Science.gov

Sample records for malignant human prostate

  1. Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

    SciTech Connect

    Gu Yongpeng; Li Hongzhen; Miki, Jun; Kim, Kee-Hong; Furusato, Bungo; Sesterhenn, Isabell A.; Chu, Wei-Sing; McLeod, David G.; Srivastava, Shiv; Ewing, Charles M.; Isaacs, William B.; Rhim, Johng S. . E-mail: jrhim@cpdr.org

    2006-04-01

    In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferative capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents.

  2. Influence of zinc deficiency on AKT-MDM2-P53 signaling axes in normal and malignant human prostate cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With prostate being the highest zinc-accumulating tissue before the onset of cancer, the effects of physiologic levels of zinc on Akt-Mdm2-p53 and Akt-p21 signaling axes in human normal prostate epithelial cells (PrEC) and malignant prostate LNCaP cells were examined. Cells were cultured for 6 d in...

  3. Frequency analysis of multispectral photoacoustic images for differentiating malignant region from normal region in excised human prostate

    NASA Astrophysics Data System (ADS)

    Sinha, Saugata; Rao, Navalgund A.; Valluru, Keerthi S.; Chinni, Bhargava K.; Dogra, Vikram S.; Helguera, Maria

    2014-03-01

    Frequency domain analysis of the photoacoustic (PA) radio frequency signals can potentially be used as a tool for characterizing microstructure of absorbers in tissue. This study investigates the feasibility of analyzing the spectrum of multiwavelength PA signals generated by excised human prostate tissue samples to differentiate between malignant and normal prostate regions. Photoacoustic imaging at five different wavelengths, corresponding to peak absorption coefficients of deoxyhemoglobin, whole blood, oxyhemoglobin, water and lipid in the near infrared (NIR) (700 nm - 1000 nm) region, was performed on freshly excised prostate specimens taken from patients undergoing prostatectomy for biopsy confirmed prostate cancer. The PA images were co-registered with the histopathology images of the prostate specimens to determine the region of interest (ROI) corresponding to malignant and normal tissue. The calibrated power spectrum of each PA signal from a selected ROI was fit to a linear model to extract the corresponding slope, midband fit and intercept parameters. The mean value of each parameter corresponding to malignant and adjacent normal prostate ROI was calculated for each of the five wavelengths. The results obtained for 9 different human prostate specimens, show that the mean values of midband fit and intercept are significantly different between malignant and normal regions. In addition, the average midband fit and intercept values show a decreasing trend with increasing wavelength. These preliminary results suggest that frequency analysis of multispectral PA signals can be used to differentiate malignant region from the adjacent normal region in human prostate tissue.

  4. Loss of estrogen receptor beta expression in malignant human prostate cells in primary cultures and in prostate cancer tissues.

    PubMed

    Pasquali, D; Rossi, V; Esposito, D; Abbondanza, C; Puca, G A; Bellastella, A; Sinisi, A A

    2001-05-01

    The aim of this study was to investigate the expression of estrogen receptor (ER) beta and alpha genes in normal (N) and malignant (C) primary cultures of human prostate epithelial cells (PEC) and fibroblasts (PFC) and in the prostate tissue donors. Both ERbeta and ERalpha messenger ribonucleic acids were found by RT-PCR analysis in six NPECs and normal prostate tissues and in only one of six CPECs and in the respective cancer tissue donor. The other five CPECs and related cancer tissue donors and all normal and cancer PFCs expressed ERalpha messenger ribonucleic acid alone. Immunoblot analysis, using a polyclonal anti-ERbeta (C-terminal) antibody, demonstrated ERbeta protein in all NPEC lysates and in one of the six CPECS: ERalpha protein was expressed in both NPECs and CPECs when a polyclonal antibody directed against the ERalpha N-terminal domain was used. In contrast, ERalpha protein was not detected in two of the six CPEC lysates when ERalpha C-terminal monoclonal antibodies were used. Using a set of primers designed to amplify the region from exons 6-8, RT-PCR analysis demonstrated the absence of the expected transcript in these cells. The present study shows that the ERbeta gene is expressed together with ERalpha in normal prostates and NPECs, whereas it is barely detectable in prostate cancer and CPECS: Moreover, in some CPECs, the ERalpha gene may be transcribed in a changed protein, resulting from the expression of a deletion variant. Together, these data suggest that prostate malignancy is associated with a potential disorder of ER-mediated pathways. PMID:11344205

  5. Role of androgen and vitamin D receptors in endothelial cells from benign and malignant human prostate

    PubMed Central

    Chung, Ivy; Montecinos, Viviana P.; Buttyan, Ralph; Johnson, Candace S.; Smith, Gary J.

    2013-01-01

    Forty years ago, Judah Folkman (Folkman. N Engl J Med 285: 1182–1186, 1971) proposed that tumor growth might be controlled by limiting formation of new blood vessels (angiogenesis) needed to supply a growing tumor with oxygen and nutrients. To this end, numerous “antiangiogenic” agents have been developed and tested for therapeutic efficacy in cancer patients, including prostate cancer (CaP) patients, with limited success. Despite the lack of clinical efficacy of lead anti-angiogenic therapeutics in CaP patients, recent published evidence continues to support the idea that prostate tumor vasculature provides a reasonable target for development of new therapeutics. Particularly relevant to antiangiogenic therapies targeted to the prostate is the observation that specific hormones can affect the survival and vascular function of prostate endothelial cells within normal and malignant prostate tissues. Here, we review the evidence demonstrating that both androgen(s) and vitamin D significantly impact the growth and survival of endothelial cells residing within prostate cancer and that systemic changes in circulating androgen or vitamin D drastically affect blood flow and vascularity of prostate tissue. Furthermore, recent evidence will be discussed about the expression of the receptors for both androgen and vitamin D in prostate endothelial cells that argues for direct effects of these hormone-activated receptors on the biology of endothelial cells. Based on this literature, we propose that prostate tumor vasculature represents an unexplored target for modulation of tumor growth. A better understanding of androgen and vitamin D effects on prostate endothelial cells will support development of more effective angiogenesis-targeting therapeutics for CaP patients. PMID:23548616

  6. Optimization and comprehensive characterization of a faithful tissue culture model of the benign and malignant human prostate.

    PubMed

    Maund, Sophia Lisette; Nolley, Rosalie; Peehl, Donna Mae

    2014-02-01

    Few preclinical models accurately depict normal human prostate tissue or primary prostate cancer (PCa). In vitro systems typically lack complex cellular interactions among structured prostatic epithelia and a stromal microenvironment, and genetic and molecular fidelity are concerns in both in vitro and in vivo models. 'Tissue slice cultures' (TSCs) provide realistic preclinical models of diverse tissues and organs, but have not been fully developed or widely utilized for prostate studies. Problems encountered include degeneration of differentiated secretory cells, basal cell hyperplasia, and poor survival of PCa. Here, we optimized, characterized, and applied a TSC model of primary human PCa and benign prostate tissue that overcomes many deficiencies of current in vitro models. Tissue cores from fresh prostatectomy specimens were precision-cut at 300 μm and incubated in a rotary culture apparatus. The ability of varied culture conditions to faithfully maintain benign and cancer cell and tissue structure and function over time was evaluated by immunohistological and biochemical assays. After optimization of the culture system, molecular and cellular responses to androgen ablation and to piperlongumine (PL), purported to specifically reduce androgen signaling in PCa, were investigated. Optimized culture conditions successfully maintained the structural and functional fidelity of both benign and PCa TSCs for 5 days. TSCs exhibited androgen dependence, appropriately undergoing ductal degeneration, reduced proliferation, and decreased prostate-specific antigen expression upon androgen ablation. Further, TSCs revealed cancer-specific reduction of androgen receptor and increased apoptosis upon treatment with PL, validating data from cell lines. We demonstrate a TSC model that authentically recapitulates the structural, cellular, and genetic characteristics of the benign and malignant human prostate, androgen dependence of the native tissue, and cancer-specific response

  7. Characterization of 17beta-hydroxysteroid dehydrogenase isoenzyme expression in benign and malignant human prostate.

    PubMed

    Elo, J P; Akinola, L A; Poutanen, M; Vihko, P; Kyllönen, A P; Lukkarinen, O; Vihko, R

    1996-03-28

    In the present study, expressions of 17beta-hydroxysteroid dehydrogenase (17HSD) types 1, 2, and 3, 5alpha-reductase type 2 and human androgen receptor mRNAs were determined in 12 benign prostatic hyperplasia and 17 prostatic carcinoma specimens. 17HSD type 2 was found to be the principle isoenzyme expressed in the prostate. Significantly higher expressions of 17HSD type 2 and 5alpha-reductase type 2 were detected in benign prostatic hyperplasia compared with the carcinoma specimens. Expression of the androgen receptor in the 2 groups was not significantly different. 17HSD type 3 mRNA was not detected in any of the specimens investigated. Only low constructive expression of the 2.3 kb mRNA of 17HSD type 1 was seen. Immunohistochemical analysis indicated that this did not lead to significant enzyme expression, only faint staining for the enzyme protein being detected, mainly in uroepithelial cells. No significant correlation was found between any of the mRNAs analysed, but the data on 5alpha-reductase type 2 mRNA support the presence of an increased proportion of 5alpha-dihydrotesterone in the hyperplastic prostate. In cultured PC-3 prostatic cancer cells and in the transiently transfected human embryonic kidney 293 cells, 17HSD type 2 was found exclusively to convert 5alpha-dihydrotestosterone and testosterone into the less potent 17-keto compounds 5alpha-androstanedione and 4-androstenedione, respectively. We suggest that the 17HSD type 2 isoenzyme plays a part in the metabolic pathway, resulting in the inactivation of testosterone and 5alpha-dihydrotestosterone locally in the prostate. The enzyme expressed in the prostate could, therefore, protect cells from excessive androgen action. PMID:8608963

  8. Telomerase-immortalized non-malignant human prostate epithelial cells retain the properties of multipotent stem cells

    SciTech Connect

    Li Hongzhen; Zhou Jianjun; Miki, Jun; Furusato, Bungo; Gu Yongpeng; Srivastava, Shiv; McLeod, David G.; Vogel, Jonathan C.; Rhim, Johng S.

    2008-01-01

    Understanding prostate stem cells may provide insight into the origin of prostate cancer. Primary cells have been cultured from human prostate tissue but they usually survive only 15-20 population doublings before undergoing senescence. We report here that RC-170N/h/clone 7 cells, a clonal cell line from hTERT-immortalized primary non-malignant tissue-derived human prostate epithelial cell line (RC170N/h), retain multipotent stem cell properties. The RC-170N/h/clone 7 cells expressed a human embryonic stem cell marker, Oct-4, and potential prostate epithelial stem cell markers, CD133, integrin {alpha}2{beta}1{sup hi} and CD44. The RC-170N/h/clone 7 cells proliferated in KGM and Dulbecco's Modified Eagle Medium with 10% fetal bovine serum and 5 {mu}g/ml insulin (DMEM + 10% FBS + Ins.) medium, and differentiated into epithelial stem cells that expressed epithelial cell markers, including CK5/14, CD44, p63 and cytokeratin 18 (CK18); as well as the mesenchymal cell markers, vimentin, desmin; the neuron and neuroendocrine cell marker, chromogranin A. Furthermore the RC170 N/h/clone 7 cells differentiated into multi tissues when transplanted into the sub-renal capsule and subcutaneously of NOD-SCID mice. The results indicate that RC170N/h/clone 7 cells retain the properties of multipotent stem cells and will be useful as a novel cell model for studying the mechanisms of human prostate stem cell differentiation and transformation.

  9. Isolation and genome-wide expression and methylation characterization of CD31+ cells from normal and malignant human prostate tissue

    PubMed Central

    Luo, Wei; Hu, Qiang; Wang, Dan; Deeb, Kristin K.; Ma, Yingyu; Morrison, Carl D.; Liu, Song; Johnson, Candace S.; Trump, Donald L.

    2013-01-01

    Endothelial cells (ECs) are an important component involved in the angiogenesis. Little is known about the global gene expression and epigenetic regulation in tumor endothelial cells. The identification of gene expression and epigenetic difference between human prostate tumor-derived endothelial cells (TdECs) and those in normal tissues may uncover unique biological features of TdEC and facilitate the discovery of new anti-angiogenic targets. We established a method for isolation of CD31+ endothelial cells from malignant and normal prostate tissues obtained at prostatectomy. TdECs and normal-derived ECs (NdECs) showed >90% enrichment in primary culture and demonstrated microvascular endothelial cell characteristics such as cobblestone morphology in monolayer culture, diI-acetyl-LDL uptake and capillary-tube like formation in Matrigel®. In vitro primary cultures of ECs maintained expression of endothelial markers such as CD31, von Willebrand factor, intercellular adhesion molecule, vascular endothelial growth factor receptor 1, and vascular endothelial growth factor receptor 2. We then conducted a pilot study of transcriptome and methylome analysis of TdECs and matched NdECs from patients with prostate cancer. We observed a wide spectrum of differences in gene expression and methylation patterns in endothelial cells, between malignant and normal prostate tissues. Array-based expression and methylation data were validated by qRT-PCR and bisulfite DNA pyrosequencing. Further analysis of transcriptome and methylome data revealed a number of differentially expressed genes with loci whose methylation change is accompanied by an inverse change in gene expression. Our study demonstrates the feasibility of isolation of ECs from histologically normal prostate and prostate cancer via CD31+ selection. The data, although preliminary, indicates that there exist widespread differences in methylation and transcription between TdECs and NdECs. Interestingly, only a small

  10. Multidisciplinary management of prostate malignancy.

    PubMed

    Basler, Joseph W; Jenkins, Carol; Swanson, Gregory

    2005-05-01

    Most urologic malignancies are diagnosed initially and managed by urologists. However, better outcomes may be attained by integrating the surgical, medical, and radiologic disciplines. The primary care physician remains an important cornerstone whose talents should not be underestimated in the overall patient management scheme. Additional services such as endocrinology, physical therapy, pain control, hospice, nutrition, biofeedback, and hyperbarics, among others, should be considered in the overall health care team. The organization of the team, including definition of the duties of key personnel and even the physical framework of the clinic, contribute to its success in treating patients with prostate cancer. Pitfalls of the process also are discussed in this article. PMID:15869728

  11. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues

    PubMed Central

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  12. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues.

    PubMed

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  13. Evidence that Human Prostate Cancer is a ZIP1-Deficient Malignancy that could be Effectively Treated with a Zinc Ionophore (Clioquinol) Approach

    PubMed Central

    Costello, Leslie C; Franklin, Renty B; Zou, Jing; Naslund, Michael J

    2015-01-01

    Despite decades of research, no efficacious chemotherapy exists for the treatment of prostate cancer. Malignant prostate zinc levels are markedly decreased in all cases of prostate cancer compared to normal/benign prostate. ZIP1 zinc transporter down regulation decreases zinc to prevent its cytotoxic effects. Thus, prostate cancer is a “ZIP1-deficient” malignancy. A zinc ionophore (e.g. Clioquinol) treatment to increase malignant zinc levels is a plausible treatment of prostate cancer. However, skepticism within the clinical/biomedical research community impedes significant progress leading to such a zinc treatment. This report reviews the clinical and experimental background, and presents new experimental data showing Clioquinol suppression of prostate malignancy; which provides strong support for a zinc ionophore treatment for prostate cancer. Evaluation of often-raised opposing issues is presented. These considerations lead to the conclusion that the compelling evidence dictates that a zinc-treatment approach for prostate cancer should be pursued with additional research leading to clinical trials. PMID:26273543

  14. Synergistic Effects of the Green Tea Extract Epigallocatechin-3-gallate and Taxane in Eradication of Malignant Human Prostate Tumors1

    PubMed Central

    Stearns, Mark E; Wang, Min

    2011-01-01

    We have examined whether epigallocatechin-3-gallate (EGCG), and extract of green tea, in combination with taxane (i.e., paclitaxel and docetaxel), exerts a synergistic activity in blocking human prostate PC-3ML tumor cell growth in vitro and in vivo. Growth assays in vitro revealed that the IC50 values were ∼30 µM, ∼3 nM, and ∼6 nM, for EGCG, paclitaxel and docetaxel, respectively. Isobolograms generated from the data clearly indicated that EGCG in combination with paclitaxel or docetaxel had an additive effect in blocking tumor cell growth. EGCG combined with taxane also had an additive effect to increase the expression of apoptotic genes, (p53, p73, p21, and caspase 3) and the percent apoptosis observed in vitro and in tumor modeling studies in severe combined immunodeficient mice. The tumor modeling studies clearly showed that EGCG plus taxane injected intraperitoneally (i.p.) induced a significant increase in apoptosis rates (TUNEL assays) and eliminated preexisting tumors generated from PC-3ML cells implanted i.p., increasing disease-free survival rates to greater than 90%. More importantly, the combination therapy (i.p. biweekly) blocked metastases after intravenous injection of PC-3ML cells through the tail vein. In mice treated with EGCG plus taxane, the disease-free survival rates increased from 0% (in untreated mice) to more than 70% to 80% in treated mice. Taken together, these data demonstrate for the first time that EGCG in combination with taxane may provide a novel therapeutic treatment of advanced prostate cancer. PMID:21633670

  15. Metabolomic Imaging for Human Prostate Cancer Detection

    PubMed Central

    Wu, Chin-Lee; Jordan, Kate W.; Ratai, Eva M.; Sheng, Jinhua; Adkins, Christen B.; DeFeo, Elita M; Jenkins, Bruce G.; Ying, Leslie; McDougal, W. Scott; Cheng, Leo L.

    2010-01-01

    As current radiological approaches cannot accurately localize prostate cancer in vivo, biopsies are conducted at random within prostates for at-risk patients, leading to high false-negative rates. Metabolomic imaging can map cancer-specific biomolecular profile values onto anatomical structures to direct biopsy. In this preliminary study, we evaluated five prostatectomy-removed whole prostates from biopsy-proven cancer patients on a 7 Tesla human, whole-body magnetic resonance scanner. Localized, multi-cross-sectional, multi-voxel magnetic resonance spectra were used to construct a malignancy index based on prostate cancer metabolomic profiles obtained from previous, intact tissue analyses by a 14 Tesla spectrometer. This calculated Malignancy Index shows linear correlation with lesion size (p<0.013) and demonstrates a 93–97% overall accuracy for detecting the presence of prostate cancer lesions. PMID:20371475

  16. MOLECULAR EVENTS ASSOCIATED WITH ARSENIC-INDUCED MALIGNANT TRANSFORMATION OF HUMAN PROSTATIC EPITHELIAL CELLS: ABERRANT GENOMIC DNA METHYLATION AND K-RAS ONCOGENE ACTIVATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Numerous studies link arsenic exposure to human cancers in a variety of tissues, including the prostate. Our prior work showed that chronic arsenic exposure of the non-tumorigenic, human prostate epithelial cell line, RWPE-1, to low levels of (5 microM) sodium arsenite for 29 weeks resulted in malig...

  17. Optical coherence elastography (OCE) as a method for identifying benign and malignant prostate biopsies

    NASA Astrophysics Data System (ADS)

    Li, Chunhui; Guan, Guangying; Ling, Yuting; Lang, Stephen; Wang, Ruikang K.; Huang, Zhihong; Nabi, Ghulam

    2015-03-01

    Objectives. Prostate cancer is the most frequently diagnosed malignancy in men. Digital rectal examination (DRE) - a known clinical tool based on alteration in the mechanical properties of tissues due to cancer has traditionally been used for screening prostate cancer. Essentially, DRE estimates relative stiffness of cancerous and normal prostate tissue. Optical coherence elastography (OCE) are new optical imaging techniques capable of providing cross-sectional imaging of tissue microstructure as well as elastogram in vivo and in real time. In this preliminary study, OCE was used in the setting of the human prostate biopsies ex vivo, and the images acquired were compared with those obtained using standard histopathologic methods. Methods. 120 prostate biopsies were obtained by TRUS guided needle biopsy procedures from 9 patients with clinically suspected cancer of the prostate. The biopsies were approximately 0.8mm in diameter and 12mm in length, and prepared in Formalin solution. Quantitative assessment of biopsy samples using OCE was obtained in kilopascals (kPa) before histopathologic evaluation. The results obtained from OCE and standard histopathologic evaluation were compared provided the cross-validation. Sensitivity, specificity, and positive and negative predictive values were calculated for OCE (histopathology was a reference standard). Results. OCE could provide quantitative elasticity properties of prostate biopsies within benign prostate tissue, prostatic intraepithelial neoplasia, atypical hyperplasia and malignant prostate cancer. Data analysed showed that the sensitivity and specificity of OCE for PCa detection were 1 and 0.91, respectively. PCa had significantly higher stiffness values compared to benign tissues, with a trend of increasing in stiffness with increasing of malignancy. Conclusions. Using OCE, microscopic resolution elastogram is promising in diagnosis of human prostatic diseases. Further studies using this technique to improve the

  18. Benign or Malignant? Two Case Reports of Gigantic Prostatic Cyst.

    PubMed

    Yu, Jiang; Wang, Xizhi; Luo, Feiye; Wang, Bo; Wang, Yi

    2016-09-01

    A 60-year-old male with a huge prostate cyst presented with obstruction symptom of urethra and intestinal tract. Complete excision of the cystic prostate failed as a result of the strong adherence and twice operations history, but we confirmed prostate adenocarcinoma and relieved his obstruction symptom. Case 2 was a 77-year-old male with an 8 cm cyst of which biopsy showed prostate cancer in local hospital. He was admitted 18 months later because of intestinal obstruction. Radical resection had a satisfied result of obstruction symptom and PSA. Here we summarized malignant characteristics of cystic lesions in prostate or surrounding structures and management. PMID:27500085

  19. Hyaluronan in human malignancies

    SciTech Connect

    Sironen, R.K.; Tammi, M.; Tammi, R.; Auvinen, P.K.; Anttila, M.; Kosma, V-M.

    2011-02-15

    Hyaluronan, a major macropolysaccharide in the extracellular matrix of connective tissues, is intimately involved in the biology of cancer. Hyaluronan accumulates into the stroma of various human tumors and modulates intracellular signaling pathways, cell proliferation, motility and invasive properties of malignant cells. Experimental and clinicopathological evidence highlights the importance of hyaluronan in tumor growth and metastasis. A high stromal hyaluronan content is associated with poorly differentiated tumors and aggressive clinical behavior in human adenocarcinomas. Instead, the squamous cell carcinomas and malignant melanomas tend to have a reduced hyaluronan content. In addition to the stroma-cancer cell interaction, hyaluronan can influence stromal cell recruitment, tumor angiogenesis and epithelial-mesenchymal transition. Hyaluronan receptors, hyaluronan synthases and hyaluronan degrading enzymes, hyaluronidases, are involved in the modulation of cancer progression, depending on the tumor type. Furthermore, intracellular signaling and angiogenesis are affected by the degradation products of hyaluronan. Hyaluronan has also therapeutic implications since it is involved in multidrug resistance.

  20. New Primary Malignancy Masquerading as Metastatic Prostate Adenocarcinoma

    PubMed Central

    Szwed, Ellen A.; Sliesoraitis, Sarunas; Nguyen, Thu-Cuc; Nguyen, Minh-Nguyet; Moreb, Jan S.; Zlotecki, Robert A.; Crispen, Paul L.; Dang, Nam H.; Dang, Long H.

    2015-01-01

    In the management of patients with prostate cancer, the development of new radiographic findings can mimic progression of the disease, thereby triggering changes in treatment. Typically, clinicians evaluate additional parameters, such as symptoms and prostate specific antigen (PSA) levels, for further evidence of disease progression. In the absence of additional findings, for example, elevated PSA, the possibility of an additional malignancy should be considered and evaluated. We present three cases of patients undergoing treatment for prostate adenocarcinoma and discovered on imaging to have findings suggestive of disease progression, but ultimately found to be a new primary malignancy. Our cases suggest that, in patients with prostate cancer, the appearance of new lymphadenopathy or bone lesions cannot be assumed to solely represent progression of the prostate cancer and warrant further investigation, especially in the presence of stable PSA levels. PMID:25789189

  1. Differential vitamin D 24-hydroxylase/CYP24A1 gene promoter methylation in endothelium from benign and malignant human prostate

    PubMed Central

    Karpf, Adam R; Omilian, Angela R; Bshara, Wiam; Tian, Lili; Tangrea, Michael A; Morrison, Carl D; Johnson, Candace S

    2011-01-01

    Epigenetic alterations occur in tumor-associated vessels in the tumor microenvironment. Methylation of the CYP24A1 gene promoter differs in endothelial cells isolated from tumors and non-tumor microenvironments in mice. The epigenetic makeup of endothelial cells of human tumor-associated vasculature is unknown due to difficulty of isolating endothelial cells populations from a heterogeneous tissue microenvironment. To ascertain CYP24A1 promoter methylation in tumor-associated endothelium, we utilized laser microdissection guided by CD31 immunohistochemistry to procure endothelial cells from human prostate tumor specimens. Prostate tissues were obtained following robotic radical prostatectomy from men with clinically localized prostate cancer. Adjacent histologically benign prostate tissues were used to compare endothelium from benign versus tumor microenvironments. Sodium bisulfite sequencing of CYP24A1 promoter region showed that the average CYP24A1 promoter methylation in the endothelium was 20% from the tumor microenvironment compared with 8.2% in the benign microenvironment (p < 0.05). A 2-fold to 17-fold increase in CYP24A1 promoter methylation was observed in the prostate tumor endothelium compared with the matched benign prostate endothelium in four patient samples, while CYP24A1 promoter methylation remained unchanged in two patient samples. In addition, there is no correlation of the level of CYP24A1 promoter methylation in prostate tumor-associated endothelium with that of epithelium/stroma. This study demonstrates that the CYP24A1 promoter is methylated in tumor-associated endothelium, indicating that epigenetic alterations in CYP24A1 may play a role in determining the phenotype of tumor-associated vasculature in the prostate tumor microenvironment. PMID:21725204

  2. Undiagnosed prostatic malignancy at the time of radical cystoprostatectomy after prior prostatic radiation therapy

    PubMed Central

    Sharma, Pranav; Zargar-Shoshtari, Kamran; Spiess, Philippe E.; Sexton, Wade J.; Poch, Michael A.

    2016-01-01

    Purpose: We determined the prevalence of prostatic malignancy in patients undergoing radical cystoprostatectomy (RC) for urothelial carcinoma (UC) with a history of radiation therapy (XRT) treatment for prostatic adenocarcinoma (PCa). Materials and Methods: Fifty-three men who underwent a RC for UC that were previously treated for PCa with XRT were retrospectively identified. Pathology reports were reviewed to assess for residual PCa or prostatic UC at the time of surgery. Results: Thirteen (25%) patients had residual PCa, 16 (30%) had prostatic UC, and 8 (15%) had both. Sixteen (30%) patients had no evidence of prostatic disease. Patients with PCa had median tumor volume of 2.2 cc (interquartile range: 1.2–2.5 cc) and one-third had high-risk features (Gleason score >8 or pT3-T4 disease). Sixteen of 24 patients (67%) with prostatic UC had a stromal invasion, 5 (21%) had a ductal invasion, and 3 (13%) had carcinoma in situ. Tumors at bladder neck or trigone during transurethral resection were predictive of prostatic UC (odds ratio: 4.32, 95% confidence interval: 1.2–15.5, P = 0.025). Conclusions: Despite prior XRT for PCa, less than one-third of patients had no prostatic disease at the time of RC. Routine prostatic sampling should be considered in these patients especially if considering the orthotopic diversion. PMID:27141183

  3. Cathepsin D acts as an essential mediator to promote malignancy of benign prostatic epithelium

    PubMed Central

    Pruitt, Freddie L.; He, Yue; Franco, Omar E.; Jiang, Ming; Cates, Justin M.; Hayward, Simon W.

    2012-01-01

    BACKGROUND Stromal-epithelial interactions are important in both development and prostate cancer. Stromal changes have been shown to be powerful prognostic indicators of prostate cancer progression and of patient death helping to define lethal versus indolent phenotypes. The specific molecular underpinnings of these interactions are incompletely understood. We investigated whether stromal cathepsin D (CathD) overexpression affects prostate tumorigenesis through a paracrine mechanism. METHODS Normal prostate fibroblasts (NPF) were retrovirally transduced to overexpress cyclin D1 (CD1) cells were designated NPFCD1. Cathepsin D expression was knocked down using shRNA in cancer associated fibroblasts (CAF) and NPFCD1. We analyzed these stromal cell lines using immunohistochemistry, Western blot, and tissue recombination. RESULTS An examination of human prostate tissue revealed significantly increased stromal staining of CathD in malignant prostate tissue. Overexpression of CD1 in normal prostate fibroblasts (NPFCD1) produced a phenotype similar to, but more moderate than, CAF in a tissue recombination model. Knockdown studies revealed that CathD is required for NPFCD1 motility and invasive growth in vitro. BPH-1 cell proliferation was found to be induced when cultured with NPFCD1 conditioned medium, this effect was inhibited when CathD was knocked down in NPFCD1 cells. Overexpression of CathD in prostate stromal cells induced malignancy in adjacent epithelium, and this transformation was inhibited when stromal CathD expression was knocked down in CAF. CONCLUSIONS The study presented here demonstrates increased CathD expression is seen in human CAF. The upregulation of CD1 results in concomitant increases in CathD expression. Elevated CathD expression in the stroma contributes to tumor promotion. PMID:22996917

  4. HUMAN PROSTATE CANCER RISK FACTORS

    EPA Science Inventory

    Prostate cancer has the highest prevalence of any non-skin cancer in the human body, with similar likelihood of neoplastic foci found within the prostates of men around the world regardless of diet, occupation, lifestyle, or other factors. Essentially all men with circulating an...

  5. Human Prostate Cancer Hallmarks Map.

    PubMed

    Datta, Dipamoy; Aftabuddin, Md; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  6. Human Prostate Cancer Hallmarks Map

    PubMed Central

    Datta, Dipamoy; Aftabuddin, Md.; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  7. Comparison of microscopic vascularity in benign and malignant prostate tissue.

    PubMed

    Bigler, S A; Deering, R E; Brawer, M K

    1993-02-01

    A variety of malignant neoplasms have been shown to induce capillary neovascularization, and in some cases the degree of vascularization appears to correlate with aggressive behavior and risk of metastasis. We hypothesized that carcinoma of the prostate also induces the formation of new capillaries, and we developed a method to quantify the relative density of microscopic vessels in carcinoma of the prostate compared with benign prostatic glandular tissue. The number of microvessel profiles in tissue sections was quantified by marking the vascular endothelial cells with antibodies to factor VIII-related antigen using standard immunohistochemistry techniques and comparing fields of adenocarcinoma with benign glandular tissue in 15 radical prostatectomy specimens. The analysis was facilitated by using the Optimas computerized image analysis system (Bioscan, Seattle, WA) with software written for this investigation. Fourteen of the 15 cases demonstrated significantly higher vascular density in the areas of carcinoma than in the benign tissues. Overall, the ratio of vessels per unit area in sections of carcinoma versus benign tissue was approximately double (ratio = 2.02; P < .001). In benign tissues the capillaries are restricted for the most part to the periglandular stroma immediately adjacent to the epithelium, whereas the distribution in carcinoma appears to be more random. The data demonstrate the increased density of capillaries in prostatic carcinoma when compared with benign prostate tissue. PMID:8432518

  8. Localization of MCT2 at peroxisomes is associated with malignant transformation in prostate cancer

    PubMed Central

    Valença, Isabel; Pértega-Gomes, Nelma; Vizcaino, José Rámon; Henrique, Rui M; Lopes, Carlos; Baltazar, Fátima; Ribeiro, Daniela

    2015-01-01

    Previous studies on monocarboxylate transporters expression in prostate cancer (PCa) have shown that monocarboxylate transporter 2 (MCT2) was clearly overexpressed in prostate malignant glands, pointing it out as a putative biomarker for PCa. However, its localization and possible role in PCa cells remained unclear. In this study, we demonstrate that MCT2 localizes mainly at peroxisomes in PCa cells and is able to take advantage of the peroxisomal transport machinery by interacting with Pex19. We have also shown an increase in MCT2 expression from non-malignant to malignant cells that was directly correlated with its peroxisomal localization. Upon analysis of the expression of several peroxisomal β-oxidation proteins in PIN lesions and PCa cells from a large variety of human prostate samples, we suggest that MCT2 presence at peroxisomes is related to an increase in β -oxidation levels which may be crucial for malignant transformation. Our results present novel evidence that may not only contribute to the study of PCa development mechanisms but also pinpoint novel targets for cancer therapy. PMID:25639644

  9. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  10. Mitochondria Biogenesis and Bioenergetics Gene Profiles in Isogenic Prostate Cells with Different Malignant Phenotypes.

    PubMed

    Burch, Tanya C; Rhim, Johng S; Nyalwidhe, Julius O

    2016-01-01

    Background. The most significant hallmarks of cancer are directly or indirectly linked to deregulated mitochondria. In this study, we sought to profile mitochondria associated genes in isogenic prostate cell lines with different tumorigenic phenotypes from the same patient. Results. Two isogenic human prostate cell lines RC77N/E (nonmalignant cells) and RC77T/E (malignant cells) were profiled for expression of mitochondrial biogenesis and energy metabolism genes by qRT-PCR using the Human Mitochondria and the Mitochondrial Energy Metabolism RT(2) PCR arrays. Forty-seven genes were differentially regulated between the two cell lines. The interaction and regulatory networks of these genes were generated by Ingenuity Pathway Analysis. UCP2 was the most significantly upregulated gene in primary adenocarcinoma cells in the current study. The overexpression of UCP2 upon malignant transformation was further validated using human prostatectomy clinical specimens. Conclusions. This study demonstrates the overexpression of multiple genes that are involved in mitochondria biogenesis, bioenergetics, and modulation of apoptosis. These genes may play a role in malignant transformation and disease progression. The upregulation of some of these genes in clinical samples indicates that some of the differentially transcribed genes could be the potential targets for therapeutic interventions. PMID:27478826

  11. Mitochondria Biogenesis and Bioenergetics Gene Profiles in Isogenic Prostate Cells with Different Malignant Phenotypes

    PubMed Central

    Burch, Tanya C.; Rhim, Johng S.

    2016-01-01

    Background. The most significant hallmarks of cancer are directly or indirectly linked to deregulated mitochondria. In this study, we sought to profile mitochondria associated genes in isogenic prostate cell lines with different tumorigenic phenotypes from the same patient. Results. Two isogenic human prostate cell lines RC77N/E (nonmalignant cells) and RC77T/E (malignant cells) were profiled for expression of mitochondrial biogenesis and energy metabolism genes by qRT-PCR using the Human Mitochondria and the Mitochondrial Energy Metabolism RT2 PCR arrays. Forty-seven genes were differentially regulated between the two cell lines. The interaction and regulatory networks of these genes were generated by Ingenuity Pathway Analysis. UCP2 was the most significantly upregulated gene in primary adenocarcinoma cells in the current study. The overexpression of UCP2 upon malignant transformation was further validated using human prostatectomy clinical specimens. Conclusions. This study demonstrates the overexpression of multiple genes that are involved in mitochondria biogenesis, bioenergetics, and modulation of apoptosis. These genes may play a role in malignant transformation and disease progression. The upregulation of some of these genes in clinical samples indicates that some of the differentially transcribed genes could be the potential targets for therapeutic interventions. PMID:27478826

  12. Fluorescence spectra of benign and malignant prostate tissues

    NASA Astrophysics Data System (ADS)

    AlSalhi, M. S.; Masilamani, V.; Atif, M.; Farhat, K.; Rabah, D.; Turki, M. R. Al

    2012-09-01

    In this study, fluorescence emission spectrum (FES), Stokes' shift spectrum (SSS), and reflectance spectrum (RS) of benign (N = 12) and malignant prostate tissues (N = 8) were investigated to discriminate the two types of tissues. The FES was done with the excitation at 325 nm only; SSS with Δλ = 70 and Δλ = 0, the latter being equivalent to reflectance spectra. Of the three modes of spectra, SSS with Δλ = 70 nm showed the best discrimination. There were four important bands, one at 280 nm (due to tryptophan); 320 nm (due to elastin & tryptophan); 355 and 385 (due to NADH) and 440 nm (due to flavin). From the relative intensities of these bands, three ratios were evaluated. Similarly another two ratios were obtained from reflectance spectra and one more from FES. Thus, there are 6 ratio parameters which represent the relative concentration of tryptophan, elastin, nicotinamide adenine dinucleotide (NADH), and flavin. A statistical analysis showed that benign and malignant tissues could be classified with accuracy greater than 90%. This report is only for in vitro analysis; but employing optical fiber, this can be extended to in vivo analysis too, so that benign tumor could be distinguished without surgery.

  13. Malignant lesions in the ventral prostate of alloxan-induced diabetic rats

    PubMed Central

    Ribeiro, Daniele Lisboa; Marques, Silvio Fernando Guideti; Alberti, Sandra; Spadella, César Tadeu; Manzato, Antônio José; Taboga, Sebastião Roberto; Dizeyi, Nishtman; Abrahamsson, Per-Anders; Góes, Rejane Maira

    2008-01-01

    The aim of this study was to evaluate the changes caused by chronic diabetes in the rat ventral prostate and to establish a correlation between diabetes and the development of prostatic lesions. Male rats received alloxan (42 mg/kg b.w.) to induce diabetes. Ninety days after diabetes diagnosis, animals were sacrificed and the ventral prostate was removed and prepared for general and immunohistochemical analyses. The total area showing different types of lesions was estimated. Diabetes led to a decrease in the body and prostatic weights, as well as in testosterone levels. The prostate morphology and stereology showed high variation in the diabetic group. Some animals had light changes; the great majority had an intense epithelial atrophy; and other rats showed premalignant and malignant lesions in the prostate. Such epithelial atrophy was, in some samples, combined with chronic inflammation, similar to proliferative inflammatory atrophy (PIA). The diabetic group also presented high incidence of prostatitis, adenocarcinoma and prostatic intra-epithelial neoplasia (PIN). Samples with adenocarcinoma had poorly differentiated acini with high levels of cellular proliferation and nuclear atypia. These lesions exhibited an invasive feature showing Bcl-2-positive cells and interruptions in the basement membrane. An association of PIA, PIN and adenocarcinoma was detected in one sample. Reduced androgen levels have a synergic effect to insulin dysfunction promoting negative effects in the rat prostate. Diabetic individuals had a high incidence of prostatitis, and this inflammation could stimulate the incidence of other forms of prostatic pathology. PMID:18715471

  14. Trimodal spectra for high discrimination of benign and malignant prostate tissue

    NASA Astrophysics Data System (ADS)

    Al Salhi, Mohamad; Masilamani, Vadivel; Trinka, Vijmasi; Rabah, Danny; Al Turki, Mohammed R.

    2011-02-01

    High false positives and over diagnosis is a major problem with management of prostate cancer. A non-invasive or a minimally invasive technique to accurately distinguish malignant prostate cancers from benign tumors will be extremely helpful to overcome this problem. In this paper, we had used three different fluorescence spectroscopy techniques viz., Fluorescence Emission Spectrum (FES), Stokes' Shift Spectrum (SSS) and Reflectance Spectrum (RS) to discriminate benign prostate tumor tissues (N=12) and malignant prostate cancer tissues (N=8). These fluorescence techniques were used to determine the relative concentration of naturally occurring biomolecules such as tryptophan, elastin, NADH and flavin which are found to be out of proportion in cancer tissues. Our studies show that combining all three techniques, benign and malignant prostate tissues could be classified with accuracy greater than 90%. This preliminary report is based on in vitro spectroscopy analysis. However, by employing fluorescence endoscopy techniques, this can be extended to in vivo analysis as well. This technique has the potential to identify malignant prostate tissues without surgery.

  15. Prostatic Stromal Tumor of Uncertain Malignant Potential Which Was Difficult to Diagnose

    PubMed Central

    Matsuyama, Satoko; Nohara, Takahiro; Kawaguchi, Shohei; Seto, Chikashi; Nakanishi, Yuko; Uchiyama, Akio; Ishizawa, Shin

    2015-01-01

    Here, we report a case of stromal tumor of uncertain malignant potential (STUMP) that was difficult to diagnose. A 53-year-old male was found to have a hard nodule on digital rectal examination; magnetic resonance imaging revealed a large nodule on the left side of the prostate, indicating prostate cancer. However, pathological diagnosis of the biopsy specimen was benign prostatic hyperplasia. Although a papillary tumor in the prostatic urethra was also seen on urethrocystoscopy, the tumor specimen obtained from transurethral resection was not malignant. The tumor in the prostatic urethra recurred only 3 months after transurethral resection, and pathological findings revealed benign hyperplasia not only in the stromal tissue but also in the epithelium; therefore, the prostate tumor was suspected to be STUMP. It took many prostate pathologists a long time to reach the final diagnosis of STUMP. STUMP is a rare benign tumor, difficult to diagnose, and sometimes transforms into stromal sarcoma. Thus, we should consider radical resection in such cases. PMID:26839730

  16. Risk of malignant melanoma in men with prostate cancer: Nationwide, population-based cohort study.

    PubMed

    Thomsen, Frederik B; Folkvaljon, Yasin; Garmo, Hans; Robinson, David; Loeb, Stacy; Ingvar, Christian; Lambe, Mats; Stattin, Pär

    2016-05-01

    An increased risk of malignant melanoma has been observed in men with prostate cancer. To assess potential shared risk factors and confounding factors, we analysed risk of melanoma in men with prostate cancer including information on tumor characteristics and demographics including socioeconomic status. In The Prostate Cancer data Base Sweden, risk of melanoma was assessed in a cohort of men with prostate cancer and in a comparison cohort of prostate-cancer free men. Data on prostate cancer risk category, melanoma stage, basal cell carcinoma, location of residency, and socioeconomic status were obtained from nationwide registers. Melanoma was diagnosed in 830/108,145 (0.78%) men with prostate cancer and in 3,699/556,792 (0.66%) prostate cancer-free men. In multivariable Cox regression models, men with prostate cancer had a significantly increased risk of melanoma (HR 1.18, 95% CI 1.09-1.27), and so had married men, men with high education and income, and men residing in southern Sweden. The strongest associations were observed for stage 0 melanoma in men with low-risk prostate cancer (HR 1.45, 1.14-1.86), high education (HR 1.87, 1.60-2.18) and top income (HR 1.61, 1.34-1.93), respectively, whereas there was no association between these factors and late-stage melanoma. Men with prostate cancer also had an increased risk of basal cell carcinoma (HR 1.18, 1.15-1.22). In conclusion, men with low-risk prostate cancer, high education, high income and residency in southern Sweden had an increased risk of early-stage melanoma. PMID:26662367

  17. Hybrid optoacoustic and ultrasonic imaging system for detection of prostate malignancies

    NASA Astrophysics Data System (ADS)

    Yaseen, Mohammad A.; Brecht, H. P.-F.; Ermilov, Sergey A.; Gharieb, Reda R.; Conjusteau, Andre; Oraevsky, Alexander A.

    2008-02-01

    Ultrasound imaging is the current gold standard for guiding biopsy of prostate. Optoacoustic imaging yields higher contrast in detection of malignant tissues. The two techniques provide complementary information. We are currently developing a hybrid laser optoacoustic and ultrasound imaging system for prostate tumor detection (LOUIS-P). The optoacoustic part consists of a fiber-coupled Q-switched laser operating at either 757 nm or 1064 nm attached to a commercially-available 128-channel ultrasonic probe modified for optimal detection of optoacoustic signals, a digital signal processor with 128 independent channels, and software that uses the radial (filtered) backprojection algorithm to reconstruct tomographic images. We evaluated system-imaging performance using test objects submerged in milky water, and poly(vinyl-chloride) plastisol tissue phantoms simulating malignant lesions. LOUIS-P demonstrates potential as a clinical technique for minimally invasive imaging and diagnosis of prostate cancer.

  18. Correlation between methylation of the E-Cadherin gene and malignancy of prostate cancer.

    PubMed

    Zhang, S Q; Zhang, G Q; Zhang, L

    2016-01-01

    Prostate cancer is a common malignant tumor in males with an unclear pathogenic mechanism. As one epigenetic regulation mechanism, DNA methylation of the whole genome and specific gene(s) plays critical roles in pathogenesis, progression, diagnosis, and treatment of prostate cancer. The E-Cadherin gene is involved in cell metabolism and has been suggested to be related with malignancy of multiple tumors. This study investigated the correlation between E-Cadherin methylation and malignancy of prostate cancer. Gradient concentrations of 5-Aza-CdR (5, 10, and 20 mM) were used to treat the prostate cancer cell line (LNCaP), and mRNA level of E-Cadherin was detected by reverse transcription-polymerase chain reaction (RT-PCR). A total of 82 prostate cancer patients were recruited to detect the methylation status of the promoter region of the E-Cadherin gene by pyrophosphate sequencing. Real-time fluorescent quantitative PCR (qRT-PCR) was employed to determine mRNA levels of E-Cadherin. Methylation and mRNA levels of E-Cadherin were analyzed by the SPSS software. With elevated concentrations of 5-Aza-CdR, mRNA levels of E-Cadherin gradually increased. DNA methylation levels of tumor tissues were significantly elevated with increased Gleason score (P < 0.05) and tumor-node-metastasis stage (P < 0.05) but were not related to age, smoking habits, or alcohol consumption (P > 0.05). DNA methylation level was negatively correlated with mRNA expression of the E-Cadherin gene. Methylation in tumor tissues was significantly higher than that in tumor adjacent tissues (P < 0.05). DNA methylation level of the E-Cadherin gene could be an important predictive index for malignancy of prostate cancer. PMID:27420993

  19. Estrogen and estrogen receptor alpha promotes malignancy and osteoblastic tumorigenesis in prostate cancer

    PubMed Central

    Mishra, Sweta; Tai, Qin; Gu, Xiang; Schmitz, James; Poullard, Ashley; Fajardo, Roberto J.; Mahalingam, Devalingam; Chen, Xiaodong; Zhu, Xueqiong; Sun, Lu-Zhe

    2015-01-01

    The role of estrogen signaling in regulating prostate tumorigenesis is relatively underexplored. Although, an increasing body of evidence has linked estrogen receptor beta (ERβ) to prostate cancer, the function of estrogen receptor alpha (ERα) in prostate cancer is not very well studied. We have discovered a novel role of ERα in the pathogenesis of prostate tumors. Here, we show that prostate cancer cells express ERα and estrogen induces oncogenic properties in prostate cancer cells through ERα. Importantly, ERα knockdown in the human prostate cancer PacMetUT1 cells as well as pharmacological inhibition of ERα with ICI 182,780 inhibited osteoblastic lesion formation and lung metastasis in vivo. Co-culture of pre-osteoblasts with cancer cells showed a significant induction of osteogenic markers in the pre-osteoblasts, which was attenuated by knockdown of ERα in cancer cells suggesting that estrogen/ERα signaling promotes crosstalk between cancer and osteoblastic progenitors to stimulate osteoblastic tumorigenesis. These results suggest that ERα expression in prostate cancer cells is essential for osteoblastic lesion formation and lung metastasis. Thus, inhibition of ERα signaling in prostate cancer cells may be a novel therapeutic strategy to inhibit the osteoblastic lesion development as well as lung metastasis in patients with advanced prostate cancer. PMID:26575018

  20. Bcl-B Expression in Human Epithelial and Nonepithelial Malignancies

    PubMed Central

    Krajewska, Maryla; Kitada, Shinichi; Winter, Jane N.; Variakojis, Daina; Lichtenstein, Alan; Zhai, Dayong; Cuddy, Michael; Huang, Xianshu; Luciano, Frederic; Baker, Cheryl H.; Kim, Hoguen; Shin, Eunah; Kennedy, Susan; Olson, Allen H.; Badzio, Andrzej; Jassem, Jacek; Meinhold-Heerlein, Ivo; Duffy, Michael J.; Schimmer, Aaron D.; Tsao, Ming; Brown, Ewan; Sawyers, Anne; Andreeff, Michael; Mercola, Dan; Krajewski, Stan; Reed, John C.

    2014-01-01

    Purpose Apoptosis plays an important role in neoplastic processes. Bcl-B is an antiapoptotic Bcl-2 family member, which is known to change its phenotype upon binding to Nur77/TR3. The expression pattern of this protein in human malignancies has not been reported. Experimental Design We investigated Bcl-B expression in normal human tissues and several types of human epithelial and nonepithelial malignancy by immunohistochemistry, correlating results with tumor stage, histologic grade, and patient survival. Results Bcl-B protein was strongly expressed in all normal plasma cells but found in only18%of multiple myelomas (n = 133). Bcl-B immunostaining was also present in normal germinal center centroblasts and centrocytes and in approximately half of diffuse large B-cell lymphoma (n =48) specimens, whereas follicular lymphomas (n = 57) did not contain Bcl-B. In breast (n = 119), prostate (n = 66), gastric (n = 180), and colorectal (n = 106) adenocarcinomas, as well as in non – small cell lung cancers (n = 82), tumor-specific overexpression of Bcl-B was observed. Bcl-B expression was associated with variables of poor prognosis, such as high tumor grade in breast cancer (P = 0.009), microsatellite stability (P = 0.0002), and left-sided anatomic location (P = 0.02) of colorectal cancers, as well as with greater incidence of death from prostate cancer (P = 0.005) and shorter survival of patients with small cell lung cancer (P = 0.009). Conversely, although overexpressed in many gastric cancers, Bcl-B tended to correlate with better outcome (P = 0.01) and more differentiated tumor histology (P < 0.0001). Conclusions Tumor-specific alterations in Bcl-B expressionmay define subsets of nonepithelial and epithelial neoplasms with distinct clinical behaviors. PMID:18483366

  1. The role of human papilloma virus in urological malignancies.

    PubMed

    Heidegger, Isabel; Borena, Wegene; Pichler, Renate

    2015-05-01

    Human papillomavirus (HPV) is associated with cancer of the cervix uteri, penis, vulva, vagina, anus and oropharynx. However, the role of HPV infection in urological tumors is not yet clarified. HPV appears not to play a major causative role in renal and testicular carcinogenesis. However, HPV infection should be kept in mind regarding cases of prostate cancer, as well as in a sub-group of patients with bladder cancer with squamous differentiation. Concerning the role of HPV in penile cancer incidence, it is a recognized risk factor proven in a large number of studies. This short review provides an update regarding recent literature on HPV in urological malignancies, thereby, also discussing possible limitations on HPV detection in urological cancer. PMID:25964524

  2. Obesity and prostate cancer: gene expression signature of human periprostatic adipose tissue

    PubMed Central

    2012-01-01

    Background Periprostatic (PP) adipose tissue surrounds the prostate, an organ with a high predisposition to become malignant. Frequently, growing prostatic tumor cells extend beyond the prostatic organ towards this fat depot. This study aimed to determine the genome-wide expression of genes in PP adipose tissue in obesity/overweight (OB/OW) and prostate cancer patients. Methods Differentially expressed genes in human PP adipose tissue were identified using microarrays. Analyses were conducted according to the donors' body mass index characteristics (OB/OW versus lean) and prostate disease (extra prostatic cancer versus organ confined prostate cancer versus benign prostatic hyperplasia). Selected genes with altered expression were validated by real-time PCR. Ingenuity Pathway Analysis (IPA) was used to investigate gene ontology, canonical pathways and functional networks. Results In the PP adipose tissue of OB/OW subjects, we found altered expression of genes encoding molecules involved in adipogenic/anti-lipolytic, proliferative/anti-apoptotic, and mild immunoinflammatory processes (for example, FADS1, down-regulated, and LEP and ANGPT1, both up-regulated). Conversely, in the PP adipose tissue of subjects with prostate cancer, altered genes were related to adipose tissue cellular activity (increased cell proliferation/differentiation, cell cycle activation and anti-apoptosis), whereas a downward impact on immunity and inflammation was also observed, mostly related to the complement (down-regulation of CFH). Interestingly, we found that the microRNA MIRLET7A2 was overexpressed in the PP adipose tissue of prostate cancer patients. Conclusions Obesity and excess adiposity modified the expression of PP adipose tissue genes to ultimately foster fat mass growth. In patients with prostate cancer the expression profile of PP adipose tissue accounted for hypercellularity and reduced immunosurveillance. Both findings may be liable to promote a favorable environment for

  3. Induced pluripotency of human prostatic epithelial cells.

    PubMed

    Zhao, Hongjuan; Sun, Ning; Young, Sarah R; Nolley, Rosalie; Santos, Jennifer; Wu, Joseph C; Peehl, Donna M

    2013-01-01

    Induced pluripotent stem (iPS) cells are a valuable resource for discovery of epigenetic changes critical to cell type-specific differentiation. Although iPS cells have been generated from other terminally differentiated cells, the reprogramming of normal adult human basal prostatic epithelial (E-PZ) cells to a pluripotent state has not been reported. Here, we attempted to reprogram E-PZ cells by forced expression of Oct4, Sox2, c-Myc, and Klf4 using lentiviral vectors and obtained embryonic stem cell (ESC)-like colonies at a frequency of 0.01%. These E-PZ-iPS-like cells with normal karyotype gained expression of pluripotent genes typical of iPS cells (Tra-1-81, SSEA-3, Nanog, Sox2, and Oct4) and lost gene expression characteristic of basal prostatic epithelial cells (CK5, CK14, and p63). E-PZ-iPS-like cells demonstrated pluripotency by differentiating into ectodermal, mesodermal, and endodermal cells in vitro, although lack of teratoma formation in vivo and incomplete demethylation of pluripotency genes suggested only partial reprogramming. Importantly, E-PZ-iPS-like cells re-expressed basal epithelial cell markers (CD44, p63, MAO-A) in response to prostate-specific medium in spheroid culture. Androgen induced expression of androgen receptor (AR), and co-culture with rat urogenital sinus further induced expression of prostate-specific antigen (PSA), a hallmark of secretory cells, suggesting that E-PZ-iPS-like cells have the capacity to differentiate into prostatic basal and secretory epithelial cells. Finally, when injected into mice, E-PZ-iPS-like cells expressed basal epithelial cell markers including CD44 and p63. When co-injected with rat urogenital mesenchyme, E-PZ-iPS-like cells expressed AR and expression of p63 and CD44 was repressed. DNA methylation profiling identified epigenetic changes in key pathways and genes involved in prostatic differentiation as E-PZ-iPS-like cells converted to differentiated AR- and PSA-expressing cells. Our results suggest that

  4. Orphan nuclear receptor nurr1 as a potential novel marker for progression in human prostate cancer.

    PubMed

    Wang, Jian; Yang, Jing; Zou, Ying; Huang, Guo-Liang; He, Zhi-Wei

    2013-01-01

    A number of studies have indicated that Nurr1, which belongs to a novel class of orphan nuclear receptors (the NR4A family), is important for carcinogenesis. Here we investigated expression of Nurr1 protein in benign and malignant human prostate tissues and association with clinicopathologic features using immunohistochemical techniques. Moreover, we also investigated the ability of Nurr1 to influence proliferation, migration, invasion and apoptosis of human prostate cancer cells using small interfering RNA silencing. Immunohistochemical analysis revealed that the expression of Nurr1 protein was higher in prostate cancer tissues than in benign prostate tissue (P < 0.001), levels being positively correlated with tumor T classification (P = 0.003), N classification (P = 0.017), M classification (P = 0.011) and the Gleason score (P = 0.020) of prostate cancer patients. In vitro, silencing of endogenous Nurr1 attenuated cell proliferation, migration and invasion, and induced apoptosis of prostate cancer cells. These results suggest that Nurr1 may be used as an indicator for prostate cancer progression and be useful for novel potential therapeutic strategies. PMID:23679312

  5. Round cell pattern of prostatic stromal tumor of uncertain malignant potential: a subtle newly recognized variant.

    PubMed

    Sadimin, Evita T; Epstein, Jonathan I

    2016-06-01

    Prostatic stromal tumor of uncertain malignant potential (STUMP) is a distinct entity which includes several different patterns. Four patterns of STUMP have been described including stroma with (1) degenerative atypia, (2) hypercellular spindle cells, (3) myxoid spindle cells, and (4) phyllodes-like pattern. The current study identified a novel round cell pattern. We searched our database from 1999 to 2015 and identified 7 patients with round cell pattern out of a total number of 98 patients with STUMP. All 7 cases showed mildly increased stromal cellularity with rounded nuclei, diagnosed on core biopsies in 5 cases, transurethral resection in 1 case, and radical prostatectomy in 1 case. Some degree of glandular displacement was observed in 4 cases. In 2 of the cases, STUMP was not recognized histologically by the referring pathologists and was initially diagnosed as benign prostatic hyperplasia. As has been described with other patterns of STUMP, several cases showed associated epithelial proliferations that in some instances masked the neoplastic stromal process. The round cell pattern of STUMP is a new deceptively subtle pattern that may not be recognized as a neoplasm and may be misdiagnosed as benign prostatic hyperplasia. Although there was no direct evidence in our study that the round cell pattern of STUMP has the same behavior as other variants of STUMPs, increased recognition of this entity will hopefully lead to additional studies to further understand its malignant potential. PMID:26980017

  6. Multidisciplinary treatment including systemic chemotherapy for a malignant phyllodes tumour of the prostate.

    PubMed

    Murakami, Yasukiyo; Tabata, Ken-Ichi; Sugita, Atsushi; Mochizuki, Kohei; Maeyama, Ryota; Okazaki, Miyoko; Nishi, Morihiro; Matsumoto, Kazumasa; Fujita, Tetsuo; Satoh, Takefumi; Jiang, Shi-Xu; Saegusa, Makoto; Iwamura, Masatsugu

    2014-03-01

    A 22-year-old man was referred to our hospital with macroscopic hematuria and consistent anal pain. Magnetic resonance imaging revealed an enlarged prostate tumour invading the bladder and rectum. A biopsy revealed an unclassified spindle cell sarcoma. Subsequently, radical cystoprostatectomy and resection of the rectum were performed. A histopathological examination revealed a prostatic malignant phyllodes tumour with a negative surgical margin. However, a local recurrence was identified 2 months after surgery. Induction therapy included 4 cycles of systemic chemotherapy comprising etoposide with ifosfamide and cisplatin. Although a partial response was observed at the local site, lung metastasis developed. Second-line chemotherapy with ifosfamide and doxorubicin with radiotherapy to the pelvis was administered and led to complete regression; however, its efficacy was transient. Although additional chemotherapy was administered, the patient eventually died due to the rapidly growing, recurrent tumour. PMID:24839496

  7. Epigenetic Regulation of Vitamin D 24-Hydroxylase/CYP24A1 in Human Prostate Cancer

    PubMed Central

    Luo, Wei; Karpf, Adam R.; Deeb, Kristin K.; Muindi, Josephia R.; Morrison, Carl D.; Johnson, Candace S.; Trump, Donald L.

    2010-01-01

    Calcitriol, a regulator of calcium homeostasis with antitumor properties, is degraded by the product of the CYP24A1 gene which is downregulated in human prostate cancer by unknown mechanisms. We found that CYP24A1 expression is inversely correlated with promoter DNA methylation in prostate cancer cell lines. Treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) activates CYP24A1 expression in prostate cancer cells. In vitro methylation of the CYP24A1 promoter represses its promoter activity. Furthermore, inhibition of histone deacetylases by trichostatin A (TSA) enhances the expression of CYP24A1 in prostate cancer cells. ChIP-qPCR reveals that specific histone modifications are associated with the CYP24A1 promoter region. Treatment with TSA increases H3K9ac and H3K4me2 and simultaneously decreases H3K9me2 at the CYP24A1 promoter. ChIP-qPCR assay reveals that treatment with DAC and TSA increases the recruitment of VDR to the CYP24A1 promoter. RT-PCR analysis of paired human prostate samples reveals that CYP24A1 expression is down-regulated in prostate malignant lesions compared to adjacent histologically benign lesions. Bisulfite pyrosequencing shows that CYP24A1 gene is hypermethylated in malignant lesions compared to matched benign lesions. Our findings indicate that repression of CYP24A1 gene expression in human prostate cancer cells is mediated in part by promoter DNA methylation and repressive histone modifications. PMID:20587525

  8. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil.

    PubMed

    Araujo-Neto, Ari P; Ferreira-Fernandes, Hygor; Amaral, Carolina M M; Santos, Lina G; Freitas, Antônio C; Silva-Neto, Jacinto C; Rey, Juan A; Burbano, Rommel R; Silva, Benedito B da; Yoshioka, France K N; Pinto, Giovanny R

    2016-03-01

    Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  9. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil

    PubMed Central

    Araujo-Neto, Ari P.; Ferreira-Fernandes, Hygor; Amaral, Carolina M.M.; Santos, Lina G.; Freitas, Antônio C.; Silva-Neto, Jacinto C.; Rey, Juan A.; Burbano, Rommel R.; da Silva, Benedito B.; Yoshioka, France K.N.; Pinto, Giovanny R.

    2016-01-01

    Abstract Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  10. GEOPHYSICS, ASTRONOMY AND ASTROPHYSICS: Second-harmonic generation as a DNA malignancy indicator of prostate glandular epithelial cells

    NASA Astrophysics Data System (ADS)

    Zhuang, Zheng-Fei; Liu, Han-Ping; Guo, Zhou-Yi; Zhuo, Shuang-Mu; Yu, Bi-Ying; Deng, Xiao-Yuan

    2010-04-01

    This paper first demonstrates second-harmonic generation (SHG) in the intact cell nucleus, which acts as an optical indicator of DNA malignancy in prostate glandular epithelial cells. Within a scanning region of 2.7 μm×2.7 μm in cell nuclei, SHG signals produced from benign prostatic hyperplasia (BPH) and prostate carcinoma (PC) tissues (mouse model C57BL/6) have been investigated. Statistical analyses (t test) of a total of 405 measurements (204 nuclei from BPH and 201 nuclei from PC) show that SHG signals from BPH and PC have a distinct difference (p < 0.05), suggesting a potential optical method of revealing very early malignancy in prostate glandular epithelial cells based upon induced biochemical and/or biophysical modifications in DNA.

  11. Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

    PubMed

    Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

    2014-12-01

    Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. PMID:24740818

  12. Human malignant melanoma heterotransplanted to nude mice.

    PubMed

    Tropé, C; Johnsson, J E; Alm, P; Landberg, T; Olsson, H; Wennerberg, J

    1981-01-01

    Five different human malignant melanoma were heterotransplanted subcutaneously to nude mice. When small tissue pieces were used 3 out of 5 tumors grew. Subcutaneous injections of suspended tumor cells were also made, but all failed to take. Metastatic or infiltrative growth was never seen in the mice observed for up to 2.5 months. The successful grafts largely retained the original morphologicaL features. The three successfully transplanted tumors could all be serially transferred with 100% tumor take. In one case passage time was reduced from 40 days to 15 days. As measured with 3H-thymidine incorporation the proliferation rate increased during the passages. These changes might be due to a selection of more rapidly growing tumor cells in the nudes. PMID:7312076

  13. Developmental Exposure to Estrogen Alters Differentiation and Epigenetic Programming in a Human Fetal Prostate Xenograft Model

    PubMed Central

    Saffarini, Camelia M.; McDonnell-Clark, Elizabeth V.; Amin, Ali; Huse, Susan M.; Boekelheide, Kim

    2015-01-01

    Prostate cancer is the most frequent non-cutaneous malignancy in men. There is strong evidence in rodents that neonatal estrogen exposure plays a role in the development of this disease. However, there is little information regarding the effects of estrogen in human fetal prostate tissue. This study explored early life estrogen exposure, with and without a secondary estrogen and testosterone treatment in a human fetal prostate xenograft model. Histopathological lesions, proliferation, and serum hormone levels were evaluated at 7, 30, 90, and 200-day time-points after xenografting. The expression of 40 key genes involved in prostatic glandular and stromal growth, cell-cycle progression, apoptosis, hormone receptors and tumor suppressors was evaluated using a custom PCR array. Epigenome-wide analysis of DNA methylation was performed on whole tissue, and laser capture-microdissection (LCM) isolated epithelial and stromal compartments of 200-day prostate xenografts. Combined initial plus secondary estrogenic exposures had the most severe tissue changes as revealed by the presence of hyperplastic glands at day 200. Gene expression changes corresponded with the cellular events in the KEGG prostate cancer pathway, indicating that initial plus secondary exposure to estrogen altered the PI3K-Akt signaling pathway, ultimately resulting in apoptosis inhibition and an increase in cell cycle progression. DNA methylation revealed that differentially methylated CpG sites significantly predominate in the stromal compartment as a result of estrogen-treatment, thereby providing new targets for future investigation. By using human fetal prostate tissue and eliminating the need for species extrapolation, this study provides novel insights into the gene expression and epigenetic effects related to prostate carcinogenesis following early life estrogen exposure. PMID:25799167

  14. Human Prostate Side Population Cells Demonstrate Stem Cell Properties in Recombination with Urogenital Sinus Mesenchyme

    PubMed Central

    Foster, Barbara A.; Gangavarapu, Kalyan J.; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D.; Miller, Austin; Huss, Wendy J.

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  15. Human prostate side population cells demonstrate stem cell properties in recombination with urogenital sinus mesenchyme.

    PubMed

    Foster, Barbara A; Gangavarapu, Kalyan J; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D; Miller, Austin; Huss, Wendy J

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  16. Metastasis in urothelial carcinoma mimicking prostate cancer metastasis in Ga-68 prostate-specific membrane antigen positron emission tomography-computed tomography in a case of synchronous malignancy.

    PubMed

    Gupta, Manoj; Choudhury, Partha Sarathi; Gupta, Gurudutt; Gandhi, Jatin

    2016-01-01

    Prostate cancer is the second most common cancer in man. It commonly presents with urinary symptoms, bone pain, or diagnosed with elevated prostate-specific antigen.(PSA) levels. Correct staging and early diagnosis of recurrence by a precise imaging tool are the keys for optimum management. Molecular imaging of prostate cancer with Ga-68 prostate-specific membrane antigen.(PSMA), positron emission tomography-computed tomography.(PET-CT) has recently received significant attention and frequently used with a signature to prostate cancer-specific remark. However, this case will highlight the more cautious use of it. A-72-year-old male treated earlier for synchronous double malignancy.(invasive papillary urothelial carcinoma right ureter and carcinoma prostate) presented with rising PSA.(0.51.ng/ml) and referred for Ga-68 PSMA PET-CT, which showed a positive enlarged left supraclavicular lymph node. Lymph node biopsy microscopic and immunohistochemistry examination revealed metastatic carcinoma favoring urothelial origin. Specificity of PSMA scan to prostate cancer has been seen to be compromised in a certain situation mostly due to neoangiogenesis, and false positives emerged in renal cell cancer, differentiated thyroid cancer, glioblastoma, breast cancer brain metastasis, and paravertebral schwannomas. Understanding the causes of false positive will further enhance the confidence of interpretating PSMA scans. PMID:27385897

  17. Metastasis in urothelial carcinoma mimicking prostate cancer metastasis in Ga-68 prostate-specific membrane antigen positron emission tomography-computed tomography in a case of synchronous malignancy

    PubMed Central

    Gupta, Manoj; Choudhury, Partha Sarathi; Gupta, Gurudutt; Gandhi, Jatin

    2016-01-01

    Prostate cancer is the second most common cancer in man. It commonly presents with urinary symptoms, bone pain, or diagnosed with elevated prostate-specific antigen.(PSA) levels. Correct staging and early diagnosis of recurrence by a precise imaging tool are the keys for optimum management. Molecular imaging of prostate cancer with Ga-68 prostate-specific membrane antigen.(PSMA), positron emission tomography-computed tomography.(PET-CT) has recently received significant attention and frequently used with a signature to prostate cancer-specific remark. However, this case will highlight the more cautious use of it. A-72-year-old male treated earlier for synchronous double malignancy.(invasive papillary urothelial carcinoma right ureter and carcinoma prostate) presented with rising PSA.(0.51.ng/ml) and referred for Ga-68 PSMA PET-CT, which showed a positive enlarged left supraclavicular lymph node. Lymph node biopsy microscopic and immunohistochemistry examination revealed metastatic carcinoma favoring urothelial origin. Specificity of PSMA scan to prostate cancer has been seen to be compromised in a certain situation mostly due to neoangiogenesis, and false positives emerged in renal cell cancer, differentiated thyroid cancer, glioblastoma, breast cancer brain metastasis, and paravertebral schwannomas. Understanding the causes of false positive will further enhance the confidence of interpretating PSMA scans. PMID:27385897

  18. Immunoprevention of human papillomavirus-associated malignancies

    PubMed Central

    Wang1, Joshua W.; Hung, Chein-fu; Huh, Warner K.; Trimble, Cornelia L.; Roden, Richard B.S.

    2014-01-01

    Persistent infection by one of fifteen high risk human papillomavirus (hrHPV) types is a necessary but not sufficient cause of 5% of all human cancers. This provides a remarkable opportunity for cancer prevention via immunization. Since Harald zur Hausen’s pioneering identification of hrHPV types 16 and 18, found in ~50% and ~20% of cervical cancers respectively, two prophylactic HPV vaccines containing virus-like particles (VLP) of each genotype have been widely licensed. These vaccines are beginning to impact infection and HPV-associated neoplasia rates after immunization campaigns in adolescents. Here we review recent progress and opportunities to better prevent HPV-associated cancers, including: broadening immune-protection to cover all hrHPV types, reducing the cost of HPV vaccines especially for developing countries that have the highest rates of cervical cancer, and immune-based treatment of established HPV infections. Screening based upon George Papanicolaou’s cervical cytology testing, and more recently detection of hrHPV DNA/RNA, followed by ablative treatment of high grade cervical intraepithelial neoplasia (CIN2/3) have substantially reduced cervical cancer rates, and we examine their interplay with immune-based modalities for the prevention and eventual elimination of cervical cancer and other HPV-related malignancies. PMID:25488410

  19. Immunoprevention of human papillomavirus-associated malignancies.

    PubMed

    Wang, Joshua W; Hung, Chein-Fu; Huh, Warner K; Trimble, Cornelia L; Roden, Richard B S

    2015-02-01

    Persistent infection by one of 15 high-risk human papillomavirus (hrHPV) types is a necessary but not sufficient cause of 5% of all human cancers. This provides a remarkable opportunity for cancer prevention via immunization. Since Harald zur Hausen's pioneering identification of hrHPV types 16 and 18, found in approximately 50% and 20% of cervical cancers, respectively, two prophylactic HPV vaccines containing virus-like particles (VLP) of each genotype have been widely licensed. These vaccines are beginning to affect infection and HPV-associated neoplasia rates after immunization campaigns in adolescents. Here, we review recent progress and opportunities to better prevent HPV-associated cancers, including broadening immune protection to cover all hrHPV types, reducing the cost of HPV vaccines especially for developing countries that have the highest rates of cervical cancer, and immune-based treatment of established HPV infections. Screening based upon George Papanicolaou's cervical cytology testing, and more recently detection of hrHPV DNA/RNA, followed by ablative treatment of high-grade cervical intraepithelial neoplasia (CIN2/3) have substantially reduced cervical cancer rates, and we examine their interplay with immune-based modalities for the prevention and eventual elimination of cervical cancer and other HPV-related malignancies. PMID:25488410

  20. N-Myc Drives Neuroendocrine Prostate Cancer Initiated from Human Prostate Epithelial Cells.

    PubMed

    Lee, John K; Phillips, John W; Smith, Bryan A; Park, Jung Wook; Stoyanova, Tanya; McCaffrey, Erin F; Baertsch, Robert; Sokolov, Artem; Meyerowitz, Justin G; Mathis, Colleen; Cheng, Donghui; Stuart, Joshua M; Shokat, Kevan M; Gustafson, W Clay; Huang, Jiaoti; Witte, Owen N

    2016-04-11

    MYCN amplification and overexpression are common in neuroendocrine prostate cancer (NEPC). However, the impact of aberrant N-Myc expression in prostate tumorigenesis and the cellular origin of NEPC have not been established. We define N-Myc and activated AKT1 as oncogenic components sufficient to transform human prostate epithelial cells to prostate adenocarcinoma and NEPC with phenotypic and molecular features of aggressive, late-stage human disease. We directly show that prostate adenocarcinoma and NEPC can arise from a common epithelial clone. Further, N-Myc is required for tumor maintenance, and destabilization of N-Myc through Aurora A kinase inhibition reduces tumor burden. Our findings establish N-Myc as a driver of NEPC and a target for therapeutic intervention. PMID:27050099

  1. Second malignancies after radiotherapy for prostate cancer: systematic review and meta-analysis

    PubMed Central

    Wallis, Christopher J D; Mahar, Alyson L; Choo, Richard; Herschorn, Sender; Kodama, Ronald T; Shah, Prakesh S; Danjoux, Cyril; Narod, Steven A

    2016-01-01

    Objective To determine the association between exposure to radiotherapy for the treatment of prostate cancer and subsequent second malignancies (second primary cancers). Design Systematic review and meta-analysis of observational studies. Data sources Medline and Embase up to 6 April 2015 with no restrictions on year or language. Study selection Comparative studies assessing the risk of second malignancies in patients exposed or unexposed to radiotherapy in the course of treatment for prostate cancer were selected by two reviewers independently with any disagreement resolved by consensus. Data extraction and synthesis Two reviewers independently extracted study characteristics and outcomes. Risk of bias was assessed with the Newcastle-Ottawa scale. Outcomes were synthesized with random effects models and Mantel-Haenszel weighting. Unadjusted odds ratios and multivariable adjusted hazard ratios, when available, were pooled. Main outcome measures Second cancers of the bladder, colorectal tract, rectum, lung, and hematologic system. Results Of 3056 references retrieved, 21 studies were selected for analysis. Most included studies were large multi-institutional reports but had moderate risk of bias. The most common type of radiotherapy was external beam; 13 studies used patients treated with surgery as controls and eight used patients who did not undergo radiotherapy as controls. The length of follow-up among studies varied. There was increased risk of cancers of the bladder (four studies; adjusted hazard ratio 1.67, 95% confidence interval 1.55 to 1.80), colorectum (three studies; 1.79, 1.34 to 2.38), and rectum (three studies; 1.79, 1.34 to 2.38), but not cancers of the hematologic system (one study; 1.64, 0.90 to 2.99) or lung (two studies; 1.45, 0.70 to 3.01), after radiotherapy compared with the risk in those unexposed to radiotherapy. The odds of a second cancer varied depending on type of radiotherapy: treatment with external beam radiotherapy was

  2. Androgen Regulated Genes in Human Prostate Xenografts in Mice: Relation to BPH and Prostate Cancer

    PubMed Central

    Love, Harold D.; Booton, S. Erin; Boone, Braden E.; Breyer, Joan P.; Koyama, Tatsuki; Revelo, Monica P.; Shappell, Scott B.; Smith, Jeffrey R.; Hayward, Simon W.

