda A.; Elewaut, Dirk; Burgos-Vargas, Ruben; Stebbings, Simon; Appleton, Louise; Farrah, Claire; Lau, Jonathan; Haroon, Nigil; Mulero, Juan; Blanco, Francisco J.; Gonzalez-Gay, Miguel A.; Lopez-Larrea, C; Bowness, Paul; Gaffney, Karl; Gaston, Hill; Gladman, Dafna D.; Rahman, Proton; Maksymowych, Walter P.; Crusius, J. Bart A.; van der Horst-Bruinsma, Irene E.; Valle-Oñate, Raphael; Romero-Sánchez, Consuelo; Hansen, Inger Myrnes; Pimentel-Santos, Fernando M.; Inman, Robert D.; Martin, Javier; Breban, Maxime; Wordsworth, Bryan Paul; Reveille, John D.; Evans, David M.; de Bakker, Paul I.W.; Brown, Matthew A.

    2015-01-01

    Ankylosing spondylitis (AS) is a common, highly heritable, inflammatory arthritis for which HLA-B*27 is the major genetic risk factor, although its role in the aetiology of AS remains elusive. To better understand the genetic basis of the MHC susceptibility loci, we genotyped 7,264 MHC SNPs in 22,647 AS cases and controls of European descent. We impute SNPs, classical HLA alleles and amino-acid residues within HLA proteins, and tested these for association to AS status. Here we show that in addition to effects due to HLA-B*27 alleles, several other HLA-B alleles also affect susceptibility. After controlling for the associated haplotypes in HLA-B, we observe independent associations with variants in the HLA-A, HLA-DPB1 and HLA-DRB1 loci. We also demonstrate that the ERAP1 SNP rs30187 association is not restricted only to carriers of HLA-B*27 but also found in HLA-B*40:01 carriers independently of HLA-B*27 genotype. PMID:25994336

  11. Major histocompatibility complex associations of ankylosing spondylitis are complex and involve further epistasis with ERAP1.

    PubMed

    Cortes, Adrian; Pulit, Sara L; Leo, Paul J; Pointon, Jenny J; Robinson, Philip C; Weisman, Michael H; Ward, Michael; Gensler, Lianne S; Zhou, Xiaodong; Garchon, Henri-Jean; Chiocchia, Gilles; Nossent, Johannes; Lie, Benedicte A; Førre, Øystein; Tuomilehto, Jaakko; Laiho, Kari; Bradbury, Linda A; Elewaut, Dirk; Burgos-Vargas, Ruben; Stebbings, Simon; Appleton, Louise; Farrah, Claire; Lau, Jonathan; Haroon, Nigil; Mulero, Juan; Blanco, Francisco J; Gonzalez-Gay, Miguel A; Lopez-Larrea, C; Bowness, Paul; Gaffney, Karl; Gaston, Hill; Gladman, Dafna D; Rahman, Proton; Maksymowych, Walter P; Crusius, J Bart A; van der Horst-Bruinsma, Irene E; Valle-Oñate, Raphael; Romero-Sánchez, Consuelo; Hansen, Inger Myrnes; Pimentel-Santos, Fernando M; Inman, Robert D; Martin, Javier; Breban, Maxime; Wordsworth, Bryan Paul; Reveille, John D; Evans, David M; de Bakker, Paul I W; Brown, Matthew A

    2015-01-01

    Ankylosing spondylitis (AS) is a common, highly heritable, inflammatory arthritis for which HLA-B*27 is the major genetic risk factor, although its role in the aetiology of AS remains elusive. To better understand the genetic basis of the MHC susceptibility loci, we genotyped 7,264 MHC SNPs in 22,647 AS cases and controls of European descent. We impute SNPs, classical HLA alleles and amino-acid residues within HLA proteins, and tested these for association to AS status. Here we show that in addition to effects due to HLA-B*27 alleles, several other HLA-B alleles also affect susceptibility. After controlling for the associated haplotypes in HLA-B, we observe independent associations with variants in the HLA-A, HLA-DPB1 and HLA-DRB1 loci. We also demonstrate that the ERAP1 SNP rs30187 association is not restricted only to carriers of HLA-B*27 but also found in HLA-B*40:01 carriers independently of HLA-B*27 genotype. PMID:25994336

  12. Patterns of selection and allele diversity of class I and class II major histocompatibility loci across the species range of sockeye salmon (Oncorhynchus nerka).

    PubMed

    McClelland, Erin K; Ming, Tobi J; Tabata, Amy; Kaukinen, Karia H; Beacham, Terry D; Withler, Ruth E; Miller, Kristina M

    2013-09-01

    The major histocompatibility complex (MHC), an important component of the vertebrate immune system, provides an important suite of genes to examine the role of genetic diversity at non-neutral loci for population persistence. We contrasted patterns of diversity at the two classical MHC loci in sockeye salmon (Oncorhynchus nerka), MHC class I (UBA) and MHC class II (DAB), and neutral microsatellite loci across 70 populations spanning the species range from Washington State to Japan. There was no correlation in allelic richness or heterozygosity between MHC loci or between MHC loci and microsatellites. The two unlinked MHC loci may be responding to different selective pressures; the distribution of FST values for the two loci was uncorrelated, and evidence for both balancing and directional selection on alleles and lineages of DAB and UBA was observed in populations throughout the species range but rarely on both loci within a population. These results suggest that fluctuating selection has resulted in the divergence of MHC loci in contemporary populations. PMID:24033436

  13. Applicability of major histocompatibility complex DRB1 alleles as markers to detect vertebrate hybridization: a case study from Iberian ibex × domestic goat in southern Spain

    PubMed Central

    2012-01-01

    Background Hybridization between closely related wild and domestic species is of great concern because it can alter the evolutionary integrity of the affected populations. The high allelic variability of Major Histocompatibility Complex (MHC) loci usually excludes them from being used in studies to detect hybridization events. However, if a) the parental species don’t share alleles, and b) one of the parental species possesses an exceptionally low number of alleles (to facilitate analysis), then even MHC loci have the potential to detect hybrids. Results By genotyping the exon2 of the MHC class II DRB1 locus, we were able to detect hybridization between domestic goats (Capra hircus) and free-ranging Iberian ibex (Capra pyrenaica hispanica) by molecular means. Conclusions This is the first documentation of a Capra pyrenaica × Capra hircus hybridization, which presented us the opportunity to test the applicability of MHC loci as new, simple, cost-effective, and time-saving approach to detect hybridization between wild species and their domesticated relatives, thus adding value to MHC genes role in animal conservation and management. PMID:23006678

  14. Narcolepsy: autoimmunity, effector T cell activation due to infection, or T cell independent, major histocompatibility complex class II induced neuronal loss?

    PubMed

    Fontana, Adriano; Gast, Heidemarie; Reith, Walter; Recher, Mike; Birchler, Thomas; Bassetti, Claudio L

    2010-05-01

    Human narcolepsy with cataplexy is a neurological disorder, which develops due to a deficiency in hypocretin producing neurons in the hypothalamus. There is a strong association with human leucocyte antigens HLA-DR2 and HLA-DQB1*0602. The disease typically starts in adolescence. Recent developments in narcolepsy research support the hypothesis of narcolepsy being an immune-mediated disease. Narcolepsy is associated with polymorphisms of the genes encoding T cell receptor alpha chain, tumour necrosis factor alpha and tumour necrosis factor receptor II. Moreover the rate of streptococcal infection is increased at onset of narcolepsy. The hallmarks of anti-self reactions in the tissue--namely upregulation of major histocompatibility antigens and lymphocyte infiltrates--are missing in the hypothalamus. These findings are questionable because they were obtained by analyses performed many years after onset of disease. In some patients with narcolepsy autoantibodies to Tribbles homolog 2, which is expressed by hypocretin neurons, have been detected recently. Immune-mediated destruction of hypocretin producing neurons may be mediated by microglia/macrophages that become activated either by autoantigen specific CD4(+) T cells or superantigen stimulated CD8(+) T cells, or independent of T cells by activation of DQB1*0602 signalling. Activation of microglia and macrophages may lead to the release of neurotoxic molecules such as quinolinic acid, which has been shown to cause selective destruction of hypocretin neurons in the hypothalamus. PMID:20403960

  15. Tissue factor initiates glomerular fibrin deposition and promotes major histocompatibility complex class II expression in crescentic glomerulonephritis.

    PubMed Central

    Erlich, J. H.; Holdsworth, S. R.; Tipping, P. G.

    1997-01-01

    Increased glomerular tissue factor (TF) expression is associated with glomerular fibrin deposition and renal failure in human and experimental crescentic glomerulonephritis (GN). However, the in vivo functional contribution of TF to the development of glomerular fibrin deposition, crescent formation, and renal failure in GN has not been established. The contribution of TF to fibrin deposition and renal injury was studied in a rabbit model of crescentic GN in which glomerular macrophage infiltration, augmented TF expression, and fibrin deposition are prominent. Administration of anti-TF antibody inhibited glomerular TF activity in nephritic glomeruli by 96%, without affecting macrophage accumulation or systemic indices of coagulation. Anti-TF antibody significantly reduced glomerular fibrin deposition (fibrin scores, 0.43 +/- 0.10 (treated) and 1.40 +/- 0.19 (control); P < 0.0005), crescent formation (0.33 +/- 0.05 (treated) and 1.0 +/- 0.06 (control); P < 0.0005), and development of renal failure (serum creatinine, 168 +/- 22 mumol/l (treated) and 267 +/- 35 mumol/l (control); P < 0.04). This was associated with significant reduction in proteinuria (1189 +/- 277 mg/24 hours (treated) and 2060 +/- 336 mg/24 hours (control); P < 0.03) and expression of MHC class II antigen in glomeruli (1.25 +/- 0.41 (treated) and 2.83 +/- 0.53 (control); P < 0.03) and in tubules and interstitial areas. These data demonstrate that TF is the major in vivo initiator of fibrin deposition in crescentic GN. The reduction in proteinuria and glomerular major histocompatibility class II antigen expression by TF inhibition suggests that TF may also activate other mediators that contribute to glomerular injury. Images Figure 1 PMID:9060825

  16. Inhibition of Class II Major Histocompatibility Complex Antigen Processing by Escherichia coli Heat-Labile Enterotoxin Requires an Enzymatically Active A Subunit

    PubMed Central

    Matousek, Milita P.; Nedrud, John G.; Cieplak, Witold; Harding, Clifford V.

    1998-01-01

    Escherichia coli heat-labile enterotoxin (LT) and cholera toxin (CT) were found to inhibit intracellular antigen processing. Processing was not inhibited by mutant LT with attenuated ADP-ribosyltransferase activity, CT B or LT B subunit, which enhanced presentation of preexisting cell surface peptide-class II major histocompatibility complex complexes. Inhibition of antigen processing correlated with A subunit ADP-ribosyltransferase activity. PMID:9632629

  17. Time-resolved fluorescence anisotropy and fluctuation correlation analysis of major histocompatibility complex class I proteins in fibroblast cells.

    PubMed

    Heikal, Ahmed A

    2014-03-15

    Major histocompatibility complex class I proteins, MHC(I), are expressed in almost all nucleated cells and synthesized in the endoplasmic reticulum (ER). The orientation and mobility of these complexes are crucial in their biological function in the immune system, i.e., the cytosolic pathogen peptides loading and their presentation to T-cell receptors at the plasma membrane, where cell destruction is triggered. Here, we investigate the structural flexibility and associations of GFP-encoded MHC(I) alleles (H2L(d)), namely H2L(d)GFPin and H2L(d)GFPout, in cultured mouse fibroblast cells. Time-resolved fluorescence anisotropy of H2L(d)GFPin in the ER indicates a dominant overall tumbling motion of 56±7 ns (ER), with a fast conformational flexibility, as compared with a restricted rotation of H2L(d)GFPout. At the single-molecule level, the diffusion coefficient of H2L(d)GFPin and H2L(d)GFPout in the ER is (1.8±0.5)×10(-9) and (2.1±0.6)×10(-9) cm(2)/s, respectively, as revealed by fluorescence correlation spectroscopy. A complementary immunoblotting of H2L(d)GFP constructs, isolated from mouse fibroblast cells, reveals band at 75 kDa as compared with 29 kDa of the free EGFP. These real-time dynamics provide new insights into the structural flexibility and intracellular associations of GFP-labeled MHC(I) alleles (H2L(d)) in living cells. PMID:23811298

  18. Inflammatory bowel diseases influence major histocompatibility complex class I (MHC I) and II compartments in intestinal epithelial cells.

    PubMed

    Bär, F; Sina, C; Hundorfean, G; Pagel, R; Lehnert, H; Fellermann, K; Büning, J

    2013-05-01

    Antigen presentation by intestinal epithelial cells (IEC) is crucial for intestinal homeostasis. Disturbances of major histocompatibility complex class I (MHC I)- and II-related presentation pathways in IEC appear to be involved in an altered activation of CD4(+) and CD8(+) T cells in inflammatory bowel disease. However, a comprehensive analysis of MHC I- and II-enriched compartments in IEC of the small and large bowel in the healthy state as opposed to inflammatory bowel diseases is lacking. The aim of this study was to characterize the subcellular expression of MHC I and II in the endocytic pathway of IEC throughout all parts of the intestinal tract, and to identify differences between the healthy state and inflammatory bowel diseases. Biopsies were taken by endoscopy from the duodenum, jejunum, ileum and colon in healthy individuals (n = 20). In Crohn's disease (CD), biopsies were obtained from the ileum and colon and within the colon from ulcerative colitis (UC) patients (n = 15). Analysis of IEC was performed by immunoelectron microscopy. MHC I and II were identified in early endosomes and multi-vesicular, multi-lamellar, electrondense and vacuolar late endosomes. Both molecules were enriched in multi-vesicular bodies. No differences were found between the distinct parts of the gut axis. In CD and UC the expression of MHC I and II showed a shift from multi-vesicular bodies towards the basolateral membranes. Within the multi-vesicular bodies, MHC I and II moved from internal vesicles to the limiting membranes upon inflammation in CD and UC. MHC I- and II-enriched compartments in IEC were identical in all parts of the small and large bowel. CD and UC appear to modulate the MHC I- and II-related presentation pathways of exogenous antigens in IEC. PMID:23574324

  19. Major histocompatibility complex class II (DR) antigen and costimulatory molecules on in vitro and in vivo activated human polymorphonuclear neutrophils

    PubMed Central

    Sandilands, Gavin P; McCrae, Jame; Hill, Kathryn; Perry, Martin; Baxter, Derek

    2006-01-01

    We have previously shown that normal human peripheral blood polymorphonuclear neutrophils (PMNs) contain cytoplasmic ‘stores’ of three key molecules normally associated with antigen presentation and T-cell costimulation, i.e. major histocompatibility complex class II (DR) antigen, CD80 (B7-1) and CD86 (B7-2). These cytoplasmic molecules were found to translocate to the cell surface within a few minutes following cross-linking (X-L) of Mac-1: an early neutrophil activation signal. In this study we have compared X-L of Mac −1 in parallel with four other well documented in vitro neutrophil activators: phorbol myristate acetate, N-formyl methionyl leucyl phenylalanine, lipopolysaccharide, and phagocytosis of immunoglobulin G–Latex particles. In addition, we have used paired samples of neutrophils obtained from peripheral blood (as a control) and synovial fluid from patients with rheumatoid arthritis as a source of in vivo activated cells. With the exception of phagocytosis, all activators resulted in the rapid (within 30 min) generation of two populations of activated neutrophils (designated P1 and P2) based on flow-cytometry measurements of size, granularity and phenotype. Significant up-regulation of DR and costimulatory molecules was observed, predominantly on P2 cells, with all activators except phagocytosis. CD80 and CD86 were noted to respond to the various activation signals in a different pattern suggesting that their intracellular granule location may be different. Dual-staining confocal laser microscopy studies showed that CD80 is largely confined to secretory vesicles (SVs) while CD86 appears to have a much wider distribution being found in SVs and within secondary (specific) and primary (azurophilic) granules. Increased surface expression of these antigens was also observed on P2 synovial fluid neutrophils appearing as large heterogeneous clusters on the cell surface when visualized by confocal laser microscopy. PMID:17034427

  20. Molecular Architecture of the Major Histocompatibility Complex Class I-Binding Site of Ly49 Natural Killer Cell Receptors

    SciTech Connect

    Deng,L.; Cho, S.; Malchiodi, E.; Kerzic, M.; Dam, J.; Mariuzza, R.

    2008-01-01

    Natural killer (NK) cells play a vital role in the detection and destruction of virally infected and tumor cells during innate immune responses. The highly polymorphic Ly49 family of NK receptors regulates NK cell function by sensing major histocompatibility complex class I (MHC-I) molecules on target cells. Despite the determination of two Ly49-MHC-I complex structures, the molecular features of Ly49 receptors that confer specificity for particular MHC-I alleles have not been identified. To understand the functional architecture of Ly49-binding sites, we determined the crystal structures of Ly49C and Ly49G and completed refinement of the Ly49C-H-2Kb complex. This information, combined with mutational analysis of Ly49A, permitted a structure-based classification of Ly49s that we used to dissect the binding site into three distinct regions, each having different roles in MHC recognition. One region, located at the center of the binding site, has a similar structure across the Ly49 family and mediates conserved interactions with MHC-I that contribute most to binding. However, the preference of individual Ly49s for particular MHC-I molecules is governed by two regions that flank the central region and are structurally more variable. One of the flanking regions divides Ly49s into those that recognize both H-2D and H-2K versus only H-2D ligands, whereas the other discriminates among H-2D or H-2K alleles. The modular design of Ly49-binding sites provides a framework for predicting the MHC-binding specificity of Ly49s that have not been characterized experimentally.

  1. Murine cytomegalovirus perturbs endosomal trafficking of major histocompatibility complex class I molecules in the early phase of infection.

    PubMed

    Tomas, Maja Ilić; Kucić, Natalia; Mahmutefendić, Hana; Blagojević, Gordana; Lucin, Pero

    2010-11-01

    Murine cytomegalovirus (MCMV) functions interfere with protein trafficking in the secretory pathway. In this report we used Δm138-MCMV, a recombinant virus with a deleted viral Fc receptor, to demonstrate that MCMV also perturbs endosomal trafficking in the early phase of infection. This perturbation had a striking impact on cell surface-resident major histocompatibility complex class I (MHC-I) molecules due to the complementary effect of MCMV immunoevasins, which block their egress from the secretory pathway. In infected cells, constitutively endocytosed cell surface-resident MHC-I molecules were arrested and retained in early endosomal antigen 1 (EEA1)-positive and lysobisphosphatidic acid (LBPA)-negative perinuclear endosomes together with clathrin-dependent cargo (transferrin receptor, Lamp1, and epidermal growth factor receptor). Their progression from these endosomes into recycling and degradative routes was inhibited. This arrest was associated with a reduction of the intracellular content of Rab7 and Rab11, small GTPases that are essential for the maturation of recycling and endolysosomal domains of early endosomes. The reduced recycling of MHC-I in Δm138-MCMV-infected cells was accompanied by their accelerated loss from the cell surface. The MCMV function that affects cell surface-resident MHC-I was activated in later stages of the early phase of viral replication, after the expression of known immunoevasins. MCMV without the three immunoevasins (the m04, m06, and m152 proteins) encoded a function that affects endosomal trafficking. This function, however, was not sufficient to reduce the cell surface expression of MHC-I in the absence of the transport block in the secretory pathway. PMID:20719942

  2. Testing for post-copulatory selection for major histocompatibility complex genotype in a semi-free-ranging primate population.

    PubMed

    Setchell, Joanna M; Abbott, Kristin M; Gonzalez, Jean-Paul; Knapp, Leslie A

    2013-10-01

    A large body of evidence suggests that major histocompatibility complex (MHC) genotype influences mate choice. However, few studies have investigated MHC-mediated post-copulatory mate choice under natural, or even semi-natural, conditions. We set out to explore this question in a large semi-free-ranging population of mandrills (Mandrillus sphinx) using MHC-DRB genotypes for 127 parent-offspring triads. First, we showed that offspring MHC heterozygosity correlates positively with parental MHC dissimilarity suggesting that mating among MHC dissimilar mates is efficient in increasing offspring MHC diversity. Second, we compared the haplotypes of the parental dyad with those of the offspring to test whether post-copulatory sexual selection favored offspring with two different MHC haplotypes, more diverse gamete combinations, or greater within-haplotype diversity. Limited statistical power meant that we could only detect medium or large effect sizes. Nevertheless, we found no evidence for selection for heterozygous offspring when parents share a haplotype (large effect size), genetic dissimilarity between parental haplotypes (we could detect an odds ratio of ≥1.86), or within-haplotype diversity (medium-large effect). These findings suggest that comparing parental and offspring haplotypes may be a useful approach to test for post-copulatory selection when matings cannot be observed, as is the case in many study systems. However, it will be extremely difficult to determine conclusively whether post-copulatory selection mechanisms for MHC genotype exist, particularly if the effect sizes are small, due to the difficulty in obtaining a sufficiently large sample. PMID:23677678

  3. Hepatitis B virus-like particles access major histocompatibility class I and II antigen presentation pathways in primary dendritic cells.

    PubMed

    Moffat, Jessica M; Cheong, Wan-Shoo; Villadangos, José A; Mintern, Justine D; Netter, Hans J

    2013-04-26

    Virus-like particles (VLPs) represent high density displays of viral proteins that efficiently trigger immunity. VLPs composed of the small hepatitis B virus envelope protein (HBsAgS) are useful vaccine platforms that induce humoral and cellular immune responses. Notably, however, some studies suggest HBsAgS VLPs impair dendritic cell (DC) function. Here we investigated HBsAgS VLP interaction with DC subsets and antigen access to major histocompatibility complex (MHC) class I and II antigen presentation pathways in primary DCs. HBsAgS VLPs impaired plasmacytoid DC (pDC) interferon alpha (IFNα) production in response to CpG in vitro, but did not alter conventional DC (cDC) or pDC phenotype when administered in vivo. To assess cellular immune responses, HBsAgS VLPs were generated containing the ovalbumin (OVA) model epitopes OVA(257-264) and OVA(323-339) to access MHCI and MHCII antigen presentation pathways, respectively; both in vitro and following immunisation in vivo. HBsAgS VLP-OVA(257-264) elicited CTL responses in vivo that were not enhanced by inclusion of an additional MHCII helper epitope. HBsAgS VLP-OVA(257-264) administered in vivo was cross-presented by CD8(+) DCs, but not CD8(-) DCs. Therefore, HBsAgS VLPs can deliver antigen to both MHCI and MHCII antigen presentation pathways in primary DCs and promote cytotoxic and helper T cell priming despite their suppressive effect on pDCs. PMID:23473776

  4. Generation of Antiviral Major Histocompatibility Complex Class I-Restricted T Cells in the Absence of CD8 Coreceptors ▿

    PubMed Central

    Andrews, Nicolas P.; Pack, Christopher D.; Lukacher, Aron E.

    2008-01-01

    The CD8 coreceptor is important for positive selection of major histocompatibility complex I (MHC-I)-restricted thymocytes and in the generation of pathogen-specific T cells. However, the requirement for CD8 in these processes may not be essential. We previously showed that mice lacking β2-microglobulin are highly susceptible to tumors induced by mouse polyoma virus (PyV), but CD8-deficient mice are resistant to these tumors. In this study, we show that CD8-deficient mice also control persistent PyV infection as efficiently as wild-type mice and generate a substantial virus-specific, MHC-I-restricted, T-cell response. Infection with vesicular stomatitis virus (VSV), which is acutely cleared, also recruited antigen-specific, MHC-I-restricted T cells in CD8-deficient mice. Yet, unlike in VSV infection, the antiviral MHC-I-restricted T-cell response to PyV has a prolonged expansion phase, indicating a requirement for persistent infection in driving T-cell inflation in CD8-deficient mice. Finally, we show that the PyV-specific, MHC-I-restricted T cells in CD8-deficient mice, while maintained long term at near-wild-type levels, are short lived in vivo and have extremely narrow T-cell receptor repertoires. These findings provide a possible explanation for the resistance of CD8-deficient mice to PyV-induced tumors and have implications for the maintenance of virus-specific MHC-I-restricted T cells during persistent infection. PMID:18337581

  5. Major histocompatibility complex class I expression on neurons in subacute sclerosing panencephalitis and experimental subacute measles encephalitis

    SciTech Connect

    Gogate, N.; Yamabe, Toshio; Verma, L.; Dhib-Jalbut, S.

    1996-04-01

    Lack of major histocompatibility class I antigens on neurons has been implicated as a possible mechanism for viral persistence in the brain since these antigens are required for cytotoxic T-lymphocyte recognition of infected cells. In subacute sclerosing panencephalitis (SSPE), measles virus (MV) persists in neurons, resulting in a fatal chronic infection. MHC class I mRNA expression was examined in formalin-fixed brain tissue from 6 SSPE patients by in situ hybridization. In addition MHC class I protein expression in MV-infected neurons was examined in experimental Subacute Measles Encephalitis (SME) by double immunohistochemistry. MHC class I mRNA expression was found to be upregulated in SSPE tissues studied, and in 5 out of 6 cases the expression was definitively seen on neurons. The percentage of neurons expressing MHC class I mRNA ranged between 20 to 84% in infected areas. There was no correlation between the degree of infection and expression of MHC class I molecules on neurons. Importantly, the number of neurons co-expressing MHC class I and MV antigens was markedly low, varying between 2 to 8%. Similar results were obtained in SME where 20 to 30% of the neurons expressed MHC class I but < 8% co-expressed MHC class I and MV antigens. Perivascular infiltrating cells in the infected regions in SME expressed IFN{gamma} immunoreactivity. The results suggest that MV may not be directly involved in the induction of MHC class I on neurons and that cytokines such as IFN{gamma} may play an important role. Furthermore, the paucity of neurons co-expressing MHC class I and MV antigens in SSPE and SME suggests that such cells are either rapidly cleared by cytotoxic T lymphocytes (CTL), or, alternatively, lack of co-expression of MHC class I on MV infected neurons favors MV persistence in these cells by escaping CTL recognition. 33 refs., 3 figs., 3 tabs.

  6. Localization of major histocompatibility complex class II molecules in phagolysosomes of murine macrophages infected with Leishmania amazonensis.

    PubMed Central

    Antoine, J C; Jouanne, C; Lang, T; Prina, E; de Chastellier, C; Frehel, C

    1991-01-01

    Leishmania-infected macrophages are potential antigen-presenting cells for CD4+ T lymphocytes, which recognize parasite antigens bound to major histocompatibility complex class II molecules (Ia). However, the intracellular sites where Ia and antigens may interact are far from clear, since parasites grow within the modified lysosomal compartment of the host cell, whereas Ia molecules seem to be targeted to endosomes. To address this question, the expression and fate of Ia molecules were studied by immunocytochemistry in Leishmania amazonensis-infected murine macrophages stimulated with gamma interferon. In uninfected macrophages, Ia molecules were localized on the plasma membrane and in perinuclear vesicles, but they underwent a dramatic redistribution after infection, since most of the intracellular staining was then associated with the periphery of the parasitophorous vacuoles (p.v.) and quite often polarized towards amastigote-binding sites. The Ii invariant chain, which is transiently associated with Ia during their intracellular transport, although well expressed in infected macrophages, apparently did not reach the p.v. Similar findings were observed with macrophages from mice either resistant or highly susceptible to Leishmania infection. In order to determine the origin of p.v.-associated Ia, the fate of plasma membrane, endosomal, and lysosomal markers, detected with specific antibodies, was determined after infection. At 48 h after infection, p.v. was found to exhibit a membrane composition typical of mature lysosomes. Overall, these data suggest that (i) Ia located in p.v. originate from secondary lysosomes involved in the biogenesis of this compartment or circulate in several endocytic organelles, including lysosomes and (ii) p.v. could play a role in antigen processing and presentation. Alternatively, the presence of high amounts of Ia in p.v. could be due to a Leishmania-induced mechanism by means of which this organism may evade the immune response

  7. Expression of major histocompatibility complex antigens on mouse brain microvascular endothelial cells in relation to susceptibility to cerebral malaria.

    PubMed Central

    Monso-Hinard, C; Lou, J N; Behr, C; Juillard, P; Grau, G E

    1997-01-01

    The physiopathology of experimental cerebral malaria (CM), an acute neurological complication of Plasmodium berghei ANKA (PbA) infection, involves interferon-gamma (IFN-gamma) and tumour necrosis factor-alpha (TNF-alpha), two cytokines that are known to modulate major histocompatibility complex (MHC) molecule expression. The aim of this study was to evaluate whether the genetic susceptibility to CM is related to the constitutive or IFN-gamma-induced expression of MHC molecules on brain microvessels. To this end, brain microvascular endothelial cells (B-MVEC) were isolated from CM-susceptible (CM-S, CBA/J) and resistant (CM-R, BALB/c) mice. By flow cytometry, we found that less than 5% of CM-S B-MVEC constitutively expressed MHC class I molecules, in contrast to up to 90% of CM-R B-MVEC. Upon stimulation with IFN-gamma, the percentage of positive cells for MHC class I molecules in CM-S B-MVEC became comparable to CM-R B-MVEC, but a higher fluorescence intensity existed on CM-S B-MVEC compared with CM-R B-MVEC. MHC class II molecules were not constitutively expressed on B-MVEC from either strain. IFN-gamma-induced expression of MHC class II (I-A, I-E) molecules was significantly higher in CM-S than CM-R B-MVEC both in percentage of positive cells and fluorescence intensity. These data demonstrate that absent or low MHC class I and higher inducibility of MHC class II expression on B-MVEC are associated with the genetic susceptibility to CM. Images Figure 4 Figure 5 PMID:9370924

  8. Histone deacetylase 1/mSin3A disrupts gamma interferon-induced CIITA function and major histocompatibility complex class II enhanceosome formation.

    PubMed

    Zika, Eleni; Greer, Susanna F; Zhu, Xin-Sheng; Ting, Jenny P-Y

    2003-05-01

    The class II transactivator (CIITA) is a master transcriptional regulator of major histocompatibility complex class II (MHC-II) promoters. CIITA does not bind DNA, but it interacts with the transcription factors RFX5, NF-Y, and CREB and associated chromatin-modifying enzymes to form an enhanceosome. This report examines the effects of histone deacetylases 1 and 2 (HDAC1/HDAC2) on MHC-II gene induction by gamma interferon (IFN-gamma) and CIITA. The results show that an inhibitor of HDACs, trichostatin A, enhances IFN-gamma-induced MHC-II expression, while HDAC1/HDAC2 inhibits IFN-gamma- and CIITA-induced MHC-II gene expression. mSin3A, a corepressor of HDAC1/HDAC2, is important for this inhibition, while NcoR, a corepressor of HDAC3, is not. The effect of this inhibition is directed at CIITA, since HDAC1/HDAC2 reduces transactivation by a GAL4-CIITA fusion protein. CIITA binds to overexpressed and endogenous HDAC1, suggesting that HDAC and CIITA may affect each other by direct or indirect association. Inhibition of HDAC activity dramatically increases the association of NF-YB and RFX5 with CIITA, the assembly of CIITA, NF-YB, and RFX5 enhanceosome, and the extent of H3 acetylation at the MHC-II promoter. These results suggest a model where HDAC1/HDAC2 affect the function of CIITA through a disruption of MHC-II enhanceosome and relevant coactivator-transcription factor association and provide evidence that CIITA may act as a molecular switch to modulate MHC-II transcription by coordinating the functions of both histone acetylases and HDACs. PMID:12697811

  9. Kaposi's Sarcoma-Associated Herpesvirus Viral Interferon Regulatory Factor 3 Inhibits Gamma Interferon and Major Histocompatibility Complex Class II Expression▿†

    PubMed Central

    Schmidt, Katharina; Wies, Effi; Neipel, Frank

    2011-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) carries four genes with homology to human interferon regulatory factors (IRFs). One of these IRFs, the viral interferon regulatory factor 3 (vIRF-3), is expressed in latently infected primary effusion lymphoma (PEL) cells and required for their continuous proliferation. Moreover, vIRF-3 is known to be involved in modulation of the type I interferon (IFN) response. We now show that vIRF-3 also interferes with the type II interferon system and antigen presentation to the adaptive immune system. Starting with an analysis of the transcriptome, we show that vIRF-3 inhibits expression of major histocompatibility complex class II (MHC II) molecules: small interfering RNA (siRNA)-mediated knockdown of vIRF-3 in KSHV-infected PEL cell lines resulted in increased MHC II levels; overexpression of vIRF-3 in KSHV-negative B cells leads to downmodulation of MHC II. This regulation could be traced back to inhibition of class II transactivator (CIITA) transcription by vIRF-3. Reporter assays revealed that the gamma interferon (IFN-γ)-sensitive CIITA promoters PIV and PIII were inhibited by vIRF-3. Consistently, IFN-γ levels increased upon vIRF-3 knockdown in PEL cells. IFN-γ regulation by vIRF-3 was confirmed in reporter assays as well as by upregulation of typical IFN-γ target genes upon knockdown of vIRF-3 in PEL cells. In summary, we conclude that vIRF-3 contributes to the viral immunoevasion by downregulation of IFN-γ and CIITA and thus MHC II expression. PMID:21345951

  10. Parasite Manipulation of the Invariant Chain and the Peptide Editor H2-DM Affects Major Histocompatibility Complex Class II Antigen Presentation during Toxoplasma gondii Infection

    PubMed Central

    Leroux, Louis-Philippe; Nishi, Manami; El-Hage, Sandy; Fox, Barbara A.; Bzik, David J.

    2015-01-01

    Toxoplasma gondii is an obligate intracellular protozoan parasite. This apicomplexan is the causative agent of toxoplasmosis, a leading cause of central nervous system disease in AIDS. It has long been known that T. gondii interferes with major histocompatibility complex class II (MHC-II) antigen presentation to attenuate CD4+ T cell responses and establish persisting infections. Transcriptional downregulation of MHC-II genes by T. gondii was previously established, but the precise mechanisms inhibiting MHC-II function are currently unknown. Here, we show that, in addition to transcriptional regulation of MHC-II, the parasite modulates the expression of key components of the MHC-II antigen presentation pathway, namely, the MHC-II-associated invariant chain (Ii or CD74) and the peptide editor H2-DM, in professional antigen-presenting cells (pAPCs). Genetic deletion of CD74 restored the ability of infected dendritic cells to present a parasite antigen in the context of MHC-II in vitro. CD74 mRNA and protein levels were, surprisingly, elevated in infected cells, whereas MHC-II and H2-DM expression was inhibited. CD74 accumulated mainly in the endoplasmic reticulum (ER), and this phenotype required live parasites, but not active replication. Finally, we compared the impacts of genetic deletion of CD74 and H2-DM genes on parasite dissemination toward lymphoid organs in mice, as well as activation of CD4+ T cells and interferon gamma (IFN-γ) levels during acute infection. Cyst burdens and survival during the chronic phase of infection were also evaluated in wild-type and knockout mice. These results highlight the fact that the infection is influenced by multiple levels of parasite manipulation of the MHC-II antigen presentation pathway. PMID:26195549

  11. Parasite Manipulation of the Invariant Chain and the Peptide Editor H2-DM Affects Major Histocompatibility Complex Class II Antigen Presentation during Toxoplasma gondii Infection.

    PubMed

    Leroux, Louis-Philippe; Nishi, Manami; El-Hage, Sandy; Fox, Barbara A; Bzik, David J; Dzierszinski, Florence S

    2015-10-01

    Toxoplasma gondii is an obligate intracellular protozoan parasite. This apicomplexan is the causative agent of toxoplasmosis, a leading cause of central nervous system disease in AIDS. It has long been known that T. gondii interferes with major histocompatibility complex class II (MHC-II) antigen presentation to attenuate CD4(+) T cell responses and establish persisting infections. Transcriptional downregulation of MHC-II genes by T. gondii was previously established, but the precise mechanisms inhibiting MHC-II function are currently unknown. Here, we show that, in addition to transcriptional regulation of MHC-II, the parasite modulates the expression of key components of the MHC-II antigen presentation pathway, namely, the MHC-II-associated invariant chain (Ii or CD74) and the peptide editor H2-DM, in professional antigen-presenting cells (pAPCs). Genetic deletion of CD74 restored the ability of infected dendritic cells to present a parasite antigen in the context of MHC-II in vitro. CD74 mRNA and protein levels were, surprisingly, elevated in infected cells, whereas MHC-II and H2-DM expression was inhibited. CD74 accumulated mainly in the endoplasmic reticulum (ER), and this phenotype required live parasites, but not active replication. Finally, we compared the impacts of genetic deletion of CD74 and H2-DM genes on parasite dissemination toward lymphoid organs in mice, as well as activation of CD4(+) T cells and interferon gamma (IFN-γ) levels during acute infection. Cyst burdens and survival during the chronic phase of infection were also evaluated in wild-type and knockout mice. These results highlight the fact that the infection is influenced by multiple levels of parasite manipulation of the MHC-II antigen presentation pathway. PMID:26195549

  12. Two-dimensional nuclear magnetic resonance analysis of a labeled peptide bound to a class II major histocompatibility complex molecule.

