Sample records for mhz srf cavity

  1. The first operation of 56 MHz SRF cavity in RHIC

    SciTech Connect

    Wu, Q.; Belomestnykh, S.; Ben-Zvi, I.; Blaskiewicz, M.; DeSanto, L.; Goldberg, D.; Harvey, M.; Hayes, T.; McIntyre, G.; Mernick, K.; Orfin, P.; Seberg, S.; Severino, F.; Smith, K.; Than, R.; Zaltsman, A.


    A 56 MHz superconducting RF cavity has been designed, fabricated and installed in the Relativistic Heavy Ion Collider (RHIC). The cavity operates at 4.4 K with a “quiet helium source” to isolate the cavity from environmental acoustic noise. The cavity is a beam driven quarter wave resonator. It is detuned and damped during injection and acceleration cycles and is brought to operation only at store energy. For a first test operation, the cavity voltage was stabilized at 300 kV with full beam current. Within both Au + Au and asymmetrical Au + He3 collisions, luminosity improvement was detected from direct measurement, and the hourglass effect was reduced. One higher order mode (HOM) coupler was installed on the cavity. We report in this paper on our measurement of a broadband HOM spectrum excited by the Au beam.

  2. R&D ERL: 5 Cell 704 MHz SRF Cavity

    SciTech Connect

    Burrill, A.


    One of the key components for the superconducting RF Energy Recovery Linac, (ERL) under development in the Collider Accelerator Department at Brookhaven National Laboratory, is the Linac cavity and cryomodule. The cavity is a 5 cell accelerating cavity designed to operate at 703.75 MHz, and to accelerate 2 MeV electrons from the photoinjector up to 15-20 MeV, allow them to make a single pass around the ERL loop and then decelerate them back down to 2 MeV prior to sending them to the beam dump. This cavity was designed by Rama Calaga and Ilan Ben-Zvi at BNL and fabricated by Advanced Energy Systems in Medford, NY. The cavity was then delivered to Thomas Jefferson Laboratory in VA for chemical processing, testing and assembly of the hermetic string assembly suitable for shipment back to BNL. Once at BNL it was built into a complete cryomodule, installed in the ERL test facility and commissioned. This paper will review the key components of the cavity and cryomodule and discuss the present status of the cryomodule commissioning. The BNL 5 cell accelerating cavity has been designed for use in our high average current Energy Recovery Linac, a proof of principle machine to demonstrate key components necessary for the future upgrades to RHIC as well as applications for future ampere class high current, high brightness ERL programs. The cavity has been tested at greater than 20 MV/m with a Q{sub 0} of 1e{sup 10}, meeting the design specifications for use at full energy in the ERL. This paper will review the cavity design and specifications as well as the RF measurements that have been made both in the VTA at Jefferson Lab as well as during the commissioning in the ERL test cave at BNL. Finally the future plan for cavity testing and measurements prior to its use in ERL operations will be reviewed. The general physics parameters for the cavity can be found in table 1, and the reader is referred to Rama Calaga's Thesis for a much more detailed review of the cavity geometry

  3. 3D simulations of multipacting in the 56 MHz SRF cavity

    SciTech Connect

    Wu Q.; Belomestnykh, S.; Ge, L.; Ko, K.; Li, Z.; Ng, C.; Xiao, L.


    The 56 MHz SRF Quarter-Wave Resonator (QWR) is designed for RHIC as a storage cavity to improve the collider performance. 2D multipacting simulation has been done for the cavity alone. Ripples were added to the outer body of the cavity for multipacting suppression based on the simulation findings. During operation, there will be four higher order mode (HOM) couplers. All of these components will be exposed to high RF fields. In this paper we compare 2D and 3D codes simulation results for multipacting in the cavity. We also report 3D simulation results for multipacting simulation at the couplers.

  4. Higher Order Mode Damper Study of the 56 MHz SRF Cavity

    SciTech Connect

    Choi,E.; Hahn, H.


    This report summarizes the study on the higher order mode (HOM) damper for the 56 MHz SRF cavity. The Q factors and frequencies of the HOMs with the HOM damper are measured and compared to the simulation. The high pass filter prototype for rejecting the fundamental mode is designed and tested. The filter measurement is also compared to the simulation. Based on the measurement, a new location of the HOM damper is chosen.

  5. Buffer Chemical Polishing and RF Testing of the 56 MHz SRF Cavity

    SciTech Connect



    The 56 MHz cavity presents a unique challenge in preparing it for RF testing prior to construction of the cryomodule. This challenge arises due to the physical dimensions and subsequent weight of the cavity, and is further complicated by the coaxial geometry, and the need to properly chemically etch and high pressure rinse the entire inner surface prior to RF testing. To the best of my knowledge, this is the largest all niobium SRF cavity to be chemically etched and subsequently tested in a vertical dewar at 4K, and these processes will be the topic of this technical note.

  6. The fundamental power coupler and pick-up of the 56 MHz SRF cavity for RHIC

    SciTech Connect

    Wu, Q.; Bellavia, S.; Ben-Zvi, I.; Pai, C.


    A fundamental power coupler (FPC) is designed to provide fast tuning the 56MHz SRF cavity in RHIC. The FPC will be inserted from one of the chemical cleaning ports at the rear end of the cavity with magnetic coupling to the RF field. The size and the location of the FPC are decided based on the required operational external Q of the cavity. The cavity is beam driven, and the FPC is designed with variable coupling that would cover a range of power levels. It is thermally isolated from the base temperature of the cavity, which is 4.2K. A 1kW power amplifier will be used to close an amplitude control feedback loop. In this paper, we discuss the coupling factor of the FPC with the chosen design.

  7. Fundamental damper power calculation of the 56MHz SRF cavity for RHIC

    SciTech Connect

    Wu, Q.; Bellavia, S.; Ben-Zvi, I.; Grau, M.; Miglionico, G.; Pai, C.


    At each injection period during RHIC's operation, the beam's frequency sweeps across a wide range, and some of its harmonics will cross the frequency of the 56MHz SRF cavity. To avoid excitation of the cavity at these times, we designed a fundamental damper for the quarter-wave resonator to damp the cavity heavily. The power extracted by the fundamental damper should correspond to the power handling ability of the system at all stages. In this paper, we discuss the power output from the fundamental damper when it is fully extracted, inserted, and any intermediate point. A Fundamental Damper (FD) will greatly reduce the cavity's Q factor to {approx}300 during the acceleration phase of the beam. However, when the beam is at store and the FD is removed, the cavity is excited by both the yellow and the blue beams at 2 x 0.3A to attain the required 2MV voltage across its gap. The cavity then is operated to increase the luminosity of the RHIC experiments. Table 1 lists the parameters of the FD. Figure 1 shows the configuration of the FD fully inserted into the 56MHz SRF cavity; this complete insertion is defined as the start location (0cm) of FD simulation, an assumption we make throughout this paper. The power consumed by the cavity while maintaining the beam's energy and its orbit is compensated by the 28MHz accelerating cavities in the storage ring. The power dissipation of the external load is dynamic with respect to the position of the FD during its extraction. As a function of the external Q and the EM field in the cavity, the power should peak with the FD at a certain vertical location. Our calculation of the power extracted is detailed in the following sections. Figure 2 plots the frequency change in the cavity, and the external Q against the changes in position of the FD. The location of the FD is selected carefully such that the frequency will approach the designed working point from the lower side only. The loaded Q of the cavity is 223 when the FD is fully

  8. IBS and expected luminosity performance for RHIC beams at top energy with 56 MHz SRF cavity

    SciTech Connect



    The purpose of RF system in RHIC is to capture injected bunches, accelerate them to the top energy, and store bunches at the top energy for many hours. The accelerating RF system operates at harmonic number h=360 of the particle revolution frequency f=78.196 kHz, which corresponds to 28.15MHz. The storage RF system accepts the shortened bunches at top energy and provides longitudinal focusing to keep these bunches short during the store time (collision mode). The storage system operates at harmonic number h=7x360=2520, which corresponds to an RF frequency of 197.05 MHz [1]. Recently, an upgrade of storage RF system with a superconducting 56 MHz cavity was proposed [2]. This upgrade will provide significant increase in the acceptance of storage RF bucket. Presently, the short bunch length for collisions is obtained via RF gymnastics with bunch rotation (called re-bucketing), because the length of 197MHz bucket of 5 nsec is too short to accommodate long bunches otherwise. However, due to bucket non-linearity and hardware complications some increase in the longitudinal emittance occurs during re-bucketing. The 56MHz cavity will produce sufficiently short bunches which would allow one to operate without re-bucketing procedure. This Note summarizes simulation of beam evolution due to Intra-beam scattering (IBS) for beam parameters expected with the 56 MHz SRF cavity upgrade. Expected luminosity improvement is shown both for Au ions at 100 GeV/nucleon and for protons at 250 GeV.

  9. Design, Fabrication and Testing of Medium-Beta 650 MHz SRF Cavity Prototypes for Project-X

    SciTech Connect

    F. Marhauser, W.A. Clemens, J. Henry, P. Kneisel, R. Martin, R.A. Rimmer, G. Slack, L. Turlington, R.S. Williams


    A new type of superconducting radio frequency (SRF) cavity shape with a shallow equator dome to reduce electron impact energies for suppressing multipacting barriers has been proposed. The shape is in consideration for the first time in the framework of Project-X to design a potential multi-cell cavity candidate for the medium-beta section of the SRF proton CW linac operating at 650 MHz. Rationales covering the design of the multi-cell cavity, the manufacture, post-processing and high power testing of two single-cell prototypes are presented.

  10. An update on the study of high-gradient elliptical SRF cavities at 805 MHz for proton and other applications

    SciTech Connect

    Tajima, Tsuyoshi; Haynes, Brian; Krawczyk, Frank; Madrid, Mike; Roybal, Ray; Simakov, Evgenya; Clemens, Bob; Macha, Jurt; Manus, Bob; Rimmer, Bob; Rimmer, Bob; Turlington, Larry


    An update on the study of 805 MHz elliptical SRF cavities that have been optimized for high gradient will be presented. An optimized cell shape, which is still appropriate for easy high pressure water rinsing, has been designed with the ratios of peak magnetic and electric fields to accelerating gradient being 3.75 mT/(MV/m) and 1.82, respectively. A total of 3 single-cell cavities have been fabricated. Two of the 3 cavities have been tested so far. The second cavity achieved an E{sub acc} of {approx}50 MV/m at Q{sub 0} of 1.4 x 10{sup 10}. This result demonstrates that 805 MHz cavities can, in principle, achieve as high as, or could even be better than, 1.3 GHz high-gradient cavities.

  11. Higher Order Model Power Calculation of the 56 MHz SRF Cavity

    SciTech Connect



    In this report, the HOM power dissipated to the load in the 56 MHz RF cavity is calculated. The HOM frequencies and Q factors with the inserted HOM damper are obtained from the simulations by MWS and SLAC codes.

  12. Summary on the Fundamental Mode Damper Experiments of the 56 MHz SRF Cavity

    SciTech Connect

    Choi,E.; Hahn, H.


    This report summarizes the experimental results done with the fundamental damper for the 56 MHz prototype Cu cavity. Various measurements were done on the cavity including determination of the position of the fundamental damper and measurement of the frequency and Q factor changes while the damper is withdrawn. Prediction on the dissipated power while the damper is withdrawn was made by experiments.

  13. Cryogenic sub-system for the 56 MHz SRF storage cavity for RHIC

    SciTech Connect

    Huang, Y.; Than, R.; Orfin, P.; Lederle, D.; Tallerico, T.; Masi L.; Talty, P.; Zhang, Y.


    A 56 MHz Superconducting RF Storage Cavity is being constructed for the RHIC collider. This cavity is a quarter wave resonator that will be operated in a liquid helium bath at 4.4 K. The cavity requires an extremely quiet environment to maintain its operating frequency. The cavity, besides being engineered for a mechanically quiet system, also requires a quiet cryogenic system. The helium is taken from RHIC's main helium supply header at 3.5 atm, 5.3K at a phase separator tank. The boil-off is sent back to the RHIC refrigeration system to recover the cooling. To acoustically separate the RHIC helium supply and return lines, a condenser/boiler heat exchanger condenses the helium vapor generated in the RF cavity bath. A system description and operating parameters are given about the cryogen delivery system. The 56 MHz superconducting storage RF cavity project is making progress. The cryogenic system design is in its final stage. The helium supply lines have been tapped into the RHIC helium distribution lines. The plate-and-fin heat exchanger design is near completion and specification will be sent out for bid soon. The cold helium vapor heating system design will start soon as well. A booster compressor specification is underway. The first phase separator and transfer line design work is near completion and will be sent out for bid soon.

  14. 1500 MHZ Passive SRF Cavity for Bunch Lengthening in the NSLS-II Storage Ring

    SciTech Connect

    Yanagisawa,T.; Rose, J.; Grimm, T.; Bogle, A.


    NSLS-II is a new ultra-bright 3 GeV 3rd generation synchrotron radiation light source. The performance goals require operation with a beam current of 500mA and a bunch current of at least 0.5mA. Ion clearing gaps are required to suppress ion effects on the beam. The natural bunch length of 3mm is planned to be lengthened by means of a third harmonic cavity in order to increase the Touschek limited lifetime. After an extensive investigation of different cavity geometries, a passive, superconducting two-cell cavity has been selected for prototyping. The cavity is HOM damped with ferrite absorbers on the beam pipes. The two-cell cavity simplifies the tuner design, compared to having two independent cells. Tradeoffs between the damping of the higher order modes, thermal isolation associated with the large beam tubes, and overall cavity length are described. A copper prototype has been constructed, and measurements of fundamental and higher order modes will be compared to calculated values.

  15. BNL 703 MHz SRF cryomodule demonstration

    SciTech Connect

    Burrill,A.; Ben-Zvi, I.; Calaga, R.; Dalesio, L.; Dottavio, T.; Gassner, D.; Hahn, H.; Hoff, L.; Kayran, D.; Kewisch, J.; Lambiase, R.; Lederle, d.; Litvinenko, v.; Mahler, G.; McIntyre, G.; et al.


    This paper will present the preliminary results of the testing of the 703 MHz SRF cryomodule designed for use in the ampere class ERL under construction at Brookhaven National Laboratory. The preliminary cavity tests, carried out at Thomas Jefferson Laboratory, demonstrated cavity performance of 20 MV/m with a Qo of 1 x 10{sup 10}, results we expect to reproduce in the horizontal configuration. This test of the entire string assembly will allow us to evaluate all of the additional cryomodule components not previously tested in the VTA and will prepare us for our next milestone test which will be delivery of electrons from our injector through the cryomodule to the beam dump. This will also be the first demonstration of an accelerating cavity designed for use in an ampere class ERL, a key development which holds great promise for future machines.

  16. Commissioning of the 112 MHz SRF Gun and 500 MHz bunching cavities for the CeC PoP Linac

    SciTech Connect

    Belomestnykh, S.; Ben-Zvi, I.; Brutus, J. C.; Litvinenko, V.; McIntosh, P.; Moss, A.; Narayan, G.; Orfin, P.; Pinayev, I.; Rao, T.; Skaritka, J.; Smith, K.; Than, R.; Tuozzolo, J.; Wang, E.; Wheelhouse, A.; Wu, Q.; Xiao, B.; Xin, T.; Xu, W.; Zaltsman, A.


    The Coherent electron Cooling Proof-of-Principle (CeC PoP) experiment at BNL includes a short electron linac. During Phase 1, a 112 MHz superconducting RF photo-emission gun and two 500 MHz normal conducting bunching cavities were installed and are under commissioning. The paper describes the Phase1 linac layout and presents commissioning results for the cavities and associated RF, cryogenic and other sub-systems

  17. Automated frequency tuning of SRF cavities at CEBAF

    SciTech Connect

    Chowdhary, M.; Doolittle, L.; Lahti, G.; Simrock, S.N.; Terrell, R.


    An automated cavity tuning procedure has been implemented in the CEBAF control system to tune the superconducting RF (SRF) cavities to their operating frequency of 1497 MHz. The capture range for coarse tuning algorithm (Burst Mode) is more than 20 cavity bandwidths (5 kHz). The fine tuning algorithm (Sweep Mode) calibrates the phase offset in the detuning angle measurement. This paper describes the implementation of these algorithms and experience of their operation in CEBAF control system. 3 refs., 5 figs.

  18. Multipacting simulation and test results of BNL 704 MHz SRF gun

    SciTech Connect

    Xu W.; Belomestnykh, S.; Ben-Zvi, I.; Cullen, C. et al


    The BNL 704MHz SRF gun has a grooved choke joint to support the photo-cathode. Due to the distortion of grooves at the choke joint during the BCP for the choke joint, several multipacting barriers showed up when it was tested with Nb cathode stalk at JLab. We built a setup to use the spare large grain SRF cavity to test and condition the multipacting at BNL with various power sources up to 50kW. The test is carried out in three stages: testing the cavity performance without cathode, testing the cavity with the Nb cathode stalk that was used at Jlab, and testing the cavity with a copper cathode stalk that is based on the design for the SRF gun. This paper summarizes the results of multipacting simulation, and presents the large grain cavity test setup and the test results.

  19. Plasma Treatment of Niobium SRF Cavity Surfaces

    SciTech Connect

    J. Upadhyay, M. Raskovic, L. Vuskovic, S. Popovic, A.-M. Valente-Feliciano, L. Phillips


    Plasma based surface modification provides an excellent opportunity to eliminate non- superconductive pollutants in the penetration depth region of the SRF cavity surface and to remove mechanically damaged surface layer improving surface roughness. We have demonstrated on flat samples that plasma etching in Ar / Cl2 of bulk Nb is a viable alternative surface preparation technique to BCP and EP methods, with comparable etching rates. The geometry of SRF cavities made of bulk Nb defines the use of asymmetric RF discharge configuration for plasma etching. In a specially designed single cell cavity with sample holders, discharge parameters are combined with etched surface diagnostics to obtain optimum combination of etching rates, roughness and homogeneity in a variety of discharge types, conditions, and sequences. The optimized experimental conditions will ultimately be applied to single cell SRF cavities.

  20. Resonance control in SRF cavities at FNAL

    SciTech Connect

    Schappert, W.; Pischalnikov, Y.; Scorrano, M.; /INFN, Pisa


    The Lorentz force can dynamically detune pulsed Superconducting RF cavities. Considerable additional RF power can be required to maintain the accelerating gradient if no effort is made to compensate for this detuning. Compensation systems using piezo actuators have been used successfully at DESY and elsewhere to control Lorentz Force Detuning (LFD). Recently, Fermilab has developed an adaptive compensation system for cavities in the Horizontal Test Stand, in the SRF Accelerator Test Facility, and for the proposed Project X.

  1. "Fine grain Nb tube for SRF cavities"

    SciTech Connect

    Robert E. Barber


    Superconducting radio frequency (SRF) cavities used in charged particle linear accelerators, are currently fabricated by deep drawing niobium sheets and welding the drawn dishes together. The Nb sheet has a non-uniform microstructure, which leads to unpredictable cavity shape and surface roughness, and inconsistent "spring-back" during forming. In addition, weld zones cause hot spots during cavity operation. These factors limit linear accelerator performance and increase cavity manufacturing cost. Equal channel angular extrusion (ECAE) can be used to refine and homogenize the microstructure of Nb tube for subsequent hydroforming into SRF cavities. Careful selection of deformation and heat treatment conditions during the processing steps can give a uniform and consistent microstructure in the tube, leading to improved deformability and lower manufacturing costs. Favorable microstructures were achieved in short test samples of RRR Nb tube, which may be particularly suitable for hydroforming into SRF cavity strings. The approach demonstrated could be applicable to microstructure engineering of other tube materials including tantalum, titanium, and zirconium.

  2. RRR Characteristics for SRF cavities

    NASA Astrophysics Data System (ADS)

    Jung, Yoochul; Hyun, Myungook; Joung, Mijoung


    The first heavy ion accelerator is being constructed by the rare isotope science project (RISP) launched by the Institute of Basic Science (IBS) in South Korea. Four different types of superconducting cavities were designed, and prototypes such as a quarter-wave resonator (QWR), a half-wave resonator (HWR) and a single-spoke resonator (SSR) were fabricated. One of the critical factors determining the performances of superconducting cavities is the residual resistance ratio (RRR). The RRR values essentially represent how pure niobium is and how fast niobium can transmit heat. In general, the RRR degrades during electron beam welding due to impurity incorporation. Thus, it is important to maintain the RRR above a certain value at which a niobium cavity shows target performance. In this study, RRR degradation related with electron beam welding conditions, for example, the welding power, welding speed, and vacuum level, will be discussed.

  3. Pump down rate for SRF cavities

    SciTech Connect

    Kuchnir, M.; Knobloch, J.


    This note is about calculations aimed at quantifying adequate pumping speeds of evacuation of normally humid clean-room air from typical Superconducting Radiofrequency (SRF) cavities. The subject is of high relevance to the semiconductor industry, where the yield of VLSI (Very Large Scale Integration) chip production is affected by micron size particles which may cause fatal defects to their micron and sub-micron features. The recent availability of particle counters capable of operating in vacuum has stimulated measurements at reduced pressures in this subject.

  4. Plasma Processing of SRF Cavities for the next Generation Of Particle Accelerators

    SciTech Connect

    Vuskovic, Leposava


    The cost-effective production of high frequency accelerating fields are the foundation for the next generation of particle accelerators. The Ar/Cl2 plasma etching technology holds the promise to yield a major reduction in cavity preparation costs. Plasma-based dry niobium surface treatment provides an excellent opportunity to remove bulk niobium, eliminate surface imperfections, increase cavity quality factor, and bring accelerating fields to higher levels. At the same time, the developed technology will be more environmentally friendly than the hydrogen fluoride-based wet etching technology. Plasma etching of inner surfaces of standard multi-cell SRF cavities is the main goal of this research in order to eliminate contaminants, including niobium oxides, in the penetration depth region. Successful plasma processing of multi-cell cavities will establish this method as a viable technique in the quest for more efficient components of next generation particle accelerators. In this project the single-cell pill box cavity plasma etching system is developed and etching conditions are determined. An actual single cell SRF cavity (1497 MHz) is plasma etched based on the pill box cavity results. The first RF test of this plasma etched cavity at cryogenic temperature is obtained. The system can also be used for other surface modifications, including tailoring niobium surface properties, surface passivation or nitriding for better performance of SRF cavities. The results of this plasma processing technology may be applied to most of the current SRF cavity fabrication projects. In the course of this project it has been demonstrated that a capacitively coupled radio-frequency discharge can be successfully used for etching curved niobium surfaces, in particular the inner walls of SRF cavities. The results could also be applicable to the inner or concave surfaces of any 3D structure other than an SRF cavity.

  5. Tests of a tuner for a 325 MHz SRF spoke resonator

    SciTech Connect

    Pishchalnikov, Y.; Borissov, E.; Khabiboulline, T.; Madrak, R.; Pilipenko, R.; Ristori, L.; Schappert, W.; /Fermilab


    Fermilab is developing 325 MHz SRF spoke cavities for the proposed Project X. A compact fast/slow tuner has been developed for final tuning of the resonance frequency of the cavity after cooling down to operating temperature and to compensate microphonics and Lorentz force detuning [2]. The modified tuner design and results of 4.5K tests of the first prototype are presented. The performance of lever tuners for the SSR1 spoke resonator prototype has been measured during recent CW and pulsed tests in the Fermilab SCTF. The tuner met or exceeded all design goals and has been used to successfully: (1) Bring the cold cavity to the operating frequency; (2) Compensate for dynamic Lorentz force detuning; and (3) Compensate for frequency detuning of the cavity due to changes in the He bath pressure.

  6. Commissioning Cornell OSTs for SRF cavity testing at Jlab

    SciTech Connect

    Eremeev, Grigory


    Understanding the current quench limitations in SRF cavities is a topic essential for any SRF accelerator that requires high fields. This understanding crucially depends on correct and precise quench identification. Second sound quench detection in superfluid liquid helium with oscillating superleak transducers is a technique recently applied at Cornell University as a fast and versatile method for quench identification in SRF cavities. Having adopted Cornell design, we report in this contribution on our experience with OST for quench identification in different cavities at JLab.

  7. R&D of BEPCII 500 MHz superconducting cavity

    NASA Astrophysics Data System (ADS)

    Liu, YaPing; Wang, GuangWei; Pan, WeiMin; Li, JiZhen; Liu, DeGui; Sun, Yi; Li, ZhongQuan; Dai, JianPing; Li, ShaoPeng; He, Kun; Wang, GuoPing; Zhao, GuangYuan; Ma, Qiang; Lin, HaiYing; Sha, Peng; Wang, QunYao; Qiu, Feng; Meng, FanBo; Li, Han


    Beijing Electron-Positron Collider Upgrade (BEPCII) adopts two 500 MHz superconducting cavities (SCCs) in each ring for higher accelerated gradient, higher Q and lower impedance (Wang et al. The proceedings of SRF'07). There's no spare cavity due to the limited time and funding during BEPCII construction. If any serious trouble happened on either one of the two cavities and could not be recovered in a short time, the operation of BEPCII facility will be affected. Therefore, since 2009 three spare cavities have been fabricated in China to ensure reliable operation, and two of them have been successfully vertically tested in January and July 2011. This paper will briefly present the manufacture, post-process and vertical test performance of the 500 MHz spare cavities.

  8. Experiment and Results on Plasma Etching of SRF cavities

    SciTech Connect

    Upadhyay, Janardan; Im, Do; Peshl, J.; Vuskovic, Leposova; Popovic, Svetozar; Valente, Anne-Marie; Phillips, H. Lawrence


    The inner surfaces of SRF cavities are currently chemically treated (etched or electropolished) to achieve the state of the art RF performance. We designed an apparatus and developed a method for plasma etching of the inner surface for SRF cavities. The process parameters (pressure, power, gas concentration, diameter and shape of the inner electrode, temperature and positive dc bias at inner electrode) are optimized for cylindrical geometry. The etch rate non-uniformity has been overcome by simultaneous translation of the gas point-of-entry and the inner electrode during the processing. A single cell SRF cavity has been centrifugally barrel polished, chemically etched and RF tested to establish a baseline performance. This cavity is plasma etched and RF tested afterwards. The effect of plasma etching on the RF performance of this cavity will be presented and discussed.

  9. Camera assembly design proposal for SRF cavity image collection

    SciTech Connect

    Tuozzolo, S.


    This project seeks to collect images from the inside of a superconducting radio frequency (SRF) large grain niobium cavity during vertical testing. These images will provide information on multipacting and other phenomena occurring in the SRF cavity during these tests. Multipacting, a process that involves an electron buildup in the cavity and concurrent loss of RF power, is thought to be occurring near the cathode in the SRF structure. Images of electron emission in the structure will help diagnose the source of multipacting in the cavity. Multipacting sources may be eliminated with an alteration of geometric or resonant conditions in the SRF structure. Other phenomena, including unexplained light emissions previously discovered at SLAC, may be present in the cavity. In order to effectively capture images of these events during testing, a camera assembly needs to be installed to the bottom of the RF structure. The SRF assembly operates under extreme environmental conditions: it is kept in a dewar in a bath of 2K liquid helium during these tests, is pumped down to ultra-high vacuum, and is subjected to RF voltages. Because of this, the camera needs to exist as a separate assembly attached to the bottom of the cavity. The design of the camera is constrained by a number of factors that are discussed.

  10. JLab SRF Cavity Fabrication Errors, Consequences and Lessons Learned

    SciTech Connect

    Frank Marhauser


    Today, elliptical superconducting RF (SRF) cavities are preferably made from deep-drawn niobium sheets as pursued at Jefferson Laboratory (JLab). The fabrication of a cavity incorporates various cavity cell machining, trimming and electron beam welding (EBW) steps as well as surface chemistry that add to forming errors creating geometrical deviations of the cavity shape from its design. An analysis of in-house built cavities over the last years revealed significant errors in cavity production. Past fabrication flaws are described and lessons learned applied successfully to the most recent in-house series production of multi-cell cavities.

  11. Tomographic Analysis of SRF Cavities as Asymmetric Plasma Reactors

    SciTech Connect

    M. Nikolić, A.L. Godunov, S. Popović, A. Samolov, J. Upadhyay, L. Vušković, H.L. Phillips, A-M. Valente-Feliciano


    The tomographic reconstruction of local plasma parameters for nonequilibrium plasma sources is a developing approach, which has a great potential in understanding the fundamental processes and phenomena during plasma processing of SRF cavity walls. Any type of SRF cavity presents a plasma rector with limited or distorted symmetry and possible presence of high gradients. Development of the tomographic method for SRF plasma analysis consists of several steps. First, we define the method based on the inversion of the Abel integral equation for a hollow spherical reactor. Second step is application of the method for the actual elliptical cavity shape. Third step consists of study of the effects of various shapes of the driven electrode. Final step consists of testing the observed line-integrated optical emission data. We will show the typical results in each step and the final result will be presented in the form of correlation between local plasma parameter distributions and local etching characteristics.

  12. Tunneling study of SRF cavity-grade niobium.

    SciTech Connect

    Proslier, T.; Zasadzinski, J.; Cooley, L.; Pellin, M.; Norem, J.; Elam, J.; Antonine, C. Z.; Rimmer, R.; Kneisel, P.; Illinois Inst. of Tech.; FNL; Thomas Jefferson Lab.; CEA-Saclay


    Niobium, with its very high H{sub C1}, has been used in superconducting radio frequency (SRF) cavities for accelerator systems for 40 years with continual improvement. The quality factor of cavities (Q) is governed by the surface impedance R{sub BCS}, which depends on the quasiparticle gap, delta, and the superfluid density. Both of these parameters are seriously affected by surface imperfections (metallic phases, dissolved oxygen, magnetic impurities). Loss mechanism and surface treatments of Nb cavities found to improve the Q factor are still unsolved mysteries. We present here an overview of the capabilities of the point contact tunneling spectroscopy and Atomic layer deposition methods and how they can help understanding the High field Q-drop and the mild baking effect. Tunneling spectroscopy was performed on Nb pieces from the same processed material used to fabricate SRF cavities. Air exposed, electropolished Nb exhibited a surface superconducting gap Delta = 1.55 meV, characteristic of clean, bulk Nb, however the tunneling density of states (DOS) was broadened significantly. Nb pieces treated with the same mild baking used to improve the Q-slope in SRF cavities revealed a much sharper DOS. Good fits to the DOS are obtained using Shiba theory suggesting that magnetic scattering of quasiparticles is the origin of the degraded surface superconductivity and the Q-slope problem of Nb SRF cavities.

  13. Recent Developments in SRF Cavity Science and Performance

    SciTech Connect

    G. Ciovati


    The performances of SRF cavities made of high purity bulk niobium have been improving in the last few years and surface magnetic fields (Bp) close to the thermodynamic critical field of niobium have been achieved in a few cases. The recommendation made in 2004 in favor of SRF as the technology of choice for the International Linear Collider (ILC), requires improving the reliability of multi-cell cavities operating at accelerating gradients (Eacc) of the order of 35 MV/m. Additionally, a better understanding of the present limitations to cavity performance, such as the high-field Q-drop is needed. This contribution presents some recent developments in SRF cavity science and performance. Among the most significant advances of the last few years, new cavity shapes with lower ratio Bp/Eacc were designed and tested. Cavities made of large-grain niobium became available, promising lower cost at comparable performance to standard fine-grain ones and several tests on single-cell cavities were done to gain a better understanding of high-field losses. In addition, studies to improve the reliability of electropolishing are being carried out by several research groups.

  14. 805 MHz and 201 MHz RF cavity development for MUCOOL

    SciTech Connect


    A muon cooling channel calls for very high acceleratinggradient RF structures to restore the energy lost by muons in theabsorbers. The RF structures have to be operated in a strong magneticfield and thus the use of superconducting RF cavities is excluded. Toachieve a high shunt impedance while maintaining a large enough apertureto accommodate a large transverse emittance muon beam, the cavity designadopted is a pillbox-like geometry with thin Be foils to terminate theelectromagnetic field at the cavity iris. The possibility of using gridsof thin-walled metallic tubes for the termination is also being explored.Many of the RF-related issues for muon cooling channels are being studiedboth theoretically and experimentally using an 805 MHz cavity that has apillbox-like geometry with thin Be windows to terminate the cavityaperture. The design and performance of this cavity are reported here.High-power RF tests of the 805 MHz cavity are in progress at Lab G inFermilab. The cavity has exceeded its design gradient of 30 MV/m,reaching 34 MV/m without external magnetic field. No surface damage wasobserved at this gradient. The cavity is currently under conditioning atLab G with an external magnetic field of 2.5 T. We also present here a201 MHz cavity design for muoncooling channels. The proposed cavitydesign is also suitable for use in a proof-of-principle Muon IonizationCooling Experiment (MICE).

  15. Apparatus and method for plasma processing of SRF cavities

    NASA Astrophysics Data System (ADS)

    Upadhyay, J.; Im, Do; Peshl, J.; Bašović, M.; Popović, S.; Valente-Feliciano, A.-M.; Phillips, L.; Vušković, L.


    An apparatus and a method are described for plasma etching of the inner surface of superconducting radio frequency (SRF) cavities. Accelerator SRF cavities are formed into a variable-diameter cylindrical structure made of bulk niobium, for resonant generation of the particle accelerating field. The etch rate non-uniformity due to depletion of the radicals has been overcome by the simultaneous movement of the gas flow inlet and the inner electrode. An effective shape of the inner electrode to reduce the plasma asymmetry for the coaxial cylindrical rf plasma reactor is determined and implemented in the cavity processing method. The processing was accomplished by moving axially the inner electrode and the gas flow inlet in a step-wise way to establish segmented plasma columns. The test structure was a pillbox cavity made of steel of similar dimension to the standard SRF cavity. This was adopted to experimentally verify the plasma surface reaction on cylindrical structures with variable diameter using the segmented plasma generation approach. The pill box cavity is filled with niobium ring- and disk-type samples and the etch rate of these samples was measured.

  16. Recent Progress on High-Current SRF Cavities at Jlab

    SciTech Connect

    Robert Rimmer, William Clemens, James Henry, Peter Kneisel, Kurt Macha, Frank Marhauser, Larry Turlington, Haipeng Wang, Daniel Forehand


    JLab has designed and fabricated several prototype SRF cavities with cell shapes optimized for high current beams and with strong damping of unwanted higher order modes. We report on the latest test results of these cavities and on developments of concepts for new variants optimized for particular applications such as light sources and high-power proton accelerators, including betas less than one. We also report on progress towards a first beam test of this design in the recirculation loop of the JLab ERL based FEL. With growing interest worldwide in applications of SRF for high-average power electron and hadron machines, a practical test of these concepts is highly desirable. We plan to package two prototype cavities in a de-mountable cryomodule for temporary installation into the JLab FEL for testing with RF and beam. This will allow verification of all critical design and operational parameters paving the way to a full-scale prototype cryomodule.

  17. Cryogenic vertical test facility for the SRF cavities at BNL

    SciTech Connect

    Than, R.; Liaw, CJ; Porqueddu, R.; Grau, M.; Tuozzolo, J.; Tallerico, T.; McIntyre, G.; Lederle, D.; Ben-Zvi, I.; Burrill, A.; Pate, D.


    A vertical test facility has been constructed to test SRF cavities and can be utilized for other applications. The liquid helium volume for the large vertical dewar is approximate 2.1m tall by 1m diameter with a clearance inner diameter of 0.95m after the inner cold magnetic shield installed. For radiation enclosure, the test dewar is located inside a concrete block structure. The structure is above ground, accessible from the top, and equipped with a retractable concrete roof. A second radiation concrete facility, with ground level access via a labyrinth, is also available for testing smaller cavities in 2 smaller dewars. The cryogenic transfer lines installation between the large vertical test dewar and the cryo plant's sub components is currently near completion. Controls and instrumentations wiring are also nearing completion. The Vertical Test Facility will allow onsite testing of SRF cavities with a maximum overall envelope of 0.9 m diameter and 2.1 m height in the large dewar and smaller SRF cavities and assemblies with a maximum overall envelope of 0.66 m diameter and 1.6 m height.

  18. High-current SRF cavity design

    NASA Astrophysics Data System (ADS)

    Meidlinger, D.; Grimm, T. L.; Hartung, W.


    For high current applications, it is desirable for the cavity shape to have a low longitudinal loss factor and to have a high beam-breakup threshold current. This paper briefly describes three different cavities designed for this purpose: a six-cell elliptical cavity for particles traveling at the speed of light, a two-cell elliptical cavity for subluminal particle speeds, and a single cell cavity which uses the TM012 mode for acceleration. SUPERFISH simulations predict the peak fields in both of the elliptical cavities will not exceed the TeSLA values by more than 10% but both will have 28.7% larger apertures. The elliptical designs assume the bunch frequency equals the accelerating mode frequency. The beam pipe radius is chosen so that the cutoff frequency is less than twice that of the accelerating mode. Hence all of the monopole and dipole higher-order modes (HOMs) that can be driven by the beam have low loaded Q values. This simplifies the problem of HOM damping. The TM012 cavity is predicted to have much higher peak fields than a π-mode elliptical cavity, but offers potential advantages from its simplified shape; it is essentially a circular waveguide with curved end plates. This basic shape results in easier fabrication and simplified tuning.