    2009-01-01

    Benign prostatic hyperplasia (BPH) and prostate carcinoma (CaP) are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ) human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1) highly expressed in prostate, 2) had significant expression changes in response to androgens, and, 3) encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues. PMID:20027305

  3. PTEN: Multiple Functions in Human Malignant Tumors

    PubMed Central

    Milella, Michele; Falcone, Italia; Conciatori, Fabiana; Cesta Incani, Ursula; Del Curatolo, Anais; Inzerilli, Nicola; Nuzzo, Carmen M. A.; Vaccaro, Vanja; Vari, Sabrina; Cognetti, Francesco; Ciuffreda, Ludovica

    2015-01-01

    PTEN is the most important negative regulator of the PI3K signaling pathway. In addition to its canonical, PI3K inhibition-dependent functions, PTEN can also function as a tumor suppressor in a PI3K-independent manner. Indeed, the PTEN network regulates a broad spectrum of biological functions, modulating the flow of information from membrane-bound growth factor receptors to nuclear transcription factors, occurring in concert with other tumor suppressors and oncogenic signaling pathways. PTEN acts through its lipid and protein phosphatase activity and other non-enzymatic mechanisms. Studies conducted over the past 10 years have expanded our understanding of the biological role of PTEN, showing that in addition to its ability to regulate proliferation and cell survival, it also plays an intriguing role in regulating genomic stability, cell migration, stem cell self-renewal, and tumor microenvironment. Changes in PTEN protein levels, location, and enzymatic activity through various molecular mechanisms can generate a continuum of functional PTEN levels in inherited syndromes, sporadic cancers, and other diseases. PTEN activity can indeed, be modulated by mutations, epigenetic silencing, transcriptional repression, aberrant protein localization, and post-translational modifications. This review will discuss our current understanding of the biological role of PTEN, how PTEN expression and activity are regulated, and the consequences of PTEN dysregulation in human malignant tumors. PMID:25763354

  4. Fluorescence Spectroscopy of Human Nonmalignant and Malignant Cells and Tissues.

    NASA Astrophysics Data System (ADS)

    Glassman, Wenling Sha

    This thesis explores steady state and time resolved fluorescence spectroscopy from human malignant and non -malignant cells and tissues. The focus of these studies are the analysis of the excitation spectra, emission spectra, and decay time based on the contribution from several key intrinsic fluorophors: NAD(P)H, flavins, tryptophan, elastin and collagen that exist in different amounts in the human tissues and cells. The comparison between the spectra from malignant and non-malignant cells and tissues gives information on the changes that occur from non-malignancy to malignancy in the cells and tissues. The spectra of tissues and cells are also compared to help in understanding what fluorophors are responsible for fluorescence spectral differences between the malignant and non-malignant tissues and cells. The results in this thesis show that the spectral differences between the normal and cancerous tissues and cells exist in various wavelength ranges. The experimental data from GYN tissues have shown with over 95% of the sensitivity and specificity to separate malignant from non-malignant tissues using 300nm excitation. The 340nm band, which is mostly in response to intrinsic fluorophor (amino acid tryptophan), from malignant tissues were relatively higher then that from the non-malignant tissues. This might have been caused by the higher concentration of free tryptophan in the malignant tumor when compared to that of the normal tissue. This has been found in medical clinical study. The experimental data in this thesis also show that the fluorescence intensities around 450nm-460nm, which are mostly due to the intrinsic fluorophor coenzyme NADH, from both malignant cells in vitro and tissues in vitro are relatively higher than from non-malignant cells in vitro and tissues in vitro. These findings are reinforced by the faster decay time of the NADH fluorescence from normal cells in vitro than from neoplasm cells in vitro. Thus, the NADH in the mitochondria might be

  5. Multiphoton gradient index endoscopy for evaluation of diseased human prostatic tissue ex vivo

    NASA Astrophysics Data System (ADS)

    Huland, David M.; Jain, Manu; Ouzounov, Dimitre G.; Robinson, Brian D.; Harya, Diana S.; Shevchuk, Maria M.; Singhal, Paras; Xu, Chris; Tewari, Ashutosh K.

    2014-11-01

    Multiphoton microscopy can instantly visualize cellular details in unstained tissues. Multiphoton probes with clinical potential have been developed. This study evaluates the suitability of multiphoton gradient index (GRIN) endoscopy as a diagnostic tool for prostatic tissue. A portable and compact multiphoton endoscope based on a 1-mm diameter, 8-cm length GRIN lens system probe was used. Fresh ex vivo samples were obtained from 14 radical prostatectomy patients and benign and malignant areas were imaged and correlated with subsequent H&E sections. Multiphoton GRIN endoscopy images of unfixed and unprocessed prostate tissue at a subcellular resolution are presented. We note several differences and identifying features of benign versus low-grade versus high-grade tumors and are able to identify periprostatic tissues such as adipocytes, periprostatic nerves, and blood vessels. Multiphoton GRIN endoscopy can be used to identify both benign and malignant lesions in ex vivo human prostate tissue and may be a valuable diagnostic tool for real-time visualization of suspicious areas of the prostate.

  6. Chromosome-wide mapping of DNA methylation patterns in normal and malignant prostate cells reveals pervasive methylation of gene-associated and conserved intergenic sequences

    PubMed Central

    2011-01-01

    Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD) followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes) and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes) hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease. PMID:21669002

  7. PKN3 is required for malignant prostate cell growth downstream of activated PI 3-kinase

    PubMed Central

    Leenders, Frauke; Möpert, Kristin; Schmiedeknecht, Anett; Santel, Ansgar; Czauderna, Frank; Aleku, Manuela; Penschuck, Silke; Dames, Sibylle; Sternberger, Maria; Röhl, Thomas; Wellmann, Axel; Arnold, Wolfgang; Giese, Klaus; Kaufmann, Jörg; Klippel, Anke

    2004-01-01

    Chronic activation of the phosphoinositide 3-kinase (PI3K)/PTEN signal transduction pathway contributes to metastatic cell growth, but up to now effectors mediating this response are poorly defined. By simulating chronic activation of PI3K signaling experimentally, combined with three-dimensional (3D) culture conditions and gene expression profiling, we aimed to identify novel effectors that contribute to malignant cell growth. Using this approach we identified and validated PKN3, a barely characterized protein kinase C-related molecule, as a novel effector mediating malignant cell growth downstream of activated PI3K. PKN3 is required for invasive prostate cell growth as assessed by 3D cell culture assays and in an orthotopic mouse tumor model by inducible expression of short hairpin RNA (shRNA). We demonstrate that PKN3 is regulated by PI3K at both the expression level and the catalytic activity level. Therefore, PKN3 might represent a preferred target for therapeutic intervention in cancers that lack tumor suppressor PTEN function or depend on chronic activation of PI3K. PMID:15282551

  8. Influence of lycopene on cell viability, cell cycle, and apoptosis of human prostate cancer and benign hyperplastic cells.

    PubMed

    Soares, Nathalia da Costa Pereira; Teodoro, Anderson Junger; Oliveira, Felipe Leite; Santos, Carlos Antonio do Nascimento; Takiya, Christina Maeda; Junior, Oswaldo Saback; Bianco, Mario; Junior, Antonio Palumbo; Nasciutti, Luiz Eurico; Ferreira, Luciana Bueno; Gimba, Etel Rodrigues Pereira; Borojevic, Radovan

    2013-01-01

    Prostate cancer is the most common malignancy in men and the second leading cause of cancer-related mortality in men of the Western world. Lycopene has received attention because of its expcted potential to prevent cancer. In the present study, we evaluated the influence of lycopene on cell viability, cell cycle, and apoptosis of human prostate cancer cells and benign prostate hyperplastic cells. Using MTT assay, we observed a decrease of cell viability in all cancer cell lines after treatment with lycopene, which decreased the percentage of cells in G0/G1 phase and increased in S and G2/M phases after 96 h of treatment in metastatic prostate cancer cell lineages. Flow citometry analysis of cell cycle revealed lycopene promoted cell cycle arrest in G0/G1 phase after 48 and 96 h of treatment in a primary cancer cell line. Using real time PCR assay, lycopene also induced apoptosis in prostate cancer cells with altered gene expression of Bax and Bcl-2. No effect was observed in benign prostate hyperplasia cells. These results suggest an effect of lycopene on activity of human prostate cancer cells. PMID:24053141

  9. Hypomethylation of DNA from Benign and Malignant Human Colon Neoplasms

    NASA Astrophysics Data System (ADS)

    Goelz, Susan E.; Vogelstein, Bert; Hamilton, Stanley R.; Feinberg, Andrew P.

    1985-04-01

    The methylation state of DNA from human colon tissue displaying neoplastic growth was determined by means of restriction endonuclease analysis. When compared to DNA from adjacent normal tissue, DNA from both benign colon polyps and malignant carcinomas was substantially hypomethylated. With the use of probes for growth hormone, γ -globin, α -chorionic gonadotropin, and γ -crystallin, methylation changes were detected in all 23 neoplastic growths examined. Benign polyps were hypomethylated to a degree similar to that in malignant tissue. These results indicate that hypomethylation is a consistent biochemical characteristic of human colonic tumors and is an alteration in the DNA that precedes malignancy.

  10. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia

    PubMed Central

    Pearson, Helen B.; Perez-Mancera, Pedro A.; Dow, Lukas E.; Ryan, Andrew; Tennstedt, Pierre; Bogani, Debora; Elsum, Imogen; Greenfield, Andy; Tuveson, David A.; Simon, Ronald; Humbert, Patrick O.

    2011-01-01

    Loss of cellular polarity is a hallmark of epithelial cancers, raising the possibility that regulators of polarity have a role in suppressing tumorigenesis. The Scribble complex is one of at least three interacting protein complexes that have a critical role in establishing and maintaining epithelial polarity. In human colorectal, breast, and endometrial cancers, expression of the Scribble complex member SCRIB is often mislocalized and deregulated. Here, we report that Scrib is indispensable for prostate homeostasis in mice. Scrib heterozygosity initiated prostate hyperplasia, while targeted biallelic Scrib loss predisposed mice to prostate intraepithelial neoplasia. Mechanistically, Scrib was shown to negatively regulate the MAPK cascade to suppress tumorigenesis. Further analysis revealed that prostate-specific loss of Scrib in mice combined with expression of an oncogenic Kras mutation promoted the progression of prostate cancer that recapitulated the human disease. The clinical significance of the work in mice was highlighted by our observation that SCRIB deregulation strongly correlated with poor survival in human prostate cancer. These data suggest that the polarity network could provide a new avenue for therapeutic intervention. PMID:21965329

  11. Incidence of Second Malignancies in Prostate Cancer Patients Treated With Low-Dose-Rate Brachytherapy and Radical Prostatectomy

    SciTech Connect

    Hamilton, Sarah Nicole; Tyldesley, Scott; Hamm, Jeremy; Jiang, Wei Ning; Keyes, Mira; Pickles, Tom; Lapointe, Vince; Kahnamelli, Adam; McKenzie, Michael; Miller, Stacy; Morris, W. James

    2014-11-15

    Purpose: To compare the second malignancy incidence in prostate cancer patients treated with brachytherapy (BT) relative to radical prostatectomy (RP) and to compare both groups with the cancer incidence in the general population. Methods and Materials: From 1998 to 2010, 2418 patients were treated with Iodine 125 prostate BT monotherapy at the British Columbia Cancer Agency, and 4015 referred patients were treated with RP. Cancer incidence was compared with the age-matched general population using standardized incidence ratios (SIRs). Pelvic malignancies included invasive and noninvasive bladder cancer and rectal cancer. Cox multivariable analysis was performed with adjustment for covariates to determine whether treatment (RP vs BT) was associated with second malignancy risk. Results: The median age at BT was 66 years and at RP 62 years. The SIR comparing BT patients with the general population was 1.06 (95% confidence interval [CI] 0.91-1.22) for second malignancy and was 1.53 (95% CI 1.12-2.04) for pelvic malignancy. The SIR comparing RP patients with the general population was 1.11 (95% CI 0.98-1.25) for second malignancy and was 1.11 (95% CI 0.82-1.48) for pelvic malignancy. On multivariable analysis, older age (hazard ratio [HR] 1.05) and smoking (HR 1.65) were associated with increased second malignancy risk (P<.0001). Radical prostatectomy was not associated with a decreased second malignancy risk relative to BT (HR 0.90, P=.43), even when excluding patients who received postprostatectomy external beam radiation therapy (HR 1.13, P=.25). Older age (HR 1.09, P<.0001) and smoking (HR 2.17, P=.0009) were associated with increased pelvic malignancy risk. Radical prostatectomy was not associated with a decreased pelvic malignancy risk compared with BT (HR 0.57, P=.082), even when excluding postprostatectomy external beam radiation therapy patients (HR 0.87, P=.56). Conclusions: After adjustment for covariates, BT patients did not have an increased second

  12. Regulation of mRNA and Protein Levels of β1 Integrin Variants in Human Prostate Carcinoma

    PubMed Central

    Perlino, Elda; Lovecchio, Mariarosaria; Vacca, Rosa A.; Fornaro, Mara; Moro, Loredana; Ditonno, Pasquale; Battaglia, Michele; Selvaggi, Francesco P.; Mastropasqua, Mauro G.; Bufo, Pantaleo; Languino, Lucia R.

    2000-01-01

    Alterations of integrin expression levels in cancer cells correlate with changes in invasiveness, tumor progression, and metastatic potential. The β1C integrin, an alternatively spliced form of the human β1 integrin, has been shown to inhibit prostate cell proliferation. Furthermore, β1C protein levels were found to be abundant in normal prostate glandular epithelium and down-regulated in prostatic adenocarcinoma. To gain further insights into the molecular mechanisms underlying abnormal cancer cell proliferation, we have studied β1C and β1 integrin expression at both mRNA and protein levels by Northern and immunoblotting analysis using freshly isolated neoplastic and normal human prostate tissue specimens. Steady-state mRNA levels were evaluated in 38 specimens: 33 prostatic adenocarcinomas exhibiting different Gleason’s grade and five normal tissue specimens that did not show any histological manifestation of benign prostatic hypertrophy. Our results demonstrate that β1C mRNA is expressed in normal prostate and is significantly down-regulated in neoplastic prostate specimens. In addition, using a probe that hybridizes with all β1 variants, mRNA levels of β1 are found reduced in neoplastic versus normal prostate tissues. We demonstrate that β1C mRNA down-regulation does not correlate with either tumor grade or differentiation according to Gleason’s grade and TNM system evaluation, and that β1C mRNA levels are not affected by hormonal therapy. In parallel, β1C protein levels were analyzed. As expected, β1C is found to be expressed in normal prostate and dramatically reduced in neoplastic prostate tissues; in contrast, using an antibody to β1 that recognizes all β1 variants, the levels of β1 are comparable in normal and neoplastic prostate, thus indicating a selective down-regulation of the β1C protein in prostate carcinoma. These results demonstrate for the first time that β1C and β1 mRNA expression is down-regulated in prostate carcinoma

  13. The molecular and cellular origin of human prostate cancer.

    PubMed

    Packer, John R; Maitland, Norman J

    2016-06-01

    Prostate cancer is the most commonly diagnosed male malignancy. Despite compelling epidemiology, there are no definitive aetiological clues linking development to frequency. Pre-malignancies such as proliferative inflammatory atrophy (PIA) and prostatic intraepithelial neoplasia (PIN) yield insights into the initiating events of prostate cancer, as they supply a background "field" for further transformation. An inflammatory aetiology, linked to recurrent prostatitis, and heterologous signalling from reactive stroma and infiltrating immune cells may result in cytokine addiction of cancer cells, including a tumour-initiating population also known as cancer stem cells (CSCs). In prostate tumours, the background mutational rate is rarely exceeded, but genetic change via profound sporadic chromosomal rearrangements results in copy number variations and aberrant gene expression. In cancer, dysfunctional differentiation is imposed upon the normal epithelial lineage, with disruption/disappearance of the basement membrane, loss of the contiguous basal cell layer and expansion of the luminal population. An initiating role for androgen receptor (AR) is attractive, due to the luminal phenotype of the tumours, but alternatively a pool of CSCs, which express little or no AR, has also been demonstrated. Indolent and aggressive tumours may also arise from different stem or progenitor cells. Castrate resistant prostate cancer (CRPC) remains the inevitable final stage of disease following treatment. Time-limited effectiveness of second-generation anti-androgens, and the appearance of an AR-neuroendocrine phenotype imply that metastatic disease is reliant upon the plasticity of the CSC population, and indeed CSC gene expression profiles are most closely related to those identified in CRPCs. PMID:26921821

  14. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  15. A human fetal prostate xenograft model of developmental estrogenization.

    PubMed

    Saffarini, Camelia M; McDonnell-Clark, Elizabeth V; Amin, Ali; Boekelheide, Kim

    2015-01-01

    Prostate cancer is a common disease in older men. Rodent models have demonstrated that an early and later-life exposure to estrogen can lead to cancerous lesions and implicated hormonal dysregulation as an avenue for developing future prostate neoplasia. This study utilizes a human fetal prostate xenograft model to study the role of estrogen in the progression of human disease. Histopathological lesions were assessed in 7-, 30-, 90-, 200-, and 400-day human prostate xenografts. Gene expression for cell cycle, tumor suppressors, and apoptosis-related genes (ie, CDKN1A, CASP9, ESR2, PTEN, and TP53) was performed for 200-day estrogen-treated xenografts. Glandular hyperplasia was observed in xenografts given both an initial and secondary exposure to estradiol in both 200- and 400-day xenografts. Persistent estrogenic effects were verified using immunohistochemical markers for cytokeratin 10, p63, and estrogen receptor α. This model provides data on the histopathological state of the human prostate following estrogenic treatment, which can be utilized in understanding the complicated pathology associated with prostatic disease and early and later-life estrogenic exposures. PMID:25633637

  16. Infrared absorption spectra of human malignant tumor tissues

    NASA Astrophysics Data System (ADS)

    Skornyakov, I. V.; Tolstorozhev, G. B.; Butra, V. A.

    2008-05-01

    We used infrared spectroscopy methods to study the molecular structure of tissues from human organs removed during surgery. The IR spectra of the surgical material from breast, thyroid, and lung are compared with data from histological examination. We show that in malignant neoplasms, a change occurs in the hydrogen bonds of protein macromolecules found in the tissue of the studied organs. We identify the spectral signs of malignant pathology.

  17. SOCS2 correlates with malignancy and exerts growth-promoting effects in prostate cancer

    PubMed Central

    Hoefer, Julia; Kern, Johann; Ofer, Philipp; Eder, Iris E; Schäfer, Georg; Dietrich, Dimo; Kristiansen, Glen; Geley, Stephan; Rainer, Johannes; Gunsilius, Eberhard; Klocker, Helmut; Culig, Zoran; Puhr, Martin

    2014-01-01

    Deregulation of cytokine and growth factor signaling due to an altered expression of endogenous regulators is well recognized in prostate cancer (PCa) and other cancers. Suppressor of cytokine signaling 2 (SOCS2) is a key regulator of the GH, IGF, and prolactin signaling pathways that have been implicated in carcinogenesis. In this study, we evaluated the expression patterns and functional significance of SOCS2 in PCa. Protein expression analysis employing tissue microarrays from two independent patient cohorts revealed a significantly enhanced expression in tumor tissue compared with benign tissue as well as association with Gleason score and disease progression. In vitro and in vivo assays uncovered the involvement of SOCS2 in the regulation of cell growth and apoptosis. Functionally, SOCS2 knockdown inhibited PCa cell proliferation and xenograft growth in a CAM assay. Decreased cell growth after SOCS2 downregulation was associated with cell-cycle arrest and apoptosis. In addition, we proved that SOCS2 expression is significantly elevated upon androgenic stimulation in androgen receptor (AR)-positive cell lines, providing a possible mechanistic explanation for high SOCS2 levels in PCa tissue. Consequently, SOCS2 expression correlated with AR expression in the malignant tissue of patients. On the whole, our study linked increased SOCS2 expression in PCa with a pro-proliferative role in vitro and in vivo. PMID:24280133

  18. Androgen-Sensitized Apoptosis of HPr-1AR Human Prostate Epithelial Cells

    PubMed Central

    Chen, Congcong; Dienhart, Jason A.; Bolton, Eric C.

    2016-01-01

    Androgen receptor (AR) signaling is crucial to the development and homeostasis of the prostate gland, and its dysregulation mediates common prostate pathologies. The mechanisms whereby AR regulates growth suppression and differentiation of luminal epithelial cells in the prostate gland and proliferation of malignant versions of these cells have been investigated in human and rodent adult prostate. However, the cellular stress response of human prostate epithelial cells is not well understood, though it is central to prostate health and pathology. Here, we report that androgen sensitizes HPr-1AR and RWPE-AR human prostate epithelial cells to cell stress agents and apoptotic cell death. Although 5α-dihydrotestosterone (DHT) treatment alone did not induce cell death, co-treatment of HPr-1AR cells with DHT and an apoptosis inducer, such as staurosporine (STS), TNFt, or hydrogen peroxide, synergistically increased cell death in comparison to treatment with each apoptosis inducer by itself. We found that the synergy between DHT and apoptosis inducer led to activation of the intrinsic/mitochondrial apoptotic pathway, which is supported by robust cleavage activation of caspase-9 and caspase-3. Further, the dramatic depolarization of the mitochondrial membrane potential that we observed upon co-treatment with DHT and STS is consistent with increased mitochondrial outer membrane permeabilization (MOMP) in the pro-apoptotic mechanism. Interestingly, the synergy between DHT and apoptosis inducer was abolished by AR antagonists and inhibitors of transcription and protein synthesis, suggesting that AR mediates pro-apoptotic synergy through transcriptional regulation of MOMP genes. Expression analysis revealed that pro-apoptotic genes (BCL2L11/BIM and AIFM2) were DHT-induced, whereas pro-survival genes (BCL2L1/BCL-XL and MCL1) were DHT-repressed. Hence, we propose that the net effect of these AR-mediated expression changes shifts the balance of BCL2-family proteins, such that

  19. Nonylphenol effects on human prostate non tumorigenic cells.

    PubMed

    Forte, Maurizio; Di Lorenzo, Mariana; Carrizzo, Albino; Valiante, Salvatore; Vecchione, Carmine; Laforgia, Vincenza; De Falco, Maria

    2016-05-16

    Nonylphenol (NP) is an industrial chemical with estrogenic activity both in vivo and in vitro; estrogens play a critical role in the development of prostate and may be the cause of some pathological states, including cancer. In this study we examined the effects of NP on human prostate non tumorigenic epithelial cells (PNT1A) investigating on cell proliferation, interaction with estrogen receptors (ERs) and gene expression of genes involved in prostate diseases. We found that NP affects cell proliferation at 10(-6)M, promoting a cytoplasm-nucleus translocation of ERα and not ERβ, like the natural estrogen 17β-estradiol (E2). Moreover, we showed that NP enhances gene expression of key regulators of cell cycle. Estrogen selective antagonist ICI182780 in part reverted the observed effects of NP. These results confirm the estrogenic activity of NP and suggest that other transduction pathways may be involved in NP action on prostate. PMID:27260121

  20. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium

    SciTech Connect

    Pelch, Katherine E.; Tokar, Erik J.; Merrick, B. Alex; Waalkes, Michael P.

    2015-08-01

    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular

  1. Phenotypic malignant changes and untargeted lipidomic analysis of long-term exposed prostate cancer cells to endocrine disruptors.

    PubMed

    Bedia, Carmen; Dalmau, Núria; Jaumot, Joaquim; Tauler, Romà

    2015-07-01

    Endocrine disruptors (EDs) are a class of environmental toxic molecules able to interfere with the normal hormone metabolism. Numerous studies involve EDs exposure to initiation and development of cancers, including prostate cancer. In this work, three different EDs (aldrin, aroclor 1254 and chlorpyrifos (CPF)) were investigated as potential inducers of a malignant phenotype in DU145 prostate cancer cells after a chronic exposure. Epithelial to mesenchymal transition (EMT) induction, proliferation, migration, colony formation and release of metalloproteinase 2 (MMP-2) were analyzed in 50-day exposed cells to the selected EDs. As a result, aldrin and CPF exposure led to an EMT induction (loss of 16% and 14% of E-cadherin levels, respectively, compared to the unexposed cells). Aroclor and CPF presented an increased migration (134% and 126%, respectively), colony formation (204% and 144%, respectively) and MMP-2 release (137% in both cases) compared to the unexposed cells. An untargeted lipidomic analysis was performed to decipher the lipids involved in the observed transformations. As general results, aldrin exposure showed a global decrease in phospholipids and sphingolipids, and aroclor and CPF showed an increase of certain phospholipids, glycosphingolipids as well as a remarkable increase of some cardiolipin species. Furthermore, the three exposures resulted in an increase of some triglyceride species. In conclusion, some significant changes in lipids were identified and thus we postulate that some lipid compounds and lipid metabolic pathways could be involved in the acquisition of the malignant phenotype in exposed prostate cancer cells to the selected EDs. PMID:25817993

  2. Characterizing the stiffness of Human Prostates using Acoustic Radiation Force

    PubMed Central

    Zhai, Liang; Madden, John; Foo, Wen-Chi; Mouraviev, Vladimir; Polascik, Thomas J.; Palmeri, Mark L.; Nightingale, Kathryn R.

    2012-01-01

    Acoustic Radiation Force Impulse (ARFI) imaging has been previously reported to portray normal anatomic structures and pathologies in ex vivo human prostates with good contrast and resolution. These findings were based on comparison with histological slides and McNeal’s zonal anatomy. In ARFI images, the central zone (CZ) appears darker (smaller displacement) than other anatomic zones, and prostate cancer (PCa) is darker than normal tissue in the peripheral zone (PZ). Since displacement amplitudes in ARFI images are determined by both the underlying tissue stiffness and the amplitude of acoustic radiation force which varies with acoustic attenuation, one question that arises is: how are the relative displacements in prostate ARFI images related to the underlying prostatic tissue stiffness? In linear, isotropic elastic materials and in tissues that are relatively uniform in acoustic attenuation (e.g. liver), relative displacement in ARFI images has been shown to be correlated with underlying tissue stiffness. However, the prostate is known to be heterogeneous. Variations in acoustic attenuation of prostatic structures could confound the interpretation of ARFI images due to the associated variations in the applied acoustic radiation force. Therefore, in this study, co-registered three-dimensional (3D) ARFI datasets and quantitative shear wave elasticity imaging (SWEI) datasets were acquired in freshly excised human prostates to investigate the relationship between displacement amplitudes in ARFI prostate images and the matched reconstructed shear moduli. The lateral time-to-peak (LTTP) algorithm was applied to the SWEI data to compute the shear wave speed and reconstruct the shear moduli. Five types of prostatic tissue (PZ, CZ, transition zone (TZ) and benign prostatic hyperplasia (BPH), PCa, and atrophy) were identified, whose shear moduli were quantified to be 4.1±0.8 kPa, 9.9±0.9 kPa, 4.8±0.6 kPa, 10.0±1.0 kPa and 8.0 kPa, respectively. Linear regression was

  3. Targeted chemotherapy with cytotoxic bombesin analogue AN-215 inhibits growth of experimental human prostate cancers.

    PubMed

    Stangelberger, Anton; Schally, Andrew V; Letsch, Markus; Szepeshazi, Karoly; Nagy, Attila; Halmos, Gabor; Kanashiro, Celia A; Corey, Eva; Vessella, Robert

    2006-01-01

    We developed a powerful cytotoxic analogue of bombesin AN-215, in which the bombesin (BN)-like carrier peptide is conjugated to 2-pyrrolino doxorubicin (AN-201). Human prostate cancers express high levels of receptors for BN/gastrin releasing peptide (GRP) that can be used for targeted chemotherapy. The effects of targeted chemotherapy with cytotoxic BN analogue AN-215 were evaluated in nude mice bearing subcutaneous xenografts of DU-145, LuCaP-35, MDA-PCa-2b and intraosseous implants of C4-2 human prostate cancers. Intraosseous growth of C4-2 tumors was monitored by serum PSA. BN/GRP receptors were evaluated by 125I-[Tyr4]BN binding assays and RT-PCR. The effects of AN-215 on apoptosis and cell proliferation were followed by histology, and the expression of Bcl-2 and Bax protein was determined by Western blot analysis. Targeted analog AN-215 significantly inhibited growth of subcutaneously implanted DU-145, LuCaP-35 and MDA-PCa-2b prostate cancers by 81% to 91% compared to controls, while cytotoxic radical AN-201 was less effective and more toxic. Serum PSA levels of mice bearing intraosseous C4-2 prostate tumors were significantly reduced. In LuCaP-35 tumors administration of BN antagonist RC-3095 prior to AN-215 blocked the receptors for BN/GRP and inhibited the effects of AN-215. High affinity receptors for BN/GRP and their m-RNA were detected on membranes of all 4 tumor models. Therapy with AN-215, but not with AN-201, decreased the ratio of Bcl-2/Bax in DU-145 and the expression of antiapoptotic Bcl-2 in LuCaP-35 tumors. The presence of BN/GRP receptors on primary and metastatic prostate cancers makes possible targeted chemotherapy with AN-215 for the treatment of this malignancy. PMID:16003723

  4. Connexin 43 expression is associated with increased malignancy in prostate cancer cell lines and functions to promote migration

    PubMed Central

    Zhang, Ao; Hitomi, Masahiro; Bar-Shain, Noah; Dalimov, Zafardjan; Ellis, Leigh; Velpula, Kiran K.; Fraizer, Gail C.; Gourdie, Robert G.; Lathia, Justin D.

    2015-01-01

    Impaired expression of connexins, the gap junction subunits that facilitate direct cell-cell communication, have been implicated in prostate cancer growth. To elucidate the crucial role of connexins in prostate cancer progression, we performed a systematic quantitative RT-PCR screening of connexin expression in four representative prostate cancer cell lines across the spectrum of malignancy. Transcripts of several connexin subunits were detected in all four cell lines, and connexin 43 (Cx43) showed marked elevation at both RNA and protein levels in cells with increased metastatic potential. Analysis of gap-junction-mediated intercellular communication revealed homocellular coupling in PC-3 cells, which had the highest Cx43 expression, with minimal coupling in LNCaP cells where Cx43 expression was very low. Treatment with the gap junction inhibitor carbenoxolone or connexin mimetic peptide ACT-1 did not impair cell growth, suggesting that growth is independent of functional gap junctions. PC-3 cells with Cx43 expression reduced by shRNA showed decreased migration in monolayer wound healing assay, as well as decreased transwell invasion capacities when compared to control cells expressing non-targeting shRNA. These results, together with the correlation between Cx43 expression levels and the metastatic capacity of the cell lines, suggest a role of Cx43 in prostate cancer invasion and metastasis. PMID:25960544

  5. Connexin 43 expression is associated with increased malignancy in prostate cancer cell lines and functions to promote migration.

    PubMed

    Zhang, Ao; Hitomi, Masahiro; Bar-Shain, Noah; Dalimov, Zafardjan; Ellis, Leigh; Velpula, Kiran K; Fraizer, Gail C; Gourdie, Robert G; Lathia, Justin D

    2015-05-10

    Impaired expression of connexins, the gap junction subunits that facilitate direct cell-cell communication, have been implicated in prostate cancer growth. To elucidate the crucial role of connexins in prostate cancer progression, we performed a systematic quantitative RT-PCR screening of connexin expression in four representative prostate cancer cell lines across the spectrum of malignancy. Transcripts of several connexin subunits were detected in all four cell lines, and connexin 43 (Cx43) showed marked elevation at both RNA and protein levels in cells with increased metastatic potential. Analysis of gap-junction-mediated intercellular communication revealed homocellular coupling in PC-3 cells, which had the highest C x 43 expression, with minimal coupling in LNCaP cells where C x 43 expression was very low. Treatment with the gap junction inhibitor carbenoxolone or connexin mimetic peptide ACT-1 did not impair cell growth, suggesting that growth is independent of functional gap junctions. PC-3 cells with C x 43 expression reduced by shRNA showed decreased migration in monolayer wound healing assay, as well as decreased transwell invasion capacities when compared to control cells expressing non-targeting shRNA. These results, together with the correlation between C x 43 expression levels and the metastatic capacity of the cell lines, suggest a role of C x 43 in prostate cancer invasion and metastasis. PMID:25960544

  6. A comparative study of serum protein-bound sialic acid in benign and malignant prostatic growth: possible role of oxidative stress in sialic acid homeostasis.

    PubMed

    Goswami, K; Nandeesha, H; Koner, B C; Nandakumar, D N

    2007-01-01

    Benign and malignant prostatic growths are associated with an increase in sialoconjugates (e.g. prostate-specific antigen (PSA)) in blood. Oxidative stress plays a crucial role in pathogenesis of various malignancies. The objective of this study was to evaluate oxidative stress parameters and protein-bound sialic acid level in sera of prostatic tumor cases and to asses for any association between them. Sera samples were collected and estimated for carbonylation of proteins, lipid peroxidation products, PSA and protein-bound sialic acid from 10 patients in each group with prostatic carcinoma (Ca prostate) and benign prostatic hyperplasia (BPH) along with 10 healthy male subjects of similar age group as control. In carcinoma prostate cases, lipid peroxides, protein carbonyls, protein-bound sialic acid and PSA were significantly increased compared to BPH and controls. There was significant association between oxidative stress parameters (lipid peroxide and protein carbonyl) and sialoconjugates (PSA and protein-bound sialic acid). In BPH cases, serum lipid peroxides and protein-bound sialic acid were significantly higher in comparison to controls and protein carbonyls were correlated with protein-bound sialic acid. ROC curve for sialic acid showed that it can be used as a marker to differentiate carcinoma prostate from benign growth of prostate at a cutoff level of 11.38 mug/mg protein with a sensitivity of 100% and specificity of 80%. We conclude that oxidative stress might be associated with the degree of sialylation of protein and graded changes in these parameters possibly unveil the pathogenic demarcation from benign to malignant condition of prostate. PMID:17404581

  7. Phenotypic malignant changes and untargeted lipidomic analysis of long-term exposed prostate cancer cells to endocrine disruptors

    SciTech Connect

    Bedia, Carmen Dalmau, Núria Jaumot, Joaquim Tauler, Romà

    2015-07-15

    Endocrine disruptors (EDs) are a class of environmental toxic molecules able to interfere with the normal hormone metabolism. Numerous studies involve EDs exposure to initiation and development of cancers, including prostate cancer. In this work, three different EDs (aldrin, aroclor 1254 and chlorpyrifos (CPF)) were investigated as potential inducers of a malignant phenotype in DU145 prostate cancer cells after a chronic exposure. Epithelial to mesenchymal transition (EMT) induction, proliferation, migration, colony formation and release of metalloproteinase 2 (MMP-2) were analyzed in 50-day exposed cells to the selected EDs. As a result, aldrin and CPF exposure led to an EMT induction (loss of 16% and 14% of E-cadherin levels, respectively, compared to the unexposed cells). Aroclor and CPF presented an increased migration (134% and 126%, respectively), colony formation (204% and 144%, respectively) and MMP-2 release (137% in both cases) compared to the unexposed cells. An untargeted lipidomic analysis was performed to decipher the lipids involved in the observed transformations. As general results, aldrin exposure showed a global decrease in phospholipids and sphingolipids, and aroclor and CPF showed an increase of certain phospholipids, glycosphingolipids as well as a remarkable increase of some cardiolipin species. Furthermore, the three exposures resulted in an increase of some triglyceride species. In conclusion, some significant changes in lipids were identified and thus we postulate that some lipid compounds and lipid metabolic pathways could be involved in the acquisition of the malignant phenotype in exposed prostate cancer cells to the selected EDs. - Highlights: • Aldrin, aroclor and chlorpyrifos induced an aggressive phenotype in DU145 cells. • An untargeted lipidomic analysis has been performed on chronic exposed cells. • Lipidomic results showed changes in specific lipid species under chronic exposure. • These lipids may have a role in the

  8. Cadmium Induces p53-Dependent Apoptosis in Human Prostate Epithelial Cells

    PubMed Central

    Aimola, Pierpaolo; Carmignani, Marco; Volpe, Anna Rita; Di Benedetto, Altomare; Claudio, Luigi; Waalkes, Michael P.; van Bokhoven, Adrie; Tokar, Erik J.; Claudio, Pier Paolo

    2012-01-01

    Cadmium, a widespread toxic pollutant of occupational and environmental concern, is a known human carcinogen. The prostate is a potential target for cadmium carcinogenesis, although the underlying mechanisms are still unclear. Furthermore, cadmium may induce cell death by apoptosis in various cell types, and it has been hypothesized that a key factor in cadmium-induced malignant transformation is acquisition of apoptotic resistance. We investigated the in vitro effects produced by cadmium exposure in normal or tumor cells derived from human prostate epithelium, including RWPE-1 and its cadmium-transformed derivative CTPE, the primary adenocarcinoma 22Rv1 and CWR-R1 cells and LNCaP, PC-3 and DU145 metastatic cancer cell lines. Cells were treated for 24 hours with different concentrations of CdCl2 and apoptosis, cell cycle distribution and expression of tumor suppressor proteins were analyzed. Subsequently, cellular response to cadmium was evaluated after siRNA-mediated p53 silencing in wild type p53-expressing RWPE-1 and LNCaP cells, and after adenoviral p53 overexpression in p53-deficient DU145 and PC-3 cell lines. The cell lines exhibited different sensitivity to cadmium, and 24-hour exposure to different CdCl2 concentrations induced dose- and cell type-dependent apoptotic response and inhibition of cell proliferation that correlated with accumulation of functional p53 and overexpression of p21 in wild type p53-expressing cell lines. On the other hand, p53 silencing was able to suppress cadmium-induced apoptosis. Our results demonstrate that cadmium can induce p53-dependent apoptosis in human prostate epithelial cells and suggest p53 mutation as a possible contributing factor for the acquisition of apoptotic resistance in cadmium prostatic carcinogenesis. PMID:22448262

  9. Prostate cancer cell malignancy via modulation of HIF-1α pathway with isoflurane and propofol alone and in combination

    PubMed Central

    Huang, H; Benzonana, L L; Zhao, H; Watts, H R; Perry, N J S; Bevan, C; Brown, R; Ma, D

    2014-01-01

    Background: Surgery is considered to be the first line treatment for solid tumours. Recently, retrospective studies reported that general anaesthesia was associated with worse long-term cancer-free survival when compared with regional anaesthesia. This has important clinical implications; however, the mechanisms underlying those observations remain unclear. We aim to investigate the effect of anaesthetics isoflurane and propofol on prostate cancer malignancy. Methods: Prostate cancer (PC3) cell line was exposed to commonly used anaesthetic isoflurane and propofol. Malignant potential was assessed through evaluation of expression level of hypoxia-inducible factor-1α (HIF-1α) and its downstream effectors, cell proliferation and migration as well as development of chemoresistance. Results: We demonstrated that isoflurane, at a clinically relevant concentration induced upregulation of HIF-1α and its downstream effectors in PC3 cell line. Consequently, cancer cell characteristics associated with malignancy were enhanced, with an increase of proliferation and migration, as well as development of chemoresistance. Inhibition of HIF-1α neosynthesis through upper pathway blocking by a PI-3K-Akt inhibitor or HIF-1α siRNA abolished isoflurane-induced effects. In contrast, the intravenous anaesthetic propofol inhibited HIF-1α activation induced by hypoxia or CoCl2. Propofol also prevented isoflurane-induced HIF-1α activation, and partially reduced cancer cell malignant activities. Conclusions: Our findings suggest that modulation of HIF-1α activity by anaesthetics may affect cancer recurrence following surgery. If our data were to be extrapolated to the clinical setting, isoflurane but not propofol should be avoided for use in cancer surgery. Further work involving in vivo models and clinical trials is urgently needed to determine the optimal anaesthetic regimen for cancer patients. PMID:25072260

  10. Effect of anthralin on cell viability in human prostate adenocarcinoma.

    PubMed

    Raevskaya, A A; Gorbunova, S L; Savvateeva, M V; Severin, S E; Kirpichnikov, M P

    2012-07-01

    The study revealed the key role of serine protease hepsin activity in transition of in situ prostate adenocarcinoma into the metastasizing form. Inhibition of hepsin activity suppresses the invasive growth of the tumor. Hepsin is an convenient target for pharmacological agents, so the study of its inhibitory mechanisms is a promising avenue in drug development. Assay of proteolytic activity in various tumor cell lines in vitro showed that this activity in prostate adenocarcinoma cells significantly surpasses proteolytic activity in other examined tumor cell lines. Selective cytotoxic action of anthralin, an inhibitor of hepsin activity, on human adenocarcinoma cells was demonstrated in comparison with other tumor cell lines. PMID:22866312

  11. SEM and X-ray microanalysis of human prostatic calculi

    SciTech Connect

    Vilches, J.; Lopez, A.; De Palacio, L.; Munoz, C.; Gomez, J.

    1982-02-01

    Calculi removed from human prostates affected with nodular hyperplasia were analyzed with scanning electron microscopy and EDAX system. The general spectrum was made up of Na, Al, Mg, S, P, Ca and Zn. Two types of stone were identified morphostructurally and microanalytically: calculi type I of nodular surface with high peaks of S, and calculi type II polyfaceted with high peaks of P and Ca. Their formation from corpora amylacea and/or exogenous constituents is discussed. The superficial deposit of Zn suggests its incorporation from the prostatic liquid and does not seem to play an important role in the genesis.

  12. Use of high-intensity focused ultrasound in the treatment of both benign and malignant prostatic disease

    NASA Astrophysics Data System (ADS)

    Kernen, Kenneth M.; Miles, Brian J.

    2000-05-01

    Prostate cancer, the most common malignancy in men in the United States, accounts for more than 29% of all male cancers diagnosed and 13% of all cancer deaths. This translates into approximately 200,000 men diagnosed and 37,000 men who will die from the disease this year in this country. A significant number of patients ultimately choose external beam radiation or interstitial radioactive implants (brachytherapy) combined with external beam radiotherapy as their primary treatment. Approximately 25 - 35% of external beam irradiation patients and 20 - 30% of interstitial implants combined with external beam radiotherapy will fail within 10 years. The treatment options for patients with localized radiorecurrent disease include watchful waiting, endocrine therapy, salvage radiotherapy, and salvage radical prostatectomy, cryotherapy and now high intensity focused ultrasound therapy (HIFU). Although some studies regarding watchful waiting demonstrated comparable results to formal treatment for early prostate cancer, other studies have shown metastatic and mortality rates that are significantly higher, and that radiorecurrent patients would have even greater rates of metastasis and progression to death. Prostate cancer cure by means of endocrine therapy is highly unlikely and its role is still one of palliation with a side effect profile which includes hot flashes, osteoporosis, fatigue, loss of muscle mass, anemia, loss of libido and potency. The role of salvage radiotherapy may offer local control, however long term efficacy has yet to be determined. In a recent series, only 50% of the patients were controlled for a mean of four years with salvage radiotherapy. Salvage prostatectomy has the advantage of providing excellent local control and even a cure if the cancer is confined to the prostate or within the surrounding periprostatic tissue. Historically, salvage prostatectomy is technically demanding and fraught with higher complications. In one large series

  13. Epigenetic regulation of inflammatory cytokines and associated genes in human malignancies.

    PubMed

    Yasmin, Rehana; Siraj, Sami; Hassan, Amjad; Khan, Abdul Rehman; Abbasi, Rashda; Ahmad, Nafees

    2015-01-01

    Inflammation is a multifaceted defense response of immune system against infection. Chronic inflammation has been implicated as an imminent threat for major human malignancies and is directly linked to various steps involved in tumorigenesis. Inflammatory cytokines, interleukins, interferons, transforming growth factors, chemokines, and adhesion molecules have been associated with chronic inflammation. Numerous cytokines are reported to be aberrantly regulated by different epigenetic mechanisms like DNA methylation and histone modifications in tumor tissues, contributing to pathogenesis of tumor in multiple ways. Some of these cytokines also work as epigenetic regulators of other crucial genes in tumor biology, either directly or indirectly. Such regulations are reported in lung, breast, cervical, gastric, colorectal, pancreatic, prostate, and head and neck cancers. Epigenetics of inflammatory mediators in cancer is currently subject of extensive research. These investigations may help in understanding cancer biology and to develop effective therapeutic strategies. The purpose of this paper is to have a brief view of the aberrant regulation of inflammatory cytokines in human malignancies. PMID:25814785

  14. Epigenetic Regulation of Inflammatory Cytokines and Associated Genes in Human Malignancies

    PubMed Central

    Yasmin, Rehana; Hassan, Amjad; Khan, Abdul Rehman; Abbasi, Rashda; Ahmad, Nafees

    2015-01-01

    Inflammation is a multifaceted defense response of immune system against infection. Chronic inflammation has been implicated as an imminent threat for major human malignancies and is directly linked to various steps involved in tumorigenesis. Inflammatory cytokines, interleukins, interferons, transforming growth factors, chemokines, and adhesion molecules have been associated with chronic inflammation. Numerous cytokines are reported to be aberrantly regulated by different epigenetic mechanisms like DNA methylation and histone modifications in tumor tissues, contributing to pathogenesis of tumor in multiple ways. Some of these cytokines also work as epigenetic regulators of other crucial genes in tumor biology, either directly or indirectly. Such regulations are reported in lung, breast, cervical, gastric, colorectal, pancreatic, prostate, and head and neck cancers. Epigenetics of inflammatory mediators in cancer is currently subject of extensive research. These investigations may help in understanding cancer biology and to develop effective therapeutic strategies. The purpose of this paper is to have a brief view of the aberrant regulation of inflammatory cytokines in human malignancies. PMID:25814785

  15. Proapoptotic effects of new pentabromobenzylisothiouronium salts in a human prostate adenocarcinoma cell line.

    PubMed

    Koronkiewicz, Mirosława; Kazimierczuk, Zygmunt; Szarpak, Kinga; Chilmonczyk, Zdzisław

    2012-01-01

    Prostate cancer is the second most common cancer in elderly men worldwide and its incidence rate is rising continuously. Agents capable of inducing apoptosis in prostate cancer cells seem a promising approach to treat this malignancy. In this study we describe the synthesis of a number of novel N- and N,N'-substituted S-2,3,4,5,6-pentabromobenzylisothiouronium bromides and their activity against the human prostate adenocarcinoma PC3 cell line. All the compounds produced changes in mitochondrial transmembrane potential and cell cycle progression, showed a cytostatic effect and induced apoptosis in the tested cancer line in a concentration- and time-dependent manner. The most effective compounds ZKK-3, ZKK-9 and ZKK-13 produced, at 20 microM concentration, apoptosis in 42, 46, and 66% of the cells, respectively, after 48 h incubation. Two selected S-2,3,4,5,6-pentabromobenzylisothiouronium bromides (ZKK-3, ZKK-9) showed also a synergic proapoptotic effect with the new casein kinase II inhibitor 2-(4-methylpiperazin-1-yl)-4,5,6,7-tetrabromo-1H-benzimidazole (TBIPIP) in the PC3 cell line. PMID:23285698

  16. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer.

    PubMed

    Sun, Xiaodong; Frierson, Henry F; Chen, Ceshi; Li, Changling; Ran, Qimei; Otto, Kristen B; Cantarel, Brandi L; Cantarel, Brandi M; Vessella, Robert L; Gao, Allen C; Petros, John; Miura, Yutaka; Simons, Jonathan W; Dong, Jin-Tang

    2005-04-01

    Cancer often results from the accumulation of multiple genetic alterations. Although most malignancies are sporadic, only a small number of genes have been shown to undergo frequent mutations in sporadic cancers. The long arm of chromosome 16 is frequently deleted in human cancers, but the target gene for this deletion has not been identified. Here we report that ATBF1, which encodes a transcription factor that negatively regulates AFP and MYB but transactivates CDKN1A, is a good candidate for the 16q22 tumor-suppressor gene. We narrowed the region of deletion at 16q22 to 861 kb containing ATBF1. ATBF1 mRNA was abundant in normal prostates but more scarce in approximately half of prostate cancers tested. In 24 of 66 (36%) cancers examined, we identified 22 unique somatic mutations, many of which impair ATBF1 function. Furthermore, ATBF1 inhibited cell proliferation. Hence, loss of ATBF1 is one mechanism that defines the absence of growth control in prostate cancer. PMID:15750593

  17. Beta-catenin is elevated in human benign prostatic hyperplasia specimens compared to histologically normal prostate tissue

    PubMed Central

    Bauman, Tyler M; Vezina, Chad M; Huang, Wei; Marker, Paul C; Peterson, Richard E; Ricke, William A

    2014-01-01

    Benign prostatic hyperplasia (BPH) is linked to lower urinary tract symptoms (LUTS) such as incomplete bladder emptying, urinary frequency and urgency. Mechanisms responsible for BPH are not fully known. Here, we tested whether beta-catenin (CTNNB1) immunostaining intensity and distribution differ in human glandular BPH tissue specimens compared to normal prostate tissue. Multiplex immunostaining of CTNNB1, its putative transcriptional target gene lymphoid enhancer binding factor 1 (LEF1), and the epithelial marker E-cadherin were examined in clinical human prostate specimens with or without histological BPH (pure epithelial or mixed stromal-epithelial nodules). BPH specimens were obtained from 24 men who experienced LUTS and underwent transurethral resection of the prostate surgery. Control specimens were tumor-adjacent histologically normal prostate tissue from 48 patients who underwent radical prostatectomy. The resulting multispectral images were unmixed and optical densities recorded to quantify staining abundance, cellular (membranous, cytoplasmic, and nuclear) and tissue localization (stromal versus epithelial), and determination of percentage of CTNNB1-positive cells. The following CTNNB1 indices were significantly higher in BPH compared to normal prostate tissue: overall staining intensity, staining intensity in prostate stromal cell membranes, cytoplasm and nuclei, and prostate epithelial cell nuclei. The following LEF1 indices were significantly lower in BPH compared to tumor-adjacent normal prostate tissue: stromal LEF1 staining intensity, percentage of LEF1-positive stromal cells, and intensity of LEF1 staining in stromal cell membranes, cytoplasm, and nuclei. The percentage of stromal cells with CTNNB1+/LEF1- nuclei was higher and percentage of stromal cells with CTNNB1-/LEF1+ nuclei was lower in BPH compared to tumor-adjacent normal prostate tissues. These results support the hypothesis that CTNNB1 expression increases in specific BPH tissue

  18. Eliminating malignant contamination from therapeutic human spermatogonial stem cells

    PubMed Central

    Dovey, Serena L.; Valli, Hanna; Hermann, Brian P.; Sukhwani, Meena; Donohue, Julia; Castro, Carlos A.; Chu, Tianjiao; Sanfilippo, Joseph S.; Orwig, Kyle E.

    2013-01-01

    Spermatogonial stem cell (SSC) transplantation has been shown to restore fertility in several species and may have application for treating some cases of male infertility (e.g., secondary to gonadotoxic therapy for cancer). To ensure safety of this fertility preservation strategy, methods are needed to isolate and enrich SSCs from human testis cell suspensions and also remove malignant contamination. We used flow cytometry to characterize cell surface antigen expression on human testicular cells and leukemic cells (MOLT-4 and TF-1a). We demonstrated via FACS that EpCAM is expressed by human spermatogonia but not MOLT-4 cells. In contrast, HLA-ABC and CD49e marked >95% of MOLT-4 cells but were not expressed on human spermatogonia. A multiparameter sort of MOLT-4–contaminated human testicular cell suspensions was performed to isolate EpCAM+/HLA-ABC–/CD49e– (putative spermatogonia) and EpCAM–/HLA-ABC+/CD49e+ (putative MOLT-4) cell fractions. The EpCAM+/HLA-ABC–/CD49e– fraction was enriched for spermatogonial colonizing activity and did not form tumors following human-to–nude mouse xenotransplantation. The EpCAM–/HLA-ABC+/CD49e+ fraction produced tumors following xenotransplantation. This approach could be generalized with slight modification to also remove contaminating TF-1a leukemia cells. Thus, FACS provides a method to isolate and enrich human spermatogonia and remove malignant contamination by exploiting differences in cell surface antigen expression. PMID:23549087

  19. Tocotrienol-rich fraction of palm oil induces cell cycle arrest and apoptosis selectively in human prostate cancer cells

    SciTech Connect

    Srivastava, Janmejai K.; Gupta, Sanjay . E-mail: sanjay.gupta@case.edu

    2006-07-28

    One of the requisite of cancer chemopreventive agent is elimination of damaged or malignant cells through cell cycle inhibition or induction of apoptosis without affecting normal cells. In this study, employing normal human prostate epithelial cells (PrEC), virally transformed normal human prostate epithelial cells (PZ-HPV-7), and human prostate cancer cells (LNCaP, DU145, and PC-3), we evaluated the growth-inhibitory and apoptotic effects of tocotrienol-rich fraction (TRF) extracted from palm oil. TRF treatment to PrEC and PZ-HPV-7 resulted in almost identical growth-inhibitory responses of low magnitude. In sharp contrast, TRF treatment resulted in significant decreases in cell viability and colony formation in all three prostate cancer cell lines. The IC{sub 5} values after 24 h TRF treatment in LNCaP, PC-3, and DU145 cells were in the order 16.5, 17.5, and 22.0 {mu}g/ml. TRF treatment resulted in significant apoptosis in all the cell lines as evident from (i) DNA fragmentation (ii) fluorescence microscopy, and (iii) cell death detection ELISA, whereas the PrEC and PZ-HPV-7 cells did not undergo apoptosis, but showed modestly decreased cell viability only at a high dose of 80 {mu}g/ml. In cell cycle analysis, TRF (10-40 {mu}g/ml) resulted in a dose-dependent G0/G1 phase arrest and sub G1 accumulation in all three cancer cell lines but not in PZ-HPV-7 cells. These results suggest that the palm oil derivative TRF is capable of selectively inhibiting cellular proliferation and accelerating apoptotic events in prostate cancer cells. TRF offers significant promise as a chemopreventive and/or therapeutic agent against prostate cancer.

  20. Differential Utilization of Dietary Fatty Acids in Benign and Malignant Cells of the Prostate

    PubMed Central

    Eder, Theresa; Höfer, Julia; Gnaiger, Erich; Aufinger, Astrid; Kenner, Lukas; Perktold, Bernhard; Ramoner, Reinhold; Klocker, Helmut; Eder, Iris E.

    2015-01-01

    Tumor cells adapt via metabolic reprogramming to meet elevated energy demands due to continuous proliferation, for example by switching to alternative energy sources. Nutrients such as glucose, fatty acids, ketone bodies and amino acids may be utilized as preferred substrates to fulfill increased energy requirements. In this study we investigated the metabolic characteristics of benign and cancer cells of the prostate with respect to their utilization of medium chain (MCTs) and long chain triglycerides (LCTs) under standard and glucose-starved culture conditions by assessing cell viability, glycolytic activity, mitochondrial respiration, the expression of genes encoding key metabolic enzymes as well as mitochondrial mass and mtDNA content. We report that BE prostate cells (RWPE-1) have a higher competence to utilize fatty acids as energy source than PCa cells (LNCaP, ABL, PC3) as shown not only by increased cell viability upon fatty acid supplementation but also by an increased ß-oxidation of fatty acids, although the base-line respiration was 2-fold higher in prostate cancer cells. Moreover, BE RWPE-1 cells were found to compensate for glucose starvation in the presence of fatty acids. Of notice, these findings were confirmed in vivo by showing that PCa tissue has a lower capacity in oxidizing fatty acids than benign prostate. Collectively, these metabolic differences between benign and prostate cancer cells and especially their differential utilization of fatty acids could be exploited to establish novel diagnostic and therapeutic strategies. PMID:26285134

  1. Differential Utilization of Dietary Fatty Acids in Benign and Malignant Cells of the Prostate.

    PubMed

    Dueregger, Andrea; Schöpf, Bernd; Eder, Theresa; Höfer, Julia; Gnaiger, Erich; Aufinger, Astrid; Kenner, Lukas; Perktold, Bernhard; Ramoner, Reinhold; Klocker, Helmut; Eder, Iris E

    2015-01-01

    Tumor cells adapt via metabolic reprogramming to meet elevated energy demands due to continuous proliferation, for example by switching to alternative energy sources. Nutrients such as glucose, fatty acids, ketone bodies and amino acids may be utilized as preferred substrates to fulfill increased energy requirements. In this study we investigated the metabolic characteristics of benign and cancer cells of the prostate with respect to their utilization of medium chain (MCTs) and long chain triglycerides (LCTs) under standard and glucose-starved culture conditions by assessing cell viability, glycolytic activity, mitochondrial respiration, the expression of genes encoding key metabolic enzymes as well as mitochondrial mass and mtDNA content. We report that BE prostate cells (RWPE-1) have a higher competence to utilize fatty acids as energy source than PCa cells (LNCaP, ABL, PC3) as shown not only by increased cell viability upon fatty acid supplementation but also by an increased ß-oxidation of fatty acids, although the base-line respiration was 2-fold higher in prostate cancer cells. Moreover, BE RWPE-1 cells were found to compensate for glucose starvation in the presence of fatty acids. Of notice, these findings were confirmed in vivo by showing that PCa tissue has a lower capacity in oxidizing fatty acids than benign prostate. Collectively, these metabolic differences between benign and prostate cancer cells and especially their differential utilization of fatty acids could be exploited to establish novel diagnostic and therapeutic strategies. PMID:26285134

  2. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice

    PubMed Central

    Bartucci, Monica; Ferrari, Anna C.; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E.

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  3. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice.

    PubMed

    Bartucci, Monica; Ferrari, Anna C; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  4. Heterogeneity and immunophenotypic plasticity of malignant cells in human liposarcomas

    PubMed Central

    Zhang, Yan; Young, Eric D.; Bill, Katelynn; Belousov, Roman; Peng, Tingsheng; Lazar, Alexander J; Pollock, Raphael E; Simmons, Paul J.; Lev, Dina; Kolonin, Mikhail G.

    2013-01-01

    Liposarcomas are tumors arising in white adipose tissue (WAT) with avidity for local recurrence. Aggressive dedifferentiated liposarcomas (DDLS) may arise from well-differentiated subtypes (WDLS) upon disease progression, however, this key issue is unresolved due in large part to knowledge gaps about liposarcoma cellular composition. Here, we wished to improve insights into liposarcoma cellular hierarchy. Tumor section analysis indicated that the populations, distinguishable based on expression of CD34 (a marker of adipocyte progenitors) and CD36 (a marker of adipocyte differentiation), occupy distinct intra-tumoral locations in both WDLS and DDLS. Taking advantage of these markers, we separated cells from a panel of fresh human surgical specimens by fluorescence-activated cell sorting (FACS). Based on chromosome analysis and the culture phenotypes of the composing populations, we demonstrate that malignant cells comprise four mesenchymal populations distinguished by expression of CD34 and CD36, while vascular (CD31+) and hematopoietic (CD45+) components are non-neoplastic. Finally, we show that mouse xenografts are derivable from both CD36-negative and CD36-positive DDLS cells, and that each population recreates the heterogeneity of CD36 expression in vivo. Combined, our results show that malignant cells in WDLS and DDLS can be classified according to distinct stages of adipogenesis and indicate immonophenotypic plasticity of malignant liposarcoma cells. PMID:23770802

  5. Vaccine Therapy and Pembrolizumab in Treating Patients With Hormone-Resistant, Metastatic Prostate Cancer

    ClinicalTrials.gov

    2016-06-22

    Hormone-Resistant Prostate Cancer; Metastatic Malignant Neoplasm in the Bone; Metastatic Malignant Neoplasm in the Soft Tissues; Metastatic Prostate Carcinoma; Prostate Adenocarcinoma; Recurrent Prostate Carcinoma; Stage IV Prostate Cancer

  6. Serially heterotransplanted human prostate tumours as an experimental model

    PubMed Central

    Lopez-Barcons, Lluis-A

    2010-01-01

    Abstract Preclinical research on prostate cancer (PC) therapies uses several models to represent the human disease accurately. A common model uses patient prostate tumour biopsies to develop a cell line by serially passaging and subsequent implantation, in immunodeficient mice. An alternative model is direct implantation of patient prostate tumour biopsies into immunodeficient mice, followed by serial passage in vivo. The purpose of this review is to compile data from the more than 30 years of human PC serial heterotransplantation research. Serially heterotransplanted tumours are characterized by evaluating the histopathology of the resulting heterotransplants, including cellular differentiation, karyotype, marker expression, hormone sensitivity, cellular proliferation, metastatic potential and stromal and vascular components. These data are compared with the initial patient tumour specimen and, depending on available information, the patient’s clinical outcome was compared with the heterotransplanted tumour. The heterotansplant model is a more accurate preclinical model than older generation serially passaged or genetic models to investigate current and newly developed androgen-deprivation agents, antitumour compounds, anti-angiogenic drugs and positron emission tomography radiotracers, as well as new therapeutic regimens for the treatment of PC. PMID:19874422

  7. Myosin VI contributes to malignant proliferation of human glioma cells

    PubMed Central

    Xu, Rong; Fang, Xu-hao

    2016-01-01

    Previously characterized as a backward motor, myosin VI (MYO6), which belongs to myosin family, moves toward the minus end of the actin track, a direction opposite to all other known myosin members. Recent researches have illuminated the role of MYO6 in human cancers, particularly in prostate cancer. However, the role of MYO6 in glioma has not yet been determined. In this study, to explore the role of MYO6 in human glioma, lentivirus-delivered short hairpin RNA (shRNA) targeting MYO6 was designed to stably down-regulate its endogenous expression in glioblastoma cells U251. Knockdown of MYO6 signifi cantly inhibited viability and proliferation of U251 cells in vitro. Moreover, the cell cycle of U251 cells was arrested at G0/G1 phase with the absence of MYO6, which could contribute to the suppression of cell proliferation. In conclusion, we firstly identified the crucial involvement of MYO6 in human glioma. The inhibition of MYO6 by shRNA might be a potential therapeutic method in human glioma. PMID:26937209

  8. Use of high-intensity focused ultrasound in the treatment of both benign and malignant prostatic disease

    NASA Astrophysics Data System (ADS)

    Kernen, Kenneth M.; Miles, Brian J.

    2000-05-01

    Prostate cancer, the most common malignancy in men in the United States, accounts for more than 29% of all male cancers diagnosed and 13% of all cancer deaths. This translates into approximately 200,000 men diagnosed and 37,000 men who will die from the disease this year in this country. A significant number of patients ultimately choose external beam radiation or interstitial radioactive implants (brachytherapy) combined with external beam radiotherapy as their primary treatment. Approximately 25 - 35% of external beam irradiation patients and 20 - 30% of interstitial implants combined with external beam radiotherapy will fail within 10 years. The treatment options for patients with localized radiorecurrent disease include watchful waiting, endocrine therapy, salvage radiotherapy, and salvage radical prostatectomy, cryotherapy and now high intensity focused ultrasound therapy (HIFU). Although some studies regarding watchful waiting demonstrated comparable results to formal treatment for early prostate cancer, other studies have shown metastatic and mortality rates that are significantly higher, and that radiorecurrent patients would have even greater rates of metastasis and progression to death. Prostate cancer cure by means of endocrine therapy is highly unlikely and its role is still one of palliation with a side effect profile which includes hot flashes, osteoporosis, fatigue, loss of muscle mass, anemia, loss of libido and potency. The role of salvage radiotherapy may offer local control, however long term efficacy has yet to be determined. In a recent series, only 50% of the patients were controlled for a mean of four years with salvage radiotherapy. Salvage prostatectomy has the advantage of providing excellent local control and even a cure if the cancer is confined to the prostate or within the surrounding periprostatic tissue. Historically, salvage prostatectomy is technically demanding and fraught with higher complications. In one large series

  9. Examining the Relationship Between Cu-ATSM Hypoxia Selectivity and Fatty Acid Synthase Expression in Human Prostate Cancer Cell Lines

    PubMed Central

    Vāvere, Amy L.; Lewis, Jason S.

    2013-01-01

    Introduction PET imaging with Cu-ATSM for delineating hypoxia has provided valuable clinical information, but investigations in animal models of prostate cancer have shown some inconsistencies. As a defense mechanism in prostate cancer cells, the fatty acid synthesis pathway harnesses its oxidizing power for improving the redox balance despite conditions of extreme hypoxia, potentially altering Cu-ATSM hypoxia-selectivity. Methods Human prostate tumor cultured cell lines (PC-3, 22Rv1, LNCaP, and LAPC-4), were treated with an FAS inhibitor (C75, 100 μM) under anoxia. 64Cu-ATSM uptake into these treated cells, and non-treated anoxic cells, was then examined. Fatty acid synthase (FAS) expression level in each cell line was subsequently quantified by ELISA. An additional study was performed in PC-3 cells to examine the relationship between the restoration of 64Cu-ATSM hypoxia-selectivity and the concentration of C75 (100, 20, 4, or 0.8 μM) administered to the cells. Results Inhibition of fatty acid synthesis with C75 resulted in a significant increase in 64Cu-ATSM retention into prostate tumor cells in vitro under anoxia over 60 mins. Inhibition studies demonstrated higher uptake values of 20.9 ± 3.27, 103.0 ± 32.6, 144.2 ± 32.3, and 200.1 ± 79.3% at 15 mins over control values for LAPC-4, PC-3, LNCaP, and 22Rv1 cells, respectively. A correlation was seen (R2 = 0.911) with FAS expression plotted against % change in 64Cu-ATSM uptake with C75 treatment. Conclusions Although Cu-ATSM has clinical relevance in the PET imaging of hypoxia in many tumor types, its translation to the imaging of prostate cancer may be limited by the over-expression of FAS associated with prostatic malignancies. PMID:18355682

  10. Anticancer activity of glucomoringin isothiocyanate in human malignant astrocytoma cells.

    PubMed

    Rajan, Thangavelu Soundara; De Nicola, Gina Rosalinda; Iori, Renato; Rollin, Patrick; Bramanti, Placido; Mazzon, Emanuela

    2016-04-01

    Isothiocyanates (ITCs) released from their glucosinolate precursors have been shown to inhibit tumorigenesis and they have received significant attention as potential chemotherapeutic agents against cancer. Astrocytoma grade IV is the most frequent and most malignant primary brain tumor in adults without any curative treatment. New therapeutic drugs are therefore urgently required. In the present study, we investigated the in vitro antitumor activity of the glycosylated isothiocyanate moringin [4-(α-l-rhamnopyranosyloxy)benzyl isothiocyanate] produced from quantitative myrosinase-induced hydrolysis of glucomoringin (GMG) under neutral pH value. We have evaluated the potency of moringin on apoptosis induction and cell death in human astrocytoma grade IV CCF-STTG1 cells. Moringin showed to be effective in inducing apoptosis through p53 and Bax activation and Bcl-2 inhibition. In addition, oxidative stress related Nrf2 transcription factor and its upstream regulator CK2 alpha expressions were modulated at higher doses, which indicated the involvement of oxidative stress-mediated apoptosis induced by moringin. Moreover, significant reduction in 5S rRNA was noticed with moringin treatment. Our in vitro results demonstrated the antitumor efficacy of moringin derived from myrosinase-hydrolysis of GMG in human malignant astrocytoma cells. PMID:26882972

  11. Ultrasonographic changes in the normal and malignant prostate after definitive radiotherapy

    SciTech Connect

    Egawa, S.; Carter, S.S.; Wheeler, T.M.; Scardino, P.T. )

    1989-11-01

    As treatments for early localized prostate cancer come under closer scrutiny, the fundamental problem of documenting the success of radiotherapy becomes more obvious. Currently, no satisfactory method exists to determine tumor viability after radiotherapy. Transrectal ultrasonography is particularly valuable for monitoring the response of prostate cancer to radiotherapy. Persistent cancer retains its hypoechoic appearance after definitive radiotherapy. Hypoechoic lesions greater than 5 mm in diameter found more than 12 months after radiotherapy should be suspected of representing persistent local disease. In our study, albeit in a selected group of patients undergoing salvage radical prostatectomy, 92 per cent of such findings were associated with what we interpreted as viable tumor by light microscopy. Ultrasound-guided biopsy should be considered in such circumstances. The persistence of hypoechoic lesions in more than 65 per cent of patients 12 to 36 months after radiotherapy also suggests that local treatment failure may be underestimated by digital rectal examination and random digitally guided biopsy. Serial measurement of the diameter of hypoechoic lesions may provide a valuable indicator of progress in an individual patient. Patients with enlarging foci of tumor within the prostate after radiotherapy might be selected for biopsy and further treatment. If such a policy is employed, it is likely that a higher incidence of persistent cancer will be found after radiotherapy than has previously been discovered by random digitally guided biopsy.

  12. Reprogramming of cell junction modules during stepwise epithelial to mesenchymal transition and accumulation of malignant features in vitro in a prostate cell model.

    PubMed

    Ke, Xi-song; Li, Wen-cheng; Hovland, Randi; Qu, Yi; Liu, Run-hui; McCormack, Emmet; Thorsen, Frits; Olsen, Jan Roger; Molven, Anders; Kogan-Sakin, Ira; Rotter, Varda; Akslen, Lars A; Oyan, Anne Margrete; Kalland, Karl-Henning

    2011-01-15

    Epithelial to mesenchymal transition (EMT) is pivotal in tumor metastasis. Our previous work reported an EMT model based on primary prostate epithelial cells (EP156T) which gave rise to cells with mesenchymal phenotype (EPT1) without malignant transformation. To promote prostate cell transformation, cells were maintained in saturation density cultures to select for cells overriding quiescence. Foci formed repeatedly following around 8 weeks in confluent EPT1 monolayers. Only later passage EPT1, but not EP156T cells of any passage, could form foci. Cells isolated from the foci were named EPT2 and formed robust colonies in soft agar, a malignant feature present neither in EP156T nor in EPT1 cells. EPT2 cells showed additional malignant traits in vitro, including higher ability to proliferate following confluence, higher resistance to apoptosis and lower dependence on exogenous growth factors than EP156T and EPT1 cells. Microarray profiling identified gene sets, many of which belong to cell junction modules, that changed expression from EP156T to EPT1 cells and continued to change from EPT1 to EPT2 cells. Our findings provide a novel stepwise cell culture model in which EMT emerges independently of transformation and is associated with subsequent accumulation of malignant features in prostate cells. Reprogramming of cell junction modules is involved in both steps. PMID:20969863

  13. The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23

    SciTech Connect

    Li, S.S.L.; Sharief, F.S. )

    1993-09-01

    Human prostatic acid phosphatase (ACPP) has been used as a diagnostic marker for prostate cancer. It is synthesized under androgen regulation and secreted by the epithelial cells of the prostate gland. The authors have confirmed the previous assignment of the ACPP gene to chromosome 3 by probing a panel of 25 human-Chinese hamster somatic cell hybrids, and they have further localized the ACPP gene to chromosome 3q21-q23 by fluorescence in situ hybridization. 10 refs., 1 fig.

  14. ICRAC controls the rapid androgen response in human primary prostate epithelial cells and is altered in prostate cancer

    PubMed Central

    Holzmann, Christian; Kilch, Tatiana; Kappel, Sven; Armbrüster, Andrea; Jung, Volker; Stöckle, Michael; Bogeski, Ivan; Schwarz, Eva C.; Peinelt, Christine

    2013-01-01

    Labelled 5α-dihydrotestosterone (DHT) binding experiments have shown that expression levels of (yet unidentified) membrane androgen receptors (mAR) are elevated in prostate cancer and correlate with a negative prognosis. However, activation of these receptors which mediate a rapid androgen response can counteract several cancer hallmark functions such as unlimited proliferation, enhanced migration, adhesion and invasion and the inability to induce apoptosis. Here, we investigate the downstream signaling pathways of mAR and identify rapid DHT induced activation of store-operated Ca2+ entry (SOCE) in primary cultures of human prostate epithelial cells (hPEC) from non-tumorous tissue. Consequently, down-regulation of Orai1, the main molecular component of Ca2+ release-activated Ca2+ (CRAC) channels results in an almost complete loss of DHT induced SOCE. We demonstrate that this DHT induced Ca2+ influx via Orai1 is important for rapid androgen triggered prostate specific antigen (PSA) release. We furthermore identified alterations of the molecular components of CRAC channels in prostate cancer. Three lines of evidence indicate that prostate cancer cells down-regulate expression of the Orai1 homolog Orai3: First, Orai3 mRNA expression levels are significantly reduced in tumorous tissue when compared to non-tumorous tissue from prostate cancer patients. Second, mRNA expression levels of Orai3 are decreased in prostate cancer cell lines LNCaP and DU145 when compared to hPEC from healthy tissue. Third, the pharmacological profile of CRAC channels in prostate cancer cell lines and hPEC differ and siRNA based knock-down experiments indicate changed Orai3 levels are underlying the altered pharmacological profile. The cancer-specific composition and pharmacology of CRAC channels identifies CRAC channels as putative targets in prostate cancer therapy. PMID:24240085

  15. The androgen receptor cistrome is extensively reprogrammed in human prostate tumorigenesis

    PubMed Central

    Pomerantz, Mark M.; Li, Fugen; Takeda, David; Lenci, Romina; Chonkar, Apurva; Chabot, Matthew; Cejas, Paloma; Vazquez, Francisca; Cook, Jennifer; Shivdasani, Ramesh A.; Bowden, Michaela; Lis, Rosina; Hahn, William C.; Kantoff, Philip W.; Brown, Myles; Loda, Massimo; Long, Henry W.; Freedman, Matthew L.

    2015-01-01

    Master transcription factors interact with DNA to establish cell-type identity and to regulate gene expression in mammalian cells1,2. The genome-wide map of these transcription factor binding sites has been termed the cistrome3. Here we show that the androgen receptor (AR) cistrome undergoes extensive reprogramming during prostate epithelial transformation in man. Using human prostate tissue, we observed a core set of AR binding sites that are consistently reprogrammed in tumors. FOXA1 and HOXB13, co-localized with the reprogrammed AR sites in human tumor tissue. Introduction of FOXA1 and HOXB13 into an immortalized prostate cell line reprogrammed the AR cistrome to resemble that of a prostate tumor, functionally linking these specific factors to AR reprogramming. These findings offer mechanistic insights into a key set of events that drive normal prostate epithelium towards transformation and establish the centrality of epigenetic reprogramming in human prostate tumorigenesis. PMID:26457646

  16. CXCL5 Promotes Prostate Cancer Progression1

    PubMed Central

    Begley, Lesa A; Kasina, Sathish; Mehra, Rohit; Adsule, Shreelekha; Admon, Andrew J; Lonigro, Robert J; Chinnaiyan, Arul M; Macoska, Jill A

    2008-01-01

    CXCL5 is a proangiogenic CXC-type chemokine that is an inflammatory mediator and a powerful attractant for granulocytic immune cells. Unlike many other chemokines, CXCL5 is secreted by both immune (neutrophil, monocyte, and macrophage) and nonimmune (epithelial, endothelial, and fibroblastic) cell types. The current study was intended to determine which of these cell types express CXCL5 in normal and malignant human prostatic tissues, whether expression levels correlated with malignancy and whether CXCL5 stimulated biologic effects consistent with a benign or malignant prostate epithelial phenotype. The results of these studies show that CXCL5 protein expression levels are concordant with prostate tumor progression, are highly associated with inflammatory infiltrate, and are frequently detected in the lumens of both benign and malignant prostate glands. Exogenous administration of CXCL5 stimulates cellular proliferation and gene transcription in both nontransformed and transformed prostate epithelial cells and induces highly aggressive prostate cancer cells to invade through synthetic basement membrane in vitro. These findings suggest that the inflammatory mediator, CXCL5, may play multiple roles in the etiology of both benign and malignant proliferative diseases in the prostate. PMID:18320069

  17. Implant supported overdenture in the patients with history of radio and chemotherapy for the prostate malignancy

    PubMed Central

    Aeran, Himanshu; Nautiyal, Vijay; Kumar, Varun; Uniyal, Shashank

    2015-01-01

    The success of dental implants in patients that have undergone chemo and radiotherapy for a region other than head and neck remain unclear, although some local and systemic factors could be contraindications to dental implant treatment. As there are very few absolute medical contraindications to dental implant treatment, but a number of conditions may increase the risk of treatment failure or complications. The case report describes the successful survival of dental implants placed in maxilla and mandible of a patient who had undergone radio and chemotherapy for prostate cancer. PMID:27390497

  18. Secreted primary human malignant mesothelioma exosome signature reflects oncogenic cargo.

    PubMed

    Greening, David W; Ji, Hong; Chen, Maoshan; Robinson, Bruce W S; Dick, Ian M; Creaney, Jenette; Simpson, Richard J

    2016-01-01

    Malignant mesothelioma (MM) is a highly-aggressive heterogeneous malignancy, typically diagnosed at advanced stage. An important area of mesothelioma biology and progression is understanding intercellular communication and the contribution of the secretome. Exosomes are secreted extracellular vesicles shown to shuttle cellular cargo and direct intercellular communication in the tumour microenvironment, facilitate immunoregulation and metastasis. In this study, quantitative proteomics was used to investigate MM-derived exosomes from distinct human models and identify select cargo protein networks associated with angiogenesis, metastasis, and immunoregulation. Utilising bioinformatics pathway/network analyses, and correlation with previous studies on tumour exosomes, we defined a select mesothelioma exosomal signature (mEXOS, 570 proteins) enriched in tumour antigens and various cancer-specific signalling (HPGD/ENO1/OSMR) and secreted modulators (FN1/ITLN1/MAMDC2/PDGFD/GBP1). Notably, such circulating cargo offers unique insights into mesothelioma progression and tumour microenvironment reprogramming. Functionally, we demonstrate that oncogenic exosomes facilitate the migratory capacity of fibroblast/endothelial cells, supporting the systematic model of MM progression associated with vascular remodelling and angiogenesis. We provide biophysical and proteomic characterisation of exosomes, define a unique oncogenic signature (mEXOS), and demonstrate the regulatory capacity of exosomes in cell migration/tube formation assays. These findings contribute to understanding tumour-stromal crosstalk in the context of MM, and potential new diagnostic and therapeutic extracellular targets. PMID:27605433

  19. Secreted primary human malignant mesothelioma exosome signature reflects oncogenic cargo

    PubMed Central

    Greening, David W.; Ji, Hong; Chen, Maoshan; Robinson, Bruce W. S.; Dick, Ian M.; Creaney, Jenette; Simpson, Richard J.