    PubMed

    Driscoll, P C; Altman, J D; Boniface, J J; Sakaguchi, K; Reay, P A; Omichinski, J G; Appella, E; Davis, M M

    1993-07-20

    The formation of peptide/major histocompatibility complex (MHC) complexes and their subsequent recognition by T cells is a pivotal event in the initiation of an immune response. While X-ray crystal structures are now available for class I MHC/peptide complexes, little detailed structural information is known about the class II MHC equivalent, and there are no solution structure data for either. A 16 amino acid residue moth cytochrome c peptide (residues 88 to 103) was 13C-labeled for two-dimensional isotope-edited NMR analysis. The peptide was labeled either selectively in the methyl groups of alanine residues or uniformly at every carbon position, and bound to unlabeled soluble mouse I-Ek class II MHC molecules. Although alpha-helical in the native cytochrome c protein and with no uniform structure in solution, the peptide is bound to the I-Ek molecule with the alpha-carbon atoms of the 11 C-terminal residues held in the binding groove. This indicates that the class II MHC peptide binding site is somewhat larger than that of class I MHC molecules (> or = 11 amino acid residues versus 8 to 10 amino acid residues), consistent with recent data on eluted peptides. Despite the large size of the complex (approximately 70 kDa), nuclear Overhauser effects are clearly detectable between peptide side-chains and the MHC molecule. Indications of the buried or exposed nature of particular side-chains within the bound peptide are derived from the NMR data and these are used together with information from previous biological studies to propose a crude model of the interaction of the peptide with the groove of the MHC molecule. We find no evidence for a conformational change in the peptide/MHC complex in the spectra at pH 5.0 versus pH 7.0, despite a 40-fold faster on-rate for the peptide at the lower pH value. PMID:8393933

  13. Genetic drift vs. natural selection in a long-term small isolated population: major histocompatibility complex class II variation in the Gulf of California endemic porpoise (Phocoena sinus).

    PubMed

    Munguia-Vega, Adrian; Esquer-Garrigos, Yareli; Rojas-Bracho, Lorenzo; Vazquez-Juarez, Ricardo; Castro-Prieto, Aines; Flores-Ramirez, Sergio

    2007-10-01

    Although many studies confirm long-term small isolated populations (e.g. island endemics) commonly sustain low neutral genetic variation as a result of genetic drift, it is less clear how selection on adaptive or detrimental genes interplay with random forces. We investigated sequence variation at two major histocompatibility complex (Mhc) class II loci on a porpoise endemic to the upper Gulf of California, México (Phocoena sinus, or vaquita). Its unique declining population is estimated around 500 individuals. Single-strand conformation polymorphism analysis revealed one putative functional allele fixed at the locus DQB (n = 25). At the DRB locus, we found two presumed functional alleles (n = 29), differing by a single nonsynonymous nucleotide substitution that could increase the stability at the dimer interface of alphabeta-heterodimers on heterozygous individuals. Identical trans-specific DQB1 and DRB1 alleles were identified between P. sinus and its closest relative, the Burmeister's porpoise (Phocoena spinipinnis). Comparison with studies on four island endemic mammals suggests fixation of one allele, due to genetic drift, commonly occurs at the DQA or DQB loci (effectively neutral). Similarly, deleterious alleles of small effect are also effectively neutral and can become fixed; a high frequency of anatomical malformations on vaquita gave empirical support to this prediction. In contrast, retention of low but functional polymorphism at the DRB locus was consistent with higher selection intensity. These observations indicated natural selection could maintain (and likely also purge) some crucial alleles even in the face of strong and prolonged genetic drift and inbreeding, suggesting long-term small populations should display low inbreeding depression. Low levels of Mhc variation warn about a high susceptibility to novel pathogens and diseases in vaquita. PMID:17727623

  14. Several regions in the major histocompatibility complex confer risk for anti-CCP-antibody positive rheumatoid arthritis, independent of the DRB1 locus.

    PubMed

    Lee, Hye-Soon; Lee, Annette T; Criswell, Lindsey A; Seldin, Michael F; Amos, Christopher I; Carulli, John P; Navarrete, Cristina; Remmers, Elaine F; Kastner, Daniel L; Plenge, Robert M; Li, Wentian; Gregersen, Peter K

    2008-01-01

    Recent evidence suggests that additional risk loci for RA are present in the major histocompatibility complex (MHC), independent of the class II HLA-DRB1 locus. We have now tested a total of 1,769 SNPs across 7.5Mb of the MHC located from 6p22.2 (26.03 Mb) to 6p21.32 (33.59 Mb) derived from the Illumina 550K Beadchip (Illumina, San Diego, CA, USA). For an initial analysis in the whole dataset (869 RA CCP + cases, 1,193 controls), the strongest association signal was observed in markers near the HLA-DRB1 locus, with additional evidence for association extending out into the Class I HLA region. To avoid confounding that may arise due to linkage disequilibrium with DRB1 alleles, we analyzed a subset of the data by matching cases and controls by DRB1 genotype (both alleles matched 1:1), yielding a set of 372 cases with 372 controls. This analysis revealed the presence of at least two regions of association with RA in the Class I region, independent of DRB1 genotype. SNP alleles found on the conserved A1-B8-DR3 (8.1) haplotype show the strongest evidence of positive association (P ~ 0.00005) clustered in the region around the HLA-C locus. In addition, we identified risk alleles that are not present on the 8.1 haplotype, with maximal association signals (P ~ 0.001-0.0027) located near the ZNF311 locus. This latter association is enriched in DRB1*0404 individuals. Finally, several additional association signals were found in the extreme centromeric portion of the MHC, in regions containing the DOB1, TAP2, DPB1, and COL11A2 genes. These data emphasize that further analysis of the MHC is likely to reveal genetic risk factors for rheumatoid arthritis that are independent of the DRB1 shared epitope alleles. PMID:18309376

  15. Equine herpesvirus type 4 UL56 and UL49.5 proteins downregulate cell surface major histocompatibility complex class I expression independently of each other.

    PubMed

    Said, Abdelrahman; Azab, Walid; Damiani, Armando; Osterrieder, Nikolaus

    2012-08-01

    Major histocompatibility complex class I (MHC-I) molecules are critically important in the host defense against various pathogens through presentation of viral peptides to cytotoxic T lymphocytes (CTLs), a process resulting in the destruction of virus-infected cells. Herpesviruses interfere with CTL-mediated elimination of infected cells by various mechanisms, including inhibition of peptide transport and loading, perturbation of MHC-I trafficking, and rerouting and proteolysis of cell surface MHC-I. In this study, we show that equine herpesvirus type 4 (EHV-4) modulates MHC-I cell surface expression through two different mechanisms. First, EHV-4 can lead to a significant downregulation of MHC-I expression at the cell surface through the product of ORF1, a protein expressed with early kinetics from a gene that is homologous to herpes simplex virus 1 UL56. The EHV-4 UL56 protein reduces cell surface MHC-I as early as 4 h after infection. Second, EHV-4 can interfere with MHC-I antigen presentation, starting at 6 h after infection, by inhibition of the transporter associated with antigen processing (TAP) through its UL49.5 protein. Although pUL49.5 has no immediate effect on overall surface MHC-I levels in infected cells, it blocks the supply of antigenic peptides to the endoplasmic reticulum (ER) and transport of peptide-loaded MHC-I to the cell surface. Taken together, our results show that EHV-4 encodes at least two viral immune evasion proteins: pUL56 reduces MHC-I molecules on the cell surface at early times after infection, and pUL49.5 interferes with MHC-I antigen presentation by blocking peptide transport in the ER. PMID:22623773

  16. Major Histocompatibility Complex Class I Downregulation Induced by Equine Herpesvirus Type 1 pUL56 Is through Dynamin-Dependent Endocytosis

    PubMed Central

    Huang, Teng; Lehmann, Maik J.; Said, Abdelrahman; Ma, Guanggang

    2014-01-01

    ABSTRACT Equine herpesvirus type 1 (EHV-1) downregulates cell surface expression of major histocompatibility complex class I (MHC-I) in infected cells. We have previously shown that pUL56 encoded by the EHV-1 ORF1 gene regulates the process (G. Ma, S. Feineis, N. Osterrieder, and G. R. Van de Walle, J. Virol. 86:3554–3563, 2012, doi:http://dx.doi.org/10.1128/JVI.06994-11). Here, we report that cell surface MHC-I in EHV-1-infected cells is internalized and degraded in the lysosomal compartment in a pUL56-dependent fashion. pUL56-induced MHC-I endocytosis required dynamin and tyrosine kinase but was independent of clathrin and caveolin-1, the main constituents of the clathrin- and raft/caveola-mediated endocytosis pathways, respectively. Downregulation of cell surface MHC-I was significantly inhibited by the ubiquitin-activating enzyme E1 inhibitor PYR41, indicating that ubiquitination is essential for the process. Finally, we show that downregulation is not specific for MHC-I and that other molecules, including CD46 and CD63, are also removed from the cell surface in a pUL56-dependent fashion. IMPORTANCE We show that alphaherpesvirus induces MHC-I downregulation through endocytosis, which is mediated by pUL56. The dynamin-dependent endocytic pathway is responsible for MHC-I internalization in infected cells. Furthermore, we discovered that this endocytic process can be disrupted by the inhibiting ubiquitin-activating E1 enzyme, which is indispensable for ubiquitination. Finally, pUL56 action extends to a number of cell surface molecules that are significant for host immunity. Therefore, the protein may exert a more general immunomodulatory effect. PMID:25165105

  17. Acute Viral Escape Selectively Impairs Nef-Mediated Major Histocompatibility Complex Class I Downmodulation and Increases Susceptibility to Antiviral T Cells

    PubMed Central

    Weiler, Andrea M.; Das, Arpita; Akinyosoye, Oluwasayo; Cui, Sherry; O'Connor, Shelby L.; Scheef, Elizabeth A.; Reed, Jason S.; Panganiban, Antonito T.; Sacha, Jonah B.; Rakasz, Eva G.; Friedrich, Thomas C.

    2015-01-01

    Nef-specific CD8+ T lymphocytes (CD8TL) are associated with control of simian immunodeficiency virus (SIV) despite extensive nef variation between and within animals. Deep viral sequencing of the immunodominant Mamu-B*017:01-restricted Nef165–173IW9 epitope revealed highly restricted evolution. A common acute escape variant, T170I, unexpectedly and uniquely degraded Nef's major histocompatibility complex class I (MHC-I) downregulatory capacity, rendering the virus more vulnerable to CD8TL targeting other epitopes. These data aid in a mechanistic understanding of Nef functions and suggest means of immunity-mediated control of lentivirus replication. PMID:26637459

  18. Acute Viral Escape Selectively Impairs Nef-Mediated Major Histocompatibility Complex Class I Downmodulation and Increases Susceptibility to Antiviral T Cells.

    PubMed

    Weiler, Andrea M; Das, Arpita; Akinyosoye, Oluwasayo; Cui, Sherry; O'Connor, Shelby L; Scheef, Elizabeth A; Reed, Jason S; Panganiban, Antonito T; Sacha, Jonah B; Rakasz, Eva G; Friedrich, Thomas C; Maness, Nicholas J

    2016-02-01

    Nef-specific CD8(+) T lymphocytes (CD8TL) are associated with control of simian immunodeficiency virus (SIV) despite extensive nef variation between and within animals. Deep viral sequencing of the immunodominant Mamu-B*017:01-restricted Nef165-173IW9 epitope revealed highly restricted evolution. A common acute escape variant, T170I, unexpectedly and uniquely degraded Nef's major histocompatibility complex class I (MHC-I) downregulatory capacity, rendering the virus more vulnerable to CD8TL targeting other epitopes. These data aid in a mechanistic understanding of Nef functions and suggest means of immunity-mediated control of lentivirus replication. PMID:26637459

  19. Two major histocompatibility complex haplotypes influence susceptibility to sporadic inclusion body myositis: critical evaluation of an association with HLA-DR3.

    PubMed

    Price, P; Santoso, L; Mastaglia, F; Garlepp, M; Kok, C C; Allcock, R; Laing, N

    2004-11-01

    Previous studies of sporadic inclusion body myositis (sIBM) have shown a strong association with HLA-DR3 and other components of the 8.1 ancestral haplotype (AH) (HLA-A1, B8, DR3), where the susceptibility locus has been mapped to the central major histocompatibility complex (MHC) region between HLA-DR and C4. Here, the association with HLA-DR3 and other genes in the central MHC and class II region was further investigated in a group of 42 sIBM patients and in an ethnically similar control group (n = 214), using single-nucleotide polymorphisms and microsatellite screening. HLA-DR3 (marking DRB1*0301 in Caucasians) was associated with sIBM (Fisher's test). However, among HLA-DR3-positive patients and controls, carriage of HLA-DR3 without microsatellite and single-nucleotide polymorphism alleles of the 8.1AH (HLA-A1, B8, DRB3*0101, DRB1*0301, DQB1*0201) was marginally less common in patients. Patients showed no increase in carriage of the 18.2AH (HLA-A30, B18, DRB3*0202, DRB1*0301, DQB1*0201) or HLA-DR3 without the central MHC of the 8.1AH, further arguing against HLA-DRB1 as the direct cause of susceptibility. Genes between HLA-DRB1 and HOX12 require further investigation. BTL-II lies in this region and is expressed in muscle. Carriage of allele 2 (exon 6) was more common in patients. BTL-II(E6)*2 is characteristic of the 35.2AH (HLA-A3, B35, DRB1*01) in Caucasians and HLA-DR1, BTL-II(E6)*2, HOX12*2, RAGE*2 was carried by several patients. The 8.1AH and 35.2AH may confer susceptibility to sIBM independently or share a critical allele. PMID:15496200

  20. High-Density SNP Screening of the Major Histocompatibility Complex in Systemic Lupus Erythematosus Demonstrates Strong Evidence for Independent Susceptibility Regions

    PubMed Central

    Barcellos, Lisa F.; May, Suzanne L.; Ramsay, Patricia P.; Quach, Hong L.; Lane, Julie A.; Nititham, Joanne; Noble, Janelle A.; Taylor, Kimberly E.; Quach, Diana L.; Chung, Sharon A.; Kelly, Jennifer A.; Moser, Kathy L.; Behrens, Timothy W.; Seldin, Michael F.; Thomson, Glenys; Harley, John B.; Gaffney, Patrick M.; Criswell, Lindsey A.

    2009-01-01

    A substantial genetic contribution to systemic lupus erythematosus (SLE) risk is conferred by major histocompatibility complex (MHC) gene(s) on chromosome 6p21. Previous studies in SLE have lacked statistical power and genetic resolution to fully define MHC influences. We characterized 1,610 Caucasian SLE cases and 1,470 parents for 1,974 MHC SNPs, the highly polymorphic HLA-DRB1 locus, and a panel of ancestry informative markers. Single-marker analyses revealed strong signals for SNPs within several MHC regions, as well as with HLA-DRB1 (global p = 9.99×10−16). The most strongly associated DRB1 alleles were: *0301 (odds ratio, OR = 2.21, p = 2.53×10−12), *1401 (OR = 0.50, p = 0.0002), and *1501 (OR = 1.39, p = 0.0032). The MHC region SNP demonstrating the strongest evidence of association with SLE was rs3117103, with OR = 2.44 and p = 2.80×10−13. Conditional haplotype and stepwise logistic regression analyses identified strong evidence for association between SLE and the extended class I, class I, class III, class II, and the extended class II MHC regions. Sequential removal of SLE–associated DRB1 haplotypes revealed independent effects due to variation within OR2H2 (extended class I, rs362521, p = 0.006), CREBL1 (class III, rs8283, p = 0.01), and DQB2 (class II, rs7769979, p = 0.003, and rs10947345, p = 0.0004). Further, conditional haplotype analyses demonstrated that variation within MICB (class I, rs3828903, p = 0.006) also contributes to SLE risk independent of HLA-DRB1*0301. Our results for the first time delineate with high resolution several MHC regions with independent contributions to SLE risk. We provide a list of candidate variants based on biologic and functional considerations that may be causally related to SLE risk and warrant further investigation. PMID:19851445

  1. Equine Herpesvirus 1 Multiply Inserted Transmembrane Protein pUL43 Cooperates with pUL56 in Downregulation of Cell Surface Major Histocompatibility Complex Class I

    PubMed Central

    Huang, Teng; Ma, Guanggang

    2015-01-01

    ABSTRACT Herpesviruses have evolved an array of strategies to counteract antigen presentation by major histocompatibility complex class I (MHC-I). Previously, we identified pUL56 of equine herpesvirus 1 (EHV-1) as one major determinant of the downregulation of cell surface MHC-I (G. Ma, S. Feineis, N. Osterrieder, and G. R. Van de Walle, J. Virol. 86:3554–3563, 2012, http://dx.doi.org/10.1128/JVI.06994-11; T. Huang, M. J. Lehmann, A. Said, G. Ma, and N. Osterrieder, J. Virol. 88:12802–12815, 2014, http://dx.doi.org/10.1128/JVI.02079-14). Since pUL56 was able to exert its function only in the context of virus infection, we hypothesized that pUL56 cooperates with another viral protein. Here, we generated and screened a series of EHV-1 single-gene deletion mutants and found that the pUL43 orthologue was required for downregulation of cell surface MHC-I expression at the same time of infection as when pUL56 exerts its function. We demonstrate that the absence of pUL43 was not deleterious to virus growth and that expression of pUL43 was detectable from 2 h postinfection (p.i.) but decreased after 8 h p.i. due to lysosomal degradation. pUL43 localized within Golgi vesicles and required a unique hydrophilic N-terminal domain to function properly. Finally, coexpression of pUL43 and pUL56 in transfected cells reduced the cell surface expression of MHC-I. This process was dependent on PPxY motifs present in pUL56, suggesting that late domains are required for pUL43- and pUL56-dependent sorting of MHC class I for lysosomal degradation. IMPORTANCE We describe here that the poorly characterized herpesviral protein pUL43 is involved in downregulation of cell surface MHC-I. pUL43 is an early protein and degraded in lysosomes. pUL43 resides in the Golgi vesicles and needs an intact N terminus to induce MHC-I downregulation in infected cells. Importantly, pUL43 and pUL56 cooperate to reduce MHC-I expression on the surface of transfected cells. Our results suggest a model for

  2. Molecular and biological interaction between major histocompatibility complex class I antigens and luteinizing hormone receptors or beta-adrenergic receptors triggers cellular response in mice.

    PubMed Central

    Solano, A R; Cremaschi, G; Sánchez, M L; Borda, E; Sterin-Borda, L; Podestá, E J

    1988-01-01

    Purified IgG from BALB/c mouse anti-C3H serum exerts positive inotropic and chronotropic effects in C3H mouse atria and induces testosterone synthesis in C3H mouse Leydig cells. The effect depends on IgG concentration and can be abolished by beta-adrenergic-receptor and luteinizing hormone-receptor antagonists. IgG interferes with the binding of dihydroalprenolol and luteinizing hormone. Monoclonal antibodies against major histocompatibility complex class I antigens were active on the Leydig cells of C3H and BALB/c mice. There was a parallelism between the effect of each individual monoclonal antibody with specificity for a particular haplotype and the response of the target cell from the strains carrying such haplotypes. These antibodies could precipitate the soluble luteinizing hormone-receptor complex. The results suggested that bound hormone triggers the association of major histocompatibility class I antigen with the receptor, thereby activating the respective target cells. PMID:2839829

  3. Parasite-mediated selection of major histocompatibility complex variability in wild brandt’s voles (Lasiopodomys brandtii) from Inner Mongolia, China

    PubMed Central

    2013-01-01

    Background Genes of the major histocompatibility complex (MHC) exhibit high levels of variability, which is believed to have arisen through pathogen-mediated selection. We investigated the relationship between parasite load and genetic diversity at selectively neutral, non-coding markers (microsatellites) and adaptive genetic variation at a functionally important part of the MHC in six independent natural populations of Brandt’s voles (Lasiopodomys brandtii) from two regions of the Xilingol Grassland area of Inner Mongolia. Results Two-hundred and fifty-two voles were screened for gastrointestinal parasites, and were assessed for genetic variation. Parasite screening was done through non-invasive fecal egg counts, while allelic diversity was determined via single-stranded conformation polymorphism and DNA sequencing. We detected eight distinct helminth egg morphotypes. A total of 10 microsatellite loci were genotyped and 19 unique MHC class II B alleles were isolated. The rate of nonsynonymous substitutions (dN) exceeded the rate of synonymous substitutions (dS) at putative antigen binding sites of DRB. Neutral and adaptive genetic diversity differed between the six vole populations. To test the main pathogen-driven selection hypotheses for the maintenance of host MHC diversity and parasite species-specific co-evolutionary effects, multivariate approaches (generalized linear mixed models) were used to test for associations between the MHC class II DRB genotype and infections with nematodes. We found no evidence for heterozygote advantage, and overall heterozygosity was lower than expected in the MHC alleles. We identified an association between the parasite load and specific MHC alleles in the voles, and this pattern varied between geographic regions. Conclusions The results suggest that MHC variability in Brandt’s voles is maintained by rare allele advantage and fluctuating selection, but the data failed to show any heterozygote advantage effect. Our results

  4. Role of major histocompatibility complex class I-related molecules A*A5·1 allele in ulcerative colitis in Chinese patients

    PubMed Central

    Lü, Min; Xia, Bing; Ge, Liuqing; Li, Yi; Zhao, Jie; Chen, Fan; Zhou, Feng; Zhang, Xiaolian; Tan, Jinquan

    2009-01-01

    The major histocompatibility complex (MHC) class I-related molecules A (MICA) is a stress-inducible cell surface antigen that is recognized by intestinal epithelial Vδ1 γδ T cells, natural killer (NK) cells and CD8+ T cells with NKG2D receptor participating in the immunological reaction in the intestinal mucosa. The present study aimed to investigate the functions of the MICA*A5.1 allele in the development of ulcerative colitis (UC) in the Chinese population. The microsatellite polymorphisms of MICA were genotyped in 124 unrelated Chinese patients with UC and 172 ethnically matched healthy controls using a semiautomatic fluorescently labelled polymerase chain reaction. MICA*A5.1-expressing Raji cells were generated by gene transfection. Cytotoxicity of NK cells to Raji cells expressing different MICA molecules was detected using the lactate dehydrogenase method. Soluble MICA in the culture supernatant was detected by enzyme-linked immunosorbent assay. The frequency of MICA*A5.1 was significantly higher in UC patients compared with the healthy controls (29·0% versus 17·4%, P= 0·001, corrected P= 0·005, OR = 1·936, 95% CI 1·310–2·863) and the frequency of a MICA*A5.1/A5.1 homozygous genotype was increased in UC patients (18·5% versus 7% in healthy controls, P= 0·0032, corrected P= 0·048, OR = 3·036, 95% CI 1·447–6·372). Raji cells with MICA*A5.1 expression produced more soluble MICA (t = 5·75, P < 0·01) than Raji cells with full-length MICA expression in culture supernatant. Raji cells with MICA*A5.1 expression were more resistant to killing by NK cells than Raji cells with full-length MICA expression. The MICA*A5.1 allele and MICA*A5.1/A5.1 genotype are significantly associated with Chinese UC patients in central China. MICA*A5.1 may play a role in the development of UC by producing more soluble MICA and resistance to NK cells. PMID:19016911

  5. Localization of major histocompatibility complex class I and II mRNA in human first-trimester chorionic villi by in situ hybridization.

    PubMed

    Lata, J A; Tuan, R S; Shepley, K J; Mulligan, M M; Jackson, L G; Smith, J B

    1992-04-01

    Maternal immune recognition of pregnancy occurs despite the nonexpression of classical major histocompatibility complex (MHC) antigenic determinants by chorionic villous trophoblast, which comprise the major surface area where maternal blood contacts fetal-derived cells. cDNA-mRNA in situ hybridization was used to probe expression of transcripts corresponding to nonpolymorphic MHC determinants in first-trimester chorionic villus samples. The HLA-B7 probe hybridization signals were localized to syncytiotrophoblast and to cells of the mesenchyme but not to villous cytotrophoblast. HLA-G mRNA was found only in syncytiotrophoblast. A DR beta clone hybridized to both villous cytotrophoblast and syncytiotrophoblast. The results suggest that expression of trophoblast class I and class II determinants early in gestation (10 wk) may be regulated by posttranscriptional events. This also suggests the potential for maternal antifetal alloimmune responses. PMID:1552281

  6. Novel Mutants Define Genes Required for the Expression of Human Histocompatibility Leukocyte Antigen DM: Evidence for Loci on Human Chromosome 6p

    PubMed Central

    Fling, Steven P.; Rak, Jennifer; Muczynski, Kimberly A.; Arp, Benjamin; Pious, Donald

    1997-01-01

    We and others have shown that the products of the HLA-DM locus are required for the intracellular assembly of major histocompatibility complex class II molecules with cognate peptides for antigen presentation. HLA-DM heterodimers mediate the dissociation of invariant chain (Ii)-derived class II–associated Ii peptides (CLIP) from class II molecules and facilitate the loading of class II molecules with antigenic peptides. Here we describe novel APC mutants with defects in the formation of class II–peptide complexes. These mutants express class II molecules which are conformationally altered, and an aberrantly high percentage of these class II molecules are associated with Ii-derived CLIP. This phenotype resembles that of DM null mutants. However, we show that the defects in two of these new mutants do not map to the DM locus. Nevertheless, our evidence suggests that the antigen processing defective phenotype in these mutants results from deficient DM expression. These mutants thus appear to define genes in which mutations have differential effects on the expression of conventional class II molecules and DM molecules. Our data are most consistent with these factors mapping to human chromosome 6p. Previous data have suggested that the expression of DM and class II genes are coordinately regulated. The results reported here suggest that DM and class II can also be differentially regulated, and that this differential regulation has significant effects on class II–restricted antigen processing. PMID:9348304

  7. Endoplasmic reticulum aminopeptidase 1 function and its pathogenic role in regulating innate and adaptive immunity in cancer and major histocompatibility complex class I-associated autoimmune diseases.

    PubMed

    Fruci, D; Romania, P; D'Alicandro, V; Locatelli, F

    2014-08-01

    Major histocompatibility complex (MHC) class I molecules present antigenic peptides on the cell surface to alert natural killer (NK) cells and CD8(+) T cells for the presence of abnormal intracellular events, such as virus infection or malignant transformation. The generation of antigenic peptides is a multistep process that ends with the trimming of N-terminal extensions in the endoplasmic reticulum (ER) by aminopeptidases ERAP1 and ERAP2. Recent studies have highlighted the potential role of ERAP1 in reprogramming the immunogenicity of tumor cells in order to elicit innate and adaptive antitumor immune responses, and in conferring susceptibility to autoimmune diseases in predisposed individuals. In this review, we will provide an overview of the current knowledge about the role of ERAP1 in MHC class I antigen processing and how its manipulation may constitute a promising tool for cancer immunotherapy and treatment of MHC class I-associated autoimmune diseases. PMID:25066018

  8. A step-by-step overview of the dynamic process of epitope selection by major histocompatibility complex class II for presentation to helper T cells

    PubMed Central

    Sadegh-Nasseri, Scheherazade

    2016-01-01

    T cell antigen receptors (TCRs) expressed on cytotoxic or helper T cells can only see their specific target antigen as short sequences of peptides bound to the groove of proteins of major histocompatibility complex (MHC) class I, and class II respectively. In addition to the many steps, several participating proteins, and multiple cellular compartments involved in the processing of antigens, the MHC structure, with its dynamic and flexible groove, has perfectly evolved as the underlying instrument for epitope selection. In this review, I have taken a step-by-step, and rather historical, view to describe antigen processing and determinant selection, as we understand it today, all based on decades of intense research by hundreds of laboratories. PMID:27347387

  9. Schwann cell differentiation inhibits interferon-gamma induction of expression of major histocompatibility complex class II and intercellular adhesion molecule-1.

    PubMed

    Lisak, Robert P; Bealmear, Beverly; Benjamins, Joyce A

    2016-06-15

    Interferon-gamma (IFN-γ) upregulates major histocompatibility complex class II (MHC class II) antigens and intercellular adhesion molecule-1 (ICAM-1) on Schwann cells (SC) in vitro, but in nerves of animals and patients MHC class II is primarily expressed on inflammatory cells. We investigated whether SC maturation influences their expression. IFN-γ induced MHC class II and upregulated ICAM-1; the axolemma-like signal 8-bromo cyclic adenosine monophosphate (8 Br cAMP) with IFN-γ inhibited expression. Delaying addition of 8 Br cAMP to SC already exposed to IFN-γ inhibited ongoing expression; addition of IFN-γ to SC already exposed to 8 Br cAMP resulted in minimal expression. Variability of cytokine-induced MHC class II and ICAM-1 expression by SC in vivo may represent the variability of signals from axolemma. PMID:27235355

  10. A step-by-step overview of the dynamic process of epitope selection by major histocompatibility complex class II for presentation to helper T cells.

    PubMed

    Sadegh-Nasseri, Scheherazade

    2016-01-01

    T cell antigen receptors (TCRs) expressed on cytotoxic or helper T cells can only see their specific target antigen as short sequences of peptides bound to the groove of proteins of major histocompatibility complex (MHC) class I, and class II respectively. In addition to the many steps, several participating proteins, and multiple cellular compartments involved in the processing of antigens, the MHC structure, with its dynamic and flexible groove, has perfectly evolved as the underlying instrument for epitope selection. In this review, I have taken a step-by-step, and rather historical, view to describe antigen processing and determinant selection, as we understand it today, all based on decades of intense research by hundreds of laboratories. PMID:27347387

  11. Specific DNA binding to a major histocompatibility complex enhancer sequence by a synthetic 57-residue double zinc finger peptide from a human enhancer binding protein.

    PubMed

    Sakaguchi, K; Appella, E; Omichinski, J G; Clore, G M; Gronenborn, A M

    1991-04-15

    Two 57-residue peptides containing one pair of "zinc fingers" from a human enhancer binding protein were prepared by solid-phase peptide synthesis. One peptide (MBP-DF) contained the native sequence, while the second peptide ([Abu11]MBP-DF) has an alpha-aminobutyric acid residue substituted for a nonconserved cysteine residue at position 11. The peptides were characterized by several chemical and physical methods, and their DNA binding properties were evaluated using gel retardation experiments. Spectroscopic studies demonstrated that addition of metal ions such as zinc and cobalt resulted in specific conformational changes in both peptides, indicating that cysteine-11 does not appear to be involved in metal chelation. One-dimensional 1H NMR studies indicate that a stable folded structure is formed upon addition of zinc, and the chemical shift pattern is consistent with that previously observed for one constituent single finger (Omichinski, J., Clore, G. M., Appella, E., Sakaguchi, K., and Gronenborn, A. M. (1990) Biochemistry 29, 9324-9334). Gel retardation experiments demonstrate that the peptides are capable of interacting with a 15-mer oligonucleotide comprising a portion of the major histocompatibility complex enhancer sequence and that the interaction is zinc-dependent. The dissociation constant for the [Abu11]MBP-DF peptide is 1.4 x 10(-7) M with maximal binding occurring at a zinc-to-peptide ratio of 2 to 1. The binding specificity observed with respect to related enhancer sequences exhibits the same relative order as noted previously for the whole protein. Studies with point mutants of the major histocompatibility complex enhancer binding sequence indicate that the last GC base pair in a four-guanine stretch plays a pivotal role in the interaction between the peptide and DNA. PMID:2016331

  12. The major histocompatibility class I locus in Atlantic salmon (Salmo salar L.): polymorphism, linkage analysis and protein modelling.

    PubMed

    Grimholt, Unni; Drabløs, Finn; Jørgensen, Sven Martin; Høyheim, Bjørn; Stet, René J M

    2002-11-01

    A cDNA library screening using the conserved exon 4 of Atlantic salmon Mhc class I as probe provided the basis for a study on Mhc class I polymorphism in a breeding population. Twelve different alleles were identified in the 82 dams and sires studied. No individual expressed more than two alleles, which corresponded to the diploid segregation patterns of the polymorphic marker residing within the 3'-untranslated tail. Close linkage between the Sasa-UBA and Sasa-TAP2B loci strengthens the claim that Sasa-UBA is the major Mhc class I locus in Atlantic salmon. We found no evidence for a second expressed classical or non-classical Mhc class I locus in Atlantic salmon. A phylogenetic analysis of salmonid Mhc class I sequences showed domains conserved between rainbow trout, brown trout and Atlantic salmon. Evidence for shuffling of the alpha(1) domain was identified and lineages of the remaining alpha(2) through the cytoplasmic tail gene segment can be defined. The coding sequence of one allele was found associated with two different markers, suggesting recombination within the 3'-tail dinucleotide repeat itself. Protein modelling of several Sasa-UBA alleles shows distinct differences in their peptide binding domains and enables a further understanding of the functionality of the high polymorphism. PMID:12439620

  13. Detection and Quantification of CD4+ T Cells with Specificity for a New Major Histocompatibility Complex Class II-Restricted Influenza A Virus Matrix Protein Epitope in Peripheral Blood of Influenza Patients

    PubMed Central

    Linnemann, Thomas; Jung, Günther; Walden, Peter

    2000-01-01

    FVFTLTVPS was identified as the core sequence of a new major histocompatibility complex class II-restricted T-cell epitope of influenza virus matrix protein. Epitope-specific CD4+ T cells were detected in the peripheral blood of patients with frequencies of up to 0.94%, depending on the number of additional terminal amino acids. PMID:10954576

  14. Genomic Anatomy of a Premier Major Histocompatibility Complex Paralogous Region on Chromosome 1q21–q22

    PubMed Central

    Shiina, Takashi; Ando, Asako; Suto, Yumiko; Kasai, Fumio; Shigenari, Atsuko; Takishima, Nobusada; Kikkawa, Eri; Iwata, Kyoko; Kuwano, Yuko; Kitamura, Yuka; Matsuzawa, Yumiko; Sano, Kazumi; Nogami, Masahiro; Kawata, Hisako; Li, Suyun; Fukuzumi, Yasuhito; Yamazaki, Masaaki; Tashiro, Hiroyuki; Tamiya, Gen; Kohda, Atsushi; Okumura, Katsuzumi; Ikemura, Toshimichi; Soeda, Eiichi; Mizuki, Nobuhisa; Kimura, Minoru; Bahram, Seiamak; Inoko, Hidetoshi

    2001-01-01

    Human chromosomes 1q21–q25, 6p21.3–22.2, 9q33–q34, and 19p13.1–p13.4 carry clusters of paralogous loci, to date best defined by the flagship 6p MHC region. They have presumably been created by two rounds of large-scale genomic duplications around the time of vertebrate emergence. Phylogenetically, the 1q21–25 region seems most closely related to the 6p21.3 MHC region, as it is only the MHC paralogous region that includes bona fide MHC class I genes, the CD1 and MR1 loci. Here, to clarify the genomic structure of this model MHC paralogous region as well as to gain insight into the evolutionary dynamics of the entire quadriplication process, a detailed analysis of a critical 1.7 megabase (Mb) region was performed. To this end, a composite, deep, YAC, BAC, and PAC contig encompassing all five CD1 genes and linking the centromeric +P5 locus to the telomeric KRTC7 locus was constructed. Within this contig a 1.1-Mb BAC and PAC core segment joining CD1D to FCER1A was fully sequenced and thoroughly analyzed. This led to the mapping of a total of 41 genes (12 expressed genes, 12 possibly expressed genes, and 17 pseudogenes), among which 31 were novel. The latter include 20 olfactory receptor (OR) genes, 9 of which are potentially expressed. Importantly, CD1, SPTA1, OR, and FCERIA belong to multigene families, which have paralogues in the other three regions. Furthermore, it is noteworthy that 12 of the 13 expressed genes in the 1q21–q22 region around the CD1 loci are immunologically relevant. In addition to CD1A-E, these include SPTA1, MNDA, IFI-16, AIM2, BL1A, FY and FCERIA. This functional convergence of structurally unrelated genes is reminiscent of the 6p MHC region, and perhaps represents the emergence of yet another antigen presentation gene cluster, in this case dedicated to lipid/glycolipid antigens rather than antigen-derived peptides. [The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL, and GenBank databases under

  15. Major histocompatibility complex class II dextramers: New tools for the detection of antigen-specific, CD4 T cells in basic and clinical research

    PubMed Central

    Massilamany, Chandirasegaran; Krishnan, Bharathi; Reddy, Jay

    2015-01-01

    The advent of major histocompatibility complex (MHC) tetramer technology has been a major contribution to T cell immunology, because tetramer reagents permit detection of antigen-specific T cells at the single-cell level in heterogeneous populations by flow cytometry. However, unlike MHC class I tetramers, the utility of MHC class II tetramers has been less frequently reported. MHC class II tetramers can be used successfully to enumerate the frequencies of antigen-specific CD4 T cells in cells activated in vitro, but their use for ex vivo analyses continues to be a problem, due in part to their activation dependency for binding with T cells. To circumvent this problem, we recently reported the creation of a new generation of reagents called MHC class II dextramers, which were found to be superior to their counterparts. In this review, we discuss the utility of class II dextramers vis-a-vis tetramers, with respect to their specificity and sensitivity, including potential applications and limitations. PMID:26207337

  16. Determining the one, two, three, or four long and short loci of human complement C4 in a major histocompatibility complex haplotype encoding C4A or C4B proteins.

    PubMed

    Chung, Erwin K; Yang, Yan; Rupert, Kristi L; Jones, Karla N; Rennebohm, Robert M; Blanchong, Carol A; Yu, C Yung

    2002-10-01

    The complex genetics of human complement C4 with unusually frequent variations in the size and number of C4A and C4B, as well as their neighboring genes, in the major histocompatibility complex has been a hurdle for accurate epidemiological studies of diseases associated with C4. A comprehensive series of novel or improved techniques has been developed to determine the total gene number of C4 and the relative dosages of C4A and C4B in a diploid genome. These techniques include (1) definitive genomic restriction-fragment-length polymorphisms (RFLPs) based on the discrete duplication patterns of the RCCX (RP-C4-CYP21-TNX) modules and on the specific nucleotide changes for C4A and C4B isotypes; (2) module-specific PCR to give information on the total number of C4 genes by comparing the relative quantities of RP1- or TNXB-specific fragments with TNXA-RP2 fragments; (3) labeled-primer single-cycle DNA polymerization procedure of amplified C4d genomic DNA for diagnostic RFLP analysis of C4A and C4B; and (4) a highly reproducible long-range-mapping method that employs PmeI-digested genomic DNA for pulsed-field gel electrophoresis, to yield precise information on the number of long and short C4 genes in a haplotype. Applications of these vigorously tested techniques may clarify the roles that human C4A and C4B gene-dosage variations play in infectious and autoimmune diseases. PMID:12224044

  17. Identification and evaluation of major histocompatibility complex antigens in chicken chimeras and their relationship to germline transmission.