  19. Microphonics Measurements in SRF Cavities for RIA

    SciTech Connect

    Kelly, M.P.; Fuerst, Joel; Kedzie, M.; Sharamentov, S.I.; Shepard, Kenneth; Delayen, Jean


    Phase stabilization of the RIA drift tube cavities in the presence of microphonics will be a key issue for RIA. Due to the relatively low beam currents (lte 0.5 pmA) required for the RIA driver, microphonics will impact the rf power required to control the cavity fields. Microphonics measurements on the ANL Beta=0.4 single spoke cavity and on the ANL Beta=0.4 two-cell spoke cavity have been performed many at high fields and using a new "cavity resonance monitor" device developed in collaboration with JLAB. Tests on a cold two-cell spoke are the first ever on a multi-cell spoke geometry. The design is essentially a production model with an integral stainless steel housing to hold the liquid helium bath.

  20. SRF Cavity Surface Topography Characterization Using Replica Techniques

    SciTech Connect

    C. Xu, M.J. Kelley, C.E. Reece


    To better understand the roll of topography on SRF cavity performance, we seek to obtain detailed topographic information from the curved practical cavity surfaces. Replicas taken from a cavity interior surface provide internal surface molds for fine Atomic Force Microscopy (AFM) and stylus profilometry. In this study, we confirm the replica resolution both on surface local defects such as grain boundary and etching pits and compare the surface uniform roughness with the aid of Power Spectral Density (PSD) where we can statistically obtain roughness parameters at different scales. A series of sampling locations are at the same magnetic field chosen at the same latitude on a single cell cavity to confirm the uniformity. Another series of sampling locations at different magnetic field amplitudes are chosen for this replica on the same cavity for later power loss calculation. We also show that application of the replica followed by rinsing does not adversely affect the cavity performance.

  1. Design of half-reentrant SRF cavities

    NASA Astrophysics Data System (ADS)

    Meidlinger, M.; Grimm, T. L.; Hartung, W.


    The shape of a TeSLA inner cell can be improved to lower the peak surface magnetic field at the expense of a higher peak surface electric field by making the cell reentrant. Such a single-cell cavity was designed and tested at Cornell, setting a world record accelerating gradient [V. Shemelin et al., An optimized shape cavity for TESLA: concept and fabrication, 11th Workshop on RF Superconductivity, Travemünde, Germany, September 8-12, 2003; R. Geng, H. Padamsee, Reentrant cavity and first test result, Pushing the Limits of RF Superconductivity Workshop, Argonne National Laboratory, September 22-24, 2004]. However, the disadvantage to a cavity is that liquids become trapped in the reentrant portion when it is vertically hung during high pressure rinsing. While this was overcome for Cornell’s single-cell cavity by flipping it several times between high pressure rinse cycles, this may not be feasible for a multi-cell cavity. One solution to this problem is to make the cavity reentrant on only one side, leaving the opposite wall angle at six degrees for fluid drainage. This idea was first presented in 2004 [T.L. Grimm et al., IEEE Transactions on Applied Superconductivity 15(6) (2005) 2393]. Preliminary designs of two new half-reentrant (HR) inner cells have since been completed, one at a high cell-to-cell coupling of 2.1% (high- kcc HR) and the other at 1.5% (low- kcc HR). The parameters of a HR cavity are comparable to a fully reentrant cavity, with the added benefit that a HR cavity can be easily cleaned with current technology.

  2. Update on the CeC PoP 704 MHz 5-cell cavity cryomodule design and fabrication

    SciTech Connect

    Brutus, J. C.; Belomestnykh, S.; Ben-Zvi, I.; Grimm, T.; Huang, Y.; Jecks, R.; Kelly, M.; Litvinenko, V.; Pinayev, I.; Reid, T.; Skaritka, J.; Snydstrup, L.; Than, R.; Tuozzolo, J.; Xu, W.; Yancey, J.; Gerbick, S.


    A 5-cell SRF cavity operating at 704 MHz will be used for the Coherent Electron Cooling Proof of Principle (CeC PoP) system under development for the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory. The CeC PoP experiment will demonstrate the new technique of cooling proton and ion beams that may increase the beam luminosity in certain cases, by as much as tenfold. The 704 MHz cavity will accelerate 2 MeV electrons from a 112 MHz SRF gun up to 22MeV. This paper provides an overview of the design, the project status and schedule of the 704 MHz 5-cell SRF for CeC PoP experiment.

  3. Atomic Layer Deposition for SRF Cavities

    SciTech Connect

    Proslier, Th.; Ha, Y.; Zasadzinski, J.; Ciovati, G.; Kneissel, P.; Reece, C.; Rimmer, R.; Gurevich, A.; Cooley, L.; Wu, G.; Pellin, M.; /Argonne


    We have begun using Atomic Layer Deposition (ALD) to synthesize a variety of surface coatings on coupons and cavities as part of an effort to produce rf structures with significantly better performance and yield than those obtained from bulk niobium, The ALD process offers the possibility of conformally coating complex cavity shapes with precise layered structures with tightly constrained morphology and chemical properties. Our program looks both at the metallurgy and superconducting properties of these coatings, and also their performance in working structures. Initial results include: (1) results from ALD coated cavities and coupons, (2) new evidence from point contact tunneling (PCT) showing magnetic oxides can be a significant limitation to high gradient operation, (3) a study of high pressure rinsing damage on niobium samples.

  4. Optimizing SRF Gun Cavity Profiles in a Genetic Algorithm Framework

    SciTech Connect

    Alicia Hofler, Pavel Evtushenko, Frank Marhauser


    Automation of DC photoinjector designs using a genetic algorithm (GA) based optimization is an accepted practice in accelerator physics. Allowing the gun cavity field profile shape to be varied can extend the utility of this optimization methodology to superconducting and normal conducting radio frequency (SRF/RF) gun based injectors. Finding optimal field and cavity geometry configurations can provide guidance for cavity design choices and verify existing designs. We have considered two approaches for varying the electric field profile. The first is to determine the optimal field profile shape that should be used independent of the cavity geometry, and the other is to vary the geometry of the gun cavity structure to produce an optimal field profile. The first method can provide a theoretical optimal and can illuminate where possible gains can be made in field shaping. The second method can produce more realistically achievable designs that can be compared to existing designs. In this paper, we discuss the design and implementation for these two methods for generating field profiles for SRF/RF guns in a GA based injector optimization scheme and provide preliminary results.

  5. Atomic Layer Deposition for SRF Cavities

    SciTech Connect

    Norem, J; Pellin, M J; Antoine, C Z; Ciovati, G; Kneisel, P; Reece, C E; Rimmer, R A; Cooley, L; Gurevich, A V; Ha, Y; Proslier, Th; Zasadzinski, J


    We have begun using Atomic Layer Deposition (ALD) to synthesize a variety of surface coatings on coupons and cavities as part of an effort to produce rf structures with significantly better performance and yield than those obtained from bulk niobium, The ALD process offers the possibility of conformally coating complex cavity shapes with precise layered structures with tightly constrained morphology and chemical properties. Our program looks both at the metallurgy and superconducting properties of these coatings, and also their performance in working structures. Initial results include: 1) evidence from point contact tunneling showing magnetic oxides can be a significant limitation to high gradient operation, 2) experimental results showing the production sharp niobium/oxide interfaces from a high temperature bake of ALD coated Al2O3 on niobium surfaces, 3) results from ALD coated structures.

  6. Optimization of the BCP processing of elliptical nb srf cavities

    SciTech Connect

    Boffo, C.; Cooper, C.; Rowe, A.; Galasso, G.; /Udine U.


    At present, the electropolishing (EP) process is considered the key technology unleashing the capability to produce Niobium SRF cavities performing at or above 35 MV/m. Nevertheless buffered chemical polishing (BCP) remains a cheap, simple and effective processing technique for single grain high gradient and polycrystalline lower gradient cavities. BCP will be adopted to chemically process the third harmonic 3.9 GHz cavities being fabricated at Fermilab [1]. The dimensions and the shape of these cavities yield a strong nonuniformity in the material removal between iris and equator of the cells. This paper describes the thermal-fluid finite element model adopted to simulate the process, the experimental flow visualization tests performed to verify the simulation and a novel device fabricated to solve the problem.

  7. SRF cavity and HOM damper tests at TRIUMF for ARIEL

    NASA Astrophysics Data System (ADS)

    Kolb, Philipp; Laxdal, Robert; Zvyagintsev, Vladimir


    The eLINAC for ARIELfootnotetextAdvanced Rare Isotope Experiment Laboratory consists of 5 superconducting nine cell cavities operating at 1.3 GHz, each cavity with a accelerating voltage of 10 MV. The design requires a quality factor of 1 .10^10 or higher at the operating temperature of 2 K for 10 W dissipated power in the cavity walls. Latest SRFfootnotetextSuperconducting Radio Frequency tests of a 1.3 GHz niobium single cell cavity will show that procedures at TRIUMF are capable of exceeding the RF requirements of ARIEL. Future upgrade plans for the eLINAC include a recirculating arc to either increase the energy of the 10 mA electron beam or drive an FELfootnotetextFree Electron Laser in ERLfootnotetextEnergy Recovery LINAC mode. BBUfootnotetextBeam Break-Up is a limitation in recirculating LINACs. Its strength depends on a number of parameters including the shunt impedance RSh of HOM,footnotetextHigher Order Modes especially dipole modes, of the SRF cavity. Using beam line absorbers made out of a low electric conductive material reduces the QL of the cavity and therefore reduces the RSh. Qualification of such a material is essential and measurements of the electrical conductivity of a candidate material will be presented in addition to the cavity tests.

  8. Plasma Processing of Large Surfaces with Application to SRF Cavity Modification

    SciTech Connect

    Upadhyay, Janardan; Popovic, Svetozar; Vuskovic, Leposova; Im, Do; Valente, Anne-Marie; Phillips, H


    Plasma based surface modifications of SRF cavities present promising alternatives to the wet etching technology currently applied. To understand and characterize the plasma properties and chemical kinetics of plasma etching processes inside a single cell cavity, we have built a specially-designed cylindrical cavity with 8 observation ports. These ports can be used for holding niobium samples and diagnostic purposes simultaneously. Two frequencies (13.56 MHz and 2.45 GHz) of power source are used for different pressure, power and gas compositions. The plasma parameters were evaluated by a Langmuir probe and by an optical emission spectroscopy technique based on the relative intensity of two Ar 5p-4s lines at 419.8 and 420.07 nm. Argon 5p-4s transition is chosen to determine electron temperature in order to optimize parameters for plasma processing. Chemical kinetics of the process was observed using real-time mass spectroscopy. The effect of these parameters on niobium surface would be measured, presented at this conference, and used as guidelines for optimal design of SRF etching process.

  9. Damping of unwanted modes in SRF deflecting/crabbing cavities

    SciTech Connect

    Burt, Graeme; Wang, Haipeng


    As deflecting and crab cavities do not use the fundamental acceleration mode for their operation, the spectrum of unwanted modes is significantly different from that of accelerating cavities. The fundamental acceleration mode is now unwanted and can cause energy spread in the beam; in addition this mode frequency is often close to or lower than that of the deflecting mode, making it difficult to damp. This is made more complex in some of the compact crab cavities as there small beampipes often attenuate the fields very sharply. In addition in some crab cavities there can be an orthogonal transverse mode similar to the deflecting mode, known as the same order mode. The degeneracy of these modes must be split by polarising the cavity and if the polarisation is not large enough, dampers should be placed at either an electric or magnetic field null of the crabbing mode to effectively damp the unwanted polarisation. Various concepts for dealing with unwanted modes in various SRF deflecting cavities will be reviewed.

  10. Study of etching rate uniformity in SRF cavities

    SciTech Connect

    Janardan Upadhyay, Svetozar Popovic, Leposova Vuskovic, H. Phillips, Anne-Marie Valente


    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. The crucial aspect of the technology development is dependence of the etching rate and surface roughness on the frequency of the power supply, pressure, power level, driven electrode shape and chlorine concentration in the gas mixture during plasma processing. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders are used as diagnostic ports for the measurement of the plasma parameters and as holders for the samples to be etched. The plasma properties are highly correlated with the shape of the driven electrode and chlorine concentration in the Argon/Chlorine gas mixtures.

  11. Development of high purity niobium used in SRF accelerating cavity

    NASA Astrophysics Data System (ADS)

    Chen, Lin; Xie, Wei-Ping; Li, Ming-Yang; He, Ji-Lin; Fan, Hui-Ru; Zhang, Bao-Cheng; He, Fei-Si; Zhao, Kui; Chen, Jia-Er; Liu, Ke-Xin


    Niobium is widely used in SRF (Superconducting Radio Frequency) cavities due to its excellent superconductivity and workability. With the continuous development of technology, higher demands of material are raised. One of the key issues is that RRR (Residual Resistance Ratio) of the Nb material should be more than 300, which requires that the Nb ingot have even higher RRR. This article introduces the development and the experimental results of high purity niobium in OTIC in Ningxia (Ningxia Orient Tantalum Industry Co. Ltd.), and the test results of the single cell TESLA (Tera Electron volt energy Superconducting Linear Accelerator) shaped cavity manufactured by Peking University using Nb material from OTIC. Supported by National Basic Research Program of China (2002CB713600)

  12. Eddy current scanning of niobium for SRF cavities at Fermilab

    SciTech Connect

    Boffo, C.; Bauer, P.; Foley, M.; Antoine, C.; Cooper, C.; Brinkmann, A.; /DESY


    In the framework of SRF cavity development, Fermilab is creating the infrastructure needed for the characterization of the material used in the cavity fabrication. An important step in the characterization of ''as received'' niobium sheets is eddy current scanning. Eddy current scanning is a non-destructive technique first adopted and further developed by DESY with the purpose of checking the cavity material for subsurface defects and inclusions. Fermilab has received and further upgraded a commercial eddy current scanner previously used for the SNS project. This scanner is now used daily to scan the niobium sheets for the Fermilab third harmonic, the ILC, and the Proton Driver cavities. After optical inspection, more than 400 squares and disks have been scanned and when necessary checked at the optical and electron microscopes, anodized, or measured with profilometers looking for surface imperfections that might limit the performance of the cavities. This paper gives a status report on the scanning results obtained so far, including a discussion of the classification of signals being detected.

  13. Plasma Parameters of SRF Cavities for Radio-Frequency Discharge Processing

    NASA Astrophysics Data System (ADS)

    Upadhyay, Janardan; Popovic, Svetozar; Vuskovic, Lepsha; Valente-Feliciano, Anne-Marie; Phillips, Larry


    Superconducting radio frequency (SRF) cavities of bulk Niobium are accelerating field-generating components of particle accelerators. Cavities are designed to support TM modes at a resonant frequency, which usually serve as their identifier. RF plasma surface modification dry-etching technology as an alternative to the currently existing wet etching technology requires a different RF coupling regime. The choice of power generator frequency greatly affects the field and plasma parameters distribution over the cavity. These are adjusted by a coaxial centerline antenna to provide for optimum level of plasma sheath uniformity. In the search for best etching conditions, we are opting for radio frequency (13.56 MHz, 100 MHz) and microwave frequency plasma (2.45 GHz) in Ar/Cl2 gas mixture. We have developed five optical probes for simultaneous spectroscopic measurements of the plasma properties at five points inside the cavity. The electron temperature and density measurement at the same set of points will be also measured with a Langmuir probe. The measurement of plasma parameters at different pressure and power for the chosen frequency set with varying chlorine content will be presented.

  14. BNl 703 MHz superconducting RF cavity testing

    SciTech Connect

    Sheehy, B.; Altinbas, Z.; Burrill, A.; Ben-Zvi, I.; Gassner, D.; Hahn, H.; Hammons, L.; Jamilkowski, J.; Kayran, D.; Kewisch, J.; Laloudakis, N.; Lederle, D.; Litvinenko, V.; McIntyre, G.; Pate, D.; Phillips, D.; Schultheiss, C.; Seda,T.; Than, R.; Xu, W.; Zaltsman, A.; Schultheiss, T.


    The BNL 5-cell, 703 MHz superconducting accelerating cavity has been installed in the high-current ERL experiment. This experiment will function as a proving ground for the development of high-current machines in general and is particularly targeted at beam development for an electron-ion collider (eRHIC). The cavity performed well in vertical tests, demonstrating gradients of 20 MV/m and a Q{sub 0} of 1e10. Here we will present its performance in the horizontal tests, and discuss technical issues involved in its implementation in the ERL.


    SciTech Connect



    The 28 MHz accelerating system consists of a quarter wave cavity driven by an inductively coupled 100kW tetrode amplifer and 1kW solid state driver amplifer. 40dB of rf feedback closed around the cavity and amplifers reduces small perturbations within the loop by a factor of 100, and reduces the time required to shift the phase at transition by a factor of 10, limited by the saturation of the drive chain. The cavity is tuned over a 200kHz range by a mechanical tuner which varies the gap capacitance. Broadband HOM damping is provided by two orthogonal loop coupled high pass filters. Design parameters and commissioning results are presented.

  16. Characterization of ingot material for SRF cavity production

    SciTech Connect

    Mondal, Jayanta; Ciovati, Gianluigi; Kneisel, Peter K.; Myneni, Ganapati Rao; Mittal, K. C.


    In recent years, large-grain/single-crystal niobium has become a viable alternative to the standard fine grain (ASTM grain size>6), high purity (RRR ) niobium for the fabrication of high-performance SRF cavities for particle accelerators. In this contribution we present the results of a systematic study of the superconducting properties of samples obtained from four Niobium ingots (from CBMM, Brazil) of different purity. Measurements of bulk magnetization, surface pinning, critical temperature and thermal conductivity have been carried out on the samples subjected to different surface treatments such as buffered chemical polishing (BCP), 6000C heat treatment, and low temperature baking (LTB). A correlation has been established between the LTB and the ratio . In addition, the phonon peak in the thermal conductivity data is suppressed by the presence of trapped magnetic vortices in the samples.

  17. Field Emission Studies From Nb Surfaces Relevant to SRF Cavities

    SciTech Connect

    Tong Wang; Charles Reece; Ronald Sundelin


    Enhanced field emission (EFE) presents the main impediment to higher acceleration gradients in superconducting rf (SRF) niobium (Nb) cavities for particle accelerators. A scanning field emission microscope was built at Jefferson Lab with the main objective of systematically investigating the sources of EFE from Nb surfaces. Various surface preparation techniques and procedures, including chemical etching, electropolishing, ultrasonic water rinse, high pressure water rinse, air-dry after methanol rinse, air-dry after water rinse in Class 10 cleanroom, were investigated. The capability and process variables for broad-area Nb surfaces to consistently reach field emission free or near field emission free performance at {approx}140 MV/m have been experimentally demonstrated using the above techniques/procedures.

  18. Performance of 3.9 GHz SRF Cavities at Fermilab's ILCTA_MDB Horizontal Test Stand

    SciTech Connect

    Harms, E.; Hocker, A.; /Fermilab


    Fermilab is building a cryomodule containing four 3.9 GHz superconducting radio frequency (SRF) cavities for the Free electron LASer in Hamburg (FLASH) facility at the Deutsches Elektronen-SYnchrotron (DESY) laboratory. Before assembling the cavities into the cryomodule, each individual cavity is tested at Fermilab's Horizontal Test Stand (HTS). The HTS provides the capability to test fully-dressed SRF cavities at 1.8 K with high-power pulsed RF in order to verify that the cavities achieve performance requirements under these conditions. The performance at the HTS of the 3.9 GHz cavities built for FLASH is presented here.

  19. Performance of 3.9 GHz SRF cavities at Fermilab's ILCTA_MDB nhorizontal test stand

    SciTech Connect

    Harms, Elvin; Hocker, Andy; /Fermilab


    Fermilab is building a cryomodule containing four 3.9 GHz superconducting radio frequency (SRF) cavities for the Free electron LASer in Hamburg (FLASH) facility at the Deutsches Elektronen-SYnchrotron (DESY) laboratory. Before assembling the cavities into the cryomodule, each individual cavity is tested at Fermilab's Horizontal Test Stand (HTS). The HTS provides the capability to test fully-dressed SRF cavities at 1.8 K with high-power pulsed RF in order to verify that the cavities achieve performance requirements under these conditions. The performance at the HTS of the 3.9 GHz cavities built for FLASH is presented here.

  20. Transverse Field Perturbation For PIP-II SRF Cavities

    SciTech Connect

    Berrutti, Paolo; Khabiboulline, Timergali N.; Lebedev, Valeri; Yakovlev, Vyacheslav P.


    Proton Improvement Plan II (PIP-II) consists in a plan for upgrading the Fermilab proton accelerator complex to a beam power capability of at least 1 MW delivered to the neutrino production target. A room temperature section accelerates H⁻ ions to 2.1 MeV and creates the desired bunch structure for injection into the superconducting (SC) linac. Five cavity types, operating at three different frequencies 162.5, 325 and 650 MHz, provide acceleration to 800 MeV. This paper presents the studies on transverse field perturbation on particle dynamic for all the superconducting cavities in the linac. The effects studied include quadrupole defocusing for coaxial resonators, and dipole kick due to couplers for elliptical cavities. A multipole expansion has been performed for each of the cavity designs including effects up to octupole.

  1. Guidelines for the Design, Fabrication, Testing, Installation and Operation of Srf Cavities

    NASA Astrophysics Data System (ADS)

    Theilacker, J.; Carter, H.; Foley, M.; Hurh, P.; Klebaner, A.; Krempetz, K.; Nicol, T.; Olis, D.; Page, T.; Peterson, T.; Pfund, P.; Pushka, D.; Schmitt, R.; Wands, R.


    Superconducting Radio-Frequency (SRF) cavities containing cryogens under pressure pose a potential rupture hazard to equipment and personnel. Generally, pressure vessels fall within the scope of the ASME Boiler and Pressure Vessel Code however, the use of niobium as a material for the SRF cavities is beyond the applicability of the Code. Fermilab developed a guideline to ensure sound engineering practices governing the design, fabrication, testing, installation and operation of SRF cavities. The objective of the guideline is to reduce hazards and to achieve an equivalent level of safety afforded by the ASME Code. The guideline addresses concerns specific to SRF cavities in the areas of materials, design and analysis, welding and brazing, pressure relieving requirements, pressure testing and quality control.


    SciTech Connect

    Theilacker, J.; Carter, H.; Foley, M.; Hurh, P.; Klebaner, A.; Krempetz, K.; Nicol, T.; Olis, D.; Page, T.; Peterson, T.; Pfund, P.; Pushka, D.; Schmitt, R.; Wands, R.


    Superconducting Radio-Frequency (SRF) cavities containing cryogens under pressure pose a potential rupture hazard to equipment and personnel. Generally, pressure vessels fall within the scope of the ASME Boiler and Pressure Vessel Code however, the use of niobium as a material for the SRF cavities is beyond the applicability of the Code. Fermilab developed a guideline to ensure sound engineering practices governing the design, fabrication, testing, installation and operation of SRF cavities. The objective of the guideline is to reduce hazards and to achieve an equivalent level of safety afforded by the ASME Code. The guideline addresses concerns specific to SRF cavities in the areas of materials, design and analysis, welding and brazing, pressure relieving requirements, pressure testing and quality control.

  3. New HOM coupler design for high current SRF cavity

    SciTech Connect

    Xu, W.; Ben-Zvi, I.; Belomestnykh, S.; Hahn, H.; Johnson, E.


    Damping higher order modes (HOMs) significantly to avoid beam instability is a challenge for the high current Energy Recovery Linac-based eRHIC at BNL. To avoid the overheating effect and high tuning sensitivity, current, a new band-stop HOM coupler is being designed at BNL. The new HOM coupler has a bandwidth of tens of MHz to reject the fundamental mode, which will avoid overheating due to fundamental frequency shifting because of cooling down. In addition, the S21 parameter of the band-pass filter is nearly flat from first higher order mode to 5 times the fundamental frequency. The simulation results showed that the new couplers effectively damp HOMs for the eRHIC cavity with enlarged beam tube diameter and 2 120{sup o} HOM couplers at each side of cavity. This paper presents the design of HOM coupler, HOM damping capacity for eRHIC cavity and prototype test results.

  4. Simulation of the High-Pass Filter for 56MHz Cavity for RHIC

    SciTech Connect

    Wu, Q.; Ben-Zvi, I.


    The 56MHz Superconducting RF (SRF) cavity for RHIC places high demands High Order Mode (HOM) damping, as well as requiring a high field at gap with fundamental mode frequency. The damper of 56MHz cavity is designed to extract all modes to the resistance load outside, including the fundamental mode. Therefore, the circuit must incorporate a high-pass filter to reflect back the fundamental mode into the cavity. In this paper, we show the good frequency response map obtained from our filter's design. We extract a circuit diagram from the microwave elements that simulate well the frequency spectrum of the finalized filter. We also demonstrate that the power dissipation on the filter over its frequency range is small enough for cryogenic cooling.

  5. Cryogenic controls for Fermilab's SRF cavities and test facility

    SciTech Connect

    Norris, B.; Bossert, R.; Klebaner, A.; Lackey, S.; Martinez, A.; Pei, L.; Soyars, W.; Sirotenko, V.; /Fermilab


    A new superconducting radio frequency (SRF) cavities test facility is now operational at Fermilab's Meson Detector Building (MDB). The facility is supplied cryogens from the Cryogenic Test Facility (CTF) located in a separate building 500-m away. The design incorporates ambient temperature pumping for super-fluid helium production, as well as three 0.6-kW at 4.5-K refrigerators, five screw compressors, a helium purifier, helium and nitrogen inventory, cryogenic distribution system, and a variety of test cryostats. To control and monitor the vastly distributed cryogenic system, a flexible scheme has been developed. Both commercial and experimental physics tools are used. APACS+{trademark}, a process automation control system from Siemens-Moore, is at the heart of the design. APACS+{trademark} allows engineers to configure an ever evolving test facility while maintaining control over the plant and distribution system. APACS+{trademark} nodes at CTF and MDB are coupled by a fiber optic network. DirectLogic205 PLC's by KOYO{reg_sign} are used as the field level interface to most I/O. The top layer of this system uses EPICS (Experimental Physics and Industrial Control System) as a SCADA/HMI. Utilities for graphical display, control loop setting, real time/historical plotting and alarming have been implemented by using the world-wide library of applications for EPICS. OPC client/server technology is used to bridge across each different platform. This paper presents this design and its successful implementation.

  6. Cryogenic Controls for Fermilab's Srf Cavities and Test Facility

    NASA Astrophysics Data System (ADS)

    Norris, B.; Bossert, R.; Klebaner, A.; Lackey, S.; Martinez, A.; Pei, L.; Soyars, W.; Sirotenko, V.


    A new superconducting radio frequency (SRF) cavities test facility is now operational at Fermilab's Meson Detector Building (MDB). The Cryogenic Test Facility (CTF), located in a separate building 500 m away, supplies the facility with cryogens. The design incorporates ambient temperature pumping for superfluid helium production, as well as three 0.6 kW at 4.5 K refrigerators, five screw compressors, a helium purifier, helium and nitrogen inventory, cryogenic distribution system, and a variety of test cryostats. To control and monitor the vastly distributed cryogenic system, a flexible scheme has been developed. Both commercial and experimental physics tools are used. APACS+™, a process automation control system from Siemens-Moore, is at the heart of the design. APACS+™ allows engineers to configure an ever evolving test facility while maintaining control over the plant and distribution system. APACS+™ nodes at CTF and MDB are coupled by a fiber optic network. DirectLogic205 PLCs by KOYO® are used as the field level interface to most I/O. The top layer of this system uses EPICS (Experimental Physics and Industrial Control System) as a SCADA/HMI. Utilities for graphical display, control loop setting, real time/historical plotting and alarming have been implemented by using the world-wide library of applications for EPICS. OPC client/server technology is used to bridge across each different platform. This paper presents this design and its successful implementation.

  7. Processing and Testing of the SRF Photoinjector Cavity for BERLinPro

    SciTech Connect

    Burrill, Andrew; Anders, W; Frahm, A; Knobloch, Jens; Neumann, Axel; Ciovati, Gianluigi; Clemens, William; Kneisel, Peter; Turlington, Larry; Zaplatin, Evgeny


    The BERLinPro project is a compact, c.w. SRF energy recovery linac (ERL) that is being built to develop the accelerator physics and technology required to operate the next generation of high current ERLs. The machine is designed to produce a 50 MeV 100 mA beam, with better than 1 mm-mrad emittance. The electron source for the ERL will be a SRF photoinjector equipped with a multi-alkali photocathode. In order to produce a SRF photoinjector to operate reliably at this beam current HZB has undertaken a 3 stage photoinjector development program to study the operation of SRF photoinjectors in detail. The 1.4 cell cavity being reported on here is the second stage of this development, and represents the first cavity designed by HZB for use with a high quantum efficiency multi-alkali photocathode. This paper will describe the work done to prepare the cavity for RF testing in the vertical testing dewar at Jefferson Laboratory as well as the results of these RF tests.

  8. Prototype 350 MHz niobium spoke-loaded cavities.

    SciTech Connect

    Delayen, J. R.; Kedzie, M.; Mammosser, J.; Piller, C.; Shepard, K. W.


    This paper reports the development of 350 MHz superconducting cavities of a spoke-loaded geometry, intended for the velocity range 0.2 < v/c < 0.6. Two prototype single-cell cavities have been designed, one optimized for velocity v/c = 0.4, and the other for v/c = 0.29. Construction of the prototype niobium cavities is nearly complete. Details of the design and construction are discussed, along with the results of cold tests.


    SciTech Connect

    Ari Palczewski, Rongli Geng


    We performed in-situ cryogenic testing of four silicon diodes as possible candidates for field emission (FE) monitors of superconducting radio frequency (SRF) cavities during qualification testing and in accelerator cryo-modules. We evaluated diodes from 2 companies - from Hamamatsu corporation model S1223-01; and from OSI Optoelectronics models OSD35-LR-A, XUV-50C, and FIL-UV20. The measurements were done by placing the diodes in superfluid liquid helium near the top of a field emitting 9-cell cavity during its vertical test. For each diode, we will discuss their viability as a 2K cryogenic detector for FE mapping of SRF cavities and the directionality of S1223-01 in such environments. We will also present calibration curves between the diodes and JLab's standard radiation detector placed above the Dewar's top plate.

  10. Materials Analysis of CED Nb Films Being Coated on Bulk Nb Single Cell SRF Cavities

    SciTech Connect

    Zhao, Xin; Reece, Charles; Palczewski, Ari; Ciovati, Gianluigi; Krishnan, Mahadevan; James, Colt; Irfan, Irfan


    This study is an on-going research on depositing a Nb film on the internal wall of bulk Nb single cell SRF cavities, via a cathodic arc Nb plasma ions source, an coaxial energetic condensation (CED) facility at AASC company. The motivation is to firstly create a homoepitaxy-like Nb/Nb film in a scale of a ~1.5GHz RF single cell cavity. Next, through SRF measurement and materials analysis, it might reveal the baseline properties of the CED-type homoepitaxy Nb films. Literally, a top-surface layer of Nb films which sustains SRF function, always grows up in homo-epitaxy mode, on top of a Nb nucleation layer. Homo-epitaxy growth of Nb must be the final stage (a crystal thickening process) of any coatings of Nb film on alternative cavity structure materials. Such knowledge of Nb-Nb homo-epitaxy is useful to create future realistic SRF cavity film coatings, such as hetero-epitaxy Nb/Cu Films, or template-layer-mitigated Nb films. One large-grain, and three fine grain bulk Nb cavities were coated. They went through cryogenic RF measurement. Preliminary results show that the Q0 of a Nb film could be as same as the pre-coated bulk Nb surface (which received a chemically-buffered polishing plus a light electro-polishing); but quality factor of two tested cavities dropped quickly. We are investigating if the severe Q-slope is caused by hydrogen incorporation before deposition, or is determined by some structural defects during Nb film growth.

  11. RF and data acquisition systems for Fermilab's ILC SRF cavity vertical test stand

    SciTech Connect

    Ozelis, Joseph P.; Nehring, Roger; Grenoble, Christiana; Powers, Thomas J.; /Jefferson Lab


    Fermilab is developing a facility for vertical testing of SRF cavities as part of its ILC program. The RF system for this facility is based on the proven production cavity test systems used at Jefferson Lab for CEBAF and SNS cavity testing. The design approach is modular in nature, using commercial-off-the-shelf (COTS) components. This yields a system that can be easily debugged and modified, and with ready availability of spares. Comprehensive data acquisition and control is provided by a PXI-based hardware platform in conjunction with software developed in the LabView programming environment.

  12. Exploration of Quench Initiation Due to Intentional Geometrical Defects in a High Magnetic Field Region of an SRF Cavity

    SciTech Connect

    J. Dai, K. Zhao, G.V. Eremeev, R.L. Geng, A.D. Palczewski; Dai, J.; Palczewski, A. D.; Eremeev, G. V.; Geng, R. L.; Zhao, K.


    A computer program which was used to simulate and analyze the thermal behaviors of SRF cavities has been developed at Jefferson Lab using C++ code. This code was also used to verify the quench initiation due to geometrical defects in high magnetic field region of SRF cavities. We built a CEBAF single cell cavity with 4 artificial defects near equator, and this cavity has been tested with T-mapping. The preheating behavior and quench initiation analysis of this cavity will be presented here using the computer program.

  13. Apparatus and process for passivating an SRF cavity


    Myneni, Ganapati Rao; Wallace, John P


    An apparatus and process for the production of a niobium cavity exhibiting high quality factors at high gradients is provided. The apparatus comprises a first chamber positioned within a second chamber, an RF generator and vacuum pumping systems. The process comprises placing the niobium cavity in a first chamber of the apparatus; thermally treating the cavity by high temperature in the first chamber while maintaining high vacuum in the first and second chambers; and applying a passivating thin film layer to a surface of the cavity in the presence of a gaseous mixture and an RF field. Further a niobium cavity exhibiting high quality factors at high gradients produced by the method of the invention is provided.

  14. Progress of ILC High Gradient SRF Cavity R&D at Jefferson Lab

    SciTech Connect

    R.L. Geng, J. Dai, G.V. Eremeev, A.D. Palczewski


    Latest progress of ILC high gradient SRF cavity R&D at Jefferson Lab will be presented. 9 out of 10 real 9-cell cavities reached an accelerating gradient of more than 38 MV/m at a unloaded quality factor of more than 8 {center_dot} 109. New understandings of quench limitation in 9-cell cavities are obtained through instrumented studies of cavities at cryogenic temperatures. Our data have shown that present limit reached in 9-cell cavities is predominantly due to localized defects, suggesting that the fundamental material limit of niobium is not yet reached in 9-cell cavities and further gradient improvement is still possible. Some examples of quench-causing defects will be given. Possible solutions to pushing toward the fundamental limit will be described.

  15. Plasma Discharge Effect on Secondary Electron Yield of Various Surface Locations on SRF Cavities

    NASA Astrophysics Data System (ADS)

    Basovic, Milos; Samolov, Ana; Cuckov, Filip; Tomovic, Mileta; Popovic, Svetozar; Vuskovic, Leposava


    Electron activity (field emission and multipacting) has been identified as the main limiting factor of Superconducting Radiofrequency (SRF) cavity performance. Secondary Electron Yield (SEY) is highly dependent on the state of the cavity's surface, which is investigated before and after plasma exposure. Current methods for simulating the electron activity in SRF cavity consider it as a uniform surface. Due to fabricating procedure there are three distinct areas of the cavity's microstructure: weld zone, heat affected zone, and base metal zone. Each zone has a characteristic microstructure even after the treatments that are currently used to clean the surface of the cavities. Improvement of existing surface treatment techniques, or use of a new is required in order to increase the limit of Q factor towards the theoretical limit of Nb. RF discharge is a promising technique for this purpose. In order to test the effect of the plasma on the SEY of the various cavity surface zones we have developed the experimental setup to measure the energy distribution of the SEY from coupon-like samples. Samples are made in a way that all three zones of cavity surface will be included in the examination. We will present the SEY changes in these three zones before and after plasma treatment.

  16. Evidence of Magnetic Breakdown on the Defects With Thermally Suppressed Critical Field in High Gradient SRF Cavities

    SciTech Connect

    Eremeev, Grigory; Palczewski, Ari


    At SRF 2011 we presented the study of quenches in high gradient SRF cavities with dual mode excitation technique. The data differed from measurements done in 80's that indicated thermal breakdown nature of quenches in SRF cavities. In this contribution we present analysis of the data that indicates that our recent data for high gradient quenches is consistent with the magnetic breakdown on the defects with thermally suppressed critical field. From the parametric fits derived within the model we estimate the critical breakdown fields.

  17. Plasma Treatment of Single-Cell Niobium SRF Cavities

    SciTech Connect

    J. Upadhyay, M. Nikolić, S. Popović, L. Vušković, H.L. Phillips, A-M. Valente-Feliciano


    Superconducting radio frequency cavities of bulk Niobium are integral components of particle accelerators based on superconducting technology. Wet chemical processing is the commonly used procedure for impurities and surface defects removal and surface roughness improvement , both required to improve the RF performance of the cavity. We are studying plasma etching as an alternate technique to process these cavities. The uniformity of the plasma sheath at the inner wall of the cavity is one prerequisite for its uniform etching. We are developing electro-optic diagnostic techniques to assess the plasma uniformity. Multiple electro-optical probes are placed at different locations of the single cell cavity to diagnose the electrical and optical properties of the plasma. The electrical parameters are required to understand the kinetic nature of the plasma and the optical emission spectroscopy provides the spatial distribution of radicals in the plasma. The spatial variation of the plasma parameters inside the cavity and their effect on the etching of niobium samples placed at different locations in the cavity will be presented.