    2016-01-01

    Malignant mesothelioma (MM) is a highly-aggressive heterogeneous malignancy, typically diagnosed at advanced stage. An important area of mesothelioma biology and progression is understanding intercellular communication and the contribution of the secretome. Exosomes are secreted extracellular vesicles shown to shuttle cellular cargo and direct intercellular communication in the tumour microenvironment, facilitate immunoregulation and metastasis. In this study, quantitative proteomics was used to investigate MM-derived exosomes from distinct human models and identify select cargo protein networks associated with angiogenesis, metastasis, and immunoregulation. Utilising bioinformatics pathway/network analyses, and correlation with previous studies on tumour exosomes, we defined a select mesothelioma exosomal signature (mEXOS, 570 proteins) enriched in tumour antigens and various cancer-specific signalling (HPGD/ENO1/OSMR) and secreted modulators (FN1/ITLN1/MAMDC2/PDGFD/GBP1). Notably, such circulating cargo offers unique insights into mesothelioma progression and tumour microenvironment reprogramming. Functionally, we demonstrate that oncogenic exosomes facilitate the migratory capacity of fibroblast/endothelial cells, supporting the systematic model of MM progression associated with vascular remodelling and angiogenesis. We provide biophysical and proteomic characterisation of exosomes, define a unique oncogenic signature (mEXOS), and demonstrate the regulatory capacity of exosomes in cell migration/tube formation assays. These findings contribute to understanding tumour-stromal crosstalk in the context of MM, and potential new diagnostic and therapeutic extracellular targets. PMID:27605433

  20. Multispectral Photoacoustic Imaging of Prostate Cancer: Preliminary Ex-vivo Results

    PubMed Central

    Dogra, Vikram S.; Chinni, Bhargava K.; Valluru, Keerthi S.; Joseph, Jean V.; Ghazi, Ahmed; Yao, Jorge L.; Evans, Katie; Messing, Edward M.; Rao, Navalgund A.

    2013-01-01

    Objective: The objective of this study is to validate if ex-vivo multispectral photoacoustic (PA) imaging can differentiate between malignant prostate tissue, benign prostatic hyperplasia (BPH), and normal human prostate tissue. Materials and Methods: Institutional Review Board's approval was obtained for this study. A total of 30 patients undergoing prostatectomy for biopsy-confirmed prostate cancer were included in this study with informed consent. Multispectral PA imaging was performed on surgically excised prostate tissue and chromophore images that represent optical absorption of deoxyhemoglobin (dHb), oxyhemoglobin (HbO2), lipid, and water were reconstructed. After the imaging procedure is completed, malignant prostate, BPH and normal prostate regions were marked by the genitourinary pathologist on histopathology slides and digital images of marked histopathology slides were obtained. The histopathology images were co-registered with chromophore images. Region of interest (ROI) corresponding to malignant prostate, BPH and normal prostate were defined on the chromophore images. Pixel values within each ROI were then averaged to determine mean intensities of dHb, HbO2, lipid, and water. Results: Our preliminary results show that there is statistically significant difference in mean intensity of dHb (P < 0.0001) and lipid (P = 0.0251) between malignant prostate and normal prostate tissue. There was difference in mean intensity of dHb (P < 0.0001) between malignant prostate and BPH. Sensitivity, specificity, positive predictive value, and negative predictive value of our imaging system were found to be 81.3%, 96.2%, 92.9% and 89.3% respectively. Conclusion: Our preliminary results of ex-vivo human prostate study suggest that multispectral PA imaging can differentiate between malignant prostate, BPH and normal prostate tissue. PMID:24228210

  1. Early Human Prostate Adenocarcinomas Harbor Androgen-Independent Cancer Cells

    PubMed Central

    Fiñones, Rita R.; Yeargin, Jo; Lee, Melissa; Kaur, Aman Preet; Cheng, Clari; Sun, Paulina; Wu, Christopher; Nguyen, Catherine; Wang-Rodriguez, Jessica; Meyer, April N.; Baird, Stephen M.; Donoghue, Daniel J.; Haas, Martin

    2013-01-01

    Although blockade of androgen receptor (AR) signaling represents the main treatment for advanced prostate cancer (PrCa), many patients progress to a lethal phenotype of “Castration-Resistant” prostate cancer (CR-PrCa). With the hypothesis that early PrCa may harbor a population of androgen-unresponsive cancer cells as precursors to CR-recurrent disease, we undertook the propagation of androgen-independent cells from PrCa-prostatectomy samples of early, localized (Stage-I) cases. A collection of 120 surgical specimens from prostatectomy cases was established, among which 54 were adenocarcinomas. Hormone-free cell culture conditions were developed allowing routine propagation of cells expressing prostate basal cell markers and stem/progenitor cell markers, and which proliferated as spheres/spheroids in suspension cultures. Colonies of androgen-independent epithelial cells grew out from 30/43 (70%) of the adenocarcinoma cases studied in detail. Fluorescence microscopy and flow cytometry showed that CR-PrCa cells were positive for CD44, CD133, CK5/14, c-kit, integrin α2β1, SSEA4, E-Cadherin and Aldehyde Dehydrogenase (ALDH). All 30 CR-PrCa cell cultures were also TERT-positive, but negative for TMPRSS2-ERG. Additionally, a subset of 22 of these CR-PrCa cell cultures was examined by orthotopic xenografting in intact and castrated SCID mice, generating histologically typical locally-invasive human PrCa or undifferentiated cancers, respectively, in 6–8 weeks. Cultured PrCa cells and orthotopically-induced in vivo cancers lacked PSA expression. We report here the propagation of Cancer Initiating Cells (CIC) directly from Stage I human PrCa tissue without selection or genetic manipulation. The propagation of stem/progenitor-like CR-PrCa cells derived from early human prostate carcinomas suggests the existence of a subpopulation of cells resistant to androgen-deprivation therapy and which may drive the subsequent emergence of disseminated CR-PrCa. PMID:24086346

  2. Butyrate modulates antioxidant enzyme expression in malignant and non-malignant human colon tissues.

    PubMed

    Jahns, Franziska; Wilhelm, Anne; Jablonowski, Nadja; Mothes, Henning; Greulich, Karl Otto; Glei, Michael

    2015-04-01

    The induction of antioxidant enzymes is an important mechanism in colon cancer chemoprevention, but the response of human colon tissue to butyrate, a gut fermentation product derived from dietary fiber, remains largely unknown. Therefore, our study investigated the effect of a butyrate treatment on catalase (CAT) and superoxide dismutase (SOD2) in matched human colon tissues of different transformation stages (n = 3-15 in each group) ex vivo. By performing quantitative real-time PCR, Western blot, and spectrophotometric measurements, we found an increase in SOD2 at expression and activity level in colonic adenocarcinomas (mRNA: 1.96-fold; protein: 1.41-fold, activity: 1.8-fold; P < 0.05). No difference was detectable for CAT between normal, adenoma, and carcinoma colon tissues. Treatment of normal colon epithelium (12 h) with a physiologically relevant concentration of butyrate (10 mM) resulted in a significant increase (P < 0.05) in CAT mRNA (1.24-fold) and protein (1.39-fold), without affecting the enzymatic activity. Consequently, preliminary experiments failed to show any protective effect of butyrate against H2 O2 -mediated DNA damage. Despite a significantly lowered SOD2 transcript (0.51-fold, P < 0.01) and, to a lesser extent, protein level (0.86-fold) after butyrate exposure of normal colon cells, the catalytic activity was significantly enhanced (1.19-fold, P < 0.05), suggesting an increased protection against tissue superoxide radicals. In malignant tissues, greater variations in response to butyrate were observed. Furthermore, both enzymes showed an age-dependent decrease in activity in normal colon epithelium (CAT: r = -0.49, P = 0.09; SOD2: r = -0.58, P = 0.049). In conclusion, butyrate exhibited potential antioxidant features ex vivo but cellular consequences need to be investigated more in depth. PMID:24677319

  3. Presence of calcitonin-like immunoreactivity (iCT) in human prostate gland: evidence for iCT secretion by cultured prostate cells.

    PubMed

    Shah, G V; Noble, M J; Austenfeld, M; Weigel, J; Deftos, L J; Mebust, W K

    1992-01-01

    Immunoreactive calcitonin (iCT) has been detected in human prostate tissue extracts as well as seminal plasma. The present studies were undertaken to examine whether iSCT (immunoreactive salmon CT-like human peptide) co-exists with iHCT (thyroid CT-like substance) in human prostate tissue extracts, and whether these substances are secreted by primary prostate cells in culture. Since the local secretion of these substances seems to increase in some neoplasms, a second objective of the study was to examine whether basal secretion of iCTs from primary prostate cells is increased in carcinoma. The present results have shown that both iHCT and iSCT were present in prostate tissue extracts. The mean iHCT levels in extracts of benign hyperplastic prostates (BPH) were 0.59 ng/g prostate, and these were significantly lower than iHCT concentrations in prostatic carcinoma (PC) (2.53 ng/g). No significant differences in their iSCT contents were observed. However, the results from culture of over 90 individual prostate tissue specimens from BPH or PC indicate that primary prostate cells secreted detectable quantities of iSCT and the basal release of this material from PC prostate cultures was almost four-fold higher than that from BPH prostate cultures. These results suggest that a CT-like immunoreactive material is secreted by primary prostate cells in culture, and the basal secretion of this material is significantly higher in PC cells as compared to BPH cells. Endogenous secretion of prostatic CT, and the elevation of its expression in PC suggest that it may serve as a regulatory factor in the pathophysiology of the prostate gland. PMID:1409122

  4. Greatwall promotes cell transformation by hyperactivating AKT in human malignancies

    PubMed Central

    Vera, Jorge; Lartigue, Lydia; Vigneron, Suzanne; Gadea, Gilles; Gire, Veronique; Del Rio, Maguy; Soubeyran, Isabelle; Chibon, Frederic; Lorca, Thierry; Castro, Anna

    2015-01-01

    The PP2A phosphatase is often inactivated in cancer and is considered as a tumour suppressor. A new pathway controlling PP2A activity in mitosis has been recently described. This pathway includes the Greatwall (GWL) kinase and its substrates endosulfines. At mitotic entry, GWL is activated and phosphorylates endosulfines that then bind and inhibit PP2A. We analysed whether GWL overexpression could participate in cancer development. We show that GWL overexpression promotes cell transformation and increases invasive capacities of cells through hyperphosphorylation of the oncogenic kinase AKT. Interestingly, AKT hyperphosphorylation induced by GWL is independent of endosulfines. Rather, GWL induces GSK3 kinase dephosphorylation in its inhibitory sites and subsequent SCF-dependent degradation of the PHLPP phosphatase responsible for AKT dephosphorylation. In line with its oncogenic activity, we find that GWL is often overexpressed in human colorectal tumoral tissues. Thus, GWL is a human oncoprotein that promotes the hyperactivation of AKT via the degradation of its phosphatase, PHLPP, in human malignancies. DOI: http://dx.doi.org/10.7554/eLife.10115.001 PMID:26613407

  5. Radiosensitization effect of zidovudine on human malignant glioma cells

    SciTech Connect

    Zhou Fuxiang; Liao Zhengkai; Dai Jing; Xiong Jie; Xie CongHua; Luo Zhiguo; Liu Shiquan; Zhou Yunfeng . E-mail: yfzhouwhu@163.com

    2007-03-09

    Telomeres are shortened with each cell division and play an important role in maintaining chromosomal integrity and function. Telomerase, responsible for telomere synthesis, is activated in 90% of human tumor cells but seldom in normal somatic cells. Zidovudine (AZT) is a reverse transcriptase inhibitor. In this study, we have investigated the effects of {gamma}-radiation in combination with AZT on telomerase activity (TA), telomere length, DNA single-strand breaks (SSBs), DNA double-strand breaks (DSBs), and the changes in radiosensitivity of human malignant glioma cell line U251. The results showed that the TA was suppressed by AZT but enhanced by irradiation, resulting in a deceleration of restored rate of shortened telomere, decreased repair rate of DNA strand breaks, and increased radiosensitivity of U251 cells. Our results suggested that telomerase activity and telomere length may serve as markers for estimating the efficacy of cancer radiotherapy and reverse transcriptase inhibitors, such as AZT, may be used clinically as a new radiosensitizer in cancer radiotherapy.

  6. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol

    SciTech Connect

    Elo, J.P.; Kvist, L.; Leinonen, K.; Isomaa, V.

    1995-12-01

    Androgens are necessary for the development of prostatic cancer. The mechanisms by which the originally androgen-dependent prostatic cancer cells are relieved of the requirement to use androgen for their growth are largely unknown. The human prostatic cancer cell line LNCaP has been shown to contain a point mutation in the human androgen receptor gene (hAR), suggesting that changes in the hAR may contribute to the abnormal hormone response of prostatic cells. To search for point mutations in the hAR, we used single strand conformation polymorphism analysis and a polymerase chain reaction direct sequencing method to screen 23 prostatic cancer specimens from untreated patients, 6 prostatic cancer specimens from treated patients, and 11 benign prostatic hyperplasia specimens. One mutation was identified in DNA isolated from prostatic cancer tissue, and the mutation was also detected in the leukocyte DNA of the patient and his offspring. The mutation changed codon 726 in exon E from arginine to leucine and was a germ line mutation. The mutation we found in exon E of the hAR gene does not alter the ligand binding specificity of the AR, but the mutated receptor was activated by estradiol to a significantly greater extent than the wild-type receptor. The AR gene mutation described in this study might be one explanation for the altered biological activity of prostatic cancer. 36 refs., 4 figs.

  7. Molecular effects of soy phytoalexin glyceollins in human prostate cancer cells LNCaP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glyceollins are soy–derived phytoalexins that have been proposed to be candidate cancer preventive compounds. The effect of the glyceollins on prostate cancer is unknown. The present study examined the molecular effects of soy phytoalexins, glyceollins, on the human prostate cancer cell line LNCaP t...

  8. Human Prostatic Acid Phosphatase: Structure, Function and Regulation

    PubMed Central

    Muniyan, Sakthivel; Chaturvedi, Nagendra K.; Dwyer, Jennifer G.; LaGrange, Chad A.; Chaney, William G.; Lin, Ming-Fong

    2013-01-01

    Human prostatic acid phosphatase (PAcP) is a 100 kDa glycoprotein composed of two subunits. Recent advances demonstrate that cellular PAcP (cPAcP) functions as a protein tyrosine phosphatase by dephosphorylating ErbB-2/Neu/HER-2 at the phosphotyrosine residues in prostate cancer (PCa) cells, which results in reduced tumorigenicity. Further, the interaction of cPAcP and ErbB-2 regulates androgen sensitivity of PCa cells. Knockdown of cPAcP expression allows androgen-sensitive PCa cells to develop the castration-resistant phenotype, where cells proliferate under an androgen-reduced condition. Thus, cPAcP has a significant influence on PCa cell growth. Interestingly, promoter analysis suggests that PAcP expression can be regulated by NF-κB, via a novel binding sequence in an androgen-independent manner. Further understanding of PAcP function and regulation of expression will have a significant impact on understanding PCa progression and therapy. PMID:23698773

  9. Prediction of alpha1-adrenoceptor occupancy in the human prostate from plasma concentrations of silodosin, tamsulosin and terazosin to treat urinary obstruction in benign prostatic hyperplasia.

    PubMed

    Yamada, Shizuo; Kato, Yasuhiro; Okura, Takashi; Kagawa, Yoshiyuki; Kawabe, Kazuki

    2007-07-01

    Alpha1-adrenoceptor antagonists are clinically useful for the improvement of urinary obstruction due to benign prostatic hyperplasia (BPH), and their therapeutic effects are mediated through the blockade of prostatic alpha(1)-adrenoceptors. The present study was undertaken to predict the magnitude and duration of alpha(1)-adrenoceptor occupancy in the human prostate after oral alpha(1)-adrenoceptor antagonists. Prostatic alpha(1)-adrenoceptor-binding parameters of silodosin were estimated by measuring specific [(3)H]prazosin binding in rat prostate after oral administration of this drug. The plasma concentration of silodosin after oral administration in rats and healthy volunteers was measured using a high-performance liquid chromatographic method. The alpha(1)-adrenoceptor-binding affinities (K(i)) of silodosin, tamsulosin, and terazosin in the human prostate and plasma concentrations of tamsulosin and terazosin were obtained from the literature. Using the alpha(1)-adrenoceptor binding parameters of silodosin in rat prostate, alpha(1)-adrenoceptor occupancy in the human prostate was estimated to be around 60-70% at 1-6 h after oral administration of silodosin at doses of 3.0, 8.1, and 16.1 micromol. Thereafter, the receptor occupancy was periodically decreased, to 24% (8.1 micromol) and 54% (16.1 micromol) 24 h later. A similar magnitude and time course of alpha(1)-adrenoceptor occupancy by silodosin in the human prostate were estimated using alpha(1)-adrenoceptor-binding affinities (K(i)) in the human prostate. Despite about two orders of differences in the plasma unbound concentrations after clinically effective oral dosages of silodosin, tamsulosin, and terazosin, there was a comparable magnitude of prostatic alpha(1)-adrenoceptor occupancy by these drugs. In conclusion, the prediction of alpha(1)-adrenoceptor occupancy in the human prostate by alpha(1)-adrenoceptor antagonists may provide the rationale for the optimum dosage regimen of these drugs in the

  10. Malignant transformation of diploid human fibroblasts by transfection of oncogenes

    SciTech Connect

    McCormick, J.J.

    1992-01-01

    This document consist of brief reports prepared by postdoctoral students supported by the project, each describing his accomplishments under the grant. Topics include (1) Malignant Transformation of MSU-1. 1 Cells by Gamma Radiation, (2) Correlation between Levels of ras Expression and Presence of Transformed Phenotypes Including Tumorigenicity, Using a Modulatable Promoter, (3) Relation between Specific rad Oncogene Expression, (4) Correlation of Genetic Changes in Fibroblastic Tumors with Malignancies, (5)Transformation of MSU-1.1 Cells by sis Oncogene, (6) Malignant Transformation of MSU-1.0 Cells, (7) Correlation of Urokinase Plasminogen Activation (mu-PA) with Malignant Phenotype, (8)Two Dimensional Gel Electrophoresis Studies of the Proteins of the Major Cell Strains of the MSU-1 Family of Cells, and (9) Correlation between Proteinase Activity Levels and Malignancy.

  11. Engraftment of human blood malignancies to the turkey embryo: a robust new in vivo model.

    PubMed

    Grinberg, Igor; Reis, Arbel; Ohana, Avivit; Taizi, Moran; Cipok, Michal; Tavor, Sigal; Rund, Deborah; Deutsch, Varda R; Goldstein, Ronald S

    2009-10-01

    Xenografting of human blood malignancies to immunodeficient SCID mice is a powerful research tool. We evaluate here whether the immunodeficient turkey embryo can also serve as a xenograft host for human blood malignancies. Human leukemia, lymphoma and myeloma lines engrafted robustly into medullary and extramedullary tissues of turkey embryos as detected by PCR, FACS and histology in 8-10 days. Four of eleven patient AML samples also engrafted the bone marrow. Grafts of two lines responded to chemotherapy with doxorubicin. The turkey embryo therefore has the potential to be a complementary xenograft model for the study of human blood malignancies. PMID:19297019

  12. Carbogen breathing increases prostate cancer oxygenation: a translational MRI study in murine xenografts and humans

    PubMed Central

    Alonzi, R; Padhani, A R; Maxwell, R J; Taylor, N J; Stirling, J J; Wilson, J I; d′Arcy, J A; Collins, D J; Saunders, M I; Hoskin, P J

    2009-01-01

    Hypoxia has been associated with poor local tumour control and relapse in many cancer sites, including carcinoma of the prostate. This translational study tests whether breathing carbogen gas improves the oxygenation of human prostate carcinoma xenografts in mice and in human patients with prostate cancer. A total of 23 DU145 tumour-bearing mice, 17 PC3 tumour-bearing mice and 17 human patients with prostate cancer were investigated. Intrinsic susceptibility-weighted MRI was performed before and during a period of carbogen gas breathing. Quantitative R2* pixel maps were produced for each tumour and at each time point and changes in R2* induced by carbogen were determined. There was a mean reduction in R2* of 6.4% (P=0.003) for DU145 xenografts and 5.8% (P=0.007) for PC3 xenografts. In all, 14 human subjects were evaluable; 64% had reductions in tumour R2* during carbogen inhalation with a mean reduction of 21.6% (P=0.0005). Decreases in prostate tumour R2* in both animal models and human patients as a result of carbogen inhalation suggests the presence of significant hypoxia. The finding that carbogen gas breathing improves prostate tumour oxygenation provides a rationale for testing the radiosensitising effects of combining carbogen gas breathing with radiotherapy in prostate cancer patients. PMID:19190629

  13. Antitumor effects of methotrexate-monoclonal anti-prostatic acid phosphatase antibody conjugate on human prostate tumor

    SciTech Connect

    Deguchi, T.; Chu, T.M.; Leong, S.S.; Horoszewicz, J.S.; Lee, C.L.

    1986-03-01

    Methotrexate (MTX) was conjugated to an IgG/sub 1/ monoclonal antibody (MCA) specific for human prostatic acid phosphatase (PAP) by an active ester method, resulting in a molar ratio of MTX to IgG/sub 1/ of 14. MTX-MCA conjugate retained 94% of free antibody activity and preserved 90% of dihydrofolate reductase inhibitory activity of free MTX. MTX-MCA conjugate was shown to be accumulated in vitro by prostate tumor cells (LNCaP) 1.3 times higher than that of MTX conjugate to normal mouse IgG (NIgG) and 6.2 times higher than that of free MTX. Antitumor activity in vitro exhibited that MTX-MCA conjugate is more effective on inhibition (52%) of /sup 3/H-deoxyuridine incorporation into LNCaP cells than that of MTX-NIgG (39%), but both were less effective than free MTX (70%). The in vivo distribution of /sup 3/H-MTX-MCA conjugate in human prostate tumor xenograft (tumor: blood ratio 5.1) was higher than those of /sup 3/H-MTX-NIgG conjugate (1.1) and of free /sup 3/H-MTX (1.5). Anti-tumor activity in vivo demonstrated that MTX-MCA conjugate retarded the growth of xenografted human prostate tumor greatly and persistently, as compared with the control groups. These results suggested that MTX-monoclonal anti-PAP antibody conjugate represents a potential reagent for immunochemotherapy of human prostate tumor (NIH CA-34536, CA-15437 and ACS CH-269.

  14. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model.

    PubMed

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-03-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  15. Long term organ culture of human prostate tissue in a NASA-designed rotating wall bioreactor

    NASA Technical Reports Server (NTRS)

    Margolis, L.; Hatfill, S.; Chuaqui, R.; Vocke, C.; Emmert-Buck, M.; Linehan, W. M.; Duray, P. H.

    1999-01-01

    PURPOSE: To maintain ex vivo integral prostatic tissue including intact stromal and ductal elements using the NASA-designed Rotating Wall Vessel (RWV) which maintains colocalized cells in an environment that promotes both three-dimensional cellular interactions together with the uniform mass transfer of nutrients and metabolic wastes. MATERIALS AND METHODS: Samples of normal prostate were obtained as a byproduct of transurethral prostatectomy or needle biopsy. Prostatic tissue dissected into small 1 x 1 mm. blocks was cultured in the Rotating Wall Vessel (RWV) Bioreactor for various time periods and analyzed using histological, immunochemical, and total cell RNA assays. RESULTS: We report the long term maintenance of benign explanted human prostate tissue grown in simple culture medium, under the simulated microgravity conditions afforded by the RWV bioreactor. Mesenchymal stromal elements including blood vessels and architecturally preserved tubuloglandular acini were maintained for a minimum of 28 days. Cytokeratins, vimentin and TGF-beta2 receptor and ligand were preserved through the entire culture period as revealed by immunocytochemistry. Prostatic acid phosphatase (PAP) was continuously expressed during the culture period, although somewhat decreased. Prostatic specific antigen (PSA) and its transcript were down regulated over time of culture. Prostatic carcinoma cells from the TSU cell line were able to invade RWV-cultured benign prostate tissue explants. CONCLUSIONS: The RWV bioreactor represents an additional new technology for culturing prostate tissue for further investigations concerning the basic physiology and pathobiology of this clinically important tissue.

  16. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model

    PubMed Central

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-01-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  17. Annatto Tocotrienol Induces a Cytotoxic Effect on Human Prostate Cancer PC3 Cells via the Simultaneous Inhibition of Src and Stat3.

    PubMed

    Sugahara, Ryosuke; Sato, Ayami; Uchida, Asuka; Shiozawa, Shinya; Sato, Chiaki; Virgona, Nantiga; Yano, Tomohiro

    2015-01-01

    Prostate cancer is one of the most frequently occurring cancers and often acquires the potential of androgen-independent growth as a malignant phenotype. Androgen-independent prostate cancer has severe chemoresistance towards conventional chemotherapeutic agents, so a new treatment approach is required for curing such prostate cancer. In this context, the present study was undertaken to check if annatto tocotrienol (main component δ-tocotrienol) could suppress cell growth in human prostate cancer (PC3, androgen-independent type) cells via the inhibition of Src and Stat3. The tocotrienol showed cytotoxic effects on PC3 cells in a dose-dependent manner, and the effect depended on G1 arrest in the cell cycle and subsequent induction of apoptosis. In a cytotoxic dose, the tocotrienol suppressed cellular growth via the simultaneous inhibition of Src and Stat3. Similarly, the treatment combination of both Src and Stat3 inhibitors induced cytotoxic effects in PC3 cells in an additive manner compared to each by itself. With respect to cell cycle regulation and the induction of apoptosis, the combination treatment showed a similar effect to that of the tocotrienol treatment. These results suggest that annatto tocotrienol effectively induces cytotoxicity in androgen-independent prostate cancer cells via the suppression of Src and Stat3. PMID:26875492

  18. Decreased expression of SLC 39A14 is associated with tumor aggressiveness and biochemical recurrence of human prostate cancer

    PubMed Central

    Xu, Xiao-Ming; Wang, Cheng-Gong; Zhu, Yu-Di; Chen, Wei-Hua; Shao, Si-Liang; Jiang, Fu-Neng; Liao, Qian-De

    2016-01-01

    Objective Solute carrier family 39, member 14 (SLC39A14), has been identified as a potential biomarker for various cancers. However, its roles in prostate cancer (PCa) are still unclear. The aim of this study was to investigate the clinical significance of SLC39A14 in patients with PCa and its functions in malignant phenotypes of PCa cells. Patients and methods Subcellular localization and expression pattern of SLC39A14 protein were examined by immunohistochemistry. Then, the associations of SLC39A14 expression with various clinicopathological features and clinical outcome of patients with PCa were statistically evaluated. Subsequently, the effects of SLC39A14 overexpression and knockdown on PCa cell proliferation and motility were, respectively, examined by Cell Counting Kit-8, transwell, and wound-healing assays. Results The immunoreactive scores of SLC39A14 protein in human PCa tissues were significantly lower than those in normal prostate tissues. Based on the Taylor dataset, SLC39A14 downregulation occurred more frequently in patients with PCa with a higher Gleason score (P<0.001), advanced clinical stage (P=0.008), presence of metastasis (P=0.009), and prostate-specific antigen failure (P=0.006). More interestingly, the survival analysis identified SLC39A14 as an independent factor for predicting the biochemical recurrence-free survival of patients with PCa (P=0.017). Functionally, the enforced expression of SLC39A14 could suppress cell proliferation, invasion, and migration of PCa cell lines in vitro, which could be reversed by the knockdown of SLC39A14. Conclusion Decreased expression of SLC39A14 may lead to malignant phenotypes of PCa cells and aggressive tumor progression in patients with PCa. Importantly, SLC39A14 may function as a tumor suppressor and a biomarker for screening patients with biochemical recurrence following radical prostatectomy. PMID:27471394

  19. Epigenetic DNA methylation of antioxidative stress regulator NRF2 in human prostate cancer.

    PubMed

    Khor, Tin Oo; Fuentes, Francisco; Shu, Limin; Paredes-Gonzalez, Ximena; Yang, Anne Yuqing; Liu, Yue; Smiraglia, Dominic J; Yegnasubramanian, Srinivasan; Nelson, William G; Kong, Ah-Ng Tony

    2014-12-01

    Epigenetic control of NRF2, a master regulator of many critical antioxidative stress defense genes in human prostate cancer (CaP), is unknown. Our previous animal study found decreased Nrf2 expression through promoter CpG methylation/histone modifications during prostate cancer progression in TRAMP mice. In this study, we evaluated CpG methylation of human NRF2 promoter in 27 clinical prostate cancer samples and in LNCaP cells using MAQMA analysis and bisulfite genomic DNA sequencing. Prostate cancer tissue microarray (TMA) containing normal and prostate cancer tissues was studied by immunohistochemistry. Luciferase reporter assay using specific human NRF2 DNA promoter segments and chromatin immunoprecipitation (ChIP) assay against histone modifying proteins were performed in LNCaP cells. Three specific CpG sites in the NRF2 promoter were found to be hypermethylated in clinical prostate cancer samples (BPHhuman prostate cancer TMA showed a decreasing trend for both intensity and percentage of positive cells from normal tissues to advanced-stage prostate cancer (Gleason score from 3-9). Reporter assays in the LNCaP cells containing these three CpG sites showed methylation-inhibited transcriptional activity of the NRF2 promoter. LNCaP cells treated with 5-aza/TSA restored the expression of NRF2 and NRF2 downstream target genes, decreased expression levels of DNMT and HDAC proteins, and ChIP assays showed increased RNA Pol II and H3Ac with a concomitant decrease in H3K9me3, MBD2, and MeCP2 at CpG sites of human NRF2 promoter. Taken together, these findings suggest that epigenetic modification may contribute to the regulation of transcription activity of NRF2, which could be used as prevention and treatment target of human prostate cancer. PMID:25266896

  20. Role of IAPs in prostate cancer progression: immunohistochemical study in normal and pathological (benign hyperplastic, prostatic intraepithelial neoplasia and cancer) human prostate

    PubMed Central

    2010-01-01

    Background In this study was investigate IAPs in normal human prostate (NP), benign prostatic hyperplasia (BPH), prostatic intraepithelial neoplasia (PIN) and prostatic carcinoma (PC), and their involvement in apoptosis/proliferation via NF-kB (TNF-α, IL-1) stimulation. Methods Immunohistochemical and Western blot analyses were performed in 10 samples of normal prostates, 35 samples of BPH, 27 samples diagnosis of PIN (with low-grade PIN or high-grade PIN) and 95 samples of PC (with low, medium or high Gleason grades). Results In NP, cytoplasm of epithelial cells were positive to c-IAP1/2 (80% of samples), c-IAP-2 (60%), ILP (20%), XIAP (20%); negative to NAIP and survivin. In BPH, epithelial cells were immunostained to c-IAP1/2 (57.57%), c-IAP-2 (57.57%), ILP (66.6%), NAIP (60.6%), XIAP (27.27%), survivin (9.1%). Whereas low-grade PIN showed intermediate results between NP and BPH; results in high-grade PIN were similar to those found in PC. In PC, epithelial cells were immunostained to c-IAP1/2, c-IAP-2, ILP, NAIP, XIAP (no Gleason variation) and survivin (increasing with Gleason). Conclusions IAPs could be involved in prostate disorder (BPH, PIN and PC) development since might be provoke inhibition of apoptosis and subsequently cell proliferation. At the same time, different transduction pathway such as IL-1/NIK/NF-kB or TNF/NF-kB (NIK or p38) also promotes proliferation. Inhibitions of IAPs, IL-1α and TNFα might be a possible target for PC treatment since IAPs are the proteins that inhibited apoptosis (favour proliferation) and IL-1α and TNFα would affect all the transduction pathway involucrate in the activation of transcription factors related to survival or proliferation (NF-kB, Elk-1 or ATF-2). PMID:20078866

  1. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer.

    PubMed

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  2. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer

    PubMed Central

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  3. Palliation of malignant rectal obstruction from invasive prostate cancer with multiple overlapping self-expanding metal stents.

    PubMed

    Smith, Aja S; Cole, Matthew; Vega, Kenneth J; Munoz, Juan Carlos

    2009-12-01

    Self-expandable metal stents (SEMS) are used for colonic neoplastic and extracolonic metastatic obstruction relief. Limited data exists on their use for locally invasive prostate cancer. We describe a unique approach using overlapping SEMS to alleviate a rectosigmoid obstruction from locally invasive prostate cancer. A patient with locally advanced prostate cancer presented with obstipation and lymphedema. Placement of overlapping rectosigmoid SEMS was performed, relieving the visualized rectosigmoid obstruction. PMID:20016435

  4. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype.

    PubMed

    Theophilou, Georgios; Lima, Kássio M G; Briggs, Matthew; Martin-Hirsch, Pierre L; Stringfellow, Helen F; Martin, Francis L

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983-1984 (n = 20), 1988-1989 (n = 25), 1993-1994 (n = 21), 1998-1999 (n = 21), 2003-2004 (n = 21), 2008-2009 (n = 20) and 2012-2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000-1,490 cm(-1)). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  5. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype

    PubMed Central

    Theophilou, Georgios; Lima, Kássio M. G.; Briggs, Matthew; Martin-Hirsch, Pierre L.; Stringfellow, Helen F.; Martin, Francis L.

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983–1984 (n = 20), 1988–1989 (n = 25), 1993–1994 (n = 21), 1998–1999 (n = 21), 2003–2004 (n = 21), 2008–2009 (n = 20) and 2012–2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000–1,490 cm−1). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  6. AKT1 and MYC Induce Distinctive Metabolic Fingerprints in Human Prostate Cancer

    PubMed Central

    Priolo, Carmen; Pyne, Saumyadipta; Rose, Joshua; Regan, Erzsébet Ravasz; Zadra, Giorgia; Photopoulos, Cornelia; Cacciatore, Stefano; Schultz, Denise; Scaglia, Natalia; McDunn, Jonathan; De Marzo, Angelo M.; Loda, Massimo

    2014-01-01

    Cancer cells may overcome growth factor dependence by deregulating oncogenic and/or tumor suppressor pathways that affect their metabolism, or by activating metabolic pathways de novo with targeted mutations in critical metabolic enzymes. It is unknown whether human prostate tumors develop a similar metabolic response to different oncogenic drivers or a particular oncogenic event results in its own metabolic reprogramming. Akt and Myc are arguably the most prevalent driving oncogenes in prostate cancer. Mass spectrometry-based metabolite profiling was performed on immortalized human prostate epithelial cells transformed by AKT1 or MYC, transgenic mice driven by the same oncogenes under the control of a prostate-specific promoter, and human prostate specimens characterized for the expression and activation of these oncoproteins. Integrative analysis of these metabolomic datasets revealed that AKT1 activation was associated with accumulation of aerobic glycolysis metabolites, whereas MYC overexpression was associated with dysregulated lipid metabolism. Selected metabolites that differentially accumulated in the MYC-high vs. AKT1-high tumors, or in normal vs. tumor prostate tissue by untargeted metabolomics, were validated using absolute quantitation assays. Importantly, the AKT1/MYC status was independent of Gleason grade and pathologic staging. Our findings show how prostate tumors undergo a metabolic reprogramming which reflects their molecular phenotypes, with implications for the development of metabolic diagnostics and targeted therapeutics. PMID:25322691

  7. Maturation of the developing human fetal prostate in a rodent xenograft model

    PubMed Central

    Saffarini, Camelia M.; McDonnell, Elizabeth V.; Amin, Ali; Spade, Daniel J.; Huse, Susan M.; Kostadinov, Stefan; Hall, Susan J.; Boekelheide, Kim

    2015-01-01

    Background Prostate cancer is the most commonly diagnosed non-skin cancer in men. The etiology of prostate cancer is unknown, although both animal and epidemiologic data suggest that early life exposures to various toxicants, may impact DNA methylation status during development, playing an important role. Methods We have developed a xenograft model to characterize the growth and differentiation of human fetal prostate implants (gestational age 12-24 weeks) that can provide new data on the potential role of early life stressors on prostate cancer. The expression of key immunohistochemical markers responsible for prostate maturation was evaluated, including p63, cytokeratin 18, α-smooth muscle actin, vimentin, caldesmon, Ki-67, prostate specific antigen, estrogen receptor-α, and androgen receptor. Xenografts were separated into epithelial and stromal compartments using laser capture microdissection (LCM), and the DNA methylation status was assessed in >480,000 CpG sites throughout the genome. Results Xenografts demonstrated growth and maturation throughout the 200 days of post-implantation evaluation. DNA methylation profiles of laser capture micro-dissected tissue demonstrated tissue-specific markers clustered by their location in either the epithelium or stroma of human prostate tissue. Differential methylated promoter region CpG-associated gene analysis revealed significantly more stromal than epithelial DNA methylation in the 30 and 90-day xenografts. Functional classification analysis identified CpG-related gene clusters in methylated epithelial and stromal human xenografts. Conclusion This study of human fetal prostate tissue establishes a xenograft model that demonstrates dynamic growth and maturation, allowing for future mechanistic studies of the developmental origins of later life proliferative prostate disease. PMID:24038131

  8. Expression of leukemia/lymphoma related factor (LRF/Pokemon) in human benign prostate hyperplasia and prostate cancer.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Hunter, William J; Yohannes, Paulos; Khan, Ansar U; Agrawal, Devendra K

    2011-04-01

    Leukemia/lymphoma related factor (LRF), also known as Pokemon, is a protein that belongs to the POK family of transcriptional repressors. It has an oncogenic role in many different solid tumors. In this study, the expression of LRF was evaluated in benign prostate hyperplastic (BPH) and prostate cancer (PC) tissues. The functional expression of LRF was studied using multiple cellular and molecular methods including RT-PCR, western blotting, immunohistochemistry, and immunofluorescence. Paraffin-embedded human tissues of BPH and PC were used to examine LRF expression. Histological staining of the BPH and PC tissue sections revealed nuclear expression of LRF with minimal expression in the surrounding stroma. The semi-quantitative RT-PCR and western immunoblot analyses demonstrated significantly higher mRNA transcripts and protein expression in PC than BPH. High expression of LRF suggests that it may have a potential role in the pathogenesis of both BPH and prostate cancer. Further studies will help elucidate the mechanisms and signaling pathways that LRF may follow in the pathogenesis of prostate carcinoma. PMID:21251909

  9. Comparative study of serum zinc concentrations in benign and malignant prostate disease: A Systematic Review and Meta-Analysis.

    PubMed

    Zhao, Jiang; Wu, Qingjiang; Hu, Xiaoyan; Dong, Xingyou; Wang, Liang; Liu, Qian; Long, Zhou; Li, Longkun

    2016-01-01

    Many studies have investigated the relationship between serum zinc concentration and prostatic disease, but have shown inconsistent results. Hence, we performed a systematic literature review and meta-analysis to assess the correlation between serum zinc concentration and prostate disease. Systematic literature searches were conducted with PubMed, EMBASE, Science Direct/Elsevier, MEDLINE, CNKI and the Cochrane Library up to June 2015 for studies that involved the relationship between serum zinc concentration and prostate disease. Fourteen studies were identified from the databases. Our results illustrated that the serum zinc concentrations in prostate cancer patients were significantly lower than those in Benign prostatic hyperplasia (BPH) patients and normal controls (SMD (95% CI), -0.94 [-1.57, -0.32]; -1.18 [-1.90, -0.45]). However, the serum zinc concentrations in BPH patients were significantly higher than those in normal controls (SMD (95% CI) 1.77 [0.15, 3.39]). The present study showed that different levels of serum zinc concentrations are correlated with different prostatic disease. Serum zinc concentration may be used as a tool for the diagnosis and screening of prostate disease. But, further studies with well-designed larger sample studies are needed in this field to further clarify the correlation between serum zinc concentration and prostate disease. PMID:27170414

  10. Comparative study of serum zinc concentrations in benign and malignant prostate disease: A Systematic Review and Meta-Analysis

    PubMed Central

    Zhao, Jiang; Wu, Qingjiang; Hu, Xiaoyan; Dong, Xingyou; Wang, Liang; Liu, Qian; Long, Zhou; Li, Longkun

    2016-01-01

    Many studies have investigated the relationship between serum zinc concentration and prostatic disease, but have shown inconsistent results. Hence, we performed a systematic literature review and meta-analysis to assess the correlation between serum zinc concentration and prostate disease. Systematic literature searches were conducted with PubMed, EMBASE, Science Direct/Elsevier, MEDLINE, CNKI and the Cochrane Library up to June 2015 for studies that involved the relationship between serum zinc concentration and prostate disease. Fourteen studies were identified from the databases. Our results illustrated that the serum zinc concentrations in prostate cancer patients were significantly lower than those in Benign prostatic hyperplasia (BPH) patients and normal controls (SMD (95% CI), −0.94 [−1.57, −0.32]; −1.18 [−1.90, −0.45]). However, the serum zinc concentrations in BPH patients were significantly higher than those in normal controls (SMD (95% CI) 1.77 [0.15, 3.39]). The present study showed that different levels of serum zinc concentrations are correlated with different prostatic disease. Serum zinc concentration may be used as a tool for the diagnosis and screening of prostate disease. But, further studies with well-designed larger sample studies are needed in this field to further clarify the correlation between serum zinc concentration and prostate disease. PMID:27170414

  11. Berberine-induced apoptosis in human prostate cancer cells is initiated by reactive oxygen species generation

    SciTech Connect

    Meeran, Syed M.; Katiyar, Suchitra; Katiyar, Santosh K.

    2008-05-15

    Phytochemicals show promise as potential chemopreventive or chemotherapeutic agents against various cancers. Here we report the chemotherapeutic effects of berberine, a phytochemical, on human prostate cancer cells. The treatment of human prostate cancer cells (PC-3) with berberine induced dose-dependent apoptosis but this effect of berberine was not seen in non-neoplastic human prostate epithelial cells (PWR-1E). Berberine-induced apoptosis was associated with the disruption of the mitochondrial membrane potential, release of apoptogenic molecules (cytochrome c and Smac/DIABLO) from mitochondria and cleavage of caspase-9,-3 and PARP proteins. This effect of berberine on prostate cancer cells was initiated by the generation of reactive oxygen species (ROS) irrespective of their androgen responsiveness, and the generation of ROS was through the increased induction of xanthine oxidase. Treatment of cells with allopurinol, an inhibitor of xanthine oxidase, inhibited berberine-induced oxidative stress in cancer cells. Berberine-induced apoptosis was blocked in the presence of antioxidant, N-acetylcysteine, through the prevention of disruption of mitochondrial membrane potential and subsequently release of cytochrome c and Smac/DIABLO. In conclusion, the present study reveals that the berberine-mediated cell death of human prostate cancer cells is regulated by reactive oxygen species, and therefore suggests that berberine may be considered for further studies as a promising therapeutic candidate for prostate cancer.

  12. Interleukin-6: a multifunctional targetable cytokine in human prostate cancer.

    PubMed

    Culig, Zoran; Puhr, Martin

    2012-09-01

    Several cytokines are involved in regulation of cellular events in prostate cancer. Interleukin-6 (IL-6) was frequently investigated in prostate cancer models because of its increased expression in cancer tissue at early stages of the disease. In patients with metastatic prostate cancer, it is well-known that IL-6 levels increase in serum. High levels of IL-6 were measured in the supernatants of cells which do not respond to androgenic stimulation. IL-6 expression in prostate cancer increases due to enhanced expression of transforming growth factor-beta, and members of the activating protein-1 complex, and loss of the retinoblastoma tumour suppressor. IL-6 activation of androgen receptor (AR) may contribute to progression of a subgroup of prostate cancers. Results obtained with two prostate cancer cell lines, LNCaP and MDA PCa 2b, indicate that IL-6 activation of AR may cause either stimulatory or inhibitory responses on proliferation. Interestingly, prolonged treatment with IL-6 led to establishment of an IL-6 autocrine loop, suppressed signal transducer and activator of transcription (STAT)3 activation, and increased mitogen-activated protein kinase phosphorylation. In several cell lines IL-6 acts as a survival molecule through activation of the signalling pathway of phosphotidylinositol 3-kinase. Expression of suppressors of cytokine signalling (SOCS) has been studied in prostate cancer. SOCS-3 prevents phosphorylation of STAT3 and is an important anti-apoptotic factor in AR-negative prostate cancer cells. Experimental therapy against IL-6 in prostate cancer is based on the use of the monoclonal antibody siltuximab which may be used for personalised therapy coming in the future. PMID:21664423

  13. The diet as a cause of human prostate cancer.

    PubMed

    Nelson, William G; Demarzo, Angelo M; Yegnasubramanian, Srinivasan

    2014-01-01

    Asymptomatic prostate inflammation and prostate cancer have reached epidemic proportions among men in the developed world. Animal model studies implicate dietary carcinogens, such as the heterocyclic amines from over-cooked meats and sex steroid hormones, particularly estrogens, as candidate etiologies for prostate cancer. Each acts by causing epithelial cell damage, triggering an inflammatory response that can evolve into a chronic or recurrent condition. This milieu appears to spawn proliferative inflammatory atrophy (PIA) lesions, a type of focal atrophy that represents the earliest of prostate cancer precursor lesions. Rare PIA lesions contain cells which exhibit high c-Myc expression, shortened telomere segments, and epigenetic silencing of genes such as GSTP1, encoding the π-class glutathione S-transferase, all characteristic of prostatic intraepithelial neoplasia (PIN) and prostate cancer. Subsequent genetic changes, such as the gene translocations/deletions that generate fusion transcripts between androgen-regulated genes (such as TMPRSS2) and genes encoding ETS family transcription factors (such as ERG1), arise in PIN lesions and may promote invasiveness characteristic of prostatic adenocarcinoma cells. Lethal prostate cancers contain markedly corrupted genomes and epigenomes. Epigenetic silencing, which seems to arise in response to the inflamed microenvironment generated by dietary carcinogens and/or estrogens as part of an epigenetic "catastrophe" affecting hundreds of genes, persists to drive clonal evolution through metastatic dissemination. The cause of the initial epigenetic "catastrophe" has not been determined but likely involves defective chromatin structure maintenance by over-exuberant DNA methylation or histone modification. With dietary carcinogens and estrogens driving pro-carcinogenic inflammation in the developed world, it is tempting to speculate that dietary components associated with decreased prostate cancer risk, such as intake of

  14. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

  15. SPOCK1 promotes tumor growth and metastasis in human prostate cancer

    PubMed Central

    Chen, Qi; Yao, Yuan-ting; Xu, Huan; Chen, Yan-bo; Gu, Meng; Cai, Zhi-kang; Wang, Zhong

    2016-01-01

    Prostate cancer is the most diagnosed noncutaneous cancer and ranks as the second leading cause of cancer-related deaths in American males. Metastasis is the primary cause of prostate cancer mortality. Survival rate is only 28% for metastatic patients, but is nearly 100% for patients with localized prostate cancers. Molecular mechanisms that underlie this malignancy remain obscure, and this study investigated the role of SPARC/osteonectin, cwcv, and kazal-like domain proteoglycan 1 (SPOCK1) in prostate cancer progression. Initially, we found that SPOCK1 expression was significantly higher in prostate cancer tissues relative to noncancerous tissues. In particular, SPOCK1 expression was also markedly high in metastatic tissues compared with nonmetastatic cancerous tissues. SPOCK1 expression knockdown by specific short hairpin RNA in PC3 cells was significantly inhibited, whereas SPOCK1 overexpression in RWPE-1 cells promoted cell viability, colony formation in vitro, and tumor growth in vivo. Moreover, the SPOCK1 knockdown in PC3 cells was associated with cell cycle arrest in G0/G1 phase, while the SPOCK1 overexpression in RWPE-1 cells induced cell cycle arrest in S phase. The SPOCK1 knockdown in PC3 cells even increased cell apoptosis. SPOCK1 modulation was also observed to affect cancerous cell proliferation and apoptotic processes in the mouse model of prostate cancer. Additionally, the SPOCK1 knockdown decreased, whereas the SPOCK1 overexpression increased cell migration and invasion abilities in vitro. Injection of SPOCK1-depleted PC3 cells significantly decreased metastatic nodules in mouse lungs. These findings suggest that SPOCK1 is a critical mediator of tumor growth and metastasis in prostate cancer. PMID:27486308

  16. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

    PubMed

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W K; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  17. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter–Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth

    PubMed Central

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W. K.; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor–promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter–driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  18. Risk of Secondary Malignant Neoplasms From Proton Therapy and Intensity-Modulated X-Ray Therapy for Early-Stage Prostate Cancer

    SciTech Connect

    Fontenot, Jonas D.; Lee, Andrew K.; Newhauser, Wayne D.

    2009-06-01

    Purpose: To assess the risk of a secondary malignant neoplasm (SMN) from proton therapy relative to intensity-modulated radiation therapy (IMRT) using X-rays, taking into account contributions from both primary and secondary sources of radiation, for prostate cancer. Methods and Materials: A proton therapy plan and a 6-MV IMRT plan were constructed for 3 patients with early-stage adenocarcinoma of the prostate. Doses from the primary fields delivered to organs at risk of developing an SMN were determined from treatment plans. Secondary doses from the proton therapy and IMRT were determined from Monte Carlo simulations and available measured data, respectively. The risk of an SMN was estimated from primary and secondary doses on an organ-by-organ basis by use of risk models from the Committee on the Biological Effects of Ionizing Radiation. Results: Proton therapy reduced the risk of an SMN by 26% to 39% compared with IMRT. The risk of an SMN for both modalities was greatest in the in-field organs. However, the risks from the in-field organs were considerably lower with the proton therapy plan than with the IMRT plan. This reduction was attributed to the substantial sparing of the rectum and bladder from exposure to the therapeutic beam by the proton therapy plan. Conclusions: When considering exposure to primary and secondary radiation, proton therapy can reduce the risk of an SMN in prostate patients compared with contemporary IMRT.

  19. Pleiotropic roles of Notch signaling in normal, malignant, and developmental hematopoiesis in the human

    PubMed Central

    Kushwah, Rahul; Guezguez, Borhane; Lee, Jung Bok; Hopkins, Claudia I; Bhatia, Mickie

    2014-01-01

    The Notch signaling pathway is evolutionarily conserved across species and plays an important role in regulating cell differentiation, proliferation, and survival. It has been implicated in several different hematopoietic processes including early hematopoietic development as well as adult hematological malignancies in humans. This review focuses on recent developments in understanding the role of Notch signaling in the human hematopoietic system with an emphasis on hematopoietic initiation from human pluripotent stem cells and regulation within the bone marrow. Based on recent insights, we summarize potential strategies for treatment of human hematological malignancies toward the concept of targeting Notch signaling for fate regulation. PMID:25252682

  20. Bauhinia purprea agglutinin-modified liposomes for human prostate cancer treatment.

    PubMed

    Ikemoto, Keisuke; Shimizu, Kosuke; Ohashi, Kento; Takeuchi, Yoshihito; Shimizu, Motohiro; Oku, Naoto

    2016-01-01

    Bauhinia purprea agglutinin (BPA) is a well-known lectin that recognizes galactosyl glycoproteins and glycolipids. In the present study, we firstly found that BPA bound to human prostate cancer specimens but not to normal prostate ones. Therefore, we sought to develop BPA-PEG-modified liposomes (BPA-PEG-LP) encapsulating anticancer drugs for the treatment of prostate cancer. We examined the tumor targetability of BPA-PEG-LP with human prostate cancer DU145 cells, and observed that fluorescently labeled BPA-PEG-LP dominantly associated with the cells via the interaction between liposome-surface BPA and cell-surface galactosyl molecules. We also observed that BPA-PEG-LP accumulated in the prostate cancer tissue after the i.v. injection to DU145 solid cancer-bearing mice, and strongly bound to the cancer cells. In a therapeutic study, DU145 solid cancer-bearing mice were i.v. injected thrice with BPA-PEG-LP encapsulating doxorubicin (BPA-PEG-LPDOX, 2 mg/kg/day as the DOX dosage) or PEG-modified liposomes encapsulating DOX (PEG-LPDOX). As a result, BPA-PEG-LPDOX significantly suppressed the growth of the DU145 cancer cells, whereas PEG-LPDOX at the same dosage as DOX showed little anti-cancer effect. The present study suggested that BPA-PEG-LP could be a useful drug carrier for the treatment of human prostate cancers. PMID:26495901

  1. Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2015-01-01

    Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

  2. Oncolytic virotherapy for human malignant mesothelioma: recent advances

    PubMed Central

    Boisgerault, Nicolas; Achard, Carole; Delaunay, Tiphaine; Cellerin, Laurent; Tangy, Frédéric; Grégoire, Marc; Fonteneau, Jean-François

    2015-01-01

    Cancer virotherapy is an attractive alternative to conventional treatments because it offers a wide range of antitumor effects due to 1) the diversity of the oncolytic viruses that are now available and 2) their multifaceted activities against both tumor cells and tumor vessels, in addition to their ability to induce antitumor immune responses. In this review, we summarize preclinical and clinical data regarding the targeting of malignant mesothelioma (MM) by oncolytic viruses. We also discuss the potential of other oncolytic viruses that have already shown antitumor effects against several malignancies in advanced clinical trials but are yet to be tested against MM cells. Finally, we review how the activation of the immune system and combinations with other types of anticancer treatments could support the development of oncolytic virotherapy for the treatment of MM. PMID:27512676

  3. Glucocorticoid receptor antagonism reverts docetaxel resistance in human prostate cancer

    PubMed Central

    Kroon, Jan; Puhr, Martin; Buijs, Jeroen T; van der Horst, Geertje; Hemmer, Daniëlle M; Marijt, Koen A; Hwang, Ming S; Masood, Motasim; Grimm, Stefan; Storm, Gert; Metselaar, Josbert M; Meijer, Onno C; Culig, Zoran; van der Pluijm, Gabri

    2016-01-01

    Resistance to docetaxel is a major clinical problem in advanced prostate cancer (PCa). Although glucocorticoids (GCs) are frequently used in combination with docetaxel, it is unclear to what extent GCs and their receptor, the glucocorticoid receptor (GR), contribute to the chemotherapy resistance. In this study, we aim to elucidate the role of the GR in docetaxel-resistant PCa in order to improve the current PCa therapies. GR expression was analyzed in a tissue microarray of primary PCa specimens from chemonaive and docetaxel-treated patients, and in cultured PCa cell lines with an acquired docetaxel resistance (PC3-DR, DU145-DR, and 22Rv1-DR). We found a robust overexpression of the GR in primary PCa from docetaxel-treated patients and enhanced GR levels in cultured docetaxel-resistant human PCa cells, indicating a key role of the GR in docetaxel resistance. The capability of the GR antagonists (RU-486 and cyproterone acetate) to revert docetaxel resistance was investigated and revealed significant resensitization of docetaxel-resistant PCa cells for docetaxel treatment in a dose- and time-dependent manner, in which a complete restoration of docetaxel sensitivity was achieved in both androgen receptor (AR)-negative and AR-positive cell lines. Mechanistically, we demonstrated down-regulation of Bcl-xL and Bcl-2 upon GR antagonism, thereby defining potential treatment targets. In conclusion, we describe the involvement of the GR in the acquisition of docetaxel resistance in human PCa. Therapeutic targeting of the GR effectively resensitizes docetaxel-resistant PCa cells. These findings warrant further investigation of the clinical utility of the GR antagonists in the management of patients with advanced and docetaxel-resistant PCa. PMID:26483423

  4. (3H)bunazosin, a novel selective radioligand of alpha 1 adrenoceptors in human prostates

    SciTech Connect

    Yamada, S.; Suzuki, M.; Matsuoka, Y.; Kato, Y.; Kimura, R.; Maruyama, M.; Kawabe, K. )

    1991-09-01

    The binding properties of a new radioligand, (3H)bunazosin, were studied in membranes of human prostates with benign prostatic hypertrophy (BPH). Specific binding of (3H)bunazosin was saturable, reversible, and of high affinity (Kd = 0.55 {plus minus} 0.04 nM). The density of (3H)bunazosin binding sites (Bmax) was 676 {plus minus} 33 fmol/mg. protein. (3H)Bunazosin rapidly associated with its binding sites in membranes of human prostates and reached steady state by 20 min. at 25C. The rate constants for association and dissociation of (3H)bunazosin binding were calculated to be 0.11 {plus minus} 0.01/nM/min. and 0.05 {plus minus} 0.02/min. (n = 4), respectively. Seven alpha 1 adrenoceptor antagonists competed with (3H)bunazosin for the binding sites in the rank order: R-(-)-YM-12617 greater than prazosin greater than SGB-1534 greater than bunazosin greater than terazosin greater than naftopidil greater than urapidil. In parallel studies with (3H)bunazosin, the Kd and Bmax values for (3H)prazosin binding in human prostates were slightly lower. There was a similarity in the potency and rank order of seven alpha 1, adrenoceptor antagonists for the inhibition of (3H) bunazosin and (3H)prazosin binding in human prostates. The new (3H)bunazosin binding assay in human prostates is remarkable for its low degree of nonspecific binding as compared to (3H)prazosin, especially at high ligand concentrations. Thus, (3H)bunazosin may become a useful radioligand for the further analysis of the alph 1 adrenoceptor binding sites in human prostates.

  5. Alterations in replication timing of cancer-related genes in malignant human breast cancer cells.

    PubMed

    Fritz, Andrew; Sinha, Seema; Marella, Narasimharao; Berezney, Ronald

    2013-05-01

    The replication timing of nine genes commonly involved in cancer was investigated in the MCF10 cell lines for human breast cancer progression. Six of these nine genes are part of a constellation of tumor suppressor genes that play a major role in familial human breast cancer (TP53, ATM, PTEN, CHK2, BRCA1, and BRCA2). Three other genes are involved in a large number of human cancers including breast as either tumor suppressors (RB1 and RAD51) or as an oncogene (cMYC). Five of these nine genes (TP53, RAD51, ATM, PTEN, and cMYC) show significant differences (P < 0.05) in replication timing between MCF10A normal human breast cells and the corresponding malignant MCF10CA1a cells. These differences are specific to the malignant state of the MCF10CA1a cells since there were no significant differences in the replication timing of these genes between normal MCF10A cells and the non-malignant cancer MCF10AT1 cells. Microarray analysis further demonstrated that three of these five genes (TP53, RAD51, and cMYC) showed significant changes in gene expression (≥2-fold) between normal and malignant cells. Our findings demonstrate an alteration in the replication timing of a small subset of cancer-related genes in malignant breast cancer cells. These alterations partially correlate with the major transcriptional changes characteristic of the malignant state in these cells. PMID:23161755

  6. Expression and functional study of estrogen receptor-related receptors in human prostatic cells and tissues.

    PubMed

    Cheung, C P; Yu, Shan; Wong, K B; Chan, L W; Lai, Fernand M M; Wang, Xianghong; Suetsugi, Masatomo; Chen, Shiuan; Chan, Franky L

    2005-03-01

    Estrogen receptor-related receptors (ERRs; alpha, beta, gamma) are orphan nuclear receptors and constitutively active without binding to estrogen. Like estrogen receptors (ERs), ERRs bind to estrogen receptor elements and estrogen receptor element-related repeats. Growing evidence suggests that ERRs can cross-talk with ERs in different cell types via competition for DNA sites and coactivators. We hypothesize that ERRs might play regulatory roles in normal and neoplastic prostatic cells by sharing similar ER-mediated pathways or acting independently. In this study, we investigated mRNA and protein expression patterns of three ERR members in normal human prostate epithelial cells, established cell lines, cancer xenografts, and prostatic tissues. Additionally, effects of transient transfection of ERRs on prostatic cell proliferation and ER expression were also examined. RT-PCR showed that ERRalpha and ERRgamma transcripts were detected in most cell lines and xenografts, whereas ERRbeta was detected in normal epithelial cells and few immortalized cell lines but not in most cancer lines. Similar results were demonstrated in clinical prostatic specimens. Western blottings and immunohistochemistry confirmed similar expression patterns that ERR proteins were detected as nuclear proteins in epithelial cells, whereas their expressions became reduced or undetected in neoplastic prostatic cells. Transient transfection confirmed that ERRs were expressed in prostatic cells as nuclear proteins and transcriptionally active in the absence of estradiol. Transfection results showed that overexpression of ERRs inhibited cell proliferation and repressed ERalpha transcription in PC-3 cells. Our study shows that ERRs, which are coexpressed with ERs in prostatic cells, could regulate cell growth and modulate ER-mediated pathways via interference on ERalpha transcription in prostatic cells. PMID:15598686

  7. Hormonal modulation of invitro biosynthesis of inhibin like peptide by human prostate.

    PubMed

    Vanage, G R; Phadke, M A; Bandivdekar, A H; Sheth, A R

    1990-01-01

    The hormonal regulation of inhibin biosynthesis by human benign hyperplastic prostate tissue was studied by determining the incorporation of 3H-leucine. 3H-inhibin, synthesized de novo, was immunoprecipitated from the culture media using specific antibodies to human prostatic inhibin. Testosterone and estradiol had no effect on inhibin biosynthesis whereas hFSH and PMSG had stimulatory effect. A decrease in inhibin biosynthesis was noticed on the addition of LHRH, TRH, hCG, hLH and human prolactin. PMID:2126421

  8. Malignancies in human immunodeficiency virus infected patients in India: Initial experience in the HAART era

    PubMed Central

    Sharma, Surendra K.; Soneja, Manish; Ranjan, Sanjay

    2015-01-01

    Background & objectives: Limited data are available on malignancies in human immunodeficiency virus (HIV)-infected patients from India. We undertook this study to assess the frequency and spectrum of malignancies in HIV-infected adult patients during the first eight years of highly active antiretroviral therapy (HAART) rollout under the National ART Programme at a tertiary care centre in New Delhi, India. Methods: Retrospective analysis of records of patients registered at the ART clinic between May 2005 and December 2013 was done. Results: The study included 2598 HIV-infected adult patients with 8315 person-years of follow up. Malignancies were diagnosed in 26 patients with a rate of 3.1 (IQR 2.1-4.5) cases per 1000 person-years. The median age for those diagnosed with malignancy was 45 (IQR 36-54) yr, which was significantly (P<0.01) higher compared with those not developing malignancies 35 (IQR 30-40) yr. The median baseline CD4+ T-cell count in patients with malignancy was 135 (IQR 68-269) cells/µl compared to 164 (IQR 86-243) cells/µl in those without malignancies. AIDS-defining cancers (ADCs) were seen in 19 (73%) patients, while non-AIDS-defining cancers (NADCs) were observed in seven (27%) patients. Malignancies diagnosed included non-Hodgkin's lymphoma (16), carcinoma cervix (3), Hodgkin's lymphoma (2), carcinoma lung (2), hepatocellular carcinoma (1), and urinary bladder carcinoma (1). One patient had primary central nervous system lymphoma. There was no case of Kaposi's sarcoma. Interpretation & conclusions: Malignancies in HIV-infected adult patients were infrequent in patients attending the clinic. Majority of the patients presented with advanced immunosuppression and the ADCs, NHL in particular, were the commonest malignancies. PMID:26658591

  9. Targeting eradication of malignant cells derived from human bone marrow mesenchymal stromal cells

    SciTech Connect

    Yang, Yingbin; Cai, Shaoxi; Yang, Li; Yu, Shuhui; Jiang, Jiahuan; Yan, Xiaoqing; Zhang, Haoxing; Liu, Lan; Liu, Qun; Du, Jun; Cai, Shaohui; Sung, K.L. Paul

    2010-12-10

    Human bone marrow mesenchymal stromal cells (hBMSC) have been shown to participate in malignant transformation. However, hampered by the low frequency of malignant transformation of hBMSC, we do not yet know how to prevent malignant transformation of implanted hBMSC. In this study, in order to establish a model for the eradication of hBMSC-derived malignant cells, a gene fusion consisting of a human telomerase (hTERT) promoter modified with both c-Myc and myeloid zinc finger protein2 (MZF-2) binding elements and followed by the E. coli cytosine deaminase (CD) and luciferase genes was stably transferred into hBMSC via lentiviral transduction; n-phosphonacelyl-L-aspartic acid (PALA) selection was used to generate malignant cell colonies derived from transduced hBMSC after treatment with the carcinogenic reagent BPDE. Cells that were amplified after PALA selection were used for transplantation and 5-FC pro-drug cytotoxicity tests. The results showed that PALA-resistant malignant cells could be generated from hBMSC co-induced with lentiviral transduction and treatment with Benzo(a)pyrene Diol Epoxide (BPDE); the modification of c-Myc and MZF-2 binding elements could remarkably enhance the transcriptional activities of the hTERT promoter in malignant cells, whereas transcriptional activity was depressed in normal hBMSC; malignant cells stably expressing CD under the control of the modified hTERT promoter could be eliminated by 5-FC administration. This study has provided a method for targeted eradication of malignant cells derived from hBMSC.

  10. Preliminary report on the correlations among pineal concretions, prostatic calculi and age in human adult males.

    PubMed

    Mori, Ryoichi; Kodaka, Tetsuo; Sano, Tsuneyoshi

    2003-09-01

    By using quantitative image analysis of soft X-ray photographs on the bulk of extracted pineal glands and prostates, we made a preliminary investigation into the correlations among pineal concretions (% by mass), prostatic calculi (% by mass) and age (years) in 40 human adult males, ranging in age from 31 to 95 years (mean (+/-SD) 69.9 +/- 15.2 years), who died and underwent the routine dissection course. The mass concentrations of pineal concretions and prostatic calculi were 17.68 +/- 13.56% (range 0-51.34%) and 0.93 +/- 1.31% (range 0-5.82%), respectively. There was no correlation between the mass concentration of pineal concretions and aging (r = 0.03; P < 1.0). There was no correlation between mass concentration of prostatic calculi and aging (r = 0.28; P < 0.5). No pineal concretions and no prostatic calculi were observed in seven and 10 cases, respectively; in addition, in one case, neither-concretions nor calculi were seen. From such data and from the previously reported suggestion on the counteracting functions between the pineal gland and prostate, a negative correlation between the mass concentrations of pineal concretions and prostatic calculi was expected. This was certainly obtained, but the correlation was low (r = -0.39; P < 0.05). Such a low correlation and no correlations between the concentrations of pineal concretions and aging or between prostatic calculi and aging may have been caused by the examination of relatively older humans. Therefore, further investigations using a number of pair samples collected from males including younger age generations will be necessary. PMID:14527133

  11. Inhibition of smooth muscle force generation by focal adhesion kinase inhibitors in the hyperplastic human prostate.

    PubMed

    Kunit, Thomas; Gratzke, Christian; Schreiber, Andrea; Strittmatter, Frank; Waidelich, Raphaela; Rutz, Beata; Loidl, Wolfgang; Andersson, Karl-Erik; Stief, Christian G; Hennenberg, Martin

    2014-10-01

    Smooth muscle contraction may be critical for lower urinary tract symptoms (LUTS) in patients with benign prostate hyperplasia and requires stable anchorage of the cytoskeleton to the cell membrane. These connections are regulated by focal adhesion kinase (FAK). Here, we addressed the involvement of FAK in the regulation of smooth muscle contraction in hyperplastic human prostate tissues. Prostate tissues were obtained from radical prostatectomy. Expression of FAK and focal adhesion proteins was assessed by Western blot analysis and immunohistochemical stainings. Effects of the FAK inhibitors PF-573228 and Y-11 on contraction of prostate strips were examined in the organ bath. Expression of FAK and focal adhesion proteins (integrin-5α, paxilin, and c-Src) was detected by Western blot analysis in prostate samples. By double immunofluorescence staining with calponin and pan-cytokeratin, expression of FAK was observed in stromal and epithelial cells. Immunoreactivity for FAK colocalized with integrin-5α, paxilin, talin, and c-Src. Stimulation of prostate tissues with the α1-adrenergic agonist phenylephrine increased the phosphorylation state of FAK at Tyr³⁹⁷ and Tyr⁹²⁵ with different kinetics, which was blocked by the α1-adrenoceptor antagonist tamsulosin. Norepinephrine and phenylephrine induced concentration-dependent contractions of prostate strips. Both FAK inhibitors PF-573228 and Y-11 significantly inhibited norepinephrine- and phenylephrine-induced contractions. Finally, PF-573228 and Y-11 inhibited contractions induced by electric field stimulation, which was significant at the highest frequency. In conclusion, α1-adrenergic smooth muscle contraction or its regulation involves FAK in the human prostate. Consequently, FAK may be involved in the pathophysiology of LUTS and in current or future LUTS therapies. PMID:25056351

  12. Down-regulation of malignant potential by alpha linolenic acid in human and mouse colon cancer cells.

    PubMed

    Chamberland, John P; Moon, Hyun-Seuk

    2015-03-01

    Omega-3 fatty acids (also called ω-3 fatty acis or n-3 fatty acid) are polyunsaturated fatty acids (PUFAs) with a double bond (C=C) at the third carbon atom from the end of the carbon chain. Numerous test tube and animal studies have shown that omega-3 fatty acids may prevent or inhibit the growth of cancers, suggesting that omega-3 fatty acids are important in cancer physiology. Alpha-linolenic acid (ALA) is one of an essential omega-3 fatty acid and organic compound found in seeds (chia and flaxseed), nuts (notably walnuts), and many common vegetable oils. ALA has also been shown to down-regulate cell proliferation of prostate, breast, and bladder cancer cells. However, direct evidence that ALA suppresses to the development of colon cancer has not been studied. Also, no previous studies have evaluated whether ALA may regulate malignant potential (adhesion, invasion and colony formation) in colon cancer cells. In order to address the questions above, we conducted in vitro studies and evaluated whether ALA may down-regulate malignant potential in human (HT29 and HCT116) and mouse (MCA38) colon cancer cell lines. We observed that treatment with 1-5 mM of ALA inhibits cell proliferation, adhesion and invasion in both human and mouse colon cancer cell lines. Interestingly, we observed that ALA did not decrease total colony numbers when compared to control. By contrast, we found that size of colony was significantly changed by ALA treatment when compared to control in all colon cancer cell lines. We suggest that our data enhance our current knowledge of ALA's mechanism and provide crucial information to further the development of new therapies for the management or chemoprevention of colon cancer. PMID:25336096

  13. Suppression of human prostate cancer cell growth by alpha1-adrenoceptor antagonists doxazosin and terazosin via induction of apoptosis.

    PubMed

    Kyprianou, N; Benning, C M

    2000-08-15

    Recent evidence from our laboratory has demonstrated that alpha1-adrenoceptor antagonists doxazosin and terazosin induced apoptosis in prostate epithelial and smooth muscle cells in patients with benign prostatic hypertrophy (BPH; J. Urol., 159: 1810-1815, 1998; J. Urol., 161: 2002-2007, 1999). In this study, we investigated the biological action of three alpha1-adrenoceptor antagonists, doxazosin, terazosin, and tamsulosin, against prostate cancer cell growth. The antigrowth effect of the three alpha1-adrenoceptor antagonists was examined in two human prostate cancer cell lines, PC-3 and DU-145, and a prostate smooth muscle cell primary culture, SMC-1, on the basis of: (a) cell viability assay; (b) rate of DNA synthesis; and (c) induction of apoptosis. Our results indicate that treatment of prostate cancer cells with doxazosin or terazosin results in a significant loss of cell viability, via induction of apoptosis in a dose-dependent manner, whereas tamsulosin had no effect on prostate cell growth. Neither doxazosin nor terazosin exerted a significant effect on the rate of cell proliferation in prostate cancer cells. Exposure to phenoxybenzamine, an irreversible inhibitor of alpha1-adrenoceptors, does not abrogate the apoptotic effect of doxazosin or terazosin against human prostate cancer or smooth muscle cells. This suggests that the apoptotic activity of doxazosin and terazosin against prostate cells is independent of their capacity to antagonize alpha1-adrenoceptors. Furthermore, an in vivo efficacy trial demonstrated that doxazosin administration (at tolerated pharmacologically relevant doses) in SCID mice bearing PC-3 prostate cancer xenografts resulted in a significant inhibition of tumor growth. These findings demonstrate the ability of doxazosin and terazosin (but not tamsulosin) to suppress prostate cancer cell growth in vitro and in vivo by inducing apoptosis without affecting cell proliferation. This evidence provides the rationale for targeting both

  14. Penetration of piperacillin-tazobactam into human prostate tissue and dosing considerations for prostatitis based on site-specific pharmacokinetics and pharmacodynamics.

    PubMed

    Kobayashi, Ikuo; Ikawa, Kazuro; Nakamura, Kogenta; Nishikawa, Genya; Kajikawa, Keishi; Yoshizawa, Takahiko; Watanabe, Masahito; Kato, Yoshiharu; Zennami, Kenji; Kanao, Kent; Tobiume, Motoi; Yamada, Yoshiaki; Mitsui, Kenji; Narushima, Masahiro; Morikawa, Norifumi; Sumitomo, Makoto

    2015-08-01

    This study aimed to investigate the penetration of PIPC-TAZ into human prostate, and to assess effectiveness of PIPC-TAZ against prostatitis by evaluating site-specific PK-PD. Patients with prostatic hypertrophy (n = 47) prophylactically received a 0.5 h infusion of PIPC-TAZ (8:1.2-0.25 g or 4-0.5 g) before transurethral resection of the prostate. PIPC-TAZ concentrations in plasma (0.5-5 h) and prostate tissue (0.5-1.5 h) were analyzed with a three-compartment PK model. The estimated model parameters were, then used to estimate the drug exposure time above the minimum inhibitory concentration for bacteria (T > MIC, the PD indicator for antibacterial effects) in prostate tissue for six PIPC-TAZ regimens (2.25 or 4.5 g; once, twice, three times or four times daily; 0.5 h infusions). Prostate tissue/plasma ratio of PIPC was about 36% both for the maximum drug concentration (Cmax) and the area under the drug concentration-time curve (AUC). Against MIC distributions for isolates of Escherichia coli, Klebsiella species and Proteus species, regimens of 4.5 g twice daily and 2.25 g three times daily achieved a >90% probability of attaining the bacteriostatic target for PIPC (30% T > MIC) in prostate tissue; regimens of 4.5 g three times daily and 2.25 g four times daily achieved a >90% probability of attaining the bactericidal target for PIPC (50% T > MIC) in prostate tissue. However, against Pseudomonas aeruginosa isolates, none of the tested regimens achieved a >90% probability. PIPC-TAZ is appropriate for the treatment of prostatitis from the site-specific PK-PD perspective. PMID:26050020

  15. A case-cohort study of human herpesvirus 8 seropositivity and incident prostate cancer in Tobago

    PubMed Central

    2011-01-01

    Background We previously reported a cross-sectional association between the presence of human herpesvirus 8 (HHV-8) serum antibodies and screen-detected prostate cancer in men living in Tobago. In the same study population, we examined the association between HHV-8 seropositivity and incident prostate cancer discovered at later screenings. Methods In 40-81 year-old men without prostate cancer discovered at initial digital rectal examination (DRE) and prostate-specific antigen (PSA) screening, a case-cohort design measured the association between baseline HHV-8 seropositivity (modified immunofluorescence assay for antibodies against HHV-8 lytic antigens) and incident prostate cancer detected at DRE and PSA screenings three or five years later. Results Analyses included 486 unique individuals, 96 incident prostate cancer cases, and 415 randomly selected subjects representing an at-risk cohort. By design, the random sub-cohort contained 25 incident prostate cancer cases. In the sub-cohort, the frequency of HHV-8 seropositivity increased across age groupings (40-49 years: 3.5%, 50-59 years: 13.6%, and ≥ 60 years: 22.9%). HHV-8 seropositivity was higher in men with elevated (≥ 4.0 ng/mL) than men with non-elevated PSA at initial screening (30.4% vs. 9.9% seropositive; crude odds ratio (OR) 3.96, 95% confidence interval (CI) 1.53-10.2; age-adjusted OR 2.42, 95% CI 0.91-6.47). HHV-8 seropositivity did not increase incident prostate cancer risk (age-adjusted hazard ratio (HR) 0.88, 95% CI 0.46-1.69). Conclusions Case-cohort analysis did not identify association between HHV-8 seropositivity and incident prostate cancer. However, analyses uncovered possible association between HHV-8 and PSA (a marker of prostate inflammation). Co-occurrence of HHV-8 seropositivity and PSA elevation may explain cross-sectional association between HHV-8 and PSA screen-detected prostate cancer. PMID:22151996

  16. Neuroanatomical Study of Periprostatic Nerve Distributions Using Human Cadaver Prostate

    PubMed Central

    Sung, Wooseuk; Lee, Sun; Park, Yong-Koo

    2010-01-01

    We investigated the distribution and navigation of periprostatic nerve fibers and constructed a 3-dimensional model of nerve distribution. A total of 5 cadaver specimens were serially sectioned in a transverse direction with 0.5 cm intervals. Hematoxylineosin staining and immunohistochemical staining were then performed on whole-mount sections. Three representative slides from the base, mid-part, and apex of each prostate were subsequently divided into 4 sectors: two lateral, one ventral, and one dorsal (rectal) part. The number of nerve fibers, the distance from nerve fiber to prostate capsule, and the nerve fiber diameters were analyzed on each sector from the representative slides by microscopy. Periprostatic nerve fibers revealed a relatively even distribution in both lateral and dorsal parts of the prostate. There was no difference in the distances from the prostate capsule to nerve fibers. Nerve fibers in the ventral area were also thinner as compared to other areas. In conclusion, periprostatic nerve fibers were observed to be distributed evenly in the periprostatic area, with the exception of the ventral area. As the number of nerve fibers on the ventral part is fewer in comparison, an excessive high up incision is insignificant during the nerve-sparing radical prostatectomy. PMID:20358006

  17. Role of hormonal and other factors in human prostate cancer.

    PubMed

    Wigle, Donald T; Turner, Michelle C; Gomes, James; Parent, Marie-Elise

    2008-03-01

    American men have a lifetime risk of about 18% for prostate cancer diagnosis. Large international variations in prostate cancer risks and increased risks among migrants from low- to high-risk countries indicate important roles for environmental factors. Major known risk factors include age, family history, and country/ethnicity. Type 2 diabetes appears to reduce risk, while high birth weight and adult height are linked to increased risk of aggressive prostate cancer. Limited evidence supports an association with a history of sexually transmitted infections. A previous meta-analysis of eight cohort studies indicated no associations with plasma androgen, estrogen, or sex hormone binding globulin (SHBG) levels. However, there were dose-response relationships with baseline plasma testosterone levels in two studies that adjusted for other serum hormones and obesity. Finasteride (a drug that blocks testosterone activation) reduced prostate cancer risk by 25%. Low-frequency genes linked to familial prostate cancer only explain a small fraction of all cases. Sporadic cases were linked to relatively common polymorphisms of genes involved in (1) androgen synthesis, activation, inactivation and excretion, (2) hormone and vitamin D receptors, (3) carcinogen metabolism, and (4) DNA repair. Epidemiologic evidence supports protective roles for dietary selenium, vitamin E, pulses, tomatoes/lycopene, and soy foods, and high plasma 1,25-dihydroxyvitamin D levels. There is inadequate evidence that vegetables, fruit, carotenoids, and vitamins A and C reduce risk and that animal fat, alpha-linoleic acid, meat, coffee, and tea increase risk. Two major cohort studies found dose-response relationships with dietary calcium intake. Total dietary energy intake may enhance risk. Limited evidence supports a protective role for physical activity and elevated risk for farmers and other men with occupational pesticide exposure, particularly to organochlorine compounds and phenoxy herbicides

  18. Development of a Preclinical Orthotopic Xenograft Model of Ewing Sarcoma and Other Human Malignant Bone Disease Using Advanced In Vivo Imaging

    PubMed Central

    Batey, Michael A.; Almeida, Gilberto S.; Wilson, Ian; Dildey, Petra; Sharma, Abhishek; Blair, Helen; Hide, I. Geoff; Heidenreich, Olaf; Vormoor, Josef; Maxwell, Ross J.; Bacon, Chris M.