    PubMed

    Bacon, L D; Zajchowski, L; Clark, M E; Etches, R J

    2002-10-01

    Chimeric chickens were evaluated as an intermediate for development of transgenic chickens. The transfer of Barred Plymouth Rock (BR) blastodermal cells into White Leghorn (WL) embryos results in BR-->WL chimeras, and some breeder males generate over 30% germline transmission of the BR genotype to offspring based on a feather-color trait. The objectives of the current study were to 1) identify the MHC (B haplotypes) in resident BR and WL lines, 2) establish that B antigens could be detected and quantified in red blood cells (RBC) of chimeras, 3) establish if there is a correlation in chimeras between percentage of RBC with donor B antigens and percentage germline transmission, and 4) evaluate if the MHC genotype influences chimera development. The RBC agglutination data indicated three B haplotypes were present in each line. The B*2-like, and B*19-like genes were unique to the WL line, and B*13-like and B-15-like genes were unique to the BR line, whereas a B*21-like gene was present in both lines. In adult BR-->WL chimeras, as well as 10- to 14 d-old WL-->WL chimeras, donor-type B antigens were detectable and quantifiable on RBC using flow cytometry. In BR-->WL chimeras, the percentage germline transmission was significantly correlated with the percentage of RBC with donor B antigen, as well as percentage of black feathers in the plumage. In a retrospective study using previously developed BR-->WL chimeras, the level of chimerism and germline transmission was higher in B*21/*21 type recipients, but this was not statistically significant in two prospective studies. It was concluded that MHC antigens on RBC can be used for identifying, quantifying, and selecting chicken chimeras developed by the transfer of blastodermal cells. PMID:12412906

  18. Major Histocompatibility Complex Class II Inhibits Fas Antigen-Mediated Gastric Mucosal Cell Apoptosis through Actin-Dependent Inhibition of Receptor Aggregation

    PubMed Central

    Stoicov, Calin; Cai, Xun; Li, Hanchen; Klucevsek, Kristine; Carlson, Jane; Saffari, Reza; Houghton, JeanMarie

    2005-01-01

    Escape from normal apoptotic controls is thought to be essential for the development of cancer. During Helicobacter pylori infection, the leading cause of gastric cancer, activation of the Fas antigen (Fas Ag) apoptotic pathway is responsible for early atrophy and tissue loss. As disease progresses, metaplastic and dysplastic glands arise which express Fas Ag but are resistant to apoptosis and are believed to be the precursor cells for adenocarcinoma. In this report, we show that one mechanism of acquired Fas resistance is inhibition of receptor aggregation via a major histocompatibility complex class II (MHCII)-mediated, actin-dependent mechanism. For these studies we used the well-described C57BL/6 mouse model of Helicobacter pylori and Helicobacter felis infection. Under normal conditions, Fas Ag is expressed at low levels, and MHCII expression on gastric mucosal cells is negligible. With infection and inflammation, both receptors are upregulated, and 6.1% of gastric mucosal cells express MHCII in combination with Fas Ag. Using the rat gastric mucosal cell line RGM-1 transfected with murine Fas Ag and MHCIIαβ chains, we demonstrate that MHCII prevents Fas receptor aggregation and inhibits Fas-mediated signaling through its effects on the actin cytoskeleton. Depolymerization of actin with cytochalasin D allows receptors to aggregate and restores Fas sensitivity. These findings offer one mechanism by which gastric mucosal cells acquire Fas resistance. PMID:16177302

  19. Introduction of protein or DNA delivered via recombinant Salmonella typhimurium into the major histocompatibility complex class I presentation pathway of macrophages.

    PubMed

    Catic, A; Dietrich, G; Gentschev, I; Goebel, W; Kaufmann, S H; Hess, J

    1999-02-01

    Recombinant (r) Salmonella typhimurium aroA strains which display the hen egg ovalbumin OVA(257-264) peptide SIINFEKL in secreted form were constructed. In addition, attenuated rS. typhimurium pcDNA-OVA constructs harbouring a eukaryotic expression plasmid encoding complete OVA were used to introduce the immunodominant OVA(257-264) epitope into the major histocompatibility complex (MHC) class I presentation pathway. Both modes of antigen delivery (DNA and protein) by Salmonella vaccine carriers stimulated OVA(257-264)-specific CD8 T-cell hybridomas. An in vitro infection system was established that allowed both rSalmonella carrier devices to facilitate MHC class I delivery of OVA(257-264) by coexpression of listeriolysin (Hly) or by coinfection with rS. typhimurium Hlys (Hess J., Gentschev I., Miko D., Welzel M., Ladel C., Goebel W., Kaufmann S.H.E., Proc. Natl. Acad. Sci. USA 93 (1996) 1458-1463). Coexpression of Hly and coinfection with rS. typhimurium Hlys slightly improved MHC class I processing of OVA. Our data provide further evidence for the feasibility of attenuated, Hly-expressing rS. typhimurium carriers secreting heterologous antigens or harbouring heterologous DNA as effective vaccines for stimulating CD8 T cells in addition to CD4 T cells. PMID:10594975

  20. Loss of T Cell Antigen Recognition Arising from Changes in Peptide and Major Histocompatibility Complex Protein Flexibility: Implications for Vaccine Design

    SciTech Connect

    Insaidoo, Francis K.; Borbulevych, Oleg Y.; Hossain, Moushumi; Santhanagopolan, Sujatha M.; Baxter, Tiffany K.; Baker, Brian M.

    2012-05-08

    Modification of the primary anchor positions of antigenic peptides to improve binding to major histocompatibility complex (MHC) proteins is a commonly used strategy for engineering peptide-based vaccine candidates. However, such peptide modifications do not always improve antigenicity, complicating efforts to design effective vaccines for cancer and infectious disease. Here we investigated the MART-1{sub 27-35} tumor antigen, for which anchor modification (replacement of the position two alanine with leucine) dramatically reduces or ablates antigenicity with a wide range of T cell clones despite significantly improving peptide binding to MHC. We found that anchor modification in the MART-1{sub 27-35} antigen enhances the flexibility of both the peptide and the HLA-A*0201 molecule. Although the resulting entropic effects contribute to the improved binding of the peptide to MHC, they also negatively impact T cell receptor binding to the peptide {center_dot} MHC complex. These results help explain how the 'anchor-fixing' strategy fails to improve antigenicity in this case, and more generally, may be relevant for understanding the high specificity characteristic of the T cell repertoire. In addition to impacting vaccine design, modulation of peptide and MHC flexibility through changes to antigenic peptides may present an evolutionary strategy for the escape of pathogens from immune destruction.

  1. Identification of Major Histocompatibility Complex-Regulated Body Odorants by Statistical Analysis of a Comparative Gas Chromatography/Mass Spectrometry Experiment

    SciTech Connect

    Willse, Alan R.; Belcher, Ann; Preti, George; Wahl, Jon H.; Thresher, Miranda; Yang, Peter; Yamazaki, Kunio; Beauchamp, Gary

    2005-04-15

    Gas chromatography (GC), combined with mass spectrometry (MS) detection, is a powerful analytical technique that can be used to separate, quantify, and identify volatile compounds in complex mixtures. This paper examines the application of GC-MS in a comparative experiment to identify volatiles that differ in concentration between two groups. A complex mixture might comprise several hundred or even thousands of volatile compounds. Because their number and location in a chromatogram generally are unknown, and because components overlap in populous chromatograms, the statistical problems offer significant challenges beyond traditional two-group screening procedures. We describe a statistical procedure to compare two-dimensional GC-MS profiles between groups, which entails (1) signal processing: baseline correction and peak detection in single ion chromatograms; (2) aligning chromatograms in time; (3) normalizing differences in overall signal intensities; and (4) detecting chromatographic regions that differ between groups. Compared to existing approaches, the proposed method is robust to errors made at earlier stages of analysis, such as missed peaks or slightly misaligned chromatograms. To illustrate the method, we identify differences in GC-MS chromatograms of ether-extracted urine collected from two nearly identical inbred groups of mice, to investigate the relationship between odor and genetics of the major histocompatibility complex.

  2. Salmonella enterica serovar Typhi live vector vaccines delivered intranasally elicit regional and systemic specific CD8+ major histocompatibility class I-restricted cytotoxic T lymphocytes.

    PubMed

    Pasetti, Marcela F; Salerno-Gonçalves, Rosangela; Sztein, Marcelo B

    2002-08-01

    We investigated the ability of live attenuated Salmonella enterica serovar Typhi strains delivered to mice intranasally to induce specific cytotoxic T-lymphocyte (CTL) responses at regional and systemic levels. Mice immunized with two doses (28 days apart) of Salmonella serovar Typhi strain Ty21a, the licensed oral typhoid vaccine, and genetically attenuated mutants CVD 908 (DeltaaroC DeltaaroD), CVD 915 (DeltaguaBA), and CVD 908-htrA (DeltaaroC DeltaaroD DeltahtrA) induced CTL specific for Salmonella serovar Typhi-infected cells in spleens and cervical lymph nodes. CTL were detected in effector T cells that had been expanded in vitro for 7 days in the presence of Salmonella-infected syngeneic splenocytes. A second round of stimulation further enhanced the levels of specific cytotoxicity. CTL activity was observed in sorted alphabeta+ CD8+ T cells, which were remarkably increased after expansion, but not in CD4+ T cells. CTL from both cervical lymph nodes and spleens failed to recognize Salmonella-infected major histocompatibility complex (MHC)-mismatched cells, indicating that the responses were MHC restricted. Studies in which MHC blocking antibodies were used showed that H-2L(d) was the restriction element. This is the first demonstration that Salmonella serovar Typhi vaccines delivered intranasally elicit CD8+ MHC class I-restricted CTL. The results further support the usefulness of the murine intranasal model for evaluating the immunogenicity of typhoid vaccine candidates at the preclinical level. PMID:12117906

  3. Molecular and immunogenetic analysis of major histocompatibility haplotypes in Northern Bobwhite enable direct identification of corresponding haplotypes in an endangered subspecies, the Masked Bobwhite

    USGS Publications Warehouse

    Drake, B.M.; Goto, R.M.; Miller, M.M.; Gee, G.F.; Briles, W.E.

    1999-01-01

    The major histocompatibility complex (MHC) is a group of genetic loci coding for haplotypes that have been associated with fitness traits in mammals and birds. Such associations suggest that MHC diversity may be an indicator of overall genetic fitness of endangered or threatened species. The MHC haplotypes of a captive population of 12 families of northern bobwhites (Colinus virginianus) were identified using a combination of immunogenetic and molecular techniques. Alloantisera were produced within families of northern bobwhites and were then tested for differential agglutination of erythrocytes of all members of each family. The pattern of reactions determined from testing these alloantisera identified a single genetic system of alloantigens in the northern bobwhites, resulting in the assignment of a tentative genotype to each individual within the quail families. Restriction fragment patterns of the DNA of each bird were determined using the chicken MHC B-G cDNA probe bg11. The concordance between the restriction fragment patterns and the alloantisera reactions showed that the alloantisera had identified the MHC of the northern bobwhite and supported the tentative genotype assignments, identifying at least 12 northern bobwhite MHC haplotypes.

  4. Intermediate number of major histocompatibility complex class IIB length variants relates to enlarged perivisceral fat deposits in the blunt-head cichlid Tropheus moorii.

    PubMed

    Hablützel, P I; Vanhove, M P M; Grégoir, A F; Hellemans, B; Volckaert, F A M; Raeymaekers, J A M

    2014-10-01

    Studying the genetic basis of host-parasite interactions represents an outstanding opportunity to observe eco-evolutionary processes. Established candidates for such studies in vertebrates are immunogenes of the major histocompatibility complex (MHC). The MHC has been reported to reach high intra- and interindividual diversity, and a diverse MHC might be advantageous when facing infections from multiple parasites. However, other studies indicated that individuals with an intermediate number of MHC alleles are less infected with parasites or have other fitness advantages. In this study, we assessed the optimal number of MHC alleles in the blunt-head cichlid Tropheus moorii from Lake Tanganyika. We investigated the influence of the interindividual variation in number of MHC length variants on parasite infection and body condition, measured by the amount of perivisceral fat reserves. Surprisingly, there was no correlation between parasite infection and number of MHC length variants or perivisceral fat deposits. However, the individual number of MHC length variants significantly correlated with the amount of perivisceral fat deposits in males, suggesting that male individuals with an intermediate number of alleles might be able to use their fat reserves more efficiently. PMID:25201492

  5. Strategic mutations in the class I major histocompatibility complex HLA-A2 independently affect both peptide binding and T cell receptor recognition.

    PubMed

    Baxter, Tiffany K; Gagnon, Susan J; Davis-Harrison, Rebecca L; Beck, John C; Binz, Anne-Kathrin; Turner, Richard V; Biddison, William E; Baker, Brian M

    2004-07-01

    Mutational studies of T cell receptor (TCR) contact residues on the surface of the human class I major histocompatibility complex (MHC) molecule HLA-A2 have identified a "functional hot spot" that comprises Arg(65) and Lys(66) and is involved in recognition by most peptide-specific HLA-A2-restricted TCRs. Although there is a significant amount of functional data on the effects of mutations at these positions, there is comparatively little biochemical information that could illuminate their mode of action. Here, we have used a combination of fluorescence anisotropy, functional assays, and Biacore binding experiments to examine the effects of mutations at these positions on the peptide-MHC interaction and TCR recognition. The results indicate that mutations at both position 65 and position 66 influence peptide binding by HLA-A2 to various extents. In particular, mutations at position 66 result in significantly increased peptide dissociation rates. However, these effects are independent of their effects on TCR recognition, and the Arg(65)-Lys(66) region thus represents a true "hot spot" for TCR recognition. We also made the observation that in vitro T cell reactivity does not scale with the half-life of the peptide-MHC complex, as is often assumed. Finally, position 66 is implicated in the "dual recognition" of both peptide and TCR, emphasizing the multiple roles of the class I MHC peptide-binding domain. PMID:15131131

  6. Versatility of using major histocompatibility complex class II dextramers for derivation and characterization of antigen-specific, autoreactive T cell hybridomas.

    PubMed

    Krishnan, Bharathi; Massilamany, Chandirasegaran; Basavalingappa, Rakesh H; Rajasekaran, Rajkumar A; Kuszynski, Charles; Switzer, Barbara; Peterson, Daniel A; Reddy, Jay

    2015-11-01

    Antigen-specific, T cell hybridomas are useful to study the cellular, molecular and functional events, but their generation is a lengthy process. Thus, there is a need to develop robust methods to generate the hybridoma clones rapidly in a short period of time. To this end, we have demonstrated a novel approach using major histocompatibility complex (MHC) class II dextramers to generate T cell hybridomas for an autoantigen, proteolipid protein (PLP) 139-151. Using MHC class II dextramers assembled with PLP 139-151 as screening and sorting tools, we successfully obtained mono antigen-specific clones within seven to eight weeks. In conjunction with other T cell markers, dextramers permitted phenotypic characterization of hybridoma clones for their antigen specificity in a single step by flow cytometry. Importantly, we achieved successful fusions using dextramer(+) cells sorted by flow cytometry as a starting population, resulting in direct identification of multiple antigen-specific clones. Characterization of selected clones led us to identify chemokine receptor, CCR4(+) to be expressed consistently, but their cytokine-producing ability was variable. Our work provides a proof-of principle that the antigen-specific, CD4 T cell hybridoma clones can be generated directly using MHC class II dextramers. The availability of hybridoma clones that bind dextramers may serve as useful tools for various in vitro and in vivo applications. PMID:26268454

  7. Monoclonal antibodies directed against major histocompatibility complex antigens bind to the surface of Treponema pallidum isolated from infected rabbits or humans.

    PubMed

    Marchitto, K S; Kindt, T J; Norgard, M V

    1986-09-01

    Evidence is presented for the association of class I major histocompatibility complex (MHC) antigens with the surface of Treponema pallidum during infection. A monoclonal antibody (IgG2a) directed against a murine H-2Kb epitope of public specificity reacted with the cell surface of T. pallidum, as assayed by the binding of protein A-colloidal gold in immunoelectron microscopy. Monoclonal antibodies directed against class I rabbit MHC antigens also reacted in immunofluorescence assays with material on the surface of rabbit-cultivated T. pallidum. In addition, impression smears of human syphilitic genital ulcers that were darkfield-positive for the presence of spirochetes were tested in immunofluorescence assays with monoclonal antibodies directed against human MHC antigens; antibody directed against HLA-ABC (class I) was reactive whereas antibody directed against HLA-DR (class II) was nonreactive. Results of the study suggest that the association of host-derived class I MHC antigens or molecular mimicry may play a role in T. pallidum evasion of host immune defenses. PMID:2428519

  8. Allelic and haplotype variation of major histocompatibility complex class II DRB1 and DQB loci in the St Lawrence beluga (Delphinapterus leucas).

    PubMed

    1999-07-01

    In order to assess levels of major histocompatibility complex (Mhc) variation within the St Lawrence beluga (Delphinapterus leucas) the variation at the beluga Mhc DRB1 class II locus was assessed by single-strand conformation polymorphism (SSCP) analysis of the peptide-binding region for 313 whales collected from 13 sampling locations across North America. In addition, samples from west Greenland and the St Lawrence were also typed at the DQB locus, allowing comparison to a previous study and assessment of linkage disequilibrium of alleles at the two loci. Comparisons of DRB1 and DQB allele frequencies among all sampling locations indicated genetic structure (alpha < 0.005). Most of this structure resulted from differences between the different wintering groups. Significant genetic structure (alpha = 0.05) exists among each pair of the following groups at both the DRB1 and DQB loci; St Lawrence, Hudson Strait, Bering Sea, Cunningham Inlet, and Davis Strait (minus Cunningham Inlet), except the St Lawrence and Hudson Strait for the DQB locus. In the St Lawrence population, six of the eight DRB1 alleles are present representing all five known allelic lineages. Evidence of linkage disequilibrium between the DRB1 and DQB is present in two sampling locations, the St Lawrence and Nuussuaq (alpha = 0.05). Analysis of probable DRB1-DQB haplotypes among groups of beluga suggests a haplotype reduction in the St Lawrence. PMID:10447854

  9. Genome Majority Vote Improves Gene Predictions

    PubMed Central

    Wall, Michael E.; Raghavan, Sindhu; Cohn, Judith D.; Dunbar, John

    2011-01-01

    Recent studies have noted extensive inconsistencies in gene start sites among orthologous genes in related microbial genomes. Here we provide the first documented evidence that imposing gene start consistency improves the accuracy of gene start-site prediction. We applied an algorithm using a genome majority vote (GMV) scheme to increase the consistency of gene starts among orthologs. We used a set of validated Escherichia coli genes as a standard to quantify accuracy. Results showed that the GMV algorithm can correct hundreds of gene prediction errors in sets of five or ten genomes while introducing few errors. Using a conservative calculation, we project that GMV would resolve many inconsistencies and errors in publicly available microbial gene maps. Our simple and logical solution provides a notable advance toward accurate gene maps. PMID:22131910

  10. Interferon-dependent induction of mRNA for the major histocompatibility antigens in human fibroblasts and lymphoblastoid cells.

    PubMed Central

    Fellous, M; Nir, U; Wallach, D; Merlin, G; Rubinstein, M; Revel, M

    1982-01-01

    In human cells treated with interferons, there is an increase in the amount of HLA-A,B,C and beta 2-microglobulin exposed on the cell surface. We have used a cloned HLA-A,B,C cDNA probe to demonstrate by molecular hybridization that this effect of interferon is preceded by a large increase in the amount of HLA mRNA in the cell. This effect was found in five different human cell lines, with purified leukocyte and fibroblast interferons. The increase in HLA mRNA is comparable in its kinetics and dose-response to the induction of (2'-5') oligo(A) synthetase mRNA by interferons. Therefore, interferons seem to activate at least two cellular genes which have different biochemical functions. Images PMID:6179076

  11. Positive selection of invariant V alpha 14+ T cells by non-major histocompatibility complex-encoded class I-like molecules expressed on bone marrow-derived cells.

    PubMed Central

    Adachi, Y; Koseki, H; Zijlstra, M; Taniguchi, M

    1995-01-01

    V alpha 14+ T cells are a unique subset expressing an invariant T-cell antigen receptor alpha chain encoded by V alpha 14 and J alpha 281 gene fragments with a 1-nt N region. Most invariant V alpha 14+ T cells develop in extrathymic organs, independent of thymus, and expand at a high frequency in various mouse strains regardless of major histocompatibility complex (MHC) haplotype. In this paper, we show that the positive selection of invariant V alpha 14+ T cells requires a beta 2-microglobulin-associated MHC class I-like molecule not linked to the MHC on chromosome 17. This was determined by linkage analysis on DNA from recombinant mice generated by crossing a C57BL/6 mouse with a wild mouse, Mus musculus molossinus, that is negative for invariant V alpha 14 TCR expression. However, the peptide transporter TAP1 is not necessary for positive selection of invariant V alpha 14+ T cells, indicating the direct recognition of the MHC class I-like molecule without peptide by the invariant V alpha 14 TCR. Further, experiments with bone marrow-chimeric mice show that invariant V alpha 14+ T cells in the periphery are selected by bone marrow cells, suggesting a unique lineage of V alpha 14+ T cells differentiated through a selection process distinct from that of conventional alpha beta TCR+ T cells. Images Fig. 1 Fig. 2 Fig. 3 PMID:7862661

  12. Adenovirus E3/19K Promotes Evasion of NK Cell Recognition by Intracellular Sequestration of the NKG2D Ligands Major Histocompatibility Complex Class I Chain-Related Proteins A and B▿

    PubMed Central

    McSharry, Brian P.; Burgert, Hans-Gerhard; Owen, Douglas P.; Stanton, Richard J.; Prod'homme, Virginie; Sester, Martina; Koebernick, Katja; Groh, Veronika; Spies, Thomas; Cox, Steven; Little, Ann-Margaret; Wang, Eddie C. Y.; Tomasec, Peter; Wilkinson, Gavin W. G.

    2008-01-01

    The adenovirus (Ad) early transcription unit 3 (E3) encodes multiple immunosubversive functions that are presumed to facilitate the establishment and persistence of infection. Indeed, the capacity of E3/19K to inhibit transport of HLA class I (HLA-I) to the cell surface, thereby preventing peptide presentation to CD8+ T cells, has long been recognized as a paradigm for viral immune evasion. However, HLA-I downregulation has the potential to render Ad-infected cells vulnerable to natural killer (NK) cell recognition. Furthermore, expression of the immediate-early Ad gene E1A is associated with efficient induction of ligands for the key NK cell-activating receptor NKG2D. Here we show that while infection with wild-type Ad enhances synthesis of the NKG2D ligands, major histocompatibility complex class I chain-related proteins A and B (MICA and MICB), their expression on the cell surface is actively suppressed. Both MICA and MICB are retained within the endoplasmic reticulum as immature endoglycosidase H-sensitive forms. By analyzing a range of cell lines and viruses carrying mutated versions of the E3 gene region, E3/19K was identified as the gene responsible for this activity. The structural requirements within E3/19K necessary to sequester MICA/B and HLA-I are similar. In functional assays, deletion of E3/19K rendered Ad-infected cells more sensitive to NK cell recognition. We report the first NK evasion function in the Adenoviridae and describe a novel function for E3/19K. Thus, E3/19K has a dual function: inhibition of T-cell recognition and NK cell activation. PMID:18287244

  13. Histocompatible chicken inbred lines: homogeneities in the major histocompatibility complex antigens of the GSP, GSN/1, PNP/DO and BM-C inbred lines assessed by hemagglutination, mixed lymphocyte reaction and skin transplantation.

    PubMed

    Valdez, Marcos B; Mizutani, Makoto; Fujiwara, Akira; Yazawa, Hajime; Yamagata, Takahiro; Shimada, Kiyoshi; Namikawa, Takao

    2007-10-01

    Chicken inbred lines of the GSP, GSN/1, PNP/DO and BM-C have been established by selection of a specific allele at the B blood group locus (MHC B-G region) and other polymorphic loci through pedigree mating. To extend the potential of these inbred lines as experimental animals in Aves, we assessed the antigenic homogeneities of the MHC antigens by three immunological methods. Antigenic variations of red blood cells (RBCs) were surveyed in the inbred lines and a random-bred line (NG) derived from the Nagoya breed by using ten kinds of intact antisera produced in the inbred line of chickens against RBCs of a red junglefowl and hybrids. In the hemagglutination test, no individual variations were found within the inbred line at all, while all the ten antisera detected highly heterogeneous reactions in individuals of the NG. The reciprocal one-way mixed lymphocyte reactions gave constantly higher stimulation responses (P<0.01) between individual pairs from the inbred lines having different B alleles compared to pairs within the inbred line, while lower stimulation was observed between pairs of the GSP and GSN/1 inbred lines both having the B(21) allele. In reciprocal skin transplantation, the transplanted skingrafts within the inbred line and between individuals from the GSP and GSN/1 inbred lines survived more than 100 days, while all the skingrafts showed signs of rejection within 7 days among the inbred lines having different B alleles. The results obtained by the three practical methods coincidentally indicated that the individuals in the respective four inbred lines were histocompatible, and further, that the GSP and GSN/1 individuals were histocompatible. PMID:18075192

  14. Closely Related Mycobacterial Strains Demonstrate Contrasting Levels of Efficacy as Antitumor Vaccines and Are Processed for Major Histocompatibility Complex Class I Presentation by Multiple Routes in Dendritic Cells

    PubMed Central

    Cheadle, Eleanor J.; O'Donnell, Dearbhaile; Selby, Peter J.; Jackson, Andrew M.

    2005-01-01

    Mycobacteria expressing recombinant antigens are already being developed as vaccines against both infections and tumors. Little is known about how dendritic cells might process such antigens. Two different mycobacterial species, the fast-growing Mycobacterium smegmatis and the slow-growing M. bovis M. bovis BCG, were engineered to express a model tumor antigen, the Kb-restricted dominant cytotoxic T-lymphocyte epitope OVA257-264. Recombinant M. bovis BCG but not recombinant M. smegmatis conferred protection to mice challenged with the B16-OVA tumor cell line. We went on to investigate whether the contrast in antitumor efficacy could be due to differences in how dendritic cells process antigen from the two mycobacterial strains for class I presentation. Both strains of mycobacteria caused phenotypic maturation of dendritic cells, but recombinant M. smegmatis infection led to a greater degree of dendritic cell maturation than recombinant M. bovis BCG infection. Antigen from recombinant M. smegmatis was processed and presented as OVA257-264 on Kb molecules by the dendritic cell line DC2.4 but not by bone marrow-derived dendritic cells (BMDC) or splenic dendritic cells. In contrast, antigen from recombinant M. bovis BCG was presented by all three dendritic cell types as long as the mycobacteria were viable. Such presentation was dependent on proteasome function and nascent major histocompatibility complex (MHC) class I molecules in DC2.4 cells but independent of the proteasome and transporter associated with antigen processings (TAP) in BMDC and splenic dendritic cells. These data demonstrate for the first time that antigen vectored by the slow-growing M. bovis BCG but not that vectored by fast-growing, readily destroyed M. smegmatis is processed and presented on MHC class I by in vitro-generated dendritic cells, which has implications for recombinant microbial vaccine development. PMID:15664917

  15. Construction of Soluble Mamu-B*1703, a Class I Major Histocompatibility Complex of Chinese Rhesus Macaques, Monomer and Tetramer Loaded with a Simian Immunodeficiency Virus Peptide

    PubMed Central

    Ouyang, Dongyun; Wang, Xiaoying; He, Xianhui; Xu, Lihui; Shi, Huanjing; Gao, Qi; Guo, He

    2009-01-01

    Chinese-descent rhesus macaques have become more prevalent for HIV infection and vaccine investigation than Indian-origin macaques. Most of the currently available data and reagents such as major histocompatibility complex (MHC) class I tetramers, however, were derived from Indian-origin macaques due to the dominant use of these animals in history. Although there are significant differences in the immunogenetic background between the two macaque populations, they share a few of common MHC class I alleles. We reported in this study the procedure for preparation of a soluble Mamu-B*1703 (a MHC class I molecule of Chinese macaques) monomer and tetramer loaded with a dominant simian immunodeficiency virus (SIV) epitope IW9 (IRYPKTFGW) that was identified to be Mamu-B*1701-restricted in Indian macaques. The DNA fragment encoding the Mamu-B*1703 extracellular domain fused with a BirA substrate peptide (BSP) was amplified from a previously cloned cDNA and inserted into a prokaratic expression vector. In the presence of the antigenic peptide IW9 and light chain β2-microglobulin, the expressed heavy chain was refolded into a soluble monomer. After biotinylation, four monomers were polymerized as a tetramer by phycoerythrin-conjugated streptavidin. The tetramer, having been confirmed to have the right conformation, was a potential tool for investigation of antigen-specific CD8+ T-lymphocytes in SIV vaccine models of Chinese macaques. And our results also suggested that some antigenic peptides reported in Indian-origin macaques could be directly recruited as ligands for construction of Chinese macaque MHC tetramers. PMID:19403061

  16. Rhodococcus equi-Infected Macrophages Are Recognized and Killed by CD8+ T Lymphocytes in a Major Histocompatibility Complex Class I-Unrestricted Fashion

    PubMed Central

    Patton, Kristin M.; McGuire, Travis C.; Fraser, Darrilyn G.; Hines, Stephen A.

    2004-01-01

    The goal of this research was to examine the role of cytotoxic T lymphocytes (CTL) in the control of Rhodococcus equi and specifically to determine if R. equi-specific CD8+ CTL occurred in the blood of immune horses. Equine peripheral blood mononuclear cells stimulated with antigen-presenting cells either infected with R. equi or exposed to soluble R. equi antigen lysed R. equi-infected target cells. Lysis was decreased to background by depletion of either CD2+ or CD3+ cells, indicating that the effector cell had a T-lymphocyte, but not NK cell, phenotype. Stimulation induced an increased percentage of CD8+ T cells in the effector population, and depletion of CD8+ T cells resulted in significantly decreased lysis of infected targets. Killing of R. equi-infected macrophages by effector cells was equally effective against autologous and equine leukocyte antigen A (classical major histocompatibility complex [MHC] class I) mismatched targets. To evaluate potential target antigens, target cells were infected with either virulent (80.6-kb plasmid-containing) or avirulent (plasmid-cured) R. equi. The degree of lysis was not altered by the presence of the plasmid, providing evidence that the virulence plasmid, which is required for survival within macrophages, was not necessary for recognition and killing of R. equi-infected cells. These data indicate that immunocompetent adult horses develop R. equi-specific CD8+ CTL, which may play a role in immunity to R. equi. The apparent lack of restriction via classical MHC class I molecules suggests a novel or nonclassical method of antigen processing and presentation, such as presentation by CD1 or other nonclassical MHC molecules. PMID:15557631

  17. Salmonella enterica Serovar Typhi Live Vector Vaccines Delivered Intranasally Elicit Regional and Systemic Specific CD8+ Major Histocompatibility Class I-Restricted Cytotoxic T Lymphocytes

    PubMed Central

    Pasetti, Marcela F.; Salerno-Gonçalves, Rosangela; Sztein, Marcelo B.

    2002-01-01

    We investigated the ability of live attenuated Salmonella enterica serovar Typhi strains delivered to mice intranasally to induce specific cytotoxic T-lymphocyte (CTL) responses at regional and systemic levels. Mice immunized with two doses (28 days apart) of Salmonella serovar Typhi strain Ty21a, the licensed oral typhoid vaccine, and genetically attenuated mutants CVD 908 (ΔaroC ΔaroD), CVD 915 (ΔguaBA), and CVD 908-htrA (ΔaroC ΔaroD ΔhtrA) induced CTL specific for Salmonella serovar Typhi-infected cells in spleens and cervical lymph nodes. CTL were detected in effector T cells that had been expanded in vitro for 7 days in the presence of Salmonella-infected syngeneic splenocytes. A second round of stimulation further enhanced the levels of specific cytotoxicity. CTL activity was observed in sorted αβ+ CD8+ T cells, which were remarkably increased after expansion, but not in CD4+ T cells. CTL from both cervical lymph nodes and spleens failed to recognize Salmonella-infected major histocompatibility complex (MHC)-mismatched cells, indicating that the responses were MHC restricted. Studies in which MHC blocking antibodies were used showed that H-2Ld was the restriction element. This is the first demonstration that Salmonella serovar Typhi vaccines delivered intranasally elicit CD8+ MHC class I-restricted CTL. The results further support the usefulness of the murine intranasal model for evaluating the immunogenicity of typhoid vaccine candidates at the preclinical level. PMID:12117906

  18. Cloning and modeling of CD8 beta in the amphibian ambystoma Mexicanum. Evolutionary conserved structures for interactions with major histocompatibility complex (MHC) class I molecules.

    PubMed

    Fellah, Julien S; Tuffèry, Pierre; Etchebest, Catherine; Guillet, Françoise; Bleux, Christian; Charlemagne, Jacques

    2002-04-17

    Mammalian and avian T-cells exhibit a large number of well characterized surface molecules associated with their maturation degree. Very little is known in comparison with T-cell differentiation in ectothermic vertebrates. This is mainly due to the lack of probes to identify T-cell subsets. We cloned and sequenced the first ectothermic CD8 beta DNA complementary to RNA from an amphibian species, the Mexican axolotl. The CD8 beta chain was 30-36% identical with its avian and mammalian homologues. The extracellular V-like domain contained the two typically conserved cysteines and was followed by a J-like sequence containing the canonical Phe-Gly-X-Gly stretch. The connecting peptide was much longer than in other species and contained potential O-glycosylation sites. The axolotl CD8 beta and major histocompatibility complex class I molecules were modeled using human HLA-A2/CD8 alphaalpha complex as template. The backbone conformation of axolotl CD8 beta matched well with the CD8 alpha-2 subunit of the human complex but significant structural differences were located in the CDR1, CDR2 and DE loops. Both axolotl and human class I showed large negative surface potential. The interacting area of the human CD8 alpha chain and of the corresponding region of axolotl CD8 beta had positive electrostatic potential compatible with complexation with the corresponding class I molecules. The presence of a CD8 beta homologue in an amphibian species implies that it was already present in the Devonian ancestor of amphibians and mammals, i.e. more than 400 million years ago. PMID:12034498

  19. Assessment of biodiversity in Chilean cattle using the distribution of major histocompatibility complex class II BoLA-DRB3 allele.

    PubMed

    Takeshima, S-N; Miyasaka, T; Matsumoto, Y; Xue, G; Diaz, V de la Barra; Rogberg-Muñoz, A; Giovambattista, G; Ortiz, M; Oltra, J; Kanemaki, M; Onuma, M; Aida, Y

    2015-01-01

    Bovine leukocyte antigens (BoLAs) are used extensively as markers for bovine disease and immunological traits. In this study, we estimated BoLA-DRB3 allele frequencies using 888 cattle from 10 groups, including seven cattle breeds and three crossbreeds: 99 Red Angus, 100 Black Angus, 81 Chilean Wagyu, 49 Hereford, 95 Hereford × Angus, 71 Hereford × Jersey, 20 Hereford × Overo Colorado, 113 Holstein, 136 Overo Colorado, and 124 Overo Negro cattle. Forty-six BoLA-DRB3 alleles were identified, and each group had between 12 and 29 different BoLA-DRB3 alleles. Overo Negro had the highest number of alleles (29); this breed is considered in Chile to be an 'Old type' European Holstein Friesian descendant. By contrast, we detected 21 alleles in Holstein cattle, which are considered to be a 'Present type' Holstein Friesian cattle. Chilean cattle groups and four Japanese breeds were compared by neighbor-joining trees and a principal component analysis (PCA). The phylogenetic tree showed that Red Angus and Black Angus cattle were in the same clade, crossbreeds were closely related to their parent breeds, and Holstein cattle from Chile were closely related to Holstein cattle in Japan. Overall, the tree provided a thorough description of breed history. It also showed that the Overo Negro breed was closely related to the Holstein breed, consistent with historical data indicating that Overo Negro is an 'Old type' Holstein Friesian cattle. This allelic information will be important for investigating the relationship between major histocompatibility complex (MHC) and disease. PMID:25430590

  20. Autoantibody Profiles in Collagen Disease Patients with Interstitial Lung Disease (ILD): Antibodies to Major Histocompatibility Complex Class I-Related Chain A (MICA) as Markers of ILD.