  18. A top loading 2 Kelvin test cryostat for SRF cavities.

    SciTech Connect

    Kedzie, M.; Kelly, M. P.; Gerbick, S. M.; Fuerst, J. D.; Shepard, K. W.; Physics


    A new large 2 Kelvin test cryostat is being commissioned at Argonne National Laboratory. This system will have a full time connection to the 4.5 Kelvin ATLAS refrigerator and, with integrated J-T heat exchanger, will allow continuous 2 Kelvin operation. The large diameter was chosen to accommodate essentially all of today's superconducting cavities and the top loading design facilitates clean room assembly. The commissioning run will be with a coaxial half wave cavity to be followed by testing with 1.3 GHz single-cell elliptical cavities. Details of the initial engineering cool down on the cryostat are presented.

  19. SRF cavities for CW option of Project X Linac

    SciTech Connect

    Solyak, N.; Gonin, I.; Khabiboulline, T.; Lunin, A.; Perunov, N.; Yakovlev, V.; /Fermilab


    Alternative option of Project X is based on the CW SC 2GeV Linac with the average current 1mA. Possible option of the CW Linac considered in the paper includes low energy part consisted of a few families SC Spoke cavities (from 2.5 MeV to 466 MeV) and high energy part consisted of 2 types of elliptical cavities (v/c=0.81 and v/c=1). Requirements and designed parameters of cavities are considered.

  20. First beam commissioning at BNL ERL SRF Gun

    SciTech Connect

    Xu, W.; Altinbas, Z.; Belomestnykh, S.; Ben-Zvi, I.; Deonarine, S.; DeSanto, L.; Gassner, D.; Gupta, R. C.; Hahn, H.; Hammons, L.; Ho, C.; Jamilkoski, J.; Kankiya, P.; Kayran, D.; Kellerman, R.; Laloudakis, N.; Lambiase, R.; Liaw, C.; Litvinenko, V.; Mahler, G.; Masi, L.; McIntyre, G.; Miller, T.; Philips, D.; Ptitsyn, V.; Seda, T.; Sheehy, B.; Smith, K.; Rao, T.; Steszyn, A.; Tallerico, T.; Than, R.; Tuozollo, J.; Wang, E.; Weiss, D.; Wiliniski, M.; Zaltsman, A.


    The 704 MHz SRF gun successfully generated the first photoemission beam in November of 2014. The configurations of the test and the sub-systems are described.The latest results of SRF commissioning, including the cavity performance, cathode QE measurements, beam current/energy measurements, are presented in the paper.

  1. 201 MHz Cavity R&D for MUCOOL and MICE

    SciTech Connect

    Li, Derun; Virostek, Steve; Zisman, Michael; Norem, Jim; Bross,Alan; Moretti, Alfred; Norris, Barry; Torun, Yagmur; Phillips, Larry; Rimmer, Robert; Stirbet, Mircea; Reep, Michael; Summers, Don


    We describe the design, fabrication, analysis and preliminary testing of the prototype 201 MHz copper cavity for a muon ionization cooling channel. Cavity applications include the Muon Ionization Cooling Experiment (MICE) as well as cooling channels for a neutrino factory or a muon collider. This cavity was developed by the US muon cooling (MUCOOL) collaboration and is being tested in the MUCOOL Test Area (MTA) at Fermilab. To achieve a high accelerating gradient, the cavity beam irises are terminated by a pair of curved, thin beryllium windows. Several fabrication methods developed for the cavity and windows are novel and offer significant cost savings as compared to conventional construction methods. The cavity's thermal and structural performances are simulated with an FEA model. Preliminary high power RF commissioning results will be presented.

  2. Ultra-Gradient Test Cavity for Testing SRF Wafer Samples

    SciTech Connect

    N.J. Pogue, P.M. McIntyre, A.I. Sattarov, C. Reece


    A 1.3 GHz test cavity has been designed to test wafer samples of superconducting materials. This mushroom shaped cavity, operating in TE01 mode, creates a unique distribution of surface fields. The surface magnetic field on the sample wafer is 3.75 times greater than elsewhere on the Niobium cavity surface. This field design is made possible through dielectrically loading the cavity by locating a hemisphere of ultra-pure sapphire just above the sample wafer. The sapphire pulls the fields away from the walls so the maximum field the Nb surface sees is 25% of the surface field on the sample. In this manner, it should be possible to drive the sample wafer well beyond the BCS limit for Niobium while still maintaining a respectable Q. The sapphire's purity must be tested for its loss tangent and dielectric constant to finalize the design of the mushroom test cavity. A sapphire loaded CEBAF cavity has been constructed and tested. The results on the dielectric constant and loss tangent will be presented

  3. Quench dynamics in SRF cavities: can we locate the quench origin with 2nd sound?

    SciTech Connect

    Maximenko, Yulia; Segatskov, Dmitri A.; /Fermilab


    A newly developed method of locating quenches in SRF cavities by detecting second-sound waves has been gaining popularity in SRF laboratories. The technique is based on measurements of time delays between the quench as determined by the RF system and arrival of the second-sound wave to the multiple detectors placed around the cavity in superfluid helium. Unlike multi-channel temperature mapping, this approach requires only a few sensors and simple readout electronics; it can be used with SRF cavities of almost arbitrary shape. One of its drawbacks is that being an indirect method it requires one to solve an inverse problem to find the location of a quench. We tried to solve this inverse problem by using a parametric forward model. By analyzing the data we found that the approximation where the second-sound emitter is a near-singular source does not describe the physical system well enough. A time-dependent analysis of the quench process can help us to put forward a more adequate model. We present here our current algorithm to solve the inverse problem and discuss the experimental results.

  4. Effect of cathode shape on vertical buffered electropolishing for niobium SRF cavities

    NASA Astrophysics Data System (ADS)

    Jin, S.; Wu, A. T.; Lu, X. Y.; Rimmer, R. A.; Lin, L.; Zhao, K.; Mammosser, J.; Gao, J.


    This paper reports the research results of the effect of cathode shape during vertical buffered electropolishing (BEP) by employing a demountable single cell niobium (Nb) superconducting radio frequency (SRF) cavity. Several different cathode shapes such as, for instance, bar, ball, ellipsoid, and wheels of different diameters have been tested. Detailed electropolishing parameters including I-V characteristic, removal rate, surface roughness, and polishing uniformity at different locations inside the demountable cavity are measured. Similar studies are also done on conventional electropolishing (EP) for comparison. It is revealed that cathode shape has dominant effects for BEP especially on the obtaining of a suitable polishing condition and a uniform polishing rate in an Nb SRF single cell cavity. EP appears to have the same tendency. This paper demonstrates that a more homogeneous polishing result can be obtained by optimizing the electric field distribution inside the cavity through the modification of the cathode shape given the conditions that temperature and electrolyte flow are kept constant. Electric field distribution and electrolyte flow patterns inside the cavity are simulated via Poisson-Superfish and Solidworks respectively. With the optimal cathode shape, BEP shows a much faster polishing rate of ∼2.5 μm/min and is able to produce a smoother surface finish in the treatments of single cell cavities in comparison with EP.

  5. Effect of cathode shape on vertical buffered electropolishing for niobium SRF cavities

    SciTech Connect

    Jin, Song; Wu, Andy T.; Lu, Xiangyang; Rimmer, Robert A.; Lin, Lin; Zhao, K.; Mammosser, John D.; Gao, Jie


    This paper reports the research results of the effect of cathode shape during vertical buffered electropolishing (BEP) by employing a demountable single cell niobium (Nb) superconducting radio frequency (SRF) cavity. Several different cathode shapes such as, for instance, bar, ball, ellipsoid, and wheels of different diameters have been tested. Detailed electropolishing parameters including I–V characteristic, removal rate, surface roughness, and polishing uniformity at different locations inside the demountable cavity are measured. Similar studies are also done on conventional electropolishing (EP) for comparison. It is revealed that cathode shape has dominant effects for BEP especially on the obtaining of a suitable polishing condition and a uniform polishing rate in an Nb SRF single cell cavity. EP appears to have the same tendency. This paper demonstrates that a more homogeneous polishing result can be obtained by optimizing the electric field distribution inside the cavity through the modification of the cathode shape given the conditions that temperature and electrolyte flow are kept constant. Electric field distribution and electrolyte flow patterns inside the cavity are simulated via Poisson–Superfish and Solidworks respectively. With the optimal cathode shape, BEP shows a much faster polishing rate of ∼2.5 μm/min and is able to produce a smoother surface finish in the treatments of single cell cavities in comparison with EP.

  6. Optimization of the Low Loss SRF Cavity for the ILC

    SciTech Connect

    Sekutowicz, J.S.; Kneisel, P.; Higo, T.; Morozumi, Y.; Saito, K.; Ge, L.; Ko, Yong-kyu; Lee, L.; Li, Z.; Ng, C.K.; Schussman, G.L.; Xiao, L.; /SLAC


    The Low-Loss shape cavity design has been proposed as a possible alternative to the baseline TESLA cavity design for the ILC main linacs. The advantages of this design over the TESLA cavity are its lower cryogenic loss, and higher achievable gradient due to lower surface fields. High gradient prototypes for such designs have been tested at KEK (ICHIRO) and TJNAF (LL). However, issues related to HOM damping and multipacting still need to be addressed. Preliminary numerical studies of the prototype cavities have shown unacceptable damping factors for some higher-order dipole modes if the typical TESLA HOM couplers are directly adapted to the design. The resulting wakefield will dilute the beam emittance thus reducing the machine luminosity. Furthermore, high gradient tests on a 9-cell prototype at KEK have experienced multipacting barriers although a single LL cell had achieved a high gradient. From simulations, multipacting activities are found to occur in the end-groups of the cavity. In this paper, we will present the optimization results of the end-groups for the Low-Loss designs for effective HOM damping and alleviation of multipacting.

  7. Design Methodology and Consideratios for NOVA 53 MHZ RF Cavities

    SciTech Connect

    Ader, C.; Wildman, D.W.; /Fermilab


    The NO?A Experiment will construct a detector optimized for electron neutrino detection in the existing Neutrino at Main Injector (NuMI) beamline. This beamline is capable of operating at 400 kW of primary beam power and the upgrade will allow up to 700 kW. The cavities will operate at 53 MHz and three of them will be installed in the Recycler beamline. Thermal stability of the cavities is crucial since this affects the tuning. Results of finite element thermal and structural analysis involving the copper RF cavity will be presented.

  8. Fabrication and Measurements of 500 MHz Double Spoke Cavity

    SciTech Connect

    Park, HyeKyoung; Hopper, Christopher S.; Delayen, Jean R.


    A 500 MHz β0=1 double spoke cavity has been designed and optimized for a high velocity application such as a compact electron accelerator at the Center for Accelerator Science at Old Dominion University [1] and the fabrication was recently completed at Jefferson Lab. The geometry specific to the double spoke cavity required a variety of tooling and fixtures. Also a number of asymmetric weld joints were expected to make it difficult to maintain minimal geometric deviation from the design. This paper will report the fabrication procedure, resulting tolerance from the design, initial test results and the lessons learned from the first β0=1 double spoke cavity fabrication.

  9. Tensile tests of niobium material for SRF cavities

    SciTech Connect

    Wu, G.; Dhanaraj, N.; Cooley, L.; Hicks, D.; Hahn, E.; Burk, D.; Muranyi, W.; Foley, N.; Edwards, H.; Harms, E.; Champion, M.; /Fermilab /Michigan State U.


    Mechanical tests of cavity-grade niobium samples were conducted to provide engineering information for the certification of 3rd-harmonic superconducting radio-frequency cavities and cryomodules. Large changes of mechanical properties occur throughout the cavity fabrication process due to the cold work introduced by forming, the heating introduced by electron beam welding, and the recovery of cold work during the anneal used to degas hydrogen after chemical processing. Data is provided here to show the different properties at various stages of fabrication, including both weld regions and samples from the bulk niobium far away from the weld. Measurements of RRR were used to assure that any contamination during annealing was negligible.

  10. Tensile Tests of Niobium Material for Srf Cavities

    NASA Astrophysics Data System (ADS)

    Wu, G.; Dhanaraj, N.; Cooley, L.; Hicks, D.; Hahn, E.; Burk, D.; Muranyi, W.; Foley, M.; Edwards, H.; Harms, E.; Champion, M.; Baars, D.; Compton, C.


    Mechanical tests of cavity-grade niobium samples were conducted to provide engineering information for the certification of 3rd-harmonic superconducting radio-frequency cavities and cryomodules. Large changes of mechanical properties occur throughout the cavity fabrication process due to the cold work introduced by forming, the heating introduced by electron beam welding, and the recovery of cold work during the anneal used to degas hydrogen after chemical processing. Data is provided here to show the different properties at various stages of fabrication, including both weld regions and samples from the bulk niobium far away from the weld. Measurements of RRR were used to assure that any contamination during annealing was negligible.

  11. Testing of the new tuner design for the CEBAF 12 GeV upgrade SRF cavities

    SciTech Connect

    Edward Daly; G. Davis; William Hicks


    The new tuner design for the 12 GeV Upgrade SRF cavities consists of a coarse mechanical tuner and a fine piezoelectric tuner. The mechanism provides a 30:1 mechanical advantage, is pre-loaded at room temperature and tunes the cavities in tension only. All of the components are located in the insulating vacuum space and attached to the helium vessel, including the motor, harmonic drive and piezoelectric actuators. The requirements and detailed design are presented. Measurements of range and resolution of the coarse tuner are presented and discussed.

  12. RF and Data Acquisition Systems for Fermilab's ILC SRF Cavity Vertical Test Stand

    SciTech Connect

    Joseph P. Ozelis; Roger Nehring; Christiana Grenoble; Thomas J. Powers


    Fermilab is developing a facility for vertical testing of SRF cavities as part of a program to improve cavity performance reproducibility for the ILC. The RF system for this facility, using the classic combination of oscillator, phase detector/mixer, and loop amplifier to detect the resonant cavity frequency and lock onto the cavity, is based on the proven production cavity test systems used at Jefferson Lab for CEBAF and SNS cavity testing. The design approach is modular in nature, using commercial-off-the-shelf (COTS) components. This yields a system that can be easily debugged and modified, and with ready availability of spares. Data acquisition and control is provided by a PXI-based hardware platform in conjunction with software developed in the LabView programming environment. This software provides for amplitude and phase adjustment of incident RF power, and measures all relevant cavity power levels, cavity thermal environment parameters, as well as field emission-produced radiation. It also calculates the various cavity performance parameters and their associated errors. Performance during system commissioning and initial cavity tests will be presented.

  13. Plasma Treatment of Bulk Niobium Surface for SRF Cavities

    SciTech Connect

    Marija Raskovic; H. Phillips; Anne-Marie Valente


    Pulsed electric discharges were used to demonstrate the validity of plasma surface treatment of superconducting radio-frequency cavities. The experiments were performed on disc-shaped Nb samples and compared with identical samples treated with buffer chemical polishing techniques. The results of several standard surface analytical techniques indicate that plasma-treated samples have comparable or superior properties regarding the surface roughness and composition.

  14. Exploiting new electrochemical understanding of niobium electropolishing for improved performance of SRF cavities for CEBAF

    SciTech Connect

    Reece, Charles E.; Tian, Hui


    Recent incorporation of analytic electrochemistry into the development of protocols for electropolishing niobium SRF cavities has yielded new insights for optimizing this process for consistent, high-performance results. Use of reference electrodes in the electrolyte, electrochemical impedance spectroscopy (EIS), rotating disk electrodes (RDE), and controlled sample temperatures has greatly clarified the process dynamics over the empirical understanding developed via years of practice. Minimizing RF losses at high operational gradients is very valuable for CW linacs. Jefferson Lab is applying these new insights to the low-loss 7-cell cavity design developed for the CEBAF 12 GeV Upgrade. Together with controlled cleaning and assembly techniques to guard against field-emission-causing particulates, the resulting process is yielding consistent cavity performance that exceeds project requirements. Cavity tests show BCS-limited Q well above 30 MV/m. Detailed process data, interpretation, and resulting rf performance data will be presented.

  15. Hydrogen Degassing Study During the Heat Treatment of 1.3-GHZ SRF Cavities

    SciTech Connect

    Joung, Mijoung; Kim, H. J.; Rowe, A.; Wong, M.


    Superconducting radio frequency (SRF) cavities undergo a number of processes as part of its manufacturing procedure in order to optimize their performance. Among these processes is a high temperature hydrogen degas heat treatment used to prevent 'Q' decrease. The heat treatment occurs in the processing sequence after either chemically or mechanically polishing the cavity. This paper summarizes the hydrogen measurements during the heat treatment of a sample of chemically and mechanically polished single-cell and nine-cell 1.3-GHz cavities. The hydrogen measurements are analyzed according the polishing method, the polishing history, the amount of time that the cavity was baked at 800°C, and the temperature ramp rate.


    SciTech Connect

    Ari Palczewski, Rongli Geng, Hui Tian


    We performed Centrifugal Barrel Polishing (CBP) on a 1.3 GHz fine grain TESLA single cell cavity and 1.5 GHz fine grain CEBAF high gradient superconducting radio frequency (SRF) single cell cavity following a modified recipe originally developed at Fermi National Accelerator Lab (FNAL). We were able to obtain a mirror like surface similar to that obtained at FNAL, while reducing the number of CBP steps and total processing time. This paper will discuss the change in surface and subsequent cavity performance post CBP, after a 800 C bake (no pre-bake chemistry) and minimal controlled electro-polishing (10 micron). In addition to Q vs. E{sub ACC} thermometry mapping with preheating characteristics and optical inspection of the cavity after CBP will also be shown.

  17. A Family of L-band SRF Cavities for High Power Proton Driver Applications

    SciTech Connect

    Robert Rimmer, Frank Marhauser


    Recent global interest in high duty factor or CW superconducting linacs with high average beam power highlights the need for robust and reliable SRF structures capable of delivering high average RF power to the beam with moderate HOM damping, low interception of halo and good efficiency. Potential applications include proton or H- drivers for spallation neutron sources, neutrino physics, waste transmutation, subcritical reactors, and high-intensity high-energy physics experiments. We describe a family of SRF cavities with a range of Betas capable of transporting beam currents in excess of 10 mA CW with large irises for minimal interception of halo and HOM and power couplers capable of supporting high average power operation. Goals include an efficient cell shape, high packing factor for efficient real-estate gradient and strong HOM damping to ensure stable beam operation,

  18. Results of Q Disease Tests With 350-MHz Spoke Cavities

    NASA Astrophysics Data System (ADS)

    Tajima, Tsuyoshi; Edwards, Randy L.; Krawczyk, Frank L.; Liu, Jian-Fei; Schrage, Dale L.; Shapiro, Alan H.


    Spoke cavities have been developed at LANL for an accelerator-driven nuclear waste transmutation system. One of the most important issues for this development is how we can build and operate the accelerator at minimum costs. It would save a significant amount of money if we do not need to heat treat the cavity at high temperatures to avoid Q disease. This motivated us to check to see if Q disease occurs with 350-MHz spoke cavities. We have tested 3 cavities, ANL, LANL/EZ02 and LANL/EZ01 so far. The ANL cavity was made of RRR˜150 and the LANL cavities were made of RRR˜250 niobium. The ANL cavity was chemically polished 98 microns at LANL with a standard buffered chemical polishing (BCP) solution, i.e., HF:HNO3:H3PO4=1:1:2 by volume, at 14 - 18 °C. We did not see any Q degradation after holding the cavity at 100 - 102 K for 13 hours or at 100 - 142 K for 86 hours. This cavity was unintentionally baked at >200 °C under poor vacuum, which may have caused thicker oxide layer that prevent the Q disease from occurring as well as due to lower RRR. The LANL/EZ02 and LANL/EZ01 cavities were polished 150 microns with standard BCP solution at <15 °C. The LANL/EZ02 cavity showed a ˜50 % Q degradation after holding the cavity at 100 - 132 K for 61 hours. More systematic tests with LANL/EZ01 to determine the dangerous temperature range precisely are under way by changing the holding temperature every 10 K. The detail of the results will be presented here.

  19. SQUID-based Nondestructive Testing Instrument of Dished Niobium Sheets for SRF Cavities

    SciTech Connect

    Q. S. Shu; I. Ben-Zvi; G. Cheng; I. M. Phipps; J. T. Susta; P. Kneisel; G. Myneni; J. Mast; R. Selim


    Currently available technology can only inspect flat sheets and allow the elimination of defective flat sheets before the expensive forming and machining of the SRF cavity half-cells, but it does not eliminate the problem of remaining or uncovered surface impurities after partial chemical etching of the half-cells, nor does it detect any defects that may have been added during the fabrication of the half-cells. AMAC has developed a SQUID scanning system based on eddy current technique that allows the scanning of curved Nb samples that are welded to make superconducting RF cavity half-cells. AMAC SQUID scanning system successfully located the defects (Ta macro particles about 100 mm diameter) in a flat Nb sample (top side) and was able to also locate the defects in a cylindrical surface sample (top side). It is more significant that the system successfully located the defects on the backside of the flat sample and curved sample or 3-mm from the top surface. The 3-D SQUID-based Nondestructive instrument will be further optimized and improved in making SRF cavities and allow inspection and detection during cavity manufacturing for achieving highest accelarating fields.

  20. Large-Volume Resonant Microwave Discharge for Plasma Cleaning of a CEBAF 5-Cell SRF Cavity

    SciTech Connect

    J. Mammosser, S. Ahmed, K. Macha, J. Upadhyay, M. Nikoli, S. Popovi, L. Vuakovi


    We report the preliminary results on plasma generation in a 5-cell CEBAF superconducting radio-frequency (SRF) cavity for the application of cavity interior surface cleaning. CEBAF currently has {approx}300 of these five cell cavities installed in the Jefferson Lab accelerator which are mostly limited by cavity surface contamination. The development of an in-situ cavity surface cleaning method utilizing a resonant microwave discharge could lead to significant CEBAF accelerator performance improvement. This microwave discharge is currently being used for the development of a set of plasma cleaning procedures targeted to the removal of various organic, metal and metal oxide impurities. These contaminants are responsible for the increase of surface resistance and the reduction of RF performance in installed cavities. The CEBAF five cell cavity volume is {approx} 0.5 m2, which places the discharge in the category of large-volume plasmas. CEBAF cavity has a cylindrical symmetry, but its elliptical shape and transversal power coupling makes it an unusual plasma application, which requires special consideration of microwave breakdown. Our preliminary study includes microwave breakdown and optical spectroscopy, which was used to define the operating pressure range and the rate of removal of organic impurities.

  1. RF breakdown of 805 MHz cavities in strong magnetic fields

    SciTech Connect

    Bowring, D.; Stratakis, D.; Kochemirovskiy, A.; Leonova, M.; Moretti, A.; Palmer, M.; Peterson, D.; Yonehara, K.; Freemire, B.; Lane, P.; Torun, Y.; Haase, A.


    Ionization cooling of intense muon beams requires the operation of high-gradient, normal-conducting RF structures in the presence of strong magnetic fields. We have measured the breakdown rate in several RF cavities operating at several frequencies. Cavities operating within solenoidal magnetic fields B > 0.25 T show an increased RF breakdown rate at lower gradients compared with similar operation when B = 0 T. Ultimately, this breakdown behavior limits the maximum safe operating gradient of the cavity. Beyond ionization cooling, this issue affects the design of photoinjectors and klystrons, among other applications. We have built an 805 MHz pillbox-type RF cavity to serve as an experimental testbed for this phenomenon. This cavity is designed to study the problem of RF breakdown in strong magnetic fields using various cavity materials and surface treatments, and with precise control over sources of systematic error. We present results from tests in which the cavity was run with all copper surfaces in a variety of magnetic fields.


    SciTech Connect

    Gianluigi Ciovati


    A recipe based on centrifugal barrel polishing (CBP) and electropolishing (EP), applied on newly designed single-cells, led to the achievement of B{sub p} values close to the thermodynamic critical field of Nb and to new records in terms of accelerating gradients The fabrication of cavities made of large-grain Nb is emerging as a viable option to reduce the material cost without sacrificing the performance. The Q-drop is not caused exclusively by losses at grain boundaries in Nb. Baking is the only known remedy against the Q-drop and its effect seems to be related to a change of the properties of the Nb up to a depth of about 20 nm. 120 C is the optimum temperature and the baking time can be reduced to 12 h. Cleaning techniques such as high-pressure rinse (HPR) are being studied in detail in order to be optimized for mass-production. Dry-ice cleaning may become a complementary cleaning method. Work is being done to better understand and to improve the EP process.

  3. Proof of Concept Thin Films and Multilayers Toward Enhanced Field Gradients in SRF Cavities

    SciTech Connect

    Lukaszew, R A; Beringer, D; Roach, W M; Eremeev, G V; Valente-Feliciano, A-M; Reece, C E; Xi, X


    Due to the very shallow penetration depth of the RF fields, SRF properties are inherently a surface phenomenon involving a material thickness of less than 1 micron thus opening up the possibility of using thin film coatings to achieve a desired performance. The challenge has been to understand the dependence of the SRF properties on the detailed characteristics of real surfaces and then to employ appropriate techniques to tailor these surface properties for greatest benefit. Our aim is to achieve gradients >100 MV/m and no simple material is known to be capable of sustaining this performance. A theoretical framework has been proposed which could yield such behavior [1] and it requires creation of thin film layered structures. I will present our systematic studies on such proof-of-principle samples. Our overarching goal has been to build a basic understanding of key nano-scale film growth parameters for materials that show promise for SRF cavity multilayer coatings and to demonstrate the ability to elevate the barrier for vortex entry in such layered structures above the bulk value of Hc1 for type-II superconductors and thus to sustain higher accelerating fields.

  4. Routine characterization of 3-D profiles of SRF cavity defects using replica techniques

    SciTech Connect

    Ge, M.; Wu, G.; Burk, D.; Ozelis, J.; Harms, E.; Sergatskov, D.; Hicks, D.; Cooley, L.D.; /Fermilab


    Recent coordination of thermometry with optical images has shown that obvious defects at specific locations produce heat or even quench superconducting radio frequency (SRF) cavities, imposing a significant limit on the overall accelerating gradient produced by the cavity. Characterization of the topography at such locations provides clues about how the defects originated, from which schemes for their prevention might be devised. Topographic analyses also provide understanding of the electromagnetic mechanism by which defects limit cavity performance, from which viability of repair techniques might be assessed. In this article we discuss how a variety of two-component silicone-based room-temperature vulcanizing agents can be routinely used to make replicas of the cavity surface and extract topographic details of cavity defects. Previously, this level of detail could only be obtained by cutting suspect regions from the cavity, thus destroying the cavity. We show 3-D profiles extracted from several different 1.3 GHz cavities. The defect locations, which were all near cavity welds, compelled us to develop extraction techniques for both equator and iris welds as well as from deep inside long 9-cell cavities. Profilometry scans of the replicas yield micrometer-scale information, and we describe various curious features, such as small peaks at the bottom of pits, which were not apparent in previous optical inspections. We also discuss contour information in terms of electromagnetic mechanisms proposed by others for local cavity heating. We show that production of the replica followed by high-pressure rinsing dose not adversely affect the cavity RF performance.

  5. Thermal Analysis of SRF Cavity Couplers Using Parallel Multiphysics Tool TEM3P

    SciTech Connect

    Akcelik, V; Lee, L.-Q.; Li, Z.; Ng, C.-K.; Ko, K.; Cheng, G.; Rimmer, R.; Wang, H.; /Jefferson Lab


    SLAC has developed a multi-physics simulation code TEM3P for simulating integrated effects of electromagnetic, thermal and structural loads. TEM3P shares the same software infrastructure with SLAC's parallel finite element electromagnetic codes, thus enabling all physics simulations within a single framework. The finite-element approach allows high-fidelity, high-accuracy simulations and the parallel implementation facilitates large-scale computation with fast turnaround times. In this paper, TEM3P is used to analyze thermal loading at coupler end of the JLAB SRF cavity.

  6. Thermal Analysis of SRF Cavity Couplers Using Parallel Multiphysics Tool TEM3P

    SciTech Connect

    Akcelik, V, Lee, L.-Q., Li, Z., Ng, C.-K., Ko, K.,Cheng, G., Rimmer, R., Wang, H.


    SLAC has developed a multi-physics simulation code TEM3P for simulating integrated effects of electromagnetic, thermal and structural loads. TEM3P shares the same software infrastructure with SLAC’s paralell finite element electromagnetic codes, thus enabling all physics simulations within a single framework. The finite-element approach allows high fidelity, high-accuracy simulations and the parallel implementation facilitates large-scale computation with fast turnaround times. In this paper, TEM3P is used to analyze thermal loading at coupler end of the JLAB SRF cavity.

  7. SRF and RF systems for LEReC Linac

    SciTech Connect

    Belomestnykh, S.; Ben-Zvi, I.; Brutus, J. C.; Fedotov, A.; McIntyre, G.; Polizzo, S.; Smith, K.; Than, R.; Tuozzolo, J.; Veshcherevich, V.; Wu, Q.; Xiao, B.; Xu, W.; Zaltsman, A.


    The Low Energy RHIC electron Cooling (LEReC) is under development at BNL to improve RHIC luminosity at low energies. It will consist of a short electron linac and two cooling sections, one for blue and one for yellow rings. For the first stage of the project, LEReC-I, we will install a 704 MHz superconducting RF cavity and three normal conducting cavities operating at 9 MHz, 704 MHz and 2.1 GHz. The SRF cavity will boost the electron beam energy up to 2 MeV. The warm cavities will be used to correct the energy spread introduced in the SRF cavity. The paper describes layouts of the SRF and RF systems, their parameters and status.

  8. WAFER TEST CAVITY -Linking Surface Microstructure to RF Performance: a ‘Short-­Sample Test Facility’ for characterizing superconducting materials for SRF cavities.

    SciTech Connect

    Pogue, Nathaniel; Comeaux, Justin; McIntyre, Peter


    The Wafer Test cavity was designed to create a short sample test system to determine the properties of the superconducting materials and S-I-S hetero-structures. The project, funded by ARRA, was successful in accomplishing several goals to achieving a high gradient test system for SRF research and development. The project led to the design and construction of the two unique cavities that each severed unique purposes: the Wafer test Cavity and the Sapphire Test cavity. The Sapphire Cavity was constructed first to determine the properties of large single crystal sapphires in an SRF environment. The data obtained from the cavity greatly altered the design of the Wafer Cavity and provided the necessary information to ascertain the Wafer Test cavity’s performance.

  9. Where Next with SRF?

    SciTech Connect

    Ciovati, Gianluigi


    RF superconductivity (SRF) has become, over the last ~20 years, the technology of choice to produce RF cavities for particle accelerators. This occurred because of improvements in material and processing techniques as well as the understanding and remediation of practical limitations in SRF cavities. This development effort span ~40 years and Nb has been the material of choice for SRF cavity production. As the performances of SRF Nb cavities are approaching what are considered to be theoretical limits of the material, it is legitimate to ask what will be the future of SRF. In this article we will attempt to answer this question on the basis of near-future demands for SRF-based accelerators and the basic SRF properties of the available materials. Clearly, Nb will continue to play a major role in SRF cavities in the coming years but the use of superconductors with higher critical temperature than Nb is also likely to occur.

  10. 800MHz Crab Cavity Conceptual Design For the LHC Upgrade

    SciTech Connect

    Xiao, Liling; Li, Zenghai; Ng, Cho-Kuen; Seryi, Andrei; /SLAC


    In this paper, we present an 800 MHz crab cavity conceptual design for the LHC upgrade. The cell shape is optimized for lower maximum peak surface fields as well as higher transverse R/Q. A compact coax-to-coax coupler scheme is proposed to damp the LOM/SOM modes. A two-stub antenna with a notch filter is used as the HOM coupler to damp the HOM modes in the horizontal plane and rejects the operating mode at 800MHz. Multipacting (MP) simulations show that there are strong MP particles at the disks. Adding grooves along the short axis without changing the operating mode's RF characteristics can suppress the MP activities. Possible input coupler configurations are discussed.

  11. Impact of forming, welding, and electropolishing on pitting and the surface finish of SRF cavity niobium

    SciTech Connect

    Cooley, L.D.; Burk, D.; Cooper, C.; Dhanaraj, N.; Foley, M.; Ford, D.; Gould, K.; Hicks, D.; Novitski, R.; Romanenko, A.; Schuessler, R.; /Fermilab


    A broad range of coupon electropolishing experiments are described to ascertain the mechanism(s) by which large defects are formed near superconducting radiofrequency (SRF) cavity welds. Cold-worked vs. annealed metal, the presence of a weld, and several variations of electropolishing (EP) parameters were considered. Pitting is strongly promoted by cold work and agitation of the EP solution. Welding also promotes pitting, but less so compared with the other factors above. Temperature increase during EP did not strongly affect glossiness or pitting, but the reduced viscosity made the electrolyte more susceptible to agitation. The experiments suggest that several factors that are rather benign alone are combined by the cavity forming, welding, and processing sequence to promote the formation of defects such as pits. Process changes to mitigate these risks are discussed.

  12. Field Emission in CEBAF's SRF Cavities and Implications for Future Accelerators

    SciTech Connect

    Jay Benesch


    Field emission is one of the key issues in superconducting RF for particle accelerators. When present, it limits operating gradient directly or via induced heat load at 2K. In order to minimize particulate contamination of and thus field emission in the CEBAF SRF cavities during assembly, a cold ceramic RF window was placed very close to the accelerating cavity proper. As an unintended consequence of this, the window is charged by field-emitted electrons, making it possible to monitor and model field emission in the CEBAF cavities since in-tunnel operation began. From January 30, 1995, through February 10, 2003, there were 64 instances of spontaneous onset or change in cavity field emission with a drop in usable gradient averaging 1.4 ({sigma} 0.8) MV/m at each event. Fractional loss averaged 0.18 ({sigma} 0.12) of pre-event gradient. This event count corresponds to 2.4 events per century per cavity, or 8 per year in CEBAF. It is hypothesized that changes in field emission are due to adsorbed gas accumulation. The possible implications of this and other observations for the International Linear Collider (ILC) and other future accelerators will be discussed.


    SciTech Connect

    Haipeng Wang; Robert Rimmer; Frank Marhauser


    After an initial cavity shape optimization [1] and cryomodule development [2] for an Ampere-class FEL ERL, we have simulated a complete 5-cell high-current (HC) cavity structure with six waveguide (WG) couplers for Higher Order Mode (HOM) damping and fundamental power coupling. The time-domain wakefield simulations of the MAFIA codes have been used to calculate the cavities broadband HOM impedance spectrum. Microwave Studio (MWS) has also been used to evaluate the external Q of the fundamental power coupler (FPC) and the R/Qs of the HOMs. A half scale 1497MHz single-cell model cavity and a 5-cell copper cavity including dummy HOM WG loads were fabricated to bench measure and confirm the design performance. Details of the multi-beam wakefield simulations, the HOM damping measurements and multi-peak data fitting analysis techniques are presented.

  14. Exploration of material removal rate of srf elliptical cavities as a function of media type and cavity shape on niobium and copper using centrifugal barrel polishing (cbp)

    SciTech Connect

    Palczewski, Ari; Ciovati, Gianluigi; Li, Yongming; Geng, Rongli


    Centrifugal barrel polishing (cbp) for SRF application is becoming more wide spread as the technique for cavity surface preparation. CBP is now being used in some form at SRF laboratories around the world including in the US, Europe and Asia. Before the process can become as mature as wet chemistry like eletro-polishing (EP) and buffered chemical polishing (BCP) there are many questions which remain unanswered. One of these topics includes the uniformity of removal as a function of cavity shape and material type. In this presentation we show CBP removal rates for various media types on 1.3 GHz TESLA and 1.5 GHz CEBAF large/fine grain niobium cavities, and 1.3GHz low surface field copper cavity. The data will also include calculated RF frequency shift modeling non-uniform removal as a function of cavity position and comparing them with CBP results.

  15. Wisconsin SRF Electron Gun Commissioning

    SciTech Connect

    Bisognano, Joseph J.; Bissen, M.; Bosch, R.; Efremov, M.; Eisert, D.; Fisher, M.; Green, M.; Jacobs, K.; Keil, R.; Kleman, K.; Rogers, G.; Severson, M.; Yavuz, D. D.; Legg, Robert A.; Bachimanchi, Ramakrishna; Hovater, J. Curtis; Plawski, Tomasz; Powers, Thomas J.


    The University of Wisconsin has completed fabrication and commissioning of a low frequency (199.6 MHz) superconducting electron gun based on a quarter wave resonator (QWR) cavity. Its concept was optimized to be the source for a CW free electron laser facility. The gun design includes active tuning and a high temperature superconducting solenoid. We will report on the status of the Wisconsin SRF electron gun program, including commissioning experience and first beam measurements.