    2014-01-01

    Ewing sarcoma and osteosarcoma represent the two most common primary bone tumours in childhood and adolescence, with bone metastases being the most adverse prognostic factor. In prostate cancer, osseous metastasis poses a major clinical challenge. We developed a preclinical orthotopic model of Ewing sarcoma, reflecting the biology of the tumour-bone interactions in human disease and allowing in vivo monitoring of disease progression, and compared this with models of osteosarcoma and prostate carcinoma. Human tumour cell lines were transplanted into non-obese diabetic/severe combined immunodeficient (NSG) and Rag2−/−/γc−/− mice by intrafemoral injection. For Ewing sarcoma, minimal cell numbers (1000–5000) injected in small volumes were able to induce orthotopic tumour growth. Tumour progression was studied using positron emission tomography, computed tomography, magnetic resonance imaging and bioluminescent imaging. Tumours and their interactions with bones were examined by histology. Each tumour induced bone destruction and outgrowth of extramedullary tumour masses, together with characteristic changes in bone that were well visualised by computed tomography, which correlated with post-mortem histology. Ewing sarcoma and, to a lesser extent, osteosarcoma cells induced prominent reactive new bone formation. Osteosarcoma cells produced osteoid and mineralised “malignant” bone within the tumour mass itself. Injection of prostate carcinoma cells led to osteoclast-driven osteolytic lesions. Bioluminescent imaging of Ewing sarcoma xenografts allowed easy and rapid monitoring of tumour growth and detection of tumour dissemination to lungs, liver and bone. Magnetic resonance imaging proved useful for monitoring soft tissue tumour growth and volume. Positron emission tomography proved to be of limited use in this model. Overall, we have developed an orthotopic in vivo model for Ewing sarcoma and other primary and secondary human bone malignancies, which

  19. Fangchinoline induced G1/S arrest by modulating expression of p27, PCNA, and cyclin D in human prostate carcinoma cancer PC3 cells and tumor xenograft.

    PubMed

    Wang, Chang-Dong; Huang, Jian-Guo; Gao, Xuan; Li, Yi; Zhou, Shi-Yi; Yan, Xu; Zou, An; Chang, Jun-Li; Wang, Yue-Sheng; Yang, Guang-Xiao; He, Guang-Yuan

    2010-01-01

    Prostate cancer (PCA) is the most common invasive malignancy and the second leading cause of cancer-related death in males. The present study investigated the effects of fangchinoline (Fan), an important compound in Stephania Tetradra S. Moore (Fenfangji) with pain-relieving, blood pressure-depressing, and antibiotic activities, on human PCA. It was found that Fan inhibited human prostate cancer cell lines (PC3) cell proliferation in a dose- and time-dependent manner. Studies of cell-cycle progression showed that the anti-proliferative effect of Fan was associated with an increase in the G1/S phase of PC3 cells. Western blot results indicated that Fan-induced G1/S phase arrest was mediated through inhibition of cyclin-regulated signaling pathways. Fan induced p27 expression and inhibited cyclin D and proliferating cell nuclear antigen (PCNA) expression in PC3 cells. Increased exposure time to Fan caused apoptosis of PC3 cells, which was associated with up-regulation of pro-apoptotic proteins Bax and caspase 3, and down-regulation of anti-apoptotic protein Bcl-2. Furthermore, Fan had anti-tumorigenic activity in vivo, including reduction of tumor volume and pro-apoptotic and anti-proliferative effects in a PC3 nude mouse xenograft. Taking all this together, it can be concluded that Fan is an effective anti-proliferative agent that modulates cell growth regulators in prostate cancer cells. PMID:20208355

  20. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer

    PubMed Central

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-01-01

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  1. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer.

    PubMed

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-02-12

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  2. The Androgen Receptor Regulates PPARγ Expression and Activity in Human Prostate Cancer Cells.

    PubMed

    Olokpa, Emuejevoke; Bolden, Adrienne; Stewart, LaMonica V

    2016-12-01

    The peroxisome proliferator activated receptor gamma (PPARγ) is a ligand-activated transcription factor that regulates growth and differentiation within normal prostate and prostate cancers. However the factors that control PPARγ within the prostate cancers have not been characterized. The goal of this study was to examine whether the androgen receptor (AR) regulates PPARγ expression and function within human prostate cancer cells. qRT-PCR and Western blot analyses revealed nanomolar concentrations of the AR agonist dihydrotestosterone (DHT) decrease PPARγ mRNA and protein within the castration-resistant, AR-positive C4-2 and VCaP human prostate cancer cell lines. The AR antagonists bicalutamide and enzalutamide blocked the ability of DHT to reduce PPARγ levels. In addition, siRNA mediated knockdown of AR increased PPARγ protein levels and ligand-induced PPARγ transcriptional activity within the C4-2 cell line. Furthermore, proteasome inhibitors that interfere with AR function increased the level of basal PPARγ and prevented the DHT-mediated suppression of PPARγ. These data suggest that AR normally functions to suppress PPARγ expression within AR-positive prostate cancer cells. To determine whether increases in AR protein would influence PPARγ expression and activity, we used lipofectamine-based transfections to overexpress AR within the AR-null PC-3 cells. The addition of AR to PC-3 cells did not significantly alter PPARγ protein levels. However, the ability of the PPARγ ligand rosiglitazone to induce activation of a PPARγ-driven luciferase reporter and induce expression of FABP4 was suppressed in AR-positive PC-3 cells. Together, these data indicate AR serves as a key modulator of PPARγ expression and function within prostate tumors. J. Cell. Physiol. 231: 2664-2672, 2016. © 2016 Wiley Periodicals, Inc. PMID:26945682

  3. Examination of CK2α and NF-κB p65 expression in human benign prostatic hyperplasia and prostate cancer tissues.

    PubMed

    Qaiser, Fatima; Trembley, Janeen H; Sadiq, Sarah; Muhammad, Iqbal; Younis, Rubina; Hashmi, Shoaib Naiyar; Murtaza, Badar; Rector, Thomas S; Naveed, Abdul Khaliq; Ahmed, Khalil

    2016-09-01

    Protein kinase CK2 plays a critical role in cell growth, proliferation, and suppression of cell death. CK2 is overexpressed, especially in the nuclear compartment, in the majority of cancers, including prostate cancer (PCa). CK2-mediated activation of transcription factor nuclear factor kappa B (NF-κB) p65 is a key step in cellular proliferation, resulting in translocation of NF-κB p65 from the cytoplasm to the nucleus. As CK2 expression and activity are also elevated in benign prostatic hyperplasia (BPH), we sought to increase the knowledge of CK2 function in benign and malignant prostate by examination of the relationships between nuclear CK2 and nuclear NF-κB p65 protein expression. The expression level and localization of CK2α and NF-κB p65 proteins in PCa and BPH tissue specimens was determined. Nuclear CK2α and NF-κB p65 protein levels are significantly higher in PCa compared with BPH, and these proteins are positively correlated with each other in both diseases. Nuclear NF-κB p65 levels correlated with Ki-67 or with cytoplasmic NF-κB p65 expression in BPH, but not in PCa. The findings provide information that combined analysis of CK2α and NF-κB p65 expression in prostate specimens relates to the disease status. Increased nuclear NF-κB p65 expression levels in PCa specifically related to nuclear CK2α levels, indicating a possible CK2-dependent relationship in malignancy. In contrast, nuclear NF-κB p65 protein levels related to both Ki-67 and cytoplasmic NF-κB p65 levels exclusively in BPH, suggesting a potential separate impact for NF-κB p65 function in proliferation for benign disease as opposed to malignant disease. PMID:27435858

  4. Percentage of Biopsy Cores Positive for Malignancy and Biochemical Failure Following Prostate Cancer Radiotherapy in 3,264 Men: Statistical Significance Without Predictive Performance

    SciTech Connect

    Williams, Scott G. Buyyounouski, Mark K.; Pickles, Tom; Kestin, Larry; Martinez, Alvaro; Hanlon, Alexandra L.; Duchesne, Gillian M.

    2008-03-15

    Purpose: To define and incorporate the impact of the percentage of positive biopsy cores (PPC) into a predictive model of prostate cancer radiotherapy biochemical outcome. Methods and Materials: The data of 3264 men with clinically localized prostate cancer treated with external beam radiotherapy at four institutions were retrospectively analyzed. Standard prognostic and treatment factors plus the number of biopsy cores collected and the number positive for malignancy by transrectal ultrasound-guided biopsy were available. The primary endpoint was biochemical failure (bF, Phoenix definition). Multivariate proportional hazards analyses were performed and expressed as a nomogram and the model's predictive ability assessed using the concordance index (c-index). Results: The cohort consisted of 21% low-, 51% intermediate-, and 28% high-risk cancer patients, and 30% had androgen deprivation with radiotherapy. The median PPC was 50% (interquartile range [IQR] 29-67%), and median follow-up was 51 months (IQR 29-71 months). Percentage of positive biopsy cores displayed an independent association with the risk of bF (p = 0.01), as did age, prostate-specific antigen value, Gleason score, clinical stage, androgen deprivation duration, and radiotherapy dose (p < 0.001 for all). Including PPC increased the c-index from 0.72 to 0.73 in the overall model. The influence of PPC varied significantly with radiotherapy dose and clinical stage (p = 0.02 for both interactions), with doses <66 Gy and palpable tumors showing the strongest relationship between PPC and bF. Intermediate-risk patients were poorly discriminated regardless of PPC inclusion (c-index 0.65 for both models). Conclusions: Outcome models incorporating PPC show only minor additional ability to predict biochemical failure beyond those containing standard prognostic factors.

  5. Prostate biopsy

    MedlinePlus

    Prostate gland biopsy; Transrectal prostate biopsy; Fine needle biopsy of the prostate; Core biopsy of the prostate; Targeted prostate biopsy; Prostate biopsy - transrectal ultrasound (TRUS); Stereotactic ...

  6. Deleted in liver cancer protein family in human malignancies (Review)

    PubMed Central

    Lukasik, D.; Wilczek, E.; Wasiutynski, A.; Gornicka, B.

    2011-01-01

    The Deleted in Liver Cancer (DLC) protein family comprises proteins that exert their function mainly by the Rho GTPase-activating protein (GAP) domain and by regulation of the small GTPases. Since Rho GTPases are key factors in cell proliferation, polarity, cytoskeletal remodeling and migration, the aberrant function of their regulators may lead to cell transformation. One subgroup of these proteins is the DLC family. It was found that the first identified gene from this family, DLC1, is often lost in hepatocellular carcinoma and may be involved as a tumor suppressor in the liver. Subsequent studies evaluated the hypothesis that the DLC1 gene acts as a tumor suppressor, not only in liver cancer, but also in other types of cancer. Following DLC1, two other members of the DLC protein family, DLC2 and DLC3, were identified. However, limited published data are available concerning the role of these proteins in malignant transformation. This review focuses on the structure and the role of DLC1 and its relatives in physiological conditions and summarizes data published thus far regarding DLC function in the neoplastic process. PMID:22866123

  7. Native cellular fluorescence characteristics of normal and malignant epithelial cells from human larynx

    NASA Astrophysics Data System (ADS)

    Parmeswearan, Diagaradjane; Ganesan, Singaravelu; Nalini, R.; Aruna, Prakasa R.; Veeraganesh, V.; Alfano, Robert R.

    1997-08-01

    Many applications of native fluorescence spectroscopy of intrinsic biomolecules such as Try, Tyr, Phe, NADH and FAD are reported on both the characterization and the discrimination of malignant tissues from the normal. In the field of diagnostic oncology, extensive studies have been made to distinguish the normal from malignant condition in breast, cervix, colon and bronchus. From the studies made by Alfano and co-workers, it was found that the emission at 340 and 440 nm under UV excitation have shown statistically significant difference between normal and malignant tissues. As tissues are highly complex in nature, it is worth to known whether the changes arise from cells or from other extracellular tissue components, so as to enable us to have better understanding on the transformation mechanism of normal into malignant and to go for an improved approach in the effective optical diagnosis. In this context, the present study addresses the question of whether there are differences in the native cellular fluorescence characteristics between normal and malignant epithelial cells from human larynx. With this aim, the UV fluorescence emission spectra in the wavelength region of excitation between 270 - 310 nm and the excitation spectra for 340 nm emission were measured and analyzed. In order to quantify the altered fluorescence signal between the normal and malignant cells, different ratio parameters were introduced.

  8. Coagulation of human prostate volumes with MRI-controlled transurethral ultrasound therapy: Results in gel phantoms

    PubMed Central

    N’Djin, William Apoutou; Burtnyk, Mathieu; Kobelevskiy, Ilya; Hadjis, Stefan; Bronskill, Michael; Chopra, Rajiv

    2012-01-01

    Purpose: The feasibility and safety of magnetic resonance imaging (MRI)-controlled transurethral ultrasound therapy were demonstrated recently in a preliminary human study in which a small subvolume of prostate tissue was treated prior to radical prostatectomy. Translation of this technology to full clinical use, however, requires the capability to generate thermal coagulation in a volume up to that of the prostate gland itself. The aim of this study was to investigate the parameters required to treat a full 3D human prostate accurately with a multi-element transurethral applicator and multiplanar MR temperature control. Methods: The approach was a combination of simulations (to select appropriate parameters) followed by experimental confirmation in tissue-mimicking phantoms. A ten-channel, MRI-compatible transurethral ultrasound therapy system was evaluated using six human prostate models (average volume: 36 cm3) obtained from the preliminary human feasibility study. Real-time multiplanar MR thermometry at 3 T was used to control the spatial heating pattern in up to nine planes simultaneously. Treatment strategies incorporated both single (4.6 or 8.1 MHz) and dual (4.6 and 14.4 MHz) frequencies, as well as maximum acoustic surface powers of 10 or 20 W cm−2. Results: Treatments at 4.6 MHz were capable of coagulating a volume equivalent to 97% of the prostate. Increasing power from 10 to 20 W cm−2 reduced treatment times by approximately 50% with full treatments taking 26 ± 3 min at a coagulation rate of 1.8 ± 0.4 cm3 min−1. A dual-frequency 4.6/14.4 MHz treatment strategy was shown to be the most effective configuration for achieving full human prostate treatment while maintaining good treatment accuracy for small treatment radii. The dual-frequency approach reduced overtreatment close to the prostate base and apex, confirming the simulations. Conclusions: This study reinforces the capability of MRI-controlled transurethral ultrasound therapy to treat

  9. P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate

    PubMed Central

    Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Wiemer, Nicolas; Ciotkowska, Anna; Rutz, Beata; Waidelich, Raphaela; Strittmatter, Frank; Liu, Chunxiao; Stief, Christian G.; Hennenberg, Martin

    2016-01-01

    Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients’ adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1–10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under

  10. A New Murine Model of Osteoblastic/Osteolytic Lesions from Human Androgen-Resistant Prostate Cancer

    PubMed Central

    Depalle, Baptiste; Serre, Claire Marie; Farlay, Delphine; Turtoi, Andrei; Bellahcene, Akeila; Follet, Hélène; Castronovo, Vincent; Clézardin, Philippe; Bonnelye, Edith

    2013-01-01

    Background Up to 80% of patients dying from prostate carcinoma have developed bone metastases that are incurable. Castration is commonly used to treat prostate cancer. Although the disease initially responds to androgen blockade strategies, it often becomes castration-resistant (CRPC for Castration Resistant Prostate Cancer). Most of the murine models of mixed lesions derived from prostate cancer cells are androgen sensitive. Thus, we established a new model of CRPC (androgen receptor (AR) negative) that causes mixed lesions in bone. Methods PC3 and its derived new cell clone PC3c cells were directly injected into the tibiae of SCID male mice. Tumor growth was analyzed by radiography and histology. Direct effects of conditioned medium of both cell lines were tested on osteoclasts, osteoblasts and osteocytes. Results We found that PC3c cells induced mixed lesions 10 weeks after intratibial injection. In vitro, PC3c conditioned medium was able to stimulate tartrate resistant acid phosphatase (TRAP)-positive osteoclasts. Osteoprotegerin (OPG) and endothelin-1 (ET1) were highly expressed by PC3c while dikkopf-1 (DKK1) expression was decreased. Finally, PC3c highly expressed bone associated markers osteopontin (OPN), Runx2, alkaline phosphatase (ALP), bone sialoprotein (BSP) and produced mineralized matrix in vitro in osteogenic conditions. Conclusions We have established a new CRPC cell line as a useful system for modeling human metastatic prostate cancer which presents the mixed phenotype of bone metastases that is commonly observed in prostate cancer patients with advanced disease. This model will help to understand androgen-independent mechanisms involved in the progression of prostate cancer in bone and provides a preclinical model for testing the effects of new treatments for bone metastases. PMID:24069383

  11. The Rate of Secondary Malignancies After Radical Prostatectomy Versus External Beam Radiation Therapy for Localized Prostate Cancer: A Population-Based Study on 17,845 Patients

    SciTech Connect

    Bhojani, Naeem; Capitanio, Umberto; Suardi, Nazareno; Jeldres, Claudio; Isbarn, Hendrik; Shariat, Shahrokh F.; Graefen, Markus; Arjane, Philippe; Duclos, Alain; Lattouf, Jean-Baptiste; Saad, Fred; Valiquette, Luc; Montorsi, Francesco; Perrotte, Paul; Karakiewicz, Pierre I.

    2010-02-01

    Purpose: External-beam radiation therapy (EBRT) may predispose to secondary malignancies that include bladder cancer (BCa), rectal cancer (RCa), and lung cancer (LCa). We tested this hypothesis in a large French Canadian population-based cohort of prostate cancer patients. Methods and Materials: Overall, 8,455 radical prostatectomy (RP) and 9,390 EBRT patients treated between 1983 and 2003 were assessed with Kaplan-Meier and Cox regression analyses. Three endpoints were examined: (1) diagnosis of secondary BCa, (2) LCa, or (3) RCa. Covariates included age, Charlson comorbidity index, and year of treatment. Results: In multivariable analyses that relied on incident cases diagnosed 60 months or later after RP or EBRT, the rates of BCa (hazard ratio [HR], 1.4; p = 0.02), LCa (HR, 2.0; p = 0.004), and RCa (HR 2.1; p <0.001) were significantly higher in the EBRT group. When incident cases diagnosed 120 months or later after RP or EBRT were considered, only the rates of RCa (hazard ratio 2.2; p = 0.003) were significantly higher in the EBRT group. In both analyses, the absolute differences in incident rates ranged from 0.7 to 5.2% and the number needed to harm (where harm equaled secondary malignancies) ranged from 111 to 19, if EBRT was used instead of RP. Conclusions: EBRT may predispose to clinically meaningfully higher rates of secondary BCa, LCa and RCa. These rates should be included in informed consent consideration.

  12. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells

    SciTech Connect

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H{sub 2}S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H{sub 2}S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H{sub 2}S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H{sub 2}S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H{sub 2}S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H{sub 2}S-producing enzyme in prostate. CSE overexpression enhanced H{sub 2}S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H{sub 2}S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H{sub 2}S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H{sub 2}S-releasing diet or drug might be beneficial in the treatment of prostate cancer. Highlights: Black-Right-Pointing-Pointer A large amount of H{sub 2}S is released from sulforaphane. Black-Right-Pointing-Pointer H{sub 2}S mediates the anti-survival effect of

  13. 18F Sodium Fluoride PET/CT in Patients with Prostate Cancer: Quantification of Normal Tissues, Benign Degenerative Lesions, and Malignant Lesions

    PubMed Central

    Oldan, Jorge D.; Hawkins, A. Stewart; Chin, Bennett B.

    2016-01-01

    Understanding the range and variability of normal, benign degenerative, and malignant 18F sodium fluoride (18F NaF) positron emission tomography/computed tomography (PET/CT) uptake is important in influencing clinical interpretation. Further, it is essential for the development of realistic semiautomated quantification techniques and simulation models. The purpose of this study is to determine the range of these values in a clinically relevant patient population with prostate cancer. 18F NaF PET/CT scans were analyzed in patients with prostate cancer (n = 47) referred for evaluation of bone metastases. Mean and maximum standardized uptake values [SUVs (SUVmean and SUVmax)] were made in normal background regions (n = 470) including soft tissues (liver, aorta, bladder, adipose, brain, and paraspinal muscle) and osseous structures (T12 vertebral body, femoral diaphyseal cortex, femoral head medullary space, and ribs). Degenerative joint disease (DJD; n = 281) and bone metastases (n = 159) were identified and quantified by an experienced reader using all scan information including coregistered CT. For normal bone regions, the highest 18F NaF PET SUVmean occurred in T12 (6.8 ± 1.4) and it also showed the lowest coefficient of variation (cv = 21%). For normal soft tissues, paraspinal muscles showed very low SUVmean (0.70 ± 0.11) and also showed the lowest variability (cv = 16%). Average SUVmean in metastatic lesions is higher than uptake in benign degenerative lesions but values showed a wide variance and overlapping values (16.3 ± 13 vs 11.1 ± 3.8; P < 0.00001). The normal 18F NaF PET uptake values for prostate cancer patients in normal background, benign degenerative disease, and osseous metastases are comparable to those reported for a general population with a wide variety of diagnoses. These normal ranges, specifically for prostate cancer patients, will aid in clinical interpretation and also help to establish the basis of normal limits in a semiautomated data

  14. (18)F Sodium Fluoride PET/CT in Patients with Prostate Cancer: Quantification of Normal Tissues, Benign Degenerative Lesions, and Malignant Lesions.

    PubMed

    Oldan, Jorge D; Hawkins, A Stewart; Chin, Bennett B

    2016-01-01

    Understanding the range and variability of normal, benign degenerative, and malignant (18)F sodium fluoride ((18)F NaF) positron emission tomography/computed tomography (PET/CT) uptake is important in influencing clinical interpretation. Further, it is essential for the development of realistic semiautomated quantification techniques and simulation models. The purpose of this study is to determine the range of these values in a clinically relevant patient population with prostate cancer. (18)F NaF PET/CT scans were analyzed in patients with prostate cancer (n = 47) referred for evaluation of bone metastases. Mean and maximum standardized uptake values [SUVs (SUVmean and SUVmax)] were made in normal background regions (n = 470) including soft tissues (liver, aorta, bladder, adipose, brain, and paraspinal muscle) and osseous structures (T12 vertebral body, femoral diaphyseal cortex, femoral head medullary space, and ribs). Degenerative joint disease (DJD; n = 281) and bone metastases (n = 159) were identified and quantified by an experienced reader using all scan information including coregistered CT. For normal bone regions, the highest (18)F NaF PET SUVmean occurred in T12 (6.8 ± 1.4) and it also showed the lowest coefficient of variation (cv = 21%). For normal soft tissues, paraspinal muscles showed very low SUVmean (0.70 ± 0.11) and also showed the lowest variability (cv = 16%). Average SUVmean in metastatic lesions is higher than uptake in benign degenerative lesions but values showed a wide variance and overlapping values (16.3 ± 13 vs 11.1 ± 3.8; P < 0.00001). The normal (18)F NaF PET uptake values for prostate cancer patients in normal background, benign degenerative disease, and osseous metastases are comparable to those reported for a general population with a wide variety of diagnoses. These normal ranges, specifically for prostate cancer patients, will aid in clinical interpretation and also help to establish the basis of normal limits in a

  15. Analysis of the codon 72 polymorphism of TP53 and human papillomavirus infection in Iranian patients with prostate cancer.

    PubMed

    Salehi, Zivar; Hadavi, Mahvash

    2012-09-01

    The TP53 gene is one of the most important tumor suppressor genes controlling DNA transcription and cell regulation. Common polymorphisms in p53 gene may play a role in some cancers. Some studies have reported an association between human papillomavirus (HPV) infections and prostate cancer. The aim of this study was to investigate whether the TP53 codon 72 polymorphism and HPV infection are responsible for susceptibility to prostate cancer in Iranian men. The prostate biopsies were taken during surgery from 68 Iranian prostatic cancer patients, and 85 patients with benign prostate hyperplasia. For genotyping of the p53 polymorphism at codon 72, PCRRFLP methods were used and the PCR products were digested with BstU1. An attempt was also made to detect HPV DNA in benign prostate hyperplasia and prostate cancer specimens. Among cancer cases, the distribution of Arg/Arg, Arg/Pro and Pro/Pro genotypes were 26.5%, 45.4%, and 19.1%, respectively. Among patients with benign prostate hyperplasia, the distribution of Arg/Arg, Arg/Pro, and Pro/Pro genotypes were 27%, 53%, and 20%, respectively. The allele frequencies did not differ significantly between prostate cancer and benign prostate hyperplasia samples. Human papillomavirus was detected only in three patients (4.4%; P = 0.71). The results from this study suggest that the TP53 codon 72 polymorphism and HPV infection do not confer susceptibility to prostate cancer in the Iranian population. Larger population-based studies are needed to clarify the relation between prostate carcinoma and p53 polymorphism and HPV infection. PMID:22825821

  16. Monitoring changes in tissue optical properties following interstitial photothermal therapy of ex vivo human prostate tissue

    NASA Astrophysics Data System (ADS)

    Weersink, Robert A.; He, Jie; Veilleux, Israel; Trachtenberg, John; Wilson, Brian C.

    2013-03-01

    We are developing a method of monitoring treatment progression of interstitial photothermal therapy of focal prostate cancer using transrectal diffuse optical tomography (TRDOT) combined with transrectal 3D ultrasound (3D-TRUS). Measurements of prostate tissue optical properties were made on ex vivo human prostate samples prior to and post coagulation. Interstitial photothermal treatments were delivered to the ex vivo samples and monitored using an interstitial probe near the treatment fiber. After treatment, bulk optical properties were measured on native and coagulated zones of tissue. Changes in optical properties across the boundary between native and coagulated tissues were spatially mapped using a small diffuse reflectance probe. The optical property estimates and spatial information obtained using each method was compared.

  17. A single domain of human prostatic acid phosphatase shows antibody-mediated restoration of catalytic activity.

    PubMed Central

    Choe, B K; Dong, M K; Walz, D; Gleason, S; Rose, N R

    1982-01-01

    By limited proteolysis with mouse submaxillaris protease, human prostatic acid phosphatase (EC 3.1.3.2) was cleaved into three fragments, Sp1, Sp2, and Sp3, which individually had no enzymatic activity. One of the fragments, Sp3, regained enzymatic activity after interaction with rabbit antibody to prostatic acid phosphatase. The Sp3 fragment was purified and characterized as to its molecular weight, amino acid composition, and carbohydrate content. The Sp3 fragment behaved like the parent molecule in L(+)-tartrate affinity and in trapping of a phosphoryl intermediate. The same Sp3 fragment also bears the most prominent antigenic determinants. This evidence suggest that Sp3 is the enzymatically active domain of prostatic acid phosphatase. Images PMID:6193513

  18. The regulation of adiponectin receptors in human prostate cancer cell lines

    SciTech Connect

    Mistry, T.; Digby, J.E.; Chen, J.; Desai, K.M.; Randeva, H.S. . E-mail: H.Randeva@warwick.ac.uk

    2006-09-29

    Obesity is a risk factor for prostate cancer, and plasma levels of the adipokine, adiponectin, are low in the former but high in the latter. Adiponectin has been shown to modulate cell proliferation and apoptosis, suggesting that adiponectin and its receptors (Adipo-R1, Adipo-R2) may provide a molecular association between obesity and prostate carcinogenesis. We show for First time, the protein distribution of Adipo-R1 and Adipo-R2 in LNCaP and PC3 cells, and in human prostate tissue. Using real-time RT-PCR we provide novel data demonstrating the differential regulation of Adipo-R1 and Adipo-R2 mRNA expression by testosterone, 5-{alpha} dihydrotestosterone, {beta}-estradiol, tumour necrosis factor-{alpha}, leptin, and adiponectin in LNCaP and PC3 cells. Our findings suggest that adiponectin and its receptors may contribute to the molecular association between obesity and prostate cancer through a complex interaction with other hormones and cytokines that also play important roles in the pathophysiology of obesity and prostate cancer.

  19. NOTCH3 IS ACTIVATED BY CHRONIC HYPOXIA AND CONTRIBUTES TO THE PROGRESSION OF HUMAN PROSTATE CANCER

    PubMed Central

    Danza, Giovanna; Di Serio, Claudia; Ambrosio, Maria Raffaella; Sturli, Niccolò; Lonetto, Giuseppe; Rosati, Fabiana; Rocca, Bruno Jim; Ventimiglia, Giuseppina; del Vecchio, Maria Teresa; Prudovsky, Igor; Marchionni, Niccolò; Tarantini, Francesca

    2013-01-01

    Prostate cancer is still the second cause of cancer-related death among men. Although patients with metastatic presentation have an ominous outcome, the vast majority of PCs are diagnosed at an early stage. Nonetheless, even among patients with clinically localized disease the outcome may vary considerably. Other than androgen sensitivity, little is known about which other signaling pathways are deranged in aggressive, localized cancers. The elucidation of such pathways may help to develop innovative therapies aimed at specific molecular targets. We report that in a hormone-sensitive prostate cancer cell line, LNCaP, Notch3 was activated by hypoxia and sustained cell proliferation and colony formation in soft agar. Hypoxia also modulated cellular cholesterol content and the number and size of lipid rafts, causing a coalescence of small rafts into bigger clusters; under this experimental condition Notch3 migrated from the non-raft into the raft compartment where it co-localized with the γ-secretase complex. We also looked at human prostate cancer biopsies and found that expression of Notch3 positively correlated with Gleason score and with expression of carbonic anhydrase IX, a marker of hypoxia. In conclusion, hypoxia triggers the activation of Notch3 which, in turn, sustains proliferation of prostate cancer cells. Notch3 pathway represents a promising target for adjuvant therapy in patients with prostate cancer. PMID:23729168

  20. Malignant Transformation of Hymenolepis nana in a Human Host.

    PubMed

    Muehlenbachs, Atis; Bhatnagar, Julu; Agudelo, Carlos A; Hidron, Alicia; Eberhard, Mark L; Mathison, Blaine A; Frace, Michael A; Ito, Akira; Metcalfe, Maureen G; Rollin, Dominique C; Visvesvara, Govinda S; Pham, Cau D; Jones, Tara L; Greer, Patricia W; Vélez Hoyos, Alejandro; Olson, Peter D; Diazgranados, Lucy R; Zaki, Sherif R

    2015-11-01

    Neoplasms occur naturally in invertebrates but are not known to develop in tapeworms. We observed nests of monomorphic, undifferentiated cells in samples from lymph-node and lung biopsies in a man infected with the human immunodeficiency virus (HIV). The morphologic features and invasive behavior of the cells were characteristic of cancer, but their small size suggested a nonhuman origin. A polymerase-chain-reaction (PCR) assay targeting eukaryotes identified Hymenolepis nana DNA. Although the cells were unrecognizable as tapeworm tissue, immunohistochemical staining and probe hybridization labeled the cells in situ. Comparative deep sequencing identified H. nana structural genomic variants that are compatible with mutations described in cancer. Invasion of human tissue by abnormal, proliferating, genetically altered tapeworm cells is a novel disease mechanism that links infection and cancer. PMID:26535513

  1. Human and murine prostate basal/stem cells are not direct targets of prolactin.

    PubMed

    Sackmann-Sala, Lucila; Angelergues, Antoine; Boutillon, Florence; d'Acremont, Bruno; Maidenberg, Marc; Oudard, Stéphane; Goffin, Vincent

    2015-09-01

    Local overexpression of prolactin (PRL) in the prostate of Pb-PRL transgenic mice induces benign prostate tumors exhibiting marked amplification of the epithelial basal/stem cell compartment. However, PRL-activated intracellular signaling seems to be restricted to luminal cells, suggesting that basal/stem cells may not be direct targets of PRL. Given their described role as prostate cancer-initiating cells, it is important to understand the mechanisms that regulate basal/stem cells. In this study, we evaluated whether PRL can act directly on these cells, by growing them as prostaspheres. For this, primary 3D prostasphere cultures were prepared from unfractionated cells isolated from freshly harvested human and mouse benign prostate tissues and subjected to PRL stimulation in vitro. None of the various concentrations of PRL tested showed any effects on the sizes or numbers of the prostaspheres generated. In addition, neither activation of canonical PRL-induced signaling pathways (Stat5, Stat3 or Erk1/2) nor increased expression of the proliferation marker Ki-67 were detected by immunostaining in PRL-stimulated prostaspheres. Consistent with the absence of response, PRL receptor mRNA levels were generally undetectable in mouse sphere cells. We conclude that human and mouse prostate basal/stem cells are not direct targets of PRL action. The observed amplification of basal/stem cells in Pb-PRL prostates might be due to paracrine mechanisms originating from PRL action on other cell compartments. Our current efforts are aimed at unraveling these mechanisms. PMID:25888939

  2. Growth inhibition of human prostate cells in vitro by novel inhibitors of androgen synthesis.

    PubMed

    Klus, G T; Nakamura, J; Li, J S; Ling, Y Z; Son, C; Kemppainen, J A; Wilson, E M; Brodie, A M

    1996-11-01

    The long-standing strategy for the treatment of metastatic prostate cancer has been to reduce androgenic stimulation of tumor growth by removal of the testes, the primary site of testosterone synthesis. However, a low level of androgenic stimulation may continue, even after castration, by the conversion of adrenal androgens to 5alpha-dihydrotestosterone (DHT) in the prostate tumor cells. Two important enzymes of the androgen biosynthetic pathway are 17alpha-hydroxylase/C17,20-lyase, which regulates an early step in the synthesis of testosterone and other androgens in both the testes and adrenal glands, and 5alpha-reductase, which converts testosterone to the more potent androgen, DHT, in the prostate. We have identified new inhibitors of these enzymes that may be of use in achieving a more complete ablation of androgens in the treatment of metastatic prostate cancer. Three derivatives of androstene were shown to inhibit 17alpha-hydroxylase/C17,20-lyase with potencies 2-20-fold greater than that of ketoconazole, a previously established inhibitor of this enzyme. Derivatives of pregnane and pregnene displayed activities against 5alpha-reductase that were comparable to that of N-(1,1-dimethyl-ethyl)-3-oxo-4-aza-5alpha-androst-1-ene-17beta-car boxamide. All of the 5alpha-reductase inhibitors were able to at least partially inhibit the mitogenic effect of testosterone in either histocultures of human benign prostatic hypertrophic tissue or in cultures of the LNCaP human prostatic tumor cell line. For these compounds, it appears that this inhibition can be attributed to a reduction of DHT synthesis in these cultures, because no inhibitory effect was observed in DHT-treated cultures, and none of the compounds had a cytotoxic effect. Surprisingly, one of the inhibitors of 17alpha-hydroxylase/C17,20-lyase, 17beta-(4-imidazolyl)-5-pregnen-3beta-ol, was also able to inhibit the mitogenic effect of testosterone in both the histoculture and cell culture assays and had an effect

  3. Zebrafish as a Model for the Study of Human Myeloid Malignancies.

    PubMed

    Lu, Jeng-Wei; Hsieh, Meng-Shan; Liao, Heng-An; Yang, Yi-Ju; Ho, Yi-Jung; Lin, Liang-In

    2015-01-01

    Myeloid malignancies are heterogeneous disorders characterized by uncontrolled proliferation or/and blockage of differentiation of myeloid progenitor cells. Although a substantial number of gene alterations have been identified, the mechanism by which these abnormalities interact has yet to be elucidated. Over the past decades, zebrafish have become an important model organism, especially in biomedical research. Several zebrafish models have been developed to recapitulate the characteristics of specific myeloid malignancies that provide novel insight into the pathogenesis of these diseases and allow the evaluation of novel small molecule drugs. This report will focus on illustrative examples of applications of zebrafish models, including transgenesis, zebrafish xenograft models, and cell transplantation approaches, to the study of human myeloid malignancies. PMID:26064935

  4. Assessment of cell surface glycoconjugates in normal, benign and malignant human nasal mucosa.

    PubMed

    Fang, S Y; Ohyama, M

    1997-12-01

    Aberrant glycosylation of proteins is a common characteristic of neoplastic changes. No reports exist relating cell surface glycoconjugates to normal, benign and malignant human nasal mucosa. Using lectin affinity histochemistry, glycoconjugate reactivities for peanut agglutinin (PNA), concanavalin A (Con A), Griffonia simplicifolia agglutinin II (GSA-II), soy bean agglutinin (SBA) and Ulex europaeus agglutinin l (UEA-I) were analysed in the following groups: normal, benign (polyp, papilloma, and inverted papilloma) and malignant (squamous cell carcinoma (SCC) alone, SCC arising in inverted papilloma, and adenocarcinoma). The positive rate of lectin staining was evaluated using a quantitative AutoCAD programme. We correlated glycoconjugate expression to clinical features, diagnosis, and malignant transformation. The positive rate of PNA after neuraminidase pre-treatment (NA-PNA) staining was higher in inverted papilloma, while all-negative in polyp and papilloma. NA-PNA staining may be used as a differential diagnostic tool. Both inverted papilloma portions and SCC portions of the SCC synchronized with inverted papilloma subjects showed similar Con A and NA-PNA staining patterns. The biological characteristics define inverted papilloma as a pre-malignant neoplasm. The positive rate of PNA staining was significantly higher in inverted papilloma (inverted papilloma transformed to SCC) compared to inverted papilloma alone. Hence, PNA staining may predict malignant transformation of inverted papilloma. However, further investigations are required to prove this possibly worthwhile prognostic marker. PMID:9532636

  5. HSF1 drives a transcriptional program distinct from heat shock to support highly malignant human cancers

    PubMed Central

    Mendillo, Marc L.; Santagata, Sandro; Koeva, Martina; Bell, George W.; Hu, Rong; Tamimi, Rulla M.; Fraenkel, Ernest; Ince, Tan A.; Whitesell, Luke; Lindquist, Susan

    2012-01-01

    SUMMARY Heat-Shock Factor 1 (HSF1), master regulator of the heat-shock response, facilitates malignant transformation, cancer cell survival and proliferation in model systems. The common assumption is that these effects are mediated through regulation of heat-shock protein (HSP) expression. However, the transcriptional network that HSF1 coordinates directly in malignancy and its relationship to the heat-shock response have never been defined. By comparing cells with high and low malignant potential alongside their non-transformed counterparts, we identify an HSF1-regulated transcriptional program specific to highly malignant cells and distinct from heat shock. Cancer-specific genes in this program support oncogenic processes: cell-cycle regulation, signaling, metabolism, adhesion and translation. HSP genes are integral to this program, however, many are uniquely regulated in malignancy. This HSF1 cancer program is active in breast, colon and lung tumors isolated directly from human patients and is strongly associated with metastasis and death. Thus, HSF1 rewires the transcriptome in tumorigenesis, with prognostic and therapeutic implications. PMID:22863008

  6. Tumour-initiating stem-like cells in human prostate cancer exhibit increased NF-κB signalling

    PubMed Central

    Rajasekhar, Vinagolu K.; Studer, Lorenz; Gerald, William; Socci, Nicholas D.; Scher, Howard I.

    2011-01-01

    Androgen depletion is a key strategy for treating human prostate cancer, but the presence of hormone-independent cells escaping treatment remains a major therapeutic challenge. Here, we identify a minor subset of stem-like human prostate tumour-initiating cells (TICs) that do not express prostate cancer markers, such as androgen receptor or prostate specific antigen. These TICs possess stem cell characteristics and multipotency as demonstrated by in vitro sphere-formation and in vivo tumour-initiation, respectively. The cells represent an undifferentiated subtype of basal cells and can be purified from prostate tumours based on coexpression of the human pluripotent stem cell marker TRA-1-60 with CD151 and CD166. Such triple-marker-positive TICs recapitulate the original parent tumour heterogeneity in serial xeno-transplantations indicating a tumour cell hierarchy in human prostate cancer development. These TICs exhibit increased nuclear factor-κB activity. These findings are important in understanding the molecular basis of human prostate cancer. PMID:21245843

  7. Frequent HLA class I alterations in human prostate cancer: molecular mechanisms and clinical relevance.

    PubMed

    Carretero, Francisco Javier; Del Campo, Ana Belen; Flores-Martín, Jose Francisco; Mendez, Rosa; García-Lopez, Cesar; Cozar, Jose Manuel; Adams, Victoria; Ward, Stephen; Cabrera, Teresa; Ruiz-Cabello, Francisco; Garrido, Federico; Aptsiauri, Natalia

    2016-01-01

    Reduced expression of HLA class I is an important immune escape mechanism from cytotoxic T cells described in various types of malignancy. It often correlates with poor prognosis and resistance to therapy. However, current knowledge about the frequency, underlying molecular mechanisms, and prognostic value of HLA class I and II alterations in prostate cancer (PC) is limited. Immunohistochemical analysis demonstrated that 88 % of the 42 studied cryopreserved prostate tumors have at least one type of HLA alteration as compared to adjacent normal prostate epithelium or benign hyperplasia. Total loss of HLA-I expression found in 50 % of tumors showed an association with increased incidence of tumor relapse, perineural invasion, and high D'Amico risk. The remaining HLA-I-positive tumors demonstrated locus and allelic losses detected in 26 and 12 % of samples, respectively. Loss of heterozygosity at chromosome 6 was detected in 32 % of the studied tumors. Molecular analysis revealed a reduced expression of B2M, TAP2, tapasin and NLRC5 mRNA in microdissected HLA-I-negative tumors. Analysis of twelve previously unreported cell lines derived from neoplastic and normal epithelium of cancerous prostate revealed different types of HLA-I aberration, ranging from locus and/or allelic downregulation to a total absence of HLA-I expression. The high incidence of HLA-I loss observed in PC, caused by both regulatory and structural defects, is associated with more aggressive disease development and may pose a real threat to patient health by increasing cancer progression and resistance to T-cell-based immunotherapy. PMID:26611618

  8. Confocal reflectance imaging of excised malignant human bladder biopsies

    NASA Astrophysics Data System (ADS)

    Daniltchenko, Dmitri I.; Kastein, Albrecht; Koenig, Frank; Sachs, Markus; Schnorr, Dietmar; Al-Shukri, Salman; Loening, Stefan A.

    2004-08-01

    To evaluate the potential of reflectance confocal scanning laser microscopy (CM) for rapid imaging of non-processed freshly excised human bladder biopsies and cystectomy specimens. Freshly excised bladder tumors from three cystectomy specimens and random biopsies from twenty patients with a history of superficial bladder tumors were imaged with CM. Additional acetic acid washing prior to CM imaging was performed in some of the samples. Confocal images were compared to corresponding routine histologic sections. CM allows imaging of unprocessed bladder tissue at a subcellular resolution. Urothelial cell layers, collagen, vessels and muscle fibers can be rapidly visualized, in native state. In this regard, umbrella cells, basement membrane elucidated. Besides obvious limitations partly due to non-use of exogenous dyes, CM imaging offers several advantages: rapid imaging of the tissue in its native state like the basement membrane, normally seen only by using immunohistopathology. Reflectance CM opens a new avenue for imaging bladder cancer.

  9. Curcumin analogues with high activity for inhibiting human prostate cancer cell growth and androgen receptor activation.

    PubMed

    Zhou, Dai-Ying; Ding, Ning; Du, Zhi-Yun; Cui, Xiao-Xing; Wang, Hong; Wei, Xing-Chuan; Conney, Allan H; Zhang, Kun; Zheng, Xi

    2014-09-01

    The androgen receptor (AR) has a critical role in prostate cancer development and progression. Several curcumin analogues (A10, B10, C10, E10 and F10) with different linker groups were investigated for their effects in human prostate cancer CWR‑22Rv1 and LNCaP cell lines. The ability of these compounds to inhibit testosterone (TT)‑ or dihydrotestosterone (DHT)‑induced AR activity was determined by an AR‑linked luciferase assay and by TT‑ or DHT‑induced expression of prostate specific antigen. Compounds F10 and E10 had stronger inhibitory effects on the growth of cultured CWR‑22Rv1 and LNCaP cell lines, and they also had enhanced stimulatory effects on apoptosis compared with curcumin and other curcumin analogues (A10, B10, C10) in CWR‑22Rv1 cells. E10 and F10 were more potent inhibitors of AR activity than curcumin, A10 and B10. The higher activities of E10 and F10 may be correlated with a heteroatom linker. The results indicate that one of the potential mechanisms for the anticancer effect of the curcumin analogues was inhibition of AR pathways in human prostate cancer cells. PMID:25060817

  10. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells.

    PubMed

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H(2)S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H(2)S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H(2)S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H(2)S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H(2)S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H(2)S-producing enzyme in prostate. CSE overexpression enhanced H(2)S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H(2)S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H(2)S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H(2)S-releasing diet or drug might be beneficial in the treatment of prostate cancer. PMID:22005276

  11. Selective induction of apoptosis through the FADD/caspase-8 pathway by a p53 c-terminal peptide in human pre-malignant and malignant cells.

    PubMed

    Li, Yin; Mao, Yuehua; Rosal, Ramon V; Dinnen, Richard D; Williams, Ann C; Brandt-Rauf, Paul W; Fine, Robert L

    2005-05-20

    A p53 C-terminal peptide (aa 361-382, p53p), fused at its C-terminus to the minimal carrier peptide of antennapedia (17 aa, Ant; p53p-Ant), induced rapid apoptosis in human cancer cells, via activation of the Fas pathway. We examined p53p-Ant mechanism of action, toxicity in various human normal, non-malignant, pre-malignant and malignant cancer cells and investigated its biophysical characteristics. p53p-Ant selectively induced cell death in only pre-malignant or malignant cells in a p53-dependent manner and was not toxic to normal and non-malignant cells. p53p-Ant was more toxic to the mutant p53 than wild-type p53 phenotype in H1299 lung cancer cells stably expressing human temperature-sensitive p53 mutant 143Ala. Surface plasmon resonance (BIACORE) analysis demonstrated that this peptide had higher binding affinity to mutant p53 as compared to wild-type p53. p53p-Ant induced-cell death had the classical morphological characteristics of apoptosis and had no features of necrosis. The mechanism of cell death by p53p-Ant was through the FADD/caspase-8-dependent pathway without the involvement of the TRAIL pathway, Bcl-2 family and cell cycle changes. Blocking Fas with antibody did not alter the peptide's effect, suggesting that Fas itself did not interact with the peptide. Transfection with a dominant-negative FADD with a deleted N-terminus inhibited p53p-Ant-induced apoptosis. Its mechanism of action is related to the FADD-induced pathway without restoration of other p53 functions. p53p-Ant is a novel anticancer agent with unique selectivity for human cancer cells and could be useful as a prototype for the development of new anti-cancer agents. PMID:15645452

  12. From The Cover: Reconstruction of functionally normal and malignant human breast tissues in mice

    NASA Astrophysics Data System (ADS)

    Kuperwasser, Charlotte; Chavarria, Tony; Wu, Min; Magrane, Greg; Gray, Joe W.; Carey, Loucinda; Richardson, Andrea; Weinberg, Robert A.

    2004-04-01

    The study of normal breast epithelial morphogenesis and carcinogenesis in vivo has largely used rodent models. Efforts at studying mammary morphogenesis and cancer with xenotransplanted human epithelial cells have failed to recapitulate the full extent of development seen in the human breast. We have developed an orthotopic xenograft model in which both the stromal and epithelial components of the reconstructed mammary gland are of human origin. Genetic modification of human stromal cells before the implantation of ostensibly normal human mammary epithelial cells resulted in the outgrowth of benign and malignant lesions. This experimental model allows for studies of human epithelial morphogenesis and differentiation in vivo and underscores the critical role of heterotypic interactions in human breast development and carcinogenesis.

  13. Demethoxycurcumin Retards Cell Growth and Induces Apoptosis in Human Brain Malignant Glioma GBM 8401 Cells

    PubMed Central

    Huang, Tzuu-Yuan; Hsu, Che-Wen; Chang, Weng-Cheng; Wang, Miin-Yau; Wu, June-Fu; Hsu, Yi-Chiang

    2012-01-01

    Demethoxycurcumin (DMC; a curcumin-related demethoxy compound) has been recently shown to display antioxidant and antitumor activities. It has also produced a potent chemopreventive action against cancer. In the present study, the antiproliferation (using the MTT assay, DMC was found to have cytotoxic activities against GBM 8401 cell with IC50 values at 22.71 μM) and induced apoptosis effects of DMC have been investigated in human brain malignant glioma GBM 8401 cells. We have studied the mitochondrial membrane potential (MMP), DNA fragmentation, caspase activation, and NF-κB transcriptional factor activity. By these approaches, our results indicated that DMC has produced an inhibition of cell proliferation as well as the activation of apoptosis in GBM 8401 cells. Both effects were observed to increase in proportion with the dosage of DMC treatment, and the apoptosis was induced by DMC in human brain malignant glioma GBM 8401 cells via mitochondria- and caspase-dependent pathways. PMID:22454662

  14. Tetrandrine suppresses proliferation, induces apoptosis, and inhibits migration and invasion in human prostate cancer cells

    PubMed Central

    Liu, Wei; Kou, Bo; Ma, Zhen-Kun; Tang, Xiao-Shuang; Lv, Chuan; Ye, Min; Chen, Jia-Qi; Li, Lei; Wang, Xin-Yang; He, Da-Lin

    2015-01-01

    Tetrandrine (TET), a traditional Chinese medicine, exerts remarkable anticancer activity on various cancer cells. However, little is known about the effect of TET on human prostate cancer cells, and the mechanism of function of TET on prostate cancer has not yet been elucidated. To investigate the effects of TET on the suppression of proliferation, induction of apoptosis, and inhibition of migration and invasion in human prostate cancer cell lines, DU145 and PC-3. Inhibition of growth was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and clone formation assay, and flow cytometry analysis was performed to detect the induction of apoptosis. Activation of poly (ADP-ribose) polymerase, caspase-3, Akt, phospho-Akt, Bcl-2, and Bax was analyzed by Western blotting. Wound healing assay and transwell migration assay were used to evaluate the effect of TET on migration and invasion of cancer cells. TET inhibited the growth of DU145 and PC–3 cells in a dose- and time-dependent manner. Cell cloning was inhibited in the presence of TET in DU145 and PC-3 cells. TET suppressed the migration of DU145 and PC-3 cells. Transwell invasion assay showed that TET significantly weakened invasion capacity of DU145 and PC-3 cells. TET exhibited strong inhibitory effect on proliferation, migration, and invasion of prostate cancer cells. In addition, TET induced apoptosis in a dose-dependent manner by activating the caspase cascade and inhibiting phosphoinositide 3-kinase-Akt signal pathway. The accumulating evidence suggests that TET could be a potential therapeutic candidate against prostate cancer in a clinical setting. PMID:25677131

  15. Tetrandrine suppresses proliferation, induces apoptosis, and inhibits migration and invasion in human prostate cancer cells.

    PubMed

    Liu, Wei; Kou, Bo; Ma, Zhen-Kun; Tang, Xiao-Shuang; Lv, Chuan; Ye, Min; Chen, Jia-Qi; Li, Lei; Wang, Xin-Yang; He, Da-Lin

    2015-01-01

    Tetrandrine (TET), a traditional Chinese medicine, exerts remarkable anticancer activity on various cancer cells. However, little is known about the effect of TET on human prostate cancer cells, and the mechanism of function of TET on prostate cancer has not yet been elucidated. To investigate the effects of TET on the suppression of proliferation, induction of apoptosis, and inhibition of migration and invasion in human prostate cancer cell lines, DU145 and PC-3. Inhibition of growth was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and clone formation assay, and flow cytometry analysis was performed to detect the induction of apoptosis. Activation of poly (ADP-ribose) polymerase, caspase-3, Akt, phospho-Akt, Bcl-2, and Bax was analyzed by Western blotting. Wound healing assay and transwell migration assay were used to evaluate the effect of TET on migration and invasion of cancer cells. TET inhibited the growth of DU145 and PC-3 cells in a dose- and time-dependent manner. Cell cloning was inhibited in the presence of TET in DU145 and PC-3 cells. TET suppressed the migration of DU145 and PC-3 cells. Transwell invasion assay showed that TET significantly weakened invasion capacity of DU145 and PC-3 cells. TET exhibited strong inhibitory effect on proliferation, migration, and invasion of prostate cancer cells. In addition, TET induced apoptosis in a dose-dependent manner by activating the caspase cascade and inhibiting phosphoinositide 3-kinase-Akt signal pathway. The accumulating evidence suggests that TET could be a potential therapeutic candidate against prostate cancer in a clinical setting. PMID:25677131

  16. Expression of melanocortin receptors in human prostate cancer cell lines: MC2R activation by ACTH increases prostate cancer cell proliferation.

    PubMed

    Hafiz, Saly; Dennis, John C; Schwartz, Dean; Judd, Robert; Tao, Ya-Xiong; Khazal, Kamel; Akingbemi, Benson; Mo, Xiu-Lei; Abdel-Mageed, Asim B; Morrison, Edward; Mansour, Mahmoud

    2012-10-01

    The melanocortin receptors (MCRs 1-5) are G protein coupled-receptors (GPCRs) that regulate food intake, inflammation, skin pigmentation, sexual function and steroidogenesis. Their peptide ligands, the melanocortins, are α-, β- and γ-melanocyte-stimulating hormone and adrenocorticotropic hormone (ACTH) all of which are secreted from the anterior pituitary gland under hypothalamic control. MC2R binds ACTH but has no affinity for the other melanocortins and is, thereby, pharmacologically different from MCRs that bind those ligands. Evidence suggests that elevated GPCRs transactivate the androgen receptor (AR), the critical mediator of prostate cell growth, and consequently promote prostate cancer cell proliferation. It may be that reduced central melanocortin signaling is coincidental with reversal of prostate cancer cachexia, but no data are available on the expression of, or the role for, MCRs in prostate cancer. Here, we show that MCR (1-5) mRNAs are expressed in androgen-dependent LNCaP and androgen-independent PC3 and DU-145 human prostate cancer cell lines. Further, MC2R, the specific target of ACTH, is expressed in LNCaP, PC3 and DU-145 cells. Among the several synthetic MCR peptide ligands that we used, only ACTH promoted concentration-dependent cell proliferation in the three cell lines as shown by MTT cell proliferation assay. In LNCaP cells, the effect was additive with testosterone stimulation and was partially blunted with SHU9119, a non-selective MCR antagonist. In the same cells, ACTH induced cAMP production and increased AR nuclear labeling in immunocytochemical assays. Our observations suggest that MC2R is involved in prostate carcinogenesis and that targeting MC2R signaling may provide a novel avenue in prostate carcinoma treatment. PMID:22842514

  17. Alpha-Methylacyl-CoA Racemase Spliced Variants and their Expression in Normal and Malignant Prostate Tissues

    PubMed Central

    Ouyang, Bin; Leung, Yuet-Kin; Wang, Vinson; Chung, Ethan; Levin, Linda; Bracken, Bruce; Cheng, Liang; Ho, Shuk-Mei

    2010-01-01

    OBJECTIVES Alpha-methylacyl-CoA racemase (AMACR) has been used as a diagnostic biomarker for prostate cancer (CaP) and is now a standard biomarker for needle biopsy specimens with ambiguous lesions. In this study, we evaluate the possibility of using AMACR variants to improve the specificity of CaP detection. METHODS We used in silico analysis and molecular cloning to discover new AMACR variants and quantitative RT-PCR to measure the transcript levels of AMACR and its variants in four prostate cell lines and 23 pairs of CaP and adjacent normal tissue. RESULTS We found four novel variants, IAs, IBL, IBLd, and IBLi. Transcript levels of the majority of AMACR variants were significantly upregulated in CaP as compared with its adjacent normal counterparts. A variants, the functional variants based on bioinformatic analysis, showed levels of transcript expression in CaP in this order: IA≫IAd=IIA≫IIAs>IAs. In contrast, the expression of the B variants, which appear to be nonfunctional due to the absence of exon 3, was lower than that of the A variants. IB was the most abundant form of B variant; and expression of IIB was negligible. More important, the difference between levels of variant IA, IAd, IIA, IIAs, IB, and IBLi in CaP and normal tissue was significantly higher than the difference in levels of total AMACR. CONCLUSIONS Our data suggest that AMACR variants have better power than total AMACR in discriminating between CaP and adjacent normal tissue. These findings may be useful for the development of future diagnostic assays. PMID:21195844

  18. Effects of dihydroxy gymnemic triacetate (DGT) on expression of apoptosis associated proteins in human prostate cancer cell lines (PC3).

    PubMed

    Pon Nivedha, Rajamanickam; Selvaraj, Jayaraman; Lalitha, Keddal Govindaram; Rajalakshmi, Manikkam

    2015-01-01

    Prostate cancer is the most common malignancies among men. The present study is aimed at the investigation of dihydroxy gymnemic triacetate (DGT) from Gymnema sylvestre on mitochondrial apoptotic pathway and cell cycle arrest. Treatment of DGT resulted in a dose-dependent inhibition of growth of PC-3 cells. The cell cycle arrest was observed at the G2/M phase and accumulation of apoptotic cells was observed in DGT-treated prostate cancer cell lines. The occurrence of apoptosis in these cells was observed by DNA fragmentation. These events were associated with increased levels of pro-apoptotic proteins Bax, Bad and reduced levels of the antiapoptotic proteins Bcl-2, Bcl-xL and Mcl-1. DGT also induces the activation of caspase-9 and caspase-3. The above results, clearly, suggest that DGT induces apoptosis by the intrinsic pathways which could be very useful for the treatment of prostate cancer. PMID:26053511

  19. The softening of human bladder cancer cells happens at an early stage of the malignancy process

    PubMed Central

    Ramos, Jorge R; Pabijan, Joanna

    2014-01-01

    Summary Various studies have demonstrated that alterations in the deformability of cancerous cells are strongly linked to the actin cytoskeleton. By using atomic force microscopy (AFM), it is possible to determine such changes in a quantitative way in order to distinguish cancerous from non-malignant cells. In the work presented here, the elastic properties of human bladder cells were determined by means of AFM. The measurements show that non-malignant bladder HCV29 cells are stiffer (higher Young’s modulus) than cancerous cells (HTB-9, HT1376, and T24 cell lines). However, independently of the histological grade of the studied bladder cancer cells, all cancerous cells possess a similar level of the deformability of about a few kilopascals, significantly lower than non-malignant cells. This underlines the diagnostic character of stiffness that can be used as a biomarker of bladder cancer. Similar stiffness levels, observed for cancerous cells, cannot be fully explained by the organization of the actin cytoskeleton since it is different in all malignant cells. Our results underline that it is neither the spatial organization of the actin filaments nor the presence of stress fibers, but the overall density and their 3D-organization in a probing volume play the dominant role in controlling the elastic response of the cancerous cell to an external force. PMID:24778971

  20. Targeting Btk/Etk of prostate cancer cells by a novel dual inhibitor.

    PubMed

    Guo, W; Liu, R; Bhardwaj, G; Yang, J C; Changou, C; Ma, A-H; Mazloom, A; Chintapalli, S; Xiao, K; Xiao, W; Kumaresan, P; Sanchez, E; Yeh, C-T; Evans, C P; Patterson, R; Lam, K S; Kung, H-J

    2014-01-01

    Btk and Etk/BMX are Tec-family non-receptor tyrosine kinases. Btk has previously been reported to be expressed primarily in B cells and has an important role in immune responses and B-cell malignancies. Etk has been shown previously to provide a strong survival and metastasis signal in human prostate cancer cells, and to confer androgen independence and drug resistance. While the role of Etk in prostate carcinogenesis is well established, the functions of Btk in prostate cancer have never been investigated, likely due to the perception that Btk is a hematopoietic, but not epithelial, kinase. Herein, we found that Btk is overexpressed in prostate cancer tissues and prostate cancer cells. The level of Btk in prostate cancer tissues correlates with cancer grades. Knockdown of Btk expression selectively inhibits the growth of prostate cancer cells, but not that of the normal prostate epithelial cells, which express very little Btk. Dual inhibition of Btk and Etk has an additive inhibitory effect on prostate cancer cell growth. To explore Btk and Etk as targets for prostate cancer, we developed a small molecule dual inhibitor of Btk and Etk, CTN06. Treatment of PC3 and other prostate cancer cells, but not immortalized prostate epithelial cells with CTN06 resulted in effective cell killing, accompanied by the attenuation of Btk/Etk signals. The killing effect of CTN06 is more potent than that of commonly used inhibitors against Src, Raf/VEGFR and EGFR. CTN06 induces apoptosis as well as autophagy in human prostate cancer cells, and is a chemo-sensitizer for docetaxel (DTX), a standard of care for metastatic prostate cancer patients. CTN06 also impeded the migration of human prostate cancer cells based on a 'wound healing' assay. The anti-cancer effect of CTN06 was further validated in vivo in a PC3 xenograft mouse model. PMID:25188519

  1. Designed modulation of sex steroid signaling inhibits telomerase activity and proliferation of human prostate cancer cells

    SciTech Connect

    Verma, Vikas; Sharma, Vikas; Singh, Vishal; Sharma, Siddharth; Bishnoi, Ajay Kumar; Chandra, Vishal; Maikhuri, J.P.; Dwivedi, Anila; Kumar, Atul; Gupta, Gopal

    2014-10-15

    The predominant estrogen-receptor (ER)-β signaling in normal prostate is countered by increased ER-α signaling in prostate cancer (CaP), which in association with androgen-receptor (AR) signaling results in pathogenesis of the disease. However CaP treatments mostly target AR signaling which is initially effective but eventually leads to androgen resistance, hence simultaneous targeting of ERs has been proposed. A novel series of molecules were designed with multiple sex-steroid receptor modulating capabilities by coalescing the pharmacophores of known anti-CaP molecules that act via modulation of ER(α/β) and/or AR, viz. 3,3′diindolylmethane (DIM), mifepristone, toremifene, tamoxifen and raloxifene. N,N-diethyl-4-((2-(4-methoxyphenyl)-1H-indol-3-yl)methyl) aniline (DIMA) was identified as the most promising structure of this new series. DIMA increased annexin-V labelling, cell-cycle arrest and caspase-3 activity, and decreased expression of AR and prostate specific antigen in LNCaP cells, in vitro. Concurrently, DIMA increased ER-β, p21 and p27 protein levels in LNCaP cells and exhibited ∼ 5 times more selective binding for ER-β than ER-α, in comparison to raloxifene. DIMA exhibited a dose-dependent ER-β agonism and ER-α antagonism in classical gene reporter assay and decreased hTERT (catalytic subunit of telomerase) transcript levels in LNCaP at 3.0 μM (P < 0.05). DIMA also dose-dependently decreased telomerase enzyme activity in prostate cancer cells. It is thus concluded that DIMA acts as a multi-steroid receptor modulator and effectively inhibits proliferation of prostate cancer cells through ER-β mediated telomerase inhibition, by countering actions of ER-α and AR. Its unique molecular design can serve as a lead structure for generation of potent agents against endocrine malignancies like the CaP.

  2. Effect of resveratrol and zinc on intracellular zinc status in normal human prostate epithelial cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To evaluate the influence of resveratrol on cellular zinc status, normal human prostate epithelial (NHPrE) cells were treated with 6 levels of resveratrol (0, 0.5, 1, 2.5, 5 and 10 microM) and 4 levels of zinc [0, 4, 16, and 32 microM for zinc-deficient (ZD), zinc-normal (ZN), zinc-adequate (ZA), an...

  3. Effect of ionizing radiation on acinar morphogenesis of human prostatic epithelial cells under three-dimensional culture conditions.

    PubMed

    Wang, T; X, S Ma; Kong, D; Yi, H; Wang, X; Liang, B; Xu, H; He, M; Jia, L; Qased, A B; Yang, Y; Liu, X

    2012-01-01

    Homeostasis is maintained by the interplay of multiple factors that directly or indirectly regulate cell proliferation and cell death. Complex multiple interactions between cells and the extracellular matrix occur during acinar morphogenesis and changes in these might indicate carcinogenesis of cells from a normal to a malignant, invasive phenotype. In this study, the human prostatic epithelial cell line RWPE-1 was cultured under three-dimensional (3-D) culture conditions, and the effect of ionizing radiation on acinar morphogenesis and its association with autophagy were discussed. The results illustrated that formation of specific spheroid (acinar) structures was detectable under 3-D culture conditions. Radiation induced the disruption of acini in different cell models using either gene overexpression (Akt) or gene knock-down (Beclin 1 and ATG7). Introduction of Akt not only accelerated the growth of cells (i.e., caused the cells to manifest elongating and microspike-like structures that are obviously different from structures seen in wild-type RWPE-1 cells under two-dimensional conditions), but also changed their morphological characteristics under 3-D culture conditions. Knock-down of autophagy-related genes (Beclin 1 and ATG7) increased the radiosensitivity of cells under 3-D culture conditions, and cells died of non-apoptotic death after radiation. The results suggested that ionizing radiation may change the cell phenotype and the formation of acini. Additionally even the autophagy mechanism may play a role in these processes. PMID:22296497

  4. Analysis of the Human Prostate-Specific Proteome Defined by Transcriptomics and Antibody-Based Profiling Identifies TMEM79 and ACOXL as Two Putative, Diagnostic Markers in Prostate Cancer

    PubMed Central

    O'Hurley, Gillian; Busch, Christer; Fagerberg, Linn; Hallström, Björn M.; Stadler, Charlotte; Tolf, Anna; Lundberg, Emma; Schwenk, Jochen M.; Jirström, Karin; Bjartell, Anders; Gallagher, William M.; Uhlén, Mathias; Pontén, Fredrik

    2015-01-01

    To better understand prostate function and disease, it is important to define and explore the molecular constituents that signify the prostate gland. The aim of this study was to define the prostate specific transcriptome and proteome, in comparison to 26 other human tissues. Deep sequencing of mRNA (RNA-seq) and immunohistochemistry-based protein profiling were combined to identify prostate specific gene expression patterns and to explore tissue biomarkers for potential clinical use in prostate cancer diagnostics. We identified 203 genes with elevated expression in the prostate, 22 of which showed more than five-fold higher expression levels compared to all other tissue types. In addition to previously well-known proteins we identified two poorly characterized proteins, TMEM79 and ACOXL, with potential to differentiate between benign and cancerous prostatic glands in tissue biopsies. In conclusion, we have applied a genome-wide analysis to identify the prostate specific proteome using transcriptomics and antibody-based protein profiling to identify genes with elevated expression in the prostate. Our data provides a starting point for further functional studies to explore the molecular repertoire of normal and diseased prostate including potential prostate cancer markers such as TMEM79 and ACOXL. PMID:26237329

  5. Quantify Prostate Cancer by Automated Histomorphometry

    NASA Astrophysics Data System (ADS)

    Braumann, Ulf-Dietrich; Kuska, Jens-Peer; Löffler, Markus; Wernert, Nicolas

    A new method is presented to quantify malignant changes in histological sections of prostate tissue immunohistochemically stained for prostate-specific antigen (PSA) by means of image processing. The morphological analysis of the prostate tissue uses the solidity of PSA-positive prostate tissue segments to compute a quantitative measure that turns out highly correlated with scores obtained from routine diagnosis (Gleason, Dhom).

  6. Production and Characterization of Monoclonal Antibodies against Human Prostate Specific Antigen

    PubMed Central

    Bayat, Ali Ahmad; Ghods, Roya; Shabani, Mahdi; Mahmoudi, Ahmad Reza; Yeganeh, Omid; Hassannia, Hadi; Sadeghitabar, Ali; Balay-Goli, Leila; Noutash-Haghighat, Farzaneh; Sarrafzadeh, Ali reza; Jeddi-Tehrani, Mahmood

    2015-01-01

    Background Prostate Specific Antigen (PSA) is an important laboratory marker for diagnosis of prostatic cancer. Thus, development of diagnostic tools specific for PSA plays an important role in screening, monitoring and early diagnosis of prostate cancer. In this paper, the production and characterization of a panel of murine monoclonal antibodies (mAbs) against PSA have been presented. Methods Balb/c mice were immunized with PSA, which was purified from seminal plasma. Splenocytes of hyperimmunized mice were extracted and fused with Sp2/0 cells. By adding selective HAT medium, hybridoma cells were established and positive clones were selected by ELISA after four times of cloning. The isotypes of produced mAbs were determined by ELISA and then purified from ascitic fluids using Hi-Trap protein G column. The reactivities of the mAbs were examined with the purified PSA and seminal plasma by ELISA and western blot techniques. Furthermore, the reactivities of the mAbs were assessed in Prostate Cancer (PCa), Benign Prostatic Hyperplasia (BPH) and brain cancer tissues by Immunohistochemistry (IHC). Results Five anti-PSA mAbs (clones: 2G2-B2, 2F9-F4, 2D6-E8, IgG1/К) and clones (2C8-E9, 2G3-E2, IgG2a/К) were produced and characterized. All mAbs, except 2F9-F4 detected the expression of PSA in PCa and BPH tissues and none of them reacted with PSA in brain cancer tissue in IHC. Besides, all mAbs could detect a protein band around 33 kDa in human seminal plasma in western blot. Conclusion These mAbs can specifically recognize PSA and may serve as a component of PSA diagnostic kit in various biological fluids. PMID:25926946

  7. Lectin-Like Oxidized LDL Receptor-1 Is an Enhancer of Tumor Angiogenesis in Human Prostate Cancer Cells

    PubMed Central

    González-Chavarría, Iván; Cerro, Rita P.; Parra, Natalie P.; Sandoval, Felipe A.; Zuñiga, Felipe A.; Omazábal, Valeska A.; Lamperti, Liliana I.; Jiménez, Silvana P.; Fernandez, Edelmira A.; Gutiérrez, Nicolas A.; Rodriguez, Federico S.; Onate, Sergio A.; Sánchez, Oliberto; Vera, Juan C.; Toledo, Jorge R.

    2014-01-01

    Altered expression and function of lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) has been associated with several diseases such as endothelial dysfunction, atherosclerosis and obesity. In these pathologies, oxLDL/LOX-1 activates signaling pathways that promote cell proliferation, cell motility and angiogenesis. Recent studies have indicated that olr1 mRNA is over-expressed in stage III and IV of human prostatic adenocarcinomas. However, the function of LOX-1 in prostate cancer angiogenesis remains to be determined. Our aim was to analyze the contribution of oxLDL and LOX-1 to tumor angiogenesis using C4-2 prostate cancer cells. We analyzed the expression of pro-angiogenic molecules and angiogenesis on prostate cancer tumor xenografts, using prostate cancer cell models with overexpression or knockdown of LOX-1 receptor. Our results demonstrate that the activation of LOX-1 using oxLDL increases cell proliferation, and the expression of the pro-angiogenic molecules VEGF, MMP-2, and MMP-9 in a dose-dependent manner. Noticeably, these effects were prevented in the C4-2 prostate cancer model when LOX-1 expression was knocked down. The angiogenic effect of LOX-1 activated with oxLDL was further demonstrated using the aortic ring assay and the xenograft model of tumor growth on chorioallantoic membrane of chicken embryos. Consequently, we propose that LOX-1 activation by oxLDL is an important event that enhances tumor angiogenesis in human prostate cancer cells. PMID:25170920

  8. Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

    PubMed Central

    2011-01-01

    Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer

  9. Widespread telomere instability in prostatic lesions.

    PubMed

    Tu, LiRen; Huda, Nazmul; Grimes, Brenda R; Slee, Roger B; Bates, Alison M; Cheng, Liang; Gilley, David

    2016-05-01

    A critical function of the telomere is to disguise chromosome ends from cellular recognition as double strand breaks, thereby preventing aberrant chromosome fusion events. Such chromosome end-to-end fusions are known to initiate genomic instability via breakage-fusion-bridge cycles. Telomere dysfunction and other forms of genomic assault likely result in misregulation of genes involved in growth control, cell death, and senescence pathways, lowering the threshold to malignancy and likely drive disease progression. Shortened telomeres and anaphase bridges have been reported in a wide variety of early precursor and malignant cancer lesions including those of the prostate. These findings are being extended using methods for the analysis of telomere fusions (decisive genetic markers for telomere dysfunction) specifically within human tissue DNA. Here we report that benign prostatic hyperplasia (BPH), high-grade prostatic intraepithelial neoplasia (PIN), and prostate cancer (PCa) prostate lesions all contain similarly high frequencies of telomere fusions and anaphase bridges. Tumor-adjacent, histologically normal prostate tissue generally did not contain telomere fusions or anaphase bridges as compared to matched PCa tissues. However, we found relatively high levels of telomerase activity in this histologically normal tumor-adjacent tissue that was reduced but closely correlated with telomerase levels in corresponding PCa samples. Thus, we present evidence of high levels of telomere dysfunction in BPH, an established early precursor (PIN) and prostate cancer lesions but not generally in tumor adjacent normal tissue. Our results suggest that telomere dysfunction may be a common gateway event leading to genomic instability in prostate tumorigenesis. . PMID:25917938

  10. Deletion of antigens of the Lewis a/b blood group family in human prostatic carcinoma.

    PubMed Central

    Young, W. W.; Mills, S. E.; Lippert, M. C.; Ahmed, P.; Lau, S. K.