    PubMed

    Furukawa, Hiroshi; Oka, Shomi; Shimada, Kota; Masuo, Kiyoe; Nakajima, Fumiaki; Funano, Shunichi; Tanaka, Yuki; Komiya, Akiko; Fukui, Naoshi; Sawasaki, Tatsuya; Tadokoro, Kenji; Nose, Masato; Tsuchiya, Naoyuki; Tohma, Shigeto

    2015-01-01

    Interstitial lung disease (ILD) is frequently associated with collagen disease. It is then designated as collagen vascular disease-associated ILD (CVD-ILD), and influences patients' prognosis. The prognosis of acute-onset diffuse ILD (AoDILD) occurring in patients with collagen disease is quite poor. Here, we report our investigation of auto-antibody (Ab) profiles to determine whether they may be useful in diagnosing CVD-ILD or AoDILD in collagen disease. Auto-Ab profiles were analyzed using the Lambda Array Beads Multi-Analyte System, granulocyte immunofluorescence test, Proto-Array Human Protein Microarray, AlphaScreen assay, and glutathione S-transferase capture enzyme-linked immunosorbent assay in 34 patients with rheumatoid arthritis (RA) with or without CVD-ILD and in 15 patients with collagen disease with AoDILD. The average anti-major histocompatibility complex class I-related chain A (MICA) Ab levels were higher in RA patients with CVD-ILD than in those without (P = 0.0013). The ratio of the average anti-MICA Ab level to the average anti-human leukocyte antigen class I Ab level (ie, MICA/Class I) was significantly higher in RA patients with CVD-ILD compared with those without (P = 4.47 × 10(-5)). To the best of our knowledge, this is the first report of auto-Ab profiles in CVD-ILD. The MICA/Class I ratio could be a better marker for diagnosing CVD-ILD than KL-6 (Krebs von den lungen-6). PMID:26327779

  1. Autoantibody Profiles in Collagen Disease Patients with Interstitial Lung Disease (ILD): Antibodies to Major Histocompatibility Complex Class I-Related Chain A (MICA) as Markers of ILD

    PubMed Central

    Furukawa, Hiroshi; Oka, Shomi; Shimada, Kota; Masuo, Kiyoe; Nakajima, Fumiaki; Funano, Shunichi; Tanaka, Yuki; Komiya, Akiko; Fukui, Naoshi; Sawasaki, Tatsuya; Tadokoro, Kenji; Nose, Masato; Tsuchiya, Naoyuki; Tohma, Shigeto

    2015-01-01

    Interstitial lung disease (ILD) is frequently associated with collagen disease. It is then designated as collagen vascular disease-associated ILD (CVD-ILD), and influences patients’ prognosis. The prognosis of acute-onset diffuse ILD (AoDILD) occurring in patients with collagen disease is quite poor. Here, we report our investigation of auto-antibody (Ab) profiles to determine whether they may be useful in diagnosing CVD-ILD or AoDILD in collagen disease. Auto-Ab profiles were analyzed using the Lambda Array Beads Multi-Analyte System, granulocyte immunofluorescence test, Proto-Array Human Protein Microarray, AlphaScreen assay, and glutathione S-transferase capture enzyme-linked immunosorbent assay in 34 patients with rheumatoid arthritis (RA) with or without CVD-ILD and in 15 patients with collagen disease with AoDILD. The average anti-major histocompatibility complex class I-related chain A (MICA) Ab levels were higher in RA patients with CVD-ILD than in those without (P = 0.0013). The ratio of the average anti-MICA Ab level to the average anti-human leukocyte antigen class I Ab level (ie, MICA/Class I) was significantly higher in RA patients with CVD-ILD compared with those without (P = 4.47 × 10−5). To the best of our knowledge, this is the first report of auto-Ab profiles in CVD-ILD. The MICA/Class I ratio could be a better marker for diagnosing CVD-ILD than KL-6 (Krebs von den lungen-6). PMID:26327779

  2. Herpes B Virus, Macacine Herpesvirus 1, Breaks Simplex Virus Tradition via Major Histocompatibility Complex Class I Expression in Cells from Human and Macaque Hosts

    PubMed Central

    Vasireddi, Mugdha

    2012-01-01

    B virus of the family Herpesviridae is endemic to rhesus macaques but results in 80% fatality in untreated humans who are zoonotically infected. Downregulation of major histocompatibility complex (MHC) class I in order to evade CD8+ T-cell activation is characteristic of most herpesviruses. Here we examined the cell surface presence and total protein expression of MHC class I molecules in B virus-infected human foreskin fibroblast cells and macaque kidney epithelial cells in culture, which are representative of foreign and natural host initial target cells of B virus. Our results show <20% downregulation of surface MHC class I molecules in either type of host cells infected with B virus, which is statistically insignificantly different from that observed in uninfected cells. We also examined the surface expression of MHC class Ib molecules, HLA-E and HLA-G, involved in NK cell inhibition. Our results showed significant upregulation of HLA-E and HLA-G in host cells infected with B virus relative to the amounts observed in other herpesvirus-infected cells. These results suggest that B virus-infected cell surfaces maintain normal levels of MHC class Ia molecules, a finding unique among simplex viruses. This is a unique divergence in immune evasion for B virus, which, unlike human simplex viruses, does not inhibit the transport of peptides for loading onto MHC class Ia molecules because B virus ICP47 lacks a transporter-associated protein binding domain. The fact that MHC class Ib molecules were significantly upregulated has additional implications for host-pathogen interactions. PMID:22973043

  3. Interplay between T Cell Receptor Binding Kinetics and the Level of Cognate Peptide Presented by Major Histocompatibility Complexes Governs CD8+ T Cell Responsiveness*

    PubMed Central

    Irving, Melita; Zoete, Vincent; Hebeisen, Michael; Schmid, Daphné; Baumgartner, Petra; Guillaume, Philippe; Romero, Pedro; Speiser, Daniel; Luescher, Immanuel; Rufer, Nathalie; Michielin, Olivier

    2012-01-01

    Through a rational design approach, we generated a panel of HLA-A*0201/NY-ESO-1157–165-specific T cell receptors (TCR) with increasing affinities of up to 150-fold from the wild-type TCR. Using these TCR variants which extend just beyond the natural affinity range, along with an extreme supraphysiologic one having 1400-fold enhanced affinity, and a low-binding one, we sought to determine the effect of TCR binding properties along with cognate peptide concentration on CD8+ T cell responsiveness. Major histocompatibility complexes (MHC) expressed on the surface of various antigen presenting cells were peptide-pulsed and used to stimulate human CD8+ T cells expressing the different TCR via lentiviral transduction. At intermediate peptide concentration we measured maximum cytokine/chemokine secretion, cytotoxicity, and Ca2+ flux for CD8+ T cells expressing TCR within a dissociation constant (KD) range of ∼1–5 μm. Under these same conditions there was a gradual attenuation in activity for supraphysiologic affinity TCR with KD < ∼1 μm, irrespective of CD8 co-engagement and of half-life (t1/2 = ln 2/koff) values. With increased peptide concentration, however, the activity levels of CD8+ T cells expressing supraphysiologic affinity TCR were gradually restored. Together our data support the productive hit rate model of T cell activation arguing that it is not the absolute number of TCR/pMHC complexes formed at equilibrium, but rather their productive turnover, that controls levels of biological activity. Our findings have important implications for various immunotherapies under development such as adoptive cell transfer of TCR-engineered CD8+ T cells, as well as for peptide vaccination strategies. PMID:22549784

  4. Antigen-Specific Signaling by a Soluble, Dimeric Peptide/Major Histocompatibility Complex Class II/Fc Chimera Leading to T Helper Cell Type 2 Differentiation

    PubMed Central

    Casares, Sofia; Zong, Cong S.; Radu, Dorel L.; Miller, Alexander; Bona, Constantin A.; Brumeanu, Teodor-Doru

    1999-01-01

    Interaction between a T cell receptor (TCR) and various ligands, i.e., anti-TCR antibodies, superantigens, peptides, or altered peptide ligands in the context of major histocompatibility complex (MHC) molecules can trigger different T helper cell (Th) effector functions. Herein, we studied the T cell response induced by a soluble, dimeric peptide/MHC class II chimera, namely hemagglutinin (HA)110-120/I-Edαβ/Fcγ2a (DEF). We have previously demonstrated that the soluble DEF molecule binds stably and specifically to HA110-120–specific TCRs expressed by a T cell hybridoma. Administration of DEF in vivo induced differentiation of resting and activated peptide-specific T cells toward a Th2 response, as indicated by the increase of interleukin (IL)-4, IL-10, and specific immunoglobulin (Ig)G1 antibodies and decrease of IL-2, specific IgG2a antibodies, and cytotoxic T lymphocyte activity. In contrast to HA110-120 peptide presented by the DEF molecule to T cells, the nominal synthetic peptide induced a predominant Th1 response, and the PR8 virus–derived HA110-120 peptides induced a mixed Th1/Th2 response. Independent of antigen processing, soluble DEF was almost 2 logs more potent in stimulating cognate T cells than the nominal peptide. Polarization of cognate T cells toward the Th2 response occurred upon interaction of soluble DEF with TCR and CD4 molecules followed by early activation of p56lck and ZAP-70 tyrosine kinases, and negative signaling of the signal transducer and activator of transcription (STAT)4 pathway of Th1 differentiation. DEF-like molecules may provide a new tool to study the mechanisms of signaling toward Th2 differentiation and may also provide a potential immunotherapeutic approach to modulate autoreactive T cells toward protective Th2 immune responses. PMID:10449525

  5. In silico prediction of peptide binding affinity to class I mouse major histocompatibility complexes: a comparative molecular similarity index analysis (CoMSIA) study.

    PubMed

    Hattotuwagama, Channa K; Doytchinova, Irini A; Flower, Darren R

    2005-01-01

    Current methods for the in silico identification of T cell epitopes (which form the basis of many vaccines, diagnostics, and reagents) rely on the accurate prediction of peptide-major histocompatibility complex (MHC) affinity. A three-dimensional quantitative structure-activity relationship (3D-QSAR) for the prediction of peptide binding to class I MHC molecules was established using the comparative molecular similarity index analysis (CoMSIA) method. Three MHC alleles were studied: H2-D(b), H2-K(b), and H2-K(k). Models were produced for each allele. Each model consisted of five physicochemical descriptors-steric bulk, electrostatic potentials, hydrophobic interactions, and hydrogen-bond donor and hydrogen-bond acceptor abilities. The models have an acceptable level of predictivity: cross-validation leave-one-out statistical terms q2 and SEP (standard error of prediction) ranged between 0.490 and 0.679 and between 0.525 and 0.889, respectively. The non-cross-validated statistical terms r2 and SEE (standard error of estimate) ranged between 0.913 and 0.979 and between 0.167 and 0.248, respectively. The use of coefficient contour maps, which indicate favored and disfavored areas for each position of the MHC-bound peptides, allowed the binding specificity of each allele to be identified, visualized, and understood. The present study demonstrates the effectiveness of CoMSIA as a method for studying peptide-MHC interactions. The peptides used in this study are available on the Internet (http://www.jenner.ac.uk/AntiJen). The partial least-squares method is available commercially in the SYBYL molecular modeling software package. PMID:16180918

  6. Bordetella pertussis Proteins Dominating the Major Histocompatibility Complex Class II-Presented Epitope Repertoire in Human Monocyte-Derived Dendritic Cells

    PubMed Central

    Stenger, Rachel M.; Meiring, Hugo D.; Kuipers, Betsy; Poelen, Martien; van Gaans-van den Brink, Jacqueline A. M.; Boog, Claire J. P.; de Jong, Ad P. J. M.

    2014-01-01

    Knowledge of naturally processed Bordetella pertussis-specific T cell epitopes may help to increase our understanding of the basis of cell-mediated immune mechanisms to control this reemerging pathogen. Here, we elucidate for the first time the dominant major histocompatibility complex (MHC) class II-presented B. pertussis CD4+ T cell epitopes, expressed on human monocyte-derived dendritic cells (MDDC) after the processing of whole bacterial cells by use of a platform of immunoproteomics technology. Pertussis epitopes identified in the context of HLA-DR molecules were derived from two envelope proteins, i.e., putative periplasmic protein (PPP) and putative peptidoglycan-associated lipoprotein (PAL), and from two cytosolic proteins, i.e., 10-kDa chaperonin groES protein (groES) and adenylosuccinate synthetase (ASS). No epitopes were detectable from known virulence factors. CD4+ T cell responsiveness in healthy adults against peptide pools representing epitope regions or full proteins confirmed the immunogenicity of PAL, PPP, groES, and ASS. Elevated lymphoproliferative activity to PPP, groES, and ASS in subjects within a year after the diagnosis of symptomatic pertussis suggested immunogenic exposure to these proteins during clinical infection. The PAL-, PPP-, groES-, and ASS-specific responses were associated with secretion of functional Th1 (tumor necrosis factor alpha [TNF-α] and gamma interferon [IFN-γ]) and Th2 (interleukin 5 [IL-5] and IL-13) cytokines. Relative paucity in the natural B. pertussis epitope display of MDDC, not dominated by epitopes from known protective antigens, can interfere with the effectiveness of immune recognition of B. pertussis. A more complete understanding of hallmarks in B. pertussis-specific immunity may advance the design of novel immunological assays and prevention strategies. PMID:24599530

  7. Bordetella pertussis proteins dominating the major histocompatibility complex class II-presented epitope repertoire in human monocyte-derived dendritic cells.

    PubMed

    Stenger, Rachel M; Meiring, Hugo D; Kuipers, Betsy; Poelen, Martien; van Gaans-van den Brink, Jacqueline A M; Boog, Claire J P; de Jong, Ad P J M; van Els, Cécile A C M

    2014-05-01

    Knowledge of naturally processed Bordetella pertussis-specific T cell epitopes may help to increase our understanding of the basis of cell-mediated immune mechanisms to control this reemerging pathogen. Here, we elucidate for the first time the dominant major histocompatibility complex (MHC) class II-presented B. pertussis CD4(+) T cell epitopes, expressed on human monocyte-derived dendritic cells (MDDC) after the processing of whole bacterial cells by use of a platform of immunoproteomics technology. Pertussis epitopes identified in the context of HLA-DR molecules were derived from two envelope proteins, i.e., putative periplasmic protein (PPP) and putative peptidoglycan-associated lipoprotein (PAL), and from two cytosolic proteins, i.e., 10-kDa chaperonin groES protein (groES) and adenylosuccinate synthetase (ASS). No epitopes were detectable from known virulence factors. CD4(+) T cell responsiveness in healthy adults against peptide pools representing epitope regions or full proteins confirmed the immunogenicity of PAL, PPP, groES, and ASS. Elevated lymphoproliferative activity to PPP, groES, and ASS in subjects within a year after the diagnosis of symptomatic pertussis suggested immunogenic exposure to these proteins during clinical infection. The PAL-, PPP-, groES-, and ASS-specific responses were associated with secretion of functional Th1 (tumor necrosis factor alpha [TNF-α] and gamma interferon [IFN-γ]) and Th2 (interleukin 5 [IL-5] and IL-13) cytokines. Relative paucity in the natural B. pertussis epitope display of MDDC, not dominated by epitopes from known protective antigens, can interfere with the effectiveness of immune recognition of B. pertussis. A more complete understanding of hallmarks in B. pertussis-specific immunity may advance the design of novel immunological assays and prevention strategies. PMID:24599530

  8. B Cell-Activating Transcription Factor Plays a Critical Role in the Pathogenesis of Anti-Major Histocompatibility Complex-Induced Obliterative Airway Disease.

    PubMed

    Xu, Z; Ramachandran, S; Gunasekaran, M; Nayak, D; Benshoff, N; Hachem, R; Gelman, A; Mohanakumar, T

    2016-04-01

    Antibodies (Abs) against major histocompatibility complex (MHC) results in T helper-17 (Th17)-mediated immunity against lung self-antigens (SAgs), K-α1 tubulin and collagen V and obliterative airway disease (OAD). Because B cell-activating transcription factor (BATF) controls Th17 and autoimmunity, we proposed that BATF may play a critical role in OAD. Anti-H2K(b) was administered intrabronchially into Batf (-/-) and C57BL/6 mice. Histopathology of the lungs on days 30 and 45 after Ab administration to Batf (-/-) mice resulted in decreased cellular infiltration, epithelial metaplasia, fibrosis, and obstruction. There was lack of Abs to SAgs, reduction of Sag-specific interleukin (IL)-17 T cells, IL-6, IL-23, IL-17, IL-1β, fibroblast growth factor-6, and CXCL12 and decreased Janus kinase 2, signal transducer and activator of transcription 3 (STAT3), and retinoid-related orphan receptor γT. Further, micro-RNA (miR)-301a, a regulator of Th17, was reduced in Batf (-/-) mice in contrast to upregulation of miR-301a and downregulation of protein inhibitor of activated STAT3 (PIAS3) in anti-MHC-induced OAD animals. We also demonstrate an increase in miR-301a in the bronchoalveolar lavage cells from lung transplant recipients with Abs to human leukocyte antigen. This was accompanied by reduction in PIAS3 mRNA. Therefore, we conclude that BATF plays a critical role in the immune responses to SAgs and pathogenesis of anti-MHC-induced rejection. Targeting BATF should be considered for preventing chronic rejection after human lung transplantation. PMID:26844425

  9. Key Role of Toll-Like Receptor 2 in the Inflammatory Response and Major Histocompatibility Complex Class II Downregulation in Brucella abortus-Infected Alveolar Macrophages

    PubMed Central

    Ferrero, Mariana C.; Hielpos, M. Soledad; Carvalho, Natalia B.; Barrionuevo, Paula; Corsetti, Patricia P.; Giambartolomei, Guillermo H.; Oliveira, Sergio C.

    2014-01-01

    Alveolar macrophages (AM) seem to constitute the main cellular target of inhaled brucellae. Here, we show that Brucella abortus invades and replicates in murine AM without inducing cytotoxicity. B. abortus infection induced a statistically significant increase of tumor necrosis factor alpha (TNF-α), CXCL1 or keratinocyte chemoattractant (KC), interleukin-1β (IL-1β), IL-6, and IL-12 in AM from C57BL/6 mice and BALB/c mice, but these responses were generally weaker and/or delayed compared to those elicited in peritoneal macrophages. Studies using knockout mice for TLR2, TLR4, and TLR9 revealed that TNF-α and KC responses were mediated by TLR2 recognition. Brucella infection reduced in a multiplicity of infection-dependent manner the expression of major histocompatibility complex class II (MHC-II) molecules induced by gamma interferon (IFN-γ) in AM. The same phenomenon was induced by incubation with heat-killed B. abortus (HKBA) or the lipidated form of the 19-kDa outer membrane protein of Brucella (L-Omp19), and it was shown to be mediated by TLR2 recognition. In contrast, no significant downregulation of MHC-II was induced by either unlipidated Omp19 or Brucella LPS. In a functional assay, treatment of AM with either L-Omp19 or HKBA reduced the MHC-II-restricted presentation of OVA peptides to specific T cells. One week after intratracheal infection, viable B. abortus was detected in AM from both wild-type and TLR2 KO mice, but CFU counts were higher in the latter. These results suggest that B. abortus survives in AM after inhalatory infection in spite of a certain degree of immune control exerted by the TLR2-mediated inflammatory response. Both the modest nature of the latter and the modulation of MHC-II expression by the bacterium may contribute to such survival. PMID:24478078

  10. Major histocompatibility complex class I-intercellular adhesion molecule-1 association on the surface of target cells: implications for antigen presentation to cytotoxic T lymphocytes.

    PubMed

    Lebedeva, Tatiana; Anikeeva, Nadja; Kalams, Spyros A; Walker, Bruce D; Gaidarov, Ibragim; Keen, James H; Sykulev, Yuri

    2004-12-01

    Polarization and segregation of the T-cell receptor (TCR) and integrins upon productive cytotoxic T-lymphocyte (CTL) target cell encounters are well documented. Much less is known about the redistribution of major histocompatibility complex class I (MHC-I) and intercellular adhesion molecule-1 (ICAM-1) proteins on target cells interacting with CTLs. Here we show that human leucocyte antigen-A2 (HLA-A2) MHC-I and ICAM-1 are physically associated and recovered from both the raft fraction and the fraction of soluble membranes of target cells. Conjugation of target cells with surrogate CTLs, i.e. polystyrene beads loaded with antibodies specific for HLA-A2 and ICAM-1, induced the accumulation of membrane rafts, and beads loaded with ICAM-1-specific antibodies caused the selective recruitment of HLA-A2 MHC-I at the contact area of the target cells. Disruption of raft integrity on target cells led to a release of HLA-A2 and ICAM-1 from the raft fraction, abatement of HLA-A2 polarization, and diminished the ability of target cells bearing viral peptides to induce a Ca(2+) flux in virus-specific CTLs. These data suggest that productive engagement of ICAM-1 on target cells facilitates the polarization of MHC-I at the CTL-target cell interface, augmenting presentation of cognate peptide-MHC (pMHC) complexes to CTLs. We propose that ICAM-1-MHC-I association on the cell membrane is a mechanism that enhances the linkage between antigen recognition and early immunological synapse formation. PMID:15554924

  11. A Major Gene for Bovine Ovulation Rate

    PubMed Central

    Kirkpatrick, Brian W.; Morris, Chris A.

    2015-01-01

    Half-sib daughters sired by a bull believed to be a carrier of a major gene for high ovulation rate were evaluated for ovulation rate and genotyped in an effort to both test the hypothesis of segregation of a major gene and to map the gene’s location. A total of 131 daughters were produced over four consecutive years at a University of Wisconsin-Madison research farm. All were evaluated for ovulation rate over an average of four estrous cycles using transrectal ultrasonography. The sire and all daughters were genotyped using a 3K SNP chip and the genotype and phenotype data were used in a linkage analysis. Subsequently, daughters recombinant within the QTL region and the sire were genotyped successively with 50K and 777K SNP chips to refine the location of the causative polymorphism. Positional candidate genes within the fine-mapped region were examined for polymorphism by Sanger sequencing of PCR amplicons encompassing coding and 5’ and 3’ flanking regions of the genes. Sire DNA was used as template in the PCR reactions. Strong evidence of a major gene for ovulation rate was observed (p<1x10-28) with the gene localized to bovine chromosome 10. Fine-mapping subsequently reduced the location to a 1.2 Mb region between 13.6 and 14.8 Mb on chromosome 10. The location identified does not correspond to that for any previously identified major gene for ovulation rate. This region contains three candidate genes, SMAD3, SMAD6 and IQCH. While candidate gene screening failed to identify the causative polymorphism, three polymorphisms were identified that can be used as a haplotype to track inheritance of the high ovulation rate allele in descendants of the carrier sire. PMID:26046917

  12. Gene expression in major depressive disorder.

    PubMed

    Jansen, R; Penninx, B W J H; Madar, V; Xia, K; Milaneschi, Y; Hottenga, J J; Hammerschlag, A R; Beekman, A; van der Wee, N; Smit, J H; Brooks, A I; Tischfield, J; Posthuma, D; Schoevers, R; van Grootheest, G; Willemsen, G; de Geus, E J; Boomsma, D I; Wright, F A; Zou, F; Sun, W; Sullivan, P F

    2016-03-01

    The search for genetic variants underlying major depressive disorder (MDD) has not yet provided firm leads to its underlying molecular biology. A complementary approach is to study gene expression in relation to MDD. We measured gene expression in peripheral blood from 1848 subjects from The Netherlands Study of Depression and Anxiety. Subjects were divided into current MDD (N=882), remitted MDD (N=635) and control (N=331) groups. MDD status and gene expression were measured again 2 years later in 414 subjects. The strongest gene expression differences were between the current MDD and control groups (129 genes at false-discovery rate, FDR<0.1). Gene expression differences across MDD status were largely unrelated to antidepressant use, inflammatory status and blood cell counts. Genes associated with MDD were enriched for interleukin-6 (IL-6)-signaling and natural killer (NK) cell pathways. We identified 13 gene expression clusters with specific clusters enriched for genes involved in NK cell activation (downregulated in current MDD, FDR=5.8 × 10(-5)) and IL-6 pathways (upregulated in current MDD, FDR=3.2 × 10(-3)). Longitudinal analyses largely confirmed results observed in the cross-sectional data. Comparisons of gene expression results to the Psychiatric Genomics Consortium (PGC) MDD genome-wide association study results revealed overlap with DVL3. In conclusion, multiple gene expression associations with MDD were identified and suggest a measurable impact of current MDD state on gene expression. Identified genes and gene clusters are enriched with immune pathways previously associated with the etiology of MDD, in line with the immune suppression and immune activation hypothesis of MDD. PMID:26008736

  13. ALVAC-SIV-gag-pol-env-Based Vaccination and Macaque Major Histocompatibility Complex Class I (A*01) Delay Simian Immunodeficiency Virus SIVmac-Induced Immunodeficiency

    PubMed Central

    Pal, R.; Venzon, D.; Letvin, N. L.; Santra, S.; Montefiori, D. C.; Miller, N. R.; Tryniszewska, E.; Lewis, M. G.; VanCott, T. C.; Hirsch, V.; Woodward, R.; Gibson, A.; Grace, M.; Dobratz, E.; Markham, P. D.; Hel, Z.; Nacsa, J.; Klein, M.; Tartaglia, J.; Franchini, G.

    2002-01-01

    T-cell-mediated immune effector mechanisms play an important role in the containment of human immunodeficiency virus/simian immunodeficiency virus (HIV/SIV) replication after infection. Both vaccination- and infection-induced T-cell responses are dependent on the host major histocompatibility complex classes I and II (MHC-I and MHC-II) antigens. Here we report that both inherent, host-dependent immune responses to SIVmac251 infection and vaccination-induced immune responses to viral antigens were able to reduce virus replication and/or CD4+ T-cell loss. Both the presence of the MHC-I Mamu-A*01 genotype and vaccination of rhesus macaques with ALVAC-SIV-gag-pol-env (ALVAC-SIV-gpe) contributed to the restriction of SIVmac251 replication during primary infection, preservation of CD4+ T cells, and delayed disease progression following intrarectal challenge exposure of the animals to SIVmac251 (561). ALVAC-SIV-gpe immunization induced cytotoxic T-lymphocyte (CTL) responses cumulatively in 67% of the immunized animals. Following viral challenge, a significant secondary virus-specific CD8+ T-cell response was observed in the vaccinated macaques. In the same immunized macaques, a decrease in virus load during primary infection (P = 0.0078) and protection from CD4 loss during both acute and chronic phases of infection (P = 0.0099 and P = 0.03, respectively) were observed. A trend for enhanced survival of the vaccinated macaques was also observed. Neither boosting the ALVAC-SIV-gpe with gp120 immunizations nor administering the vaccine by the combination of mucosal and systemic immunization routes increased significantly the protective effect of the ALVAC-SIV-gpe vaccine. While assessing the role of MHC-I Mamu-A*01 alone in the restriction of viremia following challenge of nonvaccinated animals with other SIV isolates, we observed that the virus load was not significantly lower in Mamu-A*01-positive macaques following intravenous challenge with either SIVmac251 (561) or

  14. Down-regulated expression of monocyte/macrophage major histocompatibility complex receptors in human and mouse monocytes by expression of their ligands

    PubMed Central

    Yamana, H; Tashiro-Yamaji, J; Hayashi, M; Maeda, S; Shimizu, T; Tanigawa, N; Uchiyama, K; Kubota, T; Yoshida, R

    2014-01-01

    Mouse monocyte/macrophage major histocompatibility complex (MHC) receptor 1 (MMR1; or MMR2) specific for H-2Dd (or H-2Kd) molecules is expressed on monocytes from non-H-2Dd (or non-H-2Kd), but not those from H-2Dd (or H-2Kd), inbred mice. The MMR1 and/or MMR2 is essential for the rejection of H-2Dd- and/or H-2Kd-transgenic mouse skin onto C57BL/6 (H-2DbKb) mice. Recently, we found that human leucocyte antigen (HLA)-B44 was the sole ligand of human MMR1 using microbeads that had been conjugated with 80 types of HLA class I molecules covering 94·2% (or 99·4%) and 92·4% (or 96·2%) of HLA-A and B molecules of Native Americans (or Japanese), respectively. In the present study, we also explored the ligand specificity of human MMR2 using microbeads. Microbeads coated with HLA-A32, HLA-B13 or HLA-B62 antigens bound specifically to human embryonic kidney (HEK)293T or EL-4 cells expressing human MMR2 and to the solubilized MMR2-green fluorescent protein (GFP) fusion protein; and MMR2+ monocytes from a volunteer bound HLA-B62 molecules with a Kd of 8·7 × 10−9 M, implying a three times down-regulation of MMR2 expression by the ligand expression. H-2Kd (or H-2Dd) transgene into C57BL/6 mice down-regulated not only MMR2 (or MMR1) but also MMR1 (or MMR2) expression, leading to further down-regulation of MMR expression. In fact, monocytes from two (i.e. MMR1+/MMR2+ and MMR1–/MMR2–) volunteers bound seven to nine types of microbeads among 80, indicating ≤ 10 types of MMR expression on monocytes. The physiological role of constitutive MMRs on monocytes possibly towards allogeneic (e.g. fetal) cells in the blood appears to be distinct from that of inducible MMRs on macrophages toward allografts in tissue. PMID:24842626

  15. Immunization with a single major histocompatibility complex class I-restricted cytotoxic T-lymphocyte recognition epitope of herpes simplex virus type 2 confers protective immunity.

    PubMed

    Blaney, J E; Nobusawa, E; Brehm, M A; Bonneau, R H; Mylin, L M; Fu, T M; Kawaoka, Y; Tevethia, S S

    1998-12-01

    We have evaluated the potential of conferring protective immunity to herpes simplex virus type 2 (HSV-2) by selectively inducing an HSV-specific CD8(+) cytotoxic T-lymphocyte (CTL) response directed against a single major histocompatibility complex class I-restricted CTL recognition epitope. We generated a recombinant vaccinia virus (rVV-ES-gB498-505) which expresses the H-2Kb-restricted, HSV-1/2-cross-reactive CTL recognition epitope, HSV glycoprotein B residues 498 to 505 (SSIEFARL) (gB498-505), fused to the adenovirus type 5 E3/19K endoplasmic reticulum insertion sequence (ES). Mucosal immunization of C57BL/6 mice with this recombinant vaccinia virus induced both a primary CTL response in the draining lymph nodes and a splenic memory CTL response directed against HSV gB498-505. To determine the ability of the gB498-505-specific memory CTL response to provide protection from HSV infection, immunized mice were challenged with a lethal dose of HSV-2 strain 186 by the intranasal (i.n.) route. Development of the gB498-505-specific CTL response conferred resistance in 60 to 75% of mice challenged with a lethal dose of HSV-2 and significantly reduced the levels of infectious virus in the brains and trigeminal ganglia of challenged mice. Finally, i.n. immunization of C57BL/6 mice with either a recombinant influenza virus or a recombinant vaccinia virus expressing HSV gB498-505 without the ES was also demonstrated to induce an HSV-specific CTL response and provide protection from HSV infection. This finding confirms that the induction of an HSV-specific CTL response directed against a single epitope is sufficient for conferring protective immunity to HSV. Our findings support the role of CD8(+) T cells in the control of HSV infection of the central nervous system and suggest the potential importance of eliciting HSV-specific mucosal CD8(+) CTL in HSV vaccine design. PMID:9811690

  16. Expression of bovine non-classical major histocompatibility complex class I proteins in mouse P815 and human K562 cells.

    PubMed

    Parasar, Parveen; Wilhelm, Amanda; Rutigliano, Heloisa M; Thomas, Aaron J; Teng, Lihong; Shi, Bi; Davis, William C; Suarez, Carlos E; New, Daniel D; White, Kenneth L; Davies, Christopher J

    2016-08-01

    Major histocompatibility complex class I (MHC-I) proteins can be expressed as cell surface or secreted proteins. To investigate whether bovine non-classical MHC-I proteins are expressed as cell surface or secreted proteins, and to assess the reactivity pattern of monoclonal antibodies with non-classical MHC-I isoforms, we expressed the MHC proteins in murine P815 and human K562 (MHC-I deficient) cells. Following antibiotic selection, stably transfected cell lines were stained with H1A or W6/32 antibodies to detect expression of the MHC-I proteins by flow cytometry. Two non-classical proteins (BoLA-NC1*00501 and BoLA-NC3*00101) were expressed on the cell surface in both cell lines. Surprisingly, the BoLA-NC4*00201 protein was expressed on the cell membrane of human K562 but not mouse P815 cells. Two non-classical proteins (BoLA-NC1*00401, which lacks a transmembrane domain, and BoLA-NC2*00102) did not exhibit cell surface expression. Nevertheless, Western blot analyses demonstrated expression of the MHC-I heavy chain in all transfected cell lines. Ammonium-sulfate precipitation of proteins from culture supernatants showed that BoLA-NC1*00401 was secreted and that all surface expressed proteins where shed from the cell membrane by the transfected cells. Interestingly, the surface expressed MHC-I proteins were present in culture supernatants at a much higher concentration than BoLA-NC1*00401. This comprehensive study shows that bovine non-classical MHC-I proteins BoLA-NC1*00501, BoLA-NC3*00101, and BoLA-NC4*00201 are expressed as surface isoforms with the latter reaching the cell membrane only in K562 cells. Furthermore, it demonstrated that BoLA-NC1*00401 is a secreted isoform and that significant quantities of membrane associated MHC-I proteins can be shed from the cell membrane. PMID:27473990

  17. Recognition of the Major Histocompatibility Complex (MHC) Class Ib Molecule H2-Q10 by the Natural Killer Cell Receptor Ly49C.

    PubMed

    Sullivan, Lucy C; Berry, Richard; Sosnin, Natasha; Widjaja, Jacqueline M L; Deuss, Felix A; Balaji, Gautham R; LaGruta, Nicole L; Mirams, Michiko; Trapani, Joseph A; Rossjohn, Jamie; Brooks, Andrew G; Andrews, Daniel M

    2016-09-01

    Murine natural killer (NK) cells are regulated by the interaction of Ly49 receptors with major histocompatibility complex class I molecules (MHC-I). Although the ligands for inhibitory Ly49 were considered to be restricted to classical MHC (MHC-Ia), we have shown that the non-classical MHC molecule (MHC-Ib) H2-M3 was a ligand for the inhibitory Ly49A. Here we establish that another MHC-Ib, H2-Q10, is a bona fide ligand for the inhibitory Ly49C receptor. H2-Q10 bound to Ly49C with a marginally lower affinity (∼5 μm) than that observed between Ly49C and MHC-Ia (H-2K(b)/H-2D(d), both ∼1 μm), and this recognition could be prevented by cis interactions with H-2K in situ To understand the molecular details underpinning Ly49·MHC-Ib recognition, we determined the crystal structures of H2-Q10 and Ly49C bound H2-Q10. Unliganded H2-Q10 adopted a classical MHC-I fold and possessed a peptide-binding groove that exhibited features similar to those found in MHC-Ia, explaining the diverse peptide binding repertoire of H2-Q10. Ly49C bound to H2-Q10 underneath the peptide binding platform to a region that encompassed residues from the α1, α2, and α3 domains, as well as the associated β2-microglobulin subunit. This docking mode was conserved with that previously observed for Ly49C·H-2K(b) Indeed, structure-guided mutation of Ly49C indicated that Ly49C·H2-Q10 and Ly49C·H-2K(b) possess similar energetic footprints focused around residues located within the Ly49C β4-stand and L5 loop, which contact the underside of the peptide-binding platform floor. Our data provide a structural basis for Ly49·MHC-Ib recognition and demonstrate that MHC-Ib represent an extended family of ligands for Ly49 molecules. PMID:27385590

  18. Comprehensive Analysis of Contributions from Protein Conformational Stability and Major Histocompatibility Complex Class II-Peptide Binding Affinity to CD4+ Epitope Immunogenicity in HIV-1 Envelope Glycoprotein

    PubMed Central

    Li, Tingfeng; Steede, N. Kalaya; Nguyen, Hong-Nam P.; Freytag, Lucy C.; McLachlan, James B.; Mettu, Ramgopal R.; Robinson, James E.

    2014-01-01

    ABSTRACT Helper T-cell epitope dominance in human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein gp120 is not adequately explained by peptide binding to major histocompatibility complex (MHC) proteins. Antigen processing potentially influences epitope dominance, but few, if any, studies have attempted to reconcile the influences of antigen processing and MHC protein binding for all helper T-cell epitopes of an antigen. Epitopes of gp120 identified in both humans and mice occur on the C-terminal flanks of flexible segments that are likely to be proteolytic cleavage sites. In this study, the influence of gp120 conformation on the dominance pattern in gp120 from HIV strain 89.6 was examined in CBA mice, whose MHC class II protein has one of the most well defined peptide-binding preferences. Only one of six dominant epitopes contained the most conserved element of the I-Ak binding motif, an aspartic acid. Destabilization of the gp120 conformation by deletion of single disulfide bonds preferentially enhanced responses to the cryptic I-Ak motif-containing sequences, as reported by T-cell proliferation or cytokine secretion. Conversely, inclusion of CpG in the adjuvant with gp120 enhanced responses to the dominant CD4+ T-cell epitopes. The gp120 destabilization affected secretion of some cytokines more than others, suggesting that antigen conformation could modulate T-cell functions through mechanisms of antigen processing. IMPORTANCE CD4+ helper T cells play an essential role in protection against HIV and other pathogens. Thus, the sites of helper T-cell recognition, the dominant epitopes, are targets for vaccine design; and the corresponding T cells may provide markers for monitoring infection and immunity. However, T-cell epitopes are difficult to identify and predict. It is also unclear whether CD4+ T cells specific for one epitope are more protective than T cells specific for other epitopes. This work shows that the three-dimensional (3D) structure of an

  19. Modified Vaccinia Virus Ankara-Infected Dendritic Cells Present CD4+ T-Cell Epitopes by Endogenous Major Histocompatibility Complex Class II Presentation Pathways

    PubMed Central

    Thiele, Frank; Tao, Sha; Zhang, Yi; Muschaweckh, Andreas; Zollmann, Tina; Protzer, Ulrike; Abele, Rubert

    2014-01-01

    ABSTRACT CD4+ T lymphocytes play a central role in the immune system and mediate their function after recognition of their respective antigens presented on major histocompatibility complex II (MHCII) molecules on antigen-presenting cells (APCs). Conventionally, phagocytosed antigens are loaded on MHCII for stimulation of CD4+ T cells. Certain epitopes, however, can be processed directly from intracellular antigens and are presented on MHCII (endogenous MHCII presentation). Here we characterized the MHCII antigen presentation pathways that are possibly involved in the immune response upon vaccination with modified vaccinia virus Ankara (MVA), a promising live viral vaccine vector. We established CD4+ T-cell lines specific for MVA-derived epitopes as tools for in vitro analysis of MHCII antigen processing and presentation in MVA-infected APCs. We provide evidence that infected APCs are able to directly transfer endogenous viral proteins into the MHCII pathway to efficiently activate CD4+ T cells. By using knockout mice and chemical inhibitory compounds, we further elucidated the molecular basis, showing that among the various subcellular pathways investigated, proteasomes and autophagy are key players in the endogenous MHCII presentation during MVA infection. Interestingly, although proteasomal processing plays an important role, neither TAP nor LAMP-2 was found to be involved in the peptide transport. Defining the molecular mechanism of MHCII presentation during MVA infection provides a basis for improving MVA-based vaccination strategies by aiming for enhanced CD4+ T-cell activation by directing antigens into the responsible pathways. IMPORTANCE This work contributes significantly to our understanding of the immunogenic properties of pathogens by deciphering antigen processing pathways contributing to efficient activation of antigen-specific CD4+ T cells. We identified autophagosome formation, proteasomal activity, and lysosomal integrity as being crucial for

  20. Genetic diversity and differentiation of the rhesus macaque (Macaca mulatta) population in western Sichuan, China, based on the second exon of the major histocompatibility complex class II DQB (MhcMamu-DQB1) alleles

    PubMed Central

    2014-01-01

    Abstracts Background Rhesus macaques living in western Sichuan, China, have been separated into several isolated populations due to habitat fragmentation. Previous studies based on the neutral or nearly neutral markers (mitochondrial DNA or microsatellites) showed high levels of genetic diversity and moderate genetic differentiation in the Sichuan rhesus macaques. Variation at the major histocompatibility complex (MHC) loci is widely accepted as being maintained by balancing selection, even with a low level of neutral variability in some species. However, in small and isolated or bottlenecked populations, balancing selection may be overwhelmed by genetic drift. To estimate microevolutionary forces acting on the isolated rhesus macaque populations, we examined genetic variation at Mhc-DQB1 loci in 119 wild rhesus macaques from five geographically isolated populations in western Sichuan, China, and compared the levels of MHC variation and differentiation among populations with that previously observed at neutral microsatellite markers. Results 23 Mamu-DQB1 alleles were identified in 119 rhesus macaques in western Sichuan, China. These macaques exhibited relatively high levels of genetic diversity at Mamu-DQB1. The Hanyuan population presented the highest genetic variation, whereas the Heishui population was the lowest. Analysis of molecular variance (AMOVA) and pairwise FST values showed moderate genetic differentiation occurring among the five populations at the Mhc-DQB1 locus. Non-synonymous substitutions occurred at a higher frequency than synonymous substitutions in the peptide binding region. Levels of MHC variation within rhesus macaque populations are concordant with microsatellite variation. On the phylogenetic tree for the rhesus and crab-eating macaques, extensive allele or allelic lineage sharing is observed betweenthe two species. Conclusions Phylogenetic analyses confirm the apparent trans-species model of evolution of the Mhc-DQB1 genes in these

  1. Expression and T cell recognition of hybrid antigens with amino-terminal domains encoded by Qa-2 region of major histocompatibility complex and carboxyl termini of transplantation antigens.