  16. Fast 704 MHz Ferroelectric Tuner for Superconducting Cavities

    SciTech Connect

    Jay L. Hirshfield


    The Omega-P SBIR project described in this Report has as its goal the development, test, and evaluation of a fast electrically-controlled L-band tuner for BNL Energy Recovery Linac (ERL) in the Electron Ion Collider (EIC) upgrade of the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory (BNL). The tuner, that employs an electrically-controlled ferroelectric component, is to allow fast compensation to cavity resonance changes. In ERLs, there are several factors which significantly affect the amount of power required from the wall-plug to provide the RF-power level necessary for the operation. When beam loading is small, the power requirements are determined by (i) ohmic losses in cavity walls, (ii) fluctuations in amplitude and/or phase for beam currents, and (iii) microphonics. These factors typically require a substantial change in the coupling between the cavity and the feeding line, which results in an intentional broadening of the cavity bandwidth, which in turn demands a significant amount of additional RF power. If beam loading is not small, there is a variety of beam-drive phase instabilities to be managed, and microphonics will still remain an issue, so there remain requirements for additional power. Moreover ERL performance is sensitive to changes in beam arrival time, since any such change is equivalent to phase instability with its vigorous demands for additional power. In this Report, we describe the new modular coaxial tuner, with specifications suitable for the 704 MHz ERL application. The device would allow changing the RF-coupling during the cavity filling process in order to effect significant RF power savings, and also will provide rapid compensation for beam imbalance and allow for fast stabilization against phase fluctuations caused by microphonics, beam-driven instabilities, etc. The tuner is predicted to allow a reduction of about ten times in the required power from the RF source, as compared to a compensation system

  17. A novel approach to characterizing the surface topography of niobium superconducting radio frequency (SRF) accelerator cavities

    SciTech Connect

    Hui Tian, Guilhem Ribeill, Chen Xu, Charles E. Reece, Michael J. Kelley


    As superconducting niobium radio-frequency (SRF) cavities approach fundamental material limits, there is increased interest in understanding the details of topographical influences on realized performance limitations. Micro- and nano-roughness are implicated in both direct geometrical field enhancements as well as complications of the composition of the 50 nm surface layer in which the super-currents typically flow. Interior surface chemical treatments such as buffered chemical polishing (BCP) and electropolishing (EP) used to remove mechanical damage leave surface topography, including pits and protrusions of varying sharpness. These may promote RF magnetic field entry, locally quenching superconductivity, so as to degrade cavity performance. A more incisive analysis of surface topography than the widely used average roughness is needed. In this study, a power spectral density (PSD) approach based on Fourier analysis of surface topography data acquired by both stylus profilometry and atomic force microscopy (AFM) is introduced to distinguish the scale-dependent smoothing effects, resulting in a novel qualitative and quantitative description of Nb surface topography. The topographical evolution of the Nb surface as a function of different steps of well-controlled EP is discussed. This study will greatly help to identify optimum EP parameter sets for controlled and reproducible surface levelling of Nb for cavity production.

  18. Surface polishing of niobium for superconducting radio frequency (SRF) cavity applications

    SciTech Connect

    Zhao, Liang


    Niobium cavities are important components in modern particle accelerators based on superconducting radio frequency (SRF) technology. The interior of SRF cavities are cleaned and polished in order to produce high accelerating field and low power dissipation on the cavity wall. Current polishing methods, buffered chemical polishing (BCP) and electro-polishing (EP), have their advantages and limitations. We seek to improve current methods and explore laser polishing (LP) as a greener alternative of chemical methods. The topography and removal rate of BCP at different conditions (duration, temperature, sample orientation, flow rate) was studied with optical microscopy, scanning electron microscopy (SEM), and electron backscatter diffraction (EBSD). Differential etching on different crystal orientations is the main contributor to fine grain niobium BCP topography, with gas evolution playing a secondary role. The surface of single crystal and bi-crystal niobium is smooth even after heavy BCP. The topography of fine grain niobium depends on total removal. The removal rate increases with temperature and surface acid flow rate within the rage of 0~20 °C, with chemical reaction being the possible dominate rate control mechanism. Surface flow helps to regulate temperature and avoid gas accumulation on the surface. The effect of surface flow rate on niobium EP was studied with optical microscopy, atomic force microscopy (AFM), and power spectral density (PSD) analysis. Within the range of 0~3.7 cm/s, no significant difference was found on the removal rate and the macro roughness. Possible improvement on the micro roughness with increased surface flow rate was observed. The effect of fluence and pulse accumulation on niobium topography during LP was studied with optical microscopy, SEM, AFM, and PSD analysis. Polishing on micro scale was achieved within fluence range of 0.57~0.90 J/cm2, with pulse accumulation adjusted accordingly. Larger area treatment was proved possible by

  19. Surface Topography of 'Hotspot' Regions from a Single Cell SRF Cavity

    SciTech Connect

    Xin Zhao, Gianluigi Ciovati, Charles Reece, Andy Wu


    Performance of SRF cavities are limited by non-linear localized effects. The variation of local material characters between "hot" and "cold" spots is thus of intense interest. Such locations were identified in a BCP-etched large-grain single-cell cavity and removed for examination by high resolution electron microscopy (SEM), electron-back scattering diffraction microscopy (EBSD), optical microscopy, and 3D profilometry. Pits with clearly discernable crystal facets were observed in both "hotspot" and "coldspot" specimens. The pits were found in-grain, at bi-crystal boundaries, and on tri-crystal junctions. They are interpreted as etch pits induced by surface crystal defects (e.g. dislocations). All "coldspots" examined had qualitatively low density of etching pits or very shallow tri-crystal boundary junction. EBSD revealed the crystal structure surrounding the pits via crystal phase orientation mapping, while 3D profilometry gave information on the depth and size of the pits. In addition, a survey of the samples by energy dispersive X-ray analysis (EDX) did not show any significant contamination of the samples surface.


    SciTech Connect

    Marhauser, Frank; Clemens, William; Cheng, Guangfeng; Ciovati, Gianluigi; Daly, Edward; Forehand, Daniel; Henry, James; Kneisel, Peter; Manning, Stephen; Manus, Robert; Rimmer, Robert; Tennant, Christopher; Wang, Haipeng


    The development of a new compact CW cryomodule for use in future Energy Recovery Linacs (ERLs) and Free Electron Lasers (FELs) is underway at JLab with the objective of transporting beam current up to Ampere-levels. Design goals include broadband cavity Higher Order Mode (HOM) damping, HOMs tuned to safe frequencies to minimize the power extracted from the beam, good real-estate gradient and cryogenic efficiency and consideration of cost and maintainability. Two 1497 MHz high current niobium five-cell cavities with waveguide end groups have been manufactured recently. We report on the latest results including high field tests in a vertical Dewar at 2K and a detailed assessment of the impedance budget for beam breakup (BBU) instability. The general cryomodule and cavity concept is described as well.

  1. Investigations of Residual Stresses and Mechanical Properties of Single Crystal Niobium for SRF Cavities

    SciTech Connect

    Thomas Gnäupel-Herold; Ganapati Rao Myneni; Richard E. Ricker


    This work investigates properties of large grained, high purity niobium with respect to the forming of superconducting radio frequency (SRF) cavities from such large grained sheets. The yield stresses were examined using tensile specimens that were essentially single crystals in orientations evenly distributed in the standard projection triangle. No distinct yield anisotropy was found, however, vacuum annealing increased the yield strength by a factor 2..3. The deep drawing forming operation of the half cells raises the issues of elastic shape changes after the release of the forming tool (springback) and residual stresses, both of which are indicated to be negligible. This is a consequence of the low yield stress (< 100 MPa) and the large thickness (compared to typical thicknesses in sheet metal forming). However, the significant anisotropy of the transversal plastic strains after uniaxial deformation points to potentially critical thickness variations for large grained / single crystal half cells, thus raising the issue of controlling grain orientation or using single crystal sheet material.

  2. Concept em design of the 650 MHz cavities for the Project X

    SciTech Connect

    Yakovlev, V.; Champion, M.; Gonin, I.; Lunin, A.; Kazakov, S.; Khabiboulline, T.; Solyak, N.; Saini, A.; /Fermilab


    Concept of the 650 MHz cavities for the Project X is presented. Choice of the basic parameters, i.e., number of cells, geometrical {beta}, apertures, coupling coefficients, etc., is discussed. The cavity optimization criteria are formulated. Results of the RF design are presented for the cavities of both the low-energy and high-energy sections.


    SciTech Connect



    Applications in high energy physics accelerators and other fields require the use of thousands of superconducting RF (SRF) cavities that are made of high purity Nb material and the purity of niobium is critical for these cavities to reach the highest accelerating fields. Tantalum is the most prolific of metal inclusions, which can cause thermal breakdown and prevent the cavities from reaching their theoretical performance limits of 45-50 MV/m, and DOE Labs are searching for a technology that could detect small impurities in superconducting Nb sheets reaching the highest possible accelerating fields. The proposed innovative SQUID-based Nondestructive system can scan Niobium sheets used in the manufacturing of SRF cavities with both high speed and high resolution. A highly sensitive SQUID system with a gradiometer probe, non-magnetic dewar, data acquisition system, and a scanning system will be developed for fast detection of impurities in planar Nb sheets. In phase I, we will modify our existing SQUID-based eddy current system to detect 100 micron size Ta defects and a great effort will focus on achieving fast scanning of a large number of niobium sheets in a shorter time and with reasonable resolution. An older system operated by moving the sample 1 mm, stopping and waiting for 1-2 seconds, then activating a measurement by the SQUID after the short settle time is modified. A preliminary designed and implemented a SQUID scanning system that is fast and is capable of scanning a 30 cm x 30 cm Nb sheet in 15 minutes by continuously moving the table at speeds up to 10 mm/s while activating the SQUID at 1mm interval is modified and reached the Phase I goal of 100mm resolution. We have successfully demonstrated the feasibility that a fast speed SQUID scanner without sacrificing the resolution of detection can be done, and a data acquisition and analysis system is also preliminary developed. The SQUID based scanner will help reach the highest accelerating field in SRF

  4. Basic Electropolishing Process Research and Development in Support of Improved Reliable Performance SRF Cavities for the Future Accelerator

    SciTech Connect

    H. Tian, C.E. Reece,M.J. Kelley


    Future accelerators require unprecedented cavity performance, which is strongly influenced by interior surface nanosmoothness. Electropolishing is the technique of choice to be developed for high-field superconducting radiofrequency cavities. Electrochemical impedance spectroscopy (EIS) and related techniques point to the electropolishing mechanism of Nb in a sulfuric and hydrofluoric acid electrolyte of controlled by a compact surface salt film under F- diffusion-limited mass transport control. These and other findings are currently guiding a systematic characterization to form the basis for cavity process optimization, such as flowrate, electrolyte composition and temperature. This integrated analysis is expected to provide optimum EP parameter sets for a controlled, reproducible and uniform surface leveling for Nb SRF cavities.

  5. SRF photoinjector for proof-of-principle experiment of coherent electron cooling at RHIC

    SciTech Connect

    Kayran D.; Belomestnykh, S.; Ben-Zvi, I.; Brutus, J.C.; et al


    Coherent Electron Cooling (CEC) based on Free Electron Laser (FEL) amplifier promises to be a very good way to cool protons and ions at high energies. A proof of principle experiment to demonstrate cooling at 40 GeV/u is under construction at BNL. One of possible sources to provide sufficient quality electron beam for this experiment is a SRF photoinjector. In this paper we discuss design and simulated performance of the photoinjector based on existing 112 MHz SRF gun and newly designed single-cavity SRF linac operating at 704 MHz.

  6. Film Deposition, Cryogenic RF Testing and Materials Analysis of a Nb/Cu Single Cell SRF Cavity

    SciTech Connect

    Zhao, Xin; Geng, Rongli; Palczerski, Ari; Li, Yongming


    In this study, we present preliminary results on using a cathodic-arc-discharge Nb plasma ion source to establish a Nb film-coated single-cell Cu cavity for SRF research. The polycrystalline Cu cavity was fabricated and mirror-surface-finished by a centrifugal barrel polishing (CBP) process at Jefferson Lab. Special pre-coating processes were conducted, in order to create a template-layer for follow-on Nb grain thickening. A sequence of cryogenic RF testing demonstrated that the Nb film does show superconductivity. But the quality factor of this Nb/Cu cavity is low as a result of high residual surface resistance. We are conducting a thorough materials characterization to explore if some microstructural defects or hydrogen impurities, led to such a low quality factor.

  7. Improvement of the operational performance of SRF cavities via in situ helium processing and waveguide vacuum processing

    SciTech Connect

    Reece, C.E.; Drury, M.; Rao, M.G.; Nguyen-Tuong, V.


    The useful performance range of the superconducting rf (SRF) cavities in the CEBAF accelerator at Jefferson Lab is frequently limited by electron field emission and derived phenomena. Improvements are required to support future operation of the accelerator at higher than 5 GeV. Twelve operational cryomodules have been successfully processed to higher useful operating gradients via rf-helium processing. Progress against field emission was evidenced by improved high-field Q, reduced x-ray production and greatly reduced incidence of arcing at the cold ceramic window. There was no difficulty reestablishing beamline vacuum following the processing. Cavities previously limited to 4-6 MV/m are now operating stably at 6-9 MV/m. By applying a pulsed-rf processing technique, we have also improved the pressure stability of the thermal transition region of the input waveguide for several cavities.

  8. A 201-MHz Normal Conducting RF Cavity for the International MICE Experiment

    SciTech Connect

    Li, D.; DeMello, A.J.; Virostek, Steve; S. Zisman, Michael; Rimmer, Robert


    MICE is a demonstration experiment for the ionization cooling of muon beams. Eight RF cavities are proposed to be used in the MICE cooling channel. These cavities will be operated in a strong magnetic field; therefore, they must be normal conducting. The cavity design and construction are based on the successful experience and techniques developed for a 201-MHz prototype cavity for the US MUCOOL program. Taking advantage of a muon beamâ s penetration property, the cavity employs a pair of curved thin beryllium windows to terminate conventional beam irises and achieve higher cavity shunt impedance. The cavity resembles a round, closed pillbox cavity. Two half-shells spun from copper sheets are joined by e-beam welding to form the cavity body. There are four ports on the cavity equator for RF couplers, vacuum pumping and field probes. The ports are formed by means of an extruding technique.

  9. Grid Window Tests on an 805-MHz Pillbox Cavity

    SciTech Connect

    Torun, Y.; Moretti, A.


    Muon ionization cooling channel designs use pillbox shaped RF cavities for improved power efficiency and fine control over phasing of individual cavities. For minimum scattering of the muon beam, the ends should be made out of a small thickness of high radiation length material. Good electrical and thermal conductivity are required to reduce power dissipation and remove the heat efficiently. Thin curved beryllium windows with TiN coating have been used successfully in the past. We have built an alternative win- dow set consisting of grids of tubes and tested these on a pillbox cavity previously used with both thin Be and thick Cu windows. The cavity was operated with a pair of grids as well as a single grid against a flat endplate.

  10. R&D Status for In-Situ Plasma Surface Cleaning of SRF Cavities at Spallation Neutron Source

    SciTech Connect

    S.-H. Kim, M.T. Crofford, M. Doleans, J.D. Mammosser, J. Saunders


    The SNS SCL is reliably operating at 0.93 GeV output energy with an energy reserve of 10MeV with high availability. Most of the cavities exhibit field emission, which directly or indirectly (through heating of end groups) limits the gradients achievable in the high beta cavities in normal operation with the beam. One of the field emission sources would be surface contaminations during surface processing for which mild surface cleaning, if any, will help in reducing field emission. An R&D effort is in progress to develop in-situ surface processing for the cryomodules in the tunnel without disassembly. As the first attempt, in-situ plasma processing has been applied to the CM12 in the SNS SRF facility after the repair work with a promising result. This paper will report the R&D status of plasma processing in the SNS.

  11. Progress on the high-current 704 MHz superconducting RF cavity at BNL

    SciTech Connect

    Xu W.; Astefanous, C.; Belomestnykh, S.; Ben-Zvi, I.; et al


    The 704 MHz high current superconducting cavity has been designed with consideration of both performance of fundamental mode and damping of higher order modes. A copper prototype cavity was fabricated by AES and delivered to BNL. RF measurements were carried out on this prototype cavity, including fundamental pass-band and HOM spectrum measurements, HOM studies using bead-pull setup, prototyping of antenna-type HOM couplers. The measurements show that the cavity has very good damping for the higher-order modes, which was one of the main goals for the high current cavity design. 3D cavity models were simulated with Omega3P code developed by SLAC to compare with the measurements. The paper describes the cavity design, RF measurement setups and results for the copper prototype. The progress with the niobium cavity fabrication will also be described.

  12. Dark Current and X Ray Measurements of an 805 MHz Pillbox Cavity

    SciTech Connect

    J. Norem; P. Gruber; A. Bross; S. Geer; A. Moretti; Z Qian; D. M. Kaplan; Y. Torun; R. Rimmer; Derun Li; M. Zisman


    The muon cooling systems proposed for neutrino factories require low frequency (201 MHz) RF cavities with Be windows, at high gradient (Eacc {approx} 16 MV/m), in strong solenoidal magnetic field ({approx} 5 T). For the proposed Muon Ionization Cooling Experiment (MICE) [1], an experimental demonstration of cooling, we have an additional constraint that we must operate sensitive particle detectors very close to the RF cavities, which produce backgrounds from dark currents and x rays. To understand the processes involved in cavity conditioning and operation near particle detectors, we have constructed a test facility at Lab G of Fermilab, where a 5 Tesla superconducting solenoid, a 14 MW peak power klystron and a pillbox test cavity at 805 MHz are available. We present measurements of dark currents, x rays and surface structure from the pillbox cavity, with both copper and beryllium endplates, and discuss the interaction between surface structure and radiation backgrounds produced.

  13. Fabrication of the prototype 201.25 mhz cavity for a muon ionization cooling experiment

    SciTech Connect

    Rimmer, R.A.; Manning, S.; Manus, R.; Phillips, L.; Stirbet, M.; Worland, K.; Wu, G.; Li, D.; MacGill, R.; Staples, J.; Virostek, S.; Zisman, M.S.; Taminger, K.; Hafley, R.; Martin, R.; Summers, D.; Reep, M.


    We describe the fabrication and assembly of the first prototype 201. 25 MHz copper cavity for the muon ionization cooling experiment (MICE). This cavity was developed by the US MUCOOL collaboration and will be tested in the new MUCOOL Test Area at Fermilab. We outline the component and subassembly fabrication steps and the various metal forming and joining methods used to produce the final cavity shape. These include spinning, brazing, TIG welding, electron beam welding, electron beam annealing and deep drawing. Some of the methods developed for this cavity are novel and offer significant cost savings over conventional methods.

  14. Fabrication of the Prototype 201.25 MHz Cavity for a Muon Ionization Cooling Experiment

    SciTech Connect

    R.A. Rimmer; S. Manning; R. Manus; L. Phillips; M. Stirbet; K. Worland; G. Wu; D. Li; R. MacGill; J. Staples; S. Virostek; M. Zisman; K. Taminger; R. Hafley; R. Martin; D. Summers; M. Reep


    We describe the fabrication and assembly of the first prototype 201.25 MHz copper cavity for the muon ionization cooling experiment (MICE). This cavity was developed by the US MUCOOL collaboration and will be tested in the new MUCOOL Test Area at Fermilab. We outline the component and subassembly fabrication steps and the various metal forming and joining methods used to produce the final cavity shape. These include spinning, brazing, TIG welding, electron beam welding, electron beam annealing and deep drawing. Some of the methods developed for this cavity are novel and offer significant cost savings over conventional construction methods.

  15. RF properties of 1050 MHz, β = 0.49 Elliptical cavity for High Current Proton Acceleration

    NASA Astrophysics Data System (ADS)

    Roy, Amitava; Mondal, J.; Mittal, K. C.


    BARC is developing technology for the accelerator driven subcritical system (ADSS) that will be mainly utilized for the transmutation of nuclear waste and enrichment of U233. Design and development of superconducting medium velocity cavity has been taken up as a part of the accelerator driven subcritical system project. We have studied RF properties of 1050 MHz, β = 0.49 single cell Elliptical cavity for possible use in High Current Proton Accelerator. Cavity shape optimization studies have been done by means of 2D cavity tuning code SUPERFISH and 3D High Frequency Simulation code CST Microwave Studio. The cavity peak electric and magnetic fields, power dissipation Pc, quality factor Q and effective shunt impedante ZT2 were calculated for various cavity dimensions using these codes. Based on these analyses a list of design parameter for the inner cell of the cavity has been suggested for possible use in high current proton accelerator.


    SciTech Connect

    Rose, J.; Gash, W.; Kosciuk, B.; Ravindranath, V.; Sikora, B.; Sharma, S.; Towne, N.; Grimm, T.L.; Boulware, C.H.; Krizmanich, C.; Kuhlman, B.; Miller, N.; Siegel, B.; Winowski, M.


    NSLS-II is a new ultra-bright 3 GeV 3rd generation synchrotron radiation light source. The performance goals require operation with a beam current of 500mA and a bunch current of at least 0.5mA. Ion clearing gaps are required to suppress ion effects on the beam. The natural bunch length of 3mm is planned to be lengthened by means of a third harmonic cavity in order to increase the Touschek limited lifetime. Earlier work described the design alternatives and the geometry selected for a copper prototype. We subsequently have iterated the design to lower the R/Q of the cavity and to increase the diameter of the beam pipe ferrite HOM dampers to reduce the wakefield heating. A niobium cavity and full cryomodule including LN2 shield, magnetic shield and insulating vacuum vessel have been fabricated and installed. A passive SRF 3rd harmonic cavity consisting of two tightly coupled cells has been designed and fabricated for NSLS-II. Initial cold tests of this cavity are very promising. These tests have verified that the cavity frequency and mode separation between the 0 and {pi}-modes can be set at manufacture. Further, the frequency separation can be maintained over wide tuning ranges necessary for operation. Future work includes HOM damper and motorized tuner development.

  17. Design, Construction, and Initial Test of High Spatial Resolution Thermometry Arrays for Detection of Surface Temperature Profiles on SRF Cavities in Super Fluid Helium

    SciTech Connect

    Ari Palczewski, Rongli Geng, Grigory Eremeev


    We designed and built two high resolution (0.6-0.55mm special resolution [1.1-1.2mm separation]) thermometry arrays prototypes out of the Allen Bradley 90-120 ohm 1/8 watt resistor to measure surface temperature profiles on SRF cavities. One array was designed to be physically flexible and conform to any location on a SRF cavity; the other was modeled after the common G-10/stycast 2850 thermometer and designed to fit on the equator of an ILC (Tesla 1.3GHz) SRF cavity. We will discuss the advantages and disadvantages of each array and their construction. In addition we will present a case study of the arrays performance on a real SRF cavity TB9NR001. TB9NR001 presented a unique opportunity to test the performance of each array as it contained a dual (4mm separation) cat eye defect which conventional methods such as OST (Oscillating Superleak second-sound Transducers) and full coverage thermometry mapping were unable to distinguish between. We will discuss the new arrays ability to distinguish between the two defects and their preheating performance.

  18. Great progress in developing 500 MHz single cell superconducting cavity in China

    NASA Astrophysics Data System (ADS)

    Liu, JianFei; Hou, HongTao; Mao, DongQing; Feng, ZiQiang; Ma, ZhenYu; Luo, Chen; Zhao, ShenJie; Zhao, YuBin; Yu, HaiBo; Yin, Bo; Zhang, ZhiGang; Zheng, Xiang; Li, Zheng


    Superconducting cavities have been adopted in many kinds of accelerator facilities such as synchrotron radiation light source, hard X-ray free electron laser linac, colliders and energy recovery linacs (ERL). The 500 MHz superconducting cavities will be a candidate to be installed in the high current accelerators and high current ERLs for their large beam aperture, low higher order modes impedance and high current threshold value. This paper presents great progress in the whole sequence of developing 500 MHz superconducting cavity in China. It describes the first in-house successful development of 500 MHz single cell superconducting cavity including the deep-drawing of niobium half cells, electron beam wielding of cavity, surface preparations and vertical testing. The highest accelerating gradient of the fabricated cavity #SCD-02 higher than 10 MV/m was obtained while the quality factor was better than 4×108 at 4.2 K, which has reached the world level of the same kind of cavities.

  19. Computer-aided studies of the ALS 500 MHz storage ring cavity

    SciTech Connect

    Lo, C.C.; Taylor, B.


    The design of the ALS storage ring 500 MHz cavity has been modeled with Mafia and Urmel codes. The effects of the holes cut for the drive port, the higher order mode damping port, the probe port and tuner plunger were modeled with the Mafia codes. The frequency dependence on the shape and spacing of the nose cones and the general shape of the cavity were modeled with Urmel codes. 9 refs., 7 figs., 1 tab.

  20. Operation of the 56 MHz superconducting RF cavity in RHIC during run 14

    SciTech Connect

    Wu, Q.; Belomestnykh, S.; Ben-Zvi, I.; Blaskiewicz, M.; Hayes, T.; Mernick, K.; Severino, F.; Smith, K.; Zaltsman, A.


    A 56 MHz superconducting RF cavity was designed and installed in the Relativistic Heavy Ion Collider (RHIC). It is the first superconducting quarter wave resonator (QWR) operating in a high-energy storage ring. We discuss herein the cavity operation with Au+Au collisions, and with asymmetrical Au+He3 collisions. The cavity is a storage cavity, meaning that it becomes active only at the energy of experiment, after the acceleration cycle is completed. With the cavity at 300 kV, an improvement in luminosity was detected from direct measurements, and the bunch length has been reduced. The uniqueness of the QWR demands an innovative design of the higher order mode dampers with high-pass filters, and a distinctive fundamental mode damper that enables the cavity to be bypassed during the acceleration stage.

  1. Multi-purpose 805 MHz Pillbox RF Cavity for Muon Acceleration Studies

    SciTech Connect

    Kurennoy, Sergey S.; Chan, Kwok-Chi Dominic; Jason, Andrew; Miyadera, Haruo; Turchi, Peter J.


    An 805 MHz RF pillbox cavity has been designed and constructed to investigate potential muon beam acceleration and cooling techniques. The cavity can operate at vacuum or under pressure to 100 atmospheres, at room temperature or in a liquid nitrogen bath at 77 K. The cavity is designed for easy assembly and disassembly with bolted construction using aluminum seals. The surfaces of the end walls of the cavity can be replaced with different materials such as copper, aluminum, beryllium, or molybdenum, and with different geometries such as shaped windows or grid structures. Different surface treatments such as electro polished, high-pressure water cleaned, and atomic layer deposition are being considered for testing. The cavity has been designed to fit inside the 5-Tesla solenoid in the MuCool Test Area at Fermilab. Current status of the cavity prepared for initial conditioning and operation in the external magnetic field is discussed.

  2. Beam dynamics and expected RHIC performance with 56MHz RF upgrade

    SciTech Connect

    Fedotov,A.V.; Ben-Zvi, I.


    An upgrade of the RHIC storage RF system with a superconducting 56 MHz cavity was recently proposed. This upgrade will provide a significant increase in the acceptance of the RHIC 197 MHz storage RF bucket. This paper summarizes simulations of beam evolution due to intra-beam scattering (IBS) for beam parameters expected with the 56 MHz SRF cavity upgrade. Expected luminosity improvements are shown for Au ions at 100 GeV/nucleon and protons at 250 GeV.

  3. Overview of high gradient SRF R&D for ILC cavities at Jefferson Lab

    SciTech Connect

    Geng, Rongli


    We report the progress on high gradient R&D of ILC cavities at Jefferson Lab (JLab) since the Beijing workshop. Routine 9-cell cavity electropolishing (EP) processing and RF testing has been enhanced with added surface mapping and T-mapping instrumentations. 12 new 9-cell cavities (10 of them are baseline fine-grain TESLA-shape cavities: 5 built by ACCEL/Research Instruments, 4 by AES and 1 by JLab; 2 of them are alternative cavities: 1 fine-grain ICHIRO-shape cavity built by KEK/Japan industry and 1 large-grain TESLA-shape cavity built by JLab) are EP processed and tested. 76 EP cycles are accumulated, corresponding to more than 200 hours of active EP time. Field emission (FE) and quench behaviors of electropolished 9-cell cavities are studied. EP process continues to be optimized, resulting in advanced procedures and hence improved cavity performance. Several 9-cell cavities reached 35 MV/m after the first light EP processing. FE-free performance has been demonstrated in 9-cell cavities in 35-40 MV/m range. 1-cell cavity studies explore new techniques for defect removal as well as advanced integrated cavity processing. Surface studies of niobium samples electropolished together with real cavities provide new insight into the nature of field emitters. Close cooperation with the US cavity fabrication industry has been undertaking with the successful achievement of 41 MV/m for the first time in a 9-cell ILC cavity built by AES. As the size of the data set grows, it is now possible to construct gradient yield curves, from which one can see that significant progress has been made in raising the high gradient yield.

  4. Comparison of higher order modes damping techniques for 800 MHz single cell superconducting cavities

    NASA Astrophysics Data System (ADS)

    Shashkov, Ya. V.; Sobenin, N. P.; Petrushina, I. I.; Zobov, M. M.


    At present, applications of 800 MHz harmonic cavities in both bunch lengthening and shortening regimes are under consideration and discussion in the framework of the High Luminosity LHC project. In this paper we study electromagnetic characteristics of high order modes (HOMs) for a single cell 800 MHz superconducting cavity and arrays of such cavities connected by drifts tubes. Different techniques for the HOMs damping such as beam pipe grooves, coaxial-notch loads, fluted beam pipes etc. are investigated and compared. The influence of the sizes and geometry of the drift tubes on the HOMs damping is analyzed. The problems of a multipacting discharge in the considered structures are discussed and the operating frequency detuning due to the Lorentz force is evaluated.

  5. Development of 400- to 450-MHz RFQ resonator-cavity mechanical designs

    SciTech Connect

    Hansborough, L.D.


    In the development of the radio-frequency quadrupole (RFQ) linac, the resonator cavity's mechanical design may be a challenge similar in magnitude to that of the development of the accelerator structure itself. Experience with the all-copper 425-MHz RFQ proof-of-principle linac has demonstrated that the resonator cavity must be structurally stiff and easily tunable. This experience has led to development of copper-plated steel structures having vanes that may be moved within a cylinder for tuning. Design of a flexible vane-to-cylinder radio-frequency (rf) joint, the vane, and the cylinder has many constraints dictated by the small-diameter cavities in the 400-MHz-frequency region. Two types of flexible, mechanical vane-to-cylinder rf joints are being developed at Los Alamos: the C-seal and the rf clamp-joint.

  6. Design of the 26.7 MHz rf cavity for RHIC

    SciTech Connect

    Rose, J.; Brodowski, J.; Deng, D.P.; Kwiatkowski, S.; Pirkl, W.; Ratti, A.


    The accelerating system for RHIC operates at 26.7 MHz (h = 342) and must capture the injected beam, accelerate it to top energy, and shorten the bunches prior to rebucketing into the storage (h = 2508) system. These different functions set the design parameters of the cavity. The frequency of 26.7 MHz has been chosen in order to provide large enough buckets to capture the injected beam from the AGS and a large linear region for debunching during a bunch rotation at top energy. Provision of the large linear region also dictates the voltage requirement of 400 kV per cavity. The cavity must be tuned {approximately}90 kHz to compensate for the change in speed of the gold beam.

  7. Buffered Electropolishing – A New Way for Achieving Extremely Smooth Surface Finish on Nb SRF Cavities to be Used in Particle Accelerators

    SciTech Connect

    Hui Tian, Charles Reece, Michael Kelley


    Future accelerators require unprecedented cavity performance, which is strongly influenced by interior surface nano-smoothness. Electropolishing (EP) is the technique of choice to be developed for high-field superconducting radio frequency (SRF) cavities. Electrochemical impedance spectroscopy (EIS) and related techniques point to the electropolishing mechanism of Nb in a sulphuric and hydrofluoric acid electrolyte controlled by a compact surface salt film under F- diffusion-limited mass transport control. These and other findings are guiding a systematic characterization to form the basis for cavities process optimization.

  8. Preparation and Testing of the SRF Cavities for the CEBAF 12 GeV Upgrade

    SciTech Connect

    Reilly, A. V.; Bass, T.; Burrill, A.; Davis, G. K.; Marhauser, F.; Reece, C. E.; Stirbet, M.


    Eighty new 7-cell, low-loss cell-shaped cavities are required for the CEBAF 12 GeV Upgrade project. In addition to ten pre-production units fabricated at JLab, the full set of commercially-produced cavities have been delivered. An efficient processing routine, which includes a controlled 30 micron electropolish, has been established to transform these cavities into qualified 8-cavity strings. This work began in 2010 and will run through the end of 2011. The realized cavity performance consistently exceeds project requirements and also the maximum useful gradient in CEBAF: 25 MV/m. We will describe the cavity processing and preparation protocols and summarize test results obtained to date.

  9. MgB2 Coated Ellipsoids as an Approach to Investigate the Possible Enhancement of the Vortex Penetrating Field of SRF Cavities

    NASA Astrophysics Data System (ADS)

    Tan, Teng; Wolak, Matthaeus; Tajima, Tsuyoshi; Xi, Xiaoxing; Civale, Leonardo


    Superconducting rf (SRF) cavities fabricated from bulk niobium (Nb) are a key component for modern particle accelerators. The magnetic field distribution on the inner wall of an SRF cavity is inversely similar to the field distribution on top of a superconducting ellipsoid when we put it in a magnetic field parallel to its axis. By measuring the vortex penetration into the magnetized superconducting ellipsoids, we can deduct the behavior of SRF cavities. Magnesium diboride (MgB2) has potential to replace Nb as it has a higher Tc of 39 K, a lower residual resistivity of ~ 0.1 μΩ cm (at 42 K), and a higher thermodynamic critical field Hc value compared to Nb. In this work, we successfully coated uniform MgB2 layers on top of molybdenum and niobium ellipsoids. SQUID magnetometer measurements showed that the coated MgB2 layer has a Tc above 38.5 K, and can provide a perfect magnetic shielding up to ~ 500 Oe at 1.8K. By coating MgB2 on Nb ellipsoids, we increased the vortex penetration field (the maximum field at which a cavity can be operated) by ~ 500 Oe at 2 K.

  10. Measurements at TRIUMF on a 80 MHz Cavity Model for the CERN PS Upgrade for LHC.

    NASA Astrophysics Data System (ADS)

    Mitra, A. K.; Poirier, R. L.; Losito, R.


    The RF system of the CERN PS being upgraded to bunch a beam that can be captured by the SPS 200 MHz RF system for injection into LHC. Two identical 80 MHz cavities are part of this PS upgrade programme. At CERN, the cavity has been designed using SUPERFISH and MAFIA concerning its shape, tuning devices and amplifier coupling loop. TRIUMF has built a simplified full-scale, copper-lined, wooden model, designed such that the field patters of the fundamental accelerating mode and the longitudinal modes agree closely to CERN cavity ones. The aim of constructing the wooden model was primarily to check the design of the capacitive tuners, the power coupling loop and the HOM dampers for the longitudinal modes up to 1 GHz. The results of the measurements were used to define the parameters of the tuners and a reliable model to describe the interaction of the coupling look with the fundamental mode of the final CERN cavity. Five quarter-wave antennae are adequate to damp the first fifteen longitudinal modes. In order not to decrease the shunt impedance of the fundamental mode by more than 5%, a three-element filter has been used with the antenna which damps the first longitudinal mode at 256 MHz.

  11. Status of the mechanical design of the 650 MHz cavities for Project X

    SciTech Connect

    Barbanotti, S.; Grimm, C.; Champion, M.; Foley, M.; Ginsburg, C.M.; Gonin, I.; Peterson, T.; Ristori, L.; Yakovlev, V.; /Fermilab


    In the high-energy section of the Project X Linac, acceleration of H{sup -} ions takes place in superconducting cavities operating at 650 MHz. Two families of five-cell elliptical cavities are planned: beta = 0.61 and beta = 0.9. A specific feature of the Project X Linac is low beam loading, and thus, low bandwidth and higher sensitivity to microphonics. Efforts to optimize the mechanical design of the cavities to improve their mechanical stability in response to the helium bath pressure fluctuations will be presented. These efforts take into account constraints such as cost and ease of fabrication. Also discussed will be the overall design status of the cavities and their helium jackets. The proposed design of the 3 GeV Project X superconducting (SC) Linac employs 650 MHz five-cell elliptical cavities to accelerate 1.0 mA of average H-beam current in the 160-3000 MeV energy range. The 650 MHz region of the Linac is divided into two sections with two different geometric phase velocity factors: beta = 0.61 to cover the 160-520 MeV range and beta = 0.9 to cover the 520-3000 MeV range. Approximately 40 beta = 0.61 and 150 beta = 0.9 cavities are currently planned for the project. An R&D program is in progress at FNAL, in collaboration with TJNAF and India, to develop the 650 MHz cavities for the proposed Linac design. This R&D program includes the design and fabrication of several beta = 0.61 and beta = 0.9 single-cell prototypes for evaluation prior to production of the five-cell cavities. FNAL has contracted AES to fabricate the beta = 0.9 prototypes, while TJNAF is building beta = 0.61 prototypes of their own design. In the remainder of this paper we will restrict our discussion to the five-cell beta = 0.9 cavities.

  12. In-situ plasma processing to increase the accelerating gradients of SRF cavities

    SciTech Connect

    Doleans, Marc; Afanador, Ralph; Barnhart, Debra L.; Degraff, Brian D.; Gold, Steven W.; Hannah, Brian S.; Howell, Matthew P.; Kim, Sang-Ho; Mammosser, John; McMahan, Christopher J.; Neustadt, Thomas S.; Saunders, Jeffrey W.; Tyagi, Puneet V.; Vandygriff, Daniel J.; Vandygriff, David M.; Ball, Jeffrey Allen; Blokland, Willem; Crofford, Mark T.; Lee, Sung-Woo; Stewart, Stephen; Strong, William Herb


    A new in-situ plasma processing technique is being developed at the Spallation Neutron Source (SNS) to improve the performance of the cavities in operation. The technique utilizes a low-density reactive oxygen plasma at room temperature to remove top surface hydrocarbons. The plasma processing technique increases the work function of the cavity surface and reduces the overall amount of vacuum and electron activity during cavity operation; in particular it increases the field emission onset, which enables cavity operation at higher accelerating gradients. Experimental evidence also suggests that the SEY of the Nb surface decreases after plasma processing which helps mitigating multipacting issues. This article discusses the main developments and results from the plasma processing R&D are presented and experimental results for in-situ plasma processing of dressed cavities in the SNS horizontal test apparatus.