    1988-01-01

    The expression of antigens of the blood group Lewis a/b family were studied in a series of 42 prostatectomy specimens from patients with adenocarcinoma clinically confined to the prostate; 19 of these were later reclassified as pathologic Stage C. Staining of normal or hyperplastic versus neoplastic epithelium was assessed in routinely processed, paraffin-embedded tissue using murine monoclonal antibodies and an avidin-biotin immunoperoxidase technique. Antigens screened and the antibodies used to recognize them were Lewis a (CF4C4), Lewis b and Type 1 H (NS10), monosialosyl Lewis a I (19.9), and disialosyl Lewis a and monosialosyl Lewis a II (FH7). FH7 strongly stained the benign epithelium of all 39 Lewis positive cases, suggesting that the sialyltransferase responsible for synthesis of FH7-reactive determinants is highly active in benign prostatic tissue. When compared to the reactivity of benign epithelium in Lewis positive cases, the staining of the carcinomas was markedly reduced in 18 cases (46%) and absent in 16 cases (41%). This reduction or loss of staining of the malignant epithelium was observed for all antibodies that stained the corresponding benign epithelium of each case. In only five of the cases (13%) was the intensity of staining in the carcinoma equal to that of the surrounding benign epithelium. No cases in this latter group had recurrence of disease, whereas in the other staining groups 25-33% of the cases had recurrences; median follow-up for the entire group was 78 months. No correlation was apparent between Gleason score and the staining pattern with these antigens. In summary, antigens of the Lewis a/b family are deleted in a high percentage of cases of prostatic adenocarcinoma. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:2454582

  11. Classification of normal and malignant human gastric mucosa tissue with confocal Raman microspectroscopy and wavelet analysis

    NASA Astrophysics Data System (ADS)

    Hu, Yaogai; Shen, Aiguo; Jiang, Tao; Ai, Yong; Hu, Jiming

    2008-02-01

    Thirty-two samples from the human gastric mucosa tissue, including 13 normal and 19 malignant tissue samples were measured by confocal Raman microspectroscopy. The low signal-to-background ratio spectra from human gastric mucosa tissues were obtained by this technique without any sample preparation. Raman spectral interferences include a broad featureless sloping background due to fluorescence and noise. They mask most Raman spectral feature and lead to problems with precision and quantitation of the original spectral information. A preprocessed algorithm based on wavelet analysis was used to reduce noise and eliminate background/baseline of Raman spectra. Comparing preprocessed spectra of malignant gastric mucosa tissues with those of counterpart normal ones, there were obvious spectral changes, including intensity increase at ˜1156 cm -1 and intensity decrease at ˜1587 cm -1. The quantitative criterion based upon the intensity ratio of the ˜1156 and ˜1587 cm -1 was extracted for classification of the normal and malignant gastric mucosa tissue samples. This could result in a new diagnostic method, which would assist the early diagnosis of gastric cancer.

  12. Role of Phosphodiesterase 2 in Growth and Invasion of Human Malignant Melanoma Cells

    PubMed Central

    Hiramoto, Kenichi; Murata, Taku; Shimizu, Kasumi; Morita, Hiroshi; Inui, Madoka; Manganiello, Vincent C.; Tagawa, Toshiro; Arai, Naoya

    2014-01-01

    Cyclic nucleotide phosphodiesterases (PDEs) regulate the intracellular concentrations and effects of adenosine 3’,5’-cyclic monophosphate (cAMP) and guanosine 3’,5’-cyclic monophosphate (cGMP). The role of PDEs in malignant tumor cells is still uncertain. The role of PDEs, especially PDE2, in human malignant melanoma PMP cell line was examined in this study. In PMP cells, 8-bromo-cAMP, a cAMP analog, inhibited cell growth and invasion. However, 8-bromo-cGMP, a cGMP analog, had little or no effect. PDE2 and PDE4, but not PDE3, were expressed in PMP cells. Growth and invasion of PMP cells were inhibited by erythro-9-(2-Hydroxy-3-nonyl) adenine (EHNA), a specific PDE2 inhibitor, but not by rolipram, a specific PDE4 inhibitor. Moreover, cell growth and invasion were inhibited by transfection of small interfering RNAs (siRNAs) specific for PDE2A and a catalytically-dead mutant of PDE2A. After treating cells with EHNA or rolipram, intracellular cAMP concentrations were increased. Growth and invasion were stimulated by PKA14-22, a PKA inhibitor, and inhibited by N6-benzoyl-c AMP, a PKA specific cAMP analogue, whereas 8-(4-chlorophenylthio)-2’-O-methyl-cAMP, an Epac specific cAMP analogue, did not. Invasion, but not growth, was stimulated by A-kinase anchor protein (AKAP) St-Ht31 inhibitory peptide. Based on these results, PDE2 appears to play an important role in growth and invasion of the human malignant melanoma PMP cell line. Selectively suppressing PDE2 might possibly inhibit growth and invasion of other malignant tumor cell lines. PMID:24705027

  13. Role of phosphodiesterase 2 in growth and invasion of human malignant melanoma cells.

    PubMed

    Hiramoto, Kenichi; Murata, Taku; Shimizu, Kasumi; Morita, Hiroshi; Inui, Madoka; Manganiello, Vincent C; Tagawa, Toshiro; Arai, Naoya

    2014-09-01

    Cyclic nucleotide phosphodiesterases (PDEs) regulate the intracellular concentrations and effects of adenosine 3',5'-cyclic monophosphate (cAMP) and guanosine 3',5'-cyclic monophosphate (cGMP). The role of PDEs in malignant tumor cells is still uncertain. The role of PDEs, especially PDE2, in human malignant melanoma PMP cell line was examined in this study. In PMP cells, 8-bromo-cAMP, a cAMP analog, inhibited cell growth and invasion. However, 8-bromo-cGMP, a cGMP analog, had little or no effect. PDE2 and PDE4, but not PDE3, were expressed in PMP cells. Growth and invasion of PMP cells were inhibited by erythro-9-(2-hydroxy-3-nonyl) adenine (EHNA), a specific PDE2 inhibitor, but not by rolipram, a specific PDE4 inhibitor. Moreover, cell growth and invasion were inhibited by transfection of small interfering RNAs (siRNAs) specific for PDE2A and a catalytically-dead mutant of PDE2A. After treating cells with EHNA or rolipram, intracellular cAMP concentrations were increased. Growth and invasion were stimulated by PKA14-22, a PKA inhibitor, and inhibited by N(6)-benzoyl-c AMP, a PKA specific cAMP analog, whereas 8-(4-chlorophenylthio)-2'-O-methyl-cAMP, an Epac specific cAMP analog, did not. Invasion, but not growth, was stimulated by A-kinase anchor protein (AKAP) St-Ht31 inhibitory peptide. Based on these results, PDE2 appears to play an important role in growth and invasion of the human malignant melanoma PMP cell line. Selectively suppressing PDE2 might possibly inhibit growth and invasion of other malignant tumor cell lines. PMID:24705027

  14. Bifunctional Phage-Based Pretargeted Imaging of Human Prostate Carcinoma Bifunctional Phage Based Pretargeted Imaging

    PubMed Central

    Newton-Northup, Jessica R.; Figueroa, Said D.; Quinn, Thomas P.; Deutscher, Susan L.

    2009-01-01

    Introduction Two-step and three-step pretargeting systems utilizing biotinylated prostate tumor-homing bacteriophage (phage) and 111In-radiolabeled- streptavidin or biotin were developed for use in cancer radioimaging. The in vivo selected prostate carcinoma-specific phage (G1) displaying up to five copies of the peptide IAGLATPGWSHWLAL, was the focus of the present study. Methods The ability of G1 phage to extravasate and target prostate tumor cells was investigated using immunohistochemistry. G1 phage were biotinylated, streptavidin was conjugated to diethylenetriaminepentaacetic acid (DTPA), and biotin was conjugated to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA). Biodistribution studies and single photon emission computed tomography (SPECT)/CT imaging of xenografted PC-3 tumors via two-step pretargeted 111In-labeled streptavidin and three-step pretargeted 111In-labeled biotin were performed in SCID mice to determine the optimal pretargeting method. Results The ability of G1 phage to extravasate the vasculature and bind directly to human PC-3 prostate carcinoma tumor cells in vivo was demonstrated via immunocytochemical analysis. Comparative biodistribution studies of the two-step and three-step pretargeting strategies indicated increased PC-3 human prostate carcinoma tumor uptake in SCID mice of 4.34 ±0.26 %ID/g at 0.5 hours post-injection of 111In radiolabeled biotin (utilized in a three-step protocol) compared to that of 0.67 ±0.06 %ID/g at twenty four hour postinjection of 111In radiolabeled streptavidin (employed in a two-step protocol). In vivo SPECT/CT imaging of xenografted PC-3 tumors in SCID mice with the three-step pretargeting method was superior to that of the two-step pretargeting method, and, importantly, blocking studies demonstrated specificity of tumor uptake of 111In-labeled biotin in the three-step pretargeting scheme. Conclusion This study demonstrates the use of multivalent bifunctional phage in a three

  15. Extracts of various species of Epilobium inhibit proliferation of human prostate cells.

    PubMed

    Vitalone, Annabella; Guizzetti, Marina; Costa, Lucio G; Tita, Beatrice

    2003-05-01

    This study examined whether various species of Epilobium, a phytotherapeutic agent used in folk medicine as a treatment for benign prostatic hyperplasia, may have an antiproliferative effect in PZ-HPV-7 human prostatic epithelial cells in-vitro. The MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide) test, [methyl-(3)H]thymidine incorporation into DNA and flow cytometry analysis were used to evaluate cell proliferation. Ethanolic extracts of E. spicatum, E. rosmarinifolium and E. tetragonum inhibited DNA synthesis in PZ-HPV-7 cells. While at high concentrations all extracts were cytotoxic, DNA synthesis was also decreased at levels that caused no or little cytotoxicity. Treatment of cells with Epilobium extracts did not result in a formation of DNA fragments (evaluated by the TUNEL assay) or chromatin condensation (assessed by Hoechst staining). Flow cytometry analysis indicated that Epilobium extracts inhibit the progression of the cell cycle from the G(0)/G(1) phase. These results suggest that extracts of Epilobium inhibit proliferation of human PZ-HPV-7 cells in-vitro by affecting progression of the cell cycle. This study provides some initial biological plausibility for the use of Epilobium extracts in benign prostatic hyperplasia. PMID:12831512

  16. Decreased sensitivity to aspirin is associated with altered polyamine metabolism in human prostate cancer cells.

    PubMed

    Li, Jun; Cameron, Gary A; Wallace, Heather M

    2016-04-01

    Aspirin is a well-known analgesic, anti-inflammatory and antipyretic drug and is recognised as a chemopreventative agent in cardiovascular disease and, more recently, in colorectal cancer. Although several studies indicate that aspirin is capable of reducing the risk of developing cancers, there is a lack of convincing evidence that aspirin can prevent prostate cancer in man. In this study, aspirin was shown to be an effective inhibitor of the growth of human prostate cancer cells. In order to investigate the link between polyamine catabolism and the effects of aspirin we used a "Tet off" system that induced the activity of spermidine/spermine N (1)-acetyltransferase (SSAT) in human prostate cancer cells (LNCap). Treatment with aspirin was found to decrease induced SSAT activity in these cells. A negative correlation was observed between increased polyamine catabolism via increased SSAT activity and the sensitivity to aspirin. In the presence of increased SSAT activity high amounts of N (1)-acetylspermidine and putrescine were observed. These cells were also found to grow more slowly than the non-induced cells. The results indicate that SSAT and its related polyamine metabolism may play a key role in sensitivity of cancer cells to aspirin and possibly other NSAIDs and this may have implications for the development of novel chemopreventative agents. PMID:26704566

  17. The hedgehog/Gli signaling paradigm in prostate cancer

    PubMed Central

    Chen, Mengqian; Carkner, Richard; Buttyan, Ralph

    2011-01-01

    Hedgehog is a ligand-activated signaling pathway that regulates Gli-mediated transcription. Although most noted for its role as an embryonic morphogen, hyperactive hedgehog also causes human skin and brain malignancies. The hedgehog-related gene anomalies found in these tumors are rarely found in prostate cancer. Yet surveys of human prostate tumors show concordance of high expression of hedgehog ligands and Gli2 that correlate with the potential for metastasis and therapy-resistant behavior. Likewise, prostate cancer cell lines express hedgehog target genes, and their growth and survival is affected by hedgehog/Gli inhibitors. To date, the preponderance of data supports the idea that prostate tumors benefit from a paracrine hedgehog microenvironment similar to the developing prostate. Uncertainty remains as to whether hedgehog’s influence in prostate cancer also includes aspects of tumor cell autocrine-like signaling. The recent findings that Gli proteins interact with the androgen receptor and affect its transcriptional output have helped to identify a novel pathway through which hedgehog/Gli might affect prostate tumor behavior and raises questions as to whether hedgehog signaling in prostate cancer cells is suitably measured by the expression of Gli target genes alone. PMID:21776292

  18. Loss of JUNB/AP-1 promotes invasive prostate cancer

    PubMed Central

    Thomsen, M K; Bakiri, L; Hasenfuss, S C; Wu, H; Morente, M; Wagner, E F

    2015-01-01

    Prostate cancer is a frequent cause of male death in the Western world. Relatively few genetic alterations have been identified, likely owing to disease heterogeneity. Here, we show that the transcription factor JUNB/AP-1 limits prostate cancer progression. JUNB expression is increased in low-grade prostate cancer compared with normal human prostate, but downregulated in high-grade samples and further decreased in all metastatic samples. To model the hypothesis that this downregulation is functionally significant, we genetically inactivated Junb in the prostate epithelium of mice. When combined with Pten (phosphatase and tensin homologue) loss, double-mutant mice were prone to invasive cancer development. Importantly, invasive tumours also developed when Junb and Pten were inactivated in a small cell population of the adult anterior prostate by topical Cre recombinase delivery. The resulting tumours displayed strong histological similarity with human prostate cancer. Loss of JunB expression led to increased proliferation and decreased senescence, likely owing to decreased p16Ink4a and p21CIP1 in epithelial cells. Furthermore, the tumour stroma was altered with increased osteopontin and S100 calcium-binding protein A8/9 expression, which correlated with poor prognoses in patients. These data demonstrate that JUNB/AP-1 cooperates with PTEN signalling as barriers to invasive prostate cancer, whose concomitant genetic or epigenetic suppression induce malignant progression. PMID:25526087

  19. Loss of JUNB/AP-1 promotes invasive prostate cancer.

    PubMed

    Thomsen, M K; Bakiri, L; Hasenfuss, S C; Wu, H; Morente, M; Wagner, E F

    2015-04-01

    Prostate cancer is a frequent cause of male death in the Western world. Relatively few genetic alterations have been identified, likely owing to disease heterogeneity. Here, we show that the transcription factor JUNB/AP-1 limits prostate cancer progression. JUNB expression is increased in low-grade prostate cancer compared with normal human prostate, but downregulated in high-grade samples and further decreased in all metastatic samples. To model the hypothesis that this downregulation is functionally significant, we genetically inactivated Junb in the prostate epithelium of mice. When combined with Pten (phosphatase and tensin homologue) loss, double-mutant mice were prone to invasive cancer development. Importantly, invasive tumours also developed when Junb and Pten were inactivated in a small cell population of the adult anterior prostate by topical Cre recombinase delivery. The resulting tumours displayed strong histological similarity with human prostate cancer. Loss of JunB expression led to increased proliferation and decreased senescence, likely owing to decreased p16(Ink4a) and p21(CIP1) in epithelial cells. Furthermore, the tumour stroma was altered with increased osteopontin and S100 calcium-binding protein A8/9 expression, which correlated with poor prognoses in patients. These data demonstrate that JUNB/AP-1 cooperates with PTEN signalling as barriers to invasive prostate cancer, whose concomitant genetic or epigenetic suppression induce malignant progression. PMID:25526087

  20. Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.

    2001-01-01

    It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.

  1. Intraprostatic injection of botulinum toxin type- A relieves bladder outlet obstruction in human and induces prostate apoptosis in dogs

    PubMed Central

    Chuang, Yao-Chi; Tu, Chieh-Hsien; Huang, Chao-Cheng; Lin, Hsin-Ju; Chiang, Po-Hui; Yoshimura, Naoki; Chancellor, Michael B

    2006-01-01

    Background With the increasing interest with botulinum toxin – A (BTX-A) application in the lower urinary tract, we investigated the BTX-A effects on the canine prostate and also in men with bladder outlet obstruction (BOO) due to benign prostatic hyperplasia (BPH). Methods Transperineal injection into the prostate using transrectal ultrasound (TRUS) was performed throughout the study. Saline with or without 100 U of BTX-A was injected into mongrel dogs prostate. One or 3 months later, the prostate was harvested for morphologic and apoptotic study. In addition, eight BPH patients refractory to α-blockers were treated with ultrasound guided intraprostatic injection of 200 U of BTX-A. Results In the BTX-A treated dogs, atrophy and diffuse apoptosis was observed with H&E stain and TUNEL stain at 1 and 3 months. Clinically, the mean prostate volume, symptom score, and quality of life index were significantly reduced by 18.8%, 73.1%, and 61.5% respectively. Maximal flow rate significantly increased by 72.0%. Conclusion Intraprostatic BTX-A injection induces prostate apotosis in dogs and relieves BOO in humans. It is therefore a promising alternative treatment for refractory BOO due to BPH. PMID:16620393

  2. Dynamic holographic endoscopy--ex vivo investigations of malignant tumors in the human stomach.

    PubMed

    Avenhaus, Wolfgang; Kemper, Björn; Knoche, Sabine; Domagk, Dirk; Poremba, Christopher; von Bally, Gert; Domschke, Wolfram

    2005-01-01

    Laser holographic interferometry is based on the superimposition of the holograms of different motional states of an object on a single holographic storing medium. Using a combination of holographic interferometry and endoscopic imaging, we tried to detect areas of focally disturbed tissue elasticity in gastric cancer preparations. By connecting a mobile electronic speckle pattern interferometry (ESPI) camera system (light source: double frequency Nd:YAG laser, lambda = 532 nm) to different types of endoscopes, ex vivo experiments were performed on ten formalin fixed human stomachs, nine containing adenocarcinomas and one with a gastric lymphoma. Linking the endoscopic ESPI camera complex to a fast image processing system, the method of double pulse exposure image subtraction was applied at a video frame rate of 12.5 Hz. Speckle correlation patterns and corresponding phase difference distributions resulting from gastric wall deformation by gentle touch with a guide wire were analyzed. Tumor-free gastric areas showed high-contrast concentric fringes around the point of stimulation. In contrast, fringe patterns and filtered phase difference distributions corresponding to the areas of malignancy in all the cases were characterized by largely parallel lines, indicating that stimulation of rigid tumor tissue primarily led to tilting. Our ex vivo investigations of malignant gastric tumors show that the application of dynamic holographic endoscopy makes it possible to distinguish areas of malignancy from surrounding healthy tissue based on the differences in tissue elasticity. PMID:15726298

  3. Expression of cyclin D1 correlates with malignancy in human ovarian tumours.

    PubMed Central

    Barbieri, F.; Cagnoli, M.; Ragni, N.; Pedullà, F.; Foglia, G.; Alama, A.

    1997-01-01

    Cyclin D1 is a cell cycle regulator of G1 progression that has been suggested to play a relevant role in the pathogenesis of several human cancer types. In the current study, the expression of cyclin D1 has been investigated in a series of 33 patients, with benign (10 patients), borderline (five patients) and malignant (18 patients) ovarian disease. Cyclin D1 protein and mRNA content were analysed by Western blotting and reverse transcriptase polymerase chain reaction respectively. The levels of cyclin D1 protein were undetectable in patients with benign disease, detectable in the majority of patients with borderline disease and elevated in those with ovarian carcinomas, being significantly related to the degree of malignancy (carcinoma vs benign, P = 0.0001; benign vs borderline, P = 0.0238). A significant relationship between cyclin D1 expression and tumour proliferative activity was also found (P = 0.000001). Moreover, eight benign lesions, two borderline tumours and 11 carcinomas proved to be suitable for the analysis of cyclin D1 transcript, and emerging data demonstrated significant agreement between protein abundance and mRNA expression. Results from the current study suggest that cyclin D1 expression is associated with the degree of transformation and most probably plays a role in the early development of ovarian malignancy. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:9155044

  4. GPNMB/OA protein increases the invasiveness of human metastatic prostate cancer cell lines DU145 and PC3 through MMP-2 and MMP-9 activity

    SciTech Connect

    Fiorentini, Chiara; Bodei, Serena; Bedussi, Francesca; Fragni, Martina; Bonini, Sara Anna; Simeone, Claudio; Zani, Danilo; Berruti, Alfredo; Missale, Cristina; Memo, Maurizio; Spano, PierFranco; Sigala, Sandra

    2014-04-15

    Non-metastatic glycoprotein melanoma protein B (GPNMB), also known as osteoactivin (OA) is expressed in a wide array of tumors and represents an emerging target for drug development. In this study, we investigated the role of GPNMB/OA in the progression of human metastatic DU145 and PC3 prostate cancer cells. GPNMB/OA contribution in PCa malignant phenotype has been analyzed by small interfering RNA-induced GPNMB/OA silencing. We found that following GPNMB/OA silencing the migration capability of both DU145 and PC3 cells, evaluated by using in vitro invasivity assay, as well as the metalloproteinases MMP-2 and MMP-9 activity were equally strongly inhibited. By contrast knocking down GPNMB/OA weakly attenuated cell proliferation rate of DU145, an effect that paralleled with an increase number of apoptotic cells. However, PC3 cell growth seems to be not affected by GPNMB/OA. Together, these data reveal that GPNMB/OA acts as a critical molecular mediator promoting the acquisition of the more aggressive, pro-metastatic phenotype distinctive of human DU145 and PC3 cell lines. - Highlights: • GPNMB/OA expression correlates with DU145 and PC3 cells malignant phenotype. • GPNMB/OA silencing affects the migration capability of both DU145 and PC3 cells. • GPNMB/OA increases invasiveness by up-regulating MMPs activity. • GPNMB/OA promotes DU145 and PC3 cells progression into a more aggressive phenotype.

  5. Human lung epithelial cells progressed to malignancy through specific oncogenic manipulations

    PubMed Central

    Sato, Mitsuo; Larsen, Jill E.; Lee, Woochang; Sun, Han; Shames, David S.; Dalvi, Maithili P.; Ramirez, Ruben D.; Tang, Hao; DiMaio, J. Michael; Gao, Boning; Xie, Yang; Wistuba, Ignacio I.; Gazdar, Adi F.; Shay, Jerry W.; Minna, John D.

    2013-01-01

    We used CDK4/hTERT-immortalized normal human bronchial epithelial cells (HBECs) from several individuals to study lung cancer pathogenesis by introducing combinations of common lung cancer oncogenic changes (p53, KRAS, MYC) and followed the stepwise transformation of HBECs to full malignancy. This model demonstrated that: 1) the combination of five genetic alterations (CDK4, hTERT, sh-p53, KRASV12, and c-MYC) is sufficient for full tumorigenic conversion of HBECs; 2) genetically-identical clones of transformed HBECs exhibit pronounced differences in tumor growth, histology, and differentiation; 3) HBECs from different individuals vary in their sensitivity to transformation by these oncogenic manipulations; 4) high levels of KRASV12 are required for full malignant transformation of HBECs, however prior loss of p53 function is required to prevent oncogene-induced senescence; 5) over-expression of c-MYC greatly enhances malignancy but only in the context of sh-p53+KRASV12; 6) growth of parental HBECs in serum-containing medium induces differentiation while growth of oncogenically manipulated HBECs in serum increases in vivo tumorigenicity, decreases tumor latency, produces more undifferentiated tumors, and induces epithelial-to-mesenchymal transition (EMT); 7) oncogenic transformation of HBECs leads to increased sensitivity to standard chemotherapy doublets; 8) an mRNA signature derived by comparing tumorigenic vs. non-tumorigenic clones was predictive of outcome in lung cancer patients. Collectively, our findings demonstrate this HBEC model system can be used to study the effect of oncogenic mutations, their expression levels, and serum-derived environmental effects in malignant transformation, while also providing clinically translatable applications such as development of prognostic signatures and drug response phenotypes. PMID:23449933

  6. p27 modulates cell cycle progression and chemosensitivity in human malignant glioma.

    PubMed

    Naumann, U; Weit, S; Rieger, L; Meyermann, R; Weller, M

    1999-08-11

    The cell cycle regulatory protein p27, an inhibitor of cyclin-dependent kinases (CDK), has been attributed a role in (i) prognosis in breast and colon cancer, (ii) induction of apoptosis in cancer cells, and (iii) resistance to cancer chemotherapy. Here we report that p27 is widely expressed in human malignant gliomas in vivo and in glioma cell lines in vitro. Serum deprivation or confluency promotes p27 protein accumulation in vitro. Neither baseline p27 levels nor p27 levels induced by confluency or serum deprivation correlate with p53 status or drug sensitivity of human glioma cell lines. Expression of antisense p27 mRNA increased the doubling times in T98G glioma cells, whereas sense p27 mRNA had no such effect. There was a density-dependent and drug-specific modulation of chemosensitivity by sense or antisense mRNA expression in T98G cells. Taken together, these data define a strong p27 response to altered growth conditions and suggest a role for p27 in modulating response to chemotherapy in human malignant glioma cells. PMID:10441521

  7. Defined conditions for the isolation and expansion of basal prostate progenitor cells of mouse and human origin.

    PubMed

    Höfner, Thomas; Eisen, Christian; Klein, Corinna; Rigo-Watermeier, Teresa; Goeppinger, Stephan M; Jauch, Anna; Schoell, Brigitte; Vogel, Vanessa; Noll, Elisa; Weichert, Wilko; Baccelli, Irène; Schillert, Anja; Wagner, Steve; Pahernik, Sascha; Sprick, Martin R; Trumpp, Andreas

    2015-03-10

    Methods to isolate and culture primary prostate epithelial stem/progenitor cells (PESCs) have proven difficult and ineffective. Here, we present a method to grow and expand both murine and human basal PESCs long term in serum- and feeder-free conditions. The method enriches for adherent mouse basal PESCs with a Lin(-)SCA-1(+)CD49f(+)TROP2(high) phenotype. Progesterone and sodium selenite are additionally required for the growth of human Lin(-)CD49f(+)TROP2(high) PESCs. The gene-expression profiles of expanded basal PESCs show similarities to ESCs, and NF-kB function is critical for epithelial differentiation of sphere-cultured PESCs. When transplanted in combination with urogenital sinus mesenchyme, expanded mouse and human PESCs generate ectopic prostatic tubules, demonstrating their stem cell activity in vivo. This novel method will facilitate the molecular, genomic, and functional characterization of normal and pathologic prostate glands of mouse and human origin. PMID:25702639

  8. Human malignant mesothelioma is recapitulated in immunocompetent BALB/c mice injected with murine AB cells

    PubMed Central

    Mezzapelle, Rosanna; Rrapaj, Eltjona; Gatti, Elena; Ceriotti, Chiara; Marchis, Francesco De; Preti, Alessandro; Spinelli, Antonello E.; Perani, Laura; Venturini, Massimo; Valtorta, Silvia; Moresco, Rosa Maria; Pecciarini, Lorenza; Doglioni, Claudio; Frenquelli, Michela; Crippa, Luca; Recordati, Camilla; Scanziani, Eugenio; de Vries, Hilda; Berns, Anton; Frapolli, Roberta; Boldorini, Renzo; D’Incalci, Maurizio; Bianchi, Marco E.; Crippa, Massimo P.

    2016-01-01

    Malignant Mesothelioma is a highly aggressive cancer, which is difficult to diagnose and treat. Here we describe the molecular, cellular and morphological characterization of a syngeneic system consisting of murine AB1, AB12 and AB22 mesothelioma cells injected in immunocompetent BALB/c mice, which allows the study of the interplay of tumor cells with the immune system. Murine mesothelioma cells, like human ones, respond to exogenous High Mobility Group Box 1 protein, a Damage-Associated Molecular Pattern that acts as a chemoattractant for leukocytes and as a proinflammatory mediator. The tumors derived from AB cells are morphologically and histologically similar to human MM tumors, and respond to treatments used for MM patients. Our system largely recapitulates human mesothelioma, and we advocate its use for the study of MM development and treatment. PMID:26961782

  9. Human malignant mesothelioma is recapitulated in immunocompetent BALB/c mice injected with murine AB cells.

    PubMed

    Mezzapelle, Rosanna; Rrapaj, Eltjona; Gatti, Elena; Ceriotti, Chiara; Marchis, Francesco De; Preti, Alessandro; Spinelli, Antonello E; Perani, Laura; Venturini, Massimo; Valtorta, Silvia; Moresco, Rosa Maria; Pecciarini, Lorenza; Doglioni, Claudio; Frenquelli, Michela; Crippa, Luca; Recordati, Camilla; Scanziani, Eugenio; de Vries, Hilda; Berns, Anton; Frapolli, Roberta; Boldorini, Renzo; D'Incalci, Maurizio; Bianchi, Marco E; Crippa, Massimo P

    2016-01-01

    Malignant Mesothelioma is a highly aggressive cancer, which is difficult to diagnose and treat. Here we describe the molecular, cellular and morphological characterization of a syngeneic system consisting of murine AB1, AB12 and AB22 mesothelioma cells injected in immunocompetent BALB/c mice, which allows the study of the interplay of tumor cells with the immune system. Murine mesothelioma cells, like human ones, respond to exogenous High Mobility Group Box 1 protein, a Damage-Associated Molecular Pattern that acts as a chemoattractant for leukocytes and as a proinflammatory mediator. The tumors derived from AB cells are morphologically and histologically similar to human MM tumors, and respond to treatments used for MM patients. Our system largely recapitulates human mesothelioma, and we advocate its use for the study of MM development and treatment. PMID:26961782

  10. Short Chain Fatty Acids (SCFA) Reprogram Gene Expression in Human Malignant Epithelial and Lymphoid Cells.

    PubMed

    Astakhova, Lidiia; Ngara, Mtakai; Babich, Olga; Prosekov, Aleksandr; Asyakina, Lyudmila; Dyshlyuk, Lyubov; Midtvedt, Tore; Zhou, Xiaoying; Ernberg, Ingemar; Matskova, Liudmila

    2016-01-01

    The effect of short chain fatty acids (SCFAs) on gene expression in human, malignant cell lines was investigated, with a focus on signaling pathways. The commensal microbial flora produce high levels of SCFAs with established physiologic effects in humans. The most abundant SCFA metabolite in the human microflora is n-butyric acid. It is well known to activate endogenous latent Epstein-Barr virus (EBV), that was used as a reference read out system and extended to EBV+ epithelial cancer cell lines. N-butyric acid and its salt induced inflammatory and apoptotic responses in tumor cells of epithelial and lymphoid origin. Epithelial cell migration was inhibited. The n-butyric gene activation was reduced by knock-down of the cell membrane transporters MCT-1 and -4 by siRNA. N-butyric acid show biologically significant effects on several important cellular functions, also with relevance for tumor cell phenotype. PMID:27441625

  11. Short Chain Fatty Acids (SCFA) Reprogram Gene Expression in Human Malignant Epithelial and Lymphoid Cells

    PubMed Central

    Astakhova, Lidiia; Ngara, Mtakai; Babich, Olga; Prosekov, Aleksandr; Asyakina, Lyudmila; Dyshlyuk, Lyubov; Midtvedt, Tore; Zhou, Xiaoying; Ernberg, Ingemar; Matskova, Liudmila

    2016-01-01

    The effect of short chain fatty acids (SCFAs) on gene expression in human, malignant cell lines was investigated, with a focus on signaling pathways. The commensal microbial flora produce high levels of SCFAs with established physiologic effects in humans. The most abundant SCFA metabolite in the human microflora is n-butyric acid. It is well known to activate endogenous latent Epstein-Barr virus (EBV), that was used as a reference read out system and extended to EBV+ epithelial cancer cell lines. N-butyric acid and its salt induced inflammatory and apoptotic responses in tumor cells of epithelial and lymphoid origin. Epithelial cell migration was inhibited. The n-butyric gene activation was reduced by knock-down of the cell membrane transporters MCT-1 and -4 by siRNA. N-butyric acid show biologically significant effects on several important cellular functions, also with relevance for tumor cell phenotype. PMID:27441625

  12. Suppression of β-catenin Signaling Pathway in Human Prostate Cancer PC3 Cells by Delphinidin

    PubMed Central

    Lee, Wooje; Yun, Jung-Mi

    2016-01-01

    Delphinidin possesses strong anti-oxidant, anti-inflammatory, and anti-cancer properties. Suppression of the Wnt/β-catenin signaling pathway is a potential strategy for chemoprevention and therapy. As aberrant activation of the β-catenin signaling pathway contributes to prostate cancer progression, we evaluated the effect of delphinidin on this pathway in human PC3 prostate cancer cells. An MTT assay showed that treatment with delphinidin (15–180 μM, 72 hours) resulted in a dose-dependent growth inhibition of cells. Treatment with delphinidin increased the phosphorylation of serine or threonine residues on β-catenin and decreased the levels of cytoplasmic β-catenin. Moreover, treatment with delphinidin inhibited the nuclear translocation of β-catenin and the expression of β-catenin target genes such as cyclin D1, c-myc, Axin-2, and T cell factor-1. Delphinidin also induced the phosphorylation of glycogen synthase kinase 3β and the expression of adenomatous polyposis coli and Axin proteins. Our results indicate that inhibition of cell growth by delphinidin is mediated, at least in part, through modulation of the β-catenin signaling pathway. We suggest that delphinidin is a potent inhibitor of Wnt/β-catenin signaling in prostate cancer cells. PMID:27390740

  13. Transceive surface coil array for MRI of the human prostate at 4T.

    PubMed

    Pinkerton, Robert G; Near, James P; Barberi, Enzo A; Menon, Ravi S; Bartha, Robert

    2007-02-01

    A novel torso transceive surface coil array for prostate magnetic resonance imaging (MRI) and spectroscopy (MRS) at 4T is presented. It is shown that with the use of a conformal transceive surface coil array with 50 Omega transmitter amplifiers and receiver preamplifiers, one can perform whole-volume torso imaging while maintaining the high signal-to-noise ratio (SNR) inherent to surface coil designs. Recent theoretical considerations have shown that by focusing the infringing radiofrequency (RF) electromagnetic field, one can achieve increased penetration and signal homogeneity compared to a conventional circularly polarized driving scheme. A variation of this driving scheme particular to the proposed coil design resulted in a twofold increase in SNR in the prostate compared to that achieved with a conventional circularly polarized driving scheme. The novel transceive surface coil array presented is capable of full-volume imaging of the human torso at 4T while maintaining signal penetration in the deep region of the prostate gland. PMID:17260367

  14. Tocopherols and saponins derived from Argania spinosa exert, an antiproliferative effect on human prostate cancer.

    PubMed

    Drissi, A; Bennani, H; Giton, F; Charrouf, Z; Fiet, J; Adlouni, A

    2006-10-01

    The aim of our study is to evaluate the antiproliferative effect of tocopherols obtained from alimentary virgin argan oil extracted from the endemic argan tree of Morocco and of saponins extracted from argan press cake on three human prostatic cell lines (DU145, LNCaP, and PC3). The results were compared to 2-methoxyestradiol as antiproliferative drug candidates. Cytotoxicity and antiproliferative effects were investigated after cells' treatment with tocopherols and saponins compared to 2-Methoxyoestradiol as the positive control. Tocopherols and saponins extracted from argan tree and 2-methoxyestradiol exhibit a dose-response cytotoxic effect and an antiproliferative action on the tested cell lines. The best antiproliferative effect of tocopherols is obtained with DU145 and LNCaP cell lines (28 microg/ml and 32 microg/ml, respectively, as GI50). The saponins fraction displayed the best antiproliferative effect on the PC3 cell line with 18 microg/ml as GI50. Our results confirm the antiproliferative effect of 2-methoxyestradiol and show for the first time the antiproliferative effect of tocopherols and saponins extracted from the argan tree on hormone-dependent and hormone-independent prostate cancer cell lines. These data suggest that argan oil is of potential interest in developing new strategies for prostate cancer prevention. PMID:16982463

  15. Genetic deletion of osteopontin in TRAMP mice skews prostate carcinogenesis from adenocarcinoma to aggressive human-like neuroendocrine cancers

    PubMed Central

    Mauri, Giorgio; Jachetti, Elena; Comuzzi, Barbara; Dugo, Matteo; Arioli, Ivano; Miotti, Silvia; Sangaletti, Sabina; Di Carlo, Emma; Tripodo, Claudio; Colombo, Mario P.

    2016-01-01

    Osteopontin (OPN) is a secreted glycoprotein, that belongs to the non-structural extracellular matrix (ECM), and its over expression in human prostate cancer has been associated with disease progression, androgen independence and metastatic ability. Nevertheless, the pathophysiology of OPN in prostate tumorigenesis has never been studied. We crossed TRansgenic Adenocarcinoma of the Mouse Prostate (TRAMP) mice with OPN deficient (OPN−/−) mice and followed tumor onset and progression in these double mutants. Ultrasound examination detected the early onset of a rapidly growing, homogeneous and spherical tumor in about 60% of OPN−/− TRAMP mice. Such neoplasms seldom occurred in parental TRAMP mice otherwise prone to adenocarcinomas and were characterized for being androgen receptor negative, highly proliferative and endowed with neuroendocrine (NE) features. Gene expression profiling showed up-regulation of genes involved in tumor progression, cell cycle and neuronal differentiation in OPN-deficient versus wild type TRAMP tumors. Down-regulated genes included key genes of TGFa pathway, including SMAD3 and Filamin, which were confirmed at the protein level. Furthermore, NE genes and particularly those characterizing early prostatic lesions of OPN-deficient mice were found to correlate with those of human prostate NE tumours. These data underscore a novel role of OPN in the early stages of prostate cancer growth, protecting against the development of aggressive NE tumors. PMID:26700622

  16. Genetic deletion of osteopontin in TRAMP mice skews prostate carcinogenesis from adenocarcinoma to aggressive human-like neuroendocrine cancers.

    PubMed

    Mauri, Giorgio; Jachetti, Elena; Comuzzi, Barbara; Dugo, Matteo; Arioli, Ivano; Miotti, Silvia; Sangaletti, Sabina; Di Carlo, Emma; Tripodo, Claudio; Colombo, Mario P

    2016-01-26

    Osteopontin (OPN) is a secreted glycoprotein, that belongs to the non-structural extracellular matrix (ECM), and its over expression in human prostate cancer has been associated with disease progression, androgen independence and metastatic ability. Nevertheless, the pathophysiology of OPN in prostate tumorigenesis has never been studied. We crossed TRansgenic Adenocarcinoma of the Mouse Prostate (TRAMP) mice with OPN deficient (OPN-/-) mice and followed tumor onset and progression in these double mutants. Ultrasound examination detected the early onset of a rapidly growing, homogeneous and spherical tumor in about 60% of OPN-/- TRAMP mice. Such neoplasms seldom occurred in parental TRAMP mice otherwise prone to adenocarcinomas and were characterized for being androgen receptor negative, highly proliferative and endowed with neuroendocrine (NE) features. Gene expression profiling showed up-regulation of genes involved in tumor progression, cell cycle and neuronal differentiation in OPN-deficient versus wild type TRAMP tumors. Down-regulated genes included key genes of TGFa pathway, including SMAD3 and Filamin, which were confirmed at the protein level. Furthermore, NE genes and particularly those characterizing early prostatic lesions of OPN-deficient mice were found to correlate with those of human prostate NE tumours. These data underscore a novel role of OPN in the early stages of prostate cancer growth, protecting against the development of aggressive NE tumors. PMID:26700622

  17. ETM study of electroporation influence on cell morphology in human malignant melanoma and human primary gingival fibroblast cells

    PubMed Central

    Skolucka, Nina; Daczewska, Malgorzata; Saczko, Jolanta; Chwilkowska, Agnieszka; Choromanska, Anna; Kotulska, Malgorzata; Kaminska, Iwona; Kulbacka, Julita

    2011-01-01

    Objective To estimate electroporation (EP) influence on malignant and normal cells. Methods Two cell lines including human malignant melanoma (Me-45) and normal human gingival fibroblast (HGFs) were used. EP parameters were the following: 250, 1 000, 1 750, 2 500 V/cm; 50 µs by 5 impulses for every case. The viability of cells after EP was estimated by MTT assay. The ultrastructural analysis was observed by transmission electron microscope (Zeiss EM 900). Results In the current study we observed the intracellular effect following EP on Me-45 and HGF cells. At the conditions applied, we did not observe any significant damage of mitochondrial activity in both cell lines treated by EP. Conversely, we showed that EP in some conditions can stimulate cells to proliferation. Some changes induced by EP were only visible in electron microscopy. In fibroblast cells we observed significant changes in lower parameters of EP (250 and 1 000 V/cm). After applying higher electric field intensities (2 500 V/cm) we detected many vacuoles, myelin-like bodies and swallowed endoplasmic reticulum. In melanoma cells such strong pathological modifications after EP were not observed, in comparison with control cells. The ultrastructure of both treated cell lines was changed according to the applied parameters of EP. Conclusions We can claim that EP conditions are cell line dependent. In terms of the intracellular morphology, human fibroblasts are more sensitive to electric field as compared with melanoma cells. Optimal conditions should be determined for each cell line. Summarizing our study, we can conclude that EP is not an invasive method for human normal and malignant cells. This technique can be safely applied in chemotherapy for delivering drugs into tumor cells. PMID:23569735

  18. Activated α2-Macroglobulin Binding to Human Prostate Cancer Cells Triggers Insulin-like Responses

    PubMed Central

    Misra, Uma Kant; Pizzo, Salvatore Vincent

    2015-01-01

    Ligation of cell surface GRP78 by activated α2-macroglobulin (α2M*) promotes cell proliferation and suppresses apoptosis. α2M*-treated human prostate cancer cells exhibit a 2–3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α2M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α2M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α2M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α2M* induces a 2–3-fold increase in lipogenesis as determined by 6-[14C]glucose or 1-[14C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [14CH3]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α2M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy. PMID:25720493

  19. Activated α2-macroglobulin binding to human prostate cancer cells triggers insulin-like responses.

    PubMed

    Misra, Uma Kant; Pizzo, Salvatore Vincent

    2015-04-10

    Ligation of cell surface GRP78 by activated α2-macroglobulin (α2M*) promotes cell proliferation and suppresses apoptosis. α2M*-treated human prostate cancer cells exhibit a 2-3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α2M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α2M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α2M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α2M* induces a 2-3-fold increase in lipogenesis as determined by 6-[(14)C]glucose or 1-[(14)C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [(14)CH3]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α2M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy. PMID:25720493

  20. Expression of protein kinase A regulatory subunits in benign and malignant human thyroid tissues: A systematic review.

    PubMed

    Del Gobbo, Alessandro; Peverelli, Erika; Treppiedi, Donatella; Lania, Andrea; Mantovani, Giovanna; Ferrero, Stefano

    2016-08-01

    In this review, we discuss the molecular mechanisms and prognostic implications of the protein kinase A (PKA) signaling pathway in human tumors, with special emphasis on the malignant thyroid. The PKA signaling pathway is differentially activated by the expression of regulatory subunits 1 (R1) and 2 (R2), whose levels change during development, differentiation, and neoplastic transformation. Following the identification of gene mutations within the PKA regulatory subunit R1A (PRKAR1A) that cause Carney complex-associated neoplasms, several investigators have studied PRKAR1A expression in sporadic thyroid tumors. The PKA regulatory subunit R2B (PRKAR2B) is highly expressed in benign, as well as in malignant differentiated and undifferentiated lesions. PRKAR1A is highly expressed in follicular adenomas and malignant lesions with a statistically significant gradient between benign and malignant tumors; however, it is not expressed in hyperplastic nodules. Although the importance of PKA in human malignancy outcomes is not completely understood, PRKAR1A expression correlates with tumor dimension in malignant lesions. Additional studies are needed to determine whether a relationship exists between PKA subunit expression and clinical outcomes, particularly in undifferentiated tumors. In conclusion, the R1A subunit might be a good molecular candidate for the targeted treatment of malignant thyroid tumors. PMID:27321957

  1. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  2. MicroRNAs Induce Epigenetic Reprogramming and Suppress Malignant Phenotypes of Human Colon Cancer Cells.

    PubMed

    Ogawa, Hisataka; Wu, Xin; Kawamoto, Koichi; Nishida, Naohiro; Konno, Masamitsu; Koseki, Jun; Matsui, Hidetoshi; Noguchi, Kozou; Gotoh, Noriko; Yamamoto, Tsuyoshi; Miyata, Kanjiro; Nishiyama, Nobuhiro; Nagano, Hiroaki; Yamamoto, Hirofumi; Obika, Satoshi; Kataoka, Kazunori; Doki, Yuichiro; Mori, Masaki; Ishii, Hideshi

    2015-01-01

    Although cancer is a genetic disease, epigenetic alterations are involved in its initiation and progression. Previous studies have shown that reprogramming of colon cancer cells using Oct3/4, Sox2, Klf4, and cMyc reduces cancer malignancy. Therefore, cancer reprogramming may be a useful treatment for chemo- or radiotherapy-resistant cancer cells. It was also reported that the introduction of endogenous small-sized, non-coding ribonucleotides such as microRNA (miR) 302s and miR-369-3p or -5p resulted in the induction of cellular reprogramming. miRs are smaller than the genes of transcription factors, making them possibly suitable for use in clinical strategies. Therefore, we reprogrammed colon cancer cells using miR-302s and miR-369-3p or -5p. This resulted in inhibition of cell proliferation and invasion and the stimulation of the mesenchymal-to-epithelial transition phenotype in colon cancer cells. Importantly, the introduction of the ribonucleotides resulted in epigenetic reprogramming of DNA demethylation and histone modification events. Furthermore, in vivo administration of the ribonucleotides in mice elicited the induction of cancer cell apoptosis, which involves the mitochondrial Bcl2 protein family. The present study shows that the introduction of miR-302s and miR-369s could induce cellular reprogramming and modulate malignant phenotypes of human colorectal cancer, suggesting that the appropriate delivery of functional small-sized ribonucleotides may open a new avenue for therapy against human malignant tumors. PMID:25970424

  3. Detection of antibodies directed at M. hyorhinis p37 in the serum of men with newly diagnosed prostate cancer

    PubMed Central

    2011-01-01

    Background Recent epidemiologic, genetic, and molecular studies suggest infection and inflammation initiate certain cancers, including cancers of the prostate. Over the past several years, our group has been studying how mycoplasmas could possibly initiate and propagate cancers of the prostate. Specifically, Mycoplasma hyorhinis encoded protein p37 was found to promote invasion of prostate cancer cells and cause changes in growth, morphology and gene expression of these cells to a more aggressive phenotype. Moreover, we found that chronic exposure of benign human prostate cells to M. hyorhinis resulted in significant phenotypic and karyotypic changes that ultimately resulted in the malignant transformation of the benign cells. In this study, we set out to investigate another potential link between mycoplasma and human prostate cancer. Methods We report the incidence of men with prostate cancer and benign prostatic hyperplasia (BPH) being seropositive for M. hyorhinis. Antibodies to M. hyorhinis were surveyed by a novel indirect enzyme-linked immunosorbent assay (ELISA) in serum samples collected from men presenting to an outpatient Urology clinic for BPH (N = 105) or prostate cancer (N = 114) from 2006-2009. Results A seropositive rate of 36% in men with BPH and 52% in men with prostate cancer was reported, thus leading us to speculate a possible connection between M. hyorhinis exposure with prostate cancer. Conclusions These results further support a potential exacerbating role for mycoplasma in the development of prostate cancer. PMID:21663671

  4. Multiplexed quantum dot labeling of activated c-Met signaling in castration-resistant human prostate cancer.

    PubMed

    Hu, Peizhen; Chu, Gina C-Y; Zhu, Guodong; Yang, Hua; Luthringer, Daniel; Prins, Gail; Habib, Fouad; Wang, Yuzhuo; Wang, Ruoxiang; Chung, Leland W K; Zhau, Haiyen E

    2011-01-01

    The potential application of multiplexed quantum dot labeling (MQDL) for cancer detection and prognosis and monitoring therapeutic responses has attracted the interests of bioengineers, pathologists and cancer biologists. Many published studies claim that MQDL is effective for cancer biomarker detection and useful in cancer diagnosis and prognosis, these studies have not been standardized against quantitative biochemical and molecular determinations. In the present study, we used a molecularly characterized human prostate cancer cell model exhibiting activated c-Met signaling with epithelial to mesenchymal transition (EMT) and lethal metastatic progression to bone and soft tissues as the gold standard, and compared the c-Met cell signaling network in this model, in clinical human prostate cancer tissue specimens and in a castration-resistant human prostate cancer xenograft model. We observed c-Met signaling network activation, manifested by increased phosphorylated c-Met in all three. The downstream survival signaling network was mediated by NF-κB and Mcl-1 and EMT was driven by receptor activator of NF-κB ligand (RANKL), at the single cell level in clinical prostate cancer specimens and the xenograft model. Results were confirmed by real-time RT-PCR and western blots in a human prostate cancer cell model. MQDL is a powerful tool for assessing biomarker expression and it offers molecular insights into cancer progression at both the cell and tissue level with high degree of sensitivity. PMID:22205960

  5. Epigenetic control of group V phospholipase A2 expression in human malignant cells.

    PubMed

    Menschikowski, Mario; Hagelgans, Albert; Nacke, Brit; Jandeck, Carsten; Mareninova, Olga A; Asatryan, Liana; Siegert, Gabriele

    2016-06-01

    Secreted phospholipases A2 (sPLA2) are suggested to play an important role in inflammation and tumorigenesis. Different mechanisms of epigenetic regulation are involved in the control of group IIA, III and X sPLA2s expression in cancer cells, but group V sPLA2 (GV-PLA2) in this respect has not been studied. Here, we demonstrate the role of epigenetic mechanisms in regulation of GV-PLA2 expression in different cell lines originating from leukaemia and solid cancers. In blood leukocytes from leukaemic patients, levels of GV-PLA2 transcripts were significantly lower in comparison to those from healthy individuals. Similarly, in DU-145 and PC-3 prostate and CAL-51 and MCF-7 mammary cancer cell lines, levels of GV-PLA2 transcripts were significantly lower in relation to those found in normal epithelial cells of prostate or mammary. By sequencing and methylation-specific high-resolution melting (MS-HRM) analyses of bisulphite-modified DNA, distinct CpG sites in the GV-PLA2 promoter region were identified that were differentially methylated in cancer cells in comparison to normal epithelial and endothelial cells. Spearman rank order analysis revealed a significant negative correlation between the methylation degree and the cellular expression of GV-PLA2 (r = -0.697; p = 0.01). The effects of demethylating agent (5-aza-2'-deoxycytidine) and histone deacetylase inhibitor (trichostatin A) on GV-PLA2 transcription in the analysed cells confirmed the importance of DNA methylation and histone modification in the regulation of the GV-PLA2 gene expression in leukaemic, prostate and mammary cancer cell lines. The exposure of tumour cells to human recombinant GV-PLA2 resulted in a reduced colony forming activity of MCF-7, HepG2 and PC-3 cells, but not of DU-145 cells suggesting a cell-type-dependent effect of GV-PLA2 on cell growth. In conclusion, our results suggest that epigenetic mechanisms such as DNA methylation and histone modification play an important role in

  6. Clinical significance of the integrin α6β4 in human malignancies

    PubMed Central

    Stewart, Rachel L.; O’Connor, Kathleen L.

    2015-01-01

    Integrin α6β4 is a cellular adhesion molecule that binds to laminins in the extracellular matrix and nucleates the formation of hemidesmosomes. During carcinoma progression, integrin α6β4 is released from hemidesmosomes, where it can then signal to facilitate multiple aspects of tumor progression including sustaining proliferative signaling, tumor invasion and metastasis, evasion of apoptosis, and stimulation of angiogenesis. The integrin achieves these ends by cooperating with growth factor receptors including EGFR, ErbB-2, and c-Met to amplify downstream pathways such as PI3K, AKT, MAPK and the Rho family small GTPases. Furthermore, it dramatically alters the transcriptome toward a more invasive phenotype by controlling promoter DNA demethylation of invasion and metastasis-associated proteins, such as S100A4 and autotaxin, and upregulates and activates key tumor promoting transcription factors such as the NFATs and NFkB. Expression of integrin α6β4 has been studied in many human malignancies where its overexpression is associated with aggressive behavior and a poor prognosis. This review provides an assessment of integrin α6β4 expression patterns and their prognostic significance in human malignancies, and describes key signaling functions of integrin α6β4 that contribute to tumor progression. PMID:26121317

  7. [Human recombinant leukocyte interferon alpha-2-A in 22 cases of metastatic malignant melanoma].

    PubMed

    Maral, J; Steinberg, M; Weil, M; Chleq, C; Khayat, D; Banzet, P; Jacquillat, C

    1987-06-01

    Twenty-two patients with metastatic malignant melanoma received either 36 X 10(6) U (15 patients) or 18 X 10(6) U (7 patients) of human recombinant interferon alpha-2-A daily for 3 months by the intramuscular route, with progressive increase of dosage. This was followed in responders by a maintenance treatment consisting of 3 intramuscular injections per week in the same doses as those received at the end of the induction treatment. Out of 18 patients assessable for effectiveness, 1 had complete remission (7 months +) and 3 had partial response (52,61 and 82 days respectively), an overall improvement rate of 22%. The main side-effects observed were: pseudoinfluenza syndrome (100%), fatigue (100%), somnolence (95%), anorexia (90%) and haematological disorders. Dosage reduction was necessary in 13 of the 15 patients receiving 36 MU. This study shows that human recombinant interferon alpha-2-A has antitumoral activity in metastatic malignant melanoma. Other studies, notably with therapeutic combinations, are needed to determine the optimal dosage regimen of the drug and to increase its effectiveness. PMID:2955323

  8. Selenite Treatment Inhibits LAPC-4 Tumor Growth and Prostate-Specific Antigen Secretion in a Xenograft Model of Human Prostate Cancer

    SciTech Connect

    Bhattacharyya, Rumi S.; Husbeck, Bryan; Feldman, David; Knox, Susan J.

    2008-11-01

    Purpose: Selenium compounds have known chemopreventive effects on prostate cancer. However selenite, an inorganic form of selenium, has not been extensively studied as a treatment option for prostate cancer. Our previous studies have demonstrated the inhibition of androgen receptor expression and androgen stimulated prostate-specific antigen (PSA) expression by selenite in human prostate cancer cell lines. In this study, we investigated the in vivo effects of selenite as a therapy to treat mice with established LAPC-4 tumors. Methods and Materials: Male mice harboring androgen-dependent LAPC-4 xenograft tumors were treated with selenite (2 mg/kg intraperitoneally three times per week) or vehicle for 42 days. In addition, androgen-independent LAPC-4 xenograft tumors were generated in female mice over 4 to 6 months. Once established, androgen-independent LAPC-4 tumor fragments were passaged into female mice and were treated with selenite or vehicle for 42 days. Changes in tumor volume and serum PSA levels were assessed. Results: Selenite significantly decreased androgen-dependent LAPC-4 tumor growth in male mice over 42 days (p < 0.001). Relative tumor volume was decreased by 41% in selenite-treated animals compared with vehicle-treated animals. The inhibition of LAPC-4 tumor growth corresponded to a marked decrease in serum PSA levels (p < 0.01). In the androgen-independent LAPC-4 tumors in female mice, selenite treatment decreased tumor volume by 58% after 42 days of treatment (p < 0.001). Conclusions: These results suggest that selenite may have potential as a novel therapeutic agent to treat both androgen-dependent and androgen-independent prostate cancer.

  9. Inhibition of hedgehog signaling reduces the side population in human malignant mesothelioma cell lines

    PubMed Central

    Kim, H-A; Kim, M-C; Kim, N-Y; Kim, Y

    2015-01-01

    Deregulation of crucial embryonic pathways, including hedgehog signaling, has been frequently implicated in a variety of human cancers and is emerging as an important target for anticancer therapy. This study evaluated the potential anticancer effects of cyclopamine, a chemical inhibitor of hedgehog signaling, in human malignant mesothelioma (HMM) cell lines. Cyclopamine treatment significantly decreased the proliferation of HMM cells by promoting apoptosis and shifting the cell cycle toward dormant phase. The clonogenicity and mobility of HMM cells were significantly decreased by cyclopamine treatment. Treatment of HMM cells with cyclopamine significantly reduced the abundance of side population cells, which were measured using an assay composed of Hoechst 33342 dye staining and subsequent flow cytometry. Furthermore, the expression levels of stemness-related genes were significantly affected by cyclopamine treatment. Taken together, the present study showed that targeting hedgehog signaling could reduce a more aggressive subpopulation of the cancer cells, suggesting an alternative approach for HMM therapy. PMID:26206198

  10. Quantitative expression analysis and study of the novel human kallikrein-related peptidase 14 gene (KLK14) in malignant and benign breast tissues.

    PubMed

    Papachristopoulou, Georgia; Avgeris, Margaritis; Charlaftis, Antonios; Scorilas, Andreas

    2011-01-01

    Human kallikrein-related peptidase 14 gene (KLK14) is regulated by androgens and progestins. This gene is expressed in the central nervous system and endocrine tissues such as the breast, prostate and ovary. The differential KLK14 mRNA expression levels are related to several human neoplasias, among them breast cancer. The aim of this study was to analyse the KLK14 expression in breast tissues and to investigate its differential diagnostic and prognostic value in the mammary carcinomas. For this purpose, we isolated total RNA from 70 malignant and 33 benign specimens. After testing RNA quality, we synthesised cDNA by reverse transcription and applied a highly sensitive quantitative real-time PCR (qRT-PCR) method for KLK14 mRNA quantification using the SYBR Green® chemistry. HPRT1 was used as a reference gene and the BT20 breast cancer cell line as a calibrator. Relative quantification analysis was performed using the comparative CT method 2-ΔΔCT. KLK14 expression was detected in both types of breast tumours. However, a statistically significant increase of the KLK14 mRNA level was observed in the malignant, compared to the benign tumour samples (p<0.001), highlighting its value in discriminating these breast lesions. Elevated KLK14 expression profiles were associated with higher tumour grade (p=0.043) and size (p=0.007) in cancerous samples. Furthermore, KLK14 mRNA expression showed negative correlation in a statistically significant manner with estrogen receptor status (p=0.024). In accordance with logistic regression models (p=0.012) and receiver-operating-characteristics analysis (p<0.001), KLK14 gene expression could be evaluated as a putative independent diagnostic biomarker in breast tumour biopsies. PMID:21057706

  11. Contouring variability of human- and deformable-generated contours in radiotherapy for prostate cancer

    NASA Astrophysics Data System (ADS)

    Gardner, Stephen J.; Wen, Ning; Kim, Jinkoo; Liu, Chang; Pradhan, Deepak; Aref, Ibrahim; Cattaneo, Richard, II; Vance, Sean; Movsas, Benjamin; Chetty, Indrin J.; Elshaikh, Mohamed A.

    2015-06-01

    This study was designed to evaluate contouring variability of human-and deformable-generated contours on planning CT (PCT) and CBCT for ten patients with low-or intermediate-risk prostate cancer. For each patient in this study, five radiation oncologists contoured the prostate, bladder, and rectum, on one PCT dataset and five CBCT datasets. Consensus contours were generated using the STAPLE method in the CERR software package. Observer contours were compared to consensus contour, and contour metrics (Dice coefficient, Hausdorff distance, Contour Distance, Center-of-Mass [COM] Deviation) were calculated. In addition, the first day CBCT was registered to subsequent CBCT fractions (CBCTn: CBCT2-CBCT5) via B-spline Deformable Image Registration (DIR). Contours were transferred from CBCT1 to CBCTn via the deformation field, and contour metrics were calculated through comparison with consensus contours generated from human contour set. The average contour metrics for prostate contours on PCT and CBCT were as follows: Dice coefficient—0.892 (PCT), 0.872 (CBCT-Human), 0.824 (CBCT-Deformed); Hausdorff distance—4.75 mm (PCT), 5.22 mm (CBCT-Human), 5.94 mm (CBCT-Deformed); Contour Distance (overall contour)—1.41 mm (PCT), 1.66 mm (CBCT-Human), 2.30 mm (CBCT-Deformed); COM Deviation—2.01 mm (PCT), 2.78 mm (CBCT-Human), 3.45 mm (CBCT-Deformed). For human contours on PCT and CBCT, the difference in average Dice coefficient between PCT and CBCT (approx. 2%) and Hausdorff distance (approx. 0.5 mm) was small compared to the variation between observers for each patient (standard deviation in Dice coefficient of 5% and Hausdorff distance of 2.0 mm). However, additional contouring variation was found for the deformable-generated contours (approximately 5.0% decrease in Dice coefficient and 0.7 mm increase in Hausdorff distance relative to human-generated contours on CBCT). Though deformable contours provide a reasonable starting point for contouring on

  12. Characterization of phosphodiesterase 2A in human malignant melanoma PMP cells

    PubMed Central

    MORITA, HIROSHI; MURATA, TAKU; SHIMIZU, KASUMI; OKUMURA, KENYA; INUI, MADOKA; TAGAWA, TOSHIRO

    2013-01-01

    The prognosis for malignant melanoma is poor; therefore, new diagnostic methods and treatment strategies are urgently needed. Phosphodiesterase 2 (PDE2) is one of 21 phosphodiesterases, which are divided into 11 families (PDE1-PDE11). PDE2 hydrolyzes cyclic AMP (cAMP) and cyclic GMP (cGMP), and its binding to cGMP enhances the hydrolysis of cAMP. We previously reported the expression of PDE1, PDE3 and PDE5 in human malignant melanoma cells. However, the expression of PDE2 in these cells has not been investigated. Herein, we examined the expression of PDE2A and its role in human oral malignant melanoma PMP cells. Sequencing of RT-PCR products revealed that PDE2A2 was the only variant expressed in PMP cells. Four point mutations were detected; one missense mutation at nucleotide position 734 (from C to T) resulted in the substitution of threonine with isoleucine at amino acid position 214. The other three were silent mutations. An in vitro migration assay and a terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling assay revealed that suppressing PDE2 activity with its specific inhibitor, erythro-9-(2-hydroxy-3-nonyl)-adenine (EHNA), had no impact on cell motility or apoptosis. Furthermore, the cytotoxicity of EHNA, assessed using a trypan blue exclusion assay, was negligible. On the other hand, assessment of cell proliferation by BrdU incorporation and cell cycle analysis by flow cytometry revealed that EHNA treatment inhibited DNA synthesis and increased the percentage of G2/M-arrested cells. Furthermore, cyclin A mRNA expression was downregulated, while cyclin E mRNA expression was upregulated in EHNA-treated cells. Our results demonstrated that the PDE2A2 variant carrying point mutations is expressed in PMP cells and may affect cell cycle progression by modulating cyclin A expression. Thus, PDE2A2 is a possible new molecular target for the treatment of malignant melanoma. PMID:23381931

  13. Transcription Factor Stat3 Stimulates Metastatic Behavior of Human Prostate Cancer Cells in Vivo, whereas Stat5b Has a Preferential Role in the Promotion of Prostate Cancer Cell Viability and Tumor Growth

    PubMed Central

    Gu, Lei; Dagvadorj, Ayush; Lutz, Jacqueline; Leiby, Benjamin; Bonuccelli, Gloria; Lisanti, Michael P.; Addya, Sankar; Fortina, Paolo; Dasgupta, Abhijit; Hyslop, Terry; Bubendorf, Lukas; Nevalainen, Marja T.

    2010-01-01

    Identification of the molecular changes that promote viability and metastatic behavior of prostate cancer is critical for the development of improved therapeutic interventions. Stat5a/b and Stat3 are both constitutively active in locally-confined and advanced prostate cancer, and both transcription factors have been reported to be critical for the viability of prostate cancer cells. We recently showed that Stat3 promotes metastatic behavior of human prostate cancer cells not only in vitro but also in an in vivo experimental metastases model. In this work, we compare side-by-side Stat5a/b versus Stat3 in the promotion of prostate cancer cell viability, tumor growth, and induction of metastatic colonization in vivo. Inhibition of Stat5a/b induced massive death of prostate cancer cells in culture and reduced both subcutaneous and orthotopic prostate tumor growth, whereas Stat3 had a predominant role over Stat5a/b in promoting metastases formation of prostate cancer cells in vivo in nude mice. The molecular mechanisms underlying the differential biological effects induced by these two transcription factors involve largely different sets of genes regulated by Stat5a/b versus Stat3 in human prostate cancer model systems. Of the two Stat5 homologs, Stat5b was more important for supporting growth of prostate cancer cells than Stat5a. This work provides the first mechanistic comparison of the biological effects induced by transcription factors Stat5a/b versus Stat3 in prostate cancer. PMID:20167868

  14. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells.

    PubMed

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the Radius(TM) assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  15. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells

    PubMed Central

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the RadiusTM assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  16. The bioavailability of different zinc compounds used as human dietary supplements in rat prostate: a comparative study.

    PubMed

    Sapota, Andrzej; Daragó, Adam; Skrzypińska-Gawrysiak, Małgorzata; Nasiadek, Marzenna; Klimczak, Michał; Kilanowicz, Anna

    2014-06-01

    The normal human prostate accumulates the highest levels of zinc (Zn) of any soft tissue in the body. The pool of zinc available to the body is known to significantly decrease with age. It is suggested that dietary Zn supplementation protects against oxidative damage and reduces the risk of cancer. Zinc sulfate and zinc gluconate were the most frequently mentioned in per os administration in studies on Zn supplementation. The major aim of the study was to compare the bioavailability of different Zn compounds (sulfate, gluconate and citrate) in the prostate after their daily administration to male rats at three different doses (3.0; 15.0; and 50.0 mg Zn/kg b.w.) for 30 days. The results show that bioavailability in the prostate differs significantly between individual zinc preparations. A significantly elevated Zn concentration in the dorso-lateral lobe of the prostate, compared to controls, was found in the rats supplemented with two compounds only: zinc gluconate and zinc citrate. However, after administration of zinc gluconate, this effect occurred even at the lowest dose. The lowest zinc bioavailability in the prostate was found in the rats administered zinc sulfate: no significant Zn increase was seen in particular zones of the prostate. To sum up, the use of zinc gluconate is worth considering as a possible means of zinc supplementation in men. PMID:24619814

  17. Mineralized human primary osteoblast matrices as a model system to analyse interactions of prostate cancer cells with the bone microenvironment.

    PubMed

    Reichert, Johannes C; Quent, Verena M C; Burke, Leslie J; Stansfield, Scott H; Clements, Judith A; Hutmacher, Dietmar W

    2010-11-01

    Prostate cancer metastasis is reliant on the reciprocal interactions between cancer cells and the bone niche/micro-environment. The production of suitable matrices to study metastasis, carcinogenesis and in particular prostate cancer/bone micro-environment interaction has been limited to specific protein matrices or matrix secreted by immortalised cell lines that may have undergone transformation processes altering signaling pathways and modifying gene or receptor expression. We hypothesize that matrices produced by primary human osteoblasts are a suitable means to develop an in vitro model system for bone metastasis research mimicking in vivo conditions. We have used a decellularized matrix secreted from primary human osteoblasts as a model for prostate cancer function in the bone micro-environment. We show that this collagen I rich matrix is of fibrillar appearance, highly mineralized, and contains proteins, such as osteocalcin, osteonectin and osteopontin, and growth factors characteristic of bone extracellular matrix (ECM). LNCaP and PC3 cells grown on this matrix, adhere strongly, proliferate, and express markers consistent with a loss of epithelial phenotype. Moreover, growth of these cells on the matrix is accompanied by the induction of genes associated with attachment, migration, increased invasive potential, Ca(2+) signaling and osteolysis. In summary, we show that growth of prostate cancer cells on matrices produced by primary human osteoblasts mimics key features of prostate cancer bone metastases and thus is a suitable model system to study the tumor/bone micro-environment interaction in this disease. PMID:20688384

  18. Antiinflammatory effect of androgen receptor activation in human benign prostatic hyperplasia cells.

    PubMed

    Vignozzi, Linda; Cellai, Ilaria; Santi, Raffaella; Lombardelli, Letizia; Morelli, Annamaria; Comeglio, Paolo; Filippi, Sandra; Logiodice, Federica; Carini, Marco; Nesi, Gabriella; Gacci, Mauro; Piccinni, Marie-Pierre; Adorini, Luciano; Maggi, Mario

    2012-07-01

    Progression of benign prostatic hyperplasia (BPH) involves chronic inflammation and immune dysregulation. Preclinical studies have demonstrated that prostate inflammation and tissue remodeling are exacerbated by hypogonadism and prevented by testosterone supplementation. We now investigated whether, in humans, hypogonadism was associated with more severe BPH inflammation and the in vitro effect of the selective androgen receptor agonist dihydrotestosterone (DHT) on cultures of stromal cells derived from BPH patients (hBPH). Histological analysis of inflammatory infiltrates in prostatectomy specimens from a cohort of BPH patients and correlation with serum testosterone level was performed. Even after adjusting for confounding factors, hypogonadism was associated with a fivefold increased risk of intraprostatic inflammation, which was also more severe than that observed in eugonadal BPH patients. Triggering hBPH cells by inflammatory stimuli (tumor necrosis factor α, lipopolysaccharide, or CD4(+)T cells) induced abundant secretion of inflammatory/growth factors (interleukin 6 (IL6), IL8, and basic fibroblast growth factor (bFGF)). Co-culture of CD4(+)T cells with hBPH cells induced secretion of Th1 inducer (IL12), Th1-recruiting chemokine (interferon γ inducible protein 10, IP10), and Th2 (IL9)- and Th17 (IL17)-specific cytokines. Pretreatment with DHT inhibited NF-κB activation and suppressed secretion of several inflammatory/growth factors, with the most pronounced effects on IL8, IL6, and bFGF. Reduced inflammatory cytokine production by T-cells, an increase in IL10, and a significant reduction of T cells proliferation suggested that DHT exerted a broad anti inflammatory effect on testosterone cells [corrected]. In conclusion, our data demonstrate that DHT exerts an immune regulatory role on human prostatic stromal cells, inhibiting their potential to actively induce and/or sustain autoimmune and inflammatory responses. PMID:22562653

  19. Daytime Blue Light Enhances the Nighttime Circadian Melatonin Inhibition of Human Prostate Cancer Growth

    PubMed Central

    Dauchy, Robert T; Hoffman, Aaron E; Wren-Dail, Melissa A; Hanifin, John P; Warfield, Benjamin; Brainard, George C; Xiang, Shulin; Yuan, Lin; Hill, Steven M; Belancio, Victoria P; Dauchy, Erin M; Smith, Kara; Blask, David E

    2015-01-01

    Light controls pineal melatonin production and temporally coordinates circadian rhythms of metabolism and physiology in normal and neoplastic tissues. We previously showed that peak circulating nocturnal melatonin levels were 7-fold higher after daytime spectral transmittance of white light through blue-tinted (compared with clear) rodent cages. Here, we tested the hypothesis that daytime blue-light amplification of nocturnal melatonin enhances the inhibition of metabolism, signaling activity, and growth of prostate cancer xenografts. Compared with male nude rats housed in clear cages under a 12:12-h light:dark cycle, rats in blue-tinted cages (with increased transmittance of 462–484 nm and decreased red light greater than 640 nm) evinced over 6-fold higher peak plasma melatonin levels at middark phase (time, 2400), whereas midlight-phase levels (1200) were low (less than 3 pg/mL) in both groups. Circadian rhythms of arterial plasma levels of linoleic acid, glucose, lactic acid, pO2, pCO2, insulin, leptin, and corticosterone were disrupted in rats in blue cages as compared with the corresponding entrained rhythms in clear-caged rats. After implantation with tissue-isolated PC3 human prostate cancer xenografts, tumor latency-to-onset of growth and growth rates were markedly delayed, and tumor cAMP levels, uptake–metabolism of linoleic acid, aerobic glycolysis (Warburg effect), and growth signaling activities were reduced in rats in blue compared with clear cages. These data show that the amplification of nighttime melatonin levels by exposing nude rats to blue light during the daytime significantly reduces human prostate cancer metabolic, signaling, and proliferative activities. PMID:26678364

  20. Neural Cell Adhesion Protein CNTN1 Promotes the Metastatic Progression of Prostate Cancer.

    PubMed

    Yan, Judy; Ojo, Diane; Kapoor, Anil; Lin, Xiaozeng; Pinthus, Jehonathan H; Aziz, Tariq; Bismar, Tarek A; Wei, Fengxiang; Wong, Nicholas; De Melo, Jason; Cutz, Jean-Claude; Major, Pierre; Wood, Geoffrey; Peng, Hao; Tang, Damu

    2016-03-15

    Prostate cancer metastasis is the main cause of disease-related mortality. Elucidating the mechanisms underlying prostate cancer metastasis is critical for effective therapeutic intervention. In this study, we performed gene-expression profiling of prostate cancer stem-like cells (PCSC) derived from DU145 human prostate cancer cells to identify factors involved in metastatic progression. Our studies revealed contactin 1 (CNTN1), a neural cell adhesion protein, to be a prostate cancer-promoting factor. CNTN1 knockdown reduced PCSC-mediated tumor initiation, whereas CNTN1 overexpression enhanced prostate cancer cell invasion in vitro and promoted xenograft tumor formation and lung metastasis in vivo. In addition, CNTN1 overexpression in DU145 cells and corresponding xenograft tumors resulted in elevated AKT activation and reduced E-cadherin (CDH1) expression. CNTN1 expression was not readily detected in normal prostate glands, but was clearly evident on prostate cancer cells in primary tumors and lymph node and bone metastases. Tumors from 637 patients expressing CNTN1 were associated with prostate cancer progression and worse biochemical recurrence-free survival following radical prostatectomy (P < 0.05). Collectively, our findings demonstrate that CNTN1 promotes prostate cancer progression and metastasis, prompting further investigation into the mechanisms that enable neural proteins to become aberrantly expressed in non-neural malignancies. PMID:26795349

  1. Quantitative Analysis of BTF3, HINT1, NDRG1 and ODC1 Protein Over-Expression in Human Prostate Cancer Tissue

    PubMed Central

    Symes, Andrew J.; Eilertsen, Marte; Millar, Michael; Nariculam, Joseph; Freeman, Alex; Notara, Maria; Feneley, Mark R.; Patel, Hitenedra R. H.; Masters, John R. W.; Ahmed, Aamir

    2013-01-01

    Prostate carcinoma is the most common cancer in men with few, quantifiable, biomarkers. Prostate cancer biomarker discovery has been hampered due to subjective analysis of protein expression in tissue sections. An unbiased, quantitative immunohistochemical approach provided here, for the diagnosis and stratification of prostate cancer could overcome this problem. Antibodies against four proteins BTF3, HINT1, NDRG1 and ODC1 were used in a prostate tissue array (> 500 individual tissue cores from 82 patients, 41 case pairs matched with one patient in each pair had biochemical recurrence). Protein expression, quantified in an unbiased manner using an automated analysis protocol in ImageJ software, was increased in malignant vs non-malignant prostate (by 2-2.5 fold, p<0.0001). Operating characteristics indicate sensitivity in the range of 0.68 to 0.74; combination of markers in a logistic regression model demonstrates further improvement in diagnostic power. Triple-labeled immunofluorescence (BTF3, HINT1 and NDRG1) in tissue array showed a significant (p<0.02) change in co-localization coefficients for BTF3 and NDRG1 co-expression in biochemical relapse vs non-relapse cancer epithelium. BTF3, HINT1, NDRG1 and ODC1 could be developed as epithelial specific biomarkers for tissue based diagnosis and stratification of prostate cancer. PMID:24386364

  2. Overexpression of CD99 Increases the Migration and Invasiveness of Human Malignant Glioma Cells.

    PubMed

    Seol, Ho Jun; Chang, Jong Hee; Yamamoto, Junkoh; Romagnuolo, Rocco; Suh, Youngchul; Weeks, Adrienne; Agnihotri, Sameer; Smith, Christian A; Rutka, James T

    2012-09-01

    The malignant glioma is the most common primary human brain tumor, and its migration and invasiveness away from the primary tumor mass are considered a leading cause of tumor recurrence and treatment failure. Recently, gene expression profiling revealed that the transmembrane glycoprotein CD99 is more highly expressed in malignant glioma than in normal brain. Although its function is not completely understood, CD99 is implicated in cell adhesion and migration in a variety of different cell types. CD99 has wild-type and splice variant isoforms. Previous studies have shown that wild-type CD99 may be an oncosuppressor in some tumors, distinct from the role of the splice variant isoform. In this study, our data reveal that only wild-type CD99 is expressed in human glioma cells and tissues. Using a tissue microarray, we validated that gliomas demonstrate higher expression of CD99 compared with nonneoplastic brain. To assess the role of CD99 in glioma migration and invasion, we inhibited CD99 expression by siRNA and demonstrated decreased glioma migration and invasion. In contrast, when CD99 was overexpressed in glioma cells, we observed enhancement of cell migration and invasiveness. An orthotopic brain tumor model demonstrates that CD99 overexpression significantly increases invasiveness and decreases survival rate. Interestingly, Rac activity was decreased and Rho activity was increased in CD99 overexpressing glioma cells, and the proportion of amoeboid cells to mesenchymal cells was significantly increased. Taken together, our findings suggest that CD99 may play an important role in the migration and invasion of human gliomas independent of Akt, ERK, or JNK signaling pathways. Moreover, CD99 might be involved in amoeboid-mesenchymal transition in glioma migration. CD99 may be an important future target to inhibit migration and invasion, especially in CD99-expressing gliomas. PMID:23486730

  3. Targeting Prostate Cancer Cells In Vivo Using a Rapidly Internalizing Novel Human Single-Chain Antibody Fragment

    PubMed Central

    He, Jiang; Wang, Yong; Feng, Jinjin; Zhu, Xiaodong; Lan, Xiaoli; Iyer, Arun K.; Zhang, Niu; Seo, Youngho; VanBrocklin, Henry F.; Liu, Bin

    2010-01-01

    Human antibodies targeting prostate cancer cell surface epitopes may be useful for imaging and therapy. The objective of this study was to evaluate the tumor targeting of an internalizing human antibody fragment, a small-size platform, to provide high contrast in a mouse model of human prostate carcinoma. Methods A prostate tumor-targeting single-chain antibody fragment (scFv), UA20, along with a nonbinding control scFv, N3M2, were labeled with 99mTc and evaluated for binding and rapid internalization into human prostate tumor cells in vitro and tumor homing in vivo using xenograft models. For the in vitro studies, the labeled UA20 scFv was incubated at 37°C for 1 h with metastatic prostate cancer cells (DU145) to assess the total cellular uptake versus intracellular uptake. For the animal studies, labeled UA20 and N3M2 scFvs were administered to athymic mice implanted subcutaneously with DU145 cells. Mice were imaged with small-animal SPECT/CT with concomitant biodistribution at 1 and 3 h after injection. Results The UA20 scFv was labeled in 55%–65% yield and remained stable in phosphate buffer within 24 h. The labeled UA20 scFv was taken up specifically by prostate tumor cells. Internalization was rapid, because incubation at 37°C for less than 1 h resulted in 93% internalization of total cell-associated scFvs. In animal studies, SPECT/CT showed significant tumor uptake as early as 1 h after injection. At 3 h after injection, tumor uptake was 4.4 percentage injected dose per gram (%ID/g), significantly greater than all organs or tissues studied (liver, 2.7 %ID/g; other organs or tissues, <1 %ID/g), except the kidneys (81.4 %ID/g), giving tumor-to-blood and tumor-to-muscle ratios of 12:1 and 70:1, respectively. In contrast, the control antibody exhibited a tumor uptake of only 0.26 %ID/g, similar to that of muscle and fat. Tumor-specific targeting was evidenced by reduced tumor uptake of nearly 70% on administration of a 10-fold excess of unlabeled UA20 sc

  4. Genetic modification of human T lymphocytes for the treatment of hematologic malignancies

    PubMed Central

    Hoyos, Valentina; Savoldo, Barbara; Dotti, Gianpietro

    2012-01-01

    Modern chemotherapy regimens and supportive care have produced remarkable improvements in the overall survival of patients with hematologic malignancies. However, the development of targeted small molecules, monoclonal antibodies, and biological therapies that demonstrate greater efficacy and lower toxicity remains highly desirable in hematology, and oncology in general. In the context of biological therapies, T-lymphocyte based treatments have enormous potential. Donor lymphocyte infusion in patients relapsed after allogeneic hematopoietic stem cell transplant pioneered the concept that T lymphocytes can effectively control tumor growth, and this was then followed by the development of cell culture strategies to generate T lymphocytes with selective activity against tumor cells. Over the past decade, it has become clear that the adoptive transfer of ex vivo expanded antigen-specific cytotoxic T lymphocytes promotes sustained antitumor effects in patients with virus-associated lymphomas, such as Epstein-Barr virus related post-transplant lymphomas and Hodgkin's lymphomas. Because of this compelling clinical evidence and the concomitant development of methodologies for robust gene transfer to human T lymphocytes, the field has rapidly evolved, offering new opportunities to extend T-cell based therapies. This review summarizes the most recent biological and clinical developments using genetically manipulated T cells for the treatment of hematologic malignancies. PMID:22929977

  5. Intracellular ionized calcium concentration in muscles from humans with malignant hyperthermia.

    PubMed

    López, J R; Alamo, L; Caputo, C; Wikinski, J; Ledezma, D

    1985-06-01

    Ca2+ selective microelectrodes have been used to determine the free myoplasmic [Ca2+] in human skeletal muscle obtained from patients who had developed early signs associated with malignant hyperthermia (MH) during anesthesia. Intercostal muscle biopsies were performed under local anesthesia in four MH patients 15 days to 4 months after developing the MH crisis and in three control subjects. We used only microelectrodes that showed a Nernstian response between pCa3 and pCa7 (30.5 mV per decade at 37 degrees C). Membrane resting potential (V(m)) and calcium potential (V(Ca)) were obtained from superficial fibers. The free cytosolic [Ca2+] was 0.39 +/- 0.1 microM (mean +/- SEM, n = 18) in muscle fibers obtained from malignant hyperthermic patients, whereas in control subjects it was 0.11 +/- 0.02 microM (n = 10). These results suggest that this syndrome might be related to an abnormally high myoplasmic free resting calcium concentration, probably due to a defective function of the plasma membrane or the sarcoplasmic reticulum. PMID:16758579

  6. The Microbiome of Aseptically Collected Human Breast Tissue in Benign and Malignant Disease

    PubMed Central

    Hieken, Tina J.; Chen, Jun; Hoskin, Tanya L.; Walther-Antonio, Marina; Johnson, Stephen; Ramaker, Sheri; Xiao, Jian; Radisky, Derek C.; Knutson, Keith L.; Kalari, Krishna R.; Yao, Janet Z.; Baddour, Larry M.; Chia, Nicholas; Degnim, Amy C.