    PubMed

    Stroynowski, I; Forman, J; Goodenow, R S; Schiffer, S G; McMillan, M; Sharrow, S O; Sachs, D H; Hood, L

    1985-05-01

    Coding potential of the Q6 gene from the Qa-2a region of BALB/c Crgl mice was analyzed by a combination of hybrid class I gene construction and DNA-mediated gene transfer. Recombinant genes were created by exon shuffling of the 5' coding region of the Q6 gene and the 3' coding region of a gene encoding a transplantation antigen (Kd, Dd, or Ld), or the inverse. Some of these hybrid class I genes were expressed in the transfected mouse fibroblasts (L cells). The hybrid class I molecules encoded by the 5' end of the Q6 gene and the 3' end of the Ld gene precipitated as 45,000 mol wt molecules associated with beta 2-microglobulin. The expression of the hybrid proteins indicates that 926 basepairs of the 5' flanking region upstream of the structural Q6 gene contain a promoter that functions as a transcription initiation site in L cells. The 3' portion of the Q6 gene appears to be responsible for the lack of cell surface expression of the intact Q6 and the hybrid Ld/Q6 genes in mouse fibroblasts. Accordingly, this portion of the Q6 class I gene may play a regulatory role in tissue-specific expression. Serological analyses of hybrid Q6 proteins suggested that Q6 may be a structural gene for CR (H-2 crossreactive) antigen found normally on subpopulations of lymphocytes. If this identification is correct, Q6 gene will define a new category of class I genes encoding approximately 40,000 mol wt molecules and carrying a characteristic truncated cytoplasmic tail. Analysis of L cells transfected with Q6 hybrid genes demonstrated also that the cytotoxic T cells specific for Qa-2a region-coded antigens recognize the amino-terminal alpha 1-alpha 2 domain of Q6 fusion products. This recognition can be blocked by anti-Qa-2a alloantiserum and monoclonal antibodies reactive with the alpha 3-beta 2-microglobulin portion of the Q6 hybrids. We propose that the structural requirements for the anti-Qa-2a cytotoxic T lymphocyte-specific epitopes on target molecules are the same as for anti

  2. Latent Expression of the Epstein-Barr Virus (EBV)-Encoded Major Histocompatibility Complex Class I TAP Inhibitor, BNLF2a, in EBV-Positive Gastric Carcinomas

    PubMed Central

    Strong, Michael J.; Laskow, Thomas; Nakhoul, Hani; Blanchard, Eugene; Liu, Yaozhong; Wang, Xia; Baddoo, Melody; Lin, Zhen; Yin, Qinyan

    2015-01-01

    The Epstein-Barr virus (EBV) BNLF2a gene product provides immune evasion properties to infected cells through inhibition of transporter associated with antigen processing (TAP)-mediated transport of antigen peptides. Although BNLF2a is considered to be a lytic gene, we demonstrate that it is expressed in nearly half of the EBV-associated gastric carcinomas analyzed. Further, we show that BNLF2a expression is dissociated from lytic gene expression. BNLF2a is therefore expressed in this latency setting, potentially helping protect the infected tumor cells from immunosurveillance. PMID:26178981

  3. The diversity of major histocompatibility complex class II DRB1 gene in sheep breeds from Xinjiang, China.

    PubMed

    Polat, M; Aida, Y; Takeshima, S-N; Aniwashi, J; Halik, M

    2015-01-01

    Exon 2 of the ovine leukocyte antigen OLA-DRB1 locus was examined in sheep from the Xinjiang Karakul Ram and Bashibai populations, and three generations of hybrids were derived from a cross between Bashibai and Altai Argali wild sheep. This identified 12 novel alleles and 30 previously reported alleles. A neighbor-joining tree of the amino acid sequences of these 42 alleles revealed allelic clusters shared across the study populations. There were significant differences in allelic frequency between Karakul Ram and Bashibai sheep. DRB1*K18cC was the most frequent allele in Kararul Ram with a frequency of 21.2%, while DRB1*2F10c8 (13.2%) and DRB1*0803 (13.2%) were the most frequent alleles found in Bashibai sheep; the alleles DRB1*2F16c2, DRB1*1601, and DRB1*0803 occurred most frequently in F1, F2, and F3 populations, with frequencies of 17.6%, 14.3%, and 20%, respectively. Although many alleles were shared by Bashibai and hybrid sheep, some alleles differed between them, especially in the F1 generation of the Bashibai × Altai Argali cross. The hybrid-specific alleles indicated the introgression of Altai Argali alleles into hybrid flocks. A population tree based on the OLA-DRB1 allelic frequency in each population indicated that the Bashibai sheep and three hybrid populations were similar, with Karakul Ram being genetically distinct. PMID:25430475

  4. Editorial: The genetic basis of autoimmune thyroid disease: Time to focus on chromosomal loci other than the major histocompatibility complex (HLA in man)

    SciTech Connect

    McLachlan, S.M. )

    1993-09-01

    Extensive investigations have demonstrated associations between autoimmune thyroid diseases and HLA but the relative risks are low. Family studies provide a powerful method of investigating genetic factors involved in disease. However, recent data suggest that HLA-region genes are unlikely to determine inheritance of autoimmune thyroid disease. 10 refs.

  5. Association of the bovine leukocyte antigen major histocompatibility complex class II DRB3*4401 allele with host resistance to the Lone Star Tick, Amblyomma americanum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The MHC of cattle, known as the bovine leukocyte antigen (BoLA) complex, plays an integral role in disease and parasite susceptibility, and immune responsiveness of the host. While susceptibility to tick infestation in cattle is believed to be heritable, genes that may be responsible for the manife...

  6. H2-M3 Major Histocompatibility Complex Class Ib-Restricted CD8 T Cells Induced by Salmonella enterica Serovar Typhimurium Infection Recognize Proteins Released by Salmonella Serovar Typhimurium

    PubMed Central

    Ugrinovic, S.; Brooks, C. G.; Robson, J.; Blacklaws, B. A.; Hormaeche, C. E.; Robinson, J. H.

    2005-01-01

    Salmonella enterica serovar Typhimurium causes a typhoid-like disease in mice which has been studied extensively as a model for typhoid fever in humans. CD8 T cells contribute to protection against S. enterica serovar Typhimurium in mice, but little is known about the specificity and major histocompatibility complex (MHC) restriction of the response. We report here that CD8 T-cell lines derived from S. enterica serovar Typhimurium-infected BALB/c mice lysed bone marrow macrophages infected with S. enterica serovar Typhimurium or pulsed with proteins from S. enterica serovar Typhimurium culture supernatants. Cytoxicity was beta-2-microglobulin dependent and largely TAP dependent, although not MHC class Ia restricted, as target cells of several different MHC haplotypes were lysed. The data suggested the participation of class Ib MHC molecules although no evidence for the presence of Qa1-restricted T cells could be found, unlike in previous reports. Instead, the T-cell lines lysed H2-M3-transfected fibroblasts infected with S. enterica serovar Typhimurium SL3261 or treated with Salmonella culture supernatants. Thus, this report increases the number of MHC class Ib antigen-presenting molecules known for Salmonella antigens to three: Qa-1, HLA-E, and now H2-M3. It also expands the range of pathogens that induce H2-M3-restricted CD8 T cells to include an example of gram-negative bacteria. PMID:16299293

  7. In vitro analysis of a primary, major histocompatibility complex (MHC)-restricted, cytotoxic T-lymphocyte response to avian leukosis virus (ALV), using target cells expressing MHC class I cDNA inserted into a recombinant ALV vector.

    PubMed

    Thacker, E L; Fulton, J E; Hunt, H D

    1995-10-01

    The interaction between the major histocompatibility complex (MHC) and cytotoxic T lymphocytes (CTLs) is an important component of the host's resistance to viral infections and tumor formation. In this study, an avian leukosis virus (ALV) vector system, RCASBP, expressing MHC chicken class I (B-F) cDNA was used to develop target cells expressing the chicken class I glycoproteins complexed with ALV antigens on the cell surface. Peripheral blood from chickens inoculated with ALV was shown to contain antigen-specific, MHC-restricted, CD8+ effector CTLs, using a 51Cr release assay utilizing the RCASBP B-F target cells. The stimulated effector cells were also predominantly alpha beta T-cell receptor-positive (TCR2) T cells. The CTL response varied between two haplotypes of chickens which differed in their response to Rous sarcoma virus (RSV)-induced tumors. Chickens with the B21 haplotype which regress RSV-induced tumors showed maximal cytolytic activity, while chickens with the B13 haplotype which do not regress RSV-induced tumors had minimal to no cytolytic activity. In addition to assessing the CTL response to ALV, the creation of MHC-specific immortal target cell lines will be extremely useful in evaluating CTL responses to other viral disease in chickens. PMID:7666545

  8. Highly Pathogenic Simian Immunodeficiency Virus mne Variants That Emerge during the Course of Infection Evolve Enhanced Infectivity and the Ability To Downregulate CD4 but Not Class I Major Histocompatibility Complex Antigens

    PubMed Central

    Patel, Parul G.; Yu Kimata, Monica T.; Biggins, Julia E.; Wilson, Joelle M.; Kimata, Jason T.

    2002-01-01

    The replicative, cytopathic, and antigenic properties of simian immunodeficiency virus (SIV) variants influence its replication efficiency in vivo. To further define the viral properties and determinants that may be important for high-level replication in vivo and progression to AIDS, we compared a minimally pathogenic SIVmne molecular clone with two highly pathogenic variants cloned from late stages of infection. Both variants had evolved greater infectivity than the parental clone due to mutations in nef. Interestingly, a pol determinant in one of the highly pathogenic variants also contributed to its increased infectivity. Furthermore, because replication in vivo may also be influenced by the ability of a virus to evade the cellular immune response of the host, we examined whether the variants were more capable of downregulating surface expression of class I major histocompatibility complex (MHC). Decreased MHC class I expression was not observed in cells infected with any of the viruses. Furthermore, the Nef proteins of the highly pathogenic variants only slightly reduced surface MHC class I expression in transfected cells, although they efficiently downregulated CD4. Together, these data demonstrate that mutations which can enhance viral infectivity, as well as CD4 downregulation, may be important for efficient replication of SIV in the host. However, Nef-mediated reduction of MHC class I expression does not appear to be critical for the increased in vivo replicative ability of highly pathogenic late variants. PMID:12050354

  9. Impact of Viral Dose and Major Histocompatibility Complex Class IB Haplotype on Viral Outcome in Mauritian Cynomolgus Monkeys Vaccinated with Tat upon Challenge with Simian/Human Immunodeficiency Virus SHIV89.6P ▿ †

    PubMed Central

    Cafaro, Aurelio; Bellino, Stefania; Titti, Fausto; Maggiorella, Maria Teresa; Sernicola, Leonardo; Wiseman, Roger W.; Venzon, David; Karl, Julie A.; O'Connor, David; Monini, Paolo; Robert-Guroff, Marjorie; Ensoli, Barbara

    2010-01-01

    The effects of the challenge dose and major histocompatibility complex (MHC) class IB alleles were analyzed in 112 Mauritian cynomolgus monkeys vaccinated (n = 67) or not vaccinated (n = 45) with Tat and challenged with simian/human immunodeficiency virus (SHIV) 89.6Pcy243. In the controls, the challenge dose (10 to 20 50% monkey infectious doses [MID50]) or MHC did not affect susceptibility to infection, peak viral load, or acute CD4 T-cell loss, whereas in the chronic phase of infection, the H1 haplotype correlated with a high viral load (P = 0.0280) and CD4 loss (P = 0.0343). Vaccination reduced the rate of infection acquisition at 10 MID50 (P < 0.0001), and contained acute CD4 loss at 15 MID50 (P = 0.0099). Haplotypes H2 and H6 were correlated with increased susceptibility (P = 0.0199) and resistance (P = 0.0087) to infection, respectively. Vaccination also contained CD4 depletion (P = 0.0391) during chronic infection, independently of the challenge dose or haplotype. PMID:20554774

  10. Relative abilities of distinct isotypes of human major histocompatibility complex class II molecules to bind streptococcal pyrogenic exotoxin types A and B.

    PubMed Central

    Imanishi, K; Igarashi, H; Uchiyama, T

    1992-01-01

    The relative ability of distinct isotypes of human leukocyte antigen class II molecules to bind streptococcal pyrogenic exotoxins A and B (SPE A and SPE B, respectively) was investigated by a direct-binding assay with 125I-labeled toxin for SPE A and by a functional assay system measuring the accessory cell activity of human leukocyte antigen class II transfectants in toxin-induced T-cell activation for SPE A and SPE B. SPE A binding was observed in L cells transfected with DQw1 genes. By contrast, it was not detected in L cells transfected with DR2, DR4, DPw4 or DP(Cp63) genes. All the transfectants supported SPE-induced interleukin-2 production by human T cells except the DP transfectants for SPE B. Levels of accessory cell activity were low in the DP transfectants induced by stimulation with SPE A and in the DR and DP transfectants induced by SPE B. The results indicate that SPE A and SPE B bind well to DQ molecules, less well to DR molecules, and very weakly to DP molecules. PMID:1452333

  11. Expression of major histocompatibility complex class I and class II antigens in human Schwann cell cultures and effects of infection with Mycobacterium leprae.

    PubMed

    Samuel, N M; Mirsky, R; Grange, J M; Jessen, K R

    1987-06-01

    Recent experiments on rats have raised the possibility that Schwann cells can present antigens to T lymphocytes. We have investigated whether this mechanism might be relevant in leprosy by determining under what conditions human Schwann cells express class I and class II antigens, and whether infection with Mycobacterium leprae affects this expression. The distribution of these antigens was examined on human Schwann cells in dissociated cell cultures derived from human fetal peripheral nerves. We find that both Schwann cells and fibroblastic cells in these cultures normally express class I antigens but not class II antigens. When Schwann cells are infected with live Mycobacterium leprae for 48 h, 73% of Schwann cells phagocytose the bacteria. Mycobacterium leprae prevents 3H-thymidine incorporation into cultured human Schwann cells, but does not affect class I expression in these cells. Treatment of normal and Mycobacterium leprae infected cultures with gamma-interferon for 72 h induces class II expression on most Schwann cells but not on the majority of fibroblastic cells. The fact that human Schwann cells infected with Mycobacterium leprae can be induced by gamma-interferon to express class II antigens suggests that they may be able to present Mycobacterium leprae antigens to T lymphocytes and thus initiate immune responses against the bacteria. We suggest that a failure of this response, such as that seen within nerve trunks in lepromatous leprosy, is caused by deficient class II expression on Schwann cells. This deficiency in class II expression, in turn, may be caused by the reduced gamma-interferon production characteristic of lepromatous leprosy. PMID:3115648

  12. Imaging genetics studies on monoaminergic genes in major depressive disorder.

    PubMed

    Won, Eunsoo; Ham, Byung-Joo

    2016-01-01

    Although depression is the leading cause of disability worldwide, current understanding of the neurobiology of depression has failed to be translated into clinical practice. Major depressive disorder (MDD) pathogenesis is considered to be significantly influenced by multiple risk genes, however genetic effects are not simply expressed at a behavioral level. Therefore the concept of endophenotype has been applied in psychiatric genetics. Imaging genetics applies anatomical or functional imaging technologies as phenotypic assays to evaluate genetic variation and their impact on behavior. This paper attempts to provide a comprehensive review of available imaging genetics studies, including reports on genetic variants that have most frequently been linked to MDD, such as the monoaminergic genes (serotonin transporter gene, monoamine oxidase A gene, tryptophan hydroxylase-2 gene, serotonin receptor 1A gene and catechol-O-methyl transferase gene), with regard to key structures involved in emotion processing, such as the hippocampus, amygdala, anterior cingulate cortex and orbitofrontal cortex. PMID:25828849

  13. Expression, purification and preliminary X-ray crystallographic analysis of the human major histocompatibility antigen HLA-B*1402 in complex with a viral peptide and with a self-peptide

    SciTech Connect

    Kumar, Pravin; Vahedi-Faridi, Ardeschir; Volz, Armin; Ziegler, Andreas; Saenger, Wolfram

    2007-07-01

    The crystallization of HLA-B*1402 in complex with two peptides is reported. The product of the human major histocompatibility (HLA) class I allele HLA-B*1402 only differs from that of allele HLA-B*1403 at amino-acid position 156 of the heavy chain (Leu in HLA-B*1402 and Arg in HLA-B*1403). However, both subtypes are known to be differentially associated with the inflammatory rheumatic disease ankylosing spondylitis (AS) in black populations in Cameroon and Togo. HLA-B*1402 is not associated with AS, in contrast to HLA-B*1403, which is associated with this disease in the Togolese population. The products of these alleles can present peptides with Arg at position 2, a feature shared by a small group of other HLA-B antigens, including HLA-B*2705, the prototypical AS-associated subtype. Complexes of HLA-B*1402 with a viral peptide (RRRWRRLTV, termed pLMP2) and a self-peptide (IRAAPPPLF, termed pCatA) were prepared and were crystallized using polyethylene glycol as precipitant. The complexes crystallized in space groups P2{sub 1} (pLMP2) and P2{sub 1}2{sub 1}2{sub 1} (pCatA) and diffracted synchrotron radiation to 2.55 and 1.86 Å resolution, respectively. Unambiguous solutions for both data sets were obtained by molecular replacement using a peptide-complexed HLA-B*2705 molecule (PDB code) as a search model.

  14. The role of charge and multiple faces of the CD8 alpha/alpha homodimer in binding to major histocompatibility complex class I molecules: support for a bivalent model.

    PubMed Central

    Giblin, P A; Leahy, D J; Mennone, J; Kavathas, P B

    1994-01-01

    The CD8 dimer interacts with the alpha 3 domain of major histocompatibility complex class I molecules through two immunoglobulin variable-like domains. In this study a crystal structure-informed mutational analysis has been performed to identify amino acids in the CD8 alpha/alpha homodimer that are likely to be involved in binding to class I. Several key residues are situated on the top face of the dimer within loops analogous to the complementarity-determining regions (CDRs) of immunoglobulin. In addition, other important amino acids are located in the A and B beta-strands on the sides of the dimer. The potential involvement of amino acids on both the top and the side faces of the molecule is consistent with a bivalent model for the interaction between a single CD8 alpha/alpha homodimer and two class I molecules and may have important implications for signal transduction in class I-expressing cells. This study also demonstrates a role for the positive surface potential of CD8 in class I binding and complements previous work demonstrating the importance of a negatively charged loop on the alpha 3 domain of class I for CD8 alpha/alpha-class I interaction. We propose a model whereby residues located on the CDR-like loops of the CD8 homodimer interact with the alpha 3 domain of MHC class I while amino acids on the side of the molecule containing the A and B beta-strands contact the alpha 2 domain of class I. Images PMID:8127870

  15. Escape in One of Two Cytotoxic T-Lymphocyte Epitopes Bound by a High-Frequency Major Histocompatibility Complex Class I Molecule, Mamu-A*02: a Paradigm for Virus Evolution and Persistence?

    PubMed Central

    Vogel, Thorsten U.; Friedrich, Thomas C.; O'Connor, David H.; Rehrauer, William; Dodds, Elizabeth J.; Hickman, Heather; Hildebrand, William; Sidney, John; Sette, Alessandro; Hughes, Austin; Horton, Helen; Vielhuber, Kathy; Rudersdorf, Richard; de Souza, Ivna P.; Reynolds, Matthew R.; Allen, Todd M.; Wilson, Nancy; Watkins, David I.

    2002-01-01

    It is now accepted that an effective vaccine against AIDS must include effective cytotoxic-T-lymphocyte (CTL) responses. The simian immunodeficiency virus (SIV)-infected rhesus macaque is the best available animal model for AIDS, but analysis of macaque CTL responses has hitherto focused mainly on epitopes bound by a single major histocompatibility complex (MHC) class I molecule, Mamu-A*01. The availability of Mamu-A*01-positive macaques for vaccine studies is therefore severely limited. Furthermore, it is becoming clear that different CTL responses are able to control immunodeficiency virus replication with varying success, making it a priority to identify and analyze CTL responses restricted by common MHC class I molecules other than Mamu-A*01. Here we describe two novel epitopes derived from SIV, one from Gag (Gag71-79 GY9), and one from the Nef protein (Nef159-167 YY9). Both epitopes are bound by the common macaque MHC class I molecule, Mamu-A*02. The sequences of these two eptiopes are consistent with the molecule's peptide-binding motif, which we have defined by elution of natural ligands from Mamu-A*02. Strikingly, we found evidence for the selection of escape variant viruses by CTL specific for Nef159-167 YY9 in 6 of 6 Mamu-A*02-positive animals. In contrast, viral sequences encoding the Gag71-79 GY9 epitope remained intact in each animal. This situation is reminiscent of Mamu-A*01-restricted CTL that recognize Tat28-35 SL8, which reproducibly selects for escape variants during acute infection, and Gag181-189 CM9, which does not. Differential selection by CTL may therefore be a paradigm of immunodeficiency virus infection. PMID:12388723

  16. Pathways of major histocompatibility complex allorecognition

    PubMed Central

    Afzali, Behdad; Lombardi, Giovanna; Lechler, Robert I.

    2013-01-01

    Purpose of review Here, we review the pathways of allorecognition and their potential relevance to the balance between regulatory and effector responses following transplantation. Recent findings Transplantation between nonidentical members of the same species elicits an immune response that manifests as graft rejection or persistence. Presentation of foreign antigen to recipient T cells can occur via three nonmutually exclusive routes, the direct, indirect and semi-direct pathways. Allospecific T cells can have effector or regulatory functions, and the relative proportions of the two populations activated following alloantigen presentation are two of the factors that determine the clinical outcome. Regulatory T cells have been the subject of significant research, and there is now greater understanding of their recruitment and function in the context of allorecognition. Summary A greater understanding of the mechanisms underlying allorecognition may be fundamental to appreciating how these different populations are recruited and could in turn inform novel strategies for immunomodulation. PMID:18685342

  17. Age-related macular degeneration: Evidence of a major gene

    SciTech Connect

    Bhatt, S.; Warren, C.; Yang, H.

    1994-09-01

    Age-related macular degeneration is a major cause of blindness in developing countries. It remains a very poorly understood disorder. Although environmental and genetic factors have been implicated in its pathogenesis, none have been firmly implicated. The purpose of this study was to use pedigree analysis to evaluate the possible role of a major gene as a determinant of familial aggregation. Information was collected regarding occupation, smoking, sun exposure, associated medical problems and family history. 50 probands with age-related macular degeneration (ARMD) and 39 age, race and sex-matched controls were included in the study. In the ARMD group 15/50 (30%) of probands reported a positive family history; 22 out of 222 first degree relatives over age 60 were reported to be affected. In the control groups, none of the 138 first degree relatives over age 50 had a history of ARMD. This difference is statistically significant (p = 0.0003), indicating that genetic factors may play an important role in the pathogenesis of ARMD. In the ARMD group more siblings as compared to parents (16/127 vs. 5/82) were affected. 5/50 (10%) of the ARMD probands also gave a history of a second degree relative affected with ARMD, compared to none known among the relatives of controls. Data from 50 pedigrees were analyzed by complex segregation analysis under a class A regressive logistic model using the REGD program implemented in the SAGE package. Preliminary results allow rejection of a polygenic model and suggest there is a major gene for ARMD in these families. The inheritance model most compatible with the observed familial aggregation is autosomal recessive. In conclusion, these results are suggestive of a major gene effect in the etiology of ARMD. Identification of a major gene effect is a first step to further pursue linkage analysis and to search for the gene(s) involved in the causation of ARMD.

  18. Multipotent adult germ-line stem cells, like other pluripotent stem cells, can be killed by cytotoxic T lymphocytes despite low expression of major histocompatibility complex class I molecules

    PubMed Central

    Dressel, Ralf; Guan, Kaomei; Nolte, Jessica; Elsner, Leslie; Monecke, Sebastian; Nayernia, Karim; Hasenfuss, Gerd; Engel, Wolfgang

    2009-01-01

    Background Multipotent adult germ-line stem cells (maGSCs) represent a new pluripotent cell type that can be derived without genetic manipulation from spermatogonial stem cells (SSCs) present in adult testis. Similarly to induced pluripotent stem cells (iPSCs), they could provide a source of cellular grafts for new transplantation therapies of a broad variety of diseases. To test whether these stem cells can be rejected by the recipients, we have analyzed whether maGSCs and iPSCs can become targets for cytotoxic T lymphocytes (CTL) or whether they are protected, as previously proposed for embryonic stem cells (ESCs). Results We have observed that maGSCs can be maintained in prolonged culture with or without leukemia inhibitory factor and/or feeder cells and still retain the capacity to form teratomas in immunodeficient recipients. They were, however, rejected in immunocompetent allogeneic recipients, and the immune response controlled teratoma growth. We analyzed the susceptibility of three maGSC lines to CTL in comparison to ESCs, iPSCs, and F9 teratocarcinoma cells. Major histocompatibility complex (MHC) class I molecules were not detectable by flow cytometry on these stem cell lines, apart from low levels on one maGSC line (maGSC Stra8 SSC5). However, using a quantitative real time PCR analysis H2K and B2m transcripts were detected in all pluripotent stem cell lines. All pluripotent stem cell lines were killed in a peptide-dependent manner by activated CTLs derived from T cell receptor transgenic OT-I mice after pulsing of the targets with the SIINFEKL peptide. Conclusion Pluripotent stem cells, including maGSCs, ESCs, and iPSCs can become targets for CTLs, even if the expression level of MHC class I molecules is below the detection limit of flow cytometry. Thus they are not protected against CTL-mediated cytotoxicity. Therefore, pluripotent cells might be rejected after transplantation by this mechanism if specific antigens are presented and if specific

  19. Detection of major gene for Gilles de la Tourette syndrome.

    PubMed Central

    Comings, D E; Comings, B G; Devor, E J; Cloninger, C R

    1984-01-01

    The families of 250 consecutive, unselected patients with Tourette syndrome (TS) were analyzed. If the parents had either motor or vocal tics, but not both, there was an increased risk of both TS and tics in the offspring. The mode of inheritance of the combined tic-Tourette trait was evaluated in both nuclear families and extended pedigrees. Complex segregation analysis was carried out allowing for possible contributions from both a major autosomal locus and multifactorial inheritance of variation in the background of each genotype. The most likely mode of inheritance was a major semidominant gene, Ts, with low heritability of the multifactorial background variation. This was true regardless of assumptions about the prevalence of the disorder. The hypothesis of strict multifactorial inheritance could not be rejected with nuclear family data alone. However, the hypothesis of no major gene effect was rejected using data on 3 generations for any estimate of lifetime risk less than 12 per 1,000 in the general population. A pure recessive major gene effect was also rejected. With a gene frequency of approximately .5%, the penetrance was estimated to be about 94% in abnormal Ts/Ts homozygotes, 50% in Ts/ts heterozygotes, and less than 0.3% in normal ts/ts homozygotes. More than two of every three cases are heterozygotes, and nearly all other cases are phenocopies or new mutations. This is the first demonstration by segregation analysis of a major gene in a human neuropsychiatric disorder with a frequency approaching 1% of the population. PMID:6587774

  20. Comparative and evolutionary analysis of major peanut allergen gene families.

    PubMed

    Ratnaparkhe, Milind B; Lee, Tae-Ho; Tan, Xu; Wang, Xiyin; Li, Jingping; Kim, Changsoo; Rainville, Lisa K; Lemke, Cornelia; Compton, Rosana O; Robertson, Jon; Gallo, Maria; Bertioli, David J; Paterson, Andrew H

    2014-09-01

    Peanut (Arachis hypogaea L.) causes one of the most serious food allergies. Peanut seed proteins, Arah1, Arah2, and Arah3, are considered to be among the most important peanut allergens. To gain insights into genome organization and evolution of allergen-encoding genes, approximately 617 kb from the genome of cultivated peanut and 215 kb from a wild relative were sequenced including three Arah1, one Arah2, eight Arah3, and two Arah6 gene family members. To assign polarity to differences between homoeologous regions in peanut, we used as outgroups the single orthologous regions in Medicago, Lotus, common bean, chickpea, and pigeonpea, which diverged from peanut about 50 Ma and have not undergone subsequent polyploidy. These regions were also compared with orthologs in many additional dicot plant species to help clarify the timing of evolutionary events. The lack of conservation of allergenic epitopes between species, and the fact that many different proteins can be allergenic, makes the identification of allergens across species by comparative studies difficult. The peanut allergen genes are interspersed with low-copy genes and transposable elements. Phylogenetic analyses revealed lineage-specific expansion and loss of low-copy genes between species and homoeologs. Arah1 syntenic regions are conserved in soybean, pigeonpea, tomato, grape, Lotus, and Arabidopsis, whereas Arah3 syntenic regions show genome rearrangements. We infer that tandem and segmental duplications led to the establishment of the Arah3 gene family. Our analysis indicates differences in conserved motifs in allergen proteins and in the promoter regions of the allergen-encoding genes. Phylogenetic analysis and genomic organization studies provide new insights into the evolution of the major peanut allergen-encoding genes. PMID:25193311

  1. Comparative and Evolutionary Analysis of Major Peanut Allergen Gene Families

    PubMed Central

    Ratnaparkhe, Milind B.; Lee, Tae-Ho; Tan, Xu; Wang, Xiyin; Li, Jingping; Kim, Changsoo; Rainville, Lisa K.; Lemke, Cornelia; Compton, Rosana O.; Robertson, Jon; Gallo, Maria; Bertioli, David J.; Paterson, Andrew H.

    2014-01-01

    Peanut (Arachis hypogaea L.) causes one of the most serious food allergies. Peanut seed proteins, Arah1, Arah2, and Arah3, are considered to be among the most important peanut allergens. To gain insights into genome organization and evolution of allergen-encoding genes, approximately 617 kb from the genome of cultivated peanut and 215 kb from a wild relative were sequenced including three Arah1, one Arah2, eight Arah3, and two Arah6 gene family members. To assign polarity to differences between homoeologous regions in peanut, we used as outgroups the single orthologous regions in Medicago, Lotus, common bean, chickpea, and pigeonpea, which diverged from peanut about 50 Ma and have not undergone subsequent polyploidy. These regions were also compared with orthologs in many additional dicot plant species to help clarify the timing of evolutionary events. The lack of conservation of allergenic epitopes between species, and the fact that many different proteins can be allergenic, makes the identification of allergens across species by comparative studies difficult. The peanut allergen genes are interspersed with low-copy genes and transposable elements. Phylogenetic analyses revealed lineage-specific expansion and loss of low-copy genes between species and homoeologs. Arah1 syntenic regions are conserved in soybean, pigeonpea, tomato, grape, Lotus, and Arabidopsis, whereas Arah3 syntenic regions show genome rearrangements. We infer that tandem and segmental duplications led to the establishment of the Arah3 gene family. Our analysis indicates differences in conserved motifs in allergen proteins and in the promoter regions of the allergen-encoding genes. Phylogenetic analysis and genomic organization studies provide new insights into the evolution of the major peanut allergen-encoding genes. PMID:25193311

  2. Major intrinsic proteins (MIPs) in plants: a complex gene family with major impacts on plant phenotype.

    PubMed

    Forrest, Kerrie L; Bhave, Mrinal

    2007-10-01

    The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry. PMID:17562090

  3. Major gene is responsible for anencephaly among Iranian Jews

    SciTech Connect

    Zlotogora, J.

    1995-03-13

    Anencephaly is relatively frequent in Jews originating from Iran, in particular when its incidence is compared to that of open spina bifida in the same population (12 cases of anencephaly out of 14 cases of neural tube defects). The high incidence of this disorder in Iranian Jews, a relatively isolated community with a very high rate of consanguinity, suggests that anencephaly is caused by a major recessive gene. This possibility is supported by the sex ratio among these patients, which was significantly different from that observed for patients with anencephaly in other populations. 10 refs.

  4. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    PubMed Central

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  5. Estimating the probability for major gene Alzheimer disease

    SciTech Connect

    Farrer, L.A. Boston Univ. School of Public Health, Boston, MA ); Cupples, L.A. )

    1994-02-01

    Alzheimer disease (AD) is a neuropsychiatric illness caused by multiple etiologies. Prediction of whether AD is genetically based in a given family is problematic because of censoring bias among unaffected relatives as a consequence of the late onset of the disorder, diagnostic uncertainties, heterogeneity, and limited information in a single family. The authors have developed a method based on Bayesian probability to compute values for a continuous variable that ranks AD families as having a major gene form of AD (MGAD). In addition, they have compared the Bayesian method with a maximum-likelihood approach. These methods incorporate sex- and age-adjusted risk estimates and allow for phenocopies and familial clustering of age on onset. Agreement is high between the two approaches for ranking families as MGAD (Spearman rank [r] = .92). When either method is used, the numerical outcomes are sensitive to assumptions of the gene frequency and cumulative incidence of the disease in the population. Consequently, risk estimates should be used cautiously for counseling purposes; however, there are numerous valid applications of these procedures in genetic and epidemiological studies. 41 refs., 4 figs., 3 tabs.

  6. UPDATE ON SLA GENES AND THEIR IMPACT ON IMMUNE AND DISEASE INTERACTIONS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The swine major histocompatibility complex (MHC) or swine leukocyte antigen (SLA) complex is one of the most gene-dense regions in the swine genome. It consists of three major gene clusters, the SLA class I, class III and class II regions, that span ~1.1, 0.7 and 0.5 Mb, respectively, making the swi...

  7. Identification of major blast resistance genes in the southern US

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) genes in rice play important roles in preventing infections of rice blast fungus, Magnaporthe oryzae. In order to identify more R genes for different rice growing areas in the Southern US, an extensive field survey of the blast fungus was performed from 2012 to 2013. A total of 500 is...

  8. Associations of Markers Linked to Major Histocompatibility (MH) Regions and to Other Immune Response Genes with Disease Resistance in Rainbow Trout

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two disease trials with two gram negative bacterial pathogens were conducted. The 2004 NCCCWA brood year (98 full-sib families) were challenged with Yersinia ruckeri, the causative agent of enteric red mouth disease, and the 2005 brood year (75 full-sib families) were challenged with Flavobacterium ...

  9. TOWARD POSITIONAL CLONING OF A MAJOR GLANDLESS GENE IN COTTON

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton(Gossypium spp.)is not only the leading natural fiber crop, but also an excellent source of oil and protein that are stored in its seed. Cotton breeders have an opportunity to exploit and manipulate many thousands of genes in this important field crop. We report some of our work that is relate...

  10. Complete amino acid sequence of human plasma Zn-. cap alpha. /sub 2/-glycoprotein and its homology to histocompatibility antigens

    SciTech Connect

    Araki, T.; Gejyo, F.; Takagaki, K.; Haupt, H.; Schwick, H.G.; Buergi, W.; Marti, T.; Schaller, J.; Rickli, E.; Brossmer, R.