  13. In-situ plasma processing to increase the accelerating gradients of SRF cavities


    Doleans, Marc; Afanador, Ralph; Barnhart, Debra L.; Degraff, Brian D.; Gold, Steven W.; Hannah, Brian S.; Howell, Matthew P.; Kim, Sang-Ho; Mammosser, John; McMahan, Christopher J.; et al


    A new in-situ plasma processing technique is being developed at the Spallation Neutron Source (SNS) to improve the performance of the cavities in operation. The technique utilizes a low-density reactive oxygen plasma at room temperature to remove top surface hydrocarbons. The plasma processing technique increases the work function of the cavity surface and reduces the overall amount of vacuum and electron activity during cavity operation; in particular it increases the field emission onset, which enables cavity operation at higher accelerating gradients. Experimental evidence also suggests that the SEY of the Nb surface decreases after plasma processing which helps mitigating multipactingmore » issues. This article discusses the main developments and results from the plasma processing R&D are presented and experimental results for in-situ plasma processing of dressed cavities in the SNS horizontal test apparatus.« less

  14. First Results of the SRF Wafer Test Cavity for the Characterization of Superconductors

    SciTech Connect

    Pogue, Nathaniel J.; Comeaux, Justin; McIntyre, Peter; Palczewski, Ari D.; Reece, Charles E.


    The wafer test cavity was designed as a short sample test system that could create a reproducible environment for the testing of superconducting materials above the Bardeen-Cooper- Schrieffer limit of niobium. The results of the sapphire test cavity showed that the dielectric was too lossy, and thus, the original design had to be altered to make operation feasible with current hardware and achieve ~200 mT. The new design was fabricated at Thomas Jefferson National Accelerator Facility and was cryogenically tested. After four tests, the cavity was able to produce a 6.6-mT field with a Q of 3.96 * 108. Although lower than anticipated, in comparison to other TE01 cavities, this result is quite encouraging. Multipacting and coupling were limitations, but current work is pursuing the elimination of these complications. This document will expound upon the new design, mathematical simulations, testing of the cavity, complications, results, and future work.

  15. Combined effects of cold work and chemical polishing on the absorption and release of hydrogen from SRF cavities inferred from resistance measurements of cavity-grade niobium bars

    NASA Astrophysics Data System (ADS)

    Dzyuba, A.; Cooley, L. D.


    A series of small fine-grained and single-crystal bars, with strain from 0% (recrystallized) to 50%, were given different amounts of chemical polishing. Four-point resistivity (ρ) data was used to characterize the electron scattering from dislocations, hydrogen, and any other trace contaminants. As noted by previous studies, annealed Nb displayed a weak linear increase of ρ (11 K) with polishing time due to hydrogen absorption, and bulk hydrogen concentration did not exceed 15% for 200 μm metal removed. Cold-worked samples displayed steeper slopes with polishing time (after subtracting resistivity due to strain alone), suggesting that dislocations assist the absorption of hydrogen during polishing. Absorption accelerated above 30% strain and 100 μm material removal, with room-temperature hydrogen concentration rising rapidly from 2% up to 5%. This threshold is significant, since superconducting radio-frequency (SRF) cavities are usually polished as-formed, with >35% strain, and polishing removes >150 μm of metal. Resistance jumps between 40 and 150 K, which signal the formation of hydride precipitates, were stronger in cold-worked samples, suggesting that dislocations also assist precipitate nucleation. High-vacuum anneals at 800 °C for 2 h, which are known to fully recrystallize cavity-grade niobium and de-gas hydrogen, removed the 40-150 K jumps and recovered the resistivity increase due to chemical polishing entirely. But, about 30% of the resistivity increase due to cold work remained, possibly due to residual dislocation clusters. Continued annealing only facilitated the diffusion of surface impurities into the bulk and did not recover the initial 0% state. Strain, polishing, and annealing thus appear to combine as irreversible paths that change the material. Bearing this in mind, the significant difference in hydrogen uptake between annealed and cold-worked samples suggests that annealing SRF cavities prior to chemical polishing could greatly reduce

  16. Design and simulation of a new type of 500 MHz single-cell superconducting RF cavity

    NASA Astrophysics Data System (ADS)

    Lu, Chang-Wang; Liu, Jian-Fei; Hou, Hong-Tao; Ma, Zhen-Yu; Mao, Dong-Qing; Feng, Zi-Qiang; Zhao, Shen-Jie; Luo, Chen; Zhao, Yu-Bin; Zhang, Zhi-Gang; Zheng, Xiang; Wei, Ye-Long; Yu, Hai-Bo; Li, Zheng; Xu, Kai


    This paper illustrates the design and simulation of a unique 500 MHz single-cell superconducting radio frequency cavity with a fluted beam pipe and a coaxial-type fundamental power coupler. The simulation results show that the cavity has a high r/Q value, a low peak surface field and a large beam aperture, so it can be a candidate cavity for high current accelerators. With the help of a fluted beam tube, almost all the higher order modes can propagate out of the cavity, especially the first two dipole modes, TE111 and TM110, and the first higher monopole mode, TM011. The external quality factor of the coaxial fundamental power coupler is optimized to 1.2×105, which will be useful when it is applied in the light source storage ring.

  17. A clean pumping and venting system for SRF cavities and cryomodules.

    SciTech Connect

    Gerbick, S. M.; Kelly, M. P.; Physics


    A system based on a pair of mass flow controllers has been used to evacuate and vent a clean cavity rf space. The mass-flow system is used in both single cavity testing and with the ATLAS upgrade cryomodule at Argonne. It is similar schematically to that already in use at DESY, however, it is very compact and maintains the capability to precisely control both the pump out and venting rates. Initial tests of the system with both the ATLAS single cavity test cryostat and the ATLAS upgrade cryomodule show that pump down and venting cycles may be performed without introducing substantial particulates into the cavity rf space. The system, together with the ANL top loading cryomodule design with easy access to individual cavities, will allow an individual cavity to be removed and replaced in a cryomodule string without the need to re-clean the entire string. This capability would also remove the need to test every cavity individually before installation into the string, constituting a major savings for large projects.

  18. Enhancement in Quality Factor of SRF Niobium Cavities by Material Diffusion

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Kneisel, Peter K.; Myneni, Ganapati Rao


    An increase in the quality factor of superconducting radiofrequency cavities is achieved by minimizing the surface resistance during processing steps. The surface resistance is the sum of temperature independent residual resistance and temperature/material dependent Bardeen-Cooper-Schrieffer (BCS) resistance. High temperature heat treatment usually reduces the impurities concentration from the bulk niobium, lowering the residual resistance. The BCS part can be reduced by selectively doping non-magnetic impurities. The increase in quality factor, termed as Q-rise, was observed in cavities when titanium or nitrogen thermally diffused in the inner cavity surface.

  19. Perpendicularly Biased YIG Tuners for the Fermilab Recycler 52.809 MHz Cavities

    SciTech Connect

    Madrak, R.; Kashikhin, V.; Makarov, A.; Wildman, D.


    For NOvA and future experiments requiring high intensity proton beams, Fermilab is in the process of upgrading the existing accelerator complex for increased proton production. One such improvement is to reduce the Main Injector cycle time, by performing slip stacking, previously done in the Main Injector, in the now repurposed Recycler Ring. Recycler slip stacking requires new tuneable RF cavities, discussed separately in these proceedings. These are quarter wave cavities resonant at 52.809 MHz with a 10 kHz tuning range. The 10 kHz range is achieved by use of a tuner which has an electrical length of approximately one half wavelength at 52.809 MHz. The tuner is constructed from 3⅛″ diameter rigid coaxial line, with 5 inches of its length containing perpendicularly biased, Al doped Yttrium Iron Garnet (YIG). The tuner design, measurements, and high power test results are presented.

  20. High power input coupler development for BEPCII 500 MHz superconducting cavity

    NASA Astrophysics Data System (ADS)

    Huang, Tongming; Pan, Weimin; Ma, Qiang; Wang, Guangwei; Dai, Xuwen; Zhang, Zhanjun; Furuya, T.; Mitsunobu, S.


    A high power input coupler for a 500 MHz superconducting cavity (SCC) of the upgrade project of Beijing Electron Positron Collider (BEPCII) has been developed in China. Several prototypes have been fabricated and tested successfully. A maximum of 420 kW continuous wave (CW) RF power in traveling wave (TW) mode was achieved in the high power test. The detailed design, fabrication and test of the coupler are described in this paper.


    SciTech Connect

    Charles Reece; Edward Daly; G. Davis; William Hicks; Timothy Rothgeb; H. Phillips; Joseph Preble; Haipeng Wang; Genfa Wu


    During initial testing of the prototype cavities incorporated into the developmental cryomodule Renascence severe thermal stability issues were encountered during CW operation. Additional diagnostic instrumentation was added. This enabled identification of an unanticipated thermal impedance between the HOM coupler probe feedthrough assembly and the cavity beamtube. Subsequent detailed FE analysis successfully modeled the situation and indicated the need for alternate cooling path for the couplers on those cavities. HOM damping was measured to be adequate employing only two of the four HOM couplers. The two pickup probes on the couplers at the input power coupler side of each cavity were removed, the remaining HOM probe feedthroughs were heat stationed to two-phase helium supply piping, and a novel heat sink was added to station both the inner and outer conductors of the remaining HOM rf cables. The characterization measurements, analysis, modifications, and resulting performance are presented.

  2. Reproducibility of High-Q SRF Cavities by High Temperature Heat Treatment

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Kneisel, Peter; Myneni, Ganapati Rao


    Recent work on high-temperature (> 600 °C) heat treatment of ingot Nb cavities in a customized vacuum furnace for several hours showed the possibility of achieving Q0-values of up to ~5×1010 at 2.0 K, 1.5 GHz and accelerating gradients of ~20 MV/m. This contribution presents results on further studies of the heat treatment process to produce cavities with high Q0 values for continuous-wave accelerator application. Single-cell cavities of different Nb purity have been processed through few cycles of heat-treatments and chemical etching. Measurements of Q0 as a function of temperature at low RF field and of Q0 as a function of the RF field at or below 2.0 K have been made after each treatment. Measurements by TOF-SIMS of the impurities depth profiles were made on samples heat treated with the cavities.

  3. Design And Commissioning Status Of New Cylindrical HiPIMS Nb Coating System for SRF Cavities

    SciTech Connect

    Phillips, H. Lawrence; Macha, Kurt M.; Valente-Feliciano, Anne-Marie


    For the past 19 years Jefferson Lab has sustained a program studying niobium films deposited on small samples in order to develop an understanding of the correlation between deposition parameters, film micro-structure, and RF performance. A new cavity deposition system employing a cylindrical cathode using the HiPIMS technique has been developed to apply this work to cylindrical cavities. The status of this system will be presented.

  4. Optimization of the Low-Loss SRF Cavity for the ILC

    SciTech Connect

    Z. Li; L. Ge; K. Ko; L. Lee; C.-K. Ng; G. L. Schussman; L. Xiao; T. Higo; Y. Morozumi; K. Saito; P. Kneisel; J. S. Sekutowicz


    The Low-Loss shape cavity design has been proposed as a possible alternative to the baseline TESLA cavity design for the ILC. The advantages of this design over the TESLA cavity are its lower cryogenic loss, and higher achievable gradient due to lower surface fields. High gradient prototypes for such designs have been tested at KEK (ICHIRO) and JLab (LL). However, issues related to HOM damping and multipacting (MP) still need to be addressed. Preliminary numerical studies of the prototype cavities have shown unacceptable damping for some higher-order dipole modes if the typical TESLA HOM couplers are directly adapted to the design. The resulting wakefield will dilute the beam emittance thus reduces the machine luminosity. Furthermore, high gradient tests on a 9-cell prototype at KEK have experienced MP barriers although a single LL cell had achieved a high gradient. From simulations, MP activities are found to occur in the end-groups of the cavity. In this paper, we will present the optimization results of the end-groups for the Low-Loss shape for effective HOM damping and alleviation of multipacting. Comparisons of simulation results with measurements will also be presented.

  5. Design and development of a new SRF cavity cryomodule for the ATLAS intensity upgrade

    NASA Astrophysics Data System (ADS)

    Kedzie, Mark; Conway, Zachary; Fuerst, Joel; Gerbick, Scott; Kelly, Michael; Morgan, James; Ostroumov, Peter; O'Toole, Michael; Shepard, Kenneth


    The ATLAS heavy ion linac at Argonne National Laboratory is undergoing an intensity upgrade that includes the development and implementation of a new cryomodule containing four superconducting solenoids and seven quarter-wave drift-tube-loaded superconducting rf cavities. The rf cavities extend the state of the art for this class of structure and feature ASME code stamped stainless steel liquid helium containment vessels. The cryomodule design is a further evolution of techniques recently implemented in a previous upgrade [1]. We provide a status report on the construction effort and describe the vacuum vessel, thermal shield, cold mass support and alignment, and other subsystems including couplers and tuners. Cavity mechanical design is also reviewed.

  6. Annealing to Mitigate Pitting in Electropolished Niobium Coupons and SRF Cavities

    SciTech Connect

    Cooley, L.D.; Hahn, E.; Hicks, D.; Romanenko, A.; Schuessler, R.; Thompson, C.; /Fermilab


    Ongoing studies at Fermilab investigate whether dislocations and other factors instigate pitting during cavity electropolishing (EP), despite careful processing controls and the inherent leveling mechanism of EP itself. Here, cold-worked niobium coupons, which exhibited increased tendencies for pitting in our past study, were annealed in a high vacuum furnace and subsequently processed by EP. Laser confocal scanning microscopy and special defect counting algorithms were used to assess the population of pits formed. Hardness measurements indicated that annealing for 2 hours at 800 C produced recovery, whereas annealing for 12 hours at 600 C did not, as is consistent with known changes for cavities annealed in a similar way. The 800 C anneal was effective in some cases but not others, and we discuss reasons why tendencies for pitting remain. We discuss implications for cavities and continued work to understand pitting.

  7. Improving the work function of the niobium surface of SRF cavities by plasma processing


    Tyagi, P. V.; Doleans, M.; Hannah, B.; Afanador, R.; McMahan, C.; Stewart, S.; Mammosser, J.; Howell, M.; Saunders, J.; Degraff, B.; et al


    An in situ plasma processing technique using chemically reactive oxygen plasma to remove hydrocarbons from superconducting radio frequency cavity surfaces at room temperature was developed at the spallation neutron source, at Oak Ridge National Laboratory. To understand better the interaction between the plasma and niobium surface, surface studies on small samples were performed. In this article, we report the results from those surface studies. The results show that plasma processing removes hydrocarbons from top surface and improves the surface work function by 0.5₋1.0 eV. Improving the work function of RF surface of cavities can help to improve their operational performance.

  8. Improving the work function of the niobium surface of SRF cavities by plasma processing

    NASA Astrophysics Data System (ADS)

    Tyagi, P. V.; Doleans, M.; Hannah, B.; Afanador, R.; McMahan, C.; Stewart, S.; Mammosser, J.; Howell, M.; Saunders, J.; Degraff, B.; Kim, S.-H.


    An in situ plasma processing technique using chemically reactive oxygen plasma to remove hydrocarbons from superconducting radio frequency cavity surfaces at room temperature has been developed at the spallation neutron source, at Oak Ridge National Laboratory. To understand better the interaction between the plasma and niobium surface, surface studies on small samples were performed. In this article, we report the results from those surface studies. The results show that plasma processing removes hydrocarbons from top surface and improves the surface work function by 0.5-1.0 eV. Improving the work function of RF surface of cavities can help to improve their operational performance.

  9. Cryogenic Test of a 750 MHz Superconducting RF Dipole Crabbing Cavity

    SciTech Connect

    Castilla, Alejandro; Delayen, Jean R.; Park, HyeKyoung


    A superconducting rf dipole cavity has been designed to address the challenges of a high repetition rate (750 MHz), high current for both electron/ion species (0.5/3 A per bunch), and large crossing angle (50 mrad) at the interaction points (IPs) crabbing system for the Medium Energy Electron-Ion Collider (MEIC) proposed by Jefferson Lab. The cavity prototype built at Niowave, Inc. has been tested at the Jefferson Lab facilities. In this work we present a detailed analysis of the prototype cavity performance at 4 K and 2 K, corroborating the absence of hard multipacting barriers that could limit the desired transverse fields, along with the surface resistance (Rs) temperature dependency.

  10. High power testing of the prototype accelerating cavity (352 MHz) for the advanced photon source (APS)

    SciTech Connect

    Bridges, J.F.; Kang, Y.W.; Kustom, R.L.; Primdahl, K.


    Measurement of the higher order of modes of a prototype single-cell 352 MHz cavity for the APS 7-Gev storage ring will be presented and discussed. A cavity made from solid copper was built according to dimensions derived from URMEL program runs. The longitudinal and transverse impedances of the first several higher order modes have been measured using various-shaped metal beads. High power ( > 60 kW) testing of the cavity will be described along with design and operation of dampers for those modes with coupled-bunch instability threshold currents under 300 milliamperes, the maximum circulating positron current. Low power level rf circuitry for timing and synchronization of the various APS accelerators and storage ring will be described.

  11. High power testing of the prototype accelerating cavity (352 MHz) for the advanced photon source (APS)

    SciTech Connect

    Bridges, J.F.; Kang, Y.W.; Kustom, R.L.; Primdahl, K.


    Measurement of the higher order of modes of a prototype single-cell 352 MHz cavity for the APS 7-Gev storage ring will be presented and discussed. A cavity made from solid copper was built according to dimensions derived from URMEL program runs. The longitudinal and transverse impedances of the first several higher order modes have been measured using various-shaped metal beads. High power ( > 60 kW) testing of the cavity will be described along with design and operation of dampers for those modes with coupled-bunch instability threshold currents under 300 milliamperes, the maximum circulating positron current. Low power level rf circuitry for timing and synchronization of the various APS accelerators and storage ring will be described.

  12. Design of normal conducting 704 MHz and 2.1 GHz cavities for LEReC Linac

    SciTech Connect

    Xiao, B.; Belomestnykh, S.; Ben-Zvi, I.; Brutus, J. C.; Fedotov, A.; McIntyre, G.; Smith, K.; Tuozzolo, J.; Veshcherevich, V.; Wu, Q.; Xu, W.; Zaltsman, A.


    To improve RHIC luminosity for heavy ion beam energies below 10 GeV/nucleon, the Low Energy RHIC electron Cooler (LEReC) is currently under development at BNL. Two normal conducting cavities, a single cell 704 MHz cavity and a 3 cell 2.1 GHz third harmonic cavity, will be used in LEReC for energy spread correction. In this paper we report the design of these two cavities.

  13. Mechanical design of 56 MHz superconducting RF cavity for RHIC collider

    SciTech Connect

    Pai, C.; Ben-Zvi, I.; Burrill, A.; Chang, X.; McIntyre, G.; Than, Y.; Tuozzolo, J.; Wu, Q.


    A 56 MHz Superconducting RF Cavity operating at 4.4K is being constructed for the RHIC collider. This cavity is a quarter wave resonator with beam transmission along the centerline. This cavity will increase collision luminosity by providing a large longitudinal bucket for stored bunches of RHIC ion beam. The major components of this assembly are the niobium cavity with the mechanical tuner, its titanium helium vessel and vacuum cryostat, the support system, and the ports for HOM and fundamental dampers. The cavity and its helium vessel must meet equivalent safety with the ASME pressure vessel code and it must not be sensitive to frequency shift due to pressure fluctuations from the helium supply system. Frequency tuning achieved by a two stage mechanical tuner is required to meet performance parameters. This tuner mechanism pushes and pulls the tuning plate in the gap of niobium cavity. The tuner mechanism has two separate drive systems to provide both coarse and fine tuning capabilities. This paper discusses the design detail and how the design requirements are met.

  14. Preliminary Test Results from 650 MHz Single Cell Medium Beta Cavities for Project X

    SciTech Connect

    Marhauser, Frank; Kneisel, Peter; Burrill, Andrew; Kushnick, Peter; Rimmer, R. A.


    We have fabricated two single cell 650 MHz {beta}=0.61 cavities of a JLab design, which possibly can be used for the proposed Project X proton linac application. Both cavities were manufactured at JLab from RRR>250 niobium sheet of 4 mm thickness using standard techniques such as deep drawing, electron beam welding, buffered chemical polishing, hydrogen degassing heat treatment, high pressure ultrapure water rinsing and clean room assembly. Initially cavity no. 1 was -- after final surface treatment by buffered chemical polishing (BCP) -- measured without any provisions for stiffening. As expected, the pressure sensitivity and the Lorentz Force detuning coefficients were relatively high; however, the RF performance was very encouraging: the cavity exhibited a Q-value > 10{sup 11} at 1.6K, corresponding to a residual resistance of < 1.5 n{Omega} The initial gradient was limited to E{sub acc} ~ 18 MV/m, limited by field emission. In a subsequent test, the cavity was re-rinsed and stiffened up, resulting in a somewhat improved mechanical behavior, but no improvement in rf performance. The second cavity was also tested twice, before and after low temperature baking. The results from all tests are reported in this contribution.


    SciTech Connect

    Jana, M. R.; Chung, M.; Leonova, M.; Moretti, A.; Tollestrup, A.; Yonehara, K.; Freemire, B.; Torun, Y.; Bowring, D.; Flanagan, G.


    The MuCool Test Area (MTA) at Fermilab is a facility to develop the technology required for ionization cooling for a future Muon Collider and/or Neutrino Factory. As part of this research program, we have tested two 805 MHz vacuum RF cavities in a multi-Tesla magnetic field to study the effects of the static magnetic field on the cavity operation. This study gives useful information on field emitters in the cavity, dark current, surface conditioning, breakdown mechanisms and material properties of the cavity. All these factors determine the maximum accelerating gradient in the cavity. This paper discusses the image processing technique for quantitative estimation of spark damage spot distribution on cavity interior surfaces. The distribution is compared with the electric field distribution predicted by a computer code calculation. The local spark density is proportional to probability of surface breakdown and shows a power law dependence on the maximum electric field (E). This E dependence is consistent with the dark current calculated from the Fowler-Nordheim equation.

  16. RF Simulation of the 187 MHz CW Photo-RF Gun Cavity at LBNL

    SciTech Connect

    Huang, Tong-Ming


    A 187 MHz normal conducting Photo-RF gun cavity is designed for the next generation light sources. The cavity is capable of operating in CW mode. As high as 750 kV gap voltage can be achieved with a 20 MV/m acceleration gradient. The original cavity optimization is conducted using Superfish code (2D) by Staples. 104 vacuum pumping slots are added and evenly spaced over the cavity equator in order to achieve better than 10-10-Tor of vacuum. Two loop couplers will be used to feed RF power into the cavity. 3D simulations are necessary to study effects from the vacuum pumping slots, couplers and possible multipactoring. The cavity geometry is optimized to minimize the power density and avoid multipactoring at operating field level. The vacuum slot dimensions are carefully chosen in consideration of both the vacuum conduction, local power density enhancement and the power attenuation at the getter pumps. This technical note gives a summary of 3D RF simulation results, multipactoring simulations (2D) and preliminary electromagnetic-thermal analysis using ANSYS code.

  17. Quench propagation in the HOM damper of the 56 MHz cavity

    SciTech Connect



    The aim of this report is to summarize a study of the propagation of a quench in a HOM damper probe of the 56 MHz superconducting storage cavity for RHIC and provide guidance for machine protection. The 56 MHz cavity [1] is designed to operate as a beam-driven superconducting quarter-wave resonator in the RHIC ring. Four Higher Order Mode (HOM) dampers [2] are used to prevent beam instabilities [3] in RHIC. These are inserted in the back wall of the cavity (the high magnetic field region) through ports that also serve for rinsing the cavity with high-pressure deionized water as well as the fundamental power coupler and pick-up ports. Figure 1 shows the outline of the cavity [4,5]. The HOM damper probe has a magnetic coupling loop which penetrates the cavity as shown in Figure 2 [5]. The loop is cooled by conduction to the 4.3K helium system, thus any sudden, significant amount of heat dumped on the loop will cause local heating. The peak magnetic field on the loop can reach about 7.4 x 10{sup 4} amperes per meter at a cavity voltage of 2.5 MV [5]. The scenario we present here is that a small region on the loop quenches. We can calculate the current driving the cavity using the RHIC parameters and get the magnetic field as a function of the current, the cavity's intrinsic Q and detuning parameter, however it turns out that within the time relevant for the quench development (a fraction of a second) the cavity field does not change sufficiently to warrant this extra computation. Thus we can assume that the field over the loop is constant. The damper loop dimensions are not so important, however its cross section is. In the following we assume that the loop's cross-section is 2 cm by 0.3 cm. It is actually rounded in cross section (sharp corners avoided) but we will approximate it as square. The material parameters taken for the niobium loop (assuming high RRR of about 200) are given in the following stepwise linear approximations. The surface resistivity in ohms as a


    SciTech Connect

    Charles Reece; Edward Daly; James Henry; William Hicks; Joseph Preble; Haipeng Wang; Genfa Wu


    Based on initial testing of the “HG” and “LL” 7-cell cavities in the prototype cryomodule Renascence, several opportunities for improved optimization were identified. The HOM damping configuration was refined so as to meet the requirements for damping key dipole modes while simultaneously dramatically reducing risk of HOM pickup probe heating and also creating beamline clearance for mounting the tuner to stainless steel helium vessel endplates (rather than NbTi/Ti transitions to a titanium helium vessel). Code modeling and bench measurements were performed. The new design maintains the 7-cell LL cells and incorporates a brazed transition between Nb and the SS helium vessel. The resulting configuration is now called the “C100” design. Cavity design details as well as vertical dewar and horizontal test bed performance are presented.

  19. Cavity Design, Fabrication and Commission Performance of a 750MHz, 4-rod Separator for CEBAF 4-Hall Beam Delivery System

    SciTech Connect

    Wang, Haipeng; Cheng, Guangfeng; Turlington, Larry T.; Wissmann, Mark J.


    A short version of the original CEBAF normal conducting 4-rod separator cavity has been developed into a 750MHz one * since the concept of simultaneous 4-hall operation for CEBAF is introduced **. This work has been advanced further based on the EM design optimization, bench measurement and by conducting RF-thermal coupled simulation using CST and ANSYS to confirm the cavity tuning and thermal performance. The cavity fabrication used matured technology like copper plating and machining. The cavity flanges, couplers, tuners and cooling channels adopted consistent/compatible hardware with the existing 500MHz cavities. The electromagnetic and thermal design simulations have greatly reduced the prototyping and bench tuning time of the first prototype. Four production cavities have reached a typical 1.94MV kick voltage or 3.0kW wall loss on each cavity after a minor multipactoring or no processing, 7.5% overhead power than the design specification.

  20. Performance of a 1500 MHz niobium cavity with 2K-LHe channel cooling

    SciTech Connect

    Susta, J.; Kneisel, P.; Wiseman, M.


    {beta}=1 superconducting accelerator structures are traditionally operated immersed in a liquid helium bath. Nevertheless, several attempts have been made in the past to make use of the numerous operational and cost advantages of a pipe-cooling configuration: reduction in liquid helium inventory, minimized cooldown/warmup times, and elimination of the LHe-vessel, which reduces the sensitivity to microphonics and provides easier access to all cavity components. This paper reports on tests performed with a 1500 MHz niobium cavity with 2K-LHe cooling channels covering only a fraction of the cavity surface. The cooling channels are made of niobium to preserve the capability for high temperature treatments. In the initial test the cavity was immersed in a helium bath; subsequently the cooling was only provided by superfluid helium in the cooling channels. The experimental results are compared to thermal model calculations. In addition, the computer model is used to investigate the variations in cavity performance as a function of the cooling channel geometry and thermal conductivity properties of the niobium.

  1. Niobium thin film coating on a 500-MHz copper cavity by plasma deposition

    SciTech Connect

    Haipeng Wang; Genfa Wu; H. Phillips; Robert Rimmer; Anne-Marie Valente; Andy Wu


    A system using an Electron Cyclotron Resonance (ECR) plasma source for the deposition of a thin niobium film inside a copper cavity for superconducting accelerator applications has been designed and is being constructed. The system uses a 500-MHz copper cavity as both substrate and vacuum chamber. The ECR plasma will be created to produce direct niobium ion deposition. The central cylindrical grid is DC biased to control the deposition energy. This paper describes the design of several subcomponents including the vacuum chamber, RF supply, biasing grid and magnet coils. Operational parameters are compared between an operating sample deposition system and this system. Engineering work progress toward the first plasma creation will be reported here.

  2. Effect of high solenoidal magnetic fields on breakdown voltages of high vacuum 805 MHz cavities

    SciTech Connect

    Moretti, A.; Bross, A.; Geer, S.; Qian, Z.; Norem, J.; Li, D.; Zisman, M.; Torun, Y.; Rimmer, R.; Errede, D.; /Illinois U., Urbana


    There is an on going international collaboration studying the feasibility and cost of building a muon collider or neutrino factory [1,2]. An important aspect of this study is the full understanding of ionization cooling of muons by many orders of magnitude for the collider case. An important muon ionization cooling experiment, MICE [3], has been proposed to demonstrate and validate the technology that could be used for cooling. Ionization cooling is accomplished by passing a high-emittance muon beam alternately through regions of low Z material, such as liquid hydrogen, and very high accelerating RF Cavities within a multi-Tesla solenoidal field. To determine the effect of very large solenoidal magnetic fields on the generation of dark current, x-rays and on the breakdown voltage gradients of vacuum RF cavities, a test facility has been established at Fermilab in Lab G. This facility consists of a 12 MW 805 MHz RF station and a large warm bore 5 T solenoidal superconducting magnet containing a pill box type cavity with thin removable window apertures. This system allows dark current and breakdown studies of different window configurations and materials. The results of this study will be presented. The study has shown that the peak achievable accelerating gradient is reduced by a factor greater than 2 when solenoidal field of greater than 2 T are applied to the cavity.

  3. Design and prototype tests of a large-aperture 37-53 MHz ferrite-tuned booster synchrotron cavity

    SciTech Connect

    Mark S. Champion et al.


    The Booster synchrotron at Fermilab employs eighteen 37-53 MHz ferrite-tuned double-gap coaxial radiofrequency cavities for acceleration of protons from 400 MeV to 8 GeV. The cavities have an aperture of 2.25 inches and operate at 55 kV per cavity. Future high duty factor operation of the Booster will be problematic due to unavoidable beam loss at the cavities resulting in excessive activation. The power amplifiers, high maintenance items, are mounted directly to the cavities in the tunnel. A proposed replacement for the Booster, the Proton Driver, will utilize the Booster radiofrequency cavities and requires not only a larger aperture, but also higher voltage. A research and development program is underway at Fermilab to modify the Booster cavities to provide a 5-inch aperture and a 20% voltage increase. A prototype has been constructed and high power tests have bee completed. The cavity design and test results is presented.


    SciTech Connect



    A new system to map temperature and X-ray radiation around the external surface of 700-MHz 5-cell superconducting cavities has been developed. It consists of an aluminum cylinder that is equipped with six modules of sensors. Eighty-one carbon resistors (temperature sensors) and seventy-one PIN diodes (X-ray sensors) are attached. This cylinder surrounds the 5-cell cavity and rotates about the cavity axis in about 6 minutes. A new feature, compared to the ones developed in the past, is its brush-contact mechanism on the outer surface of the aluminum cylinder, which enables the sensor array to rotate continuously in the same direction during the test. Although the present mechanism allows only one direction of rotation, it does not seem to be difficult to modify for both directions if electrical connections work in this manner. This paper describes the details of the structure and associated mechanisms as well as future schedule and plans of operation.

  5. Design and development progress of a LLRF control system for a 500 MHz superconducting cavity

    NASA Astrophysics Data System (ADS)

    Lee, Y. S.; Kim, H. W.; Song, H. S.; Lee, J. H.; Park, K. H.; Yu, I. H.; Chai, J. S.


    The LLRF (low-level radio-frequency) control system which regulates the amplitude and the phase of the accelerating voltage inside a RF cavity is essential to ensure the stable operation of charged particle accelerators. Recent advances in digital signal processors and data acquisition systems have allowed the LLRF control system to be implemented in digitally and have made it possible to meet the higher demands associated with the performance of LLRF control systems, such as stability, accuracy, etc. For this reason, many accelerator laboratories have completed or are completing the developments of digital LLRF control systems. The digital LLRF control system has advantages related with flexibility and fast reconfiguration. This paper describes the design of the FPGA (field programmable gate array) based LLRF control system and the status of development for this system. The proposed LLRF control system includes an analog front-end, a digital board (ADC (analog to digital converter), DAC (digital to analog converter), FPGA, etc.) and a RF & clock generation system. The control algorithms will be implemented by using the VHDL (VHSIC (very high speed integrated circuits) hardware description language), and the EPICS (experiment physics and industrial control system) will be ported to the host computer for the communication. In addition, the purpose of this system is to control a 500 MHz RF cavity, so the system will be applied to the superconducting cavity to be installed in the PLS storage ring, and its performance will be tested.

  6. LLRF design for the HINS-SRF test facility at Fermilab

    SciTech Connect

    Branlanrd, J.; Chase, B.; Cullerton, E.; Joireman, P.; Tupikov, V.; /Fermilab


    The High Intensity Neutrino Source (HINS) R&D program requires super conducting single spoke resonators operating at 325 MHz (SSR1). After coupler installation, these cavities are tested at the HINS-SRF facility at Fermilab. The LLRF requirements for these tests include support for continuous wave and pulsed mode operations, with the ability to track the resonance frequency of the tested cavity. Real-time measurement of the cavity loaded Q and Q{sub 0} are implemented using gradient decay techniques, allowing for Q{sub 0} versus E{sub acc} plots. A real time cavity simulator was also developed to test the LLRF system and verify its functionality.

  7. Characteristics and fabrication of a 499 MHz superconducting deflecting cavity for the Jefferson Lab 12 geV Upgrade

    SciTech Connect

    HyeKyoung Park, S.U. De Silva, J.R. Delayen


    A 499 MHz parallel bar superconducting deflecting cavity has been designed and optimized for a possible implementation at the Jefferson Lab. Previously the mechanical analysis, mainly stress, was performed. Since then pressure sensitivity was studied further and the cavity parts were fabricated. The prototype cavity is not completed due to the renovation at Jefferson Lab which resulted in the temporary shutdown of the electron beam welding facility. This paper will present the analysis results and facts encountered during fabrication. The unique geometry of the cavity and its required mechanical strength present interesting manufacturing challenges.

  8. RF optimization and analysis of the 805-MHz cavity for the MuCool program using ACE3P

    NASA Astrophysics Data System (ADS)

    Li, Zenghai; Ge, Lixin; Adolphsen, Chris; Li, Derun; Bowring, Daniel


    An 805 MHz pillbox cavity tested at Fermilab's MTA facility showed significant degradation in gradient when operated in a several Tesla solenoidal magnetic field. We have used the advanced ACE3P simulation codes developed at SLAC to study the cavity dark current and multipacting characteristics to gain more insight into the gradient limitations. We also checked whether there is an optimal cavity length that minimizes the dark current impact energy. Finally, we have improved on the cavity design, significantly lowering the fields outside the beam area. These and other results are presented in this paper.

  9. RF optimization and analysis of the 805-MHz cavity for the MuCool program using ACE3P

    SciTech Connect

    Li Zenghai; Ge Lixin; Adolphsen, Chris; Li Derun; Bowring, Daniel


    An 805 MHz pillbox cavity tested at Fermilab's MTA facility showed significant degradation in gradient when operated in a several Tesla solenoidal magnetic field. We have used the advanced ACE3P simulation codes developed at SLAC to study the cavity dark current and multipacting characteristics to gain more insight into the gradient limitations. We also checked whether there is an optimal cavity length that minimizes the dark current impact energy. Finally, we have improved on the cavity design, significantly lowering the fields outside the beam area. These and other results are presented in this paper.

  10. High Power Co-Axial SRF Coupler

    SciTech Connect

    M.L. Neubauer, R.A. Rimmer


    There are over 35 coupler designs for SRF cavities ranging in frequency from 325 to 1500 MHz. Two-thirds of these designs are coaxial couplers using disk or cylindrical ceramics in various combinations and configurations. While it is well known that dielectric losses go down by several orders of magnitude at cryogenic temperatures, it not well known that the thermal conductivity also goes down, and it is the ratio of thermal conductivity to loss tangent (SRF ceramic Quality Factor) and ceramic volume which will determine the heat load of any given design. We describe a novel robust co-axial SRF coupler design which uses compressed window technology. This technology will allow the use of highly thermally conductive materials for cryogenic windows. The mechanical designs will fit into standard-sized ConFlat® flanges for ease of assembly. Two windows will be used in a coaxial line. The distance between the windows is adjusted to cancel their reflections so that the same window can be used in many different applications at various frequencies.