    2016-01-01

    Globally breast cancer is the leading cause of cancer death among women. The breast consists of epithelium, stroma and a mucosal immune system that make up a complex microenvironment. Growing awareness of the role of microbes in the microenvironment recently has led to a series of findings important for human health. The microbiome has been implicated in cancer development and progression at a variety of body sites including stomach, colon, liver, lung, and skin. In this study, we assessed breast tissue microbial signatures in intraoperatively obtained samples using 16S rDNA hypervariable tag sequencing. Our results indicate a distinct breast tissue microbiome that is different from the microbiota of breast skin tissue, breast skin swabs, and buccal swabs. Furthermore, we identify distinct microbial communities in breast tissues from women with cancer as compared to women with benign breast disease. Malignancy correlated with enrichment in taxa of lower abundance including the genera Fusobacterium, Atopobium, Gluconacetobacter, Hydrogenophaga and Lactobacillus. This work confirms the existence of a distinct breast microbiome and differences between the breast tissue microbiome in benign and malignant disease. These data provide a foundation for future investigation on the role of the breast microbiome in breast carcinogenesis and breast cancer prevention. PMID:27485780

  7. The Microbiome of Aseptically Collected Human Breast Tissue in Benign and Malignant Disease.

    PubMed

    Hieken, Tina J; Chen, Jun; Hoskin, Tanya L; Walther-Antonio, Marina; Johnson, Stephen; Ramaker, Sheri; Xiao, Jian; Radisky, Derek C; Knutson, Keith L; Kalari, Krishna R; Yao, Janet Z; Baddour, Larry M; Chia, Nicholas; Degnim, Amy C

    2016-01-01

    Globally breast cancer is the leading cause of cancer death among women. The breast consists of epithelium, stroma and a mucosal immune system that make up a complex microenvironment. Growing awareness of the role of microbes in the microenvironment recently has led to a series of findings important for human health. The microbiome has been implicated in cancer development and progression at a variety of body sites including stomach, colon, liver, lung, and skin. In this study, we assessed breast tissue microbial signatures in intraoperatively obtained samples using 16S rDNA hypervariable tag sequencing. Our results indicate a distinct breast tissue microbiome that is different from the microbiota of breast skin tissue, breast skin swabs, and buccal swabs. Furthermore, we identify distinct microbial communities in breast tissues from women with cancer as compared to women with benign breast disease. Malignancy correlated with enrichment in taxa of lower abundance including the genera Fusobacterium, Atopobium, Gluconacetobacter, Hydrogenophaga and Lactobacillus. This work confirms the existence of a distinct breast microbiome and differences between the breast tissue microbiome in benign and malignant disease. These data provide a foundation for future investigation on the role of the breast microbiome in breast carcinogenesis and breast cancer prevention. PMID:27485780

  8. Localization and physical mapping of the prostate-specific membrane antigen (PSM) gene to human chromosome 11

    SciTech Connect

    Rinker-Schaeffer, C.W.; Hawkins, A.L.; Griffin, C.A.; Isaacs, J.T.

    1995-11-01

    The prostate-specific membrane antigen (PSM) was identified by the monoclonal antibody 7E11-C5.3, which was raised against the human prostatic carcinoma cell line LNCaP. The PSM antigen is expressed by normal, neoplastic, and metastatic prostatic tissues. The 2.65-kb cDNA encoding the 100-kDa PSM glycoprotein was cloned from LNCaP cells. Studies have shown that the expression of PSM is tissue-specific. In the present study monochromosomal somatic cell hybrids were used to localize the PSM gene to human chromosome 11. Using this information, initial mapping studies identified two potential PSM gene loci at 11p11.1-p13 and 11q14. Further high-stringency analysis using cosmid probes identified the 11q14 region as the location of the PSM gene. 10 refs., 2 figs.

  9. The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression.

    PubMed

    Sharma, Ankur; Yeow, Wen-Shuz; Ertel, Adam; Coleman, Ilsa; Clegg, Nigel; Thangavel, Chellappagounder; Morrissey, Colm; Zhang, Xiaotun; Comstock, Clay E S; Witkiewicz, Agnieszka K; Gomella, Leonard; Knudsen, Erik S; Nelson, Peter S; Knudsen, Karen E

    2010-12-01

    Retinoblastoma (RB; encoded by RB1) is a tumor suppressor that is frequently disrupted in tumorigenesis and acts in multiple cell types to suppress cell cycle progression. The role of RB in tumor progression, however, is poorly defined. Here, we have identified a critical role for RB in protecting against tumor progression through regulation of targets distinct from cell cycle control. In analyses of human prostate cancer samples, RB loss was infrequently observed in primary disease and was predominantly associated with transition to the incurable, castration-resistant state. Further analyses revealed that loss of the RB1 locus may be a major mechanism of RB disruption and that loss of RB function was associated with poor clinical outcome. Modeling of RB dysfunction in vitro and in vivo revealed that RB controlled nuclear receptor networks critical for tumor progression and that it did so via E2F transcription factor 1-mediated regulation of androgen receptor (AR) expression and output. Through this pathway, RB depletion induced unchecked AR activity that underpinned therapeutic bypass and tumor progression. In agreement with these findings, disruption of the RB/E2F/nuclear receptor axis was frequently observed in the transition to therapy resistance in human disease. Together, these data reveal what we believe to be a new paradigm for RB function in controlling prostate tumor progression and lethal tumor phenotypes. PMID:21099110

  10. Value of human chorionic gonadotropin compared to CEA in discriminating benign from malignant effusions.

    PubMed

    Lamerz, R; Stoetzer, O J; Mezger, J; Brandt, A; Darsow, M; Wilmanns, W

    1999-01-01

    Human chorionic gonadotropin (HCG) is expressed in germ cell tumors and urothelial, breast, lung and colon cancers. The aim of the study was to investigate if the determination of HCG in comparison with CEA is able to discriminate between malignant and benign effusions. Effusion and partially serum samples of 61 patients with benign (g.i., heart/kidney isnuff.) and 116 patients with malignant diseases (g.i., gynec., lung, misc., CUP) were investigated. HCG was specifically determined by an IRMA using 2 monoclonal antibodies, CEA by a conventional double Ab RIA. Cytological staining was preformed using the Pappenheim-method on cytospin preparations. Significant differences (p < 0.001) were found for HCG between benign and malignant ascitic effusions with the best discrimination at 5 IU/l (ROC) and an overall sensitivity of 31.3% (spec. vs benign eff. 93.4%) increasing in subgroups from hematol. (5.8%) < misc. (31.3%) < gynec. (32.1%) < g.i. (36%) < lung (38.1%) to CUP (50%). CEA also showed significant differences between benign and malignant total and ascitic effusions, and weaker for the pleural subgroup (cutoff 9 ng/ml) with a total sensitivity of 44.6% (sp = 100%) increasing from misc. (30.8%) < lung (47.1%) < CUP (50%) < gynec. (60%) < g.i. (60.9%). Comparative cytology and TM determinations increased the positiverate of cytology (45.2%) to 58.3% for either cytology or HCG positive cases, or to 61.6% for either cytology or CEA positive cases. For the combined determination of cytologoy and HCG and CEA, the overall TM positive rate for 33 cytology-pos. cases was 78.8%, but in 40 cytology-negative cases 37.5% for TM positive cases. In conclusion HCG is useful in ascitic > pleural effusions with high specificity (90% at 5 IU/l) but low sensitivity of 31% increasing in g.i., lung and gynecologic cases, CEA a more general TM with higher sensitivity of 45% increasing in g.i., gynecologic and lung cases (sp. 100% at 9 ng/ml) both adding significantly to cytology

  11. Reproducibility and Reliability of Anti-3-[18F] FACBC Uptake Measurements in Background Structures and Malignant Lesions on Follow-Up PET-CT in Prostate Carcinoma: an Exploratory Analysis

    PubMed Central

    Odewole, Oluwaseun A.; Oyenuga, Oyeladun A.; Tade, Funmilayo; Savir-Baruch, Bital; Nieh, Peter T.; Master, Viraj; Chen, Zhengjia; Wang, Xiaojing; Jani, Ashesh B.; Bellamy, Leah M.; Halkar, Raghuveer K.; Goodman, Mark M.; Schuster, David M.

    2016-01-01

    Purpose The aim of this study is to examine the reproducibility of anti-1-amino-3-[18F]fluorocyclobutane-1-carboxylic acid (anti-3-[18F]FACBC) quantitative measurements in key background structures and untreated malignant lesions. Procedures Retrospective review of 14 patients who underwent follow-up anti-3-[18F]FACBC positron emission tomography-X-ray computed tomography (PET-CT) for prostate carcinoma recurrence. Standard uptake values (SUV) were measured in both original and follow-up scans in key background structures and untreated malignant lesions. Absolute and percent mean difference in SUV between scans and interclass correlation coefficients (ICC) were also computed. Results Mean (±SD, range) scan interval was 17.4 months (±7.1, 4–29). %Mean difference in SUVmean was <20 % in background structures with low absolute differences. ICCs were >0.6 except for early-phase blood pool (ICC=0.4). SUVmax in malignant lesions without interim therapy increased or remained stable over time. Conclusions Despite variable time interval between scans, FACBC PET-CT demonstrates acceptable reproducibility in key background structures. Untreated malignant lesions showed stable or increased uptake over time. A formal test-retest study is planned. PMID:25281411

  12. A Prospective Randomized Trial of Two Different Prostate Biopsy Schemes

    ClinicalTrials.gov

    2016-07-03

    Prostate Cancer; Local Anesthesia; Prostate-Specific Antigen/Blood; Biopsy/Methods; Image-guided Biopsy/Methods; Prostatic Neoplasms/Diagnosis; Prostate/Pathology; Prospective Studies; Humans; Male; Ultrasonography, Interventional/Methods

  13. Effects of a human plasma membrane-associated sialidase siRNA on prostate cancer invasion

    SciTech Connect

    Li, Xiaojie; Zhang, Ling; Shao, Yueting; Liang, Zuowen; Shao, Chen; Wang, Bo; Guo, Baofeng; Li, Na; Zhao, Xuejian; Li, Yang; Xu, Deqi

    2011-12-16

    Highlights: Black-Right-Pointing-Pointer Neu3 is as one of the sialidases and regulates cell surface functions. Black-Right-Pointing-Pointer A Neu3-specific siRNA inhibited prostrate cancer cell invasion and migration. Black-Right-Pointing-Pointer The Neu3-specific siRNA inhibited prostate cancer metastasis in mice. Black-Right-Pointing-Pointer Targeting Neu3 may have utility for gene-based therapy of human cancer metastasis. -- Abstract: Human plasma membrane-associated sialidase (Neu3) is one of several sialidases that hydrolyze sialic acids in the terminal position of the carbohydrate groups of glycolipids and glycoproteins. Neu3 is mainly localized in plasma membranes and plays crucial roles in the regulation of cell surface functions. In this study, we investigated the effects and molecular mechanisms of Neu3 on cell invasion and migration in vivo and in vitro. Initially, we found that the levels of Neu3 expression were higher in prostate cancer tissues and cell lines than in normal prostate tissues based on RT-PCR and Western blotting analyses. We then applied a Neu3 siRNA approach to block Neu3 signaling using PC-3M cells as model cells. Transwell invasion assays and wound assays showed significantly decreased invasion and migration potential in the Neu3 siRNA-transfected cells. RT-PCR and Western blotting analyses revealed that Neu3 knockdown decreased the expressions of the matrix metalloproteinases MMP-2 and MMP-9. In vivo, mice injected with PC-3M cell tumors were evaluated by SPECT/CT to determine the presence of bone metastases. Mice treated with attenuated Salmonella carrying the Neu3 siRNA developed fewer bone metastases than mice treated with attenuated Salmonella carrying a control Scramble siRNA, attenuated Salmonella alone or PBS. The results for bone metastasis detection by pathology were consistent with the data obtained by SPECT/CT. Tumor blocks were evaluated by histochemical, RT-PCR and Western blotting analyses. The results revealed

  14. Lipids and FA analysis of canine prostate tissue.

    PubMed

    Attar-Bashi, Nadia M; Orzeszko, Karyn; Slocombe, Ronald F; Sinclair, Andrew J

    2003-06-01

    It is widely reported that an association exists between dietary fat intake and the incidence of prostate cancer in humans. To study this association, there is a need for an animal model where prostate carcinogenesis occurs spontaneously. The canine prostate is considered a suitable experimental model for prostate cancer in humans since it is morphologically similar to the human prostate and both humans and dogs have a predisposition to benign and malignant prostate disease. In this study, the FA and lipids profiles of the normal canine prostate tissue from nine dogs were examined. The total lipid content of the canine prostate tissue was 1.7 +/- 0.5% (wet weight). The lipid composition analysis using TLC-FID showed that the two major lipid classes were phospholipids and TAG. Total FA, phospholipid, and TAG FA analysis showed that the major FA were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2n-6), and arachidonic acid (20:4n-6). The n-3 FA were present at <3% of total FA and included alpha-linolenic acid (18:3n-3) (in total and TAG tissue FA), EPA (20:5n-3) (not in TAG), and DHA (22:6n-3) (not in TAG). The n-3/n-6 ratio was 1:11, 1:13, and 1:8 in total, phospholipid, and TAG FA, respectively. This study shows the canine prostate has a low level of n-3 FA and a low n-3/n-6 ratio. This is perhaps due to low n-3 content of the diet of the dogs. FA analysis of dogfoods available in Australia showed that the n-3 content in both supermarket and premium brand dogfoods was <3% (wet weight), and the n-3/n-6 ratio was low. PMID:12934677

  15. Lin28 Enhances Tumorigenesis and is Associated With Advanced Human Malignancies

    PubMed Central

    Viswanathan, Srinivas R.; Powers, John T.; Einhorn, William; Hoshida, Yujin; Ng, Tony; Toffanin, Sara; O'Sullivan, Maureen; Lu, Jun; Philips, Letha A.; Lockhart, Victoria L.; Shah, Samar P.; Tanwar, Pradeep S.; Mermel, Craig H.; Beroukhim, Rameen; Azam, Mohammad; Teixeira, Jose; Meyerson, Matthew; Hughes, Timothy P.; Llovet, Josep M; Radich, Jerald; Mullighan, Charles G.; Golub, Todd R.; Sorensen, Poul H.; Daley, George Q.

    2009-01-01

    Multiple members of the let-7 family of miRNAs are often repressed in human cancers1,2, thereby promoting oncogenesis by de-repressing the targets K-Ras, c-Myc, and HMGA2 3,4. However, the mechanism by which let-7 miRNAs are coordinately repressed is unclear. The RNA-binding proteins Lin28 and Lin28B block let-7 precursors from being processed to mature miRNAs5–8, suggesting that over-expression of Lin28/Lin28B might promote malignancy via repression of let-7. Here we show that LIN28 and LIN28B are over-expressed in primary human tumors and human cancer cell lines (overall frequency ∼15%), and that over-expression is linked to repression of let-7 family miRNAs and de-repression of let-7 targets. Lin28/Lin28B facilitate cellular transformation in vitro, and over-expression is associated with advanced disease across multiple tumor types. Our work provides a mechanism for the coordinate repression of let-7 miRNAs observed in a subset of human cancers, and associates activation of LIN28/LIN28B with poor clinical prognosis. PMID:19483683

  16. PRUNE2 is a human prostate cancer suppressor regulated by the intronic long noncoding RNA PCA3.

    PubMed

    Salameh, Ahmad; Lee, Alessandro K; Cardó-Vila, Marina; Nunes, Diana N; Efstathiou, Eleni; Staquicini, Fernanda I; Dobroff, Andrey S; Marchiò, Serena; Navone, Nora M; Hosoya, Hitomi; Lauer, Richard C; Wen, Sijin; Salmeron, Carolina C; Hoang, Anh; Newsham, Irene; Lima, Leandro A; Carraro, Dirce M; Oliviero, Salvatore; Kolonin, Mikhail G; Sidman, Richard L; Do, Kim-Anh; Troncoso, Patricia; Logothetis, Christopher J; Brentani, Ricardo R; Calin, George A; Cavenee, Webster K; Dias-Neto, Emmanuel; Pasqualini, Renata; Arap, Wadih

    2015-07-01

    Prostate cancer antigen 3 (PCA3) is the most specific prostate cancer biomarker but its function remains unknown. Here we identify PRUNE2, a target protein-coding gene variant, which harbors the PCA3 locus, thereby classifying PCA3 as an antisense intronic long noncoding (lnc)RNA. We show that PCA3 controls PRUNE2 levels via a unique regulatory mechanism involving formation of a PRUNE2/PCA3 double-stranded RNA that undergoes adenosine deaminase acting on RNA (ADAR)-dependent adenosine-to-inosine RNA editing. PRUNE2 expression or silencing in prostate cancer cells decreased and increased cell proliferation, respectively. Moreover, PRUNE2 and PCA3 elicited opposite effects on tumor growth in immunodeficient tumor-bearing mice. Coregulation and RNA editing of PRUNE2 and PCA3 were confirmed in human prostate cancer specimens, supporting the medical relevance of our findings. These results establish PCA3 as a dominant-negative oncogene and PRUNE2 as an unrecognized tumor suppressor gene in human prostate cancer, and their regulatory axis represents a unique molecular target for diagnostic and therapeutic intervention. PMID:26080435

  17. Role of cyclin D1 immunoreactivity and AgNOR staining in the evaluation of benign and malignant lesions of the prostate

    PubMed Central

    Gupta, Veena; Garg, Monika; Chaudhry, Manish; Singh, Sunita; Sen, Rajeev; Gill, Meenu; Sangwaiya, Ashok

    2014-01-01

    Purpose: Prostatic carcinoma is a common and growing public health problem. Histological evaluation is fairly adequate for assessing tumor differentiation, but tumor proliferative activity is difficult to measure. Increasing evidence suggests that the factors controlling cell cycle progression also modulate the rate of ribosome biogenesis. Despite the influence of cyclin D1 and argyrophilic nuclear organizer region (AgNOR) on prostate cancer proliferation, few studies have evaluated the diagnostic importance of these markers. Therefore, the present study was carried out to analyze the diagnostic value of the proliferative markers cyclin D1 and AgNOR in various prostatic lesions and to determine whether any association or relation between these markers and different Gleason grades exists. Methods: A total 50 cases of various prostatic lesions were studied. Tumor grade, AgNOR staining, and cyclin D1 expression were evaluated in all cases. Correlations between the intensity and differential localization of these markers and Gleason grades were evaluated. Results: The mean AgNOR count in cases of prostatic intraepithelial neoplasia was high compared with cases of benign prostatic hyperplasia (BPH) but lower than that of carcinoma cases. The intensity of cyclin D1 expression was high in carcinoma. A total of 14 cases (46.67%) showed strong positivity. No significant correlation was found between the intensity of cyclin D1 expression, AgNOR count, and histologic grades of prostatic carcinoma, whereas a significant correlation was observed between intensity and percentage expression of cyclin D1 in BPH and carcinoma (P<0.01). Nuclear as well as cytoplasmic positivity was seen among various grades of carcinoma. Conclusions: AgNOR count and cyclin D1 may be helpful in distinguishing between BPH and carcinoma of the prostate but may not be used as reliable indicators of the grade of prostatic adenocarcinoma because of overlapping values in various grades. However, further

  18. FTIR microscopic comparative study on normal, premalignant, and malignant tissues of human intenstine

    NASA Astrophysics Data System (ADS)

    Mordechai, Shaul; Argov, Shmuel; Salman, Ahmad O.; Cohen, Beny; Ramesh, Jagannathan; Erukhimovitch, Vitaly; Goldstein, Jed; Sinelnikov, Igor

    2000-07-01

    Fourier-Transform Infrared Spectroscopy (FTIR) employs a unique approach to optical diagnosis of tissue pathology based on the characteristic molecular vibrational spectra of the tissue. The architectural changes in the cellular and sub-cellular levels developing in abnormal tissue, including a majority of cancer forms, manifest themselves in different optical signatures, which can be detected in infrared spectroscopy. The biological systems we have studied include normal, premalignant (polyp) and malignant human colonic tissues from three patients. Our method is based on microscopic infrared study (FTIR-microscopy) of thin tissue specimens and a direct comparison with normal histopathological analysis, which serves as a `gold' reference. The normal intestine tissue has a stronger absorption than polyp and cancerous types over a wide region in all three cases. The detailed analysis showed that there is a significant decrease in total phosphate and creatine contents for polyp and cancerous tissue types in comparison to the controls.

  19. Malignant transformation in human chondrosarcoma cells supported by telomerase activation and tumor suppressor inactivation.

    PubMed

    Martin, James A; Forest, Erin; Block, Joel A; Klingelhutz, Aloysius J; Whited, Brent; Gitelis, Steven; Wilkey, Andrew; Buckwalter, Joseph A

    2002-09-01

    Human chondrosarcomas do not respond to current chemotherapies or radiation therapy, and their size and histological appearance do not reliably predict the risk of local recurrence and metastases, making selection of surgical treatment difficult. Identifying mechanisms responsible for the proliferation and invasive behavior of these tumors would be of immense clinical value. We hypothesized that telomerase expression is one of these mechanisms. We detected telomerase expression in 7 of 16 chondrosarcomas, but cells cultured from telomerase-negative chondrosarcomas acquired strong telomerase activity and lost tumor suppressor activity after their establishment in culture. These changes were associated with accelerated indefinite cell proliferation, morphological transition, and increased invasive activity, indicating that telomerase activation and loss of cell cycle control leads to the emergence of aggressive cells from chondrosarcoma cell populations. These observations may lead to better understanding of the factors responsible for malignant transformation, local recurrence, and metastases of cartilage neoplasms. PMID:12354749

  20. Prognostic significance of neoplastic cell proliferation parameters in human haematological malignancies.

    PubMed

    Kotelnikov, V M

    1990-01-01

    High percentage of neoplastic cells in S, G2 and M phases of cell cycle is unfavourable prognostic sign in human haematological malignancies. In chronic leukaemias (CML and CLL) it is true for peripheral blood leukaemic cells, in non-Hodgkin lymphomas--for lymph node cells, in multiple myeloma--for bone marrow plasma cells. In acute leukaemia results are controversial: some authors found a correlation between proliferation parameters of bone marrow blast cells while others did not. These parameters correlate positively with the rate of complete remission and negatively with its duration. It is concluded that proliferation parameters of neoplastic cells may be used for individual prognosis in patients with haematological tumours especially in combination with other biological and clinical prognostic markers. PMID:1703108

  1. Phase I study of recombinant human tumor necrosis factor-alpha in patients with advanced malignancies.

    PubMed

    Bartsch, H H; Nagel, G A; Mull, R; Flener, R; Pfizenmaier, K

    1988-01-01

    A clinical phase I trial with recombinant human tumor necrosis factor-alpha (rTNF-alpha) was performed in 30 patients with advanced malignancies. The maximal tolerated dose (MTD) by 3 times weekly intramuscular (i.m.) application was 150 micrograms m-2. Main subjective toxicities including chills, fever, hypotension, fatigue, and anorexia were dose-related. In addition, transient changes in hematologic parameters and lipid metabolism were noted. Two out of 25 evaluated patients showed a minor tumor response after eight weeks of therapy. There was evidence for an improvement of in vivo immuneresponsiveness as revealed from positive delayed type hypersensitivity (DTH) skin tests of 3 out of 6 pretherapeutically anergic patients. We conclude from this phase I trial that rTNF-alpha can be safely administered at doses up to 150 micrograms m-2 i.m., 3 times weekly, without evidence of cumulative toxicity in long-term treatment. PMID:3267369

  2. Effect of Small Molecules Modulating Androgen Receptor (SARMs) in Human Prostate Cancer Models

    PubMed Central

    Tesei, Anna; Leonetti, Carlo; Di Donato, Marzia; Gabucci, Elisa; Porru, Manuela; Varchi, Greta; Guerrini, Andrea; Amadori, Dino; Arienti, Chiara; Pignatta, Sara; Paganelli, Giulia; Caraglia, Michele; Castoria, Gabriella; Zoli, Wainer

    2013-01-01

    The management of hormone-refractory prostate cancer represents a major challenge in the therapy of this tumor, and identification of novel androgen receptor antagonists is needed to render treatment more effective. We analyzed the activity of two novel androgen receptor antagonists, (S)-11 and (R)-9, in in vitro and in vivo experimental models of hormone-sensitive or castration-resistant prostate cancer (CRPC). In vitro experiments were performed on LNCaP, LNCaP-AR, LNCaP-Rbic and VCaP human prostate cancer cells. Cytotoxic activity was assessed by SRB and BrdU uptake, AR transactivation by luciferase reporter assay and PSA levels by Real Time RT-PCR and ELISA assays. Cell cycle progression-related markers were evaluated by western blot. In vivo experiments were performed on SCID mice xenografted with cells with different sensitivity to hormonal treatment. In hormone-sensitive LNCaP and LNCaP-AR cells, the latter expressing high androgen receptor levels, (R)-9 and (S)-11 exhibited a higher cytotoxic effect compared to that of the reference compound ((R)-bicalutamide), also in the presence of the synthetic androgen R1881. Furthermore, the cytotoxic effect produced by (R)-9 was higher than that of (S)-11 in the two hormone-resistant LNCaP-AR and VCaP cells. A significant reduction in PSA levels was observed after exposure to both molecules. Moreover, (S)-11 and (R)-9 inhibited DNA synthesis by blocking the androgen-induced increase in cyclin D1 protein levels. In vivo studies on the toxicological profile of (R)-9 did not reveal the presence of adverse events. Furthermore, (R)-9 inhibited tumor growth in various in vivo models, especially LNCaP-Rbic xenografts, representative of recurrent disease. Our in vitro results highlight the antitumor activity of the two novel molecules (R)-9 and (S)-11, making them a potentially attractive option for the treatment of CRPC. PMID:23667504

  3. Dietary tocopherols inhibit PhIP-induced prostate carcinogenesis in CYP1A-humanized mice.

    PubMed

    Chen, Jayson X; Li, Guangxun; Wang, Hong; Liu, Anna; Lee, Mao-Jung; Reuhl, Kenneth; Suh, Nanjoo; Bosland, Maarten C; Yang, Chung S

    2016-02-01

    Tocopherols, the major forms of vitamin E, exist as alpha-tocopherol (α-T), β-T, γ-T and δ-T. The cancer preventive activity of vitamin E is suggested by epidemiological studies, but recent large-scale cancer prevention trials with high dose of α-T yielded disappointing results. Our hypothesis that other forms of tocopherols have higher cancer preventive activities than α-T was tested, herein, in a novel prostate carcinogenesis model induced by 2-amino-1-methyl-6-phenylimidazo [4,5-b] pyridine (PhIP), a dietary carcinogen, in the CYP1A-humanized (hCYP1A) mice. Treatment of hCYP1A mice with PhIP (200 mg/kg b.w., i.g.) induced high percentages of mouse prostatic intraepithelial neoplasia (mPIN), mainly in the dorsolateral glands. Supplementation with a γ-T-rich mixture of tocopherols (γ-TmT, 0.3% in diet) significantly inhibited the development of mPIN lesions and reduced PhIP-induced elevation of 8-oxo-deoxyguanosine, COX-2, nitrotyrosine, Ki-67 and p-AKT, and the loss of PTEN and Nrf2. Further studies with purified δ-T, γ-T or α-T (0.2% in diet) showed that δ-T was more effective than γ-T or α-T in preventing mPIN formations and p-AKT elevation. These results indicate that γ-TmT and δ-T could be effective preventive agents of prostate cancer. PMID:26582657

  4. A B-Cell Superantigen Induces the Apoptosis of Murine and Human Malignant B Cells.

    PubMed

    Lorenzo, Daniela; Duarte, Alejandra; Mundiñano, Juliana; Berguer, Paula; Nepomnaschy, Irene; Piazzon, Isabel

    2016-01-01

    B-cell superantigens (Sags) bind to conserved sites of the VH or VL regions of immunoglobulin molecules outside their complementarity-determining regions causing the apoptosis of normal cognate B cells. No attempts to investigate whether B-cell Sags are able to induce the apoptosis of cognate malignant B cells were reported. In the present study we show that protein L (PpL), secreted by Finegoldia magna, a B-cell Sag which interacts with κ+ bearing cells, induces the apoptosis of murine and human κ+ lymphoma B cells both in vitro and in vivo. Apoptosis was not altered by caspase-8 inhibitor. No alterations in the levels of Bid, Fas and Fas-L were found suggesting that PpL does not activate the extrinsic pathway of apoptosis. The involvement of the intrinsic pathway was clearly indicated by: i) alterations in mitochondrial membrane potential (ΔΨm) both in murine and human lymphoma cells exposed to PpL; ii) decreased levels of apoptosis in the presence of caspase-9 inhibitor; iii) significant increases of Bim and Bax protein levels and downregulation of Bcl-2; iv) the translocation from the cytoplasm to the mitochondria of Bax and Bim pro-apoptotic proteins and its inhibition by caspase-9 inhibitor but not by caspase-8 inhibitor and v) the translocation of Bcl-2 protein from the mitochondria to the cytosol and its inhibition by caspase-9 inhibitor but not by caspase-8 inhibitor. The possibility of a therapeutic use of Sags in lymphoma/leukemia B cell malignancies is discussed. PMID:27603942

  5. Inhibition of prostaglandin synthesis and actions by genistein in human prostate cancer cells and by soy isoflavones in prostate cancer patients.

    PubMed

    Swami, Srilatha; Krishnan, Aruna V; Moreno, Jacqueline; Bhattacharyya, Rumi S; Gardner, Christopher; Brooks, James D; Peehl, Donna M; Feldman, David

    2009-05-01

    Soy and its constituent isoflavone genistein inhibit the development and progression of prostate cancer (PCa). Our study in both cultured cells and PCa patients reveals a novel pathway for the actions of genistein, namely the inhibition of the synthesis and biological actions of prostaglandins (PGs), known stimulators of PCa growth. In the cell culture experiments, genistein decreased cyclooxygenase-2 (COX-2) mRNA and protein expression in both human PCa cell lines (LNCaP and PC-3) and primary prostate epithelial cells and increased 15-hydroxyprostaglandin dehydrogenase (15-PGDH) mRNA levels in primary prostate cells. As a result genistein significantly reduced the secretion of PGE(2) by these cells. EP4 and FP PG receptor mRNA were also reduced by genistein, providing an additional mechanism for the suppression of PG biological effects. Further, the growth stimulatory effects of both exogenous PGs and endogenous PGs derived from precursor arachidonic acid were attenuated by genistein. We also performed a pilot randomised double blind clinical study in which placebo or soy isoflavone supplements were given to PCa patients in the neo-adjuvant setting for 2 weeks before prostatectomy. Gene expression changes were measured in the prostatectomy specimens. In PCa patients ingesting isoflavones, we observed significant decreases in prostate COX-2 mRNA and increases in p21 mRNA. There were significant correlations between COX-2 mRNA suppression, p21 mRNA stimulation and serum isoflavone levels. We propose that the inhibition of the PG pathway contributes to the beneficial effect of soy isoflavones in PCa chemoprevention and/or treatment. PMID:19127598

  6. Surface charge characteristics of cells from malignant cell lines and normal cell lines of the human hematopoietic system.

    PubMed

    Marikovsky, Y; Ben-Bassat, H; Leibovich, S J; Cividalli, L; Fischler, H; Danon, D

    1979-02-01

    Cells from malignant and normal lines of human hematopoietic origin were studied for their surface charge characteristics with the use of the following criteria: 1) the electron microscopic appearance of cell membranes after labeling with cationized ferritin (CF) either before or after glutaraldehyde fixation, 2) electrophoretic mobility, 3) total sialic acid content, and 4) agglutinability with poly-L-lysine (PLL). CF induced a time-dependent redistribution of surface receptors in unfixed malignant cells but not in unfixed normal cells. After 10 seconds of labeling with CF, both normal and malignant unfixed cells showed a uniform and even labeling pattern. After 5 minutes of labeling, malignant cells exhibited a highly pronounced pattern of clusters and patches, as distinct from a random and even pattern exhibited by normal cells. Both normal and malignant cells after fixation exhibited an equivalent random and even labeling pattern with CF, independent of the duration of labeling. The malignant cells studied possessed less sialic acid, had a lower electric mobility, and were agglutinated more readily with PLL than were the normal cells. PMID:310907

  7. Bortezomib and etoposide combinations exert synergistic effects on the human prostate cancer cell line PC-3

    PubMed Central

    ARAS, BEKIR; YERLIKAYA, AZMI

    2016-01-01

    Novel treatment modalities are urgently required for androgen-independent prostate cancer. In order to develop an alternative treatment for prostate cancer, the cytotoxic effects of the 26S proteasome inhibitor bortezomib, either alone or in combination with the two commonly used chemotherapeutic agents irinotecan and etoposide, on the human prostate cancer cell line PC-3 were evaluated in the present study. The PC-3 cell line was maintained in Dulbecco's modified Eagle's medium with 10% fetal bovine serum and treated with various doses of bortezomib, irinotecan, etoposide or their combinations. The growth inhibitory and cytotoxic effects were determined by water-soluble tetrazolium (WST)-1 assay, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay or iCELLigence system. The combination index values were determined by the Chou-Talalay method. The half maximal inhibitory concentration (IC50) value of bortezomib on the PC-3 cell line was determined to be 53.4 nM by WST-1 assay, whereas the IC50 values of irinotecan and etoposide were determined to be 2.1 and 26.5 µM, respectively. These results suggest that the 26S proteasome inhibitor bortezomib is more potent, compared with irinotecan and etoposide, in the androgen-insensitive and tumor protein p53-null cell line PC-3. The combined effects of bortezomib+irinotecan and bortezomib+etoposide were also tested on PC-3 cells. The effect of bortezomib+irinotecan combination was not significantly different than that produced by either monotherapy, according to the results of iCELLigence system and MTT assay. However, 40 nM bortezomib+5 µM etoposide or 40 nM bortezomib+20 µM etoposide combinations were observed to be more effective than each drug tested alone. The results of the current study suggest that bortezomib and etoposide combination may be additionally evaluated in clinical trials for the treatment of hormone-refractory prostate cancer. PMID:27123085

  8. In vivo determination of the absorption and scattering spectra of the human prostate during photodynamic therapy

    PubMed Central

    Finlay, Jarod C.; Zhu, Timothy C; Dimofte, Andreea; Stripp, Diana; Malkowicz, S. Bruce; Whittington, Richard; Miles, Jeremy; Glatstein, Eli; Hahn, Stephen M.

    2015-01-01

    A continuing challenge in photodynamic therapy is the accurate in vivo determination of the optical properties of the tissue being treated. We have developed a method for characterizing the absorption and scattering spectra of prostate tissue undergoing PDT treatment. Our current prostate treatment protocol involves interstitial illumination of the organ via cylindrical diffusing optical fibers (CDFs) inserted into the prostate through clear catheters. We employ one of these catheters to insert an isotropic white light point source into the prostate. An isotropic detection fiber connected to a spectrograph is inserted into a second catheter a known distance away. The detector is moved along the catheter by a computer-controlled step motor, acquiring diffuse light spectra at 2 mm intervals along its path. We model the fluence rate as a function of wavelength and distance along the detector’s path using an infinite medium diffusion theory model whose free parameters are the absorption coefficient µa at each wavelength and two variables A and b which characterize the reduced scattering spectrum of the form µ’s = Aλ−b. We analyze our spectroscopic data using a nonlinear fitting algorithm to determine A, b, and µa at each wavelength independently; no prior knowledge of the absorption spectrum or of the sample’s constituent absorbers is required. We have tested this method in tissue simulating phantoms composed of intralipid and the photosensitizer motexafin lutetium (MLu). The MLu absorption spectrum recovered from the phantoms agrees with that measured in clear solution, and µa at the MLu absorption peak varies linearly with concentration. The µ’s spectrum reported by the fit is in agreement with the known scattering coefficient of intralipid. We have applied this algorithm to spectroscopic data from human patients sensitized with MLu (2 mg kg−1) acquired before and after PDT. Before PDT, the absorption spectra we measure include the characteristic

  9. Two new trifunctional antibodies for the therapy of human malignant melanoma.

    PubMed

    Ruf, Peter; Jäger, Michael; Ellwart, Joachim; Wosch, Susanne; Kusterer, Elisabeth; Lindhofer, Horst

    2004-02-20

    Trifunctional antibodies are able to redirect T cells and Fcgamma receptor(+) accessory immune cells to tumor targets. The simultaneous activation of these different classes of effector cells results in efficient killing of the tumor cells by different mechanisms such as phagocytosis and perforin-mediated cytotoxicity. Here, we introduce 2 new trifunctional antibodies specific for human melanoma. These trifunctional antibodies recognize with one binding arm CD3 on human T cells. The other binding arm is directed against melanoma-associated proteoglycans or melanoma-associated gangliosides (GD2 as well as GD3). They mediate specific lysis of various melanoma cell lines in correlation with the level of antigen expression in short-term cytotoxicity experiments. A combination of the 2 trifunctional antibodies was equally or even more efficient. Moreover, they induced a strong Th1 cytokine pattern with high amounts of IFN-gamma and low or no IL-4. Accordingly, CD4(+) and especially CD8(+) T cells expanded, whereas B cells, NK cells and monocytes decreased. The cytokine response was up to 16-fold higher when tumor cells were present. IFN-gamma reached cytotoxic concentrations for SK-MEL-23 melanoma cells. The induction of a T-cell-activatory and melanoma cell-inhibitory cytokine milieu together with the redirection of T-cell- and accessory cell-mediated cytotoxicity are interesting features of these trifunctional antibodies. They may be a new option for the therapy of human malignant melanoma. PMID:14696099

  10. siRNA Knockdown of Ribosomal Protein Gene RPL19 Abrogates the Aggressive Phenotype of Human Prostate Cancer

    PubMed Central

    Bee, Alix; Brewer, Daniel; Beesley, Carol; Dodson, Andrew; Forootan, Shiva; Dickinson, Timothy; Gerard, Patricia; Lane, Brian; Yao, Sheng; Cooper, Colin S.; Djamgoz, Mustafa B. A.; Gosden, Christine M.; Ke, Youqiang; Foster, Christopher S.

    2011-01-01

    We provide novel functional data that posttranscriptional silencing of gene RPL19 using RNAi not only abrogates the malignant phenotype of PC-3M prostate cancer cells but is selective with respect to transcription and translation of other genes. Reducing RPL19 transcription modulates a subset of genes, evidenced by gene expression array analysis and Western blotting, but does not compromise cell proliferation or apoptosis in-vitro. However, growth of xenografted tumors containing the knocked-down RPL19 in-vivo is significantly reduced. Analysis of the modulated genes reveals induction of the non-malignant phenotype principally to involve perturbation of networks of transcription factors and cellular adhesion genes. The data provide evidence that extra-ribosomal regulatory functions of RPL19, beyond protein synthesis, are critical regulators of cellular phenotype. Targeting key members of affected networks identified by gene expression analysis raises the possibility of therapeutically stabilizing a benign phenotype generated by modulating the expression of an individual gene and thereafter constraining a malignant phenotype while leaving non-malignant tissues unaffected. PMID:21799931

  11. Dietary Carcinogen 2-Amino-1-Methyl-6-Phenylimidazo[4,5-b]Pyridine Induced Prostate Carcinogenesis in CYP1A-humanized Mice

    PubMed Central

    Li, Guangxun; Wang, Hong; Liu, Anna B.; Cheung, Connie; Reuhl, Kenneth R.; Bosland, Maarten C.; Yang, Chung S.

    2014-01-01

    To develop a relevant mouse model for prostate cancer prevention research, we administered a dietary carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), to CYP1A-humanized mice. In comparison to mouse Cyp1a2, human CYP1A2 preferentially activates PhIP to a proximate carcinogen. Following a single oral dose of PhIP (200 mg/kg body weight), we observed inflammation, atrophy of acini, low-grade prostatic intraepithelial neoplasia (PIN) (after 20 weeks) and high-grade PIN (HgPIN) (after 30 to 50 weeks) in dorso-lateral, ventral and coagulating anterior prostate glands of these mice. These lesions were androgen receptor positive and featured the loss of expression of the basal cell marker p63 and the tumor suppressor PTEN. Similar to human prostate carcinogenesis, glutathione-S-transferase P1 (GSTP1) expression was lost or partially lost in HgPIN. E-Cadherin expression was also lost in HgPIN. The expression of DNA methyltransferase 1 was elevated, possibly to enhance promoter hypermethylation for the silencing of GSTP1 and E-cadherin. Prostate carcinogenesis was promoted by a high-fat stress diet, resulting in HgPIN that developed earlier and in advanced lesions displayed features consistent with carcinoma in situ. This dietary carcinogen-induced prostate cancer model, recapitulating important features of early human prostate carcinogenesis, constitutes a new experimental system for prostate cancer research. PMID:22581815

  12. Cabazitaxel-loaded human serum albumin nanoparticles as a therapeutic agent against prostate cancer

    PubMed Central

    Qu, Na; Lee, Robert J; Sun, Yating; Cai, Guangsheng; Wang, Junyang; Wang, Mengqiao; Lu, Jiahui; Meng, Qingfan; Teng, Lirong; Wang, Di; Teng, Lesheng

    2016-01-01

    Cabazitaxel-loaded human serum albumin nanoparticles (Cbz-NPs) were synthesized to overcome vehicle-related toxicity of current clinical formulation of the drug based on Tween-80 (Cbz-Tween). A salting-out method was used for NP synthesis that avoids the use of chlorinated organic solvent and is simpler compared to the methods based on emulsion-solvent evaporation. Cbz-NPs had a narrow particle size distribution, suitable drug loading content (4.9%), and superior blood biocompatibility based on in vitro hemolysis assay. Blood circulation, tumor uptake, and antitumor activity of Cbz-NPs were assessed in prostatic cancer xenograft-bearing nude mice. Cbz-NPs exhibited prolonged blood circulation and greater accumulation of Cbz in tumors along with reduced toxicity compared to Cbz-Tween. Moreover, hematoxylin and eosin histopathological staining of organs revealed consistent results. The levels of blood urea nitrogen and serum creatinine in drug-treated mice showed that Cbz-NPs were less toxic than Cbz-Tween to the kidneys. In conclusion, Cbz-NPs provide a promising therapeutic for prostate cancer. PMID:27555767

  13. Real Time Metastatic Route Tracking of Orthotopic PC-3-GFP Human Prostate Cancer Using Intravital Imaging.

    PubMed

    Zhang, Yong; Wang, Xiaoen; Hoffman, Robert M; Seki, Naohiko

    2016-04-01

    The cellular basis of metastasis is poorly understood. An important step to understanding this process is to be able to visualize the routes by which cancer cells migrate from the primary tumor to various distant sites to eventually form metastasis. Our laboratory previously developed single-cell in vivo imaging using fluorescent proteins to label cancer cells. In the present study, using PC-3 human prostate cancer cells labeled with green fluorescent protein (GFP) and orthotopic tumor transplantation, we have imaged in live mice various highly diverse routes by which PC-3 cells metastasize superiorly and inferiorly to distant sites, including in the portal area, stomach area, and urogenital system. Imaging began at day 9, at which time distant metastasis had already occurred, and increased at each imaging point at days 10, 13, 14, and 16. Metastatic cells were observed migrating superiorly and inferiorly from the primary tumor as well as in lymphatic channels and trafficking in various organ systems demonstrating that PC-3 has multiple metastatic routes similar to hormone-independent advanced-stage prostate cancer in the clinic. PMID:26515240

  14. Delivery of retinoic acid to LNCap human prostate cancer cells using solid lipid nanoparticles.

    PubMed

    Akanda, Mushfiq H; Rai, Rajeev; Slipper, Ian J; Chowdhry, Babur Z; Lamprou, Dimitrios; Getti, Giulia; Douroumis, Dennis

    2015-09-30

    In this study retinoic acid (RTA) loaded solid lipid nanoparticles (SLNs) were optimized by tuning the process parameters (pressure/temperature) and using different lipids to develop nanodispersions with enhanced anticancer activity. The RTA-SLN dispersions were produced by high-pressure homogenization and characterized in terms of particle size, zeta potential, drug entrapment efficiency, stability, transmission electron microscopy (TEM), atomic force microscopy (AFM), X-ray diffraction (XRD) and in vitro drug release. Thermal and X-ray analysis showed the RTA to be in the amorphous state, whilst microscopic images revealed a spherical shape and uniform particle size distribution of the nanoparticles. Anticancer efficiency was evaluated by incubating RTA-SLNs with human prostate cancer (LNCap) cells, which demonstrated reduced cell viability with increased drug concentrations (9.53% at 200 ug/ml) while blank SLNs displayed negligible cytotoxicity. The cellular uptake of SLN showed localization within the cytoplasm of cells and flow cytometry analysis indicated an increase in the fraction of cells expressing early apoptotic markers, suggesting that the RTA loaded SLNs are able to induce apoptosis in LNCap cells. The RTA-SLN dispersions have the potential to be used for prostate anticancer treatment. PMID:26200751

  15. Cabazitaxel-loaded human serum albumin nanoparticles as a therapeutic agent against prostate cancer.

    PubMed

    Qu, Na; Lee, Robert J; Sun, Yating; Cai, Guangsheng; Wang, Junyang; Wang, Mengqiao; Lu, Jiahui; Meng, Qingfan; Teng, Lirong; Wang, Di; Teng, Lesheng

    2016-01-01

    Cabazitaxel-loaded human serum albumin nanoparticles (Cbz-NPs) were synthesized to overcome vehicle-related toxicity of current clinical formulation of the drug based on Tween-80 (Cbz-Tween). A salting-out method was used for NP synthesis that avoids the use of chlorinated organic solvent and is simpler compared to the methods based on emulsion-solvent evaporation. Cbz-NPs had a narrow particle size distribution, suitable drug loading content (4.9%), and superior blood biocompatibility based on in vitro hemolysis assay. Blood circulation, tumor uptake, and antitumor activity of Cbz-NPs were assessed in prostatic cancer xenograft-bearing nude mice. Cbz-NPs exhibited prolonged blood circulation and greater accumulation of Cbz in tumors along with reduced toxicity compared to Cbz-Tween. Moreover, hematoxylin and eosin histopathological staining of organs revealed consistent results. The levels of blood urea nitrogen and serum creatinine in drug-treated mice showed that Cbz-NPs were less toxic than Cbz-Tween to the kidneys. In conclusion, Cbz-NPs provide a promising therapeutic for prostate cancer. PMID:27555767

  16. Prostatic blue nevus.

    PubMed

    Anderco, Denisa; Lazăr, Elena; Tăban, Sorina; Miclea, Fl; Dema, Alis

    2010-01-01

    We report the case of a 69-year-old patient with no significant personal urological history. The clinical and ultrasound examination revealed a prostatic gland with increased volume and homogenous appearance. After transurethral resection, multiples gray-brown-blackish prostatic chips were obtained, which could be confused with a malignant melanoma. The histological routine examination in conjunction with the histochemical (Fontana-Masson) and immunohistochemical (S100, HMB45) reactions established the diagnosis of prostatic blue nevus. The presence of melanin in prostatic tissue is an unusual aspect, being encountered three distinct lesions: blue nevus, melanosis and malignant melanoma. Recognition and correct classification of each of these three entities is fundamental, concerning the clinical and prognosis implications. PMID:20809037

  17. Improved prostate cancer detection with a human kallikrein 11 and percentage free PSA-based artificial neural network.

    PubMed

    Stephan, Carsten; Meyer, Hellmuth-Alexander; Cammann, Henning; Nakamura, Terukazu; Diamandis, Eleftherios P; Jung, Klaus

    2006-06-01

    Human kallikrein 11 (hK11) was evaluated in a percentage free PSA-based artificial neural network (ANN) to reduce unnecessary prostate biopsies. Serum samples from 357 patients with (n=132) and without (n=225) prostate cancer (PCa) were analyzed and ANN models were constructed and compared to all parameters. The discriminatory power of hK11 was lower than that of PSA, but receiver operator characteristic (ROC) analyses demonstrated significantly larger areas under the curves for the ANN compared to all other parameters. ANNs with hK11 may lead to a further reduction in unnecessary prostate biopsies, especially when analyzing patients with less than 15% free PSA. PMID:16800743

  18. Herpes simplex virus type 2 or human herpesvirus 8 infection and prostate cancer risk: A meta-analysis.

    PubMed

    Ge, Xiaoxiao; Wang, Xiao; Shen, Peng

    2013-05-01

    Prostate cancer is the second most frequently diagnosed type of cancer and the sixth leading cause of cancer mortality among males worldwide. The aim of this study was to investigate the association between the infection by herpes simplex virus type 2 (HSV-2) or human herpesvirus 8 (HHV-8) and the risk of prostate cancer. A systematic literature search was performed using PubMed, Cochrane Library, Web of Science, Scopus, CNKI and CBM. The association of HSV-2 or HHV-8 infection with the risk of prostate cancer was separately assessed. Estimates of the odds ratio (OR) with 95% confidence interval (CI) were pooled by the fixed- or random-effects model. A total of 11 articles with 2,996 cases and 3,875 controls were included in this meta-analysis. HSV-2 infection was associated with increased prostate cancer risk (OR=1.209; 95% CI, 1.003-1.456). Results of the stratified analysis suggested that such an association existed among participants from North and South America (OR=1.226; 95% CI, 1.000-1.503). No significant correlation was observed in the HHV-8 group (OR=1.106; 95% CI, 0.765-1.598). Further investigations and large-sample studies are required to elucidate the possible mechanism underlying viral carcinogenesis and the association between herpes virus infection and the risk of prostate cancer. PMID:24648964

  19. Frequent detection of high human papillomavirus DNA loads in oral potentially malignant disorders.

    PubMed

    Pierangeli, A; Cannella, F; Scagnolari, C; Gentile, M; Sciandra, I; Antonelli, G; Ciolfi, C; Russo, C; Palaia, G; Romeo, U; Polimeni, A

    2016-01-01

    Human papillomavirus (HPV) is estimated to be the cause of 40--80% of the squamous cell carcinoma of the oropharynx but only of a small fraction of the oral cavity cancers. The prevalence of oral HPV infection has significantly increased in the last decade, raising concerns about the role of HPV in progression of oral potentially malignant disorders (OPMD) toward squamous cell carcinomas. We sought to study HPV infection in patients with oral lesions, and in control individuals, using non-invasive and site-specific oral brushing and sensitive molecular methods. HPV DNA positivity and viral loads were evaluated in relation to patient data and clinical diagnosis. We enrolled 116 individuals attending Dental Clinics: 62 patients with benign oral lesions (e.g. fibromas, papillomatosis, ulcers) or OPMD (e.g. lichen, leukoplakia) and 54 controls. Oral cells were collected with Cytobrush and HPV-DNA was detected with quantitative real-time PCR for the more common high-risk (HR) and low-risk (LR) genotypes. HPV detection rate, percentage of HR HPVs and HPV-DNA loads (namely HPV16 and in particular, HPV18) were significantly higher in patients than in controls. Lichen planus cases had the highest HPV-positive rate (75.0%), hairy leukoplakia the lowest (33.3%). This study detected unexpectedly high rates of HPV infection in cells of the oral mucosa. The elevated HR HPV loads found in OPMD suggest the effectiveness of quantitative PCR in testing oral lesions. Prospective studies are needed to establish whether elevated viral loads represent a clinically useful marker of the risk of malignant progression. PMID:26408278

  20. Human papillomavirus infection and the malignant transformation of sinonasal inverted papilloma: A meta-analysis.

    PubMed

    Zhao, Ren-Wu; Guo, Zhi-Qiang; Zhang, Ru-Xin

    2016-06-01

    A growing number of molecular epidemiological studies have been conducted to evaluate the association between human papillomavirus (HPV) infection and the malignancy of sinonasal inverted papilloma (SNIP). However, the results remain inconclusive. Here, a meta-analysis was conducted to quantitatively assess this association. Case-control studies investigating SNIP tissues for presence of HPV DNA were identified. The odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by the Mantel-Haenszel method. An assessment of publication bias and sensitivity analysis were also performed. We calculated a pooled OR of 2.16 (95% CI=1.46-3.21, P<0.001) without statistically significant heterogeneity or publication bias. Stratification by HPV type showed a stronger association for patients with high-risk HPV (hrHPV) types, HPV-16, HPV-18, and HPV-16/18 infection (OR=8.8 [95% CI: 4.73-16.38], 8.04 [95% CI: 3.34-19.39], 18.57 [95% CI: 4.56-75.70], and 26.24 [4.35-158.47], respectively). When only using PCR studies, pooled ORs for patients with hrHPV, HPV-16, and HPV18 infection still reached statistical significance. However, Egger's test reflected significant publication bias in the HPV-16 sub-analysis (P=0.06), and the adjusted OR was no longer statistically significant (OR=1.65, 95%CI: 0.58-4.63). These results suggest that HPV infection, especially hrHPV (HPV-18), is significantly associated with malignant SNIP. PMID:27085508

  1. Preclinical studies identify novel targeted pharmacological strategies for treatment of human malignant pleural mesothelioma

    PubMed Central

    Favoni, Roberto E; Daga, Antonio; Malatesta, Paolo; Florio, Tullio

    2012-01-01

    The incidence of human malignant pleural mesothelioma (hMPM) is still increasing worldwide. hMPM prognosis is poor even if the median survival time has been slightly improved after the introduction of the up-to-date chemotherapy. Nevertheless, large phase II/III trials support the combination of platinum derivatives and pemetrexed or raltitrexed, as preferred first-line schedule. Better understanding of the molecular machinery of hMPM will lead to the design and synthesis of novel compounds targeted against pathways identified as crucial for hMPM cell proliferation and spreading. Among them, several receptors tyrosine kinase show altered activity in subsets of hMPM. This observation suggests that these kinases might represent novel therapeutic targets in this chemotherapy-resistant disease. Over these foundations, several promising studies are ongoing at preclinical level and novel molecules are currently under evaluation as well. Yet, established tumour cell lines, used for decades to investigate the efficacy of anticancer agents, although still the main source of drug efficacy studies, after long-term cultures tend to biologically diverge from the original tumour, limiting the predictive potential of in vivo efficacy. Cancer stem cells (CSCs), a subpopulation of malignant cells capable of self-renewal and multilineage differentiation, are believed to play an essential role in cancer initiation, growth, metastasization and relapse, being responsible of chemo- and radiotherapy refractoriness. According to the current carcinogenesis theory, CSCs represent the tumour-initiating cell (TIC) fraction, the only clonogenic subpopulation able to originate a tumour mass. Consequently, the recently described isolation of TICs from hMPM, the proposed main pharmacological target for novel antitumoural drugs, may contribute to better dissect the biology and multidrug resistance pathways controlling hMPM growth. PMID:22289125

  2. Isolation and characterization of human malignant glioma cells from histologically normal brain.

    PubMed

    Silbergeld, D L; Chicoine, M R

    1997-03-01

    Brain invasion prevents complete surgical extirpation of malignant gliomas; however, invasive cells from distant, histologically normal brain previously have not been isolated, cultured, and characterized. To evaluate invasive human malignant glioma cells, the authors established cultures from gross tumor and histologically normal brain. Three men and one woman, with a mean age of 67 years, underwent two frontal and two temporal lobectomies for tumors, which yielded specimens of both gross tumor and histologically normal brain. Each specimen was acquired a minimum of 4 cm from the gross tumor. The specimens were split: a portion was sent for neuropathological evaluation (three glioblastomas multiforme and one oligodendroglioma) and a portion was used to establish cell lines. Morphologically, the specimens of gross tumor and histologically normal brain were identical in three of the four cell culture pairs. Histochemical staining characteristics were consistent both within each pair and when compared with the specimens sent for neuropathological evaluation. Cultures demonstrated anchorage-independent growth in soft agarose and neoplastic karyotypes. Growth rates in culture were greater for histologically normal brain than for gross tumor in three of the four culture pairs. Although the observed increases in growth rates of histologically normal brain cultures do not correlate with in vivo behavior, these findings corroborate the previously reported stem cell potential of invasive glioma cells. Using the radial dish assay, no significant differences in motility between cultures of gross tumor and histologically normal brain were found. In summary, tumor cells were cultured from histologically normal brain acquired from a distance greater than 4 cm from the gross tumor, indicating the relative insensitivity of standard histopathological identification of invasive glioma cells (and hence the inadequacy of frozen-section evaluation of resection margins). Cell lines

  3. The systemic delivery of an oncolytic adenovirus expressing decorin inhibits bone metastasis in a mouse model of human prostate cancer

    DOE PAGESBeta

    Xu, Weidong; Neill, Thomas; Yang, Yuefeng; Hu, Zebin; Cleveland, Elyse; Wu, Ying; Hutten, Ryan; Xiao, Xianghui; Stock, Stuart R.; Shevrin, Daniel; et al

    2014-12-11

    In an effort to develop a new therapy for prostate cancer bone metastases, we have created Ad.dcn, a recombinant oncolytic adenovirus carrying the human decorin gene. Infection of PC-3 and DU-145, the human prostate tumor cells, with Ad.dcn or a non-replicating adenovirus Ad(E1-).dcn resulted in decorin expression; Ad.dcn produced high viral titers and cytotoxicity in human prostate tumor cells. Adenoviral-mediated decorin expression inhibited Met, the Wnt/β- catenin signaling axis, vascular endothelial growth factor A, reduced mitochondrial DNA levels, and inhibited tumor cell migration. To examine the anti-tumor response of Ad.dcn, PC-3-luc cells were inoculated in the left heart ventricle tomore » establish bone metastases in nude mice. Ad.dcn, in conjunction with control replicating and non-replicating vectors were injected via tail vein. The real-time monitoring of mice, once a week, by bioluminescence imaging and X-ray radiography showed that Ad.dcn produced significant inhibition of skeletal metastases. Analyses of the mice at the terminal time point indicated a significant reduction in the tumor burden, osteoclast number, serum TRACP 5b levels, osteocalcin levels, hypercalcemia, inhibition of cancer cachexia, and an increase in the animal survival. Finally, based on these studies, we believe that Ad.dcn can be developed as a potential new therapy for prostate cancer bone metastasis.« less

  4. The systemic delivery of an oncolytic adenovirus expressing decorin inhibits bone metastasis in a mouse model of human prostate cancer

    SciTech Connect

    Xu, Weidong; Neill, Thomas; Yang, Yuefeng; Hu, Zebin; Cleveland, Elyse; Wu, Ying; Hutten, Ryan; Xiao, Xianghui; Stock, Stuart R.; Shevrin, Daniel; Kaul, Karen; Brendler, Charles; Iozzo, Renato V.; Seth, Prem

    2014-12-11

    In an effort to develop a new therapy for prostate cancer bone metastases, we have created Ad.dcn, a recombinant oncolytic adenovirus carrying the human decorin gene. Infection of PC-3 and DU-145, the human prostate tumor cells, with Ad.dcn or a non-replicating adenovirus Ad(E1-).dcn resulted in decorin expression; Ad.dcn produced high viral titers and cytotoxicity in human prostate tumor cells. Adenoviral-mediated decorin expression inhibited Met, the Wnt/β- catenin signaling axis, vascular endothelial growth factor A, reduced mitochondrial DNA levels, and inhibited tumor cell migration. To examine the anti-tumor response of Ad.dcn, PC-3-luc cells were inoculated in the left heart ventricle to establish bone metastases in nude mice. Ad.dcn, in conjunction with control replicating and non-replicating vectors were injected via tail vein. The real-time monitoring of mice, once a week, by bioluminescence imaging and X-ray radiography showed that Ad.dcn produced significant inhibition of skeletal metastases. Analyses of the mice at the terminal time point indicated a significant reduction in the tumor burden, osteoclast number, serum TRACP 5b levels, osteocalcin levels, hypercalcemia, inhibition of cancer cachexia, and an increase in the animal survival. Finally, based on these studies, we believe that Ad.dcn can be developed as a potential new therapy for prostate cancer bone metastasis.

  5. Adenoviral-Mediated Endothelial Precursor Cell Delivery of Soluble CD115 Suppresses Human Prostate Cancer Xenograft Growth in Mice

    PubMed Central

    Lucas, Trevor; Abraham, Dietmar; Untergasser, Gerold; Zins, Karin; Hofer, Erhard; Gunsilius, Eberhard; Aharinejad, Seyedhossein

    2009-01-01

    Prostate cancer tumor growth and neovascularization is promoted by an interplay between migratory tumor stromal cells such as specialized tumor-associated macrophages (TAMs) and circulating endothelial precursor cells (CEPs). As vehicles for tumor therapy, human CEPs are relatively easy to isolate from peripheral blood, are able to proliferate long-term in vitro, are amenable to viral manipulation, and preferentially home to regions of ischemia found in growing tumors. We show here that human peripheral blood CEPs expanded ex vivo migrate to prostate cancer cells in vitro and efficiently home to human prostate tumor xenografts in vivo. Infection of precursors ex vivo with an adenovirus constructed to secrete a soluble form of the colony-stimulating factor-1 receptor CD115 that inhibits macrophage viability and migration in vitro significantly decreases the number of TAMs in xenografts (p < .05), reduces proliferation (p < .01) and vascular density (p < .03), and suppresses the growth of xenografts (p < .03). These data show for the first time that targeting stromal cell processes with cellular therapy has the potential to retard prostate tumor growth. PMID:19522014

  6. Vitamin E and Prostate Cancer

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vitamin E, its metabolites or its analogs, might help prevent prostate cancer initiation or progression. Prostate cancer is the most common non-skin malignancy and the second leading cause of cancer deaths among men in the United States, exceeded only by lung cancer. About 218,890 new cases of prost...

  7. Horizontal Transmission and Retention of Malignancy, as well as Functional Human Genes, After Spontaneous Fusion of Human Glioblastoma and Hamster Host Cells In Vivo

    PubMed Central

    Goldenberg, David M.; Zagzag, David; Heselmeyer-Haddad, Kerstin M.; Berroa Garcia, Lissa Y; Ried, Thomas; Loo, Meiyu; Chang, Chien-Hsing; Gold, David V.

    2011-01-01

    Cell fusion in vitro has been used to study cancer, gene mapping and regulation, and the production of antibodies via hybridomas. However, in-vivo heterosynkaryon formation by cell-cell fusion has received less attention. This investigation describes the spontaneous fusion of a human glioblastoma with normal hamster cells after xenogeneic transplantation, resulting in malignant cells that express both human and hamster genes and gene products, and retention of glioblastoma traits with an enhanced ability to metastasize. Three of 7 human genes found showed translation of their proteins during serial propagation in vivo or in vitro for years; namely, CD74, CXCR4, and PLAGL2, each implicated with malignancy or glioblastoma. This supports the thesis that genetic hybridization of cancer and normal cells can transmit malignancy and also, as first described herein, regulatory genes involved in the tumor’s organotypic morphology. Evidence also is increasing that even cell-free human cancer DNA can induce malignancy and transfer genetic information to normal cells. Hence, we posit that the transfer of genetic information between tumor and stromal cells, whether by cell-cell fusion or other mechanisms, is implicated in the progression of malignancy, and may further define the crosstalk between cancer cells and their stromal neighbors. PMID:21796629

  8. Ca²⁺ Movement Induced by Deltamethrin in PC3 Human Prostate Cancer Cells.

    PubMed

    Lee, Hai-Hsiang; Chou, Chiang-Ting; Liang, Wei-Zhe; Chen, Wei-Chuan; Wang, Jue-Long; Yeh, Jeng-Hsien; Kuo, Chun-Chi; Shieh, Pochuen; Kuo, Daih-Huang; Chen, Fu-An; Jan, Chung-Ren

    2016-06-30

    This study explored the effect of deltamethrin, a pesticide, on intracellular free Ca²⁺ concentration ([Ca²⁺]i) in PC3 human prostate cancer cells. Deltamethrin at concentrations between 5 μM and 20 μM evoked [Ca²⁺]i rises in a concentration-dependent manner. This Ca²⁺ signal was inhibited by 22% by removal of extracellular Ca²⁺. Nifedipine, econazole, and SKF96365 also inhibited the Ca²⁺ signal. Treatment with the endoplasmic reticulum Ca²⁺ pump inhibitor 2,5-di-tert-butylhydroquinone (BHQ) in Ca²⁺-free medium nearly abolished deltamethrin-induced [Ca²⁺]i rises. Treatment with deltamethrin also inhibited most of BHQ-induced [Ca²⁺]i rises. Inhibition of phospholipase C (PLC) with U73122 failed to alter deltamethrin-evoked [Ca²⁺]i rises. Deltamethrin killed cells at concentrations of 20-100 μM in a concentration-dependent fashion. Chelation of cytosolic Ca²⁺ with 1,2-bis (2-aminophenoxy) ethane-N, N, N', N'-tetraacetic acid/acetoxymethyl ester (BAPTA/AM) did not prevent deltamethrin's cytotoxicity. Together, in PC3 human prostate cancer cells, deltamethrin induced [Ca²⁺]i rises that involved Ca²⁺ entry through store-operated Ca²⁺ channels and PLC-independent Ca²⁺ release from the endoplasmic reticulum. Deltamethrin induced cytotoxicity in a Ca²⁺-independent manner. PMID:27188467

  9. Prostate cancer detection using combined auto-fluorescence and light reflectance spectroscopy: ex vivo study of human prostates

    PubMed Central

    Sharma, Vikrant; Olweny, Ephrem O.; Kapur, Payal; Cadeddu, Jeffrey A.; Roehrborn, Claus G.; Liu, Hanli

    2014-01-01

    This study was conducted to evaluate the capability of detecting prostate cancer (PCa) using auto-fluorescence lifetime spectroscopy (AFLS) and light reflectance spectroscopy (LRS). AFLS used excitation at 447 nm with four emission wavelengths (532, 562, 632, and 684 nm), where their lifetimes and weights were analyzed using a double exponent model. LRS was measured between 500 and 840 nm and analyzed by a quantitative model to determine hemoglobin concentrations and light scattering. Both AFLS and LRS were taken on n = 724 distinct locations from both prostate capsular (nc = 185) and parenchymal (np = 539) tissues, including PCa tissue, benign peripheral zone tissue and benign prostatic hyperplasia (BPH), of fresh ex vivo radical prostatectomy specimens from 37 patients with high volume, intermediate-to-high-grade PCa (Gleason score, GS ≥7). AFLS and LRS parameters from parenchymal tissues were analyzed for statistical testing and classification. A feature selection algorithm based on multinomial logistic regression was implemented to identify critical parameters in order to classify high-grade PCa tissue. The regression model was in turn used to classify PCa tissue at the individual aggressive level of GS = 7,8,9. Receiver operating characteristic curves were generated and used to determine classification accuracy for each tissue type. We show that our dual-modal technique resulted in accuracies of 87.9%, 90.1%, and 85.1% for PCa classification at GS = 7, 8, 9 within parenchymal tissues, and up to 91.1%, 91.9%, and 94.3% if capsular tissues were included for detection. Possible biochemical and physiological mechanisms causing signal differences in AFLS and LRS between PCa and benign tissues were also discussed. PMID:24877012

  10. Anti-CTLA-4 therapy results in higher CD4+ICOShi T cell frequency and IFN-γ levels in both nonmalignant and malignant prostate tissues

    PubMed Central

    Chen, Hong; Liakou, Chrysoula I.; Kamat, Ashish; Pettaway, Curtis; Ward, John F.; Tang, Derek Ng; Sun, Jingjing; Jungbluth, Achim A.; Troncoso, Patricia; Logothetis, Christopher; Sharma, Padmanee

    2009-01-01

    Cytotoxic lymphocyte antigen-4 (CTLA-4) blockade is an active immunotherapeutic strategy that is currently in clinical trials in cancer. There are several ongoing trials of anti-CTLA-4 in the metastatic setting of prostate cancer patients with reported clinical responses consisting of decreases in the prostate specific antigen (PSA) tumor marker for some patients. Immunologic markers that correlate with these clinical responses are necessary to guide further development of anti-CTLA-4 therapy in the treatment of cancer patients. We recently reported that CD4+ inducible co-stimulator (ICOS)hi T cells that produce interferon-γ (IFN-γ) are increased in the peripheral blood and tumor tissues of bladder cancer patients treated with anti-CTLA-4 antibody. Here we present data from the same clinical trial in bladder cancer patients demonstrating a higher frequency of CD4+ICOShi T cells and IFN-γ mRNA levels in nonmalignant prostate tissues and incidental prostate tumor tissues removed at the time of radical cystoprostatectomy. Our data suggest immunologic markers that can be used to monitor prostate cancer patients who receive anti-CTLA-4 therapy and indicate that the immunologic impact of anti-CTLA-4 antibody can occur in both tumor and nonmalignant tissues. These data should be taken into consideration for evaluation of efficacy as well as immune-related adverse events associated with anti-CTLA-4 therapy. PMID:19202079

  11. Significant systemic therapeutic effects of high-LET immunoradiation by 212Pb-trastuzumab against prostatic tumors of androgen-independent human prostate cancer in mice.