    1988-02-01

    In the present study the complete amino acid sequence of human plasma Zn-..cap alpha../sub 2/-glycoprotein was determined. This protein whose biological function is unknown consists of a single polypeptide chain of 276 amino acid residues including 8 tryptophan residues and has a pyroglutamyl residue at the amino terminus. The location of the two disulfide bonds in the polypeptide chain was also established. The three glycans, whose structure was elucidated with the aid of 500 MHz /sup 1/H NMR spectroscopy, were sialylated N-biantennas. The molecular weight calculated from the polypeptide and carbohydrate structure is 38,478, which is close to the reported value of approx. = 41,000 based on physicochemical measurements. The predicted secondary structure appeared to comprised of 23% ..cap alpha..-helix, 27% ..beta..-sheet, and 22% ..beta..-turns. The three N-glycans were found to be located in ..beta..-turn regions. An unexpected finding was made by computer analysis of the sequence data; this revealed that Zn-..cap alpha../sub 2/-glycoprotein is closely related to antigens of the major histocompatibility complex in amino acid sequence and in domain structure. There was an unusually high degree of sequence homology with the ..cap alpha.. chains of class I histocompatibility antigens. Moreover, this plasma protein was shown to be a member of the immunoglobulin gene superfamily. Zn-..cap alpha../sub 2/-glycoprotein appears to be truncated secretory major histocompatibility complex-related molecule, and it may have a role in the expression of the immune response.

  11. Construction of a High-Resolution 2.5-Mb Transcript Map of the Human 6p21.2–6p21.3 Region Immediately Centromeric of the Major Histocompatibility Complex

    PubMed Central

    Tripodis, Nicos; Palmer, Sophie; Phillips, Sam; Milne, Sarah; Beck, Stephan; Ragoussis, Jiannis

    2000-01-01

    We have constructed a 2.5-Mb physical and transcription map that spans the human 6p21.2–6p21.3 region and includes the centromeric end of the MHC, using a combination of techniques. In total 88 transcription units including exons, cDNAs, and cDNA contigs were characterized and 60 were confidently positioned on the physical map. These include a number of genes encoding nuclear and splicing factors (Ndr kinase, HSU09564, HSRP20); cell cycle, DNA packaging, and apoptosis related [p21, HMGI(Y), BAK]; immune response (CSBP, SAPK4); transcription activators and zinc finger-containing genes (TEF-5, ZNF76); embryogenesis related (Csa-19); cell signaling (DIPP); structural (HSET), and other genes (TULP1, HSPRARD, DEF-6, EO6811, cyclophilin), as well as a number of RP genes and pseudogenes (RPS10, RPS12-like, RPL12-like, RPL35-like). Furthermore, several novel genes (a Br140-like, a G2S-like, a FBN2-like, a ZNF-like, and B1/KIAA0229) have been identified, as well as cDNAs and cDNA contigs. The detailed map of the gene content of this chromosomal segment provides a number of candidate genes, which may be involved in several biological processes that have been associated with this region, such as spermatogenesis, development, embryogenesis, and neoplasia. The data provide useful tools for synteny studies between mice and humans, for genome structure analysis, gene density comparisons, and studies of nucleotide composition, of different isochores and Giemsa light and Giemsa dark bands. PMID:10779486

  12. Requirement of gene VII in cis for the expression of downstream genes on the major transcript of figwort mosaic virus.

    PubMed

    Gowda, S; Scholthof, H B; Wu, F C; Shepherd, R J

    1991-12-01

    The six major conserved genes of figwort mosaic virus (FMV), a caulimovirus, appear in tandem array on an RNA transcript that spans the entire viral genome. Gene VI, the only cistron that appears as a separate subgenomic RNA, has been reported to transactivate the expression of downstream genes of the full-length transcript. This transcript has a long 5'-leader of about 600 nucleotides followed by a small nonconserved region (gene VII), a smaller intergenic region (57 nucleotides), and the major conserved genes in a closely spaced array. In our present experiments we have constructed expression units containing the promoter for the full-length transcript followed by the 5' leader region, gene VII, and a reporter gene. These have been tested for expression with and without gene VI as a separate plasmid by electroporation into plant protoplasts. A series of these expression units containing truncated versions of the 5' leader region placed upstream of a reporter gene (CAT) showed that gene VI transactivation occurred only when gene VII sequences were present in cis between the leader region and the reporter gene. In addition, a more complete version of the FMV genome containing the reporter gene further downstream (in viral gene IV) showed CAT expression only when gene VII sequences were present in an upstream position. A similar construct failed to express CAT activity when gene VII was absent. PMID:1962457

  13. Do Major Roads Reduce Gene Flow in Urban Bird Populations?

    PubMed Central

    Zhang, Shuping; Suo, Mingli; Liu, Shenglin; Liang, Wei

    2013-01-01

    Background Although the negative effects of roads on the genetics of animal populations have been extensively reported, the question of whether roads reduce gene flow in volant, urban bird populations has so far not been addressed. In this study, we assess whether highways decreased gene flow and genetic variation in a small passerine bird, the tree sparrow (Passer montanus). Methodology We assessed genetic differences among tree sparrows (Passer montanus) sampled at 19 sites within Beijing Municipality, China, using 7 DNA microsatellites as genetic markers. Results AMOVA showed that genetic variation between sites, between urban and rural populations, and between opposite sides of the same highway, were very weak. Mantel tests on all samples, and on urban samples only, indicated that the age and number of highways, and the number of ordinary roads, were uncorrelated with genetic differences (FST) among tree sparrows from different urban sites. Birds sampled at urban sites had similar levels of genetic diversity to those at rural sites. There was, however, evidence of some weak genetic structure between urban sites. Firstly, there were significant genetic differences (FST) between birds from opposite sides of the same highway, but no significant FST values between those from sites that were not separated by highways. Secondly, birds from eleven urban sites had loci that significantly deviated from the Hardy–Weinberg equilibrium but no such deviation was found in birds from rural sites. Conclusion We cannot, therefore, conclusively reject the hypothesis that highways have no effect on the gene flow of tree sparrow populations. Furthermore, since the significance of these results may increase with time, we suggested that research on the influence of highways on gene flow in urban bird populations needs to be conducted over several decades. PMID:24204724

  14. An indication of major genes affecting hip and elbow dysplasia in four Finnish dog populations.

    PubMed

    Mäki, K; Janss, L L G; Groen, A F; Liinamo, A-E; Ojala, M

    2004-05-01

    The aim of the study was to assess the possible existence of major genes influencing hip and elbow dysplasia in four dog populations. A Bayesian segregation analysis was performed separately on each population. In total, 34 140 dogs were included in the data set. Data were analysed with both a polygenic and a mixed inheritance model. Polygenic models included fixed and random environmental effects and additive genetic effects. To apply mixed inheritance models, the effect of a major gene was added to the polygenic models. The major gene was modelled as an autosomal biallelic locus with Mendelian transmission probabilities. Gibbs sampling and a Monte Carlo Markov Chain algorithm were used. The goodness-of-fit of the different models were compared using the residual sum-of-squares. The existence of a major gene was considered likely for hip dysplasia in all the breeds and for elbow dysplasia in one breed. Several procedures were followed to exclude the possible false detection of major genes based on non-normality of data: permuted datasets were analysed, data-transformations were applied, and residuals were judged for normality. Allelic effects at the major gene locus showed nearly to complete dominance, with a recessive, unfavourable allele in both traits. Relatively high estimates of the frequencies of unfavourable alleles in each breed suggest that considerable genetic progress would be possible by selection against major genes. However, the major genes that are possibly affecting hip and elbow dysplasia in these populations will require further study. PMID:14997179

  15. Adaptive major histocompatibility complex (MHC) and neutral genetic variation in two native Baltic Sea fishes (perch Perca fluviatilis and zander Sander lucioperca) with comparisons to an introduced and disease susceptible population in Australia (P. fluviatilis): assessing the risk of disease epidemics.

    PubMed

    Faulks, L K; Östman, Ö

    2016-04-01

    This study assessed the major histocompatibility complex (MHC) and neutral genetic variation and structure in two percid species, perch Perca fluviatilis and zander Sander lucioperca, in a unique brackish ecosystem, the Baltic Sea. In addition, to assess the importance of MHC diversity to disease susceptibility in these populations, comparisons were made to an introduced, disease susceptible, P. fluviatilis population in Australia. Eighty-three MHC class II B exon 2 variants were amplified: 71 variants from 92 P. fluviatilis samples, and 12 variants from 82 S. lucioperca samples. Microsatellite and MHC data revealed strong spatial genetic structure in S. lucioperca, but not P. fluviatilis, across the Baltic Sea. Both microsatellite and MHC data showed higher levels of genetic diversity in P. fluviatilis from the Baltic Sea compared to Australia, which may have facilitated the spread of an endemic virus, EHNV in the Australian population. The relatively high levels of genetic variation in the Baltic Sea populations, together with spatial genetic structure, however, suggest that there currently seems to be little risk of disease epidemics in this system. To ensure this remains the case in the face of ongoing environmental changes, fisheries and habitat disturbance, the conservation of local-scale genetic variation is recommended. PMID:26940068

  16. Transplanting the elderly: Balancing aging with histocompatibility.

    PubMed

    Dreyer, G J; Hemke, A C; Reinders, M E J; de Fijter, J W

    2015-10-01

    Across the world, the proportions of senior citizens (i.e. those ≥65years) increase rapidly and are predicted to constitute over 25% of the general population by 2050. In 2012 already 48% of the population with end stage renal disease (ESRD) was aged 65years or older. Transplantation is considered the preferred treatment option for ESRD offering survival advantage over long-term dialysis in the majority of patients. Indeed, acceptable outcomes have been documented for selected patients over the age of 70years or even cases over 80years. The reality of organ scarcity and prolonged waiting times for a deceased donor kidney transplantation, however, indicate that at best 50% of the selected elderly may have realistic expectations to receive a timely transplant offer. By choice or medical selection, access to transplantation also decreases with increasing age. In order to expedite the chance for elderly to receive a kidney transplant dedicated allocation systems have been developed. These allocation systems, like the Eurotransplant Senior Program (ESP), support preferential local allocation of kidneys from older donors to older patients in order to match recipient and graft life while disregarding histocompatibility for HLA antigens. The consequence has been more acute rejection episodes and an increase in immunosuppressive load. In the elderly, the most common cause of graft loss is death with functioning graft and death from infectious diseases is one of the dominant causes. The Eurotransplant Senior DR-compatible Program (ESDP) was designed to further improve the perspective of successful transplantation in the elderly in terms of life and quality of life by re-introducing matching criteria for HLA-DR in the old-for-old algorithm. PMID:26411382

  17. Effects of Highly Conserved Major Histocompatibility Complex (MHC) Extended Haplotypes on Iron and Low CD8+ T Lymphocyte Phenotypes in HFE C282Y Homozygous Hemochromatosis Patients from Three Geographically Distant Areas

    PubMed Central

    Barton, James C.; Thorstensen, Ketil; Morais, Sandra; da Silva, Berta M.; Pinto, Jorge P.; Vieira, Cristina P.; Vieira, Jorge; Acton, Ronald T.; Porto, Graça

    2013-01-01

    Hereditary Hemochromatosis (HH) is a recessively inherited disorder of iron overload occurring commonly in subjects homozygous for the C282Y mutation in HFE gene localized on chromosome 6p21.3 in linkage disequilibrium with the human leukocyte antigen (HLA)-A locus. Although its genetic homogeneity, the phenotypic expression is variable suggesting the presence of modifying factors. One such genetic factor, a SNP microhaplotype named A-A-T, was recently found to be associated with a more severe phenotype and also with low CD8+T-lymphocyte numbers. The present study aimed to test whether the predictive value of the A-A-T microhaplotype remained in other population settings. In this study of 304 HH patients from 3 geographically distant populations (Porto, Portugal 65; Alabama, USA 57; Nord-Trøndelag, Norway 182), the extended haplotypes involving A-A-T were studied in 608 chromosomes and the CD8+ T-lymphocyte numbers were determined in all subjects. Patients from Porto had a more severe phenotype than those from other settings. Patients with A-A-T seemed on average to have greater iron stores (p = 0.021), but significant differences were not confirmed in the 3 separate populations. Low CD8+ T-lymphocytes were associated with HLA-A*03-A-A-T in Porto and Alabama patients but not in the greater series from Nord-Trøndelag. Although A-A-T may signal a more severe iron phenotype, this study was unable to prove such an association in all population settings, precluding its use as a universal predictive marker of iron overload in HH. Interestingly, the association between A-A-T and CD8+ T-lymphocytes, which was confirmed in Porto and Alabama patients, was not observed in Nord-Trøndelag patients, showing that common HLA haplotypes like A*01–B*08 or A*03–B*07 segregating with HFE/C282Y in the three populations may carry different messages. These findings further strengthen the relevance of HH as a good disease model to search for novel candidate loci associated with

  18. Establishment of the reversible peptide-major histocompatibility complex (pMHC) class I Histamer technology: tool for visualization and selection of functionally active antigen-specific CD8(+) T lymphocytes.

    PubMed

    Tischer, Sabine; Kaireit, Till; Figueiredo, Constança; Hiller, Oliver; Maecker-Kolhoff, Britta; Geyeregger, Renè; Immenschuh, Stephan; Blasczyk, Rainer; Eiz-Vesper, Britta

    2012-09-01

    Multimers of soluble peptide-major histocompatibilty complex (pMHC) molecules are used in both basic and clinical immunology. They allow the specific visualization and isolation of antigen-specific T cells from ex vivo samples. Adoptive transfer of antigen-specific T cells sorted by pMHC multimers is an effective strategy for treatment of patients with malignancies or infectious diseases after transplantation. We developed a new reversible pMHC multimer called 'Histamer' to enable the specific detection and isolation of antiviral T cells from peripheral blood. HLA-A*02:01/CMVpp65 (495-503) Histamer (A02/CMV Histamer) was generated by coupling 6xHis-tagged pMHC molecules onto cobalt-based magnetic beads. The specificity of the Histamer was evaluated by flow cytometry. Sorting of antiviral CD8(+) cytotoxic T lymphocytes (CTLs) was performed by magnetic cell separation, followed by the monomerization of the Histamer after addition of the competitor L-histidine. Sorted T cells were analyzed for phenotype and function. The reversible pMHC Histamer proved to be highly specific and sensitive. CMV-specific T cells of up to 99.6% purity were isolated using the Histamer technology. Rapid and complete disassembly of the T-cell surface-bound A02/CMV Histamer followed by the subsequent dissociation of the pMHC monomers from CD8(+) CTL receptors was achieved using 100 mM L-histidine. The function of CMV-specific T cells enriched by Histamer staining did not differ from CTLs induced by standard T-cell assays. This reversible T-cell staining procedure preserves the functionality of antigen-specific T cells and can be adapted to good manufacturing practice conditions. The pMHC Histamer technology offers full flexibility and fulfills all requirements to generate clinical-grade T lymphocytes. PMID:22740564

  19. Gene Acquisitions from Bacteria at the Origins of Major Archaeal Clades Are Vastly Overestimated

    PubMed Central

    Groussin, Mathieu; Boussau, Bastien; Szöllõsi, Gergely; Eme, Laura; Gouy, Manolo; Brochier-Armanet, Céline; Daubin, Vincent

    2016-01-01

    In a recent article, Nelson-Sathi et al. (NS) report that the origins of major archaeal lineages (MAL) correspond to massive group-specific gene acquisitions via HGT from bacteria (Nelson-Sathi et al. 2015. Origins of major archaeal clades correspond to gene acquisitions from bacteria. Nature 517(7532):77-80.). If correct, this would have fundamental implications for the process of diversification in microbes. However, a reexamination of these data and results shows that the methodology used by NS systematically inflates the number of genes acquired at the root of each MAL, and incorrectly assumes bacterial origins for these genes. A reanalysis of their data with appropriate phylogenetic models accounting for the dynamics of gene gain and loss between lineages supports the continuous acquisition of genes over long periods in the evolution of Archaea. PMID:26541173

  20. Sex Biased Gene Expression Profiling of Human Brains at Major Developmental Stages.

    PubMed

    Shi, Lei; Zhang, Zhe; Su, Bing

    2016-01-01

    There are many differences in brain structure and function between males and females. However, how these differences were manifested during development and maintained through adulthood are still unclear. Here we present a time series analyses of genome-wide transcription profiles of the human brain, and we identified genes showing sex biased expression at major developmental stages (prenatal time, early childhood, puberty time and adulthood). We observed a great number of genes (>2,000 genes) showing between-sex expression divergence at all developmental stages with the greatest number (4,164 genes) at puberty time. However, there are little overlap of sex-biased genes among the major developmental stages, an indication of dynamic expression regulation of the sex-biased genes in the brain during development. Notably, the male biased genes are highly enriched for genes involved in neurological and psychiatric disorders like schizophrenia, bipolar disorder, Alzheimer's disease and autism, while no such pattern was seen for the female-biased genes, suggesting that the differences in brain disorder susceptibility between males and females are likely rooted from the sex-biased gene expression regulation during brain development. Collectively, these analyses reveal an important role of sex biased genes in brain development and neurodevelopmental disorders. PMID:26880485

  1. Sex Biased Gene Expression Profiling of Human Brains at Major Developmental Stages

    PubMed Central

    Shi, Lei; Zhang, Zhe; Su, Bing

    2016-01-01

    There are many differences in brain structure and function between males and females. However, how these differences were manifested during development and maintained through adulthood are still unclear. Here we present a time series analyses of genome-wide transcription profiles of the human brain, and we identified genes showing sex biased expression at major developmental stages (prenatal time, early childhood, puberty time and adulthood). We observed a great number of genes (>2,000 genes) showing between-sex expression divergence at all developmental stages with the greatest number (4,164 genes) at puberty time. However, there are little overlap of sex-biased genes among the major developmental stages, an indication of dynamic expression regulation of the sex-biased genes in the brain during development. Notably, the male biased genes are highly enriched for genes involved in neurological and psychiatric disorders like schizophrenia, bipolar disorder, Alzheimer’s disease and autism, while no such pattern was seen for the female-biased genes, suggesting that the differences in brain disorder susceptibility between males and females are likely rooted from the sex-biased gene expression regulation during brain development. Collectively, these analyses reveal an important role of sex biased genes in brain development and neurodevelopmental disorders. PMID:26880485

  2. Overexpression of a single Leishmania major gene enhances parasite infectivity in vivo and in vitro

    PubMed Central

    Reiling, Linda; Chrobak, Mareike; Schmetz, Christel; Clos, Joachim

    2010-01-01

    We identified a Leishmania major-specific gene that can partly compensate for the loss of virulence observed for L. major HSP100 null mutants. The gene, encoding a 46 kD protein of unknown function and lineage, also enhances the virulence of wild type L. major upon overexpression. Surprisingly, the approximately sixfold overexpression of this protein also extends the host range of L. major to normally resistant C57BL/6 mice, causing persisting lesions in this strain, even while eliciting a strong cellular immune response. This enhanced virulence in vivo is mirrored in vitro by increased parasite burden inside bone marrow-derived macrophages. The localization of the protein in the macrophage cytoplasm suggests that it may modulate the macrophage effector mechanisms. In summary, our data show that even minor changes of gene expression in L. major may alter the outcome of an infection, regardless of the host's genetic predisposition. PMID:20345655

  3. A Hox Gene, Antennapedia, Regulates Expression of Multiple Major Silk Protein Genes in the Silkworm Bombyx mori.

    PubMed

    Tsubota, Takuya; Tomita, Shuichiro; Uchino, Keiro; Kimoto, Mai; Takiya, Shigeharu; Kajiwara, Hideyuki; Yamazaki, Toshimasa; Sezutsu, Hideki

    2016-03-25

    Hoxgenes play a pivotal role in the determination of anteroposterior axis specificity during bilaterian animal development. They do so by acting as a master control and regulating the expression of genes important for development. Recently, however, we showed that Hoxgenes can also function in terminally differentiated tissue of the lepidopteranBombyx mori In this species,Antennapedia(Antp) regulates expression of sericin-1, a major silk protein gene, in the silk gland. Here, we investigated whether Antpcan regulate expression of multiple genes in this tissue. By means of proteomic, RT-PCR, and in situ hybridization analyses, we demonstrate that misexpression of Antpin the posterior silk gland induced ectopic expression of major silk protein genes such assericin-3,fhxh4, and fhxh5 These genes are normally expressed specifically in the middle silk gland as is Antp Therefore, the evidence strongly suggests that Antpactivates these silk protein genes in the middle silk gland. The putativesericin-1 activator complex (middle silk gland-intermolt-specific complex) can bind to the upstream regions of these genes, suggesting that Antpdirectly activates their expression. We also found that the pattern of gene expression was well conserved between B. moriand the wild species Bombyx mandarina, indicating that the gene regulation mechanism identified here is an evolutionarily conserved mechanism and not an artifact of the domestication of B. mori We suggest that Hoxgenes have a role as a master control in terminally differentiated tissues, possibly acting as a primary regulator for a range of physiological processes. PMID:26814126

  4. Origins of major archaeal clades correspond to gene acquisitions from bacteria

    PubMed Central

    Nelson-Sathi, Shijulal; Sousa, Filipa L.; Röttger, Mayo; Lozada-Chávez, Nabor; Thiergart, Thorsten; Janssen, Arnold; Bryant, David; Landan, Giddy; Schönheit, Peter; Siebers, Bettina; McInerney, James O.; Martin, William F.

    2014-01-01

    The mechanisms that underlie the origin of major prokaryotic groups are poorly understood. In principle, the origin of both species and higher taxa among prokaryotes should entail similar mechanisms — ecological interactions with the environment paired with natural genetic variation involving lineage-specific gene innovations and lineage-specific gene acquisitions1,2,3,4. To investigate the origin of higher taxa in archaea, we have determined gene distributions and gene phylogenies for the 267,568 protein coding genes of 134 sequenced archaeal genomes in the context of their homologs from 1,847 reference bacterial genomes. Archaea-specific gene families define 13 traditionally recognized archaeal higher taxa in our sample. Here we report that the origins of these 13 groups unexpectedly correspond to 2,264 group-specific gene acquisitions from bacteria. Interdomain gene transfer is highly asymmetric, transfers from bacteria to archaea are more than 5-fold more frequent than vice versa. Gene transfers identified at major evolutionary transitions among prokaryotes specifically implicate gene acquisitions for metabolic functions from bacteria as key innovations in the origin of higher archaeal taxa. PMID:25317564

  5. Major histocompatibility complex class II DR alleles DRB1*1501 and those encoding HLA-DR13 are preferentially associated with a diminution in maternally transmitted human immunodeficiency virus 1 infection in different ethnic groups: determination by an automated sequence-based typing method.

    PubMed Central

    Winchester, R; Chen, Y; Rose, S; Selby, J; Borkowsky, W

    1995-01-01

    Transmission of human immunodeficiency virus 1 (HIV-1) from an infected women to her offspring during gestation and delivery was found to be influenced by the infant's major histocompatibility complex class II DRB1 alleles. Forty-six HIV-infected infants and 63 seroreverting infants, born with passively acquired anti-HIV antibodies but not becoming detectably infected, were typed by an automated nucleotide-sequence-based technique that uses low-resolution PCR to select either the simpler Taq or the more demanding T7 sequencing chemistry. One or more DR13 alleles, including DRB1*1301, 1302, and 1303, were found in 31.7% of seroreverting infants and 15.2% of those becoming HIV-infected [OR (odds ratio) = 2.6 (95% confidence interval 1.0-6.8); P = 0.048]. This association was influenced by ethnicity, being seen more strongly among the 80 Black and Hispanic children [OR = 4.3 (1.2-16.4); P = 0.023], with the most pronounced effect among Black infants where 7 of 24 seroreverters inherited these alleles with none among 12 HIV-infected infants (Haldane OR = 12.3; P = 0.037). The previously recognized association of DR13 alleles with some situations of long-term nonprogression of HIV suggests that similar mechanisms may regulate both the occurrence of infection and disease progression after infection. Upon examining for residual associations, only only the DR2 allele DRB1*1501 was associated with seroreversion in Caucasoid infants (OR = 24; P = 0.004). Among Caucasoids the DRB1*03011 allele was positively associated with the occurrence of HIV infection (P = 0.03). PMID:8618904

  6. Inhibition by chloroquine of the class II major histocompatibility complex-restricted presentation of endogenous antigens varies according to the cellular origin of the antigen-presenting cells, the nature of the T-cell epitope, and the responding T cell.

    PubMed Central

    Lombard-Platlet, S; Bertolino, P; Deng, H; Gerlier, D; Rabourdin-Combe, C

    1993-01-01

    Chloroquine treatment of antigen-presenting cells (APC) was explored as a tool to investigate the processing pathway for major histocompatibility complex (MHC) class II-restricted presentation of the endogenous secreted hen egg lysozyme (HEL) and transmembrane measles virus haemagglutinin (HA). A 72-hr pretreatment of the APC with 25 microM chloroquine blocked the presentation of the HEL(52-61) T-cell epitope generated from endogenous HEL to the I-Ak-restricted 3A9 T-cell hybridoma by MHC class II-transfected L cells expressing the invariant chain (Ii). The presentation of exogenously added HEL peptides was not affected. Under the same conditions, no inhibition of the presentation of HEL(106-116) to the I-Ed-restricted G28 high-avidity T-cell hybridoma, nor of HA when synthesized by L cells, was observed. When B-lymphoid APC were used, inhibition was observed in every case with a low number of B APC pretreated for 48 hr with chloroquine prior to the T-cell stimulation test. Moreover, addition of chloroquine to untreated B APC during the T-cell stimulation assay was sufficient to inhibit completely the presentation of HEL(106-116) to the B10.D24.42 low avidity T-cell hybridoma. Altogether these studies suggest that an apparent resistance of endogenous Ag presentation to chloroquine inhibition may not necessarily indicate the existence of a non-endosomal pathway but may be due to the nature of the T-cell epitope, to the use of 'non-professional' APC such as L cells, to the use of T cells of high avidity, and to high amounts of pre-existing MHC class II-peptide complexes expressed by the APC. We demonstrate here that, at least in conventional APC such as B cells, class II-restricted presentation of both endogenous secreted HEL and transmembrane HA involves an endosomal pathway. PMID:7508420

  7. Analyses for the presence of a major gene affecting uterine capacity in unilaterally ovariectomized rabbits.

    PubMed Central

    Argente, M J; Blasco, A; Ortega, J A; Haley, C S; Visscher, P M

    2003-01-01

    The presence of a major gene for uterine capacity (UC), ovulation rate (OR), number of implanted embryos (IE), embryo survival (ES), fetal survival (FS), and prenatal survival (PS) was investigated in a population of rabbits divergently selected for UC for 10 generations. Selection was performed on estimated breeding values for UC up to four parities. UC was estimated as litter size in the remaining overcrowded horn of unilaterally ovariectomized does. OR and IE were counted by means of laparoscopy. Bartlett's test, Fain's test, and a complex segregation analysis using Bayesian methods were used to test for the presence of a major gene. All three tests showed that the data appeared consistent with the presence of a major gene affecting UC and IE. The results of the complex segregation analysis suggested the presence of a major gene with large effect on IE and ES (a > 1sigma(p)), at high frequency (p = 0.70 and 0.68, respectively), and with a large contribution to the total variance (R(g) = 0.39 and 0.47, respectively); and the presence of a major gene with moderate effect on each of OR, FS, PS, and UC. The results suggest that the studied reproductive traits are determined genetically by at least one gene of large effect. PMID:12663544

  8. Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii.

    PubMed

    Jacobson, M R; Brigle, K E; Bennett, L T; Setterquist, R A; Wilson, M S; Cash, V L; Beynon, J; Newton, W E; Dean, D R

    1989-02-01

    Determination of a 28,793-base-pair DNA sequence of a region from the Azotobacter vinelandii genome that includes and flanks the nitrogenase structural gene region was completed. This information was used to revise the previously proposed organization of the major nif cluster. The major nif cluster from A. vinelandii encodes 15 nif-specific genes whose products bear significant structural identity to the corresponding nif-specific gene products from Klebsiella pneumoniae. These genes include nifH, nifD, nifK, nifT, nifY, nifE, nifN, nifX, nifU, nifS, nifV, nifW, nifZ, nifM, and nifF. Although there are significant spatial differences, the identified A. vinelandii nif-specific genes have the same sequential arrangement as the corresponding nif-specific genes from K. pneumoniae. Twelve other potential genes whose expression could be subject to nif-specific regulation were also found interspersed among the identified nif-specific genes. These potential genes do not encode products that are structurally related to the identified nif-specific gene products. Eleven potential nif-specific promoters were identified within the major nif cluster, and nine of these are preceded by an appropriate upstream activator sequence. A + T-rich regions were identified between 8 of the 11 proposed nif promoter sequences and their upstream activator sequences. Site-directed deletion-and-insertion mutagenesis was used to establish a genetic map of the major nif cluster. PMID:2644218

  9. Physical and genetic map of the major nif gene cluster from Azotobacter vinelandii.

    PubMed Central

    Jacobson, M R; Brigle, K E; Bennett, L T; Setterquist, R A; Wilson, M S; Cash, V L; Beynon, J; Newton, W E; Dean, D R

    1989-01-01

    Determination of a 28,793-base-pair DNA sequence of a region from the Azotobacter vinelandii genome that includes and flanks the nitrogenase structural gene region was completed. This information was used to revise the previously proposed organization of the major nif cluster. The major nif cluster from A. vinelandii encodes 15 nif-specific genes whose products bear significant structural identity to the corresponding nif-specific gene products from Klebsiella pneumoniae. These genes include nifH, nifD, nifK, nifT, nifY, nifE, nifN, nifX, nifU, nifS, nifV, nifW, nifZ, nifM, and nifF. Although there are significant spatial differences, the identified A. vinelandii nif-specific genes have the same sequential arrangement as the corresponding nif-specific genes from K. pneumoniae. Twelve other potential genes whose expression could be subject to nif-specific regulation were also found interspersed among the identified nif-specific genes. These potential genes do not encode products that are structurally related to the identified nif-specific gene products. Eleven potential nif-specific promoters were identified within the major nif cluster, and nine of these are preceded by an appropriate upstream activator sequence. A + T-rich regions were identified between 8 of the 11 proposed nif promoter sequences and their upstream activator sequences. Site-directed deletion-and-insertion mutagenesis was used to establish a genetic map of the major nif cluster. PMID:2644218

  10. DNA analysis of histocompatibility antigens: identification of new DQw specificities and of DPw patterns.

    PubMed

    Goldberg, A C; Kalil, J

    1989-01-01

    1. The HLA-D region of the major histocompatibility complex has several subregions, the most important of which are DR, DQ and DP. The genes coding for the beta chains of these proteins present most of the polymorphisms which result in the large variety of class II antigens observed. 2. We have studied the restriction fragment length polymorphism (RFLP) of the DQ beta and DP beta genes in order to establish accurate typing patterns. 3. The data show that DQ typing based on RFLP permits the identification of the recently described DQw1 splits (new antigenic specificities), DQw5 and DQw6. The TA10-monoclonal antibody-positive split of DQw3, designated DQw7, is associated with specific DNA fragments after digestion with four different enzymes: Taq I, Hind III, Pvu II and Bgl II. Furthermore, the recently reported specificity DQw4 (formerly typed as a blank) is associated with a specific 2.4-kb fragment when the DNA is digested with EcoRV. 4. DP typing proved to be more difficult even though six enzymes were used, and only broad groups could be identified. PMID:2483530

  11. Base J represses genes at the end of polycistronic gene clusters in Leishmania major by promoting RNAP II termination.

    PubMed

    Reynolds, David L; Hofmeister, Brigitte T; Cliffe, Laura; Siegel, T Nicolai; Anderson, Britta A; Beverley, Stephen M; Schmitz, Robert J; Sabatini, Robert

    2016-08-01

    The genomes of kinetoplastids are organized into polycistronic gene clusters that are flanked by the modified DNA base J. Previous work has established a role of base J in promoting RNA polymerase II termination in Leishmania spp. where the loss of J leads to termination defects and transcription into adjacent gene clusters. It remains unclear whether these termination defects affect gene expression and whether read through transcription is detrimental to cell growth, thus explaining the essential nature of J. We now demonstrate that reduction of base J at specific sites within polycistronic gene clusters in L. major leads to read through transcription and increased expression of downstream genes in the cluster. Interestingly, subsequent transcription into the opposing polycistronic gene cluster does not lead to downregulation of sense mRNAs. These findings indicate a conserved role for J regulating transcription termination and expression of genes within polycistronic gene clusters in trypanosomatids. In contrast to the expectations often attributed to opposing transcription, the essential nature of J in Leishmania spp. is related to its role in gene repression rather than preventing transcriptional interference resulting from read through and dual strand transcription. PMID:27125778

  12. Evidence for a major gene influencing 7-year increases in diastolic blood pressure with age

    SciTech Connect

    Li Shu-Chuan Cheng; Carmelli, D.; Hunt, S.C.

    1995-11-01

    The contribution of genetic factors to blood pressure levels is well established. The contribution of genes to the longitudinal change in blood pressure has been less well studied, because of the lack of longitudinal family data. The present study investigated a possible major-gene effect on the observed increase with age in diastolic blood pressure (DBP) levels. Subjects included 965 unmedicated adults (age {ge}18 years) in 73 pedigrees collected in Utah as part of a longitudinal cardiovascular family study. Segregation analysis of DBP change over 7.2 years of follow-up identified a recessive major-gene effect with a gene frequency of p = .23. There was also a significant age effect on the genotypic means, which decreased expression of the major gene at older ages. For those inferred to have the genotype responsible for large DBP increases, DBP increased 32.3%, compared with a 1.5% increase in the nonsusceptible group (P < .0001). The relative risk of developing hypertension between the susceptible and nonsusceptible groups after 7.2 years was 2.4 (P = .006). Baseline DBP reactivities to mental arithmetic (P < .0001) and isometric hand-grip (P < .0001) stress tests were greatest in those assigned to the susceptible genotype. We conclude that age-related changes in DBP are influenced by a major gene. Characteristics of this major-gene effect for greater age-related blood pressure increases include greater reactivity to mental and physical stressors. The present study thus provides evidence for genetic control of changes in blood pressure, in addition to the previously suggested genetic control of absolute blood pressure level. 28 refs., 6 tabs.

  13. Abnormal response to minor histocompatibility antigens in Obese strain chickens.

    PubMed Central

    Jakobisiak, M; Sundick, R S; Bacon, L D; Rose, N R

    1976-01-01

    Obese strain chickens, which spontaneously develop autoimmune thyroiditis, were tested for their ability to tolerate skin allografts. Several procedures known to prolong graft survival in normal strains were employed. These included the use of skin matched at the major histocompatibility locus, grafting on the day of hatching, thymectomy, and x-irradiation. A dramatic difference between the Obese and the normal Cornell strain (the strain from which Obese was derived) was detected when both were thymectomized and grafted at hatching. Under these conditions eight of 13 normal but only one of 16 Obese strain birds retained their grafts for 50 days. This suggests the presence of an abnormal thymus or thymus-derived suppressor T cells in Obese strain chickens. PMID:785474

  14. Whole-genome expression analysis reveals genes associated with treatment response to escitalopram in major depression.

    PubMed

    Pettai, Kristi; Milani, Lili; Tammiste, Anu; Võsa, Urmo; Kolde, Raivo; Eller, Triin; Nutt, David; Metspalu, Andres; Maron, Eduard

    2016-09-01

    The reasons for variability in treatment response in major depressive disorder (MDD) are not fully understood, but there is accumulating evidence suggesting that therapeutic outcomes of antidepressants can be influenced by genetic factors. In the present study we applied the microarray Illumina platform for whole genome expression profiling in depressive patients treated with escitalopram medication in order to identify genes underlying response to antidepressant treatment. The initial study sample consisted of 135 outpatients with major depressive disorder (mean age 31.1±11.6 years, 68% females) treated with escitalopram 10-20mg/day for 12 weeks, from which 87 patients (55 females) were included in gene expression analyzing. The gene expression profiles were measured on peripheral blood cells at baseline, at week 4 and at the end of treatment (week 12) using BeadChips Illumina. The fold change was used to demonstrate rate of changes in average gene expressions between studied groups. Statistical analyses were performed using the false discovery rate (FDR). The most interesting gene, which showed the predictive effect on treatment outcome by delineating low dose responders and treatment-resistant patients at the beginning of medication, was NLGN2, belonging to a family of neuronal cell surface proteins and involving in synapse formation. In addition, the several gene clusters, related to immune response, signal transduction and neurotrophin pathway, have distinguished responders from non-responders at the week 4 of treatment. After 4 weeks of escitalopram treatment (10mg/day), the YWHAZ gene has showed the highest transcriptional change in responders as compared with non-responders. Finally, at the end of the treatment we noticed that at least three genes (NR2C2, ZNF641, FKBP1A) have been strongly associated with resistance to escitalopram. Thus the results of this study support that exploration of peripheral gene expression is a useful tool in the further

  15. PROPOSED MAJOR POWDERY MILDEW GENES IN EASTERN AND SOUTHERN WHEAT GERMPLASM; IN THE PAST TEN YEARS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to powdery mildew of wheat is controlled by major genes in adult and seedling stages or quantitative resistance in the adult stage. Entries in the PM nursery from Southern and Eastern US were screened on detached seedling leaves. The observed virulence patterns were then compared to virul...

  16. Utilization of a major brown rust resistance gene in sugarcane breeding

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Brown rust, caused by Puccinia melanocephala has had devastating effects on sugarcane (Saccharum spp.) breeding programs and on commercial production. The discovery of Bru1, a major gene conferring resistance to brown rust represented a substantial breakthrough and markers for the detection of Bru1 ...

  17. New insight for two major rice blast R genes: Pi-ta and Pi-km

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In rice breeding programs across the world, the introgression of major resistance (R) genes remains the most cost-effective method to control blast epidemics caused by the fungal pathogen Magnaporthe oryzae. During the last two years, we have examined two loci, on chromosome 12 and 11, which harbor ...

  18. Testing the predictive value of peripheral gene expression for nonremission following citalopram treatment for major depression.