  11. Studies of an LL-type 500 MHz 5-cell superconducting cavity at SINAP

    NASA Astrophysics Data System (ADS)

    Hou, Hong-Tao; Ma, Zhen-Yu; Mao, Dong-Qing; Feng, Zi-Qiang; Luo, Chen; Shi, Jing; Wang, Yan; Li, Zheng; Xu, Kai; Zhao, Yu-Bin; Zheng, Xiang; Zhao, Shen-Jie; Zhang, Zhi-Gang; Liu, Jian-Fei


    A low loss- (LL) type 500 MHz 5-cell superconducting niobium prototype cavity with a large beam aperture has been developed successfully including the optimization, the deep drawing and electron beam welding, the surface treatment and the vertical testing. The performance of the fundamental mode was optimized and the higher order modes were damped by adopting an enlarged beam pipe for propagation. Surface preparation or treatment including mechanical polishing, buffered chemical polishing and high pressure rinsing with ultra-pure water and so on was carried out carefully to ensure a perfect inner surface condition. The vertical testing results show that the accelerating voltage higher than 7.5 MV was obtained while the quality factor was better than 1×109 at 4.2 K. No obvious multipacting or field emission was found during the test. However, a quench happened while increasing the field a little higher than 7.5 MV that at present limited the cavity performance. Supported by National Natural Science Foundation of China (11175237)

  12. Survey of SRF guns

    SciTech Connect

    Belomestnykh, S.


    Developing Superconducting RF (SRF) electron guns is an active field with several laboratories working on different gun designs. While the first guns were based on elliptic cavity geometries, Quarter Wave Resonator (QWR) option is gaining popularity. QWRs are especially well suited for producing beams with high charge per bunch. In this talk we will describe recent progress in developing both types of SRF guns. SRF guns made excellent progress in the last two years. Several guns generated beams and one, at HZDR, injected beam into an accelerator. By accomplishing this, HZDR/ELBE gun demonstrated feasibility of the SRF gun concept with a normal-conducting Cs{sub 2}Te cathode. The cathode demonstrated very good performance with the lifetime of {approx}1 year. However, for high average current/high bunch charge operation CsK{sub 2}Sb is preferred as it needs green lasers, unlike UV laser for the Cs{sub 2}Te, which makes it easier to build laser/optics systems. Other high QE photocathodes are being developed for SRF guns, most notably diamond-amplified photocathode. Several QWR guns are under development with one producing beam already. They are very promising for high bunch charge operation. The field is very active and we should expect more good results soon.

  13. An Analysis of the Temperature and Field Dependence of the RF Surface Resistance of Nitrogen-Doped Niobium SRF Cavities with Respect to Existing Theoretical Models

    SciTech Connect

    Reece, Charles E.; Palczewski, Ari D.; Xiao, Binping


    Recent progress with the reduction of rf surface resistance (Rs) of niobium SRF cavities via the use of high temperature surface doping by nitrogen has opened a new regime for energy efficient accelerator applications. For particular doping conditions one observes dramatic decreases in Rs with increasing surface magnetic fields. The observed variations as a function of temperature may be analyzed in the context of recent theoretical treatments in hopes of gaining insight into the underlying beneficial mechanism of the nitrogen treatment. Systematic data sets of Q0 vs. Eacc vs. temperature acquired during the high Q0 R&D work of the past year will be compared with theoretical model predictions..

  14. Additive manufacturing method for SRF components of various geometries


    Rimmer, Robert; Frigola, Pedro E; Murokh, Alex Y


    An additive manufacturing method for forming nearly monolithic SRF niobium cavities and end group components of arbitrary shape with features such as optimized wall thickness and integral stiffeners, greatly reducing the cost and technical variability of conventional cavity construction. The additive manufacturing method for forming an SRF cavity, includes atomizing niobium to form a niobium powder, feeding the niobium powder into an electron beam melter under a vacuum, melting the niobium powder under a vacuum in the electron beam melter to form an SRF cavity; and polishing the inside surface of the SRF cavity.

  15. External-cavity-controlled 32-MHz narrow-band cw GaA1As-diode lasers.


    Voumard, C


    By coupling a cw GaA1As-diode laser to an external resonator with Fabry-Perot etalons as dispersive elements, emission was reduced to a single-axial mode of 32-MHz width. The wavelength could be coarsely tuned over a spectral range of over 10 nm. Fine tuning over about 500 MHz was achieved by varying the external cavity length by less than lambda/3. At single-axial-mode operation, the commonly observed high- and low-frequency self-pulsing of the light output was found to disappear almost completely. PMID:19680331

  16. A 201 MHz RF cavity design with non-stressed pre-curved Be windows for muon cooling channels

    SciTech Connect

    Li, Derun; Ladran, A.; Staples, J.; Virostek, S.; Zisman, M.; Lau, W.; Yang, S .; Rimmer, R.A.


    We present a 201-MHz RF cavity design for muon cooling channels with non-stressed and pre-curved Be foils to terminate the beam apertures. The Be foils are necessary to improve the cavity shunt impedance with large beam apertures needed for accommodating large transverse size muon beams. Be is a low-Z material with good electrical and thermal properties. It presents an almost transparent window to muon beams, but terminates the RF cavity electro-magnetically. Previous designs use pre-stressed flat Be foils in order to keep cavity from detuning resulted from RF heating on the window surface. Be foils are expensive, and it is difficult to make them under desired tension. An alternative design is to use precurved and non-stressed Be foils where the buckling direction is known, and frequency shifts can be properly predicted. We will present mechanical simulations on the Be foils in this paper.

  17. High-power RF testing of a 352-MHZ fast-ferrite RF cavity tuner at the Advanced Photon Source.

    SciTech Connect

    Horan, D.; Cherbak, E.; Accelerator Systems Division


    A 352-MHz fast-ferrite rf cavity tuner, manufactured by Advanced Ferrite Technology, was high-power tested on a single-cell copper rf cavity at the Advanced Photon Source. These tests measured the fast-ferrite tuner performance in terms of power handling capability, tuning bandwidth, tuning speed, stability, and rf losses. The test system comprises a single-cell copper rf cavity fitted with two identical coupling loops, one for input rf power and the other for coupling the fast-ferrite tuner to the cavity fields. The fast-ferrite tuner rf circuit consists of a cavity coupling loop, a 6-1/8-inch EIA coaxial line system with directional couplers, and an adjustable 360{sup o} mechanical phase shifter in series with the fast-ferrite tuner. A bipolar DC bias supply, controlled by a low-level rf cavity tuning loop consisting of an rf phase detector and a PID amplifier, is used to provide a variable bias current to the tuner ferrite material to maintain the test cavity at resonance. Losses in the fast-ferrite tuner are calculated from cooling water calorimetry. Test data will be presented.

  18. Simulation Study Using an Injection Phase-locked Magnetron as an Alternative Source for SRF Accelerators

    SciTech Connect

    Wang, Haipeng; Plawski, Tomasz E.; Rimmer, Robert A.


    As a drop-in replacement for the CEBAF CW klystron system, a 1497 MHz, CW-type high-efficiency magnetron using injection phase lock and amplitude variation is attractive. Amplitude control using magnetic field trimming and anode voltage modulation has been studied using analytical models and MATLAB/Simulink simulations. Since the 1497 MHz magnetron has not been built yet, previously measured characteristics of a 2.45GHz cooker magnetron are used as reference. The results of linear responses to the amplitude and phase control of a superconducting RF (SRF) cavity, and the expected overall benefit for the current CEBAF and future MEIC RF systems are presented in this paper.

  19. Investigation of a 10 MHz, non-steady state cavity for pulse energy enhancement of ultrafast fiber lasers

    NASA Astrophysics Data System (ADS)

    Breitkopf, Sven; Wunderlich, Stefano; Eidam, Tino; Shestaev, Evgeny; Gottschall, Thomas; Carstens, Henning; Holzberger, Simon; Pupeza, Ioachim; Limpert, Jens; Tünnermann, Andreas


    Here, we present a passive 30-m long enhancement cavity that supports a steady-state enhancement of 198, which is the highest enhancement that has ever been reached in such a long cavity. Furthermore, we demonstrate the extraction of a short burst with a total energy of 53.6 μJ employing an acousto-optic modulator (AOM) as a switching device. The cavity was seeded with pulses of 1.49 μJ energy at 10 MHz repetition rate. The individual output coupled pulses showed an energy enhancement of up to 8.5 while the whole burst contained the entire energy of 36 input pulses. In the last section theoretical considerations for the single pulse extraction are presented and briefly discussed.


    SciTech Connect

    Valente, Anne-Marie


    For the past three decades, bulk niobium has been the material of choice for SRF cavity applications. Alternative materials, mainly Nb compounds and A15 compounds have been investigated with moderate effort in the past. In the recent years, RF cavity performance has approached the theoretical limit for bulk niobium. For further improvement of RF cavity performance for future accelerator projects, research interest is renewed towards alternative materials to niobium. A few laboratories around the world are now investigating superconductors with higher transition temperature Tc for application to SRF cavities. This paper gives an overview of the results obtained and challenges encountered for Nb compounds and A15 compounds, as well as for MgB2, for SRF cavity applications. An interesting alternative has been recently proposed by Alex Gurevich with the Superconductor-Insulator-Superconductor multilayer approach. This could potentially lead to further improvement in RF cavity performance using the benefit of the higher critical field Hc of higher-Tc superconductors without being limited with their lower Hc1.

  1. Analysis of New High-Q0 SRF Cavity Tests by Nitrogen Gas Doping at Jefferson Lab

    SciTech Connect

    Palczewski, Ari D.; Geng, Rongli; Reece, Charles E.


    In order to refine systematic understanding and establish confident process control, Jefferson Lab has joined with partners to investigate and thoroughly characterize the dramatically higher Q0 of 1.3 GHz niobium cavities first reported by FNAL in 2013[1]. With partial support from the LCLS-II project, JLab has undertaken a parametric study of nitrogen doping in vacuum furnace at 800 °C followed by variable depth surface removal in the 5 - 20 μm range. Q0 above 3×1010 are typical at 2.0 K and 16 MV/m accelerating field. We report observations from the single cell study and current interpretations. In addition to the parametric single cell study, we also report on the ongoing serial testing of six nitrogen-doped 9-cell cavities as baseline prototypes for LCLS-II.

  2. Fabrication and Testing of the SRF cavities for the CEBAF 12 GeV Upgrade Prototype Cryomodule Renascence

    SciTech Connect

    C. E. Reece; E. F. Daly; S. Manning; R. Manus; S. Morgan; J. P. Ozelis; L. Turlington


    Twelve seven-cell niobium cavities for the CEBAF 12 GeV upgrade prototype cryomodule Renascence have been fabricated at JLab and tested individually. This set includes four of the ''Low Loss'' (LL) design and eight of the ''High Gradient'' (HG) design. The fabrication strategy was an efficient mix of batch job-shop component machining and in-house EBW, chemistry, and final-step machining to meet mechanical tolerances. Process highlights will be presented. The cavities have been tested at 2.07 K, the intended CEBAF operating temperature. Performance exceeded the tentative design requirement of 19.2 MV/m CW with less than 29 W dynamic heat dissipation. These results, as well as the HOM damping performance are presented.

  3. Fabrication and Testing of the SRF Cavities for the CEBAF 12 GeV Upgrade Prototype Cryomodule Renascence

    SciTech Connect

    Charles Reece; Edward Daly; Stephen Manning; Robert Manus; Samuel Morgan; Joseph Ozelis; Larry Turlington


    Twelve seven-cell niobium cavities for the CEBAF 12 GeV upgrade prototype cryomodule Renascence have been fabricated at JLab and tested individually. This set includes four of the ''Low Loss'' (LL) design and eight of the ''High Gradient'' (HG) design. The fabrication strategy was an efficient mix of batch job-shop component machining and in-house EBW, chemistry, and final-step machining to meet mechanical tolerances. Process highlights will be presented. The cavities have been tested at 2.07 K, the intended CEBAF operating temperature. Performance exceeded the tentative design requirement of 19.2 MV/m cw with less than 29 W dynamic heat dissipation. These results, as well as the HOM damping performance will be presented.

  4. Thermal analysis and water-cooling design of the CSNS MEBT 324 MHz buncher cavity

    NASA Astrophysics Data System (ADS)

    Liu, Hua-Chang; Ouyang, Hua-Fu


    At least two bunchers are needed in the 3 MeV H- Medium Energy Beam Transport (MEBT) line located between RFQ and DTL for the CSNS (China Spallation Neutron Source). A nose-cone geometry has been adopted as the type of buncher cavity for its simplicity, higher impedance and lower risk of multipacting. By making use of the results got from the simulations on the buncher with two-dimension code SUPERFISH, the thermal and structural analyses have been carried out, the process and results to determine the resulting frequency shift due to thermal and structural distortion of the cavity are presented, the water-cooling channel position and the optimum cooling water temperature as well as the tuning method by adjusting the cooling water temperature when the cavity is out of resonance are also determined through the analyses.

  5. R&D ERL: SRF Electron Gun

    SciTech Connect

    Burrill, A.


    When the BNL high current ERL was first envisioned the choice of injector went through several iterations before concluding that an SRF injector was the appropriate choice for the task at hand. The design requirements were quite stringent as the injector had to be designed to reach currents never before achieved in any injector. The overall goal was to design an injector capable of delivering up to 0.5 Ampere at 703.75 MHz. This criteria was set based on the need to demonstrate high average current energy recovery at the ERL so that future machines could be designed and built with confidence in the injector. For the ERL the injector needs to be capable of accelerating electrons to 2-2.5 MeV with charges ranging from 0.7 to 5 nC per bunch depending on the operational parameters being studied. These criteria led to a 1/2 cell photoinjector designed to accommodate a demountable photocathode utilizing a novel quarter wave choke joint for the cathode insertion mechanism. The cavity requires a total of 1 MW of power coupled to the beam in order to meet the high current application, necessitating two 500 kW RF power couplers. This AP note will review the overall physics design and analysis, the fabrication sequence, and the testing plan for this cavity.

  6. Tuning methods for the 805 MHz side-coupled cavities in the Fermilab linac upgrade

    SciTech Connect

    Miller, H.W.; Jurgens, T.G.; Kerns, Q.A.; Padilla, R.; Qian, Z.


    The fabrication and tuning of Side-Coupled Accelerator Structures (SCS) are strongly interrelated. Consideration of mechanical tolerances and fabrication sequences can reduce tuning steps that require repeated machining. With available CNC machines and numerical calculation programs, it is possible to machine cavities to a calculated shape. Accelerating cells are tuned by control of the depth of coupling slots rather than trimming the nose of accelerating cells. Predicting the correct frequency off-sets to use at each manufacturing stage produces a brazed structure of proper couplig with a minimum amount of tuning. 2 refs., 1 fig.

  7. Proton in SRF Niobium

    NASA Astrophysics Data System (ADS)

    Wallace, John Paul


    Hydrogen is a difficult impurity to physically deal with in superconducting radio frequency (SRF) niobium, therefore, its properties in the metals should be well understood to allow the metal's superconducting properties to be optimized for minimum loss in the construction of resonant accelerator cavities. It is known that hydrogen is a paramagnetic impurity in niobium from NMR studies. This paramagnetism and its effect on superconducting properties are important to understand. To that end analytical induction measurements aimed at isolating the magnetic properties of hydrogen in SRF niobium are introduced along with optical reflection spectroscopy which is also sensitive to the presence of hydrogen. From the variety, magnitude and rapid kinetics found in the optical and magnetic properties of niobium contaminated with hydrogen forced a search for an atomic model. This yielded quantum mechanical description that correctly generates the activation energy for diffusion of the proton and its isotopes not only in niobium but the remaining metals for which data is available. This interpretation provides a frame work for understanding the individual and collective behavior of protons in metals.

  8. Proton in SRF Niobium

    SciTech Connect

    Wallace, John Paul


    Hydrogen is a difficult impurity to physically deal with in superconducting radio frequency (SRF) niobium, therefore, its properties in the metals should be well understood to allow the metal's superconducting properties to be optimized for minimum loss in the construction of resonant accelerator cavities. It is known that hydrogen is a paramagnetic impurity in niobium from NMR studies. This paramagnetism and its effect on superconducting properties are important to understand. To that end analytical induction measurements aimed at isolating the magnetic properties of hydrogen in SRF niobium are introduced along with optical reflection spectroscopy which is also sensitive to the presence of hydrogen. From the variety, magnitude and rapid kinetics found in the optical and magnetic properties of niobium contaminated with hydrogen forced a search for an atomic model. This yielded quantum mechanical description that correctly generates the activation energy for diffusion of the proton and its isotopes not only in niobium but the remaining metals for which data is available. This interpretation provides a frame work for understanding the individual and collective behavior of protons in metals.

  9. Mechanical Analysis of the 400 MHz RF-Dipole Crabbing Cavity Prototype for LHC High Luminosity Upgrade

    SciTech Connect

    De Silva, Subashini U.; Park, HyeKyoung; Delayen, Jean R.; Li, Z.


    The proposed LHC high luminosity upgrade requires two crabbing systems in increasing the peak luminosity, operating both vertically and horizontally at two interaction points of IP1 and IP5. The required system has tight dimensional constraints and needs to achieve higher operational gradients. A proof-of-principle 400 MHz crabbing cavity design has been successfully tested and has proven to be an ideal candidate for the crabbing system. The cylindrical proof-of-principle rf-dipole design has been adapted in to a square shaped design to further meet the dimensional requirements. The new rf-dipole design has been optimized in meeting the requirements in rf-properties, higher order mode damping, and multipole components. A crabbing system in a cryomodule is expected to be tested on the SPS beam line prior to the test at LHC. The new prototype is required to achieve the mechanical and thermal specifications of the SPS test followed by the test at LHC. This paper discusses the detailed mechanical and thermal analysis in minimizing Lorentz force detuning and sensitivity to liquid He pressure fluctuations.

  10. A prototype 7.5 MHz Finemet(Trademark) loaded RF cavity and 200kW amplifier for the Fermilab proton driver

    SciTech Connect

    David W. Wildman et al.


    A 7.5 MHz RF cavity and power amplifier have been built and tested at Fermilab as part of the proton Driver Design Study. The project goal was to achieve the highest possible 7.5 MHz accelerating gradient at 15 Hz with a 50% duty cycle. To reduce beam loading effects, a low shunt impedance (500{Omega}) design was chosen. The 46 cm long single gap cavity uses 5 inductive cores, consisting of the nanocrystalline soft magnetic alloy Finemet, to achieve a peak accelerating voltage of 15 kV. The 95 cm OD tape wound cores have been cut in half to increase the cavity Q and are cooled from both sides using large water-cooled copper heat sinks. The prototype cavity has a shunt impedance of 550{Omega}, Q = 11, and is powered by a 200 kW cw cathode driven tetrode amplifier. Both cavity and amplifier designs are described. Results from recent cavity tests coalescing beam in the Fermilab Main Injector is also presented.

  11. Design, fabrication, RF test at 2 K of 1050MHz, β=0.49 single cell large and fine grain niobium cavity

    SciTech Connect

    Jayanta Mondal, Gianluigi Ciovati, Peter Kneisel, Kailash Mittal, Ganapati Rao Myneni


    BARC is developing a technology for the accelerator driven subcritical system (ADSS) that will be mainly utilized for the transmutation of nuclear waste and enrichment of U233. Design and prototyping of a superconducting medium velocity cavity has been taken up as a part of the ADSS project. The cavity design for {beta} = 0.49, f = 1050 MHz has been optimized to minimize the peak electric and magnetic fields, with a goal of 5 MV/m of accelerating gradient at a Q > 5 x 10{sup 9} at 2 K. After the design optimization, two single cell cavities were fabricated from polycrystalline (RRR > 200) and large grain (RRR > 96) Niobium material. The cavities have been tested at 2 K in a vertical cryostat at Jefferson Lab and both achieved the performance specifications.

  12. Sub-MHz accuracy measurement of the S(2) 2-0 transition frequency of D2 by Comb-Assisted Cavity Ring Down spectroscopy

    NASA Astrophysics Data System (ADS)

    Mondelain, D.; Kassi, S.; Sala, T.; Romanini, D.; Gatti, D.; Campargue, A.


    The line position of the very weak S(2) transition of deuterium in the 2-0 band has been measured with a Comb-Assisted Cavity Ring Down spectrometer. The high sensitivity spectra were recorded at 5 and 10 mbar with a Noise Equivalent Absorption, αmin, of 8 × 10-11 cm-1. The line positions at 5 and 10 mbar were measured with sub-MHz accuracy (460 and 260 kHz, respectively). After correction of the line pressure-shift, the frequency at zero pressure of the S(2) transition of the first overtone band was determined to be 187 104 299.51 ± 0.50 MHz. This value agrees within 1.7 MHz with the frequency obtained from the best available ab initio calculations and corresponds to only 15% of the claimed theoretical uncertainty.

  13. Recent Progress of RF Cavity Study at Mucool Test Area

    SciTech Connect

    Yonehara, Katsuya; /Fermilab


    Summar of presentation is: (1) MTA is a multi task working space to investigate RF cavities for R&D of muon beam cooling channel - (a) Intense 400 MeV H{sup -} beam, (b) Handle hydrogen (flammable) gas, (c) 5 Tesla SC solenoid magnet, (d) He cryogenic/recycling system; (2) Pillbox cavity has been refurbished to search better RF material - Beryllium button test will be happened soon; (3) E x B effect has been tested in a box cavity - Under study (result seems not to be desirable); (4) 201 MHz RF cavity with SRF cavity treatment has been tested at low magnetic field - (a) Observed some B field effect on maximum field gradient and (b) Further study is needed (large bore SC magnet will be delivered end of 2011); and (5) HPRF cavity beam test has started - (a) No RF breakdown observed and (b) Design a new HPRF cavity to investigate more plasma loading effect.

  14. Design a high-q optical cavity for the project of laser notching h- beam at 38.5 mhz

    SciTech Connect

    Yang, Xi; Ankenbrandt, Charles M.; /Fermilab


    Ray matrix formalism is used to represent a two-mirror resonator with a thermal lens in the middle. By tracking a ray vector, which starts from the place where the laser and H{sup -} beams intercept, through the optical cavity, the cavity property can be analyzed. The cavity design can be optimized in such a way that at the interception, the spacious jitter of the laser beam caused by the cavity misalignment is the minimum.

  15. Development of Ultra High Gradient and High Q{sub 0} Superconducting Radio Frequency Cavities

    SciTech Connect

    Geng, Rongli; Clemens, William A.; Follkie, James E.; Harris, Teena M.; Kushnick, Peter W.; Machie, Danny; Martin, Robert E.; Palczewski, Ari D.; Perry, Era A.; Slack, Gary L.; Williams, R. S.; Adolphsen, C.; Li, Z.; Hao, J. K.; Li, Y. M.; Liu, K. X.


    We report on the recent progress at Jefferson Lab in developing ultra high gradient and high Q{sub 0} superconducting radio frequency (SRF) cavities for future SRF based machines. A new 1300 MHz 9-cell prototype cavity is being fabricated. This cavity has an optimized shape in terms of the ratio of the peak surface field (both magnetic and electric) to the acceleration gradient, hence the name low surface field (LSF) shape. The goal of the effort is to demonstrate an acceleration gradient of 50 MV/m with Q{sub 0} of 10{sup 10} at 2 K in a 9-cell SRF cavity. Fine-grain niobium material is used. Conventional forming, machining and electron beam welding method are used for cavity fabrication. New techniques are adopted to ensure repeatable, accurate and inexpensive fabrication of components and the full assembly. The completed cavity is to be first mechanically polished to a mirror-finish, a newly acquired in-house capability at JLab, followed by the proven ILC-style processing recipe established already at JLab. In parallel, new single-cell cavities made from large-grain niobium material are made to further advance the cavity treatment and processing procedures, aiming for the demonstration of an acceleration gradient of 50 MV/m with Q{sub 0} of 2�10{sup 10} at 2K.

  16. Operational Experience with the Nb/Pb SRF Photoelectron Gun

    SciTech Connect

    Kamps, T; Barday, R; Jankowiak, A; Knoblock, J; Kugeler, O; Matveenko, A N; Neumann, A; Quast, T; Rudolph, J; Schubert, S G; Volker, J; Kneisel, P; Nietubyc, R; Sekutowicz, J K; Smedley, J; Teichert, J; Volkov, V; Will, I


    SRF photoelectron guns offer the promise of high brightness, high average current beam production for the next generation of accelerator driven light sources such as free electron lasers, THz radiation sources or energy-recovery linac driven synchrotron radiation sources. In a first step a fully superconducting RF (SRF) photoelectron gun is under development by a collaboration between HZB, DESY, JLAB, BNL and NCBJ. The aim of the experiment is to understand and improve the performance of a Nb SRF gun cavity coated with a small metallic Pb cathode film on the cavity backplane. This paper describes the highlights from the commissioning and beam parameter measurements. The main focus is on lessons learned from operation of the SRF gun.

  17. Quench studies of ILC cavities

    SciTech Connect

    Eremeev, Grigory; Geng, Rongli; Palczewski, Ari; Dai, Jin


    Quench limits accelerating gradient in SRF cavities to a gradient lower than theoretically expected for superconducting niobium. Identification of the quenching site with thermometry and OST, optical inspection, and replica of the culprit is an ongoing effort at Jefferson Lab aimed at better understanding of this limiting phenomenon. In this contribution we present our finding with several SRF cavities that were limited by quench.

  18. Overview of SRF-related Activities at Jefferson Lab

    SciTech Connect

    Charles Reece


    SRF-related activities at JLab are varied and increasing. Operation of CEBAF at 5.7 GeV for nuclear physics is now routine. There has been significant progress in the development and testing of components and subsystems for a new cryomodule design for coming upgrades of the JLab CEBAF and FEL. Construction of the first such module has begun, and further optimization studies continue. Jefferson Lab joined the collaboration to build the Spallation Neutron Source (SNS). JLab will contribute 81 cavities in 23 SNS cryomodules. Prototyping of the beta. 0.61 and 0.81 cavities is nearing completion. Development and testing of the high-power coaxial input coupler for SNS is underway. Fresh efforts have been initiated to pursue improved understanding and control of SRF surfaces. JLab has led discussions and development of modern low-level rf controls tailored for power-efficient operation of high-gradient SRF cavities in lightly-beamloaded, cw applications. To support these efforts, major upgrades and renovations to the JLab SRF facilities and information infrastructures are underway. The lab has recognized the importance of SRF to future developments in the accelerator community by the creation of the new Institute for SRF Science and Technology.

  19. Design, simulation and conditioning of the fundamental power couplers for BNL SRF gun

    SciTech Connect

    Xu W.; Altinbas, Z.; Belomestnykh, S.; Ben-Zvi, I. et al


    The 704 MHz SRF gun for the BNL Energy Recovery Linac (ERL) prototype uses two fundamental power couplers (FPCs) to deliver up to 1 MW of CW RF power to the half-cell cavity. To prepare the couplers for high-power RF service and process multipacting, the FPCs should be conditioned prior to installation into the gun cryomodule. A room-temperature test stand was configured for conditioning FPCs in full reflection regime with varied phase of the reflecting wave. The FPCs have been conditioned up to 250 kW in pulse mode and 125 kW in CW mode. The multipacting simulations were carried out with Track3P code developed at SLAC. The simulations matched the experimental results very well. This paper presents the FPC RF and thermal design, multipacting simulations and conditioning of the BNL gun FPCs.

  20. The ESS Superconducting RF Cavity and Cryomodule Cryogenic Processes

    NASA Astrophysics Data System (ADS)

    Darve, C.; Elias, N.; Molloy, S.; Bosland, P.; Renard, B.; Bousson, S.; Olivier, G.; Reynet, D.; Thermeau, J. P.

    The European Spallation Source (ESS) is one of Europe's largest research infrastructures, tobring new insights to the grand challenges of science and innovation in fields as diverse as material and life sciences, energy, environmental technology, cultural heritage,solid-state and fundamental physics by the end of the decade. The collaborative project is funded by a collaboration of 17 European countries and is under design and construction in Lund, Sweden. A 5 MW, long pulse proton accelerator is used to reach this goal. The pulsed length is 2.86 ms and the repetition frequency is 14 Hz (4% duty cycle). The choice of SRF technology is a key element in the development of the ESS linear accelerator (linac). The superconducting linacis composed of one section of spoke cavity cryomodules(352.21 MHz) and two sections of elliptical cavity cryomodules (704.42 MHz). These cryomodules contain niobium SRF cavities operating at 2 K, cooled by the accelerator cryoplantthrough the cryogenic distribution system. This paper presents the superconducting RF cavity and cryomodule cryogenic processes, which are developed for the technology demonstrators and to be ultimately integrated for the ESS tunnel operation.

  1. A compact 10 kW, 476 MHz solid state radio frequency amplifier for pre-buncher cavity of free electron laser injector linear accelerator

    SciTech Connect

    Mohania, Praveen; Mahawar, Ashish; Shrivastava, Purushottam; Gupta, P. D.


    A 10 kW, 476 MHz, 0.1% duty cycle solid state RF amplifier system for driving sub-harmonic, pre-buncher cavity of IR-FEL injector LINAC, has been developed at RRCAT. The 10 kW power is achieved by combining output of eight 1400 W amplifier modules using 8-way planar corporate combiner. The solid state amplifier modules have been developed using 50 V RF LDMOS transistors which although meant for push-pull operation are being used in single ended configuration with matching circuit developed on a thin (25 mils), high dielectric constant (9.7), low loss microwave laminate with an aim to have a compact structure. Ease of fabrication, modularity, small size, and low cost are the important features of this design which could be used as a template for low duty cycle medium to high pulsed power UHF amplifier system.

  2. A compact 10 kW, 476 MHz solid state radio frequency amplifier for pre-buncher cavity of free electron laser injector linear accelerator

    NASA Astrophysics Data System (ADS)

    Mohania, Praveen; Mahawar, Ashish; Shrivastava, Purushottam; Gupta, P. D.


    A 10 kW, 476 MHz, 0.1% duty cycle solid state RF amplifier system for driving sub-harmonic, pre-buncher cavity of IR-FEL injector LINAC, has been developed at RRCAT. The 10 kW power is achieved by combining output of eight 1400 W amplifier modules using 8-way planar corporate combiner. The solid state amplifier modules have been developed using 50 V RF LDMOS transistors which although meant for push-pull operation are being used in single ended configuration with matching circuit developed on a thin (25 mils), high dielectric constant (9.7), low loss microwave laminate with an aim to have a compact structure. Ease of fabrication, modularity, small size, and low cost are the important features of this design which could be used as a template for low duty cycle medium to high pulsed power UHF amplifier system.

  3. A compact 10 kW, 476 MHz solid state radio frequency amplifier for pre-buncher cavity of free electron laser injector linear accelerator.


    Mohania, Praveen; Mahawar, Ashish; Shrivastava, Purushottam; Gupta, P D


    A 10 kW, 476 MHz, 0.1% duty cycle solid state RF amplifier system for driving sub-harmonic, pre-buncher cavity of IR-FEL injector LINAC, has been developed at RRCAT. The 10 kW power is achieved by combining output of eight 1400 W amplifier modules using 8-way planar corporate combiner. The solid state amplifier modules have been developed using 50 V RF LDMOS transistors which although meant for push-pull operation are being used in single ended configuration with matching circuit developed on a thin (25 mils), high dielectric constant (9.7), low loss microwave laminate with an aim to have a compact structure. Ease of fabrication, modularity, small size, and low cost are the important features of this design which could be used as a template for low duty cycle medium to high pulsed power UHF amplifier system. PMID:24089846

  4. Design, fabrication, and test of an SRF cryomodule prototype at Fermilab

    SciTech Connect

    Soyars, W.; Darve, C.; Nicol, T.; Rowe, A.; /Fermilab


    In support of the Charged Kaons at the Main Injector (CKM) experiment [1], an SRF cryomodule was designed, assembled, and tested at Fermilab. The cryomodule prototype consists of a single niobium 13-cell 3.9 GHz superconducting RF cavity installed in its horizontal cryostat. The prototype was simplified to hold an additional dummy cavity in place of a second 13-cell SRF cavity. Although this cryomodule was originally intended for beamline deflection in the CKM experiment, this first preliminary test aims to compliment existing vertical 3-cell 3.9 GHz SRF cavity testing and also to gain expertise in the field of SRF testing. The cryomodule's thermal and mechanical design is reported. The test process and instrumentation is described. The first operational cooldown with RF powering is discussed and some cryogenic results are given.

  5. The polarized SRF gun experiment.

    SciTech Connect

    Kewisch,J.; Ben-Zvi, I.; Rao, T.; Burrill, A.; Pate, D.; Grover, R.; Todd, R.; Bluem, H.; Holmes, D.; Schultheiss, T.


    RF electron guns are capable of producing electron bunches with high brightness, which outperform DC electron guns and may even be able to provide electron beams for the ILC without the need for a damping ring. However, all successful existing guns for polarized electrons are DC guns because the environment inside an RF gun is hostile to the GaAs cathode material necessary for polarization. While the typical vacuum pressure in a DC gun is better than 10{sup -11} torr the vacuum in an RF gun is in the order of 10{sup -9} torr. Experiments at BINP Novosibirsk show that this leads to strong ion back-bombardment and generation of dark currents, which destroy the GaAs cathode in a short time. The situation might be much more favorable in a (super-conducting) SRF gun. The cryogenic pumping of the gun cavity walls may make it possible to maintain a vacuum close to 10{sup -12} torr, solving the problem of ion bombardment and dark currents. Of concern would be contamination of the gun cavity by evaporating cathode material. This report describes an experiment that Brookhaven National Laboratory (BNL) in collaboration with Advanced Energy Systems (AES) is conducting to answer these questions.

  6. Laser polishing of niobium for SRF applications

    SciTech Connect

    Zhao, Liang; Klopf, J. Michael; Reece, Charles E.; Kelley, Michael


    Smooth interior surfaces are desired for niobium SRF cavities, now obtained by buffered chemical polish (BCP) and/or electropolish (EP). Laser polishing is a potential alternative, having advantages of speed, freedom from chemistry and in-process inspection. Here we show that laser polishing can produce smooth topography with Power Spectral Density (PSD) measurements similar to that obtained by EP. We studied the influence of the laser power density and laser beam raster rate on the surface topography. These two factors need to be combined carefully to smooth the surface without damaging it. Computational modeling was used to simulate the surface temperature and explain the mechanism of laser polishing.

  7. Elliptical Cavity Shape Optimization for Acceleration and HOM Damping

    SciTech Connect

    Haipeng Wang; Robert Rimmer; Genfa Wu


    We report a survey of center cell shapes developed for Superconducting Radio Frequency (SRF) multi-cell cavities for different projects. Using a set of normalized parameters, we compare the designs for different frequencies and particle velocities for the fundamental mode. Using dispersion curves of High Order Modes (HOM) (frequency verse phase advance) calculated by MAFIA for a single cell, we further optimize the cavity shape to avoid a light cone line crossing at the dangerous resonance frequencies determined by the beam bunch structure and eliminate the trapped (or high R/Q) modes with a low group velocity. We developed this formulation to optimize a 5-cell, 750MHz cavity shape, with good real-estate accelerating gradient and a strong HOM damping waveguide structure for the JLab 1MW ERL-FEL project.

  8. Broadband and highly sensitive comb-assisted cavity ring down spectroscopy of CO near 1.57 μm with sub-MHz frequency accuracy

    NASA Astrophysics Data System (ADS)

    Mondelain, D.; Sala, T.; Kassi, S.; Romanini, D.; Marangoni, M.; Campargue, A.


    A self-referenced frequency comb has been combined with a cavity ring down (CRD) spectrometer to achieve a sub-MHz accuracy on the derived positions of the absorption lines. The frequency emitted by the distributed feedback (DFB) laser diode used in the spectrometer was obtained from the frequency of its beat note with the closest mode of the frequency comb. This delivers excellent frequency accuracy over a broad spectral region with sensitivity (noise equivalent absorption) of 1×10-11 cm-1 Hz-1/2. This setup is used to measure the absorption spectrum of CO over a wide range corresponding to the 3-0 band (6172.5-6418.0 cm-1). Accurate values of line centers are measured for a total of 184 lines of four CO isotopologues, namely 12C16O, 13C16O, 12C18O and 12C17O present in "natural" abundances in our sample. The measurements include the first extensive study of the 3-0 band of 12C18O and 12C17O, of the 4-1 hot band of 12C16O and the detection of new high-J transitions of the 3-0 band of 12C16O up to J=34. The line centers were corrected for the self-pressure shift and used to derive the upper state spectroscopic parameters. The obtained standard deviation of about 300 kHz and 500 kHz for the 3-0 band of 12C16O and of the minor isotopologues, respectively, is a good estimate of the average accuracy of the reported line centers. The resulting 3-0 line list of 12C16O provided as Supplementary material includes 69 reference line positions with a 300 kHz accuracy for the 6183-6418 cm-1 region.

  9. Cavities


    ... The tooth may hurt even without stimulation (spontaneous toothache). If irreversible damage to the pulp occurs and ... To detect cavities early, a dentist inquires about pain, examines the teeth, probes the teeth with dental instruments, and may take x-rays. People should ...

  10. World-Wide Experience with SRF Facilities

    SciTech Connect

    Andrew Hutton, Adam Carpenter


    The speaker will review and analyze the performance of existing SRF facilities in the world, addressing issues of usage and availability for different customers (HEP research, material sciences, ADS). Lessons learned should be summarized for proposed future facilities (ILC, Project X, Muon Collider). The first use of superconducting cavities for accelerating beams was at HEPL, Stanford University in the early sixties. Rather quickly, other laboratories followed suit, notably the University of Illinois at Champagne, Urbana and Cornell University. There were two main uses, which still persist today. The first is to provide accelerated particles as an injector or for fixed target experiments. The second is to maintain circulating beams, either for synchrotron light sources or for colliding beam experiments. Given the differing requirements, these two uses led to rather different implementations and, in particular, different average operating gradients. A second difference in the implementation is the speed of the particle being accelerated. Electrons are sufficiently relativistic at low beam energies (> {approx} 5 MeV) that cavities designed for relativistic beams can also function acceptably at low energy. This is not the case for protons or ion accelerators so, until recently, copper cavities were used to cover the first {approx} 100 MeV. Superconducting cavities are now also being proposed to cover this energy range as well using a series of superconducting cavities, each of which is matched to the particle velocity.