    PubMed

    Tan, Zongqing; Chen, Pingping; Schneider, Nathan; Glover, Samuel; Cui, Lingling; Torgue, Julien; Rixe, Olivier; Spitz, Henry B; Dong, Zhongyun

    2012-06-01

    The purpose of this study was to determine therapeutic effects and systemic toxicity of 212Pb-trastuzumab in an orthotopic model of human prostate cancer cells in nude mice. TCMC-Trastuzumab was radiolabeled with 212Pb. The 212Pb-trastuzumab generated from the procedure was intact and had high binding affinity with a dissociation constant (of 3.9±0.99 nM. PC-3MM2 cells, which expressed a lower level of HER2 both in culture and in tumors, were used in therapy studies. A single intravenous injection of 212Pb-trastuzumab reduced tumor growth by 60-80%, reduced aortic lymph node metastasis, and prolonged the survival of tumor-bearing mice. Treatment with 212Pb-trastuzumab did not cause significant changes in body weight, serum glutamic pyruvic transaminase (SGPT), blood urea nitrogen (BUN), hematological profiles, and histological morphology of several major organs of tumor-bearing mice. These findings suggest that a systemic delivery of 212Pb-trastuzumab could be an effective modality for management of advanced human prostate cancer. PMID:22322558

  12. Emerging Role and Targeting of Carcinoembryonic Antigen-related Cell Adhesion Molecule 6 (CEACAM6) in Human Malignancies

    PubMed Central

    Johnson, Benny; Mahadevan, Daruka

    2015-01-01

    Background: Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6) is a member of the CEA family of cell adhesion proteins that belong to the immunoglobulin superfamily. CEACAM6 is normally expressed on the surface of myeloid (CD66c) and epithelial surfaces. Stiochiomertic expression of members of the CEA family (CEACAM1, 5, 6, 7) on epithelia maintains normal tissue architecture through homo-and hetero-philic interactions. Dysregulated over-expression of CEACAM6 is oncogenic, is associated with anoikis resistance and an invasive phenotype mediated by excessive TGFβ, AKT, FAK and SRC signaling in human malignancies. Methods: Extensive literature review through PubMed was conducted to identify relevant preclinical and clinical research publications regarding CEACAM6 over the last decade and was summarized in this manuscript. Results: CEACAM5 and 6 are over-expressed in nearly 70% of epithelial malignancies including colorectal cancer (CRC), pancreatic ductal adenocarcinoma (PDA), hepatobiliary, gastric, breast, non-small cell lung and head/neck cancers. Importantly, CEACAM6 is a poor prognostic marker in CRC, while its expression correlates with tumor stage, metastasis and post-operative survival in PDA. CEACAM6 appears to be an immune checkpoint suppressor in hematologic malignancies including acute lymphoblastic leukemia and multiple myeloma. Several therapeutic monoclonal antibodies or antibody fragments targeting CEACAM6 have been designed and developed as a targeted therapy for human malignancies. A Llama antibody targeting CEACAM6 is being evaluated in early phase clinical trials. Conclusion: This review focuses on the role of CEACAM6 in the pathogenesis and signaling of the malignant phenotype in solid and hematologic malignancies and highlights its potential as a therapeutic target for anti-cancer therapy.

  13. Comprehensively Evaluating cis-Regulatory Variation in the Human Prostate Transcriptome by Using Gene-Level Allele-Specific Expression

    PubMed Central

    Larson, Nicholas B.; McDonnell, Shannon; French, Amy J.; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A.; Wang, Liang; Schaid, Daniel J.; Thibodeau, Stephen N.

    2015-01-01

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E−5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate. PMID:25983244

  14. Matched Cohort Analysis of Outcomes of Definitive Radiotherapy for Prostate Cancer in Human Immunodeficiency Virus-Positive Patients

    SciTech Connect

    Kahn, Shannon; Jani, Ashesh; Edelman, Scott; Rossi, Peter; Godette, Karen; Landry, Jerome; Anderson, Cynthia

    2012-05-01

    Purpose: To compare the biochemical outcome and toxicity scores of men with human immunodeficiency virus (HIV) and prostate cancer with a matched control population with negative or unknown HIV status when treated with external-beam radiotherapy (EBRT). Methods and Materials: A single-institution database of men with prostate cancer treated with EBRT from 1999 to 2009 was reviewed. Thirteen men with HIV were identified and matched to 2 control patients according to age, race, T stage, prostate-specific antigen level, Gleason score, RT dose, intensity-modulated RT vs. three-dimensional conformal RT, and whole-pelvis vs. prostate-only RT, for a total of 39 cases. The median follow-up time was 39 months (range, 3-110 months). Results: The 4-year biochemical failure (BF)-free survival rate was 87% in the HIV-positive group vs. 89% in the controls (p = 0.94). Pre- and post-RT viral loads were found to be predictive of BF (p = 0.04 and p = 0.04, respectively). No men with HIV died, whereas 2 in the control group died of causes unrelated to prostate cancer. Acute and chronic genitourinary and gastrointestinal toxicity were less in the HIV-positive patients than in controls (p < 0.001, p < 0.001, p = 0.003, and p < 0.001, respectively). The HIV-positive men experienced an average decline in CD4 count of 193 cells/mm{sup 3}. Conclusions: Our findings suggest that men with HIV treated with EBRT have a similar risk of BF; however, high viral loads may contribute to an increased risk. This analysis supports that HIV-positive men with prostate cancer can be treated with definitive EBRT with similar disease control and toxicity outcomes as in the general population.

  15. Multifunctional iron platinum stealth immunomicelles: targeted detection of human prostate cancer cells using both fluorescence and magnetic resonance imaging

    PubMed Central

    Huber, Dale L.; Monson, Todd C.; Ali, Abdul-Mehdi S.; Bisoffi, Marco; Sillerud, Laurel O.

    2011-01-01

    Superparamagnetic iron oxide nanoparticles (SPIONs) are the most common type of contrast agents used in contrast agent-enhanced magnetic resonance imaging (MRI). Still, there is a great deal of room for improvement, and nanoparticles with increased MRI relaxivities are needed to increase the contrast enhancement in MRI applied to various medical conditions including cancer. We report the synthesis of superparamagnetic iron platinum nanoparticles (SIPPs) and subsequent encapsulation using PEGylated phospholipids to create stealth immunomicelles (DSPE-SIPPs) that can be specifically targeted to human prostate cancer cell lines and detected using both MRI and fluorescence imaging. SIPP cores and DSPE-SIPPs were 8.5 ± 1.6 nm and 42.9 ± 8.2 nm in diameter, respectively, and the SIPPs had a magnetic moment of 120 A m2/kg iron. J591, a monoclonal antibody against prostate specific membrane antigen (PSMA), was conjugated to the DSPE-SIPPs (J591-DSPE-SIPPs), and specific targeting of J591-DSPE-SIPPs to PSMA-expressing human prostate cancer cell lines was demonstrated using fluorescence confocal microscopy. The transverse relaxivity of the DSPE-SIPPs, measured at 4.7 Tesla, was 300.6 ± 8.5 s−1 mM−1, which is 13-fold better than commercially available SPIONs (23.8 ± 6.9 s−1 mM−1) and ~3-fold better than reported relaxivities for Feridex® and Resovist®. Our data suggest that J591-DSPE-SIPPs specifically target human prostate cancer cells in vitro, are superior contrast agents in T2-weighted MRI, and can be detected using fluorescence imaging. To our knowledge, this is the first report on the synthesis of multifunctional SIPP micelles and using SIPPs for the specific detection of prostate cancer. PMID:22121333

  16. Adenovirus-mediated suppression of HMGI(Y) protein synthesis as potential therapy of human malignant neoplasias

    PubMed Central

    Scala, Stefania; Portella, Giuseppe; Fedele, Monica; Chiappetta, Gennaro; Fusco, Alfredo

    2000-01-01

    High mobility group I (HMGI) proteins are overexpressed in several human malignant tumors. We previously demonstrated that inhibition of HMGI synthesis prevents thyroid cell transformation. Here, we report that an adenovirus carrying the HMGI(Y) gene in an antisense orientation (Ad-Yas) induced programmed cell death of two human thyroid anaplastic carcinoma cell lines (ARO and FB-1), but not normal thyroid cells. The Ad-Yas virus led to death of lung, colon, and breast carcinoma cells. A control adenovirus carrying the lacZ gene did not inhibit the growth of either normal or neoplastic cells. Ad-Yas treatment of tumors induced in athymic mice by ARO cells caused a drastic reduction in tumor size. Therefore, suppression of HMGI(Y) protein synthesis by an HMGI(Y) antisense adenoviral vector may be a useful treatment strategy in a variety of human malignant neoplasias, in which HMGI(Y) gene overexpression is a general event. PMID:10759549

  17. Human Cytomegalovirus Antigens in Malignant Gliomas as Targets for Adoptive Cellular Therapy

    PubMed Central

    Landi, Daniel; Hegde, Meenakshi; Ahmed, Nabil

    2014-01-01

    Malignant gliomas are the most common primary brain tumor in adults, with over 12,000 new cases diagnosed in the United States each year. Over the last decade, investigators have reliably identified human cytomegalovirus (HCMV) proteins, nucleic acids, and virions in most high-grade gliomas, including glioblastoma (GBM). This discovery is significant because HCMV gene products can be targeted by immune-based therapies. In this review, we describe the current level of understanding regarding the presence and role in pathogenesis of HCMV in GBM. We describe our success detecting and expanding HCMV-specific cytotoxic T lymphocytes to kill GBM cells and explain how these cells can be used as a platform for enhanced cellular therapies. We discuss alternative approaches that capitalize on HCMV infection to treat patients with HCMV-positive tumors. Adoptive cellular therapy for HCMV-positive GBM has been tried in a small number of patients with some benefit, but we reason why, to date, these approaches generally fail to generate long-term remission or cure. We conjecture how cellular therapy for GBM can be improved and describe the barriers that must be overcome to cure these patients. PMID:25505736

  18. Function and significance of MicroRNAs in benign and malignant human stem cells.

    PubMed

    Utikal, Jochen; Abba, Mohammed; Novak, Daniel; Moniuszko, Marcin; Allgayer, Heike

    2015-12-01

    MicroRNAs now not only represent a significant mechanism for post-transcriptional gene regulation, but have come to be appreciated as molecules with far reaching tentacles affecting diverse processes and pathologies by modulating amongst others, cellular gene expression, epigentic mechanisms, complex signaling cascades, cell-cell communication, the immune system and microenvironmental interactions between several cell types, tissues and organ systems. In this review, we systematically reflect on the impact of miRNAs on all types of benign and malignant human stem cells, looking at the roles they play in maintaining or changing the stem cell state, and review how aberrations of their expression and function within diverse types of stem cells orchestrate carcinogenesis and metastasis. As a conclusion, we consider it striking to see how similar some miR-driven mechanisms are between different types of stem cells and cancer cells, and how this might support hypotheses of miR-driven embryologic pathway reactivation in metastasis or propose putative functions of miRs in important novel cross-topic fields such as obesity and cancer. PMID:26192966

  19. Human metapneumovirus infections in hematopoietic cell transplant recipients and hematologic malignancy patients: A systematic review.

    PubMed

    Shah, Dimpy P; Shah, Pankil K; Azzi, Jacques M; El Chaer, Firas; Chemaly, Roy F

    2016-08-28

    Over the past decade, reported incidence of human metapneumovirus (hMPV) has increased owing to the use of molecular assays for diagnosis of respiratory viral infections in cancer patients. The seasonality of these infections, differences in sampling strategies across institutions, and small sample size of published studies make it difficult to appreciate the true incidence and impact of hMPV infections. In this systematic review, we summarized the published data on hMPV infections in hematopoietic cell transplant recipients and patients with hematologic malignancy, focusing on incidence, hMPV-associated lower respiratory tract infection (LRTI), mortality, prevention, and management with ribavirin and/or intravenous immunoglobulins. Although the incidence of hMPV infections and hMPV-associated LRTI in this patient population is similar to respiratory syncytial virus or parainfluenza virus and despite lack of directed antiviral therapy, the mortality rate remains low unless patients develop LRTI. In the absence of vaccine to prevent hMPV, infection control measures are recommended to reduce its burden in cancer patients. PMID:27260872

  20. Analgesic-antitumor peptide inhibits proliferation and migration of SHG-44 human malignant glioma cells.

    PubMed

    Zhao, Youlong; Cai, Xueting; Ye, Tingmei; Huo, Jiege; Liu, Chao; Zhang, Shuangquan; Cao, Peng

    2011-09-01

    Malignant gliomas, the most common subtype of primary brain tumors, are characterized by high proliferation, great invasion, and neurological destruction and considered to be the deadliest of human cancers. Analgesic-antitumor peptide (AGAP), one of scorpion toxic polypeptides, has been shown to have antitumor activity. Here, we show that recombinant AGAP (rAGAP) not only inhibits the proliferation of gliomas cell SHG-44 and rat glioma cell C6, but also suppresses the migration of SHG-44 cells during wound healing. To explain these phenomena, we find that rAGAP leads to cell cycle of SHG-44 arrested in G1 phase accompanied by suppressing G1 cell cycle regulatory proteins CDK2, CDK6, and p-RB by means of the down-regulated protein expression of p-AKT. Meanwhile, rAGAP significantly decreases the production of NF-κB, BCL-2, p-p38, p-c-Jun, and p-Erk1/2 and further suppresses the activation of VEGF and MMP-9 in SHG-44 cells. These findings suggest rAGAP inhibit proliferation and migration of SHG-44 cells by arresting cell cycle and interfering p-AKT, NF-κB, BCL-2, and MAPK signaling pathways. PMID:21538480

  1. β-lapachone suppresses the proliferation of human malignant melanoma cells by targeting specificity protein 1.

    PubMed

    Bang, Woong; Jeon, Young-Joo; Cho, Jin Hyoung; Lee, Ra Ham; Park, Seon-Min; Shin, Jae-Cheon; Choi, Nag-Jin; Choi, Yung Hyun; Cho, Jung-Jae; Seo, Jae-Min; Lee, Seung-Yeop; Shim, Jung-Hyun; Chae, Jung-Il

    2016-02-01

    β-lapachone (β-lap), a novel natural quinone derived from the bark of the Pink trumpet tree (Tabebuia avellanedae) has been demonstrated to have anticancer activity. In this study, we investigated whether β-lap exhibits anti-proliferative effects on two human malignant melanoma (HMM) cell lines, G361 and SK-MEL-28. The effects of β-lap on the HMM cell lines were investigated using 3-(4,5-dimethylthiazol-2-yl)‑5-(3-carboxymethoxyphenyl)‑2-(4-sulfophenyl-2H-tetrazolium (MTS) assay, 4',6-diamidino-2-phenylindole (DAPI) staining, Annexin V and Dead cell assay, mitochondrial membrane potential (MMP) assay and western blot analysis. We demonstrated that β-lap significantly induced apoptosis and suppressed cell viability in the HMM cells. Intriguingly, the transcription factor specificity protein 1 (Sp1) was significantly downregulated by β-lap in a dose- and time-dependent manner. Furthermore, β-lap modulated the protein expression level of the Sp1 regulatory genes including cell cycle regulatory proteins and apoptosis-associated proteins. Taken together, our findings indicated that β-lap modulates Sp1 transactivation and induces apoptotic cell death through the regulation of cell cycle- and apoptosis-associated proteins. Thus, β-lap may be used as a promising anticancer drug for cancer prevention and may improve the clinical outcome of patients with cancer. PMID:26718788

  2. [Phase I study of human lymphoblastoid alpha-interferon on malignant tumor].

    PubMed

    Furue, H

    1986-04-01

    A phase I study with human lymphoblastoid alpha-interferon (IFN-alpha) was conducted in 31 patients with malignant tumors. IFN-alpha was administered by intravenous drip infusion, intramuscular injection or local injection. In each patient, the dose was increased in 6 steps from 3 X 10(6) IU/body up to 54 X 10(6) IU/body for the purpose of investigating the safety, optimal regimen, pharmacokinetics and antitumor effect. The following findings were obtained: 1) Fever as a side effect was most frequently (in about 80%) found. However, the temperature did not exceed 40 degrees C in most cases and, on the next day, spontaneously fell to normal. 2) The dose-limiting factors (DLF) may include the subjective symptoms of anorexia, general fatigue and nausea/vomiting and the objective symptom of pancytopenia. 3) The maximum tolerated dose (MTD) was estimated to be between 36 X 10(6) and 54 X 10(6) IU/body per dose. 4) As for the route of administration, the intramuscular one was considered most suitable on the basis of the plasma concentration profile of INF-alpha. It was therefore concluded that the drug may be further submitted to a phase II study which is to be conducted with due consideration of its safety. PMID:3963861

  3. Molecular Mechanisms of Malignant Transformation by Low Dose Cadmium in Normal Human Bronchial Epithelial Cells

    PubMed Central

    Kluz, Thomas; Cohen, Lisa; Shen, Steven S.; Costa, Max

    2016-01-01

    Cadmium is a carcinogenic metal, the mechanisms of which are not fully understood. In this study, human bronchial epithelial cells were transformed with sub-toxic doses of cadmium (0.01, 0.05, and 0.1 μM) and transformed clones were characterized for gene expression changes using RNA-seq, as well as other molecular measurements. 440 genes were upregulated and 47 genes were downregulated in cadmium clones relative to control clones over 1.25-fold. Upregulated genes were associated mostly with gene ontology terms related to embryonic development, immune response, and cell movement, while downregulated genes were associated with RNA metabolism and regulation of transcription. Several embryonic genes were upregulated, including the transcription regulator SATB2. SATB2 is critical for normal skeletal development and has roles in gene expression regulation and chromatin remodeling. Small hairpin RNA knockdown of SATB2 significantly inhibited growth in soft agar, indicating its potential as a driver of metal-induced carcinogenesis. An increase in oxidative stress and autophagy was observed in cadmium clones. In addition, the DNA repair protein O6-methylguanine-DNA-methyltransferase was depleted by transformation with cadmium. MGMT loss caused significant decrease in cell viability after treatment with the alkylating agent temozolomide, demonstrating diminished capacity to repair such damage. Results reveal various mechanisms of cadmium-induced malignant transformation in BEAS-2B cells including upregulation of SATB2, downregulation of MGMT, and increased oxidative stress. PMID:27186882

  4. Preliminary micro-Raman images of normal and malignant human skin cells

    NASA Astrophysics Data System (ADS)

    Short, Michael A.; Lui, Harvey; McLean, David I.; Zeng, Haishan; Chen, Michael X.

    2006-02-01

    Micro-Raman spectroscopy covering a frequency range from 200 to 4000 cm -1 was used to image human skin melanocytes and keratinocytes with a spatial resolution of 0.5 μm. The cells were either cultivated on glass microscope slides or were located within thin sections of skin biopsies mounted on low fluorescence BaF II. A commercially available system was used to obtain the spectra utilizing a x100 long working distance objective with a numerical aperture of 0.8, and a cooled CCD. Both 633 and 515 nm excitations were tried, although the latter proved to be more effcient at producing Raman emission mostly due to the 1/λ 4 dependence in light scattering. Fluorescence emission from the cells was surprisingly low. The excitation power at the sample was kept below about 2 mW to avoid damaging the cells; this was the limiting factor on how quickly a Raman image could be obtained. Despite this diffculty we were able to obtain Raman images with rich information about the spectroscopic and structural features within the cytoplasm and cell nuclei. Differences were observed between the Raman images of normal and malignant cells. Spectra from purified DNA, RNA, lipids, proteins and melanin were obtained and these spectra were compared with the skin cell spectra with the aim of understanding how they are distributed over a cell and how the distribution changes between different cells.

  5. Worldwide Prevalence of Human Papillomavirus and Relative Risk of Prostate Cancer: A Meta-analysis

    PubMed Central

    Yang, Lin; Xie, Shuanghua; Feng, Xiaoshuang; Chen, Yuheng; Zheng, Tongzhang; Dai, Min; Ke Zhou, Cindy; Hu, Zhibin; Li, Ni; Hang, Dong

    2015-01-01

    Despite the increasing number of studies conducted recently to evaluate the association between HPV infections and the risk of prostate cancer, the results remain inconclusive. Furthermore, the prevalence and distribution of overall and individual HPV types worldwide in prostate cancer has not been reported until now. Therefore, we estimated the prevalence of HPV in prostate cancer by pooling data of 46 studies with 4919 prostate cancer cases, taking into account the heterogeneity of major related parameters, including study region, specimen type, HPV DNA source, detection method, publication calendar period and Gleason score. Moreover, we tested the association of HPV infections with prostate cancer risks by a meta-analysis of 26 tissue-based case-control studies. We found that the prevalence of HPV infection was 18.93% (95% CI = 17.84–20.05%) in prostate cancer cases, and most of which were high-risk HPV types (17.73%, 95% CI = 16.52–18.99%). The prevalence varied by region, PCR primers used, publication calendar period and Gleason score. Our study also showed a significantly increased risk of prostate cancer with the positivity of overall HPV detected in prostate tissues (OR = 1.79, 95% CI = 1.29–2.49) and revealed the geographic variation of association strength (P < 0.001). In conclusion, HPV infections may contribute to the risk of prostate cancer. PMID:26441160

  6. Monocyte chemoattractant protein-1 gene expression in prostatic hyperplasia and prostate adenocarcinoma.

    PubMed Central

    Mazzucchelli, L.; Loetscher, P.; Kappeler, A.; Uguccioni, M.; Baggiolini, M.; Laissue, J. A.; Mueller, C.

    1996-01-01

    Human monocyte chemoattractant protein-1 (MCP-1) has been shown to act as a chemokine in the recruitment of monocyte/macrophages during inflammation states. Furthermore, there is increasing evidence that MCP-1 is involved in the recruitment of tumor-associated macrophages. In vivo, one of the major cellular sources of MCP-1 are the smooth muscle cells. As MCP-1 gene expression and/or protein production in these cells is not necessarily correlated with the accumulation of inflammatory cells, there might possibly be additional functions of this cytokine. In the present study, we investigated by use of 35S-labeled antisense RNA probes whether the MCP-1 gene is expressed in tissue specimens of benign prostatic hyperplasia (n = 13) and specimens of prostate carcinoma (n = 8), both of which are characterized by a prominent fibromuscular stroma and inconspicuous inflammatory infiltrates. MCP-1 transcripts were located in stromal smooth muscle cells and, additionally, in basal cells of benign prostatic glands. In prostate carcinoma, the number of MCP-1 mRNA-expressing cells was significantly less than in benign prostatic hyperplasia. MCP-1 transcripts were located in preserved fibromuscular stroma and in basal cells of entrapped non-neoplastic glands but not in carcinomatous cells. Immunohistochemical staining with polyclonal antibodies raised against MCP-1 revealed strong reactivity in the fibromuscular stroma surrounding both benign and malignant glands. MCP-1 gene expression or immunoreactivity for anti-MCP-1 antibodies was not related to the rare, lymphocytic interstitial infiltrates. The results show that 1) in the absence of significant leukocyte accumulation, it is unlikely that MCP-1 exerts chemotactic functions in the prostate and 2) that MCP-1, in contrast to previous findings in a wide variety of other human neoplasms, is not expressed in carcinomatous cells of the prostate. Images Figure 2 Figure 3 Figure 4 PMID:8701989

  7. Keratinocyte-Derived Chemokine Induces Prostate Epithelial Hyperplasia and Reactive Stroma in a Novel Transgenic Mouse Model

    PubMed Central

    Schauer, Isaiah G.; Ressler, Steven J.; Rowley, David R.

    2009-01-01

    Background Interleukin-8 (IL-8) is upregulated in fibrotic and malignant diseases and is a key mediator of proliferative responses. Elevated IL-8 was recently correlated with benign prostatic hyperplasia epithelium and a myofibroblast reactive stroma. Thus, we sought to determine whether overexpressed IL-8 and keratinocyte-derived chemokine (KC), the functional murine homolog of IL-8, induce prostate epithelial hyperplasia and a reactive phenotype. Methods Transgenic mice that overexpress KC within prostate epithelia and xenograft models with engineered human cells that overexpress IL-8 were developed. Results Overexpression of KC in transgenic mice produced hyperplastic prostate epithelial acini associated with a periacinar reactive stroma. KC induced an altered epithelial/stroma proliferation index ratio, increased acini diameter, epithelial infolding, and expression of prototypical reactive stroma markers. Overexpression of IL-8 in normal human prostate epithelial xenografts correlated with elevated epithelial proliferation index and altered morphology. Elevated human prostate stromal and epithelial cell proliferation, nodule-like morphology and increased xenograft survival were observed in IL-8-overexpressing orthotopic xenografts. Conclusions Together, these data demonstrate that overexpression of IL-8/KC results in a prostate epithelial hyperplasia with an associated reactive stroma phenotype. The novel transgenic mouse and human xenograft models described here may be useful in dissecting key mechanisms of IL-8 induced prostate hyperplasia and reactive stroma. PMID:19021203

  8. Magnetic nanoparticle hyperthermia enhances radiation therapy: A study in mouse models of human prostate cancer

    PubMed Central

    Attaluri, Anilchandra; Kandala, Sri Kamal; Wabler, Michele; Zhou, Haoming; Cornejo, Christine; Armour, Michael; Hedayati, Mohammad; Zhang, Yonggang; DeWeese, Theodore L.; Herman, Cila; Ivkov, Robert

    2015-01-01

    Purpose We aimed to characterise magnetic nanoparticle hyperthermia (mNPH) with radiation therapy (RT) for prostate cancer. Methods Human prostate cancer subcutaneous tumours, PC3 and LAPC-4, were grown in nude male mice. When tumours measured 150 mm3 magnetic iron oxide nanoparticles (MIONPs) were injected into tumours to a target dose of 5.5 mg Fe/cm3 tumour, and treated 24 h later by exposure to alternating magnetic field (AMF). Mice were randomly assigned to one of four cohorts to characterise (1) intratumour MIONP distribution, (2) effects of variable thermal dose mNPH (fixed AMF peak amplitude 24 kA/m at 160±5 kHz) with/without RT (5 Gy), (3) effects of RT (RT5: 5 Gy; RT8: 8 Gy), and (4) fixed thermal dose mNPH (43 °C for 20min) with/without RT (5 Gy). MIONP concentration and distribution were assessed following sacrifice and tissue harvest using inductively coupled plasma mass spectrometry (ICP-MS) and Prussian blue staining, respectively. Tumour growth was monitored and compared among treated groups. Results LAPC-4 tumours retained higher MIONP concentration and more uniform distribution than did PC3 tumours. AMF power modulation provided similar thermal dose for mNPH and combination therapy groups (CEM43: LAPC-4: 33.6 ± 3.4 versus 25.9 ± 0.8, and PC3: 27.19 ± 0.7 versus 27.50 ± 0.6), thereby overcoming limitations of MIONP distribution and yielding statistically significant tumour growth delay. Conclusion PC3 and LAPC-4 tumours represent two biological models that demonstrate different patterns of nanoparticle retention and distribution, offering a model to make comparisons of these effects for mNPH. Modulating power for mNPH offers potential to overcome limitations of MIONP distribution to enhance mNPH. PMID:25811736

  9. Combination Therapy with Epigallocatechin-3-Gallate and Doxorubicin in Human Prostate Tumor Modeling Studies

    PubMed Central

    Stearns, Mark E.; Amatangelo, Michael D.; Varma, Devika; Sell, Chris; Goodyear, Shaun M.

    2010-01-01

    The polyphenol epigallocatechin-3-gallate (EGCG) in combination with doxorubicin (Dox) exhibits a synergistic activity in blocking the growth and colony-forming ability of human prostate cell lines in vitro. EGCG has been found to disrupt the mitochondrial membrane potential, induce vesiculation of mitochondria, and induce elevated poly (ADP-ribose) polymerase (PARP) cleavage and apoptosis. EGCG in combination with low levels of Dox had a synergistic effect in blocking tumor cell growth. In vivo tumor modeling studies with a highly metastatic tumor line, PC-3ML cells, revealed that EGCG (228 mg/kg or 200 μmol/L) appeared to sensitize tumors to Dox. EGCG combined with low levels of Dox (0.14 mg/kg or 2 μmol/L) blocked tumor growth by PC-3ML cells injected intraperitoneally (ie, in CB17 severe combined immunodeficiencies) and significantly increased mouse survival rates. Similarly, relatively low levels of EGCG (57 mg/kg or 50 μmol/L) plus Dox (0.07 mg/kg or 1 μmol/L) eradicated established tumors (ie, in nonobese diabetic–severe combined immunodeficiencies) that were derived from CD44hi tumor-initiating cells isolated from PCa-20a cells. Flow cytometry results showed that EGCG appeared to enhance retention of Dox by tumor cells to synergistically inhibit tumor growth and eradicate tumors. These data suggest that localized delivery of high dosages of EGCG combined with low levels of Dox may have significant clinical application in the treatment of metastatic prostate and/or eradication of primary tumors derived from tumor-initiating cells. PMID:20971741

  10. Novel Imidazopyridine Derivatives Possess Anti-Tumor Effect on Human Castration-Resistant Prostate Cancer Cells

    PubMed Central

    Muniyan, Sakthivel; D’Cunha, Napoleon; Robinson, Tashika; Hoelting, Kyle; Dwyer, Jennifer G.; Bu, Xiu R.; Batra, Surinder K.; Lin, Ming-Fong

    2015-01-01

    Prostate cancer (PCa) is the second leading cause of cancer-related death afflicting United States males. Most treatments to-date for metastatic PCa include androgen-deprivation therapy and second-generation anti-androgens such as abiraterone acetate and enzalutamide. However, a majority of patients eventually develop resistance to these therapies and relapse into the lethal, castration-resistant form of PCa to which no adequate treatment option remains. Hence, there is an immediate need to develop effective therapeutic agents toward this patient population. Imidazopyridines have recently been shown to possess Akt kinase inhibitory activity; thus in this study, we investigated the inhibitory effect of novel imidazopyridine derivatives HIMP, M-MeI, OMP, and EtOP on different human castration-resistant PCa cells. Among these compounds, HIMP and M-MeI were found to possess selective dose- and time-dependent growth inhibition: they reduced castration-resistant PCa cell proliferation and spared benign prostate epithelial cells. Using LNCaP C-81 cells as the model system, these compounds also reduced colony formation as well as cell adhesion and migration, and M-MeI was the most potent in all studies. Further investigation revealed that while HIMP primarily inhibits PCa cell growth via suppression of PI3K/Akt signaling pathway, M-MeI can inhibit both PI3K/Akt and androgen receptor pathways and arrest cell growth in the G2 phase. Thus, our results indicate the novel compound M-MeI to be a promising candidate for castration-resistant PCa therapy, and future studies investigating the mechanism of imidazopyridine inhibition may aid to the development of effective anti-PCa agents. PMID:26121643

  11. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  12. Celastrol Potentiates Radiotherapy by Impairment of DNA Damage Processing in Human Prostate Cancer

    SciTech Connect

    Dai Yao; DeSano, Jeffrey T.; Meng Yang; J, Qing; Ljungman, Mats; Lawrence, Theodore S.; Xu Liang

    2009-07-15

    Purpose: Celastrol is an active ingredient of traditional herbal medicine and has recently been identified as a potent natural proteasome inhibitor. In the present study, we evaluated the radiosensitizing potential of celastrol in the human prostate cancer PC-3 model. Methods and Materials: Clonogenic assays were performed to determine the radiosensitizing effect of celastrol. Apoptosis was examined by flow cytometry using Annexin V and propidium iodide staining and by a caspase-3 activation assay. DNA damage processing was examined by immunofluorescent staining and Western blot for phosphorylated H2AX ({gamma}H2AX). The PC-3 xenograft model in the athymic nude mouse was used for the determination of the in vivo efficacy of celastrol combined with radiotherapy. The tumor samples were also analyzed for apoptosis and angiogenesis. Results: Celastrol sensitized PC-3 cells to ionizing radiation (IR) in a dose- and schedule-dependent manner, in which pretreatment with celastrol for 1 h followed by IR achieved maximal radiosensitization. Celastrol significantly prolonged the presence of IR-induced {gamma}H2AX and increased IR-induced apoptosis. Celastrol, combined with fractionated radiation, significantly inhibited PC-3 tumor growth in vivo without obvious systemic toxicity. The combination treatment increased {gamma}H2AX levels and apoptosis, induced cleavage of poly(adenosine diphosphate-ribose)polymerase and Mcl-1, and reduced angiogenesis in vivo compared with either treatment alone. Conclusion: Celastrol sensitized PC-3 cells to radiation both in vitro and in vivo by impairing DNA damage processing and augmenting apoptosis. Celastrol might represent a promising new adjuvant regimen for the treatment of hormone-refractory prostate cancer.

  13. Cytotoxic Effects of the Ethanol Bane Skin Extract in Human Prostate Cancer Pc3 Cells

    PubMed Central

    Amiri, Maryam; Kazerouni, Faranak; Namaki, Saeed; Darbandi Tamijani, Hassan; Rahimipour, Hooman; Boroumand, Nasrin; Barghi, Siyamak; Ebrahimi, Nazanin; Gheibi Hayat, Seyed Mohammad

    2016-01-01

    Background: It is extensively supposed that vegetarian diet could affect cancer progress and increase the influence of formal chemotherapy. Objectives: The present study was designed to determine the effect of the ethanol Bane skin extract against chemo resistant prostate cancer PC3 cells. Materials and Methods: PC3 and L929 cells were cultivated and then incubated in the ethanol Bane skin extract with various concentrations of 0.78, 1.5, 3.13, 6.25, 12.5 mg/mL in 3 times 24, 48, 72 hours. Cytotoxic effect of the ethanol Bane skin extract on PC3 and L929 cells was examined by MTT assay after 24, 48, and 72 hours. Morphology of PC3 cells was evaluated by Gimsa staining. Results: The ethanol Bane skin extract inhibited proliferation and caused cell death with IC50 values of 2.8 mg/mL on PC3 cells and the IC50 was 6.1 mg/mL on l929 cells. Morphological changes and apoptotic bodies were observed in PC3 cells faced with the ethanol Bane skin extract by staining with Gimsa. Conclusions: The ethanol Bane skin extract could repress the growth of PC3 cell line. This inhibitory effect of the Bane extract depended on the dose and the time on PC3. The result of this study shows that the ethanol Bane skin extract includes photochemical and inhibitory function against proliferation and inducer of apoptosis in human prostate cancer PC3 cells and also has less cytotoxic effect on l929 than PC3 cells. The ethanol Bane skin extract might be a good candidate for the new herbal anticancer drug. PMID:27482333

  14. Analysis and significance of the malignant 'eclipse' during the progression of primary cutaneous human melanomas.

    PubMed

    Kerbel, R S; Kobayashi, H; Graham, C H; Lu, C

    1996-04-01

    Why is it that primary melanomas which are less than 0.76 mm in thickness are almost always curable by surgery whereas thicker lesions are associated with a worse prognosis? Put in another way, why is it that such small increases in tumor thickness beyond 0.76 mm are often associated with the eventual formation of distant metastases and death? Part of the answer lies in the dramatic qualitative changes which can accompany small increases in the size of primary human melanomas. Thus, primary melanomas less than 0.76 mm in thickness usually contain very low proportions of metastatically competent tumor cells, whereas slightly thicker lesions can contain very high proportions of such cells, resulting from a selective growth advantage of the latter in the dermal mesenchyme. This overgrowth process is akin to a 'malignant eclipse' phenomenon (by analogy with a solar eclipse). We have been studying the causes of the malignant eclipse in melanoma, for which there are at least four possibilities: 1) an increase in autocrine, mitogenic growth factors by melanoma cells; 2) a decreased rate of apoptosis in the same population; 3) an acquired resistance to paracrine growth inhibitory factors; and 4) an increased ability to induce an angiogenic response. Evidence exists for all four possibilities. Our experimental approach to studying this problem has relied heavily on the use of cell lines obtained from early stage radial growth phase or vertical growth phase lesions which have a clinical-like inability to grow progressively in nude mice, and variants obtained from such lines which are aggressively tumorigenic. Using such paired lines, and other experimental systems, we have obtained evidence that shows early stage melanoma cell lines may be deficient in inducing angiogenesis, are highly sensitive to the growth inhibitory effects of a plethora of cytokines, including transforming growth factor beta, interleukin-6, and oncostatin M, and are more sensitive to undergoing

  15. Prostate Cancer

    MedlinePlus

    ... version of this page please turn Javascript on. Prostate Cancer What is Prostate Cancer? How Tumors Form The body is made up ... the Escape (Esc) button on your keyboard.) How Prostate Cancer Occurs Prostate cancer occurs when a tumor forms ...

  16. Expression of Human Herpesvirus-6 Antigens in Benign and Malignant Lymphoproliferative Diseases

    PubMed Central

    Luppi, Mario; Barozzi, Patrizia; Garber, Richard; Maiorana, Antonio; Bonacorsi, Goretta; Artusi, Tullio; Trovato, Raffaella; Marasca, Roberto; Torelli, Giuseppe

    1998-01-01

    Immunohistochemistry was used to look for the expression of human herpesvirus-6 (HHV-6) antigens in a well characterized series of benign, atypical, and malignant lymphoid lesions, which tested positive for the presence of HHV-6 DNA. A panel of specific antibodies against HHV-6 antigens, characteristic either of the early (p41) or late (p101K, gp106, and gp116) phases of the viral cycle, was applied to the lymphoid tissues from 15 non-Hodgkin’s lymphomas, 14 Hodgkin’s disease cases, 5 angioimmunoblastic lymphadenopathies with dysproteinemia, 14 reactive lymphadenopathies, and 2 cases of sinus histiocytosis with massive lymphadenopathy (Rosai-Dorfman disease). In lymphomatous tissues, the expression of late antigens was documented only in reactive cells, and mainly in plasma cells. Of interest, the expression of the early p41 antigen was detected in the so-called “mummified” Reed-Sternberg cells, in two Hodgkin’s disease cases. In reactive lymphadenopathies, the HHV-6 late antigen-expressing cells were plasma cells, histiocytes, and rare granulocytes distributed in interfollicular areas. In both cases of Rosai-Dorfman disease, the p101K showed an intense staining in follicular dendritic cells of germinal centers, whereas the gp106 exhibited an intense cytoplasmic reaction in the abnormal histiocytes, which represent the histological hallmark of the disease. The expression of HHV-6 antigens is tightly controlled in lymphoid tissues. The lack of HHV-6 antigen expression in neoplastic cells and the limited expression in degenerating Reed-Sternberg cells argue against a major pathogenetic role of the virus in human lymphomagenesis. The detection of a rather unique pattern of viral late antigen expression in Rosai-Dorfman disease suggests a possible pathogenetic involvement of HHV-6 in some cases of this rare lymphoproliferative disorder. PMID:9736030

  17. Comprehensive Glycomics of a Multistep Human Brain Tumor Model Reveals Specific Glycosylation Patterns Related to Malignancy

    PubMed Central

    Okada, Kazue; Kimura, Taichi; Piao, Jinhua; Tanaka, Shinya; Shinohara, Yasuro

    2015-01-01

    Cancer cells frequently express glycans at different levels and/or with fundamentally different structures from those expressed by normal cells, and therefore elucidation and manipulation of these glycosylations may provide a beneficial approach to cancer therapy. However, the relationship between altered glycosylation and causal genetic alteration(s) is only partially understood. Here, we employed a unique approach that applies comprehensive glycomic analysis to a previously described multistep tumorigenesis model. Normal human astrocytes were transformed via the serial introduction of hTERT, SV40ER, H-RasV12, and myrAKT, thereby mimicking human brain tumor grades I-IV. More than 160 glycans derived from three major classes of cell surface glycoconjugates (N- and O-glycans on glycoproteins, and glycosphingolipids) were quantitatively explored, and specific glycosylation patterns related to malignancy were systematically identified. The sequential introduction of hTERT, SV40ER, H-RasV12, and myrAKT led to (i) temporal expression of pauci-mannose/mono-antennary type N-glycans and GD3 (hTERT); (ii) switching from ganglio- to globo-series glycosphingolipids and the appearance of Neu5Gc (hTERT and SV40ER); (iii) temporal expression of bisecting GlcNAc residues, α2,6-sialylation, and stage-specific embryonic antigen-4, accompanied by suppression of core 2 O-glycan biosynthesis (hTERT, SV40ER and Ras); and (iv) increased expression of (neo)lacto-series glycosphingolipids and fucosylated N-glycans (hTERT, SV40ER, Ras and AKT). These sequential and transient glycomic alterations may be useful for tumor grade diagnosis and tumor prognosis, and also for the prediction of treatment response. PMID:26132161

  18. A Three-dimensional Tissue Culture Model to Study Primary Human Bone Marrow and its Malignancies

    PubMed Central

    Parikh, Mukti R.; Belch, Andrew R.; Pilarski, Linda M; Kirshner, Julia

    2014-01-01

    Tissue culture has been an invaluable tool to study many aspects of cell function, from normal development to disease. Conventional cell culture methods rely on the ability of cells either to attach to a solid substratum of a tissue culture dish or to grow in suspension in liquid medium. Multiple immortal cell lines have been created and grown using such approaches, however, these methods frequently fail when primary cells need to be grown ex vivo. Such failure has been attributed to the absence of the appropriate extracellular matrix components of the tissue microenvironment from the standard systems where tissue culture plastic is used as a surface for cell growth. Extracellular matrix is an integral component of the tissue microenvironment and its presence is crucial for the maintenance of physiological functions such as cell polarization, survival, and proliferation. Here we present a 3-dimensional tissue culture method where primary bone marrow cells are grown in extracellular matrix formulated to recapitulate the microenvironment of the human bone (rBM system). Embedded in the extracellular matrix, cells are supplied with nutrients through the medium supplemented with human plasma, thus providing a comprehensive system where cell survival and proliferation can be sustained for up to 30 days while maintaining the cellular composition of the primary tissue. Using the rBM system we have successfully grown primary bone marrow cells from normal donors and patients with amyloidosis, and various hematological malignancies. The rBM system allows for direct, in-matrix real time visualization of the cell behavior and evaluation of preclinical efficacy of novel therapeutics. Moreover, cells can be isolated from the rBM and subsequently used for in vivo transplantation, cell sorting, flow cytometry, and nucleic acid and protein analysis. Taken together, the rBM method provides a reliable system for the growth of primary bone marrow cells under physiological conditions

  19. Extract of Cordyceps militaris inhibits angiogenesis and suppresses tumor growth of human malignant melanoma cells.

    PubMed

    Ruma, I Made Winarsa; Putranto, Endy Widya; Kondo, Eisaku; Watanabe, Risayo; Saito, Ken; Inoue, Yusuke; Yamamoto, Ken-Ichi; Nakata, Susumu; Kaihata, Masaji; Murata, Hitoshi; Sakaguchi, Masakiyo

    2014-07-01

    Angiogenesis is essential for tumor development and metastasis. Among several angiogenic factors, vascular endothelial growth factor receptor (VEGF) is important for tumor-derived angiogenesis and commonly overexpressed in solid tumors. Thus, many antitumor strategies targeting VEGF have been developed to inhibit cancer angiogenesis, offering insights into the successful treatment of solid cancers. However, there are a number of issues such as harmful effects on normal vascularity in clinical trials. Taking this into consideration, we employed Cordyceps militaris as an antitumor approach due to its biological safety in vivo. The herbal medicinal mushroom Cordyceps militaris has been reported to show potential anticancer properties including anti-angiogenic capacity; however, its concrete properties have yet to be fully demonstrated. In this study, we aimed to elucidate the biological role of Cordyceps militaris extract in tumor cells, especially in regulating angiogenesis and tumor growth of a human malignant melanoma cell line. We demonstrated that Cordyceps militaris extract remarkably suppressed tumor growth via induction of apoptotic cell death in culture that links to the abrogation of VEGF production in melanoma cells. This was followed by mitigation of Akt1 and GSK-3β activation, while p38α phosphorylation levels were increased. Extract treatment in mouse model xenografted with human melanoma cells resulted in a dramatic antitumor effect with down-regulation of VEGF expression. The results suggest that suppression of tumor growth by Cordyceps militaris extract is, at least, mediated by its anti-angiogenicity and apoptosis induction capacities. Cordyceps militaris extract may be a potent antitumor herbal drug for solid tumors. PMID:24789042

  20. Antivascular Effects of Neoadjuvant Androgen Deprivation for Prostate Cancer: An In Vivo Human Study Using Susceptibility and Relaxivity Dynamic MRI

    SciTech Connect

    Alonzi, Roberto; Padhani, Anwar R.; Taylor, N. Jane; Collins, David J.; D'Arcy, James A.; Stirling, J. James; Saunders, Michele I.; Hoskin, Peter J.

    2011-07-01

    Purpose: The antivascular effects of androgen deprivation have been investigated in animal models; however, there has been minimal investigation in human prostate cancer. This study tested the hypothesis that androgen deprivation causes significant reductions in human prostate tumor blood flow and the induction of hypoxia at a magnitude and in a time scale relevant to the neoadjuvant setting before radiotherapy. Methods and Materials: Twenty patients were examined, each with five multi-parameter magnetic resonance imaging scans: two scans before the commencement of androgen suppression, one scan after 1 month of hormone treatment, and two further scans after 3 months of therapy. Quantitative parametric maps of the prostate informing on relative blood flow (rBF), relative blood volume (rBV), vascular permeability (transfer constant [K{sup trans}]), leakage space (v{sub e}) and blood oxygenation (intrinsic relaxivity [R{sub 2}*]) were calculated. Results: Tumor blood volume and blood flow decreased by 83% and 79%, respectively, in the first month (p < 0.0001), with 74% of patients showing significant changes. The proportion of individual patients who achieved significant changes in T1 kinetic parameter values after 3 months of androgen deprivation for tumor measurements was 68% for K{sup trans} and 53% for v{sub e} By 3 months, significant increases in R{sub 2}* had occurred in prostate tumor, with a rise of 41.1% (p < 0.0001). Conclusions: Androgen deprivation induces profound vascular collapse within 1 month of starting treatment. Increased R{sub 2}* in regions of prostate cancer and a decrease in blood volume suggest a reduction in tumor oxygenation.

  1. The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

    PubMed

    Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

    2016-02-15

    FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. PMID:26614767

  2. Defined Conditions for the Isolation and Expansion of Basal Prostate Progenitor Cells of Mouse and Human Origin

    PubMed Central

    Höfner, Thomas; Eisen, Christian; Klein, Corinna; Rigo-Watermeier, Teresa; Goeppinger, Stephan M.; Jauch, Anna; Schoell, Brigitte; Vogel, Vanessa; Noll, Elisa; Weichert, Wilko; Baccelli, Irène; Schillert, Anja; Wagner, Steve; Pahernik, Sascha; Sprick, Martin R.; Trumpp, Andreas

    2015-01-01

    Summary Methods to isolate and culture primary prostate epithelial stem/progenitor cells (PESCs) have proven difficult and ineffective. Here, we present a method to grow and expand both murine and human basal PESCs long term in serum- and feeder-free conditions. The method enriches for adherent mouse basal PESCs with a Lin−SCA-1+CD49f+TROP2high phenotype. Progesterone and sodium selenite are additionally required for the growth of human Lin−CD49f+TROP2high PESCs. The gene-expression profiles of expanded basal PESCs show similarities to ESCs, and NF-kB function is critical for epithelial differentiation of sphere-cultured PESCs. When transplanted in combination with urogenital sinus mesenchyme, expanded mouse and human PESCs generate ectopic prostatic tubules, demonstrating their stem cell activity in vivo. This novel method will facilitate the molecular, genomic, and functional characterization of normal and pathologic prostate glands of mouse and human origin. PMID:25702639

  3. Clinical Significance of Cannabinoid Receptors CB1 and CB2 Expression in Human Malignant and Benign Thyroid Lesions

    PubMed Central

    Lakiotaki, Eleftheria; Giaginis, Constantinos; Tolia, Maria; Alexandrou, Paraskevi; Delladetsima, Ioanna; Giannopoulou, Ioanna; Kyrgias, George; Patsouris, Efstratios; Theocharis, Stamatios

    2015-01-01

    The endocannabinoid system is comprised of cannabinoid receptors (CB1 and CB2), their endogenous ligands (endocannabinoids), and proteins responsible for their metabolism participate in many different functions indispensable to homeostatic regulation in several tissues, exerting also antitumorigenic effects. The present study aimed to evaluate the clinical significance of CB1 and CB2 expression in human benign and malignant thyroid lesions. CB1 and CB2 proteins' expression was assessed immunohistochemically on paraffin-embedded thyroid tissues obtained from 87 patients with benign (n = 43) and malignant (n = 44) lesions and was statistically analyzed with clinicopathological parameters, follicular cells' proliferative capacity, and risk of recurrence rate estimated according to the American Thyroid Association (ATA) staging system. Enhanced CB1 and CB2 expression was significantly more frequently observed in malignant compared to benign thyroid lesions (p = 0.0010 and p = 0.0005, resp.). Enhanced CB1 and CB2 expression was also significantly more frequently observed in papillary carcinomas compared to hyperplastic nodules (p = 0.0097 and p = 0.0110, resp.). In malignant thyroid lesions, elevated CB2 expression was significantly associated with the presence of lymph node metastases (p = 0.0301). Enhanced CB2 expression was also more frequently observed in malignant thyroid cases with presence of capsular (p = 0.1165), lymphatic (p = 0.1989), and vascular invasion (p = 0.0555), as well as in those with increased risk of recurrence rate (p = 0.1165), at a nonsignificant level though, whereas CB1 expression was not associated with any of the clinicopathological parameters examined. Our data suggest that CB receptors may be involved in malignant thyroid transformation and especially CB2 receptor could serve as useful biomarker and potential therapeutic target in thyroid neoplasia. PMID:26539529

  4. Malignant mesothelioma

    PubMed Central

    Moore, Alastair J; Parker, Robert J; Wiggins, John

    2008-01-01

    Malignant mesothelioma is a fatal asbestos-associated malignancy originating from the lining cells (mesothelium) of the pleural and peritoneal cavities, as well as the pericardium and the tunica vaginalis. The exact prevalence is unknown but it is estimated that mesotheliomas represent less than 1% of all cancers. Its incidence is increasing, with an expected peak in the next 10–20 years. Pleural malignant mesothelioma is the most common form of mesothelioma. Typical presenting features are those of chest pain and dyspnoea. Breathlessness due to a pleural effusion without chest pain is reported in about 30% of patients. A chest wall mass, weight loss, sweating, abdominal pain and ascites (due to peritoneal involvement) are less common presentations. Mesothelioma is directly attributable to occupational asbestos exposure with a history of exposure in over 90% of cases. There is also evidence that mesothelioma may result from both para-occupational exposure and non-occupational "environmental" exposure. Idiopathic or spontaneous mesothelioma can also occur in the absence of any exposure to asbestos, with a spontaneous rate in humans of around one per million. A combination of accurate exposure history, along with examination radiology and pathology are essential to make the diagnosis. Distinguishing malignant from benign pleural disease can be challenging. The most helpful CT findings suggesting malignant pleural disease are 1) a circumferential pleural rind, 2) nodular pleural thickening, 3) pleural thickening of > 1 cm and 4) mediastinal pleural involvement. Involvement of a multidisciplinary team is recommended to ensure prompt and appropriate management, using a framework of radiotherapy, chemotherapy, surgery and symptom palliation with end of life care. Compensation issues must also be considered. Life expectancy in malignant mesothelioma is poor, with a median survival of about one year following diagnosis. PMID:19099560

  5. High-power diode laser at 980 nm for the treatment of benign prostatic hyperplasia: ex vivo investigations on porcine kidneys and human cadaver prostates.

    PubMed

    Seitz, Michael; Reich, Oliver; Gratzke, Christian; Schlenker, Boris; Karl, Alexander; Bader, Markus; Khoder, Wael; Fischer, Florian; Stief, Christian; Sroka, Ronald

    2009-03-01

    Diode laser systems at 980 nm have been introduced for the treatment of lower-urinary-tract-symptoms (LUTS) suggestive of benign prostatic enlargement (BPE). However, the coagulation and vaporization properties are unknown. We therefore aimed to evaluate these properties in ex vivo models in comparison with the kalium-titanyl-phosphate-(KTP) laser. The diode laser treatment was applied to isolated, blood-perfused porcine kidneys and fresh human cadaver prostates (HCPs) at different generator settings. We performed histological examination to compare the depth of coagulation and vaporization. The diode laser showed larger ablation and coagulation characteristics than the KTP laser did. Ablation of the diode laser was found to be 1.79-times (120 W in porcine kidney, P < 0.0001) and 3.0-5 times (200 W in HCP, P < 0.0005) larger. The diode laser created a nine-times (120 W in porcine kidney, P < 0.0001) and seven-times (200 W in HCP, P < 0.0001) deeper necrosis zone. The diode laser vaporization was highly effective ex vivo. Owing to the laser's deep coagulation zones, in vivo animal experiments are mandatory before the diode laser (980 nm) is applied in a clinical setting, so that damage to underlying structures is prevented. PMID:18270761

  6. Human prostate cancer cells lack feedback regulation of low-density lipoprotein receptor and its regulator, SREBP2.

    PubMed

    Chen, Y; Hughes-Fulford, M

    2001-01-01

    The low-density lipoprotein receptor (LDLR) pathway provides cells with essential fatty acids for prostaglandin E2 (PGE2) synthesis. Regulation of LDLR expression by LDL was compared between the human normal and cancer prostate cells using semi-quantitative RT-PCR and LDL uptake assays. LDLR mRNA expression and LDL uptake by LDLR were down-regulated in the presence of exogenous LDL or whole serum in the normal prostate cells, but not in the prostate cancer cells. Addition of exogenous cholesterol down-regulated both LDLR and a potent regulator of the ldlr promoter, sterol regulatory element binding protein 2 (SREBP2), in normal cells but not in cancer cells. PGE2 synthesis in prostate cancer cells was significantly increased in response to LDL. Our study suggests that over-production of LDLR is an important mechanism in cancer cells for obtaining more essential fatty acids through LDLR endocytosis, allowing increased synthesis of prostaglandins, which subsequently stimulate cell growth. The data also suggest that the sterol regulatory element and SREBP2 play a role in the loss of sterol feedback regulation in cancer cells. PMID:11149418

  7. Prostate Diseases

    MedlinePlus

    ... our e-newsletter! Aging & Health A to Z Prostate Diseases Basic Facts & Information What are Prostate Diseases? The prostate—one of the components of ... out anything serious. The Most Common Types of Prostate Diseases Benign prostatic hyperplasia (BPH) Prostatitis Prostate cancer ...

  8. Human castration resistant prostate cancer rather prefer to decreased 5α-reductase activity

    PubMed Central

    Kosaka, Takeo; Miyajima, Akira; Nagata, Hirohiko; Maeda, Takahiro; Kikuchi, Eiji; Oya, Mototsugu

    2013-01-01

    Physiologically relevant steroid 5α-reductase (SRD5A) activity that is essential for dihydrotestosterone (DHT) biosynthesis in human castration-resistant prostate cancer (CRPC) has not been fully characterized yet. In this study to ascertain the potential SRD5A activity, we cultured two human CRPC cell lines, C4-2 and C4-2AT6, with the steroid precursor: 13C-[2,3,4]-androstenedione (13C-Adione), and analyzed the sequential biosynthesis of 13C-[2,3,4]-testosterone (13C-T) and 13C-[2,3,4]-DHT (13C-DHT) by liquid chromatography/mass spectrometry (LC/MS/MS). The 13C-DHT/13C-T concentration ratio detected by LC/MS/MS in C4-2AT6 cells appeared to reflect the SRD5A activity. The ratio in C4-2AT6 was significantly lower than that in C4-2. An increased concentration of DHT did not have a positive effect on cell proliferation, rather it exhibited inhibitory effects. 5α-reductase inhibitors did not have any inhibitory effect at clinically achievable concentrations. These results indicate that CRPC cells may have an unknown regulation system to protect themselves from an androgenic suppressive effect mediated by SRD5A activity. PMID:23429215

  9. Evaluation of polymer shielding for adenovirus serotype 6 (Ad6) for systemic virotherapy against human prostate cancers

    PubMed Central

    Nguyen, Tien V; Heller, Greg J; Barry, Mary E; Crosby, Catherine M; Turner, Mallory A; Barry, Michael A

    2016-01-01

    Oncolytic viruses hold promise as “self-amplifying” cancer therapies wherein a virally killed cell can produce thousands of new viral “drugs” that can kill more cancer cells. Adenoviruses (Ads) are one family of oncolytic viruses. Most human studies have used human Ad serotype 5 (Ad5). Unfortunately, most patients are already immune to Ad5 increasing the likelihood that the agent will be neutralized if used as a cancer therapy. In this work, lower seroprevalence Ad6 was tested as a systemic therapy for prostate cancer. Ad5 and Ad6 were injected intravenously a single time in nude mice bearing human prostate tumors, and toxicity and efficacy were assessed. Ad6 was chemically shielded with polyethylene glycol (PEG) to test if this would further improve its pharmacology. Ad6 produced 30-fold lower liver damage and less toxicity than Ad5. Ad6 significantly repressed the growth of androgen-resistant human DU145 prostate tumors and androgen-sensitive LNCaP tumors after single intravenous injection. PEGylation did not change virus distribution, but blunted liver damage and cytokine production by Ad6. PEGylated Ad6 eradicated LNCaP tumors and maintained body mass, but lost potency against the more challenging DU145 tumors. These and other data suggest that low seroprevalent Ad6 has better efficacy and safety than the benchmark oncolytic virus Ad5 for systemic therapy of prostate cancer. These data also indicate that PEGylation may improve Ad6 safety, but that this shielding may reduce oncolytic efficacy after intravenous treatment. PMID:26900598

  10. Response of Human Prostate Cancer Cells to Mitoxantrone Treatment in Simulated Microgravity Environment

    NASA Astrophysics Data System (ADS)

    Zhang, Ye; Wu, Honglu

    2012-07-01

    RESPONSE OF HUMAN PROSTATE CANCER CELLS TO MITOXANTRONE TREATMENT IN SIMULATED MICROGRAVITY ENVIRONMENT Ye Zhang1,2, Christopher Edwards3, and Honglu Wu1 1 NASA-Johnson Space Center, Houston, TX 2 Wyle Integrated Science and Engineering Group, Houston, TX 3 Oregon State University, Corvallis, OR This study explores the changes in growth of human prostate cancer cells (LNCaP) and their response to the treatment of an antineoplastic agent, mitoxantrone, under the simulated microgravity condition. In comparison to static 1g, microgravity and simulated microgravity have been shown to alter global gene expression patterns and protein levels in various cultured cell models or animals. However, very little is known about the effect of altered gravity on the responses of cells to the treatment of drugs, especially chemotherapy drugs. To test the hypothesis that zero gravity would result in altered regulations of cells in response to antineoplastic agents, we cultured LNCaP cells in either a High Aspect Ratio Vessel (HARV) bioreactor at the rotating condition to model microgravity in space or in the static condition as control, and treated the cells with mitoxantrone. Cell growth, as well as expressions of oxidative stress related genes, were analyzed after the drug treatment. Compared to static 1g controls, the cells cultured in the simulated microgravity environment did not present significant differences in cell viability, growth rate, or cell cycle distribution. However, after mitoxantrone treatment, a significant proportion of bioreactor cultured cells became apoptotic or was arrested in G2. Several oxidative stress related genes also showed a higher expression level post mitoxantrone treatment. Our results indicate that simulated microgravity may alter the response of LNCaP cells to mitoxantrone treatment. Understanding the mechanisms by which cells respond to drugs differently in an altered gravity environment will be useful for the improvement of cancer treatment on

  11. Prevention and early detection of prostate cancer.

    PubMed

    Cuzick, Jack; Thorat, Mangesh A; Andriole, Gerald; Brawley, Otis W; Brown, Powel H; Culig, Zoran; Eeles, Rosalind A; Ford, Leslie G; Hamdy, Freddie C; Holmberg, Lars; Ilic, Dragan; Key, Timothy J; La Vecchia, Carlo; Lilja, Hans; Marberger, Michael; Meyskens, Frank L; Minasian, Lori M; Parker, Chris; Parnes, Howard L; Perner, Sven; Rittenhouse, Harry; Schalken, Jack; Schmid, Hans-Peter; Schmitz-Dräger, Bernd J; Schröder, Fritz H; Stenzl, Arnulf; Tombal, Bertrand; Wilt, Timothy J; Wolk, Alicja

    2014-10-01

    Prostate cancer is a common malignancy in men and the worldwide burden of this disease is rising. Lifestyle modifications such as smoking cessation, exercise, and weight control offer opportunities to reduce the risk of developing prostate cancer. Early detection of prostate cancer by prostate-specific antigen (PSA) screening is controversial, but changes in the PSA threshold, frequency of screening, and the use of other biomarkers have the potential to minimise the overdiagnosis associated with PSA screening. Several new biomarkers for individuals with raised PSA concentrations or those diagnosed with prostate cancer are likely to identify individuals who can be spared aggressive treatment. Several pharmacological agents such as 5α-reductase inhibitors and aspirin could prevent development of prostate cancer. In this Review, we discuss the present evidence and research questions regarding prevention, early detection of prostate cancer, and management of men either at high risk of prostate cancer or diagnosed with low-grade prostate cancer. PMID:25281467

  12. Genome-Wide Methylation Analysis of Prostate Tissues Reveals Global Methylation Patterns of Prostate Cancer

    PubMed Central

    Luo, Jian-Hua; Ding, Ying; Chen, Rui; Michalopoulos, George; Nelson, Joel; Tseng, George; Yu, Yan P.

    2014-01-01

    Altered genome methylation is a hallmark of human malignancies. In this study, high-throughput analyses of concordant gene methylation and expression events were performed for 91 human prostate specimens, including prostate tumor (T), matched normal adjacent to tumor (AT), and organ donor (OD). Methylated DNA in genomic DNA was immunoprecipitated with anti-methylcytidine antibodies and detected by Affymetrix human whole genome SNP 6.0 chips. Among the methylated CpG islands, 11,481 islands were found located in the promoter and exon 1 regions of 9295 genes. Genes (7641) were methylated frequently across OD, AT, and T samples, whereas 239 genes were differentially methylated in only T and 785 genes in both AT and T but not OD. Genes with promoter methylation and concordantly suppressed expression were identified. Pathway analysis suggested that many of the methylated genes in T and AT are involved in cell growth and mitogenesis. Classification analysis of the differentially methylated genes in T or OD produced a specificity of 89.4% and a sensitivity of 85.7%. The T and AT groups, however, were only slightly separated by the prediction analysis, indicating a strong field effect. A gene methylation prediction model was shown to predict prostate cancer relapse with sensitivity of 80.0% and specificity of 85.0%. These results suggest methylation patterns useful in predicting clinical outcomes of prostate cancer. PMID:23583283

  13. The Guanine Nucleotide Exchange Factor SWAP-70 Modulates the Migration and Invasiveness of Human Malignant Glioma Cells12

    PubMed Central

    Seol, Ho Jun; Smith, Christian A; Salhia, Bodour; Rutka, James T

    2009-01-01

    The malignant glioma is the most common primary human brain tumor. Its tendency to invade away from the primary tumor mass is considered a leading cause of tumor recurrence and treatment failure. Accordingly, the molecular pathogenesis of glioma invasion is currently under investigation. Previously, we examined a gene expression array database comparing human gliomas to nonneoplastic controls and identified several Rac guanine nucleotide exchange factors with differential expression. Here, we report that the guanine nucleotide exchange factor SWAP-70 has increased expression in malignant gliomas and strongly correlates with lowered patient survival. SWAP-70 is a multifunctional signaling protein involved in membrane ruffling that works cooperatively with activated Rac. Using a glioma tissue microarray, we validated that SWAP-70 demonstrates higher expression in malignant gliomas compared with low-grade gliomas or nonneoplastic brain tissue. Through immunofluorescence, SWAP-70 localizes to membrane ruffles in response to the growth factor, epidermal growth factor. To assess the role of SWAP-70 in glioma migration and invasion, we inhibited its expression withsmall interfering RNAs and observed decreased glioma cell migration and invasion. SWAP-70 overexpression led to increased levels of active Rac even in low-serum conditions. In addition, when SWAP-70 was overexpressed in glioma cells, we observed enhanced membrane ruffle formation followed by increased cellmigration and invasiveness. Taken together, our findings suggest that the guanine nucleotide exchange factor SWAP-70 plays an important role in the migration and invasion of human gliomas into the surrounding tissue. PMID:19956392

  14. The Methanol Extract of Angelica sinensis Induces Cell Apoptosis and Suppresses Tumor Growth in Human Malignant Brain Tumors

    PubMed Central

    Lai, Wen-Lin; Harn, Horng-jyh; Hung, Pei-Hsiu; Hsieh, Ming-Chang; Chang, Kai-Fu; Huang, Xiao-Fan; Liao, Kuang-Wen; Lee, Ming-Shih; Tsai, Nu-Man

    2013-01-01

    Glioblastoma multiforme (GBM) is a highly vascularized and invasive neoplasm. The methanol extract of Angelica sinensis (AS-M) is commonly used in traditional Chinese medicine to treat several diseases, such as gastric mucosal damage, hepatic injury, menopausal symptoms, and chronic glomerulonephritis. AS-M also displays potency in suppressing the growth of malignant brain tumor cells. The growth suppression of malignant brain tumor cells by AS-M results from cell cycle arrest and apoptosis. AS-M upregulates expression of cyclin kinase inhibitors, including p16, to decrease the phosphorylation of Rb proteins, resulting in arrest at the G0-G1 phase. The expression of the p53 protein is increased by AS-M and correlates with activation of apoptosis-associated proteins. Therefore, the apoptosis of cancer cells induced by AS-M may be triggered through the p53 pathway. In in vivo studies, AS-M not only suppresses the growth of human malignant brain tumors but also significantly prolongs patient survival. In addition, AS-M has potent anticancer effects involving cell cycle arrest, apoptosis, and antiangiogenesis. The in vitro and in vivo anticancer effects of AS-M indicate that this extract warrants further investigation and potential development as a new antibrain tumor agent, providing new hope for the chemotherapy of malignant brain cancer. PMID:24319475

  15. p53 mutations in human lymphoid malignancies: Association with Burkitt lymphoma and chronic lymphocytic leukemia

    SciTech Connect

    Gaidano, G.; Ballerini, P.; Gong, J.Z.; Inghirami, G.; Knowles, D.M.; Dalla-Favera, R. ); Neri, A, Centro Malattie del Sangue G. Marcora, Milan ); Newcomb, E.W. ); Magrath, I.T. )

    1991-06-15

    The authors have investigated the frequency of p53 mutations in B- and T-cell human lymphoid malignancies, including acute lymphoblastic leukemia, the major subtypes of non-Hodgkin lymphoma, and chronic lymphocytic leukemia. p53 exons 5-9 were studied by using genomic DNA from 197 primary tumors and 27 cell lines by single-strand conformation polymorphism analysis and by direst sequencing of PCR-amplified fragments. Mutations were found associated with (i) Burkitt lymphoma (9/27 biopsoes; 17/27 cell lines) and its leukemic counterpart L{sub 3}-type B-cell acute lymphoblastic leukemia (5/9), both of which also carry activated c-myc oncogenes, and (ii) B-cell chronic lymphocytic leukemia (6/40) and, in particular, its stage of progression known as Richter's transformation (3/7). Mutations were not found at any significant frequency in other types of non-Hodgkin lymphoma or acute lymphoblastic leukemia. In many cases, only the mutated allele was detectable, implying loss of the normal allele. These results suggest that (1) significant differences in the frequency of p53 mutations are present among subtypes of neoplasms derived from the same tissue; (2) p53 may play a role in tumor progression in B-cell chronic lymphocytic leukemia; (3) the presence of both p53 loss/inactivation and c-myc oncogene activation may be important in the pathogenesis of Burkitt lymphoma and its leukemia form L{sub 3}-type B-cell acute lymphoblastic leukemia.

  16. In vivo imaging of human malignant mesothelioma grown orthotopically in the peritoneal cavity of nude mice.

    PubMed

    Feng, Mingqian; Zhang, Jingli; Anver, Miriam; Hassan, Raffit; Ho, Mitchell

    2011-01-01

    Malignant mesothelioma (MM) causes significant morbidity and mortality in patients. With increasing efforts devoted to developing therapeutics targeting mesothelioma, a xenograft mouse model with in vivo tumor imaging is especially desired for evaluating anti-tumor therapies. In the present study, we fluorescently labeled the NCI-H226 human mesothelioma cell line by a lentiviral vector harboring a luciferase-GFP (Luc/GFP) fusion gene driven by the RNA polymerase II promoter. After single-cell cloning by flow cytometry, a clone (named LMB-H226-GL) that stably expresses high levels of Luc/GFP was obtained. The in vivo tumorigenicity of Luc/GFP-labeled LMB-H226-GL was determined by using intraperitoneal injections of the cells in nude mice. LMB-H226-GL was found to be able to consistently form solid tumors in the peritoneum of mice. Tumor growth and aggressive progression could be quantitated via in vivo bioluminescence imaging. The model exhibited the pathological hallmarks consistent with the clinical progression of MM in terms of tumor growth and spread inside the peritoneal cavity. To evaluate the in vivo efficacy of drugs targeting mesothelioma, we treated mice with SS1P, a recombinant immunotoxin currently evaluated in Phase II clinical trials for treatment of mesothelioma. All the tumor-bearing mice had a significant response to SS1P treatment. Our results showed that this is a well-suited model for mesothelioma, and may be useful for evaluating other novel agents for mesothelioma treatment in vivo. PMID:21479131

  17. In Vivo Imaging of Human Malignant Mesothelioma Grown Orthotopically in the Peritoneal Cavity of Nude Mice

    PubMed Central

    Feng, Mingqian; Zhang, Jingli; Anver, Miriam; Hassan, Raffit; Ho, Mitchell

    2011-01-01

    Malignant mesothelioma (MM) causes significant morbidity and mortality in patients. With increasing efforts devoted to developing therapeutics targeting mesothelioma, a xenograft mouse model with in vivo tumor imaging is especially desired for evaluating anti-tumor therapies. In the present study, we fluorescently labeled the NCI-H226 human mesothelioma cell line by a lentiviral vector harboring a luciferase-GFP (Luc/GFP) fusion gene driven by the RNA polymerase II promoter. After single-cell cloning by flow cytometry, a clone (named LMB-H226-GL) that stably expresses high levels of Luc/GFP was obtained. The in vivo tumorigenicity of Luc/GFP-labeled LMB-H226-GL was determined by using intraperitoneal injections of the cells in nude mice. LMB-H226-GL was found to be able to consistently form solid tumors in the peritoneum of mice. Tumor growth and aggressive progression could be quantitated via in vivo bioluminescence imaging. The model exhibited the pathological hallmarks consistent with the clinical progression of MM in terms of tumor growth and spread inside the peritoneal cavity. To evaluate the in vivo efficacy of drugs targeting mesothelioma, we treated mice with SS1P, a recombinant immunotoxin currently evaluated in Phase II clinical trials for treatment of mesothelioma. All the tumor-bearing mice had a significant response to SS1P treatment. Our results showed that this is a well-suited model for mesothelioma, and may be useful for evaluating other novel agents for mesothelioma treatment in vivo. PMID:21479131

  18. Catalase ameliorates polychlorinated biphenyl-induced cytotoxicity in non-malignant human breast epithelial cells

    PubMed Central

    Venkatesha, Venkatasubbaiah A.; Venkataraman, Sujatha; Sarsour, Ehab H.; Kalen, Amanda L.; Buettner, Garry R.; Robertson, Larry W.; Lehmler, Hans-Joachim; Goswami, Prabhat C.

    2008-01-01

    Polychlorinated biphenyls (PCBs) are environmental chemical contaminants believed to adversely affect cellular processes. We investigated the hypothesis that PCB-induced changes in the levels of cellular reactive oxygen species (ROS) induce DNA damage resulting in cytotoxicity. Exponentially growing cultures of human non-malignant breast epithelial cells (MCF10A) were incubated with PCBs for 3 days and assayed for cell number, ROS levels, DNA damage, and cytotoxicity. Exposure to 2,2',4,4',5,5'-hexachlorobiphenyl (PCB153) or 2-(4-chlorophenyl)benzo-1,4-quinone (4-Cl-BQ), a metabolite of 4-chlorobiphenyl (PCB3) significantly decreased cell number, MTS reduction, and increased the percentage of cells with sub G1 DNA content. Results from electron paramagnetic resonance (EPR) spectroscopy showed a 4-fold increase in the steady-state levels of ROS, which was suppressed in cells pre-treated with catalase. EPR measurements in cells treated with 4-Cl-BQ detected the presence of a semiquinone radical, suggesting that the increased levels of ROS could be due to the redox-cycling of 4-Cl-BQ. A dose-dependent increase in micronuclei frequency was observed in PCB-treated cells, consistent with an increase in histone 2AX-phosphorylation. Treatment of cells with catalase blunted the PCB-induced increase in micronuclei frequency and H2AX phosphorylation that was consistent with an increase in cell survival. Our results demonstrate a PCB-induced increase in cellular levels of ROS causing DNA damage, resulting in cell killing. PMID:18691649

  19. Virus-like particles for the prevention of human papillomavirus-associated malignancies

    PubMed Central

    Wang, Joshua W.; Roden, Richard B.S.

    2013-01-01

    As compared to peptide/protein-based vaccines, naked DNA vectors and even traditional attenuated or inactived virus vaccines, virus-like particles (VLPs) are an attractive vaccine platform because they offer a combination of safety, ease of production, and both high density B cell epitope display and intracellular presentation of T cell epitopes that induce potent humoral and cellular immune responses respectively. Indeed, human papillomavirus (HPV) vaccines based on VLP production by recombinant expression of major capsid antigen L1 in yeast (Gardasil®, Merck & Co.) or insect cells (Cervarix®, GlaxoSmithKline) have been licensed for the prevention of cervical and anogenital infection and disease associated with the genotypes targeted by each vaccine. These HPV vaccines however have not been demonstrated as effective to treat existing infections, and efforts to develop a therapeutic HPV vaccine continue. Furthermore, current HPV L1-VLP vaccines provide type-restricted protection, requiring highly multivalent formulations to broaden coverage to the dozen or more oncogenic HPV genotypes. This raises the complexity and cost of vaccine production. The lack of access to screening and high disease burden in developing countries has spurred efforts to develop second generation HPV vaccines that are more affordable, induce wider protective coverage and offer therapeutic coverage against HPV-associated malignancies. Given the previous success with L1 VLP-based vaccines against HPV, VLPs have been also adopted as platforms for many second generation HPV and non-HPV vaccine candidates with both prophylactic and therapeutic intent. Here we examine the progress and challenges of these efforts, with a focus on how they inform VLP vaccine design. PMID:23414405

  20. Genotype analysis of the human endostatin variant p.D104N in benign and malignant adrenocortical tumors

    PubMed Central

    de Paula Mariani, Beatriz Marinho; Trarbach, Ericka Barbosa; Ribeiro, Tamaya Castro; Pereira, Maria Adelaide Albergaria; Mendonca, Berenice Bilharinho; Fragoso, Maria Candida Barisson Villares

    2012-01-01

    OBJECTIVE: Endostatin is a potent endogenous inhibitor of angiogenesis. It is derived from the proteolytic cleavage of collagen XVIII, which is encoded by the COL18A1 gene. A polymorphic COL18A1 allele encoding the functional polymorphism p.D104N impairs the activity of endostatin, resulting in a decreased ability to inhibit angiogenesis. This polymorphism has been previously analyzed in many types of cancer and has been considered a phenotype modulator in some benign and malignant tumors. However, these data are controversial, and different results have been reported for the same tumor types, such as prostate and breast cancer. The purpose of this study was to genotype the p.D104N variant in a cohort of pediatric and adult patients with adrenocortical tumors and to determine its possible association with the biological behavior of adrenocortical tumors. METHODS: DNA samples were obtained from 38 pediatric and 56 adult patients (0.6–75 yrs) with adrenocortical tumors. The DNA samples were obtained from peripheral blood, frozen tissue or paraffin-embedded tumor blocks when blood samples or fresh frozen tissue samples were unavailable. Restriction fragment length polymorphism analysis was used to genotype the patients and 150 controls. The potential associations of the p.D104N polymorphism with clinical and histopathological features and oncologic outcome (age of onset, tumor size, malignant tumor behavior, and clinical syndrome) were analyzed. RESULTS: Both the patient group and the control group were in Hardy–Weinberg equilibrium. The frequencies of the p.D104N polymorphism in the patient group were 81.9% (DD), 15.9% (DN) and 2.2% (NN). In the controls, these frequencies were 80.6%, 17.3% and 2.0%, respectively. We did not observe any association of this variant with clinical or histopathological features or oncologic outcome in our cohort of pediatric and adult patients with adrenocortical tumors. PMID:22358232

  1. Light propagation in paint and prostate human tissues using visible to mid-IR spectroscopy and imaging techniques

    NASA Astrophysics Data System (ADS)

    Ali, Jamal Hafiez

    The topic of the thesis is to understand the structural and molecular changes in scattering media for bio-medical applications such as animal, and human prostate tissues and non-biomedical applications such as corrosion and cracks beneath paint using steady and time-resolved light spectroscopy and imaging techniques in the visible to mid-IR spectral region. The thesis focuses also on understanding the randomization of coherence and polarization in thin scattering paint medium. Temporal polarization emission profiles of Fluorescein dye attached to different molecular weight ranging from 4 K to 500 K were measured. Images of an object containing varying molecular weight of Fluorescein dye embedded inside intralipid media were investigated. The non-invasive spectral polarization difference imaging and the fluorescence polarization difference imaging techniques using Cardio Green dye are introduced in the optical imaging studies to enhance the image quality. The measured transport length for prostate tissues using time-resolved pulse transmission is ℓtr = 0.86 mm. Four modeling samples of human rectum-membrane-prostate tissue were investigated using the near-infrared spectral polarization imaging technique to detect small foreign objects at different depths inside prostate tissues. The content of water in cancerous and normal human prostate tissues was shown to be different using near infrared spectroscopy and imaging techniques. The OH stretching vibrational overtone mode at 980 nm, 1195 nm, 1444 nm and other water overtone modes provide key spectroscopic fingerprints to detect non-invasively cancer in prostate tissue. The value of the transport length (ℓtr) for paint medium obtained from time-resolved pulse transmission, steady state, and degree of polarization measurements is 28mum, 34mu m, and 29mum, respectively. The correlation of time-resolved interference (coherence) and polarization in a scattering thin paint medium has been determined for the first time

  2. Leiomyosarcoma of the prostate-an unexpected histopathological outcome.

    PubMed

    Raj, Dinesh Harvey; Dash, Prafulla Kumar; Mohanty, Jayashree; Sarangi, Pradosh Kumar

    2016-01-01

    Prostate leiomyosarcoma is an extremely rare and highly aggressive neoplasm that accounts for >0.1% of all primary prostate malignancies. We report a case of a patient, presenting with recurrent episodes of dysuria, who had been diagnosed and operated for benign prostatic hyperplasia 1 month earlier, and now presented with similar symptoms postoperatively. Trans-rectal biopsy of the prostate was carried out and histopathology revealed leiomyosarcoma of the prostate. PMID:27284101

  3. Abrogation of prostaglandin E-EP4 signaling in osteoblasts prevents the bone destruction induced by human prostate cancer metastases.