    PubMed

    Guilloux, Jean-Philippe; Bassi, Sabrina; Ding, Ying; Walsh, Chris; Turecki, Gustavo; Tseng, George; Cyranowski, Jill M; Sibille, Etienne

    2015-02-01

    Major depressive disorder (MDD) in general, and anxious-depression in particular, are characterized by poor rates of remission with first-line treatments, contributing to the chronic illness burden suffered by many patients. Prospective research is needed to identify the biomarkers predicting nonremission prior to treatment initiation. We collected blood samples from a discovery cohort of 34 adult MDD patients with co-occurring anxiety and 33 matched, nondepressed controls at baseline and after 12 weeks (of citalopram plus psychotherapy treatment for the depressed cohort). Samples were processed on gene arrays and group differences in gene expression were investigated. Exploratory analyses suggest that at pretreatment baseline, nonremitting patients differ from controls with gene function and transcription factor analyses potentially related to elevated inflammation and immune activation. In a second phase, we applied an unbiased machine learning prediction model and corrected for model-selection bias. Results show that baseline gene expression predicted nonremission with 79.4% corrected accuracy with a 13-gene model. The same gene-only model predicted nonremission after 8 weeks of citalopram treatment with 76% corrected accuracy in an independent validation cohort of 63 MDD patients treated with citalopram at another institution. Together, these results demonstrate the potential, but also the limitations, of baseline peripheral blood-based gene expression to predict nonremission after citalopram treatment. These results not only support their use in future prediction tools but also suggest that increased accuracy may be obtained with the inclusion of additional predictors (eg, genetics and clinical scales). PMID:25176167

  19. Transcriptomic profiling of gene expression and RNA processing during Leishmania major differentiation

    PubMed Central

    Dillon, Laura A. L.; Okrah, Kwame; Hughitt, V. Keith; Suresh, Rahul; Li, Yuan; Fernandes, Maria Cecilia; Belew, A. Trey; Corrada Bravo, Hector; Mosser, David M.; El-Sayed, Najib M.

    2015-01-01

    Protozoan parasites of the genus Leishmania are the etiological agents of leishmaniasis, a group of diseases with a worldwide incidence of 0.9–1.6 million cases per year. We used RNA-seq to conduct a high-resolution transcriptomic analysis of the global changes in gene expression and RNA processing events that occur as L. major transforms from non-infective procyclic promastigotes to infective metacyclic promastigotes. Careful statistical analysis across multiple biological replicates and the removal of batch effects provided a high quality framework for comprehensively analyzing differential gene expression and transcriptome remodeling in this pathogen as it acquires its infectivity. We also identified precise 5′ and 3′ UTR boundaries for a majority of Leishmania genes and detected widespread alternative trans-splicing and polyadenylation. An investigation of possible correlations between stage-specific preferential trans-splicing or polyadenylation sites and differentially expressed genes revealed a lack of systematic association, establishing that differences in expression levels cannot be attributed to stage-regulated alternative RNA processing. Our findings build on and improve existing expression datasets and provide a substantially more detailed view of L. major biology that will inform the field and potentially provide a stronger basis for drug discovery and vaccine development efforts. PMID:26150419

  20. Major Soybean Maturity Gene Haplotypes Revealed by SNPViz Analysis of 72 Sequenced Soybean Genomes

    PubMed Central

    Langewisch, Tiffany; Zhang, Hongxin; Vincent, Ryan; Joshi, Trupti; Xu, Dong; Bilyeu, Kristin

    2014-01-01

    In this Genomics Era, vast amounts of next-generation sequencing data have become publicly available for multiple genomes across hundreds of species. Analyses of these large-scale datasets can become cumbersome, especially when comparing nucleotide polymorphisms across many samples within a dataset and among different datasets or organisms. To facilitate the exploration of allelic variation and diversity, we have developed and deployed an in-house computer software to categorize and visualize these haplotypes. The SNPViz software enables users to analyze region-specific haplotypes from single nucleotide polymorphism (SNP) datasets for different sequenced genomes. The examination of allelic variation and diversity of important soybean [Glycine max (L.) Merr.] flowering time and maturity genes may provide additional insight into flowering time regulation and enhance researchers' ability to target soybean breeding for particular environments. For this study, we utilized two available soybean genomic datasets for a total of 72 soybean genotypes encompassing cultivars, landraces, and the wild species Glycine soja. The major soybean maturity genes E1, E2, E3, and E4 along with the Dt1 gene for plant growth architecture were analyzed in an effort to determine the number of major haplotypes for each gene, to evaluate the consistency of the haplotypes with characterized variant alleles, and to identify evidence of artificial selection. The results indicated classification of a small number of predominant haplogroups for each gene and important insights into possible allelic diversity for each gene within the context of known causative mutations. The software has both a stand-alone and web-based version and can be used to analyze other genes, examine additional soybean datasets, and view similar genome sequence and SNP datasets from other species. PMID:24727730

  1. Molecular Mapping of Wheat: Major Genes and Rearrangements in Homoeologous Groups 4, 5, and 7

    PubMed Central

    Nelson, J. C.; Sorrells, M. E.; Van-Deynze, A. E.; Lu, Y. H.; Atkinson, M.; Bernard, M.; Leroy, P.; Faris, J. D.; Anderson, J. A.

    1995-01-01

    A molecular-marker linkage map of hexaploid wheat (Triticum aestivum L. em. Thell) provides a framework for integration with the classical genetic map and a record of the chromosomal rearrangements involved in the evolution of this crop species. We have constructed restriction fragment length polymorphism (RFLP) maps of the A-, B-, and D-genome chromosomes of homoeologous groups 4, 5, and 7 of wheat using 114 F(7) lines from a synthetic X cultivated wheat cross and clones from 10 DNA libraries. Chromosomal breakpoints for known ancestral reciprocal translocations involving these chromosomes and for a known pericentric inversion on chromosome 4A were localized by linkage and aneuploid analysis. Known genes mapped include the major vernalization genes Vrn1 and Vrn3 on chromosome arms 5AL and 5DL, the red-coleoptile gene Rc1 on 7AS, and presumptively the leaf-rust (Puccinia recondita f.sp. tritici) resistance gene Lr34 on 7DS and the kernel-hardness gene Ha on 5DS. RFLP markers previously obtained for powdery-mildew (Blumeria graminis f.sp. tritici) resistance genes Pm2 and Pm1 were localized on chromosome arms 5DS and 7AL. PMID:8647405

  2. Role of four major cellulases in triggering of cellulase gene expression by cellulose in Trichoderma reesei.

    PubMed Central

    Seiboth, B; Hakola, S; Mach, R L; Suominen, P L; Kubicek, C P

    1997-01-01

    The relative contributions of four major cellulases of Trichoderma reesei (1,4-beta-D-glucan cellobiohydrolase I [CBH I], CBH II, endo-1,4-beta-D-glucanase I [EG I], and EG II) to the generation of the cellulase inducer from cellulose were studied with isogenic strains in which the corresponding genes (cbh1, cbh2, egl1, and egl2) had been deleted by insertion of the Aspergillus nidulans amdS marker gene. During growth on lactose (a soluble carbon source provoking cellulase gene expression), these strains showed no significant alterations in their ability to express the respective other cellulase genes, with the exception of the strain containing delta cbh1, which exhibited an increased steady-state level of cbh2 mRNA. On crystalline cellulose as the only carbon source, however, significant differences were apparent: strains in which cbh2 and egl2, respectively, had been deleted showed no expression of the other cellulase genes, whereas strains carrying the cbh1 or egl1 deletion showed these transcripts. The delta cbh1-containing strain also showed enhanced cbh2 mRNA levels under these conditions. A strain in which both cbh1 and cbh2 had been deleted, however, was unable to initiate growth on cellulose. Addition of 2 mM sophorose, a putative inducer of cellulase gene expression, to such cultures induced the transcription of egl1 and egl2 and restored the ability to grow on cellulose. We conclude that CBH II and EG II are of major importance for the efficient formation of the inducer from cellulose in T. reesei and that removal of both cellobiohydrolases renders T. reesei unable to attack crystalline cellulose. PMID:9286982

  3. No evidence of major effects in several Toll-like receptor gene polymorphisms in rheumatoid arthritis

    PubMed Central

    Jaen, Olivier; Petit-Teixeira, Elisabeth; Kirsten, Holger; Ahnert, Peter; Semerano, Luca; Pierlot, Céline; Cornelis, Francois; Boissier, Marie-Christophe; Falgarone, Geraldine

    2009-01-01

    Introduction The objective was to study the potential genetic contribution of Toll-like receptor (TLR) genes in rheumatoid arthritis (RA). TLRs bind to pathogen-associated molecular patterns, and TLR genes influence both proinflammatory cytokine production and autoimmune responses. Host–pathogen interactions are involved in RA physiopathology. Methods We tested SNPs of five TLR genes (TLR9, TLR2, TLR6, TLR1, and TLR4) in a cohort of 100 French families with RA. Genotypes were analyzed using the transmission disequilibrium test. As TLR2, TLR6, and TLR1 are located on chromosome 4, we determined the haplotype relative risk. Analyses were performed in subgroups defined by status for rheumatoid factor, anti-cyclic citrullinated peptide autoantibodies, and erosions. Results We found no disequilibrium in allele transmission for any of the SNPs of the five TLR genes. In subgroup analyses, no associations were detected linking TLR9, TLR2, or TLR9/TLR2 to rheumatoid factor, anti-cyclic citrullinated peptide autoantibodies, or erosions. Haplotype analysis of the polymorphisms showed no haplotype associations in any of the subgroups. Conclusions We found no evidence of major effects of TLR gene polymorphisms in RA, although we tested different TLR phenotypes. Moreover, no associations were noted with autoantibody production or erosions. PMID:19134200

  4. Trends of the Major Porin Gene (ompF) Evolution: Insight from the Genus Yersinia

    PubMed Central

    Stenkova, Anna M.; Isaeva, Marina P.; Shubin, Felix N.; Rasskazov, Valeri A.; Rakin, Alexander V.

    2011-01-01

    OmpF is one of the major general porins of Enterobacteriaceae that belongs to the first line of bacterial defense and interactions with the biotic as well as abiotic environments. Porins are surface exposed and their structures strongly reflect the history of multiple interactions with the environmental challenges. Unfortunately, little is known on diversity of porin genes of Enterobacteriaceae and the genus Yersinia especially. We analyzed the sequences of the ompF gene from 73 Yersinia strains covering 14 known species. The phylogenetic analysis placed most of the Yersinia strains in the same line assigned by 16S rDNA-gyrB tree. Very high congruence in the tree topologies was observed for Y. enterocolitica, Y. kristensenii, Y. ruckeri, indicating that intragenic recombination in these species had no effect on the ompF gene. A significant level of intra- and interspecies recombination was found for Y. aleksiciae, Y. intermedia and Y. mollaretii. Our analysis shows that the ompF gene of Yersinia has evolved with nonrandom mutational rate under purifying selection. However, several surface loops in the OmpF porin contain positively selected sites, which very likely reflect adaptive diversification Yersinia to their ecological niches. To our knowledge, this is a first investigation of diversity of the porin gene covering the whole genus of the family Enterobacteriaceae. This study demonstrates that recombination and positive selection both contribute to evolution of ompF, but the relative contribution of these evolutionary forces are different among Yersinia species. PMID:21655186

  5. Polymorphisms of IKBKE gene are associated with major depressive disorder and panic disorder

    PubMed Central

    Traks, Tanel; Koido, Kati; Balõtšev, Roman; Eller, Triin; Kõks, Sulev; Maron, Eduard; Tõru, Innar; Shlik, Jakov; Vasar, Eero; Vasar, Veiko

    2015-01-01

    Background The immune system has been increasingly implicated in the development of mood and anxiety disorders. Inhibitor of kappa light polypeptide gene enhancer in B cells, kinase epsilon (IKBKE) gene encodes IKKε protein that is involved in innate immunity, predominantly antiviral response generation. It also bears pro-inflammatory properties that could affect psychiatric outcomes. In order to investigate the possible role of IKBKE gene in major depressive disorder (MDD) and panic disorder (PD), we conducted a case–control genetic association study concerning these disorders. Methods In all, 14 SNPs of IKBKE gene were genotyped in groups of 391 patients with MDD and 190 patients with PD together with respective 389 and 371 healthy control individuals. The given groups were further divided by gender for additional analyses. Results Substantial genetic associations were revealed between IKBKE SNPs and MDD (multiple testing adjusted P < 0.05) and suggestive associations in case of PD (Padj > 0.05). In addition, two SNPs that were only associated with PD among males, also displayed significantly different allele frequencies compared to PD females. This may indicate a specific role of these SNPs in male PD, but caution should be applied here due to the small size of the studied PD males group. Conclusions The results of this study confirm our initial findings and indicate a possible role of IKBKE gene in mood and anxiety disorders. PMID:25798331

  6. Circadian dysregulation of clock genes: clues to rapid treatments in major depressive disorder.

    PubMed

    Bunney, B G; Li, J Z; Walsh, D M; Stein, R; Vawter, M P; Cartagena, P; Barchas, J D; Schatzberg, A F; Myers, R M; Watson, S J; Akil, H; Bunney, W E

    2015-02-01

    Conventional antidepressants require 2-8 weeks for a full clinical response. In contrast, two rapidly acting antidepressant interventions, low-dose ketamine and sleep deprivation (SD) therapy, act within hours to robustly decrease depressive symptoms in a subgroup of major depressive disorder (MDD) patients. Evidence that MDD may be a circadian-related illness is based, in part, on a large set of clinical data showing that diurnal rhythmicity (sleep, temperature, mood and hormone secretion) is altered during depressive episodes. In a microarray study, we observed widespread changes in cyclic gene expression in six regions of postmortem brain tissue of depressed patients matched with controls for time-of-death (TOD). We screened 12 000 transcripts and observed that the core clock genes, essential for controlling virtually all rhythms in the body, showed robust 24-h sinusoidal expression patterns in six brain regions in control subjects. In MDD patients matched for TOD with controls, the expression patterns of the clock genes in brain were significantly dysregulated. Some of the most robust changes were seen in anterior cingulate (ACC). These findings suggest that in addition to structural abnormalities, lesion studies, and the large body of functional brain imaging studies reporting increased activation in the ACC of depressed patients who respond to a wide range of therapies, there may be a circadian dysregulation in clock gene expression in a subgroup of MDDs. Here, we review human, animal and neuronal cell culture data suggesting that both low-dose ketamine and SD can modulate circadian rhythms. We hypothesize that the rapid antidepressant actions of ketamine and SD may act, in part, to reset abnormal clock genes in MDD to restore and stabilize circadian rhythmicity. Conversely, clinical relapse may reflect a desynchronization of the clock, indicative of a reactivation of abnormal clock gene function. Future work could involve identifying specific small

  7. Circadian dysregulation of clock genes: clues to rapid treatments in major depressive disorder

    PubMed Central

    Bunney, BG; Li, JZ; Walsh, DM; Stein, R; Vawter, MP; Cartagena, P; Barchas, JD; Schatzberg, AF; Myers, RM; Watson, SJ; Akil, H; Bunney, WE

    2016-01-01

    Conventional antidepressants require 2–8 weeks for a full clinical response. In contrast, two rapidly acting antidepressant interventions, low-dose ketamine and sleep deprivation (SD) therapy, act within hours to robustly decrease depressive symptoms in a subgroup of major depressive disorder (MDD) patients. Evidence that MDD may be a circadian-related illness is based, in part, on a large set of clinical data showing that diurnal rhythmicity (sleep, temperature, mood and hormone secretion) is altered during depressive episodes. In a microarray study, we observed widespread changes in cyclic gene expression in six regions of postmortem brain tissue of depressed patients matched with controls for time-of-death (TOD). We screened 12 000 transcripts and observed that the core clock genes, essential for controlling virtually all rhythms in the body, showed robust 24-h sinusoidal expression patterns in six brain regions in control subjects. In MDD patients matched for TOD with controls, the expression patterns of the clock genes in brain were significantly dysregulated. Some of the most robust changes were seen in anterior cingulate (ACC). These findings suggest that in addition to structural abnormalities, lesion studies, and the large body of functional brain imaging studies reporting increased activation in the ACC of depressed patients who respond to a wide range of therapies, there may be a circadian dysregulation in clock gene expression in a subgroup of MDDs. Here, we review human, animal and neuronal cell culture data suggesting that both low-dose ketamine and SD can modulate circadian rhythms. We hypothesize that the rapid antidepressant actions of ketamine and SD may act, in part, to reset abnormal clock genes in MDD to restore and stabilize circadian rhythmicity. Conversely, clinical relapse may reflect a desynchronization of the clock, indicative of a reactivation of abnormal clock gene function. Future work could involve identifying specific small

  8. Evidence of a major gene influencing hair length and heat tolerance in Bos taurus cattle.

    PubMed

    Olson, T A; Lucena, C; Chase, C C; Hammond, A C

    2003-01-01

    Evidence was found that supports the existence of a major gene (designated as the slick hair gene), dominant in mode of inheritance, that is responsible for producing a very short, sleek hair coat. Cattle with slick hair were observed to maintain lower rectal temperatures (RT). The gene is found in Senepol cattle and criollo (Spanish origin) breeds in Central and South America. This gene is also found in a Venezuelan composite breed, the Carora, formed from the Brown Swiss and a Venezuelan criollo breed. Two sets of backcross matings of normal-haired sire breeds to Senepol crossbred dams assumed to be heterozygous for the slick hair gene resulted in ratios of slick to normal-haired progeny that did not significantly differ from 1:1. Data from Carora x Holstein crossbred cows in Venezuela also support the concept of a major gene that is responsible for the slick hair coat of the Carora breed. Cows that were 75% Holstein: 25% Carora in breed composition segregated with a ratio that did not differ from 1:1, as would be expected from a backcross matinginvolving a dominant gene. The effect of the slick hair gene on RT depended on the degree of heat stress and appeared to be affected by age and/or lactation status. The decreased RT observed for slick-haired crossbred calves compared to normal-haired contemporaries ranged from 0.18 to 0.4 degrees C. An even larger decrease in RT (0.61 degrees C; P < 0.01) was observed in lactating Carora x Holstein F1 crossbred cows, even though it did not appear that these cows were under severe heat stress. The improved thermotolerance of crossbred calves due to their slick hair coats did not result in increased weaning weights, possibly because both the slick and normal-haired calves were being nursed by slick-haired dams. There were indications that the slick-haired calves grew faster immediately following weaning and that their growth during the cooler months of the year was not compromised significantly by their reduced quantity of

  9. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    PubMed

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  10. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    PubMed Central

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  11. TWO MAJOR RESISTANCE GENES CONFER RESISTANCE TO RACE SHIFT ISOLATES OVERCOMING BLAST RESISTANCE GENC PI-TA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    One of the major challenges for blast disease management is that major resistance genes are often defeated by new virulent isolates. The goal of this project is to identify and characterize blast resistance genes to facilitate the development of blast resistant US cultivars by marker-assisted selec...

  12. Prediction of cancer class with majority voting genetic programming classifier using gene expression data.

    PubMed

    Paul, Topon Kumar; Iba, Hitoshi

    2009-01-01

    In order to get a better understanding of different types of cancers and to find the possible biomarkers for diseases, recently, many researchers are analyzing the gene expression data using various machine learning techniques. However, due to a very small number of training samples compared to the huge number of genes and class imbalance, most of these methods suffer from overfitting. In this paper, we present a majority voting genetic programming classifier (MVGPC) for the classification of microarray data. Instead of a single rule or a single set of rules, we evolve multiple rules with genetic programming (GP) and then apply those rules to test samples to determine their labels with majority voting technique. By performing experiments on four different public cancer data sets, including multiclass data sets, we have found that the test accuracies of MVGPC are better than those of other methods, including AdaBoost with GP. Moreover, some of the more frequently occurring genes in the classification rules are known to be associated with the types of cancers being studied in this paper. PMID:19407358

  13. A major gene for IGF-I serum concentration interacts with diet in Mexican Americans

    SciTech Connect

    Blangero, J.; Mahaney, M.C.; Comuzzie, A.G.

    1994-09-01

    Insulin-like growth factor-I (IGF-I) is an important regulator of cell growth/differentiation and exhibits insulin-like metabolic effects on glucose homeostasis. Serum levels of IGF-I decrease markedly with age and are partly regulated by nutritional factors such as protein intake. To better understand the role of genes and genotype x environment interaction in the determination of normal IGF-I variation, we measured IGF-I serum levels in 422 Mexican Americans distributed in 23 pedigrees. Information on dietary intake was obtained for each individual using a food frequency questionnaire. Using an extension of segregation analysis that allows for genotype x environment interaction, we found clear evidence for the effect of a major gene influencing IGF-I levels. The estimated frequency of an allele (A) associated with lowered IGF-I levels was 0.54{+-}0.05. Likelihood ratio tests also revealed strong evidence for genotype x sex, genotype x age, and genotype x diet interaction. Individuals with genotypes AA and Aa showed a less marked decline in IGF-I levels with age than that observed for the aa genotype. Similarly, in aa individuals, IGF-I concentration exhibited a much stronger positive relationship with the relative intake of dietary protein and carbohydrate than that observed in the other genotypes. Because of this genotype x environment interaction, the relative phenotypic variance attributable to the major gene is highly dependent upon age and diet.

  14. The major resistance gene cluster in lettuce is highly duplicated and spans several megabases.

    PubMed Central

    Meyers, B C; Chin, D B; Shen, K A; Sivaramakrishnan, S; Lavelle, D O; Zhang, Z; Michelmore, R W

    1998-01-01

    At least 10 Dm genes conferring resistance to the oomycete downy mildew fungus Bremia lactucae map to the major resistance cluster in lettuce. We investigated the structure of this cluster in the lettuce cultivar Diana, which contains Dm3. A deletion breakpoint map of the chromosomal region flanking Dm3 was saturated with a variety of molecular markers. Several of these markers are components of a family of resistance gene candidates (RGC2) that encode a nucleotide binding site and a leucine-rich repeat region. These motifs are characteristic of plant disease resistance genes. Bacterial artificial chromosome clones were identified by using duplicated restriction fragment length polymorphism markers from the region, including the nucleotide binding site-encoding region of RGC2. Twenty-two distinct members of the RGC2 family were characterized from the bacterial artificial chromosomes; at least two additional family members exist. The RGC2 family is highly divergent; the nucleotide identity was as low as 53% between the most distantly related copies. These RGC2 genes span at least 3.5 Mb. Eighteen members were mapped on the deletion breakpoint map. A comparison between the phylogenetic and physical relationships of these sequences demonstrated that closely related copies are physically separated from one another and indicated that complex rearrangements have shaped this region. Analysis of low-copy genomic sequences detected no genes, including RGC2, in the Dm3 region, other than sequences related to retrotransposons and transposable elements. The related but divergent family of RGC2 genes may act as a resource for the generation of new resistance phenotypes through infrequent recombination or unequal crossing over. PMID:9811791

  15. Systematic silencing of benzylisoquinoline alkaloid biosynthetic genes reveals the major route to papaverine in opium poppy.

    PubMed

    Desgagné-Penix, Isabel; Facchini, Peter J

    2012-10-01

    Papaverine, a major benzylisoquinoline alkaloid in opium poppy (Papaver somniferum), is used as a vasodilator and antispasmodic. Conversion of the initial intermediate (S)-norcoclaurine to papaverine involves 3'-hydroxylation, four O-methylations and dehydrogenation. However, our understanding of papaverine biosynthesis remains controversial more than a century after an initial scheme was proposed. In vitro assays and in vivo labeling studies have been insufficient to establish the sequence of conversions, the potential role of the intermediate (S)-reticuline, and the enzymes involved. We used virus-induced gene silencing in opium poppy to individually suppress the expression of six genes with putative roles in papaverine biosynthesis. Suppression of the gene encoding coclaurine N-methyltransferase dramatically increased papaverine levels at the expense of N-methylated alkaloids, indicating that the main biosynthetic route to papaverine proceeds via N-desmethylated compounds rather than through (S)-reticuline. Suppression of genes encoding (S)-3'-hydroxy-N-methylcoclaurine 4-O-methyltransferase and norreticuline 7-O-methyltransferase, which accept certain N-desmethylated alkaloids, reduced papaverine content. In contrast, suppression of genes encoding N-methylcoclaurine 3'-hydroxylase or reticuline 7-O-methyltransferase, which are specific for N-methylated alkaloids, did not affect papaverine levels. Suppression of norcoclaurine 6-O-methyltransferase transcript levels significantly suppressed total alkaloid accumulation, implicating (S)-coclaurine as a key branch-point intermediate. The differential detection of N-desmethylated compounds in response to suppression of specific genes highlights the primary route to papaverine. PMID:22725256

  16. Association of carbamazepine major metabolism and transport pathway gene polymorphisms and pharmacokinetics in patients with epilepsy

    PubMed Central

    Puranik, Yogita Ghodke; Birnbaum, Angela K; Marino, Susan E; Ahmed, Ghada; Cloyd, James C; Remmel, Rory P; Leppik, Ilo E; Lamba, Jatinder K

    2013-01-01

    Aim The aim of this study was to evaluate the association of genetic variants in the major genes involved in carbamazepine (CBZ) metabolism and transport with its pharmacokinetics in epilepsy patients. Materials & methods Twenty-five SNPs within seven CBZ pathway genes, namely CYP3A4, CYP3A5, EPHX1, NR1I2, UGT2B7, ABCB1 and ABCC2, were analyzed for association with CBZ pharmacokinetics in 90 epilepsy patients. Results The CYP3A4*1B SNP was significantly associated with CBZ clearance. Significant association of EPHX1 SNPs was observed with greater carbamazepine-10,11-trans dihydrodiol:carbamazepine 10-11 epoxide ratios. Among drug transporters, ABCB1 and ABCC2 SNPs were significantly associated with altered CBZ clearance. Conclusion SNPs within CBZ pathway genes contribute to interpatient variation in CBZ pharmacokinetics and might contribute to pharmacoresistant epilepsy. Although our results need further clinical validation in a larger patient cohort, they indicate that genetic variation in CBZ pathway genes could influence its pharmacokinetics, and hence would have clinical significance. PMID:23252947

  17. The neuronal transporter gene SLC6A15 confers risk to major depression.

    PubMed

    Kohli, Martin A; Lucae, Susanne; Saemann, Philipp G; Schmidt, Mathias V; Demirkan, Ayse; Hek, Karin; Czamara, Darina; Alexander, Michael; Salyakina, Daria; Ripke, Stephan; Hoehn, David; Specht, Michael; Menke, Andreas; Hennings, Johannes; Heck, Angela; Wolf, Christiane; Ising, Marcus; Schreiber, Stefan; Czisch, Michael; Müller, Marianne B; Uhr, Manfred; Bettecken, Thomas; Becker, Albert; Schramm, Johannes; Rietschel, Marcella; Maier, Wolfgang; Bradley, Bekh; Ressler, Kerry J; Nöthen, Markus M; Cichon, Sven; Craig, Ian W; Breen, Gerome; Lewis, Cathryn M; Hofman, Albert; Tiemeier, Henning; van Duijn, Cornelia M; Holsboer, Florian; Müller-Myhsok, Bertram; Binder, Elisabeth B

    2011-04-28

    Major depression (MD) is one of the most prevalent psychiatric disorders and a leading cause of loss in work productivity. A combination of genetic and environmental risk factors probably contributes to MD. We present data from a genome-wide association study revealing a neuron-specific neutral amino acid transporter (SLC6A15) as a susceptibility gene for MD. Risk allele carrier status in humans and chronic stress in mice were associated with a downregulation of the expression of this gene in the hippocampus, a brain region implicated in the pathophysiology of MD. The same polymorphisms also showed associations with alterations in hippocampal volume and neuronal integrity. Thus, decreased SLC6A15 expression, due to genetic or environmental factors, might alter neuronal circuits related to the susceptibility for MD. Our convergent data from human genetics, expression studies, brain imaging, and animal models suggest a pathophysiological mechanism for MD that may be accessible to drug targeting. PMID:21521612

  18. The neuronal transporter gene SLC6A15 confers risk to major depression

    PubMed Central

    Kohli, Martin A.; Lucae, Susanne; Saemann, Philipp G.; Schmidt, Mathias V.; Demirkan, Ayse; Hek, Karin; Czamara, Darina; Alexander, Michael; Salyakina, Daria; Ripke, Stephan; Hoehn, David; Specht, Michael; Menke, Andreas; Hennings, Johannes; Heck, Angela; Wolf, Christiane; Ising, Marcus; Schreiber, Stefan; Czisch, Michael; Müller, Marianne B.; Uhr, Manfred; Bettecken, Thomas; Becker, Albert; Schramm, Johannes; Rietschel, Marcella; Maier, Wolfgang; Bradley, Bekh; Ressler, Kerry J.; Nöthen, Markus M.; Cichon, Sven; Craig, Ian W.; Breen, Gerome; Lewis, Cathryn M.; Hofman, Albert; Tiemeier, Henning; van Duijn, Cornelia M.; Holsboer, Florian; Müller-Myhsok, Bertram; Binder, Elisabeth B.

    2011-01-01

    Major depression (MD) is one of the most prevalent psychiatric disorders and a leading cause of loss in work productivity. A combination of genetic and environmental risk factors likely contributes to MD. We present data from a genome-wide association study revealing a neuron-specific neutral amino acid transporter (SLC6A15) as a novel susceptibility gene for MD. Risk allele carrier status in humans and chronic stress in mice were associated with a downregulation of the expression of this gene in the hippocampus, a brain region implicated in the pathophysiology of MD. The same polymorphisms also showed associations with alterations in hippocampal volume and neuronal integrity. Thus, decreased SLC6A15 expression, due to genetic or environmental factors might alter neuronal circuits related to the susceptibility for MD. Our convergent data from human genetics, expression studies, brain imaging and animal models suggest a novel pathophysiological mechanism for MD that may be accessible to drug targeting. PMID:21521612

  19. Integrated Genomic and Gene Expression Profiling Identifies Two Major Genomic Circuits in Urothelial Carcinoma

    PubMed Central

    Lindgren, David; Sjödahl, Gottfrid; Lauss, Martin; Staaf, Johan; Chebil, Gunilla; Lövgren, Kristina; Gudjonsson, Sigurdur; Liedberg, Fredrik; Patschan, Oliver; Månsson, Wiking; Fernö, Mårten; Höglund, Mattias

    2012-01-01

    Similar to other malignancies, urothelial carcinoma (UC) is characterized by specific recurrent chromosomal aberrations and gene mutations. However, the interconnection between specific genomic alterations, and how patterns of chromosomal alterations adhere to different molecular subgroups of UC, is less clear. We applied tiling resolution array CGH to 146 cases of UC and identified a number of regions harboring recurrent focal genomic amplifications and deletions. Several potential oncogenes were included in the amplified regions, including known oncogenes like E2F3, CCND1, and CCNE1, as well as new candidate genes, such as SETDB1 (1q21), and BCL2L1 (20q11). We next combined genome profiling with global gene expression, gene mutation, and protein expression data and identified two major genomic circuits operating in urothelial carcinoma. The first circuit was characterized by FGFR3 alterations, overexpression of CCND1, and 9q and CDKN2A deletions. The second circuit was defined by E3F3 amplifications and RB1 deletions, as well as gains of 5p, deletions at PTEN and 2q36, 16q, 20q, and elevated CDKN2A levels. TP53/MDM2 alterations were common for advanced tumors within the two circuits. Our data also suggest a possible RAS/RAF circuit. The tumors with worst prognosis showed a gene expression profile that indicated a keratinized phenotype. Taken together, our integrative approach revealed at least two separate networks of genomic alterations linked to the molecular diversity seen in UC, and that these circuits may reflect distinct pathways of tumor development. PMID:22685613

  20. The Spectrum of Major Seed Storage Genes and Proteins in Oats (Avena sativa)

    PubMed Central

    Anderson, Olin D.

    2014-01-01

    Background The oat seed storage proteins are mainly composed of two classes: the globulins and avenins. Among the major cereals, the globulins are the major seed protein class in rice and oats, and along with the higher protein content of oats is the basis for the relative higher nutrition content in oats compared to the other cereals. The second major class of oat seed proteins is the avenins; also classified as prolamins – seed proteins high in proline and glutamine amino acids. The prolamins are associated with celiac disease, an autoimmune disorder of the gastrointestinal tract. In spite of their importance, neither the oat globulins nor the avenins have been completely analyzed and described for any single germplasm. Results Using available EST resources for a single hexaploid oat cultivar, the spectrum of avenin and globulin sequences are described for the gene coding regions and the derived protein sequences. The nine unique avenin sequences are suggested to be divided into 3–4 distinct subclasses distributed in the hexaploid genome. The globulins from the same germplasm include 24 distinct sequences. Variation in globulin size results mainly from a glutamine-rich domain, similar to as in the avenins, and to variation in the C-terminal sequence domain. Two globulin genes have premature stop codons that shorten the resulting polypeptides by 9 and 17 amino acids, and eight of the globulin sequences form a branch of the globulins not previously reported. Conclusions A more complete description of the major oat seed proteins should allow a more thorough analysis of their contributions to those oat seed characteristics related to nutritional value, evolutionary history, and celiac disease association. PMID:25054628

  1. Search for major genes with progeny test data to accelerate the development of genetically superior loblolly pine

    SciTech Connect

    NCSU

    2003-12-30

    This research project is to develop a novel approach that fully utilized the current breeding materials and genetic test information available from the NCSU-Industry Cooperative Tree Improvement Program to identify major genes that are segregating for growth and disease resistance in loblolly pine. If major genes can be identified in the existing breeding population, they can be utilized directly in the conventional loblolly pine breeding program. With the putative genotypes of parents identified, tree breeders can make effective decisions on management of breeding populations and operational deployment of genetically superior trees. Forest productivity will be significantly enhanced if genetically superior genotypes with major genes for economically important traits could be deployed in an operational plantation program. The overall objective of the project is to develop genetic model and analytical methods for major gene detection with progeny test data and accelerate the development of genetically superior loblolly pine. Specifically, there are three main tasks: (1) Develop genetic models for major gene detection and implement statistical methods and develop computer software for screening progeny test data; (2) Confirm major gene segregation with molecular markers; and (3) Develop strategies for using major genes for tree breeding.