  11. Superconducting cavity tuner performance at CEBAF

    SciTech Connect

    Marshall, J.; Preble, J.; Schneider, W.


    At the Continuous Electron Beam Accelerator Facility (CEBAF), a 4 GeV, multipass CW electron beam is to be accelerated by 338 SRF, 5-cell niobium cavities operating at a resonant frequency of 1497 MHz. Eight cavities arranged as four pairs comprise a cyromodule, a croygenically isolated linac subdivision. The frequency is controlled by a mechanical tune attached to the first and fifth cell of the cavity which elastically deforms the cavity and thereby alters its resonant frequency. The tuner is driven by a stepper motor mounted external to the cryomodule that transfers torque through two rotary feedthroughs. A linear variable differential transducer (LVDT) mounted on the tuner monitors the displacement, and two limit switches interlock the movement beyond a 400 kHz bandwidth. Since the cavity has a loaded Q of 6.6 {center_dot} 10{sup 6}, the control system must maintain the frequency of the cavity to within {plus_minus} 50 Hz of the drive frequency for efficient coupling. This requirement is somewhat difficult to achieve since the difference in thermal contractions of the cavity and the tuner creates a frequency hystersis of approximately 10 kHz. The cavity is also subject to frequency shifts due to pressure fluctuations of the helium bath as well as radiation pressure. This requires that each cavity be characterized in terms of frequency change as a function of applied motor steps to allow proper tuning operations. This paper describes the electrical and mechanical performance of the cavity tuner during the commissioning and operation of the cryomodulus manufactured to date.

  12. Thermodynamic Evaluation of Hydrogen Absorption by Niobium During SRF Fabrication

    SciTech Connect

    Ricker, R. E.; Myneni, G. R.


    The properties and performance of the ultra high purity Nb used to fabricate superconducting radio frequency (SRF) particle accelerator cavities have been found to vary with processing conditions. One hypothesis for these variations is that hydrogen, absorbed during processing, is responsible for this behavior. The key assumption behind this hypothesis is that niobium can absorb hydrogen from one or more of the processing environments. This paper reviews work examining the validity of this assumption. It was determined that Nb will spontaneously react with water producing adsorbed atomic hydrogen that is readily absorbed into the metal. The passivating oxide film normally prevents this reaction, but this film is frequently removed during processing and it is attacked by the fluoride ion used in the polishing solutions for SRF cavities. However, during electropolishing that cathodic reduction of hydrogen is transferred to the auxiliary electrode and this should suppress hydrogen absorption.

  13. Thermodynamic Evaluation of Hydrogen Absorption by Niobium During SRF Fabrication

    SciTech Connect

    R.E. Ricker, G.R. Myneni


    The properties and performance of the ultra high purity Nb used to fabricate superconducting radio frequency (SRF) particle accelerator cavities have been found to vary with processing conditions. One hypothesis for these variations is that hydrogen, absorbed during processing, is responsible for this behavior. The key assumption behind this hypothesis is that niobium can absorb hydrogen from one or more of the processing environments. This paper reviews work examining the validity of this assumption. It was determined that Nb will spontaneously react with water producing adsorbed atomic hydrogen that is readily absorbed into the metal. The passivating oxide film normally prevents this reaction, but this film is frequently removed during processing and it is attacked by the fluoride ion used in the polishing solutions for SRF cavities. However, during electropolishing that cathodic reduction of hydrogen is transferred to the auxiliary electrode and this should suppress hydrogen absorption.

  14. Parameter Optimization for Laser Polishing of Niobium for SRF Applications

    SciTech Connect

    Zhao, Liang; Klopf, John Michael; Reece, Charles E.; Kelley, Michael J.


    Surface smoothness is critical to the performance of SRF cavities. As laser technology has been widely applied to metal machining and surface treatment, we are encouraged to use it on niobium as an alternative to the traditional wet polishing process where aggressive chemicals are involved. In this study, we describe progress toward smoothing by optimizing laser parameters on BCP treated niobium surfaces. Results shows that microsmoothing of the surface without ablation is achievable.

  15. RF Input Power Couplers for High Current SRF Applications

    SciTech Connect

    Khan, V. F.; Anders, W.; Burrill, Andrew; Knobloch, Jens; Kugeler, Oliver; Neumann, Axel; Wang, Haipeng


    High current SRF technology is being explored in present day accelerator science. The bERLinPro project is presently being built at HZB to address the challenges involved in high current SRF machines with the goal of generating and accelerating a 100 mA electron beam to 50 MeV in continuous wave (cw) mode at 1.3 GHz. One of the main challenges in this project is that of handling the high input RF power required for the photo-injector as well as booster cavities where there is no energy recovery process. A high power co-axial input power coupler is being developed to be used for the photo-injector and booster cavities at the nominal beam current. The coupler is based on the KEK–cERL design and has been modified to minimise the penetration of the coupler tip in the beam pipe without compromising on beam-power coupling (Qext ~105). Herein we report on the RF design of the high power (115 kW per coupler, dual couplers per cavity) bERLinPro (BP) coupler along with initial results on thermal calculations. We summarise the RF conditioning of the TTF-III couplers (modified for cw operation) performed in the past at BESSY/HZB. A similar conditioning is envisaged in the near future for the low current SRF photo-injector and the bERLinPro main linac cryomodule.

  16. The external Q factor of a dual-feed coupling for superconducting radio frequency cavities: theoretical and experimental studies.


    Dai, J; Belomestnykh, S; Ben-Zvi, I; Xu, Wencan


    We propose a theoretical model based on network analysis to study the external quality factor (Q factor) of dual-feed coupling for superconducting radio-frequency (SRF) cavities. Specifically, we apply our model to the dual-feed 704 MHz half-cell SRF gun for Brookhaven National Laboratory's prototype Energy Recovery Linac (ERL). The calculations show that the external Q factor of this dual-feed system is adjustable from 10(4) to 10(9) provided that the adjustment range of a phase shifter covers 0°-360°. With a period of 360°, the external Q factor of the coupling system changes periodically with the phase difference between the two coupling arms. When the RF phase of both coupling arms is adjusted simultaneously in the same direction, the external Q factor of the system also changes periodically, but with a period of 180°. PMID:24289393

  17. Optimization of SRF Linacs

    SciTech Connect

    Powers, Tom


    This work describes preliminary results of a new software tool that allows one to vary parameters and understand the effects on the optimized costs of construction plus 10 year operations of an SRF linac, the associated cryogenic facility, and controls, where operations includes the cost of the electrical utilities but not the labor or other costs. It derives from collaborative work done with staff from Accelerator Science and Technology Centre, Daresbury, UK several years ago while they were in the process of developing a conceptual design for the New Light Source project.[1] The initial goal was to convert a spread sheet format to a graphical interface to allow the ability to sweep different parameter sets. The tools also allow one to compare the cost of the different facets of the machine design and operations so as to better understand the tradeoffs. The work was first published in an ICFA Beam Dynamics News Letter.[2] More recent additions to the software include the ability to save and restore input parameters as well as to adjust the Qo versus E parameters in order to explore the potential costs savings associated with doing so. Additionally, program changes now allow one to model the costs associated with a linac that makes use of energy recovery mode of operation.

  18. The New 2nd-Generation SRF R&D Facility at Jefferson Lab: TEDF

    SciTech Connect

    Reece, Charles E.; Reilly, Anthony V.


    The US Department of Energy has funded a near-complete renovation of the SRF-based accelerator research and development facilities at Jefferson Lab. The project to accomplish this, the Technical and Engineering Development Facility (TEDF) Project has completed the first of two phases. An entirely new 3,100 m{sup 2} purpose-built SRF technical work facility has been constructed and was occupied in summer of 2012. All SRF work processes with the exception of cryogenic testing have been relocated into the new building. All cavity fabrication, processing, thermal treatment, chemistry, cleaning, and assembly work is collected conveniently into a new LEED-certified building. An innovatively designed 800 m2 cleanroom/chemroom suite provides long-term flexibility for support of multiple R&D and construction projects as well as continued process evolution. The characteristics of this first 2nd-generation SRF facility are described.

  19. A high-brightness SRF photoelectron injector for FEL light sources

    NASA Astrophysics Data System (ADS)

    Arnold, A.; Büttig, H.; Janssen, D.; Kamps, T.; Klemz, G.; Lehmann, W. D.; Lehnert, U.; Lipka, D.; Marhauser, F.; Michel, P.; Möller, K.; Murcek, P.; Schneider, Ch.; Schurig, R.; Staufenbiel, F.; Stephan, J.; Teichert, J.; Volkov, V.; Will, I.; Xiang, R.


    Most of the proposed electron accelerator projects for future FELs, ERLs or 4th generation light sources require electron beams with an unprecedented combination of high brightness, low emittance, and high average current. In all projects photoguns will be applied: DC-photoguns, normal conducting RF-photoguns (NC-guns), and superconducting RF photoguns (SRF-guns). While the concepts of DC- and NC-guns are well proofed, the SRF-gun development still possesses a high risk. Challenges are the design of the superconducting cavity, the choice of the photocathode type, its life time, a possible cavity contamination, the difficulty of coupling high average power into the gun, and, finally, the risk of beam excitation of higher-order cavity modes. In combination with SRF linacs, the SRF-guns seem to be the best solution for high average currents. Several R&D projects of SRF-gun have been launched. In this paper, we will give an overview of the progress of the SRF photoinjector development. In detail, the technical concept, the performance and the status of the Dresden Rossendorf SRF-gun project, a collaboration of BESSY, DESY, MBI and FZD, will be presented. The main design parameters of this SRF-gun are the final electron energy of 9.5 MeV, 1 mA average current, and transverse normalized emittances (rms) of 1 mm mrad at 77 pC and 2.5 mm mrad at 1 nC bunch charge. The 1.3 GHz cavity consists of three TESLA-shaped cells, a specially designed half-cell where the photocathode is placed and a choke filter in order to prevent RF losses at the cathode side. The normal-conducting photocathode with a Cs 2Te photoemission layer is cooled by liquid nitrogen. The SRF-gun cryostat consists of a stainless steel vacuum vessel, a warm magnetic shield, a liquid nitrogen-cooled thermal shield and a titanium He tank with a two-phase supply tube. The 10 kW fundamental power coupler is adopted from the ELBE cryomodule. In a first commissioning and test period the gun will be operated in

  20. Study of cavity type antenna structure of large-area 915 MHz ultra-high frequency wave plasma device based on three-dimensional finite difference time-domain analysis

    SciTech Connect

    Chang, Xijiang; Graduate School of Science and Engineering, Shizuoka University, 3-5-1 Johoku, Hamamatsu 432-8561 ; Kunii, Kazuki; Liang, Rongqing; Nagatsu, Masaaki; Graduate School of Engineering, Shizuoka University,3-5-1 Johoku, Hamamatsu 432-8561


    A large-area planar plasma source with a resonant cavity type launcher driven by a 915 MHz ultra-high frequency wave was developed. Theoretical analysis with the three-dimensional finite difference time-domain simulation was carried out to determine the optimized launcher structure by analyzing the resonant transverse magnetic mode in the resonant cavity. Numerical result expects that the resonant electric field distribution inside the cavity dominantly consists of the TM{sub 410} mode. The resonant cavity type launcher having 8 holes in an octagonal geometry was designed to fit the resonant transverse magnetic mode. Adjusting 8 hole positions of the launcher to the field pattern of the resonant TM{sub 410} mode, we found that the plasma density increased about 40%∼50% from 1.0∼1.1 × 10{sup 11} cm{sup −3} to ∼1.5 × 10{sup 11} cm{sup −3} at the same incident power of 2.5 kW, compared with the previous results with the launcher having 6 holes in the hexagonal geometry. It is also noted that the electron density changes almost linearly with the incident wave power without any mode jumps.

  1. Fundamental Research in Superconducting RF Cavity Design

    SciTech Connect

    Georg Hoffstaetter


    This is a 3-year SRF R&D proposal with two main goals: 1) to benefit near term high gradient SRF applications by understanding the causes of quench at high fields in present-day niobium cavities 2) to open the long-range prospects for SRF applications by experimentally verifying the recent exciting theoretical predication for new cavity materials such as Nb3Sn and MgB2. These predictions shwo that ultimately gradients of 100Mv/m to 200MV/m may become possible as material imperfections are overcome.

  2. SRF niobium characterization using SIMS and FIB-TEM

    NASA Astrophysics Data System (ADS)

    Stevie, F. A.


    Our understanding of superconducting radio frequency (SRF) accelerator cavities has been improved by elemental analysis at high depth resolution and by high magnification microscopy. This paper summarizes the technique development and the results obtained on poly-crystalline, large grain, and single crystal SRF niobium. Focused ion beam made possible sample preparation using transmission electron microscopy and the images obtained showed a very uniform oxide layer for all samples analyzed. Secondary ion mass spectrometry indicated the presence of a high concentration of hydrogen and the hydrogen content exhibited a relationship with improvement in performance. Depth profiles of carbon, nitrogen, and oxygen did not show major differences with heat treatment. Niobium oxide less than 10 nm thick was shown to be an effective hydrogen barrier. Niobium with titanium contamination showed unexpected performance improvement.

  3. SRF niobium characterization using SIMS and FIB-TEM

    SciTech Connect

    Stevie, F. A.


    Our understanding of superconducting radio frequency (SRF) accelerator cavities has been improved by elemental analysis at high depth resolution and by high magnification microscopy. This paper summarizes the technique development and the results obtained on poly-crystalline, large grain, and single crystal SRF niobium. Focused ion beam made possible sample preparation using transmission electron microscopy and the images obtained showed a very uniform oxide layer for all samples analyzed. Secondary ion mass spectrometry indicated the presence of a high concentration of hydrogen and the hydrogen content exhibited a relationship with improvement in performance. Depth profiles of carbon, nitrogen, and oxygen did not show major differences with heat treatment. Niobium oxide less than 10 nm thick was shown to be an effective hydrogen barrier. Niobium with titanium contamination showed unexpected performance improvement.

  4. Superconducting 112 MHz QWR electron gun

    SciTech Connect

    Belomestnykh, S.; Ben-Zvi, I.; Boulware, C.H.; Chang, X.; Grimm, T.L.; Rao, T.; Siegel, B.; Skaritka, J.; Than, R.; Winowski, M.; Wu, Q.; Xin, T.; Xue, L.


    Brookhaven National Laboratory and Niowave, Inc. have designed and fabricated a superconducting 112 MHz quarter-wave resonator (QWR) electron gun. The first cold test of the QWR cryomodule has been completed at Niowave. The paper describes the cryomodule design, presents the cold test results, and outline plans to upgrade the cryomodule. Future experiments include studies of different photocathodes and use for the coherent electron cooling proof-of-principle experiment. Two cathode stalk options, one for multi-alkali photocathodes and the other one for a diamond-amplified photocathode, are discussed. A quarter-wave resonator concept of superconducting RF (SRF) electron gun was proposed at BNL for electron cooling hadron beams in RHIC. QWRs can be made sufficiently compact even at low RF frequencies (long wavelengths). The long wavelength allows to produce long electron bunches, thus minimizing space charge effects and enabling high bunch charge. Also, such guns should be suitable for experiments requiring high average current electron beams. A 112 MHz QWR gun was designed, fabricated, and cold-tested in collaboration between BNL and Niowave. This is the lowest frequency SRF gun ever tested successfully. In this paper we describe the gun design and fabrication, present the cold test results, and outline our plans. This gun will also serve as a prototype for a future SRF gun to be used for coherent electron cooling of hadrons in eRHIC.

  5. Analysis of coupled-bunch instabilities for the NSLS-II storage ring with a 500 MHz 7-cell PETRA-III cavity

    NASA Astrophysics Data System (ADS)

    Bassi, G.; Blednykh, A.; Cheng, W.; Gao, F.; Rose, J.; Teytelman, D.


    The NSLS-II storage ring is designed to operate with superconducting RF-cavities with the aim to store an average current of 500 mA distributed in 1080 bunches, with a gap in the uniform filling for ion clearing. At the early stage of the commissioning (phase 1), characterized by a bare lattice without damping wigglers and without Landau cavities, a normal conducting 7-cell PETRA-III RF-cavity structure has been installed with the goal to store an average current of 25 mA. In this paper we discuss our analysis of coupled-bunch instabilities driven by the Higher Order Modes (HOMs) of the 7-cell PETRA-III RF-cavity. As a cure of the instabilities, we apply a well-known scheme based on a proper detuning of the HOMs frequencies based upon cavity temperature change, and the use of the beneficial effect of the slow head-tail damping at positive chromaticity to increase the transverse coupled-bunch instability thresholds. In addition, we discuss measurements of coupled-bunch instabilities observed during the phase 1 commissioning of the NSLS-II storage ring. In our analysis we rely, in the longitudinal case, on the theory of coupled-bunch instability for uniform fillings, while in the transverse case we complement our studies with numerical simulations with OASIS, a novel parallel particle tracking code for self-consistent simulations of collective effects driven by short and long-range wakefields.

  6. 1.3 GHz superconducting RF cavity program at Fermilab

    SciTech Connect

    Ginsburg, C.M.; Arkan, T.; Barbanotti, S.; Carter, H.; Champion, M.; Cooley, L.; Cooper, C.; Foley, M.; Ge, M.; Grimm, C.; Harms, E.; /Fermilab


    At Fermilab, 9-cell 1.3 GHz superconducting RF (SRF) cavities are prepared, qualified, and assembled into cryomodules (CMs) for Project X, an International Linear Collider (ILC), or other future projects. The 1.3 GHz SRF cavity program includes targeted R&D on 1-cell 1.3 GHz cavities for cavity performance improvement. Production cavity qualification includes cavity inspection, surface processing, clean assembly, and one or more cryogenic low-power CW qualification tests which typically include performance diagnostics. Qualified cavities are welded into helium vessels and are cryogenically tested with pulsed high-power. Well performing cavities are assembled into cryomodules for pulsed high-power testing in a cryomodule test facility, and possible installation into a beamline. The overall goals of the 1.3 GHz SRF cavity program, supporting facilities, and accomplishments are described.

  7. Etching of Niobium Sample Placed on Superconducting Radio Frequency Cavity Surface in Ar/CL2 Plasma

    SciTech Connect

    Janardan Upadhyay, Larry Phillips, Anne-Marie Valente


    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. It has been proven with flat samples that the bulk Niobium (Nb) removal rate and the surface roughness after the plasma etchings are equal to or better than wet etching processes. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders serve the purpose of diagnostic ports for the measurement of the plasma parameters and for the holding of the Nb sample to be etched. The plasma properties at RF (100 MHz) and MW (2.45 GHz) frequencies are being measured with the help of electrical and optical probes at different pressures and RF power levels inside of this cavity. The niobium coupons placed on several holders around the cell are being etched simultaneously. The etching results will be presented at this conference.

  8. Multipacting-free quarter-wavelength choke joint design for BNL SRF

    SciTech Connect

    Xu, W.; Belomestnykh, S.; Ben-Zvi, I.; Liaw, C. J.; Smith, K.; Than, R.; Tuozzolo, J.; Wang, E.; Weiss, D.; Zaltsman, A.


    The BNL SRF gun cavity operated well in CW mode up to 2 MV. However, its performance suffered due to multipacting in the quarter-wavelength choke joint. A new multipacting-free cathode stalk was designed and conditioned. This paper describes RF and thermal design of the new cathode stalk and its conditioning results.

  9. Fast thermometry for superconducting rf cavity testing

    SciTech Connect

    Orris, Darryl; Bellantoni, Leo; Carcagno, Ruben H.; Edwards, Helen; Harms, Elvin Robert; Khabiboulline, Timergali N.; Kotelnikov, Sergey; Makulski, Andrzej; Nehring, Roger; Pischalnikov, Yuriy; /Fermilab


    Fast readout of strategically placed low heat capacity thermometry can provide valuable information of Superconducting RF (SRF) cavity performance. Such a system has proven very effective for the development and testing of new cavity designs. Recently, several resistance temperature detectors (RTDs) were installed in key regions of interest on a new 9 cell 3.9 GHz SRF cavity with integrated HOM design at FNAL. A data acquisition system was developed to read out these sensors with enough time and temperature resolution to measure temperature changes on the cavity due to heat generated from multipacting or quenching within power pulses. The design and performance of the fast thermometry system will be discussed along with results from tests of the 9 cell 3.9GHz SRF cavity.

  10. Single-photon emission at a rate of 143 MHz from a deterministic quantum-dot microlens triggered by a mode-locked vertical-external-cavity surface-emitting laser

    NASA Astrophysics Data System (ADS)

    Schlehahn, A.; Gaafar, M.; Vaupel, M.; Gschrey, M.; Schnauber, P.; Schulze, J.-H.; Rodt, S.; Strittmatter, A.; Stolz, W.; Rahimi-Iman, A.; Heindel, T.; Koch, M.; Reitzenstein, S.


    We report on the realization of a quantum dot (QD) based single-photon source with a record-high single-photon emission rate. The quantum light source consists of an InGaAs QD which is deterministically integrated within a monolithic microlens with a distributed Bragg reflector as back-side mirror, which is triggered using the frequency-doubled emission of a mode-locked vertical-external-cavity surface-emitting laser (ML-VECSEL). The utilized compact and stable laser system allows us to excite the single-QD microlens at a wavelength of 508 nm with a pulse repetition rate close to 500 MHz at a pulse width of 4.2 ps. Probing the photon statistics of the emission from a single QD state at saturation, we demonstrate single-photon emission of the QD-microlens chip with g(2)(0) < 0.03 at a record-high single-photon flux of (143 ± 16) MHz collected by the first lens of the detection system. Our approach is fully compatible with resonant excitation schemes using wavelength tunable ML-VECSELs, which will optimize the quantum optical properties of the single-photon emission in terms of photon indistinguishability.

  11. Single-photon emission at a rate of 143 MHz from a deterministic quantum-dot microlens triggered by a mode-locked vertical-external-cavity surface-emitting laser

    SciTech Connect

    Schlehahn, A.; Gschrey, M.; Schnauber, P.; Schulze, J.-H.; Rodt, S.; Strittmatter, A.; Heindel, T. Reitzenstein, S.; Gaafar, M.; Vaupel, M.; Stolz, W.; Rahimi-Iman, A.; Koch, M.


    We report on the realization of a quantum dot (QD) based single-photon source with a record-high single-photon emission rate. The quantum light source consists of an InGaAs QD which is deterministically integrated within a monolithic microlens with a distributed Bragg reflector as back-side mirror, which is triggered using the frequency-doubled emission of a mode-locked vertical-external-cavity surface-emitting laser (ML-VECSEL). The utilized compact and stable laser system allows us to excite the single-QD microlens at a wavelength of 508 nm with a pulse repetition rate close to 500 MHz at a pulse width of 4.2 ps. Probing the photon statistics of the emission from a single QD state at saturation, we demonstrate single-photon emission of the QD-microlens chip with g{sup (2)}(0) < 0.03 at a record-high single-photon flux of (143 ± 16) MHz collected by the first lens of the detection system. Our approach is fully compatible with resonant excitation schemes using wavelength tunable ML-VECSELs, which will optimize the quantum optical properties of the single-photon emission in terms of photon indistinguishability.

  12. Ingot Nb based SRF technology for the International Linear Collider

    NASA Astrophysics Data System (ADS)

    Yamamoto, Akira; Yamanaka, Masashi; Myneni, Ganapati


    The International Linear Collider (ILC) is anticipated to be built as the next energy-frontier electron-positron colliding accelerator with a global effort in particle physics. Niobium based Superconducting Radio-Frequency (SRF) technology is required to provide beam-accelerating structure with elliptical cavity strings to linearly accelerate the electron and positron beams up to 250 GeV and to realize a center-of-mass energy of 500 GeV in collisions. The accelerator design and R&D efforts progressed, and the ILC Technical Design Report (ILC-TDR) was published in 2013. Niobium will take a critical role to generate electric field gradient with a frequency of 1.3 GHz, for accelerating the beam with the best efficiency, in energy balance, using RF superconductivity. This paper discusses a technical approach to provide Nb material (ingot) and thin disks for producing the elliptical cavity structure, with direct slicing from Nb ingot having sufficiently optimized purity and residual resistance ration (RRR) necessary for the ILC SRF cavities.

  13. Ingot Nb based SRF technology for the International Linear Collider

    SciTech Connect

    Yamamoto, Akira; Yamanaka, Masashi; Myneni, Ganapati


    The International Linear Collider (ILC) is anticipated to be built as the next energy-frontier electron-positron colliding accelerator with a global effort in particle physics. Niobium based Superconducting Radio-Frequency (SRF) technology is required to provide beam-accelerating structure with elliptical cavity strings to linearly accelerate the electron and positron beams up to 250 GeV and to realize a center-of-mass energy of 500 GeV in collisions. The accelerator design and R&D efforts progressed, and the ILC Technical Design Report (ILC-TDR) was published in 2013. Niobium will take a critical role to generate electric field gradient with a frequency of 1.3 GHz, for accelerating the beam with the best efficiency, in energy balance, using RF superconductivity. This paper discusses a technical approach to provide Nb material (ingot) and thin disks for producing the elliptical cavity structure, with direct slicing from Nb ingot having sufficiently optimized purity and residual resistance ration (RRR) necessary for the ILC SRF cavities.

  14. SRF Performance of CEBAF After Thermal Cycle to Ambient Temperature

    SciTech Connect

    Robert Rimmer; Jay Benesch; Joseph Preble; Charles Reece


    In September 2003, in the wake of Hurricane Isabel, JLab was without power for four days after a tree fell on the main power lines feeding the site. This was long enough to lose insulating vacuum in the cryomodules and cryogenic systems resulting in the whole accelerator warming up and the total loss of the liquid helium inventory. This thermal cycle stressed many of the cryomodule components causing several cavities to become inoperable due to helium to vacuum leaks. At the same time the thermal cycle released years of adsorbed gas from the cold surfaces. Over the next days and weeks this gas was pumped away, the insulating vacuum was restored and the machine was cooled back down and re-commissioned. In a testament to the robustness of SRF technology, only a small loss in energy capability was apparent, although individual cavities had quite different field-emission characteristics compared to before the event. In Summer 2004 a section of the machine was again cycled to room temperature during the long maintenance shutdown. We report on the overall SRF performance of the machine after these major disturbances and on efforts to characterize and optimize the new behavior for high-energy running.

  15. Multi-MHz retinal OCT

    PubMed Central

    Klein, Thomas; Wieser, Wolfgang; Reznicek, Lukas; Neubauer, Aljoscha; Kampik, Anselm; Huber, Robert


    We analyze the benefits and problems of in vivo optical coherence tomography (OCT) imaging of the human retina at A-scan rates in excess of 1 MHz, using a 1050 nm Fourier-domain mode-locked (FDML) laser. Different scanning strategies enabled by MHz OCT line rates are investigated, and a simple multi-volume data processing approach is presented. In-vivo OCT of the human ocular fundus is performed at different axial scan rates of up to 6.7 MHz. High quality non-mydriatic retinal imaging over an ultra-wide field is achieved by a combination of several key improvements compared to previous setups. For the FDML laser, long coherence lengths and 72 nm wavelength tuning range are achieved using a chirped fiber Bragg grating in a laser cavity at 419.1 kHz fundamental tuning rate. Very large data sets can be acquired with sustained data transfer from the data acquisition card to host computer memory, enabling high-quality averaging of many frames and of multiple aligned data sets. Three imaging modes are investigated: Alignment and averaging of 24 data sets at 1.68 MHz axial line rate, ultra-dense transverse sampling at 3.35 MHz line rate, and dual-beam imaging with two laser spots on the retina at an effective line rate of 6.7 MHz. PMID:24156052

  16. Vibrational measurement for commissioning SRF Accelerator Test Facility at Fermilab

    SciTech Connect

    McGee, M.W.; Leibfritz, J.; Martinez, A.; Pischalnikov, Y.; Schappert, W.; /Fermilab


    The commissioning of two cryomodule components is underway at Fermilab's Superconducting Radio Frequency (SRF) Accelerator Test Facility. The research at this facility supports the next generation high intensity linear accelerators such as the International Linear Collider (ILC), a new high intensity injector (Project X) and other future machines. These components, Cryomodule No.1 (CM1) and Capture Cavity II (CC2), which contain 1.3 GHz cavities are connected in series in the beamline and through cryogenic plumbing. Studies regarding characterization of ground motion, technical and cultural noise continue. Mechanical transfer functions between the foundation and critical beamline components have been measured and overall system displacement characterized. Baseline motion measurements given initial operation of cryogenic, vacuum systems and other utilities are considered.

  17. R&D progress in SRF surface preparation with centrifugal barrel polishing (cbp) for both Nb and Cu

    SciTech Connect

    Palczewski, Ari


    Centrifugal Barrel polishing (CBP) is becoming a common R&D tool for SRF cavity preparation around the world. During the CBP process a cylindrically symmetric SRF cavity is filled with relatively cheap and environmentally friendly abrasive and sealed. The cavity is then spun around a cylindrically symmetric axis at high speeds uniformly conditioning the inner surface. This uniformity is especially relevant for SRF application because many times a single manufacturing defects limits cavity?s performance well below it?s theoretical limit. In addition CBP has created surfaces with roughness?s on the order of 10?s of nm which create a unique surface for wet chemistry or thin film deposition. CBP is now being utilized at Jefferson Laboratory, Fermi Laboratory and Cornell University in the US, Deutsches Elektronen-Synchrotron in Germany, Laboratori Nazionali di Legnaro in Italy, and Raja Ramanna Centre for Advanced Technology in India. In this talk we will present current CBP research from each lab including equipment, baseline recipes, cavity removal rates and subsequent cryogenic cavity tests on niobium as well as copper cavities where available.

  18. Defect Detection in Superconducting Radiofrequency Cavity Surface Using C + + and OpenCV

    NASA Astrophysics Data System (ADS)

    Oswald, Samantha; Thomas Jefferson National Accelerator Facility Collaboration


    Thomas Jefferson National Accelerator Facility (TJNAF) uses superconducting radiofrequency (SRF) cavities to accelerate an electron beam. If theses cavities have a small particle or defect, it can degrade the performance of the cavity. The problem at hand is inspecting the cavity for defects, little bubbles of niobium on the surface of the cavity. Thousands of pictures have to be taken of a single cavity and then looked through to see how many defects were found. A C + + program with Open Source Computer Vision (OpenCV) was constructed to reduce the number of hours searching through the images and finds all the defects. Using this code, the SRF group is now able to use the code to identify defects in on-going tests of SRF cavities. Real time detection is the next step so that instead of taking pictures when looking at the cavity, the camera will detect all the defects.

  19. Surface Impedance of Superconducting Radio Frequency (SRF) Materials

    NASA Astrophysics Data System (ADS)

    Xiao, Binping

    Superconducting radio frequency (SRF) technology is widely adopted in particle accelerators. There remain many open questions, however, in developing a systematic understanding of the fundamental behavior of SRF materials, including niobium treated in different ways and various other bulk/thin film materials that are fabricated with different methods under assorted conditions. A facility that can measure the SRF properties of small samples in a range of 2˜40 K temperature is needed in order to fully answer these questions. The Jefferson Lab surface impedance characterization (SIC) system has been designed to attempt to meet this requirement. It consists of a sapphire-loaded cylindrical Nb TE011 cavity at 7.4 GHz with a 50 mm diameter flat sample placed on a non-contacting end plate and uses a calorimetric technique to measure the radio frequency (RF) induced heat on the sample. Driving the resonance to a known field on this surface enables one to derive the surface resistance of a relatively small localized area. TE011 mode identification has been done at room temperature and 4 K, and has been compared with Microwave Studio® and SuperFish simulation results. RF loss mechanisms in the SIC system are under investigation. A VCO phase lock loop system has been used in both CW and pulsed mode. Two calorimeters, with stainless steel and Cu as the thermal path material for high precision and high power versions, respectively, have been designed and commissioned for the SIC system to provide low temperature control and measurement. A power compensation method has been developed to measure the RF induced power on the sample. Simulation and experimental results show that with these two calorimeters, the whole thermal range of interest for SRF materials has been covered, The power measurement error in the interested power range is within 1.2% and 2.7% for the high precision and high power versions, respectively. Temperature distributions on the sample surface for both

  20. RF and structural characterization of new SRF films

    SciTech Connect

    A.-M. Valente-Feliciano,H. L. Phillips,C. E. Reece,X. Zhao,D. Gu,R. Lukaszew,B. Xiao,K. Seo


    In the past years, energetic vacuum deposition methods have been developed in different laboratories to improve Nb/Cu technology for superconducting cavities. Jefferson Lab is pursuing energetic condensation deposition via Electron Cyclotron Resonance. As part of this study, the influence of the deposition energy on the material and RF properties of the Nb thin film is investigated. The film surface and structure analyses are conducted with various techniques like X-ray diffraction, Transmission Electron Microscopy, Auger Electron Spectroscopy and RHEED. The microwave properties of the films are characterized on 50 mm disk samples with a 7.5 GHz surface impedance characterization system. This paper presents surface impedance measurements in correlation with surface and material characterization for Nb films produced on copper substrates with different bias voltages and also highlights emerging opportunities for developing multilayer SRF films with a new deposition system.

  1. 40 CFR 35.3115 - Eligible activities of the SRF.

    Code of Federal Regulations, 2011 CFR


    ... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Eligible activities of the SRF. 35.3115 Section 35.3115 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3115 Eligible activities of the SRF. Funds in the SRF...

  2. Implications of incomplete energy recovery in SRF-based energy recovery linacs

    SciTech Connect

    Tom Powers; Chris Tennant


    The choice of the loaded quality factor (QL) of a superconducting cavity is driven by many factors, including beam loading effects and microphonics. In accelerators with minimal beam loading, use of SRF cavities with relatively high loaded-Q allows one to employ lower power RF sources. Many individuals are therefore considering energy recovered linac designs making use of SRF cavities with loaded-Q values that are primarily limited by microphonic effects. While this is valid for machines which have near-ideal energy recovery, many applications do not necessarily fit this model. In some applications the second pass, energy recovered beam experiences a phase shift between one state of machine operation and a second state. One complication in this process is that the cavity resonance control algorithms are influenced by this phase shift. With respect to RF power requirements, this is a positive interaction inasmuch as the tuner partially compensates for the phase shift of the recovered beam. This work will go through the implications of partial energy recovery on the selection of the loaded-Q for cavity fundamental power couplers.

  3. Some experiences with BEPCII SRF system operation

    NASA Astrophysics Data System (ADS)

    Huang, Tong-ming; Lin, Hai-ying; Sun, Yi; Dai, Jian-ping; Wang, Guang-wei; Pan, Wei-min Li, Zhong-quan; Ma, Qiang; Wang, Qun-yao; Zhao, Guang-yuan; Mi, Zheng-hui; Sha, Peng


    The Superconducting Radio Frequency (SRF) system of the upgrade project of the Beijing Electron Positron Collider (BEPCII) has been in operation for almost 8 years. During operation, many problems have been encountered, such as excessive heating of the power couplers, frequent beam trips during high intensity colliding, false arc interlock trigger and so on. Among them, some has been solved successfully, some have been alleviated. This paper will describe some experiences with BEPCII SRF system operation, including the symptoms, causes and solutions of problems.

  4. Identification of New SRF Binding Sites in Genes Modulated by SRF Over-Expression in Mouse Hearts

    PubMed Central

    Zhang, Xiaomin; Azhar, Gohar; Helms, Scott; Burton, Brian; Huang, Chris; Zhong, Ying; Gu, Xuesong; Fang, Hong; Tong, Weida; Wei, Jeanne Y.


    Background: To identify in vivo new cardiac binding sites of serum response factor (SRF) in genes and to study the response of these genes to mild over-expression of SRF, we employed a cardiac-specific, transgenic mouse model, with mild over-expression of SRF (Mild-O SRF Tg). Methodology: Microarray experiments were performed on hearts of Mild-O-SRF Tg at 6 months of age. We identified 207 genes that are important for cardiac function that were differentially expressed in vivo. Among them the promoter region of 192 genes had SRF binding motifs, the classic CArG or CArG-like (CArG-L) elements. Fifty-one of the 56 genes with classic SRF binding sites had not been previously reported. These SRF-modulated genes were grouped into 12 categories based on their function. It was observed that genes associated with cardiac energy metabolism shifted toward that of carbohydrate metabolism and away from that of fatty acid metabolism. The expression of genes that are involved in transcription and ion regulation were decreased, but expression of cytoskeletal genes was significantly increased. Using public databases of mouse models of hemodynamic stress (GEO database), we also found that similar altered expression of the SRF-modulated genes occurred in these hearts with cardiac ischemia or aortic constriction as well. Conclusion and significance: SRF-modulated genes are actively regulated under various physiological and pathological conditions. We have discovered that a large number of cardiac genes have classic SRF binding sites and were significantly modulated in the Mild-O-SRF Tg mouse hearts. Hence, the mild elevation of SRF protein in the heart that is observed during typical adult aging may have a major impact on many SRF-modulated genes, thereby affecting cardiac structure and performance. The results from our study could help to enhance our understanding of SRF regulation of cellular processes in the aged heart. PMID:21792293

  5. Effect of RF Gradient upon the Performance of the Wisconsin SRF Electron Gun

    SciTech Connect

    Bosch, Robert; Legg, Robert A.