    PubMed

    Watanabe, Kenta; Tominari, Tsukasa; Hirata, Michiko; Matsumoto, Chiho; Maruyama, Takayuki; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato; Inada, Masaki

    2016-09-01

    The metastasis of tumors to bone is known to be promoted by prostaglandin E2 (PGE2) produced by the tumor host stromal tissue. Although bone metastases frequently occur in prostate cancer patients, the significance of PGE2 in stromal responses to the tumor is not known. In this study, we report that PGE2 and its receptor EP4 play a pivotal role in bone destruction and metastasis in an experimental metastasis model of prostate cancer in nude mice. Using human prostate cancer PC-3 cells that are stably transfected with luciferase, we showed that the development of bone metastasis was accompanied by increased osteoclastic bone resorption in the bone metastasis microenvironment, and could be abrogated by an EP4 receptor antagonist. The growth of PC-3 cells in vitro was not influenced by PGE2 or by the EP4 receptor. However, cell-cell interactions between fixed PC-3 cells and host osteoblasts induced PGE2 production and RANKL expression in the osteoblasts. Addition of an EP4 antagonist suppressed both PGE2 and RANKL expression induced by the PC3-osteoblast interaction, which would have consequent effects on osteoclast activation and osteolysis. These results indicate that the blockage of PGE2-EP4 signaling prevents the bone destruction required for prostate cancer metastases, and that this is, in part due to the abrogation of bone cell responses. The study provides further evidence that an EP4 antagonist is a candidate for the treatment of prostate cancer in the blockade of bone metastasis. PMID:27450806

  4. Procyanidin B2 3,3″-di-O-gallate, a biologically active constituent of grape seed extract, induces apoptosis in human prostate cancer cells via targeting NF-κB, Stat3 and AP1 transcription factors

    PubMed Central

    Tyagi, Alpna; Raina, Komal; Shrestha, Suraj Prakash; Miller, Bettina; Thompson, John A.; Wempe, Michael F.; Agarwal, Rajesh; Agarwal, Chapla

    2014-01-01

    Recently, we identified procyanidin B2 3,3″-di-O-gallate (B2G2) as most active constituent of grape seed extract (GSE) for efficacy against prostate cancer (PCa). Isolating large quantities of B2G2 from total GSE is labor intensive and expensive, thereby limiting both efficacy and mechanistic studies with this novel anti-cancer agent. Accordingly, here we synthesized gram-scale quantities of B2G2, compared it with B2G2 isolated from GSE for possible equivalent biological activity, and conducted mechanistic studies. Both B2G2 preparations inhibited cell growth, decreased clonogenicity, and induced cell cycle arrest and apoptotic death, comparable to each other, in various human PCa cell lines. Mechanistic studies focusing on transcription factors involved in apoptotic and survival pathways revealed that B2G2 significantly inhibits NF-κB and AP1 transcriptional activity and nuclear translocation of Stat3 in PCa cell lines, irrespective of their functional androgen receptor status. B2G2 also decreased survivin expression which is regulated by NF-κB, AP1 and Stat3, and increased cleaved PARP level. In summary, we report B2G2 chemical synthesis at gram-quantity with equivalent biological efficacy against human PCa cell lines and same molecular targeting profiles at key transcription factors level. The synthetic B2G2 will stimulate more research on prostate and possibly other malignancies in preclinical models and clinical translation. PMID:24191894

  5. Brassinin Combined with Capsaicin Enhances Apoptotic and Anti-metastatic Effects in PC-3 Human Prostate Cancer Cells.

    PubMed

    Kim, Sung-Moo; Oh, Eun Young; Lee, Jong Hyun; Nam, Dongwoo; Lee, Seok Geun; Lee, Junhee; Kim, Sung-Hoon; Shim, Bum Sang; Ahn, Kwang Seok

    2015-11-01

    Brassinin (BSN), a type of indole compound derived from cruciferous vegetables, has shown anti-cancer effects in cells and animals. Capsaicin (CAP), an alkaloid derived from the chilli pepper, is also of interest in for its reported efficacy against various malignancies. The objective of our study was to analyze the potential synergistic anti-tumor effects of BSN combined with CAP on prostate cancer PC-3 cells. After treatment with BSN and CAP at various concentrations, the synergistic cytotoxic effect of PC-3 cells was analyzed by MTT method, proliferation, apoptosis, mitochondrial membrane potential, colony formation, and Western blotting. Moreover, the inhibitory effects of BSN and CAP on the constitutive expressions of MMP-9/2, their enzymatic activities, cellular migration, and cell invasion were also investigated. The cytotoxicity was synergistically increased in combination compared with the single drug used; moreover, proliferation, apoptosis, mitochondrial membrane potential, and colony formation were significantly suppressed and anti-apoptotic-, proliferative-, and metastatic-related proteins were clearly abolished in the combination group. Besides, constitutive MMP-9/2 expression, their enzymatic activities, cell migration, and tumor cell invasion were inhibited, and TIMP-1 was up-regulated in the combination group in PC-3 cells. Our results indicate, for the first time, that BSN and CAP in combination exert synergistic anticancer effects in prostate carcinoma. PMID:26426257

  6. β4-integrin-mediated cytotoxic activity of AexU in human prostate cancer PC3 cells.

    PubMed

    Kumano, Masafumi; Miyake, Hideaki; Abolghait, Said K; Behnsawy, Hosny M; Fujisawa, Masato

    2013-11-01

    The present study aimed to characterize the cytotoxic activity of AexU, an effector-mediating type three secretion system (TTSS) of gram-negative bacteria, in human prostate cancer cells, focusing on the association with β4-integrin expression. The cytotoxic effects of AexU either alone or in combination with chemotherapeutic agents were evaluated using several human prostate cancer cell lines. Human prostate cancer PC3 cells, in which an expression vector containing siRNA targeting β4-integrin had been introduced, were established (PC3/sh-In), and the cytotoxic effects of AexU on the PC3/sh-In cells were compared with the PC3 cells that were transfected with a control vector (PC3/C). The expression levels of β4-integrin in the PC3 cells were markedly higher compared with those in the LNCaP or DU145 cells, and the cytotoxic effects of AexU in the PC3 cells were more pronounced compared with those in the LNCaP or DU145 cells. The sensitivity of the PC3 cells to docetaxel and cisplatin was significantly enhanced following treatment with AexU, resulting in a decrease in the IC50 of the two agents by ~90%. The cytotoxic effect of AexU in the PC3/C cells was more marked compared with that in the PC3/sh-In cells, and the phosphorylation of Akt in the PC3/C cells appeared to be significantly more inhibited by the treatment with AexU compared with the PC3/sh-In cells. In conclusion, treatment with AexU may be a useful therapeutic option for prostate cancer when β4-integrin is overexpressed. The treatment appears to exert its effects through growth inhibition and by enhancing the sensitivity of the cancer cells to chemotherapeutic agents. PMID:24179545

  7. Nogo-A inhibits the migration and invasion of human malignant glioma U87MG cells.

    PubMed

    Jin, Shu-Guang; Ryu, Hyang-Hwa; Li, Song-Yuan; Li, Chun-Hao; Lim, Sa-Hoe; Jang, Woo-Youl; Jung, Shin

    2016-06-01

    Nogo or reticulon-4 (RTN4), also known as neurite outgrowth inhibitor, is a member of the reticulon family of genes. Nogo-A, one of the three isoforms, is enriched in the central nervous system (CNS). The extracellular domain of Nogo-A, Nogo-66, has neurite growth inhibitory activity that is specific for neurons and is mediated by the Nogo receptor. However, most of its functions are not known yet. We investigated whether Nogo-A modulates the migration and invasion of a glioblastoma cell line, as well as the factors that have an effect on Nogo-A. The expression of Nogo-A was evaluated using western blotting and immunohistochemistry in human brain tumor specimens. U87MG cells were transfected with a sense-Nogo-A cDNA construct (U87-Nogo-A cells expressing Nogo-A) and an empty vector (U87MG-E cells not expressing Nogo-A). The migration and invasion abilities of these cells were investigated using simple scratch and Matrigel invasion assays. Morphologic and cytoskeletal changes were documented by confocal microscopy. The proliferation rate was estimated using doubling time assay. The effects of Nogo-A on Rho activity and phosphorylated cofilin were determined by a Rho activity assay and western blotting. Among primary brain tumors, Nogo-A expression was found in a higher percentage of oligodendrogliomas (90.0%) compared with the percentage in the glioblastomas (68.4%). In addition, the percentage in mixed gliomas was 42.9%, while it was not expressed in pituitary adenomas or schwannomas. The migration and invasion abilities of the U87-Nogo-A cells were decreased compared with the control. In the U87-Nogo-A cell line, Rho activity and phosphorylated cofilin expression were also decreased and morphology became more flat in comparison with the U87MG-E cell line. Nogo-A may inhibit the migration and invasion of human malignant glioma cells via the downregulation of RhoA-cofilin signaling. PMID:27109183

  8. Keratin immunoreactivity as an aid to the diagnosis of persistent adenocarcinoma in irradiated human prostates

    SciTech Connect

    Brawer, M.K.; Nagle, R.B.; Pitts, W.; Freiha, F.; Gamble, S.L.

    1989-02-01

    Postirradiation prostatic biopsy is believed by many to be the best measure of radiation effectiveness in prostatic cancer. Therapeutic irradiation may induce prostatic glandular atypia, which in its severe form can be confused with persistent adenocarcinoma on prostatic biopsies. In the current study, 37 postirradiation prostate biopsy specimens were evaluated by immunohistochemistry using a specific monoclonal anticytokeratin antibody (KA1) that reacts with the basal cells of normal or hyperplastic glands, but is nonreactive with the lumenal cells or with prostatic carcinoma cells. Persistent carcinoma was observed in 19 cases in which antibody staining was absent. The noncarcinomatous glands retained reactivity, but this reactivity appeared in a new and previously undescribed pattern. The irradiated lesion was characterized by cellular pleomorphisism, with enlargement of nuclei and loss of polarity. The immunoreactivity was seen in the enlarged basal cells and was seen to focally extend to involve the lumenal cell layer. In five of 37 cases, glands were seen that were so atypical on the routinely stained sections that a distinction from cancer could not be made. These same glands in the adjacent section reacted with KA1 in each case allowing us to conclude that the changes were benign. We conclude that the interpretation of postirradiation prostatic biopsy specimens may be aided by immunohistochemistry with this anticytokeratin antibody.

  9. Dysregulation of cholesterol homeostasis in human prostate cancer through loss of ABCA1

    PubMed Central

    Lee, Byron H.; Taylor, Margaret G.; Robinet, Peggy; Smith, Jonathan D.; Schweitzer, Jessica; Sehayek, Ephraim; Falzarano, Sara M.; Magi-Galluzzi, Cristina; Klein, Eric A.; Ting, Angela H.

    2012-01-01

    Recent epidemiologic data show that low serum cholesterol level as well as statin use is associated with a decreased risk of developing aggressive or advanced prostate cancer, suggesting a role for cholesterol in aggressive prostate cancer development. Intracellular cholesterol promotes prostate cancer progression as a substrate for de novo androgen synthesis and through regulation of AKT signaling. By performing next-generation sequencing-based DNA methylome analysis, we have discovered marked hypermethylation at the promoter of the major cellular cholesterol efflux transporter, ABCA1, in LNCaP prostate cancer cells. ABCA1 promoter hypermethylation renders the promoter unresponsive to trans-activation and leads to elevated cholesterol levels in LNCaP. ABCA1 promoter hypermethylation is enriched in intermediate to high grade prostate cancers and not detectable in benign prostate. Remarkably, ABCA1 down-regulation is evident in all prostate cancers examined, and expression levels are inversely correlated with Gleason grade. Our results suggest cancer-specific ABCA1 hypermethylation and loss of protein expression direct high intracellular cholesterol levels and hence contribute to an environment conducive to tumor progression. PMID:23233737

  10. EXAFS studies of prostate cancer cell lines

    NASA Astrophysics Data System (ADS)

    Czapla, J.; Kwiatek, W. M.; Lekki, J.; Kisiel, A.; Steininger, R.; Goettlicher, J.

    2013-04-01

    Sulphur plays a vital role in every human organism. It is known, that sulphur-bearing compounds, such as for example cysteine and glutathione, play critical roles in development and progression of many diseases. Any alteration in sulphur's biochemistry could become a precursor of serious pathological conditions. One of such condition is prostate cancer, the most frequently diagnosed malignancy in the western world and the second leading cause of cancer related death in men. The purpose of presented studies was to examine what changes occur in the nearest chemical environment of sulphur in prostate cancer cell lines in comparison to healthy cells. The Extended X-ray Absorption Fine Structure (EXAFS) spectroscopy was used, followed by theoretical calculations. The results of preliminary analysis is presented.

  11. Review of Prostate Anatomy and Embryology and the Etiology of Benign Prostatic Hyperplasia.

    PubMed

    Aaron, LaTayia; Franco, Omar E; Hayward, Simon W

    2016-08-01

    Prostate development follows a common pattern between species and depends on the actions of androgens to induce and support ductal branching morphogenesis of buds emerging from the urogenital sinus. The human prostate has a compact zonal anatomy immediately surrounding the urethra and below the urinary bladder. Rodents have a lobular prostate with lobes radiating away from the urethra. The human prostate is the site of benign hyperplasia, prostate cancer, and prostatitis. The rodent prostate has little naturally occurring disease. Rodents can be used to model aspects of human benign hyperplasia, but care should be taken in data interpretation and extrapolation to the human condition. PMID:27476121

  12. Immunotherapy in prostate cancer.

    PubMed

    Sobol, Ilya; Thompson, R H; Dong, Haidong; Krco, Christopher; Kwon, Eugene D

    2015-06-01

    Immunotherapy for the treatment of malignant neoplasms has made significant progress over the last 20 years. Multiple molecular targets and clinical agents have been developed recently, particularly in the field of metastatic adenocarcinoma of the prostate. Sipuleucel-T is currently the only FDA approved immunotherapy for prostate cancer. PSA-TRICOM (Prostvac) currently has a phase III randomized trial underway after a phase II trial showed an improvement in overall survival. Interestingly, both these agents showed improvement in overall survival with no measurable change in disease state, leading to significant controversy as the utility of these agents in prostate cancer. Ipilimumab revealed a benefit for a sub-cohort of men in a post-docetaxel group and is currently undergoing investigation in a pre-docetaxel group. There are a number of other targets such as PD-1 which have shown effectiveness in other neoplasms that will likely be investigated in the future for use in prostate cancer. PMID:25894495

  13. Cytotoxicity of obacunone and obacunone glucoside in human prostate cancer cells involves Akt-mediated programmed cell death.

    PubMed

    Murthy, Kotamballi N Chidambara; Jayaprakasha, Guddadarangavvanahally K; Patil, Bhimanagouda S

    2015-03-01

    Obacunone and obacunone glucoside (OG) are naturally occurring triterpenoids commonly found in citrus and other plants of the Rutaceae family. The current study reports the mechanism of cytotoxicity of citrus-derived obacunone and OG on human androgen-dependent prostate cancer LNCaP cells. Both limonoids exhibited time- and dose-dependent inhibition of cell proliferation, with more than 60% inhibition of cell viability at 100 μM, after 24 and 48 h. Analysis of fragmentation of DNA, activity of caspase-3, and cytosolic cytochrome-c in the cells treated with limonoids provided evidence for activation of programmed cell death by limonoids. Treatment of LNCaP cells with obacunone and OG resulted in dose-dependent changes in expression of proteins responsible for the induction of programmed cell death through the intrinsic pathway and down-regulation of Akt, a key molecule in cell signaling pathways. In addition, obacunone and OG also negatively regulated an inflammation-associated transcription factor, androgen receptor, and prostate-specific antigen, and activated proteins related to the cell cycle, confirming the ability of limonoids to induce cytotoxicity through multiple pathways. The results of this study provided, for the first time, an evidence of the cytotoxicity of obacunone and OG in androgen-dependent human prostate cancer cells. PMID:25592883

  14. Caffeic acid phenethyl ester suppresses the proliferation of human prostate cancer cells through inhibition of AMPK and Akt signaling networks

    PubMed Central

    Chuu, Chih-Pin; Lin, Hui-Ping; Ciaccio, Mark F.; Kokontis, John M.; Hause, Ronald J.; Hiipakka, Richard A.; Liao, Shutsung; Jones, Richard Baker

    2016-01-01

    Caffeic acid phenethyl ester (CAPE) is a bioactive component derived from honeybee hive propolis. CAPE has been shown to have anti-mitogenic, anti-carcinogenic, and other beneficial medicinal properties. Many of its effects have been shown to be mediated through its inhibition of NF-κB signaling pathways. We took a systematic approach to uncover CAPE’s effects from hours to days on the signaling networks in human prostate cancer cells. We observed that CAPE dosage-dependently suppressed the proliferation of LNCaP, DU-145, and PC-3 human prostate cancer cells. Administration of CAPE by gavage significantly inhibited the tumor growth of LNCaP xenografts in nude mice. Using LNCaP cells as a model system, we examined CAPE’s effect on gene expression, protein signaling, and transcriptional regulatory networks using Micro-Western Arrays and PCR arrays. We built a model of CAPE’s impact on cell signaling which suggested that it acted through inhibition of Akt-related protein signaling networks. Over-expression of Akt1 or cMyc, a downstream target of Akt signaling, significantly blocked the anti-proliferative effects of CAPE. In summary, our results suggest that CAPE administration may be useful as an adjuvant therapy for prostate and potentially other types of cancers that are driven by the AMPK and Akt signaling networks. PMID:22562408

  15. Combined Effects of Nonylphenol and Bisphenol A on the Human Prostate Epithelial Cell Line RWPE-1

    PubMed Central

    Gan, Weidong; Zhou, Ming; Xiang, Zou; Han, Xiaodong; Li, Dongmei

    2015-01-01

    The xenoestrogens nonylphenol (NP) and bisphenol A (BPA) are regarded as endocrine disrupting chemicals (EDCs) which have widespread occurrence in our daily life. In the present study, the purpose was to analyze the combined effects of NP and BPA on the human prostate epithelial cell line RWPE-1 using two mathematical models based on the Loewe additivity (LA) theory and the Bliss independence (BI) theory. RWPE-1 cells were treated with NP (0.01–100 µM) and BPA (1–5000 µM) in either a single or a combined format. A cell viability assay and lactate dehydrogenase (LDH) leakage rate assay were employed as endpoints. As predicted by the two models and based on the cell viability assay, significant synergism between NP and BPA were observed. However, based on the LDH assay, the trends were reversed. Given that environmental contaminants are frequently encountered simultaneously, these data indicated that there were potential interactions between NP and BPA, and the combined effects of the chemical mixture might be stronger than the additive values of individual chemicals combined, which should be taken into consideration for the risk assessment of EDCs. PMID:25874684

  16. Endothelin receptors and their cellular signal transduction mechanism in human cultured prostatic smooth muscle cells.

    PubMed

    Saita, Y; Koizumi, T; Yazawa, H; Morita, T; Takenaka, T; Honda, K

    1997-06-01

    1. Endothelin (ET) receptors, and their cellular signal transduction mechanism, were characterized in a primary culture of human prostatic smooth muscle cells (HP cell). 2. [125I]-ET-1 and [125I]-ET-3 binding studies revealed that both ETA and ETB receptors were present in the HP cells, and the ratio of ETA to ETB receptors was 1.4:1. 3. Analysis of ET receptor mRNA by reverse transcription-polymerase chain reaction also demonstrated that HP cells express both ETA and ETB receptors. 4. ET-1 and ET-3 increased intracellular free Ca2+ concentration ([Ca2+]i) in the HP cells in a concentration-dependent manner. Use of subtype selective antagonists BQ-123 and BQ-788, indicated that both ETA and ETB receptors were coupled to an increase in [Ca2+]i. 5. Pretreatment of the cells with pertussis toxin resulted in a significant but partial attenuation of the [Ca2+]i increase mediated through the ETA and ETB receptors. However, sensitivity to pertussis toxin (PTX) was significantly different between them. 6. In conclusion, HP cells possess ETA and ETB receptors. Further, these two endothelin receptor subtypes evoke an increase in [Ca2+]i possibly via the action of different GTP-binding proteins. PMID:9208135

  17. Anti-proliferative activity of 25-hydroxyvitamin D3 in human prostate cells.

    PubMed

    Munetsuna, Eiji; Kawanami, Rie; Nishikawa, Miyu; Ikeda, Shinnosuke; Nakabayashi, Sachie; Yasuda, Kaori; Ohta, Miho; Kamakura, Masaki; Ikushiro, Shinichi; Sakaki, Toshiyuki

    2014-02-15

    1α-Hydroxylation of 25-hydroxyvitamin D3 is believed to be essential for its biological effects. In this study, we evaluated the biological activity of 25(OH)D3 itself comparing with the effect of cell-derived 1α,25-dihydroxyvitamin D3 (1α,25(OH)2D3). First, we measured the cell-derived 1α,25(OH)2D3 level in immortalized human prostate cell (PZ-HPV-7) using [(3)H]-25(OH)D3. The effects of the cell-derived 1α,25(OH)2D3 on vitamin D3 24-hydroxylase (CYP24A1) mRNA level and the cell growth inhibition were significantly lower than the effects of 25(OH)D3 itself added to cell culture. 25-Hydroxyvitamin D3 1α-hydroxylase (CYP27B1) gene knockdown had no significant effects on the 25(OH)D3-dependent effects, whereas vitamin D receptor (VDR) gene knockdown resulted in a significant decrease in the 25(OH)D3-dependent effects. These results strongly suggest that 25(OH)D3 can directly bind to VDR and exerts its biological functions. DNA microarray and real-time RT-PCR analyses suggest that semaphorin 3B, cystatin E/M, and cystatin D may be involved in the antiproliferative effect of 25(OH)D3. PMID:24291609

  18. Antitumor Activity of Garcinol in Human Prostate Cancer Cells and Xenograft Mice.

    PubMed

    Wang, Yu; Tsai, Mei-Ling; Chiou, Li-Yu; Ho, Chi-Tang; Pan, Min-Hsiung

    2015-10-21

    Garcinol, which is isolated from fruit rinds of Garcinia indica, is a polyisoprenylated benzophenone. It has been studied for its antitumor activity by inducing apoptosis and inhibiting autophagy in human prostate cancer cells. The Bax/Bcl-2 ratio increased when garcinol was applied to PC-3 cells indicating a presence of apoptosis. Meanwhile, procaspases-9 and -3 were suppressed with attenuating PARP and DFF-45. Autophagy was inhibited through activating p-mTOR and p-PI3 Kinase/AKT by garcinol, which as a result induced the cells to apoptosis directly. In addition, the apoptosis effect of garcinol in a xenograft mouse model was also tested, suggesting a consistent result with PC-3 cell model. The tumor size was reduced more than 80 percent after the mouse accepted the garcinol treatment. Garcinol was demonstrated to have a strong antitumor activity through inhibiting autophagy and inducing apoptosis, which was discovered for the first time. Based on these findings, our data suggests that garcinol deserves further investigation as a potent chemopreventive agent. PMID:26442822

  19. Endothelin receptors and their cellular signal transduction mechanism in human cultured prostatic smooth muscle cells

    PubMed Central

    Saita, Yuji; Koizumi, Tomonobu; Yazawa, Hidenori; Morita, Takashi; Takenaka, Toichi; Honda, Kazuo

    1997-01-01

    Endothelin (ET) receptors, and their cellular signal transduction mechanism, were characterized in a primary culture of human prostatic smooth muscle cells (HP cell). [125I]-ET-1 and [125I]-ET-3 binding studies revealed that both ETA and ETB receptors were present in the HP cells, and the ratio of ETA to ETB receptors was 1.4:1. Analysis of ET receptor mRNA by reverse transcription-polymerase chain reaction also demonstrated that HP cells express both ETA and ETB receptors. ET-1 and ET-3 increased intracellular free Ca2+ concentration ([Ca2+]i) in the HP cells in a concentration-dependent manner. Use of subtype selective antagonists BQ-123 and BQ-788, indicated that both ETA and ETB receptors were coupled to an increase in [Ca2+]i. Pretreatment of the cells with pertussis toxin resulted in a significant but partial attenuation of the [Ca2+]i increase mediated through the ETA and ETB receptors. However, sensitivity to pertussis toxin (PTX) was significantly different between them. In conclusion, HP cells possess ETA and ETB receptors. Further, these two endothelin receptor subtypes evoke an increase in [Ca2+]i possibly via the action of different GTP-binding proteins. PMID:9208135

  20. Association of epigenetic alterations in the human C7orf24 gene with the aberrant gene expression in malignant cells.

    PubMed

    Ohno, Yuji; Hattori, Akira; Yoshiki, Tatsuhiro; Kakeya, Hideaki

    2013-10-01

    Human chromosome 7 open reading frame 24 (C7orf24)/γ-glutamyl cyclotransferase has been suggested to be a potential diagnostic marker for several cancers, including carcinomas in the bladder urothelium, breast and endometrial epithelium. We here investigated the epigenetic regulation of the human C7orf24 promoter in normal diploid ARPE-19 and IMR-90 cells and in the MCF-7 and HeLa cancer cell lines to understand the transcriptional basis for the malignant-associated high expression of C7orf24. Chromatin immunoprecipitation analysis revealed that histone modifications associated with active chromatin were enriched in the proximal region but not in the distal region of the C7orf24 promoter in HeLa and MCF-7 cells. In contrast, elevated levels of histone modifications leading to transcriptional repression and accumulation of heterochromatin proteins in the C7orf24 promoter were observed in the ARPE-19 and IMR-90 cells, compared to the levels in HeLa and MCF-7 cancer cells. In parallel, the CpG island of the C7orf24 promoter was methylated to a greater extent in the normal cells than in the cancer cells. These results suggest that the transcriptional silencing of the C7orf24 gene in the non-malignant cells is elicited through heterochromatin formation in its promoter region; aberrant expression of C7orf24 associated with malignant alterations results from changes in chromatin dynamics. PMID:23853312

  1. The activation of human endogenous retrovirus K (HERV-K) is implicated in melanoma cell malignant transformation

    SciTech Connect

    Serafino, A. Balestrieri, E.; Pierimarchi, P.; Matteucci, C.; Moroni, G.; Oricchio, E.; Rasi, G.; Mastino, A.; Spadafora, C.; Garaci, E.; Vallebona, P. Sinibaldi

    2009-03-10

    Melanoma development is a multi-step process arising from a series of genetic and epigenetic events. Although the sequential stages involved in progression from melanocytes to malignant melanoma are clearly defined, our current understanding of the mechanisms leading to melanoma onset is still incomplete. Growing evidence show that the activation of endogenous retroviral sequences might be involved in transformation of melanocytes as well as in the increased ability of melanoma cells to escape immune surveillance. Here we show that human melanoma cells in vitro undergo a transition from adherent to a more malignant, non-adherent phenotype when exposed to stress conditions. Melanoma-derived non-adherent cells are characterized by an increased proliferative potential and a decreased expression of both HLA class I molecules and Melan-A/MART-1 antigen, similarly to highly malignant cells. These phenotypic and functional modifications are accompanied by the activation of human endogenous retrovirus K expression (HERV-K) and massive production of viral-like particles. Down-regulation of HERV-K expression by RNA interference prevents the transition from the adherent to the non-adherent growth phenotype in low serum. These results implicate HERV-K in at least some critical steps of melanoma progression.

  2. Evaluation of T and B lymphocyte membrane markers in human non-Hodgkin malignant lymphomata.

    PubMed Central

    Brouet, J. C.; Labaume, S.; Seligmann, M.

    1975-01-01

    Lymphoma cells from 25 patients were studied for the presence of B lymphocytes (membrane bound Ig and Fc receptor) and T lymphocytes (rosette formation with sheep erythrocytes) membrane markers. All cases of well differentiated lymphocytic lymphoma and of acute lymphosarcoma cell leukaemia and most cases of poorly differentiated lymphocytic lymphoma behaved as B cell monoclonal malignancies. However, the malignant cells of some patients were not definitely classified according to their B or T cell origin or lacked these membrane markers. The latter situation was encountered in 4 reticulum cell sarcomata. Polyclonal Ig were found on the surface of B cells in a case of hyperbasophilic undifferentiated lymphoma. The need for using several membrane markers to study the abnormal lymphoma cells is outlined. Such studies improve our understanding of these malignancies and may lead in the future to a satisfactory classification of non-Hodgkin lymphomata. PMID:1081001

  3. The liver X receptor agonist T0901317 acts as androgen receptor antagonist in human prostate cancer cells

    SciTech Connect

    Chuu, Chih-pin; Chen, Rou-Yu; Hiipakka, Richard A.; Kokontis, John M.; Warner, Karen V.; Xiang, Jialing; Liao, Shutsung . E-mail: sliao@uchicago.edu

    2007-06-01

    T0901317 is a potent non-steroidal synthetic liver X receptor (LXR) agonist. T0901317 blocked androgenic stimulation of the proliferation of androgen-dependent LNCaP 104-S cells and androgenic suppression of the proliferation of androgen-independent LNCaP 104-R2 cells, inhibited the transcriptional activation of an androgen-dependent reporter gene by androgen, and suppressed gene and protein expression of prostate specific antigen (PSA), a target gene of androgen receptor (AR) without affecting gene and protein expression of AR. T0901317 also inhibited binding of a radiolabeled androgen to AR, but inhibition was much weaker compared to the effect of the antiandrogens, bicalutamide and hydroxyflutamide. The LXR agonist T0901317, therefore, acts as an antiandrogen in human prostate cancer cells.

  4. Prostate cancer markers: An update

    PubMed Central

    PENTYALA, SRINIVAS; WHYARD, TERRY; PENTYALA, SAHANA; MULLER, JOHN; PFAIL, JOHN; PARMAR, SUNJIT; HELGUERO, CARLOS G.; KHAN, SARDAR

    2016-01-01

    As the most common noncutaneous malignancy in American men, prostate cancer currently accounts for 29% of all diagnosed cancers, and ranks second as the cause of cancer fatality in American men. Prostatic cancer is rarely symptomatic early in its course and therefore disease presentation often implies local extension or even metastatic disease. Thus, it is extremely critical to detect and diagnose prostate cancer in its earliest stages, often prior to the presentation of symptoms. Three of the most common techniques used to detect prostate cancer are the digital rectal exam, the transrectal ultrasound, and the use of biomarkers. This review presents an update regarding the field of prostate cancer biomarkers and comments on future biomarkers. Although there is not a lack of research in the field of prostate cancer biomarkers, the discovery of a novel biomarker that may have the advantage of being more specific and effective warrants future scientific inquiry. PMID:26998261

  5. Human non-Hodgkin's malignant lymphomas serially transplanted in nude mice conditioned with whole-body irradiation.

    PubMed Central

    Igarashi, T.; Oka, K.; Miyamoto, T.

    1989-01-01

    Direct transplantation of non-Hodgkin's malignant lymphoma into athymic nude mice was successfully achieved after whole-body irradiation (5 Gy). Twenty-seven per cent (6/22) of transplanted lymphomas were established as nude mouse lines. The successful lines were derived solely from the patients with diffuse lymphoma who showed advanced clinical stage, high LDH value, large mass and poor prognosis. The histological, immunophenotypic and chromosomal characteristics of the nude mouse lines were compared with those of the original lymphomas, and the proliferative characteristics of the lines were examined. The transplanted lymphomas substantially retained the characteristics of the original lymphomas, and could be useful in biological, oncological and therapeutic studies of human malignant lymphoma. Images Figure 1 Figure 2 Figure 3 PMID:2649134

  6. Pomegranate extract induces apoptosis in human prostate cancer cells by modulation of the IGF-IGFBP axis

    PubMed Central

    Koyama, Satomi; Cobb, Laura J; Mehta, Hemal H; Seeram, Navindra P.; Heber, David; Pantuck, Allan J.; Cohen, Pinchas

    2009-01-01

    The IGF axis is critical for the regulation of apoptosis in many human cancer cell lines. Recently, potent anti-tumorigenic effects of pomegranate juice and extracts have been reported. Consequently, pomegranate has potential not only as a treatment but also as a preventative measure against certain types of cancer, including prostate. In this study, we investigated the relationship between pomegranate-induced apoptosis in human prostate cancer cells and the IGF/IGFBP system. Treatment of LAPC4 prostate cancer cells with 10 μg/ml POMx, a highly potent pomegranate extract prepared from skin and arils minus seeds and standardized to ellagitannin content (37% punicalagins by HPLC), resulted in inhibition of cell proliferation and induction of apoptosis. Interestingly, co-treatment with POMx and IGFBP-3 revealed synergistic stimulation of apoptosis and additive inhibition of cell growth. Western blot analysis revealed that treatment with POMx or POMx/IGFBP-3 combination resulted in increased JNK phosphorylation, and decreased Akt and mTOR activation, consistent with a growth inhibitory, pro-apoptotic function. We also investigated the relationship between IGF-1 and pomegranate-induced apoptosis in 22RV1 prostate cancer cells. Co-treatment with 100 ng/ml IGF-1 completely blocked apoptosis induction by POMx. In contrast, IGF-I failed to inhibit POMx-induced apoptosis in R- cells, suggesting the importance of IGF-IR. POMx-treatment decreased Igf1 mRNA expression in a dose-dependent manner indicating that its actions also involve tumor-specific suppression of IGF-1. These studies revealed novel interactions between the IGF system and pomegranate-induced apoptosis. PMID:19853487

  7. Quantification of phase I / II metabolizing enzyme gene expression and polycyclic aromatic hydrocarbon-DNA adduct levels in human prostate

    PubMed Central

    John, Kaarthik; Ragavan, Narasimhan; Pratt, M. Margaret; Singh, Paras B.; Al-Buheissi, Salah; Matanhelia, Shyam S.; Phillips, David H.; Poirier, Miriam C.; Martin, Francis L.

    2008-01-01

    BACKGROUND Studies of migrant populations suggest that dietary and/or environmental factors play a crucial role in the aetiology of prostatic adenocarcinoma (CaP). The human prostate consists of the peripheral zone (PZ), transition zone (TZ) and central zone (CZ); CaP occurs most often in the PZ. METHODS To investigate the notion that an underlying differential expression of phase I/II genes, and/or the presence of polycyclic aromatic hydrocarbon (PAH)-DNA adducts might explain the elevated PZ susceptibility, we examined prostate tissues (matched tissue sets consisting of PZ and TZ) from men undergoing radical retropubic prostatectomy for CaP (n=26) or cystoprostatectomy (n=1). Quantitative gene expression analysis was employed for cytochrome P450 (CYP) isoforms CYP1A1, CYP1B1 and CYP1A2, as well as N-acetyltransferase 1 and 2 (NAT1 and NAT2) and catechol-O-methyl transferase (COMT). RESULTS CYP1B1, NAT1 and COMT were expressed in all tissue sets; levels of CYP1B1 and NAT1 were consistently higher in the PZ compared to TZ. Immunohistochemistry confirmed the presence of CYP1B1 (nuclear-associated and primarily in basal epithelial cells) and NAT1. Tissue sections from 23 of these aforementioned 27 matched tissue sets were analyzed for PAH-DNA adduct levels using antiserum elicited against DNA modified with r7, t8-dihydroxy-t-9,10-oxy-7,8,9,10-tetrahydro-benzo[a]pyrene (BPDE). PAH-DNA adduct levels were highest in glandular epithelial cells, but a comparison of PZ and TZ showed no significant differences. CONCLUSION Although expression of activating and/or detoxifying enzymes may be higher in the PZ, PAH-DNA adduct levels appear to be similar in both zones. Therefore, factors other than PAH-DNA adducts may be responsible for promotion of tumour formation in the human prostate. PMID:19143007

  8. Effect of lycopene isolated from Chlorella marina on proliferation and apoptosis in human prostate cancer cell line PC-3.

    PubMed

    Renju, G L; Muraleedhara Kurup, G; Bandugula, Venkata Reddy

    2014-11-01

    Even though the role of lycopene from tomato (trans form) in controlling prostate cancer was reported, lycopene (cis and trans 60:40) isolated from green algae Chlorella marina was not reported so far. The present study aimed to assess the anti-proliferative and apoptotic effect of lycopene from a new source and to compare the activity with available trans lycopene by using androgen-independent human prostate cancer cell lines. Exposure of PC-3 and DU-145 cell lines to algal lycopene (AL) at a dose of 20 and 50 μM significantly inhibited the growth and colony formation, and the percentage of inhibition was higher than tomatal lycopene (TL)-treated groups. The stability of AL in cell culture medium was high, when compared to TL under standard cell culture conditions. The level of lycopene was not detected in PC-3 cell lines cultured in medium lacking lycopene. Staining cells with acridine orange and ethidium bromide, the PC-3 control cells showed largely non-fragmented intact nucleoid. Stronger apoptosis signal was induced with higher concentrations (50 μM) of algal lycopene. Increased DNA damage was observed in AL- and TL-treated cells which appear as comet during single-cell gel electrophoresis. Flow cytometry results revealed that AL caused PC-3 cells to accumulate in the G0/G1 phase and to undergo apoptosis. The effect was higher in AL groups than TL-treated groups. Algal lycopene showed very significant anti-proliferative and apoptotic effect in human prostate cancer cell lines. Therefore, algal lycopene from C.marina would be recommended for the treatment of prostate cancer. PMID:25073513

  9. Genomic Copy Number Variations in the Genomes of Leukocytes Predict Prostate Cancer Clinical Outcomes

    PubMed Central

    Huo, Zhiguang; Martin, Amantha; Nelson, Joel B.; Tseng, George C.; Luo, Jian-Hua

    2015-01-01

    Accurate prediction of prostate cancer clinical courses remains elusive. In this study, we performed whole genome copy number analysis on leukocytes of 273 prostate cancer patients using Affymetrix SNP6.0 chip. Copy number variations (CNV) were found across all chromosomes of the human genome. An average of 152 CNV fragments per genome was identified in the leukocytes from prostate cancer patients. The size distributions of CNV in the genome of leukocytes were highly correlative with prostate cancer aggressiveness. A prostate cancer outcome prediction model was developed based on large size ratio of CNV from the leukocyte genomes. This prediction model generated an average prediction rate of 75.2%, with sensitivity of 77.3% and specificity of 69.0% for prostate cancer recurrence. When combined with Nomogram and the status of fusion transcripts, the average prediction rate was improved to 82.5% with sensitivity of 84.8% and specificity of 78.2%. In addition, the leukocyte prediction model was 62.6% accurate in predicting short prostate specific antigen doubling time. When combined with Gleason’s grade, Nomogram and the status of fusion transcripts, the prediction model generated a correct prediction rate of 77.5% with 73.7% sensitivity and 80.1% specificity. To our knowledge, this is the first study showing that CNVs in leukocyte genomes are predictive of clinical outcomes of a human malignancy. PMID:26295840

  10. Alpha 2 adrenergic receptors in hyperplastic human prostate: identification and characterization using (/sup 3/H) rauwolscine

    SciTech Connect

    Shapiro, E.; Lepor, H.

    1986-05-01

    (/sup 3/H)Rauwolscine ((/sup 3/H)Ra), a selective ligand for the alpha 2 adrenergic receptor, was used to identify and characterize alpha 2 adrenergic receptors in prostate glands of men with benign prostatic hyperplasia. Specific binding of (/sup 3/H)Ra to prostatic tissue homogenates was rapid and readily reversible by addition of excess unlabelled phentolamine. Scatchard analysis of saturation experiments demonstrates a single, saturable class of high affinity binding sites (Bmax = 0.31 +/- 0.04 fmol./microgram. DNA, Kd = 0.9 +/- 0.11 nM.). The relative potency of alpha adrenergic drugs (clonidine, alpha-methylnorepinephrine and prazosin) in competing for (/sup 3/H)Ra binding sites was consistent with the order predicted for an alpha 2 subtype. The role of alpha 2 adrenergic receptors in normal prostatic function and in men with bladder outlet obstruction secondary to BPH requires further investigation.

  11. Quinazoline-derived alpha1-adrenoceptor antagonists induce prostate cancer cell apoptosis via an alpha1-adrenoceptor-independent action.

    PubMed

    Benning, Cynthia M; Kyprianou, Natasha

    2002-01-15

    Recent evidence suggests that the quinazoline-based alpha1-adrenoceptor antagonists, doxazosin and terazosin, exhibit a potent apoptotic effect against prostate tumor epithelial cells, whereas tamsulosin, a sulfonamide-based alpha1-adrenoceptor antagonist, was ineffective in inducing a similar apoptotic effect against prostate cells (Cancer Res., 60: 4550-4555, 2000). In this study, to identify the precise molecular mechanism underlying this apoptosis induction, we examined whether doxazosin and terazosin (both piperazinyl quinazolines) affect prostate growth via an alpha1-adrenoceptor-independent action. Transfection-mediated overexpression of alpha1-adrenoceptor in human prostate cancer cells, DU-145 (that lack alpha1-adrenoceptor), did not alter the ability of prostate cancer cells to undergo apoptosis in response to quinazolines. Significantly enough, there was no modification of the apoptotic threshold of the androgen-sensitive prostate cancer cells, LNCaP, to either quinazoline-based alpha1-agonist by androgens. Furthermore, human normal prostate epithelial cells exhibited a very low sensitivity to the apoptotic effects of doxazosin compared with that observed for the malignant prostate cells. These findings provide the first evidence that the apoptotic activity of the quinazoline-based alpha1-adrenoceptor antagonists (doxazosin and terazosin) against prostate cancer cells is independent of: (a) their capacity to antagonize alpha1-adrenoceptors; and (b) the hormone sensitivity status of the cells. This may have potential therapeutic significance in the use of quinazoline-based alpha1-adrenoceptor antagonists (already in clinical use for the treatment of hypertension and benign prostate hyperplasia) for the treatment of androgen-independent human prostate cancer. PMID:11809715

  12. Fas-mediated apoptosis of melanoma cells and infiltrating lymphocytes in human malignant melanomas.

    PubMed

    Shukuwa, Tetsuo; Katayama, Ichiro; Koji, Takehiko

    2002-04-01

    In a rodent system, melanoma cells expressing Fas ligand (FasL) could kill Fas-positive lymphocytes, suggesting that FasL expression was an essential factor for melanoma cell survival in vivo. These findings led us to investigate apoptosis, and to histochemically analyze involvement of Fas and FasL in the induction of apoptosis, in human malignant melanoma tissues. The percentages of terminal deoxynucleotidyl transferase-mediated biotin-dUTP nick end-labeling (TUNEL)-positive melanoma cells and of proliferating cell nuclear antigen (PCNA)-positive melanoma cells in melanoma tissues (n = 22) were greater than those in melanocytes in uninvolved skin (n = 6) and nevus cells in nevi tissues (n = 9). The infiltrating lymphocytes around melanomas were also TUNEL positive. Immunohistochemistry revealed expression of Fas and FasL in melanoma cells and lymphocytes, whereas no Fas or FasL expression was detected in normal skin melanocytes and nevus cells. There was significant correlation between Fas-positive indices and TUNEL indices in melanoma tissues. Moreover, TUNEL-, Fas-, and FasL-positive indices of melanoma cells from patients with Stage 3 melanomas were significantly lower than those with Stage 2 melanomas. The PCNA index of Stage 1 melanoma was significantly lower than that of the other stages, although the difference of PCNA index was insignificant among Stages 2 to 4. Among Stages 1 to 4, there was no difference in the PCNA, TUNEL-, and Fas-positive indices of lymphocytes, although the FasL-positive index of lymphocytes from Stage 3 melanomas was significantly lower than in that from Stage 2. These data reveal that melanoma cells and infiltrating lymphocytes have the potential to induce their own apoptosis regulated by Fas and FasL in an autocrine and/or paracrine fashion and that the decline of Fas-mediated apoptosis of melanoma cells, rather than the apoptosis of infiltrating lymphocytes, may affect the prognosis of melanoma patients, possibly through the

  13. Lipid metabolism in prostate cancer

    PubMed Central

    Wu, Xinyu; Daniels, Garrett; Lee, Peng; Monaco, Marie E

    2014-01-01

    The malignant transformation of cells requires adaptations across multiple metabolic processes to satisfy the energy required for their increased rate of proliferation. Dysregulation of lipid metabolism has been a hallmark of the malignant phenotype; increased lipid accumulation secondary to changes in the levels of a variety of lipid metabolic enzymes has been documented in a variety of tumors, including prostate. Alterations in prostate lipid metabolism include upregulation of several lipogenic enzymes as well as of enzymes that function to oxidize fatty acids as an energy source. Cholesterol metabolism and phospholipid metabolism are also affected. With respect to lipogenesis, most studies have concentrated on increased expression and activity ofthe de novo fatty acid synthesis enzyme, fatty acid synthase (FASN), with suggestions that FASN might function as an oncogene. A central role for fatty acid oxidation in supplying energy to the prostate cancer cell is supported by the observation that the peroxisomal enzyme, α-methylacyl-CoA racemase (AMACR), which facilitates the transformation of branched chain fatty acids to a form suitable for β-oxidation, is highly overexpressed in prostate cancer compared with normal prostate. Exploitation of the alterations in lipid metabolic pathways in prostate cancer could result in the development of new therapeutic modalities as well as provide candidates for new prognostic and predictive biomarkers. AMACR has already proven to be a valuable biomarker in distinguishing normal from malignant prostate tissue, and is used routinely in clinical practice. PMID:25374912

  14. Comparative Analysis of Metastasis Variants Derived from Human Prostate Carcinoma Cells

    PubMed Central

    Conn, Erin M.; Botkjaer, Kenneth A.; Kupriyanova, Tatyana A.; Andreasen, Peter A.; Deryugina, Elena I.; Quigley, James P.

    2009-01-01

    To analyze the process of tumor cell intravasation, we used the human tumor-chick embryo spontaneous metastasis model to select in vivo high (PC-hi/diss) and low (PC-lo/diss) disseminating variants from the human PC-3 prostate carcinoma cell line. These variants dramatically differed in their intravasation and dissemination capacities in both chick embryo and mouse spontaneous metastasis models. Concomitant with enhanced intravasation, PC-hi/diss exhibited increased angiogenic potential in avian and murine models. PC-hi/diss angiogenesis and intravasation were dependent on increased secretion of vascular endothelial growth factor (VEGF), since treating developing tumors with a function-blocking anti-VEGF antibody simultaneously inhibited both processes without affecting primary tumor growth. PC-hi/diss cells were also more migratory and invasive, suggestive of heightened ability to escape from primary tumors due to matrix-degrading activity. Consistent with this suggestion, PC-hi/diss cells produced more of the serine protease urokinase-type plasminogen activator (uPA) as compared with PC-lo/diss. The functional role of uPA in PC-hi/diss dissemination was confirmed by inhibition of invasion, angiogenesis, and intravasation with specific function-blocking antibodies that prevented uPA activation and blocked uPA activity. These processes were similarly sensitive to aprotinin, a potent inhibitor of serine proteases, including uPA-generated plasmin. Thus, our comparison of the PC-3 intravasation variants points to key roles for the uPA-plasmin system in PC-hi/diss intravasation, possibly via (1) promoting tumor cell matrix invasion and (2) facilitating development of VEGF-dependent angiogenic blood vessels. PMID:19729488

  15. Expression of Beta-Defensin 131 Promotes an Innate Immune Response in Human Prostate Epithelial Cells

    PubMed Central

    Kim, Hae Jong; Lee, Jaehyouk; Myung, Soon Chul

    2015-01-01

    Previously, using the Illumina HumanHT-12 microarray we found that β-defensin 131 (DEFB131), an antimicrobial peptide, is upregulated in the human prostate epithelial cell line RWPE-1 upon stimulation with lipoteichoic acid (LTA; a gram-positive bacterial component), than that in the untreated RWPE-1 cells. In the current study, we aimed to investigate the role of DEFB131 in RWPE-1 cells during bacterial infection. We examined the intracellular signaling pathways and nuclear responses in RWPE-1 cells that contribute to DEFB131 gene induction upon stimulation with LTA. Chromatin immunoprecipitation was performed to determine whether NF-κB directly binds to the DEFB131 promoter after LTA stimulation in RWPE-1 cells. We found that DEFB131 expression was induced by LTA stimulation through TLR2 and p38MAPK/NF-κB activation, which was evident in the phosphorylation of both p38MAPK and IκBα. We also found that SB203580 and Bay11-7082, inhibitors of p38MAPK and NF-κB, respectively, suppressed LTA-induced DEFB131 expression. The chromatin immunoprecipitation assay showed that NF-κB directly binds to the DEFB131 promoter, suggesting that NF-κB is a direct regulator, and is necessary for LTA-induced DEFB131 expression in RWPE-1 cells. Interestingly, with DEFB131 overexpression in RWPE-1 cells, the accumulation of mRNA and protein secretion of cytokines (IL-1α, IL-1β, IL-6, and IL-12α) and chemokines (CCL20, CCL22, and CXCL8) were significantly enhanced. In addition, DEFB131-transfected RWPE-1 cells markedly induced chemotactic activity in THP-1 monocytes. We concluded that DEFB131 induces cytokine and chemokine upregulation through the TLR2/NF-κB signaling pathway in RWPE-1 cells during bacterial infection and promotes an innate immune response. PMID:26649771

  16. PROSTATE AND ENDOCRINE DISRUPTION

    EPA Science Inventory

    This project offers the very distinct advantages of human relevance and enhanced susceptibility in the evaluation of environmental impacts on prostate development. The goal of this pilot project is to build a platform to evaluate the developmental origins of later life prostat...

  17. Discovery and horizontal follow-up of an autoantibody signature in human prostate cancer.

    PubMed

    Mintz, Paul J; Rietz, Anna Cecilia; Cardó-Vila, Marina; Ozawa, Michael G; Dondossola, Eleonora; Do, Kim-Anh; Kim, Jeri; Troncoso, Patricia; Logothetis, Christopher J; Sidman, Richard L; Pasqualini, Renata; Arap, Wadih

    2015-02-24

    In response to an urgent need for improved diagnostic and predictive serum biomarkers for management of metastatic prostate cancer, we used phage display fingerprinting to analyze sequentially acquired serum samples from a patient with advancing prostate cancer. We identified a peptide ligand, CTFAGSSC, demonstrating an increased recovery frequency over time. Serum antibody reactivity to this peptide epitope increased in the index patient, in parallel with development of deteriorating symptoms. The antigen mimicking the peptide epitope was identified as alpha-2-Heremans-Schmid glycoprotein, also known as fetuin-A. Metastatic prostate cancer cell lines and bone metastasis samples displayed robust fetuin-A expression, and we demonstrated serum immune reactivity to fetuin-A with concomitant development of metastatic castrate-resistant disease in a large cohort of prostate cancer patients. Whereas fetuin-A is an established tumor antigen in several types of cancer, including breast cancer, glioblastoma, and pancreas cancer, this report is to our knowledge the first study implicating fetuin-A in prostate cancer and indicating that autoantibodies specific for fetuin-A show utility as a prognostic indicator for prostate cancer patients prone to progress to metastatic disease. PMID:25675522

  18. Pomegranate fruit juice for chemoprevention and chemotherapy of prostate cancer

    PubMed Central

    Malik, Arshi; Afaq, Farrukh; Sarfaraz, Sami; Adhami, Vaqar M.; Syed, Deeba N.; Mukhtar, Hasan

    2005-01-01

    Prostate cancer is the most common invasive malignancy and the second leading cause of cancer-related deaths among U.S. males, with a similar trend in many Western countries. One approach to control this malignancy is its prevention through the use of agents present in diet consumed by humans. Pomegranate from the tree Punica granatum possesses strong antioxidant and antiinflammatory properties. We recently showed that pomegranate fruit extract (PFE) possesses remarkable antitumor-promoting effects in mouse skin. In this study, employing human prostate cancer cells, we evaluated the antiproliferative and proapoptotic properties of PFE. PFE (10-100 μg/ml; 48 h) treatment of highly aggressive human prostate cancer PC3 cells resulted in a dose-dependent inhibition of cell growth/cell viability and induction of apoptosis. Immunoblot analysis revealed that PFE treatment of PC3 cells resulted in (i) induction of Bax and Bak (proapoptotic); (ii) down-regulation of Bcl-XL and Bcl-2 (antiapoptotic); (iii) induction of WAF1/p21 and KIP1/p27; (iv) a decrease in cyclins D1, D2, and E; and (v) a decrease in cyclin-dependent kinase (cdk) 2, cdk4, and cdk6 expression. These data establish the involvement of the cyclin kinase inhibitor-cyclin-cdk network during the antiproliferative effects of PFE. Oral administration of PFE (0.1% and 0.2%, wt/vol) to athymic nude mice implanted with androgen-sensitive CWR22Rν1 cells resulted in a significant inhibition in tumor growth concomitant with a significant decrease in serum prostate-specific antigen levels. We suggest that pomegranate juice may have cancer-chemopreventive as well as cancer-chemotherapeutic effects against prostate cancer in humans. PMID:16192356

  19. Elevated expression of calcium-binding protein p9Ka is associated with increasing malignant characteristics of rat prostate carcinoma cells.

    PubMed

    Ke, Y; Jing, C; Barraclough, R; Smith, P; Davies, M P; Foster, C S

    1997-05-29

    Northern and Western blotting techniques were used to study expression of the mRNA and corresponding protein product of the S100-related calcium-binding molecule p9Ka in 6 different metastatic cell lines of the Dunning R3327 rat prostate cancer model. In cells with the lowest metastatic capability (G cells), p9Ka mRNA was barely detectable. In 2 weakly metastatic cell lines (AT-1 and AT-2), p9Ka transcript amounts were, respectively, 6.29 +/- 0.74 and 5.55 +/- 1.11 times that detected in the G cells. In 3 highly metastatic cell lines (AT-3, MAT-LyLu and MAT-Lu), the amounts of p9Ka mRNA were, respectively, 12.85 +/- 2.82, 13.06 +/- 1.69 and 11.62 +/- 1.81 times that expressed in the G cells. Western blot analyses detected no p9Ka protein in the G cells. The amounts of p9Ka protein expressed by tumour cells of intermediate metastatic capability (AT-1 and AT-2) were 3.4 +/- 1.3 microg and 3.3 +/- 1.4 microg, respectively, per 1 x 10(6) cells. The amounts of p9Ka protein expressed by the tumour cells of highest metastatic capability (AT-3, MAT-LyLu and MAT-Lu) were 8.3 +/- 1.1 microg, 8.7 +/- 1.6 microg and 9.6 +/- 1.7 microg, respectively, per 1 x 10(6) cells. Our data reveal a direct association between the elevated expression of mRNA and the p9Ka protein amounts and the increased metastatic capability of individual prostatic cancer cell lines. We suggest that calcium-binding protein p9Ka may play an important role in the metastatic behaviour of rat prostate cancer. PMID:9180153

  20. TLR9-mediated siRNA delivery for targeting of normal and malignant human hematopoietic cells in vivo.

    PubMed

    Zhang, Qifang; Hossain, Dewan Md Sakib; Nechaev, Sergey; Kozlowska, Anna; Zhang, Wang; Liu, Yong; Kowolik, Claudia M; Swiderski, Piotr; Rossi, John J; Forman, Stephen; Pal, Sumanta; Bhatia, Ravi; Raubitschek, Andrew; Yu, Hua; Kortylewski, Marcin

    2013-02-21

    STAT3 operates in both cancer cells and tumor-associated immune cells to promote cancer progression. As a transcription factor, it is a highly desirable but difficult target for pharmacologic inhibition. We have recently shown that the TLR9 agonists CpG oligonucleotides can be used for targeted siRNA delivery to mouse immune cells. In the present study, we demonstrate that a similar strategy allows for targeted gene silencing in both normal and malignant human TLR9(+) hematopoietic cells in vivo. We have developed new human cell-specific CpG(A)-STAT3 siRNA conjugates capable of inducing TLR9-dependent gene silencing and activation of primary immune cells such as myeloid dendritic cells, plasmacytoid dendritic cells, and B cells in vitro. TLR9 is also expressed by several human hematologic malignancies, including B-cell lymphoma, multiple myeloma, and acute myeloid leukemia. We further demonstrate that oncogenic proteins such as STAT3 or BCL-X(L) are effectively knocked down by specific CpG(A)-siRNAs in TLR9(+) hematologic tumor cells in vivo. Targeting survival signaling using CpG(A)-siRNAs inhibits the growth of several xenotransplanted multiple myeloma and acute myeloid leukemia tumors. CpG(A)-STAT3 siRNA is immunostimulatory and nontoxic for normal human leukocytes in vitro. The results of the present study show the potential of using tumoricidal/immunostimulatory CpG-siRNA oligonucleotides as a novel 2-pronged therapeutic strategy for hematologic malignancies. PMID:23287859

  1. PTHrP promotes malignancy of human oral cancer cell downstream of the EGFR signaling

    SciTech Connect

    Yamada, Tamaki; Tsuda, Masumi; Ohba, Yusuke Kawaguchi, Hideaki; Totsuka, Yasunori; Shindoh, Masanobu

    2008-04-11

    Parathyroid hormone-related protein (PTHrP) is detected in many aggressive tumors and involved in malignant conversion; however, the underlying mechanism remains obscure. Here, we identified PTHrP as a mediator of epidermal growth factor receptor (EGFR) signaling to promote the malignancies of oral cancers. PTHrP mRNA was abundantly expressed in most of the quiescent oral cancer cells, and was significantly upregulated by EGF stimulation via ERK and p38 MAPK. PTHrP silencing by RNA interference, as well as EGFR inhibitor AG1478 treatment, significantly suppressed cell proliferation, migration, and invasiveness. Furthermore, combined treatment of AG1478 and PTHrP knockdown achieved synergistic inhibition of malignant phenotypes. Recombinant PTHrP substantially promoted cell motility, and rescued the inhibition by PTHrP knockdown, suggesting the paracrine/autocrine function of PTHrP. These data indicate that PTHrP contributes to the malignancy of oral cancers downstream of EGFR signaling, and may thus provide a therapeutic target for oral cancer.

  2. MK591, a second generation leukotriene biosynthesis inhibitor, prevents invasion and induces apoptosis in the bone-invading C4-2B human prostate cancer cells: implications for the treatment of castration-resistant, bone-metastatic prostate cancer.

    PubMed

    Sarveswaran, Sivalokanathan; Ghosh, Ritisha; Morisetty, Shravan; Ghosh, Jagadananda

    2015-01-01

    Castration-resistant prostate cancer (CRPC) is a major clinical challenge for which no cure is currently available primarily because of the lack of proper understanding about appropriate molecular target(s). Previously we observed that inhibition of 5-lipoxygenase (5-Lox) activity induces apoptosis in some types of prostate cancer cells, suggesting an important role of 5-Lox in the viability of prostate cancer cells. However, nothing is known about the role of 5-Lox in the survival of castration-resistant, metastatic prostate cancer cells. Thus, we tested the effects of MK591, a second-generation, specific inhibitor of 5-Lox activity, on the viability and metastatic characteristics of CRPC cells. We observed that MK591 effectively kills the bone-invading C4-2B human prostate cancer cells (which bear characteristics of CRPC), but does not affect normal, non-cancer fibroblasts (which do not express 5-Lox) in the same experimental conditions. We also observed that MK591 dramatically inhibits the in vitro invasion and soft-agar colony formation of C4-2B cells. Interestingly, we found that treatment with MK591 dramatically down-regulates the expression of c-Myc and its targets at sub-lethal doses. In light of frequent over-activation of c-Myc in a spectrum of aggressive cancers (including CRPC), and the challenges associated with inhibition of c-Myc (because of its non-enzymatic nature), our novel findings of selective killing, and blockade of invasive and soft-agar colony-forming abilities of the castration-resistant, bone-metastatic C4-2B prostate cancer cells by MK591, open up a new avenue to attack CRPC cells for better management of advanced prostate cancer while sparing normal, non-cancer body cells. PMID:25875826

  3. Networks of intergenic long-range enhancers and snpRNAs drive castration-resistant phenotype of prostate cancer and contribute to pathogenesis of multiple common human disorders

    PubMed Central

    Glinskii, Anna B; Ma, Shuang; Ma, Jun; Grant, Denise; Lim, Chang-Uk; Guest, Ian; Sell, Stewart; Buttyan, Ralph

    2011-01-01

    The mechanistic relevance of intergenic disease-associated genetic loci (IDAGL) containing highly statistically significant disease-linked SNPs remains unknown. Here, we present experimental and clinical evidence supporting the importantance of the role of IDAGL in human diseases. A targeted RT-PCR screen coupled with sequencing of purified PCR products detects widespread transcription at multiple IDAGL and identifies 96 small noncoding trans-regulatory RNAs of ∼100–300 nt in length containing SNPs (snpRNAs) associated with 21 common disorders. Multiple independent lines of experimental evidence support functionality of snpRNAs by documenting their cell type-specific expression and evolutionary conservation of sequences, genomic coordinates and biological effects. Chromatin state signatures, expression profiling experiments and luciferase reporter assays demonstrate that many IDAGL are Polycomb-regulated long-range enhancers. Expression of snpRNAs in human and mouse cells markedly affects cellular behavior and induces allele-specific clinically relevant phenotypic changes: NLRP1-locus snpRNAs rs2670660 exert regulatory effects on monocyte/macrophage transdifferentiation, induce prostate cancer (PC) susceptibility snpRNAs and transform low-malignancy hormone-dependent human PC cells into highly malignant androgen-independent PC. Q-PCR analysis and luciferase reporter assays demonstrate that snpRNA sequences represent allele-specific “decoy” targets of microRNAs that function as SNP allele-specific modifiers of microRNA expression and activity. We demonstrate that trans-acting RNA molecules facilitating resistance to androgen depletion (RAD) in vitro and castration-resistant phenotype (CRP) in vivo of PC contain intergenic 8q24-locus SNP variants (rs1447295; rs16901979; rs6983267) that were recently linked with increased risk of PC. Q-PCR analysis of clinical samples reveals markedly increased and highly concordant (r = 0.896; p < 0.0001) snpRNA expression

  4. Epidermal growth factor receptor-dependent stimulation of amphiregulin expression in androgen-stimulated human prostate cancer cells.

    PubMed Central

    Sehgal, I; Bailey, J; Hitzemann, K; Pittelkow, M R; Maihle, N J

    1994-01-01

    Amphiregulin is a heparin-binding epidermal growth factor (EGF)-related peptide that binds to the EGF receptor (EGF-R) with high affinity. In this study, we report a role for amphiregulin in androgen-stimulated regulation of prostate cancer cell growth. Androgen is known to enhance EGF-R expression in the androgen-sensitive LNCaP human prostate carcinoma cell line, and it has been suggested that androgenic stimuli may regulate proliferation, in part, through autocrine mechanisms involving the EGF-R. In this study, we demonstrate that LNCaP cells express amphiregulin mRNA and peptide and that this expression is elevated by androgenic stimulation. We also show that ligand-dependent EGF-R stimulation induces amphiregulin expression and that androgenic effects on amphiregulin synthesis are mediated through this EGF-R pathway. Parallel studies using the estrogen-responsive breast carcinoma cell line, MCF-7, suggest that regulation of amphiregulin by estrogen may also be mediated via an EGF-R pathway. In addition, heparin treatment of LNCaP cells inhibits androgen-stimulated cell growth further suggesting that amphiregulin can mediate androgen-stimulated LNCaP proliferation. Together, these results implicate an androgen-regulated autocrine loop composed of amphiregulin and its receptor in prostate cancer cell growth and suggest that the mechanism of steroid hormone regulation of amphiregulin synthesis may occur through androgen upregulation of the EGF-R and subsequent receptor-dependent pathways. Images PMID:8049525

  5. Skip Regulates TGF- β 1-Induced Extracellular Matrix Degrading Proteases Expression in Human PC-3 Prostate Cancer Cells.

    PubMed

    Villar, Victor; Kocic, Jelena; Santibanez, Juan F

    2013-01-01

    Purpose. To determine whether Ski-interacting protein (SKIP) regulates TGF- β 1-stimulated expression of urokinase-type plasminogen activator (uPA), matrix metalloproteinase-9 (MMP-9), and uPA Inhibitor (PAI-1) in the androgen-independent human prostate cancer cell model. Materials and Methods. PC-3 prostate cancer cell line was used. The role of SKIP was evaluated using synthetic small interference RNA (siRNA) compounds. The expression of uPA, MMP-9, and PAI-1 was evaluated by zymography assays, RT-PCR, and promoter transactivation analysis. Results. In PC-3 cells TGF- β 1 treatment stimulated uPA, PAI-1, and MMP-9 expressions. The knockdown of SKIP in PC-3 cells enhanced the basal level of uPA, and TGF- β 1 treatment inhibited uPA production. Both PAI-1 and MMP-9 production levels were increased in response to TGF- β 1. The ectopic expression of SKIP inhibited both TGF- β 1-induced uPA and MMP-9 promoter transactivation, while PAI-1 promoter response to the factor was unaffected. Conclusions. SKIP regulates the expression of uPA, PAI-1, and MMP-9 stimulated by TGF- β 1 in PC-3 cells. Thus, SKIP is implicated in the regulation of extracellular matrix degradation and can therefore be suggested as a novel therapeutic target in prostate cancer treatment. PMID:23766912

  6. Intratumor Cellular Heterogeneity and Alterations in ras Oncogene and p53 Tumor Suppressor Gene in Human Prostate Carcinoma

    PubMed Central

    Konishi, Noboru; Hiasa, Yoshio; Matsuda, Hirofumi; Tao, Ming; Tsuzuki, Toshihide; Hayashi, Isao; Kitahori, Yoshiteru; Shiraishi, Taizo; Yatani, Ryuichi; Shimazaki, Jun; Lin, Jung-Chung

    1995-01-01

    To assess the potential role of ras oncogene activation and P53 tumor suppressor gene mutations in the development of human prostate carcinoma, nine cases of histologically heterogeneous prostate tumors obtained from total prostatectomies were probed for these specific events. Each tumor was divided into 5 to 10 areas according to different growth or histological patterns. Targeted DNA sequences coding for ras and p53 were amplified by the polymerase chain reaction, analyzed by single-strand conformational polymorphisms, and confirmed by direct DNA sequencing. Point mutations of the ras gene were found in three of the nine tumors. Two contained K-ras codon 13 and H-ras codon 61 mutations, found in only one and three areas of each lesion, respectively. The third tumor contained two different point mutations in K-ras codons 13 and 61 in different foci of the sample. Loss of heterozygosity at the polymorphic codon 72 in the p53 gene was detected in two of four informative cases (50%) showing fragment cleavage by restriction fragment length polymorphism analysis. Mutations in p53, missense transversions, single base insertions, and two base deletions were also detected in three tumors. The present results reveal mutated ras and p53 occasionally occurring in small foci of the tumor and that genetic mutations in p53, as opposed to those in ras, are more closely associated with invasive growth of heterogeneous prostate carcinoma. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5 PMID:7573356

  7. Colocalisation of CD9 and mortalin in CD9-induced mitotic catastrophe in human prostate cancer cells

    PubMed Central

    Zvereff, V; Wang, J-C; Shun, K; Lacoste, J; Chevrette, M

    2007-01-01

    CD9, a member of the tetraspanin family of proteins, is involved in a variety of cellular interactions with many other proteins and molecules. Although CD9 has been implicated in cell fusion, migration and cancer progression, the detailed function of this protein is not completely understood and likely depends on interactions with different protein partners, which are not yet all known. Using co-immunoprecipitation and mass-spectrometric protein sequencing, we have identified in prostate cancer cells, a novel CD9 partner, the 75-kDa protein HSPA9B, also known as mortalin. We further show that introduction and overexpression of wild-type CD9 into human PC-3 prostate cancer cells induces mitotic catastrophe. We also demonstrate, by immunocolocalisation studies, the interaction of CD9 and mortalin in PC-3 cells undergoing mitotic catastrophe. Our results not only identified mortalin as a new CD9 partner, but also clarify the mechanisms by which CD9 may control prostate cancer progression. PMID:17848953

  8. ILs-3, 6 and 11 increase, but ILs-10 and 24 decrease stemness of human prostate cancer cells in vitro

    PubMed Central

    Yu, Dandan; Zhong, Yali; Li, Xiaoran; Li, Yaqing; Li, Xiaoli; Cao, Jing; Fan, Huijie; Yuan, Yuan; Ji, Zhenyu; Qiao, Baoping; Wen, Jian-Guo; Zhang, Mingzhi; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

    2015-01-01

    Cancer stem cells (CSCs) are associated with cancer recurrence and metastasis. Prostate cancer cells often metastasize to the bone with a complex microenvironment of cytokines favoring cell survival. In this study, the cell stemness influence of a group of interleukins including IL-3, 6, 10, 11 and 24 on human prostate cancer cell lines LNCaP and PC-3 was explored in vitro. Sulforhodamine B(SRB) and 5-ethynyl-2′-deoxyuridine (EdU) assays were applied to examine the effect on cell proliferation, and wound healing and transwell assays were used for migration and invasion studies, in addition to colony formation, Western blotting and flowcytometry for the expression of stemness factors and chemotherapy sensitivity. We observed that ILs-3, 6 and 11 stimulated while ILs-10 and 24 inhibited the growth, invasion and migration of both cell lines. Interestingly, ILs-3, 6 and 11 significantly promoted colony formation and increased the expression of SOX2, CD44 and ABCG2 in both prostate cancer cell lines. However, ILs-10 and 24 showed the opposite effect on the expression of these factors. In line with the above findings, treatment with either IL-3 or IL-6 or IL-11 decreased the chemosensitivity to docetaxel while treatment with either IL-10 or IL-24 increased the sensitivity of docetaxel chemotherapy. In conclusion, our results suggest that ILs-3, 6 and 11 function as tumor promoters while ILs-10 and 24 function as tumor suppressors in the prostate cancer cell lines PC-3 and LNCaP in vitro, and such differences may attribute to their different effect on the stemness of PCa cells. PMID:26528857

  9. Evaluation of vesicular stomatitis virus mutant as an oncolytic agent against prostate cancer

    PubMed Central

    Zhao, Xin; Huang, Shengsong; Luo, Huarong; Wan, Xiaodong; Gui, Yaping; Li, Junliang; Wu, Denglong

    2014-01-01

    Background: To date, limited options are available to treat malignant prostate cancer, and novel strategies need to be developed. Oncolytic viruses (OV) that have preferential replication capabilities in cancer cells rather than normal cells represent one promising alternative for treating malignant tumors. Vesicular stomatitis virus (VSV) is a non-segmented, negative-strand RNA virus with the inherent capability to selectively kill tumor cells. The aim of this study was to evaluate the potential of VSV-ΔM51-GFP as an effective therapeutic agent for treating prostate tumors. Methods: For in vitro experiments, DU145 and PC3 cell lines were treated with VSV-ΔM51-GFP. Viral titers were quantified using plaque assays. Cytotoxicity was performed by MTT analysis. IFN-β production was measured using a Human IFN-β detection ELISA Kit. The detection of apoptosis was performed via Annexin-V-FITC staining method and analyzed with flow cytometry. The in vivo antitumor efficacy of VSV-ΔM51-GFP in a xenograft mice prostate tumor model. Results: It was observed that VSV-ΔM51-GFP can efficiently replicate and lyse human prostate cancer cells and that this virus has reduced toxicity against normal human prostate epithelial cells in vitro. VSV-ΔM51-GFP in the induction of apoptosis in DU145 cells and PC3 cells. Furthermore, in a xenograft tumor animal model, nude mice bearing replication-competent VSV-ΔM51-GFP were able to eradicate malignant cells while leaving normal tissue relatively unaffected. The survival of the tumor-burdened animals treated with VSV-ΔM51-GFP may also be significantly prolonged compared to mock-infected animals. Conclusions: VSV-ΔM51-GFP showed promising oncolytic activity for treating prostate cancer. PMID:24995075

  10. Prostate cancer

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/000380.htm Prostate cancer To use the sharing features on this page, please enable JavaScript. Prostate cancer is cancer that starts in the prostate gland. ...

  11. Prostate brachytherapy

    MedlinePlus

    Implant therapy - prostate cancer; Radioactive seed placement; Internal radiation therapy - prostate; High dose radiation (HDR) ... CT scan to plan and then place the seeds that deliver radiation into your prostate. The seeds ...

  12. Prostatitis - bacterial

    MedlinePlus

    ... or tender scrotum The provider may perform a digital rectal exam to examine your prostate. During this ... samples may be collected for urinalysis and urine culture . Prostatitis may affect the results of the prostate- ...

  13. Enlarged prostate

    MedlinePlus

    ... doctor if you should still take it. SURGERY Prostate surgery may be recommended if you have: Incontinence Recurrent ... of your prostate gland. Most men who have prostate surgery have improvement in urine flow rates and symptoms. ...

  14. The Prostate

    MedlinePlus

    ... Renal Cell) Cancer Leukemia Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer All ... Publications Reports What You Need To Know About™ Prostate Cancer This booklet is about prostate cancer. Learning about ...

  15. Enlarged prostate

    MedlinePlus

    BPH; Benign prostatic hyperplasia (hypertrophy); Prostate - enlarged ... The actual cause of prostate enlargement is unknown. Factors linked to aging and changes in the cells of the testicles may have a role in the growth ...

  16. PME-1 protects ERK pathway activity from protein phosphatase 2A-mediated inactivation in human malignant glioma

    PubMed Central

    Puustinen, Pietri; Junttila, Melissa R.; Vanhatupa, Sari; Sablina, Anna A.; Hector, Melissa E.; Teittinen, Kaisa; Raheem, Olayinka; Ketola, Kirsi; Lin, Shujun; Kast, Juergen; Haapasalo, Hannu; Hahn, William C.; Westermarck, Jukka

    2010-01-01

    ERK/MAPK pathway activity is regulated by the antagonist function of activating kinases and inactivating protein phosphatases. Sustained ERK pathway activity is commonly observed in human malignancies, however the mechanisms by which the pathway is protected from phosphatase-mediated inactivation in the tumor tissue remain obscure. Here we show that methylesterase PME-1-mediated inhibition of the protein phosphatase 2A (PP2A) promotes basal ERK pathway activity, and is required for efficient growth factor response. Mechanistically PME-1 is shown to support ERK pathway signaling upstream of Raf, but downstream of growth factor receptors and PKC. In malignant glioblastoma, PME-1 expression levels correlate with both ERK activity and cell proliferation in vivo. Moreover, PME-1 expression significantly correlates with disease progression in human astrocytic gliomas (N=222). Together, these observations identify PME-1 expression as one mechanism by which ERK pathway activity is maintained in cancer cells, and suggest important functional role for PME-1 in the disease progression of human astrocytic gliomas. PMID:19293187

  17. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma.

    PubMed

    Xu, Song; Yi, Xiao-Ming; Tang, Chao-Peng; Ge, Jing-Ping; Zhang, Zheng-Yu; Zhou, Wen-Quan

    2016-07-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  18. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma

    PubMed Central

    XU, SONG; YI, XIAO-MING; TANG, CHAO-PENG; GE, JING-PING; ZHANG, ZHENG-YU; ZHOU, WEN-QUAN

    2016-01-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  19. VHF-induced thermoacoustic imaging of fresh human prostates using a clinical ultrasound transducer array

    NASA Astrophysics Data System (ADS)

    Patch, S. K.; See, W. A