  2. CREB1 gene polymorphisms combined with environmental risk factors increase susceptibility to major depressive disorder (MDD)

    PubMed Central

    Wang, Peng; Yang, Yanjie; Yang, Xiuxian; Qiu, Xiaohui; Qiao, Zhengxue; Wang, Lin; Zhu, Xiongzhao; Sui, Hong; Ma, Jingsong

    2015-01-01

    Major depressive disorder (MDD) is one of the most severe psychiatric disorders. The objective of this study was to explore the effects of CREB1 gene polymorphisms on risk of developing MDD and the joint effects of gene-environment interactions. Genotyping was performed by Taqman allelic discrimination assay among 586 patients and 586 healthy controls. A significant impact on rs6740584 genotype distribution was found for childhood trauma (P = 0.015). We did not find an association of CREB1 polymorphisms with MDD susceptibility. However, we found a significantly increased risk associated with the interactions of CREB1 polymorphisms and drinking (OR = 11.67, 95% CI = 2.52-54.18; OR = 11.52, 95% CI = 2.55-51.95 for rs11904814; OR = 4.18, 95% CI = 1.87-9.38; OR = 5.02, 95% CI = 2.27-11.14 for rs6740584; OR = 7.58, 95% CI = 2.05-27.98; OR = 7.59, 95% CI = 2.12-27.14 for rs2553206; OR = 8.37, 95% CI = 3.02-23.23; OR = 7.84, 95% CI = 2.93-20.98 for rs2551941). We also noted that CREB polymorphisms combined with family harmony and childhood trauma conferred increased susceptibility for MDD. In conclusion, polymorphisms in the CREB gene may not be independently associated with MDD risk, but they are likely to confer increased susceptibility by interacting with environmental risk factors in the Chinese population. PMID:25755794

  3. Mapping a Major Gene for Resistance to Rift Valley Fever Virus in Laboratory Rats.

    PubMed

    Busch, Catherine M; Callicott, Ralph J; Peters, Clarence J; Morrill, John C; Womack, James E

    2015-01-01

    The Rift Valley Fever virus (RVFV) presents an epidemic and epizootic threat in sub-Saharan Africa, Egypt, and the Arabian Peninsula, and has furthermore recently gained attention as a potential weapon of bioterrorism due to its ability to infect both livestock and humans. Inbred rat strains show similar characteristic responses to the disease as humans and livestock, making them a suitable model species. Previous studies had indicated differences in susceptibility to RVFV hepatic disease among various rat strains, including a higher susceptibility of Wistar-Furth (WF) compared to a more resistant Lewis (LEW) strain. Further study revealed that this resistance trait exhibits the pattern of a major dominant gene inherited in Mendelian fashion. A genome scan of a congenic WF.LEW strain, created from the susceptible WF and resistant LEW strains and itself resistant to infection with RVFV, revealed 2 potential regions for the location of the gene, 1 on chromosome 3 and the other on chromosome 9. Through backcrossing of WF.LEW rats to WF rats, genotyping offspring using SNPs and microsatellites, and viral challenges of 3 N1 litters, we have mapped the gene to the distal end of chromosome 3. PMID:26546799

  4. HOX genes: Major actors in resistance to selective endocrine response modifiers.

    PubMed

    Jin, Kideok; Sukumar, Saraswati

    2016-04-01

    Long term treatment with therapies aimed at blocking the estrogen- (ER) or androgen receptor (AR) action often leads to the development of resistance to selective modulators of the estrogen receptor (SERMs) in ERα-positive breast cancer, or of the androgen receptor (SARMs) in AR-positive prostate cancer. Many underlying molecular events that confer resistance are known, but a unifying theme is yet to be revealed. Receptor tyrosine kinases (RTKs) such EGFR, ERBB2 and IGF1R are major mediators that can directly alter cellular response to the SERM, tamoxifen, but the mechanisms underlying increased expression of RTKs are not clear. A number of HOX genes and microRNAs and non-coding RNAs residing in the HOX cluster, have been identified as important independent predictors of endocrine resistant breast cancer. Recently, convincing evidence has accumulated that several members belonging to the four different HOX clusters contribute to endocrine therapy resistant breast cancer, but the mechanisms remain obscure. In this article, we have reviewed recent progress in understanding of the functioning of HOX genes and regulation of their expression by hormones. We also discuss, in particular, the contributions of several members of the HOX gene family to endocrine resistant breast cancer. PMID:26803986

  5. ITIH family genes confer risk to schizophrenia and major depressive disorder in the Han Chinese population.

    PubMed

    He, Kuanjun; Wang, Qingzhong; Chen, Jianhua; Li, Tao; Li, Zhiqiang; Li, Wenjin; Wen, Zujia; Qiang, Yu; Wang, Meng; Shen, Jiawei; Song, Zhijian; Ji, Jue; Feng, Guoyin; Qi, Shuguang; Lin, He; Shi, Yongyong; Cheng, Zaohuo

    2014-06-01

    As a major extracellular matrix component, ITIHs played an important role in inflammation and carcinogenesis. Several genome-wide association studies have reported that some positive signals which were derived from the tight linkage disequilibrium region on chromosome 3p21 were associated with both schizophrenia and bipolar disorders in the Caucasian population. To further investigate whether this genomic region is also a susceptibility locus of schizophrenia and major depressive disorder in the Han Chinese population, we conducted this study by recruiting 1235 schizophrenia patients, 1045 major depressive disorder patients and 1235 healthy control subjects in the Han Chinese samples for a case-control study. We genotyped seven SNPs within this region using TaqMan® technology. We found that rs2710322 was significantly associated with schizophrenia (adjusted P(allele) = 0.0018, adjusted P(genotype) = 0.006, OR [95% CI] = 1.278 [1.117-1.462]) while rs1042779 was weakly associated with schizophrenia (adjusted P(allele) = 0.048, OR [95% CI] = 1.164 [1.040-1.303]) and major depressive disorder (adjusted P(allele) = 0.042, OR [95% CI] = 1.178 [1.047-1.326]); it was also our finding that rs3821831 was positively associated with major depressive disorder (adjusted P(allele) = 0.003, adjusted P(genotype) = 0.006, OR [95% CI] = 1.426 [1.156-1.760]). Furthermore, no haplotype was found to be associated with schizophrenia and major depressive disorder. Via the association analysis which combines the schizophrenia and major depressive disorder cases, we also notice that rs1042779 and rs3821831 were significantly associated with combined cases (rs1042779: adjusted P(allele) = 0.012, adjusted P(genotype) = 0.018, OR [95% CI] = 1.171 [1.060-1.292]; rs3821831:adjusted P(genotype) = 0.012, OR [95% CI] = 1.193 [1.010-1.410]). Our results revealed that the shared genetic risk factors of both schizophrenia and major depressive disorder exist in ITIH family genes in the Han Chinese

  6. Segregation analysis of blood oxygen saturation in broilers suggests a major gene influence on ascites.

    PubMed

    Navarro, P; Visscher, P M; Chatziplis, D; Koerhuis, A N M; Haley, C S

    2006-12-01

    1. Blood oxygen saturation (SaO) is a potential indicator trait for resistance to ascites in chickens. 2. The objective of the study was to investigate the genetic architecture of SaO in a meat-type chicken line reared in commercial conditions. 3. Data were collected over 15 generations of selection and were divided into two data sets on the basis of a change in recording age from 6 to 5 weeks of age, approximately halfway through the period. The resulting pedigrees comprised in excess of 90,000 birds each and, on average, 12% of these birds had SaO records. 4. Segregation analyses of SaO were carried out assuming a mixed inheritance model that included a major locus segregating in a polygenic background. 5. The analyses suggest that a major gene is involved in the genetic control of SaO in this line. The putative gene acts in a dominant fashion and has an additive effect of around 0.90 sigma(p), equivalent to a predicted difference in SaO between the two homozygous classes of more than 10%. The frequency of the allele that increases SaO changed from 0.53 to 0.65 from the first to the second set of data, consistent with selection on SaO scores. 6. Using estimated genotype probabilities at the putative major locus, we inferred that it acts in an overdominant fashion on body weight and fleshing score. If the low SaO allele leads to susceptibility to ascites, its combined effects are consistent with it being maintained in the population by a balance of natural selection on fitness nad artificial selection on growth and carcase traits. 7. Even with selection on both SaO and growth traits, the combined genotypic effects would make it difficult to remove the unfavourable low-SaO allele by means of traditional selection without the use of genetic markers. PMID:17190674

  7. Timing major conflict between mitochondrial and nuclear genes in species relationships of Polygonia butterflies (Nymphalidae: Nymphalini)

    PubMed Central

    Wahlberg, Niklas; Weingartner, Elisabet; Warren, Andrew D; Nylin, Sören

    2009-01-01

    Background Major conflict between mitochondrial and nuclear genes in estimating species relationships is an increasingly common finding in animals. Usually this is attributed to incomplete lineage sorting, but recently the possibility has been raised that hybridization is important in generating such phylogenetic patterns. Just how widespread ancient and/or recent hybridization is in animals and how it affects estimates of species relationships is still not well-known. Results We investigate the species relationships and their evolutionary history over time in the genus Polygonia using DNA sequences from two mitochondrial gene regions (COI and ND1, total 1931 bp) and four nuclear gene regions (EF-1α, wingless, GAPDH and RpS5, total 2948 bp). We found clear, strongly supported conflict between mitochondrial and nuclear DNA sequences in estimating species relationships in the genus Polygonia. Nodes at which there was no conflict tended to have diverged at the same time when analyzed separately, while nodes at which conflict was present diverged at different times. We find that two species create most of the conflict, and attribute the conflict found in Polygonia satyrus to ancient hybridization and conflict found in Polygonia oreas to recent or ongoing hybridization. In both examples, the nuclear gene regions tended to give the phylogenetic relationships of the species supported by morphology and biology. Conclusion Studies inferring species-level relationships using molecular data should never be based on a single locus. Here we show that the phylogenetic hypothesis generated using mitochondrial DNA gives a very different interpretation of the evolutionary history of Polygonia species compared to that generated from nuclear DNA. We show that possible cases of hybridization in Polygonia are not limited to sister species, but may be inferred further back in time. Furthermore, we provide more evidence that Haldane's effect might not be as strong a process in

  8. Effect of serotonin receptor 2A gene polymorphism on mirtazapine response in major depression.

    PubMed

    Kang, Rhee-Hun; Choi, Myoung-Jin; Paik, Jong-Woo; Hahn, Sang-Woo; Lee, Min-Soo

    2007-01-01

    The 5-HTR2A gene is a candidate gene for influencing the clinical response to treatment with antidepressants. The purpose of this study was to determine the relationship between the -1438A/G polymorphism of the 5-HTR2A gene and the response to mirtazapine in a Korean population with major depressive disorder. Mirtazapine was administered for eight weeks to the 101 patients who completed the study, during which we evaluated the clinical outcome using repeated-measures ANCOVA. A main effect of genotype or an effect of genotype-time interactions on the decrease in HAMD score during the eight-week follow-up was not found, which suggests that the 5-HTR2A -1438A/G polymorphism does not affect the clinical outcome to mirtazapine administration. However, significant effects of genotype and allele carriers on the decrease in the sleep score over the eight weeks were found (genotype: F = 4.093, p = 0.017; allele: F = 4.371, p = 0.037), whereas no effect of genotype-time interactions on the decrease in the HAMD score over the eight-week follow-up was found. These observations suggest that the -1438A/G polymorphism on the sleep improvement at each time period revealed significant differences in the sleep scores after two weeks of mirtazapine administration. The sleep scores were lower for carriers of the A+ allele than of the A- allele after two weeks of mirtazapine administration (p = 0.041), which means that the -1438GG genotype is associated with less improvement in sleep, and suggests that the effect of mirtazapine on improving the sleep quality differs with the 5-HTR2A -1438A/G polymorphism within two weeks of mirtazapine treatment. In conclusion, although the -1438A/G polymorphism affects the sleep improvement resulting from the administration of mirtazapine to Korean patients with major depressive disorder, our results do not support the hypothesis that this polymorphism of the 5-HTR2A gene is involved in the therapeutic response to mirtazapine. PMID:18314859

  9. Search for major genes with progeny test data to accelerate the development of genetically superior loblolly pine. Technical progress report

    SciTech Connect

    2000-02-15

    This report details the progress of the three tasks of this project. The tasks are: (1) develop genetic models and analytical methods; (2) molecular confirmation of major gene segregation; and (3) develop strategies for marker-assisted breeding.

  10. Systematic search for major genes in schizophrenia: Methodological issues and results from chromosome 12

    SciTech Connect

    Dawson, E.; Powell, J.F.; Sham, P.

    1995-10-09

    We describe a method of systematically searching for major genes in disorders of unknown mode of inheritance, using linkage analysis. Our method is designed to minimize the probability of missing linkage due to inadequate exploration of data. We illustrate this method with the results of a search for a locus for schizophrenia on chromosome 12 using 22 highly polymorphic markers in 23 high density pedigrees. The markers span approximately 85-90% of the chromosome and are on average 9.35 cM apart. We have analysed the data using the most plausible current genetic models and allowing for the presence of genetic heterogeneity. None of the markers was supportive of linkage and the distribution of the heterogeneity statistics was in accordance with the null hypothesis. 53 refs., 2 figs., 4 tabs.

  11. Oral-facial-digital syndrome type VI: is C5orf42 really the major gene?

    PubMed

    Romani, Marta; Mancini, Francesca; Micalizzi, Alessia; Poretti, Andrea; Miccinilli, Elide; Accorsi, Patrizia; Avola, Emanuela; Bertini, Enrico; Borgatti, Renato; Romaniello, Romina; Ceylaner, Serdar; Coppola, Giangennaro; D'Arrigo, Stefano; Giordano, Lucio; Janecke, Andreas R; Lituania, Mario; Ludwig, Kathrin; Martorell, Loreto; Mazza, Tommaso; Odent, Sylvie; Pinelli, Lorenzo; Poo, Pilar; Santucci, Margherita; Signorini, Sabrina; Simonati, Alessandro; Spiegel, Ronen; Stanzial, Franco; Steinlin, Maja; Tabarki, Brahim; Wolf, Nicole I; Zibordi, Federica; Boltshauser, Eugen; Valente, Enza Maria

    2015-01-01

    Oral-facial-digital type VI syndrome (OFDVI) is a rare phenotype of Joubert syndrome (JS). Recently, C5orf42 was suggested as the major OFDVI gene, being mutated in 9 of 11 families (82 %). We sequenced C5orf42 in 313 JS probands and identified mutations in 28 (8.9 %), most with a phenotype of pure JS. Only 2 out of 17 OFDVI patients (11.7 %) were mutated. A comparison of mutated vs. non-mutated OFDVI patients showed that preaxial and mesoaxial polydactyly, hypothalamic hamartoma and other congenital defects may predict C5orf42 mutations, while tongue hamartomas are more common in negative patients. PMID:25407461

  12. A family of heat shock protein 70-related genes are expressed in the promastigotes of Leishmania major.

    PubMed Central

    Searle, S; Campos, A J; Coulson, R M; Spithill, T W; Smith, D F

    1989-01-01

    We describe the isolation and characterisation of two novel genes of the parasitic protozoan Leishmania major that are related by nucleotide sequence homology to eukaryotic genes encoding 70 Kd. heat shock proteins. The transcription of neither gene is heat-inducible but both are constituitively-expressed throughout the promastigote stage of the parasite life cycle. A third gene shows differential expression between non-infective and infective promastigote stages in the absence of any temperature change. These genes are related by sequence homology to the tandemly-repeated hsp70 genes of trypanosomatids, but are located on different, dispersed chromosomes within the genome of L. major. The open reading frame for translation derived from one of these sequences contains a putative mitochondrial signal peptide at its amino-terminus. Images PMID:2762121

  13. NF1 gene mutations represent the major molecular event underlying neurofibromatosis-Noonan syndrome.

    PubMed

    De Luca, Alessandro; Bottillo, Irene; Sarkozy, Anna; Carta, Claudio; Neri, Cinzia; Bellacchio, Emanuele; Schirinzi, Annalisa; Conti, Emanuela; Zampino, Giuseppe; Battaglia, Agatino; Majore, Silvia; Rinaldi, Maria M; Carella, Massimo; Marino, Bruno; Pizzuti, Antonio; Digilio, Maria Cristina; Tartaglia, Marco; Dallapiccola, Bruno

    2005-12-01

    Neurofibromatosis type 1 (NF1) demonstrates phenotypic overlap with Noonan syndrome (NS) in some patients, which results in the so-called neurofibromatosis-Noonan syndrome (NFNS). From a genetic point of view, NFNS is a poorly understood condition, and controversy remains as to whether it represents a variable manifestation of either NF1 or NS or is a distinct clinical entity. To answer this question, we screened a cohort with clinically well-characterized NFNS for mutations in the entire coding sequence of the NF1 and PTPN11 genes. Heterozygous NF1 defects were identified in 16 of the 17 unrelated subjects included in the study, which provides evidence that mutations in NF1 represent the major molecular event underlying this condition. Lesions included nonsense mutations, out-of-frame deletions, missense changes, small inframe deletions, and one large multiexon deletion. Remarkably, a high prevalence of inframe defects affecting exons 24 and 25, which encode a portion of the GAP-related domain of the protein, was observed. On the other hand, no defect in PTPN11 was observed, and no lesion affecting exons 11-27 of the NF1 gene was identified in 100 PTPN11 mutation-negative subjects with NS, which provides further evidence that NFNS and NS are genetically distinct disorders. These results support the view that NFNS represents a variant of NF1 and is caused by mutations of the NF1 gene, some of which have been demonstrated to cause classic NF1 in other individuals. PMID:16380919

  14. DNA Methylation Analysis of the Angiotensin Converting Enzyme (ACE) Gene in Major Depression

    PubMed Central

    Zill, Peter; Baghai, Thomas C.; Schüle, Cornelius; Born, Christoph; Früstück, Clemens; Büttner, Andreas; Eisenmenger, Wolfgang; Varallo-Bedarida, Gabriella; Rupprecht, Rainer; Möller, Hans-Jürgen; Bondy, Brigitta

    2012-01-01

    Background The angiotensin converting enzyme (ACE) has been repeatedly discussed as susceptibility factor for major depression (MD) and the bi-directional relation between MD and cardiovascular disorders (CVD). In this context, functional polymorphisms of the ACE gene have been linked to depression, to antidepressant treatment response, to ACE serum concentrations, as well as to hypertension, myocardial infarction and CVD risk markers. The mostly investigated ACE Ins/Del polymorphism accounts for ∼40%–50% of the ACE serum concentration variance, the remaining half is probably determined by other genetic, environmental or epigenetic factors, but these are poorly understood. Materials and Methods The main aim of the present study was the analysis of the DNA methylation pattern in the regulatory region of the ACE gene in peripheral leukocytes of 81 MD patients and 81 healthy controls. Results We detected intensive DNA methylation within a recently described, functional important region of the ACE gene promoter including hypermethylation in depressed patients (p = 0.008) and a significant inverse correlation between the ACE serum concentration and ACE promoter methylation frequency in the total sample (p = 0.02). Furthermore, a significant inverse correlation between the concentrations of the inflammatory CVD risk markers ICAM-1, E-selectin and P-selectin and the degree of ACE promoter methylation in MD patients could be demonstrated (p = 0.01 - 0.04). Conclusion The results of the present study suggest that aberrations in ACE promoter DNA methylation may be an underlying cause of MD and probably a common pathogenic factor for the bi-directional relationship between MD and cardiovascular disorders. PMID:22808171

  15. Evidence of Localized Prophage-Host Recombination in the lytA Gene, Encoding the Major Pneumococcal Autolysin ▿

    PubMed Central

    Morales, María; García, Pedro; de la Campa, Adela G.; Liñares, Josefina; Ardanuy, Carmen; García, Ernesto

    2010-01-01

    According to a highly polymorphic region in the lytA gene, encoding the major autolysin of Streptococcus pneumoniae, two different families of alleles can be differentiated by PCR and restriction digestion. Here, we provide evidence that this polymorphic region arose from recombination events with homologous genes of pneumococcal temperate phages. PMID:20304992

  16. Gene expression and association analysis of LIM (PDLIM5) in major depression.

    PubMed

    Iga, Jun-ichi; Ueno, Shu-ichi; Yamauchi, Ken; Numata, Shusuke; Motoki, Ikuyo; Tayoshi, Sumiko; Kinouchi, Sawako; Ohta, Koshi; Song, Hongwei; Morita, Kyoko; Rokutan, Kazuhito; Tanabe, Hirotaka; Sano, Akira; Ohmori, Tetsuro

    2006-06-12

    LIM (PDLIM5) is a small protein that interacts with protein kinase C-epsilon and the N-type calcium channel alpha-1B subunit and modulates neuronal calcium signaling. Recently, the LIM mRNA expression in postmortem brains and immortalized lymphoblastoid cells from mood disorder patients was reported to be changed and seems to be involved in its pathophysiology. We hypothesized that the expression of the LIM mRNA in the native peripheral leukocytes may be a good candidate for the biological marker for mood disorders. Twenty patients with major depression and age- and sex-matched control subjects were included in this expression study. The LIM mRNA levels in the peripheral leukocytes from drug-naive depressive patients were significantly lower than those from control subjects and increased significantly after 4-week paroxetine treatments, to almost the same level as controls'. Hamilton depressive scores (HAM-D) were improved about 50% after 4-week treatment but neither paroxetine concentrations nor the changes of HAM-D scores showed significant correlation with the change of the mRNA levels. Then, we genotyped three single nucleotide polymorphic markers of LIM gene, which were reported to be associated with bipolar disorder in patients with major depression and control subjects (n=130, each), but there were no associations between these SNPs and major depression. Our investigation indicates that the lower expression levels of LIM mRNA in the peripheral leukocytes are associated with the depressive state and that its recovery after treatment may be an adaptive change induced by the antidepressant. PMID:16595163

  17. [Evaluation of the histocompatibility of endodontic cement in subcutaneous connective tissue using three methods].

    PubMed

    Ferraz, S L; Birman, E G; Antoniazzi, J H; Magalhães, J

    1990-01-01

    It was employed three methods to evaluate the histocompatibility of a root canal filling cement, as the N-Rickert paste: implantation of round glass cover slips, polyethylene tubes and pellets of the cement. The results demonstrated qualitative and quantitative differences among the methods utilized indicating as a good toll the use of glass cover slips covered by the cement, since they provide good conditions of work, major areas of study, as also facilities in obtaining the specimens for study. The pellets didn't simulate the clinical conditions of the cement and the very small areas of study of the polyethylene tubes don't give definitive conclusions. PMID:2135431

  18. Molecular evolution and in vitro characterization of Botryllus histocompatibility factor.

    PubMed

    Taketa, Daryl A; Nydam, Marie L; Langenbacher, Adam D; Rodriguez, Delany; Sanders, Erin; De Tomaso, Anthony W

    2015-10-01

    Botryllus schlosseri is a colonial ascidian with a natural ability to anastomose with another colony to form a vascular and hematopoietic chimera. In order to fuse, two individuals must share at least one allele at the highly polymorphic fuhc locus. Otherwise, a blood-based inflammatory response will occur resulting in a melanin scar at the sites of interaction. The single-locus genetic control of allorecognition makes B. schlosseri an attractive model to study the underlying molecular mechanisms. Over the past decade, several candidate genes involved in allorecognition have been identified, but how they ultimately contribute to allorecognition outcome remains poorly understood. Here, we report our initial molecular characterization of a recently identified candidate allodeterminant called Botryllus histocompatibility factor (bhf). bhf, both on a DNA and protein level, is the least polymorphic protein in the fuhc locus studied so far and, unlike other known allorecognition determinants, does not appear to be under any form of balancing or directional selection. Additionally, we identified a second isoform through mRNA-Seq and an EST assembly library which is missing exon 3, resulting in a C-terminally truncated form. We report via whole-mount fluorescent in situ hybridization that a subset of cells co-express bhf and cfuhc(sec). Finally, we observed BHF's localization in HEK293T at the cytoplasmic side of the plasma membrane in addition to the nucleus via a nuclear localization signal. Given the localization data thus far, we hypothesize that BHF may function as a scaffolding protein in a complex with other Botryllus proteins, rather than functioning as an allorecognition determinant. PMID:26359175

  19. Reassessing Domain Architecture Evolution of Metazoan Proteins: Major Impact of Gene Prediction Errors

    PubMed Central

    Nagy, Alinda; Szláma, György; Szarka, Eszter; Trexler, Mária; Bányai, László; Patthy, László

    2011-01-01

    In view of the fact that appearance of novel protein domain architectures (DA) is closely associated with biological innovations, there is a growing interest in the genome-scale reconstruction of the evolutionary history of the domain architectures of multidomain proteins. In such analyses, however, it is usually ignored that a significant proportion of Metazoan sequences analyzed is mispredicted and that this may seriously affect the validity of the conclusions. To estimate the contribution of errors in gene prediction to differences in DA of predicted proteins, we have used the high quality manually curated UniProtKB/Swiss-Prot database as a reference. For genome-scale analysis of domain architectures of predicted proteins we focused on RefSeq, EnsEMBL and NCBI's GNOMON predicted sequences of Metazoan species with completely sequenced genomes. Comparison of the DA of UniProtKB/Swiss-Prot sequences of worm, fly, zebrafish, frog, chick, mouse, rat and orangutan with those of human Swiss-Prot entries have identified relatively few cases where orthologs had different DA, although the percentage with different DA increased with evolutionary distance. In contrast with this, comparison of the DA of human, orangutan, rat, mouse, chicken, frog, zebrafish, worm and fly RefSeq, EnsEMBL and NCBI's GNOMON predicted protein sequences with those of the corresponding/orthologous human Swiss-Prot entries identified a significantly higher proportion of domain architecture differences than in the case of the comparison of Swiss-Prot entries. Analysis of RefSeq, EnsEMBL and NCBI's GNOMON predicted protein sequences with DAs different from those of their Swiss-Prot orthologs confirmed that the higher rate of domain architecture differences is due to errors in gene prediction, the majority of which could be corrected with our FixPred protocol. We have also demonstrated that contamination of databases with incomplete, abnormal or mispredicted sequences introduces a bias in DA

  20. Reassessing domain architecture evolution of metazoan proteins: major impact of gene prediction errors.

    PubMed

    Nagy, Alinda; Szláma, György; Szarka, Eszter; Trexler, Mária; Bányai, László; Patthy, László

    2011-01-01

    In view of the fact that appearance of novel protein domain architectures (DA) is closely associated with biological innovations, there is a growing interest in the genome-scale reconstruction of the evolutionary history of the domain architectures of multidomain proteins. In such analyses, however, it is usually ignored that a significant proportion of Metazoan sequences analyzed is mispredicted and that this may seriously affect the validity of the conclusions. To estimate the contribution of errors in gene prediction to differences in DA of predicted proteins, we have used the high quality manually curated UniProtKB/Swiss-Prot database as a reference. For genome-scale analysis of domain architectures of predicted proteins we focused on RefSeq, EnsEMBL and NCBI's GNOMON predicted sequences of Metazoan species with completely sequenced genomes. Comparison of the DA of UniProtKB/Swiss-Prot sequences of worm, fly, zebrafish, frog, chick, mouse, rat and orangutan with those of human Swiss-Prot entries have identified relatively few cases where orthologs had different DA, although the percentage with different DA increased with evolutionary distance. In contrast with this, comparison of the DA of human, orangutan, rat, mouse, chicken, frog, zebrafish, worm and fly RefSeq, EnsEMBL and NCBI's GNOMON predicted protein sequences with those of the corresponding/orthologous human Swiss-Prot entries identified a significantly higher proportion of domain architecture differences than in the case of the comparison of Swiss-Prot entries. Analysis of RefSeq, EnsEMBL and NCBI's GNOMON predicted protein sequences with DAs different from those of their Swiss-Prot orthologs confirmed that the higher rate of domain architecture differences is due to errors in gene prediction, the majority of which could be corrected with our FixPred protocol. We have also demonstrated that contamination of databases with incomplete, abnormal or mispredicted sequences introduces a bias in DA

  1. Progress in the epidemiological understanding of gene-environment interactions in major diseases: cancer

    PubMed Central

    Clavel, Jacqueline

    2007-01-01

    Cancer epidemiology has undergone marked development since the nineteen-fifties. One of the most spectacular and specific contributions was the demonstration of the massive effect of smoking on the occurrence of lung, larynx and bladder cancer. Major chemical, physical and biological carcinogenic agents have been identified in the working environment and in the overall environment. The chain of events from environmental exposures to cancer requires hundreds of polymorphic genes coding for proteins involved in the transport and metabolism of xenobiotics, or in repair, or in an immune or inflammatory response. The multifactorial and multistage characteristics of cancer create the theoretical conditions for statistical interactions which have been exceptionnally detected. Over the last two decades, a considerable mass of data has been generated, mostly addressing the interactions between smoking and xenobiotic-metabolizing enzymes in smoking-related cancers. They are sometimes considered disappointing but they actually brought a lot of information and raised many methodological issues. In parallel, the number of polymorphisms which can be considered candidate per function increased so much that multiple testing has become a major issue, and genome wide screening approaches have more and more gained in interest. Facing the resulting complexity, some instruments are being set up: our studies are now equipped with carefully sampled biological collections, high-throughput genotyping systems are becoming available, work on statistical methodologies is ongoing, bioinformatics databases are growing larger and access to them is becoming simpler; international consortiums are being organized. The roles of environmental and genetic factors are being jointly elucidated. The basic rules of epidemiology, which are demanding with respect to sampling, with respect to the histological and molecular criteria for cancer classification, with respect to the evaluation of environmental

  2. Identification of IL6 as a susceptibility gene for major depressive disorder

    PubMed Central

    Zhang, Chen; Wu, Zhiguo; Zhao, Guoqing; Wang, Fan; Fang, Yiru

    2016-01-01

    Our previous work implied that interleukin 6 (IL6) may be a biological marker for major depressive disorder (MDD). In this study, we performed a comprehensive genetic study to determine the association between the gene encoding IL6 (IL6) and MDD in Han Chinese. There were 50 drug-naïve MDD patients and 50 healthy controls undergoing an mRNA expression study. A sample of 772 patients with MDD and 759 healthy controls were used for genetic analysis. Next, we performed an eQTL analysis to identify whether risk SNP(s) is associated with IL6 expression in brain. Our results showed that patients with MDD have higher levels of IL6 than healthy controls (P = 0.008). The SNP rs1800797 has a significant association with MDD (P = 0.01) in a dominant model. The eQTL analysis showed a marginally significant association between the rs1800797 and IL6 expression in the frontal cortex (P = 0.087). Our preliminary findings are suggestive of an association between rs1800797 and the risk of MDD. Further investigations are required to evaluate this association in larger samples to increase statistical power, and to examine the correlation between rs1800797 and IL6 methylation patterns. PMID:27502736

  3. Identification of IL6 as a susceptibility gene for major depressive disorder.

    PubMed

    Zhang, Chen; Wu, Zhiguo; Zhao, Guoqing; Wang, Fan; Fang, Yiru

    2016-01-01

    Our previous work implied that interleukin 6 (IL6) may be a biological marker for major depressive disorder (MDD). In this study, we performed a comprehensive genetic study to determine the association between the gene encoding IL6 (IL6) and MDD in Han Chinese. There were 50 drug-naïve MDD patients and 50 healthy controls undergoing an mRNA expression study. A sample of 772 patients with MDD and 759 healthy controls were used for genetic analysis. Next, we performed an eQTL analysis to identify whether risk SNP(s) is associated with IL6 expression in brain. Our results showed that patients with MDD have higher levels of IL6 than healthy controls (P = 0.008). The SNP rs1800797 has a significant association with MDD (P = 0.01) in a dominant model. The eQTL analysis showed a marginally significant association between the rs1800797 and IL6 expression in the frontal cortex (P = 0.087). Our preliminary findings are suggestive of an association between rs1800797 and the risk of MDD. Further investigations are required to evaluate this association in larger samples to increase statistical power, and to examine the correlation between rs1800797 and IL6 methylation patterns. PMID:27502736

  4. Uncovering major genomic features of essential genes in Bacteria and a methanogenic Archaea.

    PubMed

    Grazziotin, Ana Laura; Vidal, Newton M; Venancio, Thiago M

    2015-09-01

    Identification of essential genes is critical to understanding the physiology of a species, proposing novel drug targets and uncovering minimal gene sets required for life. Although essential gene sets of several organisms have been determined using large-scale mutagenesis techniques, systematic studies addressing their conservation, genomic context and functions remain scant. Here we integrate 17 essential gene sets from genome-wide in vitro screenings and three gene collections required for growth in vivo, encompassing 15 Bacteria and one Archaea. We refine and generalize important theories proposed using Escherichia coli. Essential genes are typically monogenic and more conserved than nonessential genes. Genes required in vivo are less conserved than those essential in vitro, suggesting that more divergent strategies are deployed when the organism is stressed by the host immune system and unstable nutrient availability. We identified essential analogous pathways that would probably be missed by orthology-based essentiality prediction strategies. For example, Streptococcus sanguinis carries horizontally transferred isoprenoid biosynthesis genes that are widespread in Archaea. Genes specifically essential in Mycobacterium tuberculosis and Burkholderia pseudomallei are reported as potential drug targets. Moreover, essential genes are not only preferentially located in operons, but also occupy the first position therein, supporting the influence of their regulatory regions in driving transcription of whole operons. Finally, these important genomic features are shared between Bacteria and at least one Archaea, suggesting that high order properties of gene essentiality and genome architecture were probably present in the last universal common ancestor or evolved independently in the prokaryotic domains. PMID:26084810

  5. The Use of Mixture Models to Detect Effects of Major Genes on Quantitative Characters in a Plant Breeding Experiment

    PubMed Central

    Changjian, J.; Xuebiao, P.; Minghong, G.

    1994-01-01

    An analysis based on Elston's model of mixed major locus and polygenic inheritance is extended to include populations of progeny testing such as F(3), B(1s) and B(2s) families derived from F(2) and backcrosses in a cross between two inbred lines. Genetic hypotheses that can be validly tested by the likelihood ratio method in the analysis of a breeding experiment include homogeneity of variances due to environment and/or polygenes with transformable scale effect by Box-Cox power function, random and independent segregation of major genes, invariance of the effects of major genes with population types and additive and dominant models for polygenes. Testing hypotheses in the order suggested here can lead to a gradual simplification of the models and increases the feasibility of the subsequent analysis, but caution must be paid to the possible bias in parameter estimation and hypotheses tests. The procedure is applied to a set of data on plant height of rice with the effects of dwarf genes in crosses among three varieties. Two recessive dwarf genes are shown to be nonallelic and unlinked. One dwarf gene is shown to reduce plant height about 36-56 cm, and another 52-61 cm. The effect of polygenes, estimated as the standard deviation among possible inbred lines derived from these crosses, is about 11.7 cm. Interactions between the dwarf genes and the polygenic background are found, especially for one of the two genes. Both the polygenic effects and the interactions are much smaller than the effects of the major dwarf genes. PMID:8138172

  6. Major gene for field stem rust resistance co-locates with resistance gene Sr12 in "Thatcher" wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effecting stem rust resistance genes. "Thatcher" wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was ...

  7. Human genes for three complement components that regulate the activation of C3 are tightly linked.

    PubMed

    Rodriguez de Cordoba, S; Lublin, D M; Rubinstein, P; Atkinson, J P

    1985-05-01

    A new cluster of complement component genes, including C4BP, C3bR, and FH, is described. Family segregation data indicate that FH is linked to the genes for C4-bp and C4bR, previously reported to be linked and to maintain linkage disequilibrium. This cluster is not linked to the major histocompatibility complex, which contains the genes for the complement components, C4, C2, and factor B, or to the C3 locus. These data further suggest that the organization of genes for functionally related proteins in clusters may be a rule for the complement system. PMID:3157763

  8. Genetic distribution and association analysis of DRD2 gene polymorphisms with major depressive disorder in the Chinese Han population.

    PubMed

    He, Mei; Yan, Hong; Duan, Zhao-Xia; Qu, Wei; Gong, Hai-Yan; Fan, Zheng-Li; Kang, Jian-Yi; Li, Bing-Cang; Wang, Jian-Min

    2013-01-01

    Dopamine D2 receptor is involved in reward-mediating mesocorticolimbic pathways. It plays an important role in major depressive disorder (MDD). Three gene polymorphisms Taq1A, C957T and -141C ins/del, were identified in the DRD2 gene among the Western population. These variants in the DRD2 gene might be associated with the susceptibility of MDD patients through affecting the bioeffects of endogenous dopamine neurotransmission. However, little is known about their occurrence in Chinese population and their association with the susceptibility of patients with major depressive disorder. In this study, a total of 338 unrelated adult Chinese Han population, including 224 healthy volunteers and 114 patients with major depressive disorder, were recruited. DRD2 polymorphisms (Taq1A and -141C ins/del) were detected using restriction fragment length polymorphism (RFLP) analysis and the C957T were detected by sequencing directly. As a result, three polymorphisms were identified in Chinese Han population and all were common SNP. However, we could detect no evidence of genetic association between 3 markers in DRD2 and major depressive disorder in the Chinese Han population. To conclude, this result suggests that Taq1A, C957T and -141C ins/del of DRD2 gene may not be associated with major depressive disorder, also may be the sample sizes too small to allow a meaningful test. PMID:23696934

  9. Forkhead box O member FOXO1 regulates the majority of follicle-stimulating hormone responsive genes in ovarian granulosa cells.

    PubMed

    Herndon, Maria K; Law, Nathan C; Donaubauer, Elyse M; Kyriss, Brandon; Hunzicker-Dunn, Mary

    2016-10-15

    FSH promotes maturation of ovarian follicles. One pathway activated by FSH in granulosa cells (GCs) is phosphatidylinositol-3 kinase/AKT. The AKT target FOXO1 is reported to function primarily as a repressor of FSH genes, including Ccnd2 and Inha. Based on its broad functions in other tissues, we hypothesized that FOXO1 may regulate many more GC genes. We transduced GCs with empty adenovirus or constitutively active FOXO1 followed by treatment with FSH for 24 h, and conducted RNA deep sequencing. Results show that FSH regulates 3772 genes ≥2.0-fold; 60% of these genes are activated or repressed by FOXO1. Pathway Studio Analysis revealed enrichment of genes repressed by FOXO1 in metabolism, signaling, transport, development, and activated by FOXO1 in signaling, cytoskeletal functions, and apoptosis. Gene regulation was verified by q-PCR (eight genes) and ChIP analysis (two genes). We conclude that FOXO1 regulates the majority of FSH target genes in GCs. PMID:27328024

  10. Characterization and expression analysis of gene encoding heme peroxidase HPX15 in major Indian malaria vector Anopheles stephensi (Diptera: Culicidae).

    PubMed

    Kajla, Mithilesh; Kakani, Parik; Choudhury, Tania Pal; Gupta, Kuldeep; Gupta, Lalita; Kumar, Sanjeev

    2016-06-01

    The interaction of mosquito immune system with Plasmodium is critical in determining the vector competence. Thus, blocking the crucial mosquito molecules that regulate parasite development might be effective in controlling the disease transmission. In this study, we characterized a full-length AsHPX15 gene from the major Indian malaria vector Anopheles stephensi. This gene is true ortholog of Anopheles gambiae heme peroxidase AgHPX15 (AGAP013327), which modulates midgut immunity and regulates Plasmodium falciparum development. We found that AsHPX15 is highly induced in mosquito developmental stages and blood fed midguts. In addition, this is a lineage-specific gene that has identical features and 65-99% amino acids identity with other HPX15 genes present in eighteen worldwide-distributed anophelines. We discuss that the conserved HPX15 gene might serve as a common target to manipulate mosquito immunity and arresting Plasmodium development inside the vector host. PMID:26943999

  11. The MHC class I genes of zebrafish

    PubMed Central

    Dirscherl, Hayley; McConnell, Sean C.; Yoder, Jeffrey A.; de Jong, Jill L. O.

    2014-01-01

    Major histocompatibility complex (MHC) molecules play a central role in the immune response and in the recognition of non-self. Found in all jawed vertebrate species, including zebrafish and other teleosts, MHC genes are considered the most polymorphic of all genes. In this review we focus on the multi-faceted diversity of zebrafish MHC class I genes, which are classified into three sequence lineages: U, Z, and L. We examine the polygenic, polymorphic, and haplotypic diversity of the zebrafish MHC class I genes, discussing known and postulated functional differences between the different class I lineages. In addition, we provide the first comprehensive nomenclature for the L lineage genes in zebrafish, encompassing at least 15 genes, and characterize their sequence properties. Finally, we discuss how recent findings have shed new light on the remarkably diverse MHC loci of this species. PMID:24631581

  12. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  13. Sugars and circadian regulation make major contributions to the global regulation of diurnal gene expression in Arabidopsis.

    PubMed

    Bläsing, Oliver E; Gibon, Yves; Günther, Manuela; Höhne, Melanie; Morcuende, Rosa; Osuna, Daniel; Thimm, Oliver; Usadel, Björn; Scheible, Wolf-Rüdiger; Stitt, Mark

    2005-12-01

    The diurnal cycle strongly influences many plant metabolic and physiological processes. Arabidopsis thaliana rosettes were harvested six times during 12-h-light/12-h-dark treatments to investigate changes in gene expression using ATH1 arrays. Diagnostic gene sets were identified from published or in-house expression profiles of the response to light, sugar, nitrogen, and water deficit in seedlings and 4 h of darkness or illumination at ambient or compensation point [CO(2)]. Many sugar-responsive genes showed large diurnal expression changes, whose timing matched that of the diurnal changes of sugars. A set of circadian-regulated genes also showed large diurnal changes in expression. Comparison of published results from a free-running cycle with the diurnal changes in Columbia-0 (Col-0) and the starchless phosphoglucomutase (pgm) mutant indicated that sugars modify the expression of up to half of the clock-regulated genes. Principle component analysis identified genes that make large contributions to diurnal changes and confirmed that sugar and circadian regulation are the major inputs in Col-