    The performance of the Wisconsin 200-MHz SRF electron gun is simulated for several values of the RF gradient. Bunches with charge of 200 pC are modeled for the case where emittance compensation is completed during post-acceleration to 85 MeV in a TESLA module. We first perform simulations in which the initial bunch radius is optimal for the design gradient of 41 MV/m. We then optimize the radius as a function of RF gradient to improve the performance for low gradients.

  6. Chemical pathways in ultracold reactions of SrF molecules

    SciTech Connect

    Meyer, Edmund R.; Bohn, John L.


    We present a theoretical investigation of the chemical reaction SrF + SrF {yields} products, focusing on reactions at ultralow temperatures. We find that bond swapping SrF + SrF {yields} Sr{sub 2} + F{sub 2} is energetically forbidden at these temperatures. Rather, the only energetically allowed reaction is SrF + SrF {yields} SrF{sub 2} + Sr, and even then only singlet states of the SrF{sub 2} trimer can form. A calculation along a reduced reaction path demonstrates that this abstraction reaction is barrierless and proceeds by one SrF molecule ''handing off'' a fluorine atom to the other molecule.

  7. Exploration of very high gradient cavities

    SciTech Connect

    Eremeev, Grigory


    Several of the 9-cell ILC cavities processed at Jlab within ongoing ILC R&D program have shown interesting behavior at high fields, such as mode mixing and sudden field emission turn-on during quench. Equipped with thermometry and oscillating superleak transducer (OST) system for quench detection, we couple our RF measurements with local dissipation measurements. In this contribution we report on our findings with high gradient SRF cavities.

  8. Analysis Of Post-Wet-Chemistry Heat Treatment Effects On Nb SRF Surface Resistance

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Kneisel, Peter K.; Myneni, Ganapati Rao


    Most of the current research in superconducting radio frequency (SRF) cavities is focused on ways to reduce the construction and operating cost of SRF-based accelerators as well as on the development of new or improved cavity processing techniques. The increase in quality factors is the result of the reduction of the surface resistance of the materials. A recent test on a 1.5 GHz single cell cavity made from ingot niobium of medium purity and heat treated at 1400 deg C in a ultra-high vacuum induction furnace resulted in a residual resistance of ~ 1n{Omega} and a quality factor at 2.0 K increasing with field up to ~ 5×10{sup 10} at a peak magnetic field of 90 mT. In this contribution, we present some results on the investigation of the origin of the extended Q{sub 0}-increase, obtained by multiple HF rinses, oxypolishing and heat treatment of all Nb cavities.

  9. SRF is required for neutrophil migration in response to inflammation

    PubMed Central

    Taylor, Ashley; Tang, Wenwen; Bruscia, Emanuela M.; Zhang, Ping-Xia; Lin, Aiping; Gaines, Peter; Wu, Dianqing


    Serum response factor (SRF) is a ubiquitously expressed transcription factor and master regulator of the actin cytoskeleton. We have previously shown that SRF is essential for megakaryocyte maturation and platelet formation and function. Here we elucidate the role of SRF in neutrophils, the primary defense against infections. To study the effect of SRF loss in neutrophils, we crossed Srffl/fl mice with select Cre-expressing mice and studied neutrophil function in vitro and in vivo. Despite normal neutrophil numbers, neutrophil function is severely impaired in Srf knockout (KO) neutrophils. Srf KO neutrophils fail to polymerize globular actin to filamentous actin in response to N-formyl-methionine-leucine-phenylalanine, resulting in significantly disrupted cytoskeletal remodeling. Srf KO neutrophils fail to migrate to sites of inflammation in vivo and along chemokine gradients in vitro. Polarization in response to cytokine stimuli is absent and Srf KO neutrophils show markedly reduced adhesion. Integrins play an essential role in cellular adhesion, and although integrin expression levels are maintained with loss of SRF, integrin activation and trafficking are disrupted. Migration and cellular adhesion are essential for normal cell function, but also for malignant processes such as metastasis, underscoring an essential function for SRF and its pathway in health and disease. PMID:24574460

  10. Mechanical Properties of Ingot Nb Cavities

    SciTech Connect

    Ciovati, Gianluigi; Dhakal, Pashupati; Kneisel, Peter; Mammosser, John; Matalevich, Joseph; Rao Myneni, Ganapati


    This contribution presents the results of measurements of the resonant frequency and of strain along the contour of a single-cell cavity made of ingot Nb subjected to increasing uniform differential pressure, up to 6 atm. The data were used to infer mechanical properties of this material after cavity fabrication, by comparison with the results from simulation calculations done with ANSYS. The objective is to provide useful information about the mechanical properties of ingot Nb cavities which can be used in the design phase of SRF cavities intended to be built with this material.

  11. Injector Cavities Fabrication, Vertical Test Performance and Primary Cryomodule Design

    SciTech Connect

    Wang, Haipeng; Cheng, Guangfeng; Clemens, William; Davis, G; Macha, Kurt; Overton, Roland; Spell, D.


    After the electromagnetic design and the mechanical design of a β=0.6, 2-cell elliptical SRF cavity, the cavity has been fabricated. Then both 2-cell and 7-cell cavities have been bench tuned to the target values of frequency, coupling external Q and field flatness. After buffer chemistry polishing (BCP) and high pressure rinses (HPR), Vertical 2K cavity test results have been satisfied the specifications and ready for the string assembly. We will report the cavity performance including Lorenz Force Detuning (LFD) and Higher Order Modes (HOM) damping data. Its integration with cavity tuners to the cryomodule design will be reported.

  12. NbTiN Based SIS Multilayer Structures for SRF Applications

    SciTech Connect

    Valente, Anne-marie; Eremeev, Grigory; Phillips, H; Reece, Charles; Spradlin, Joshua; Yang, Qiguang; Lukaszew, Rosa


    For the past three decades, bulk niobium has been the material of choice for SRF cavities applications. RF cavity performance is now approaching the theoretical limit for bulk niobium. For further improvement of RF cavity performance for future accelerator projects, Superconductor Insulator - Superconductor (SIS) multilayer structures (as recently proposed by Alex Gurevich) present the theoretical prospect to reach RF performance beyond bulk Nb, using thinly layered higher-Tc superconductors with enhanced Hc1. Jefferson Lab (JLab) is pursuing this approach with the development of NbTiN and AlN based multilayer SIS structures. This paper presents the results on the characteristics of NbTiN films and the first RF measurements on NbTiN-based multilayer structure on thick Nb films.

  13. Research on Field Emission and Dark Current in ILC Cavities

    SciTech Connect

    Liu, Kexin; Li, Yongming; Palczewski, Ari; Geng, Rongli


    Field emission and dark current are issues of concern for SRF cavity performance and SRF linac operation. Complete understanding and reliable control of the issue are still needed, especially in full-scale multi-cell cavities. Our work aims at developing a generic procedure for finding an active field emitter in a multi-cell cavity and benchmarking the procedure through cavity vertical test. Our ultimate goal is to provide feedback to cavity preparation and cavity string assembly in order to reduce or eliminate filed emission in SRF cavities. Systematic analysis of behaviors of field emitted electrons is obtained by ACE3P developed by SLAC. Experimental benchmark of the procedure was carried out in a 9-cell cavity vertical test at JLab. The energy spectrum of Bremsstrahlung X-rays is measured using a NaI(Tl) detector. The end-point energy in the X-ray energy spectrum is taken as the highest kinetic electron energy to predict longitudinal position of the active field emitter. Angular location of the field emitter is determined by an array of silicon diodes around irises of the cavity. High-resolution optical inspection was conducted at the predicted field emitter location.

  14. Magnetic flux studies in horizontally cooled elliptical superconducting cavities

    SciTech Connect

    Martinello, M. Checchin, M.; Grassellino, A. Crawford, A. C.; Melnychuk, O.; Romanenko, A.; Sergatskov, D. A.


    Previous studies on magnetic flux expulsion as a function of cooldown procedures for elliptical superconducting radio frequency (SRF) niobium cavities showed that when the cavity beam axis is placed parallel to the helium cooling flow and sufficiently large thermal gradients are achieved, all magnetic flux could be expelled and very low residual resistance could be achieved. In this paper, we investigate flux trapping for the case of resonators positioned perpendicularly to the helium cooling flow, which is more representative of how SRF cavities are cooled in accelerators and for different directions of the applied magnetic field surrounding the resonator. We show that different field components have a different impact on the surface resistance, and several parameters have to be considered to fully understand the flux dynamics. A newly discovered phenomenon of concentration of flux lines at the cavity top leading to temperature rise at the cavity equator is presented.

  15. Recent improvements to software used for optimization of SRF linacs

    SciTech Connect

    Powers, Tom J.


    This work describes a software tool that allows one to vary parameters and understand the effects on the optimized costs of construction plus 10 year operations of an SRF linac, where operation costs includes the cost of the electrical utilities but not the labor or other costs. The program includes estimates for the associated cryogenic facility, and controls hardware. The software interface provides the ability to vary the cost of the different aspects of the machine as well as to change the cryomodule and cavity types. Additionally, this work will describe the recent improvements to the software that allow one to estimate the costs of energy-recovery based linacs and to enter arbitrary values of the low field Q0 and Q0 slope. The initial goal when developing the software was to convert a spreadsheet format to a graphical interface and to allow the ability to sweep different parameter sets. The tools also allow one to compare the cost of the different facets of the machine design and operations so as to better understand tradeoffs. An example of how it was used to independently investigate cost optimization tradeoffs for the LCLS-II linac will also be presented.

  16. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2011 CFR


    ... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Limitations on SRF assistance. 35.3125 Section 35.3125 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on SRF assistance. (a) Prevention of...

  17. Plasma processing of superconducting radio frequency cavities

    NASA Astrophysics Data System (ADS)

    Upadhyay, Janardan

    The development of plasma processing technology of superconducting radio frequency (SRF) cavities not only provides a chemical free and less expensive processing method, but also opens up the possibility for controlled modification of the inner surfaces of the cavity for better superconducting properties. The research was focused on the transition of plasma etching from two dimensional flat surfaces to inner surfaces of three dimensional (3D) structures. The results could be applicable to a variety of inner surfaces of 3D structures other than SRF cavities. Understanding the Ar/Cl2 plasma etching mechanism is crucial for achieving the desired modification of Nb SRF cavities. In the process of developing plasma etching technology, an apparatus was built and a method was developed to plasma etch a single cell Pill Box cavity. The plasma characterization was done with the help of optical emission spectroscopy. The Nb etch rate at various points of this cavity was measured before processing the SRF cavity. Cylindrical ring-type samples of Nb placed on the inner surface of the outer wall were used to measure the dependence of the process parameters on plasma etching. The measured etch rate dependence on the pressure, rf power, dc bias, temperature, Cl2 concentration and diameter of the inner electrode was determined. The etch rate mechanism was studied by varying the temperature of the outer wall, the dc bias on the inner electrode and gas conditions. In a coaxial plasma reactor, uniform plasma etching along the cylindrical structure is a challenging task due to depletion of the active radicals along the gas flow direction. The dependence of etch rate uniformity along the cylindrical axis was determined as a function of process parameters. The formation of dc self-biases due to surface area asymmetry in this type of plasma and its variation on the pressure, rf power and gas composition was measured. Enhancing the surface area of the inner electrode to reduce the

  18. Normal Conducting RF Cavity for MICE

    SciTech Connect

    Li, D.; DeMello, A.; Virostek, S.; Zisman, M.; Summers, D.


    Normal conducting RF cavities must be used for the cooling section of the international Muon Ionization Cooling Experiment (MICE), currently under construction at Rutherford Appleton Laboratory (RAL) in the UK. Eight 201-MHz cavities are needed for the MICE cooling section; fabrication of the first five cavities is complete. We report the cavity fabrication status including cavity design, fabrication techniques and preliminary low power RF measurements.

  19. Upgraded cavities for the positron accumulator ring of the APS

    SciTech Connect

    Kang, Y.W.; Jiang, X.; Mangra, D.


    Upgraded versions of cavities for the APS positron accumulator ring (PAR) have been built and are being tested. Two cavities are in the PAR: a fundamental 9.8-MHz cavity and a twelfth harmonic 117.3-MHz cavity. Both cavities have been manufactured for higher voltage operation with improved Q-factors, reliability, and tuning capability. Both cavities employ current-controlled ferrite tuners for control of the resonant frequency. The harmonic cavity can be operated in either a pulsed mode or a CW mode. The rf properties of the cavities are presented.

  20. Comparison of Deformation in High-Purity Single/Large Grain and Polycrystalline Niobium Superconducting Cavities

    SciTech Connect

    Ganapati Rao Myneni; Peter Kneisel


    The current approach for the fabrication of superconducting radio frequency (SRF) cavities is to roll and deep draw sheets of polycrystalline high-purity niobium. Recently, a new technique was developed at Jefferson Laboratory that enables the fabrication of single-crystal high-purity Nb SRF cavities. To better understand the differences between SRF cavities fabricated out of fine-grained polycrystalline sheet in the standard manner and single crystal cavities fabricated by the new technique, two half-cells were produced according to the two different procedures and compared using a variety of analytical techniques including optical microscopy, scanning laser confocal microscopy, profilometry, and X-ray diffraction. Crystallographic orientations, texture, and residual stresses were determined in the samples before and after forming and this poster presents the results of this ongoing study.

  1. Three-dimensional self-consistent simulations of multipacting in superconducting radio frequency cavities

    SciTech Connect

    Chet Nieter


    Superconducting radio frequency (SRF) cavities are a popular choice among researchers designing new accelerators because of the reduced power losses due to surface resistance. However, SRF cavities still have unresolved problems, including the loss of power to stray electrons. Sources of these electrons are field emission from the walls and ionization of background gas, but the predominant source is secondary emission yield (SEY) from electron impact. When the electron motion is in resonance with the cavity fields the electrons strike the cavity surface repeatedly creating a resonant build up of electrons referred to as multipacting. Cavity shaping has successfully reduced multipacting for cavities used in very high energy accelerators. However, multipacting is still a concern for the cavity power couplers, where shaping is not possible, and for cavities used to accelerate particles at moderate velocities. This Phase II project built upon existing models in the VORPAL simulation framework to allow for simulations of multipacting behavior in SRF cavities and their associated structures. The technical work involved allowed existing models of secondary electron generation to work with the complex boundary conditions needed to model the cavity structures. The types of data produced by VORPAL were also expanded to include data common used by cavity designers to evaluate cavity performance. Post-processing tools were also modified to provide information directly related to the conditions that produce multipacting. These new methods were demonstrated by running simulations of a cavity design being developed by researchers at Jefferson National Laboratory to attempt to identify the multipacting that would be an issue for the cavity design being considered. These simulations demonstrate that VORPAL now has the capabilities to assist researchers working with SRF cavities to understand and identify possible multipacting issues with their cavity designs.

  2. RF Test Results from Cryomodule 1 at the Fermilab SRF Beam Test Facility

    SciTech Connect

    Harms, E.; Carlson, K.; Chase, B.; Cullerton, E.; Hocker, A.; Jensen, C.; Joireman, P.; Klebaner, A.; Kubicki, T.; Kucera, M.; Legan, A.; /Fermilab /DESY


    Powered operation of Cryomodule 1 (CM-1) at the Fermilab SRF Beam Test Facility began in late 2010. Since then a series of tests first on the eight individual cavities and then the full cryomodule have been performed. We report on the results of these tests and lessons learned which will have an impact on future module testing at Fermilab. Since November 2010 Cryomodule 1 has been operating at 2 Kelvin. After evaluating each of the eight cavities while individually powered, the entire module has recently been powered and peak operation determined as shown in Figure 4. Several more weeks of measurements are planned before the module is warmed up, removed and replaced with Cryomodule 2 now under assembly at Fermilab.

  3. Diagnostics Beamline for the SRF Gun Project

    SciTech Connect

    T. Kamps; V. Durr; K. Goldammer; D. Kramer; P. Kuske; J. Kuszynski; D. Lipka; F. Marhauser; T. Quast; D. Richter; U. Lehnert; P. Michel; J. Teichert; P. Evtushenko; I. Will


    A superconducting radio-frequency photo electron injector (SRF gun) is currently under construction by a collaboration of BESSY, DESY, FZR and MBI. The project aims at the design and setup of a CW SRF gun including a diagnostics beamline for the ELBE FEL and to address R&D issues on low emittance injectors for future light sources such as the BESSY FEL. Of critical importance for the injector performance is the control of the electron beam parameters. For this reason a compact diagnostics beamline is under development serving a multitude of operation settings ranging from low-charge (77pC), low-emittance (1 mm mrad) mode to high-charge (2.5nC) operation of the gun. For these operation modes beam dynamics simulations are resulting in boundary conditions for the beam instrumentation. Proven and mature technology is projected wherever possible, for example for current and beam position monitoring. The layout of the beam profile and emittance measurement systems is described. For the bunch length, which varies between 5 ps and 50 ps, two schemes using electro-optical sampling and Cherenkov radiation are detailed. The beam energy and energy spread is measured with a 180-degree spectrometer.

  4. Ion Exchange Temperature Testing with SRF Resin

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Brown, Garrett N.; Peterson, Reid A.


    Ion exchange using the Spherical Resorcinol-Formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection for use in the Pretreatment Facility of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in an at-tank deployment for removing 137Cs. Recent proposed changes to the WTP ion exchange process baseline indicate that higher temperatures (50°C) to alleviate post-filtration precipitation issues prior to reaching the ion exchange columns may be required. Therefore, it is important to understand the behavior of SRF resin performance under the conditions expected with the new equipment and process changes. This research examined the impact of elevated temperature on resin loading and resin degradation during extended solution flow using elevated temperature (45°, 50°, 55°, 60°, 65°, 75°C). Testing for extended times at elevated temperatures showed that the resin does degrade and loading capacity is reduced at and above 45°C. Above 60°C the resin appears to not load at all.

  5. Higher order mode damping in a five-cell superconducting rf cavity with a photonic band gap coupler cell

    NASA Astrophysics Data System (ADS)

    Arsenyev, Sergey A.; Temkin, Richard J.; Shchegolkov, Dmitry Yu.; Simakov, Evgenya I.; Boulware, Chase H.; Grimm, Terry L.; Rogacki, Adam R.


    We present a study of higher order mode (HOM) damping in the first multicell superconducting radio-frequency (SRF) cavity with a photonic band gap (PBG) coupler cell. Achieving higher average beam currents is particularly desirable for future light sources and particle colliders based on SRF energy-recovery linacs (ERLs). Beam current in ERLs is limited by the beam breakup instability, caused by parasitic HOMs interacting with the beam in accelerating cavities. A PBG cell incorporated in an accelerating cavity can reduce the negative effect of HOMs by providing a frequency selective damping mechanism, thus allowing significantly higher beam currents. The five-cell cavity with a PBG cell was designed and optimized for HOM damping. Monopole and dipole HOMs were simulated. The SRF cavity was fabricated and tuned. External quality factors for some HOMs were measured in a cold test. The measurements agreed well with the simulations.

  6. Physical and mechanical metallurgy of high purity Nb accelerator cavities.

    SciTech Connect

    Wright, N. T.; Bieler, T. R.; Pourgoghart , F.; Compton, C.; Hartwig, K. T.; Baars, D.; Zamiri, A.; Chandrasekaran, S.; Darbandi, P.; Jiang, H.; Skoug, E.; Balachandran, S.; Ice, G. E.; Liu, W.; Michigan State Univ.; Texas A & M Univ.; ORNL


    In the past decade, high Q values have been achieved in high purity Nb superconducting radio frequency (SRF) cavities. Fundamental understanding of the physical metallurgy of Nb that enables these achievements is beginning to reveal what challenges remain to establish reproducible and cost-effective production of high performance SRF cavities. Recent studies of dislocation substructure development and effects of recrystallization arising from welding and heat treatments and their correlations with cavity performance are considered. With better fundamental understanding of the effects of dislocation substructure evolution and recrystallization on electron and phonon conduction, as well as the interior and surface states, it will be possible to design optimal processing paths for cost-effective performance using approaches such as hydroforming, which minimizes or eliminates welds in a cavity.

  7. High-gradient SRF R&D for ILC at Jefferson Lab

    SciTech Connect

    Geng, Rongli; Crawford, Anthony; Ciovati, Gianluigi; Champion, Mark; Sergatskov, Dmitri; Furuta, Fumio; Saito, Kenji


    Jefferson Lab plays an active role in high-gradient SRF R&D in the frame work of the internationally coordinated ILC S0 program. The S0 aim is to push the yield at 35 MV/m in 9-cell cavities. So far, twelve cavities have been electropolishing (EP) processed and RF tested by using the state-of-the-art recipes at JLab, in close collaboration with FNAL and KEK. Seven of them reached a best gradient of over 31.5 MV/m. Understanding gradient limiting mechanisms in real 9-cell cavities is an important component of our studies. Thermometry and high-resolution optical inspection are used to locate and understand the source of gradient limits. Experimenting with selective cavities is still a necessary method for process optimization. One example is the first demonstration of 35 MV/m without detectable Bremsstrahlung X-ray after a light EP is applied to a previously heavy BCP etched 7-cell cavity. Some new understanding has been gained with regard to quench behaviors, field emission behaviors as

  8. Cavity magnomechanics

    NASA Astrophysics Data System (ADS)

    Zou, Chang-Ling; Zhang, Xufeng; Jiang, Liang; Tang, Hong


    Recently, cavity magnonics has attracted much attention for potential applications of coherent information transduction and hybrid quantum devices. The magnon is a collective spin wave excitation in ferromagnetic material. It is magnetically tunability, with long coherence time and non-reciprocical interaction with electro-magnetic fields. We report the coherent coupling between magnon, microwave photon and phonon. First, we demonstrate strong coupling and ultrastrong coupling between the magnon in YIG sphere and microwave photon in three-dimensional cavity. Then, based on the hybridized magnon-photon modes, we observe the triply resonant magnon-mcirowave photon-phonon coupling, where the ultrahigh-Q mechanical vibration of YIG sphere is dispersively coupled with the magnon via magnetostrictive interaction. We observe interesting phenomena, including electromagnetically induced transparency/absorption and parametric amplification. In particular, benefit from the large tunability of the magnon, we demonstrate a tunable microwave amplifier with gain as high as 30 dB. The single crystal YIG also has excellent optical properties, and thus provide a unique platform bridging MHz, GHz and THz information carriers. Finally, we present the latest progress towards coherent magnon to optical photon conversion.

  9. Mass, energy and material balances of SRF production process. Part 1: SRF produced from commercial and industrial waste.


    Nasrullah, Muhammad; Vainikka, Pasi; Hannula, Janne; Hurme, Markku; Kärki, Janne


    This paper presents the mass, energy and material balances of a solid recovered fuel (SRF) production process. The SRF is produced from commercial and industrial waste (C&IW) through mechanical treatment (MT). In this work various streams of material produced in SRF production process are analyzed for their proximate and ultimate analysis. Based on this analysis and composition of process streams their mass, energy and material balances are established for SRF production process. Here mass balance describes the overall mass flow of input waste material in the various output streams, whereas material balance describes the mass flow of components of input waste stream (such as paper and cardboard, wood, plastic (soft), plastic (hard), textile and rubber) in the various output streams of SRF production process. A commercial scale experimental campaign was conducted on an MT waste sorting plant to produce SRF from C&IW. All the process streams (input and output) produced in this MT plant were sampled and treated according to the CEN standard methods for SRF: EN 15442 and EN 15443. The results from the mass balance of SRF production process showed that of the total input C&IW material to MT waste sorting plant, 62% was recovered in the form of SRF, 4% as ferrous metal, 1% as non-ferrous metal and 21% was sorted out as reject material, 11.6% as fine fraction, and 0.4% as heavy fraction. The energy flow balance in various process streams of this SRF production process showed that of the total input energy content of C&IW to MT plant, 75% energy was recovered in the form of SRF, 20% belonged to the reject material stream and rest 5% belonged with the streams of fine fraction and heavy fraction. In the material balances, mass fractions of plastic (soft), plastic (hard), paper and cardboard and wood recovered in the SRF stream were 88%, 70%, 72% and 60% respectively of their input masses to MT plant. A high mass fraction of plastic (PVC), rubber material and non

  10. Superconducting drift-tube cavity development for the RIA driver.

    SciTech Connect

    Shepard, K. W.; Kelly, M. P.; Fuerst, J. D.


    This paper reports the design and development of two intermediate-velocity superconducting cavities and design of an associated cryomodule for the RIA driver linac. The two cavity types are a 115 MHz, {beta}{sub GEOM} = 0.15 quarter-wave resonant (QWR) cavity, and a 173 MHz, {beta}{sub GEOM} = 0.26 half-wave loaded cavity. Both cavities are well-corrected for dipole and quadrupole asymmetries in the accelerating field. The cryomodule is being designed to incorporate a separate vacuum system for cavity vacuum to provide a particulate-free environment for the superconducting cavities.

  11. Superconducting Storage Cavity for RHIC

    SciTech Connect



    This document provides a top-level description of a superconducting cavity designed to store hadron beams in the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory. It refers to more detailed documents covering the various issues in designing, constructing and operating this cavity. The superconducting storage cavity is designed to operate at a harmonic of the bunch frequency of RHIC at a relatively low frequency of 56 MHz. The current storage cavities of RHIC operate at 197 MHz and are normal-conducting. The use of a superconducting cavity allows for a high gap voltage, over 2 MV. The combination of a high voltage and low frequency provides various advantages stemming from the resulting large longitudinal acceptance bucket.

  12. Hybrid Physical Chemical Vapor Deposition of Superconducting Magnesium Diboride Coatings for Large Scale Radio Frequency Cavities

    NASA Astrophysics Data System (ADS)

    Lee, Namhoon; Withanage, Wenura; Tan, Teng; Wolak, Matthaeus; Xi, Xiaoxing


    Magnesium diboride (MgB2) is considered to be a great candidate for next generation superconducting radio frequency (SRF) cavities due to its higher critical temperature Tc (40 K) and increased thermodynamic critical field Hc compared to other conventional superconductors. These properties significantly reduce the BCS surface resistance (RsBCS)and residual resistance (Rres) according to theoretical studies and suggest the possibility of an enhanced accelerating field (Eacc) . We have investigated the possibility of coating the inner surface of a 3 GHz SRF cavity with MgB2 by using a hybrid physical-vapor deposition (HPCVD) system which was modified for this purpose. To simulate a real 3 GHz SRF cavity, a stainless steel mock cavity has been employed for the study. The film quality was characterized on small substrates that were placed at selected locations within the cavity. MgB2 films on stainless steel foils, niobium pieces and SiC substrates showed transition temperatures of above 36 K. Dielectric resonance measurements resulted in promising Q values as obtained for the MgB2 films grown on the various substrates. By employing the HPCVD technique, a uniform film was achieved across the cavity interior, demonstrating the feasibility of HPCVD for MgB2 coatings for SRF cavities.

  13. A Program for Optimizing SRF Linac Costs

    SciTech Connect

    Powers, Thomas J.


    Every well-designed machine goes through the process of cost optimization several times during its design, production and operation. The initial optimizations are done during the early proposal stage of the project when none of the systems have been engineered. When a superconducting radio frequency (SRF) linac is implemented as part of the design, it is often a difficult decision as to the frequency and gradient that will be used. Frequently, such choices are made based on existing designs, which invariably necessitate moderate to substantial modifications so that they can be used in the new accelerator. Thus the fallacy of using existing designs is that they will frequently provide a higher cost machine or a machine with sub-optimal beam physics parameters. This paper describes preliminary results of a new software tool that allows one to vary parameters and understand the effects on the optimized costs of construction plus 10 year operations of an SRF linac, the associated cryogenic facility, and controls, where operations includes the cost of the electrical utilities but not the labor or other costs. It derives from collaborative work done with staff from Accelerator Science and Technology Centre, Daresbury, UK [1] several years ago while they were in the process of developing a conceptual design for the New Light Source project. The initial goal was to convert a spread sheet format to a graphical interface to allow the ability to sweep different parameter sets. The tools also allow one to compare the cost of the different facets of the machine design and operations so as to better understand the tradeoffs.

  14. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2013 CFR


    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  15. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2014 CFR


    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  16. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2012 CFR


    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  17. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2010 CFR


    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  18. HOM Survey of the First CEBAF Upgrade Style Cavity Pair

    SciTech Connect

    Marhauser, Frank; Davis, G; Drury, Michael; Grenoble, Christiana; Hogan, John; Manus, Robert; Preble, Joseph; Reece, Charles; Rimmer, Robert; Tian, Kai; Wang, Haipeng


    The planned upgrade of the Continuous Electron Beam Accelerator Facility (CEBAF) at the Thomas Jefferson National Accelerator Laboratory (JLab) requires ten new superconducting rf (SRF) cavity cryomodules to double the beam energy to the envisaged 12 GeV. Adequate cavity Higher Order Mode (HOM) suppression is essential to avoid multipass, multibunch beam break-up (BBU) instabilities of the recirculating beam. We report on detailed HOM surveys performed for the first two upgrade style cavities tested in a dedicated cavity pair cryomodule at 2K. The safety margin to the BBU threshold budget at 12 GeV has been assessed.

  19. Control System Design for Automatic Cavity Tuning Machines

    SciTech Connect

    Carcagno, R.; Khabiboulline, T.; Kotelnikov, S.; Makulski, A.; Nehring, R.; Nogiec, J.; Ross, M.; Schappert, W.; Goessel, A.; Iversen, J.; Klinke, D.; /DESY


    A series of four automatic tuning machines for 9-cell TESLA-type cavities are being developed and fabricated in a collaborative effort among DESY, FNAL, and KEK. These machines are intended to support high-throughput cavity fabrication for construction of large SRF-based accelerator projects. Two of these machines will be delivered to cavity vendors for the tuning of XFEL cavities. The control system for these machines must support a high level of automation adequate for industrial use by non-experts operators. This paper describes the control system hardware and software design for these machines.

  20. 500 MHz neutron detector

    SciTech Connect

    Yen, Yi-Fen; Bowman, J.D.; Matsuda, Y.


    A {sup 10}B-loaded scintillation detector was built for neutron transmission measurements at the Los Alamos Neutron Scattering Center. The efficiency of the detector is nearly 100% for neutron energies from 0 to 1 keV. The neutron moderation time in the scintillator is about 250 ns and is energy independent. The detector and data processing system are designed to handle an instantaneous rate as high as 500 MHz. The active area of the detector is 40 cm in diameter.

  1. Tunneling study of cavity grade Nb : possible magnetic scattering at the surface.

    SciTech Connect

    Prolier, T.; Zasadzinski, J. F.; Cooley, L.; Antoine, C.; Moore, J.; Pellin, M.; Norem, J.; Gray, K. E.; Materials Science Division; Illinois Inst. Tech.; FNAL; Centre d'etude de Saclay


    Tunneling spectroscopy was performed on Nb pieces prepared by the same processes used to etch and clean superconducting radio frequency (SRF) cavities. Air exposed, electropolished Nb exhibited a surface superconducting gap {Delta} = 1.55 meV, which is characteristic of a clean, bulk Nb. However, the tunneling density of states (DOS) was significantly broadened. The Nb pieces, which were treated with the same mild baking used to improve the Q slope in SRF cavities, reveal a sharper DOS. Good fits to the DOS were obtained by using the Shiba theory, suggesting that magnetic scattering of quasiparticles is the origin of the gapless surface superconductivity and a heretofore unrecognized contributor to the Q-slope problem of Nb SRF cavities.

  2. Potential SRF generation from a closed landfill in northern Italy.


    Passamani, Giorgia; Ragazzi, Marco; Torretta, Vincenzo


    The aim of this work is to assess the possibility of producing solid recovered fuel (SRF) and "combustible SRF" from a landfill located in the north of Italy, where the waste is placed in cylindrical wrapped bales. Since the use of landfills for the disposal of municipal solid waste has many technical limitations and is subject to strict regulations and given that landfill post-closure care is very expensive, an interesting solution is to recover the bales that are stored in the landfill. The contents of the bales can then be used for energy recovery after specific treatments. Currently the landfill is closed and the local municipal council together with an environmental agency are considering constructing a mechanical biological treatment (MBT) plant for SRF production. The municipal solid waste that is stored in the landfill, the bio-dried material produced by the hypothetically treated waste in a plant for bio-drying, and the SRF obtained after the post-extraction of inert materials, metals and glass from the bio-dried material were characterized according to the quality and classification criteria of regulations in Italy. The analysis highlighted the need to treat the excavated waste in a bio-drying plant and later to remove the inert waste, metals and glass. Thus in compliance with Italian law, the material has a high enough LHV to be considered as "combustible SRF", (i.e. an SRF with enhanced characteristics). PMID:26209342

  3. Mass, energy and material balances of SRF production process. Part 2: SRF produced from construction and demolition waste.


    Nasrullah, Muhammad; Vainikka, Pasi; Hannula, Janne; Hurme, Markku; Kärki, Janne


    In this work, the fraction of construction and demolition waste (C&D waste) complicated and economically not feasible to sort out for recycling purposes is used to produce solid recovered fuel (SRF) through mechanical treatment (MT). The paper presents the mass, energy and material balances of this SRF production process. All the process streams (input and output) produced in MT waste sorting plant to produce SRF from C&D waste are sampled and treated according to CEN standard methods for SRF. Proximate and ultimate analysis of these streams is performed and their composition is determined. Based on this analysis and composition of process streams their mass, energy and material balances are established for SRF production process. By mass balance means the overall mass flow of input waste material stream in the various output streams and material balances mean the mass flow of components of input waste material stream (such as paper and cardboard, wood, plastic (soft), plastic (hard), textile and rubber) in the various output streams of SRF production process. The results from mass balance of SRF production process showed that of the total input C&D waste material to MT waste sorting plant, 44% was recovered in the form of SRF, 5% as ferrous metal, 1% as non-ferrous metal, and 28% was sorted out as fine fraction, 18% as reject material and 4% as heavy fraction. The energy balance of this SRF production process showed that of the total input energy content of C&D waste material to MT waste sorting plant, 74% was recovered in the form of SRF, 16% belonged to the reject material and rest 10% belonged to the streams of fine fraction and heavy fraction. From the material balances of this process, mass fractions of plastic (soft), paper and cardboard, wood and plastic (hard) recovered in the SRF stream were 84%, 82%, 72% and 68% respectively of their input masses to MT plant. A high mass fraction of plastic (PVC) and rubber material was found in the reject material

  4. Review of ingot niobium as a material for superconducting radiofrequency accelerating cavities

    SciTech Connect

    Kneisel, P.; Ciovati, G.; Dhakal, P.; Saito, K.; Singer, W.; Singer, X.; Myneni, G. R.


    As a result of collaboration between Jefferson Lab and niobium manufacturer Companhia Brasileira de Metalurgia e Mineração (CBMM), ingot niobium was explored as a possible material for superconducting radiofrequency (SRF) cavity fabrication. The first single cell cavity from large-grain high purity niobium was fabricated and successfully tested at Jefferson Lab in 2004. This work triggered research activities in other SRF laboratories around the world. The large-grain (LG) niobium became not only an interesting alternative material for cavity builders, but also material scientists and surface scientists were eager to participate in the development of this technology. Many single cell cavities made from material of different suppliers have been tested successfully and several multi-cell cavities have shown performances comparable to the best cavities made from standard fine-grain niobium. Several 9-cell cavities fabricated by Research Instruments and tested at DESY exceeded the best performing fine grain cavities with a record accelerating gradient of Eacc=45.6 MV/m. The quality factor of those cavities was also higher than that of fine-grain (FG) cavities processed with the same methods. Such performance levels push the state-of-the art of SRF technology and are of great interest for future accelerators. This contribution reviews the development of ingot niobium technology and highlights some of the differences compared to standard FG material and opportunities for further developments.

  5. Review of ingot niobium as a material for superconducting radiofrequency accelerating cavities


    Kneisel, P.; Ciovati, G.; Dhakal, P.; Saito, K.; Singer, W.; Singer, X.; Myneni, G. R.


    As a result of collaboration between Jefferson Lab and niobium manufacturer Companhia Brasileira de Metalurgia e Mineração (CBMM), ingot niobium was explored as a possible material for superconducting radiofrequency (SRF) cavity fabrication. The first single cell cavity from large-grain high purity niobium was fabricated and successfully tested at Jefferson Lab in 2004. This work triggered research activities in other SRF laboratories around the world. The large-grain (LG) niobium became not only an interesting alternative material for cavity builders, but also material scientists and surface scientists were eager to participate in the development of this technology. Many single cell cavities mademore » from material of different suppliers have been tested successfully and several multi-cell cavities have shown performances comparable to the best cavities made from standard fine-grain niobium. Several 9-cell cavities fabricated by Research Instruments and tested at DESY exceeded the best performing fine grain cavities with a record accelerating gradient of Eacc=45.6 MV/m. The quality factor of those cavities was also higher than that of fine-grain (FG) cavities processed with the same methods. Such performance levels push the state-of-the art of SRF technology and are of great interest for future accelerators. This contribution reviews the development of ingot niobium technology and highlights some of the differences compared to standard FG material and opportunities for further developments.« less

  6. Review of ingot niobium as a material for superconducting radiofrequency accelerating cavities

    NASA Astrophysics Data System (ADS)

    Kneisel, P.; Ciovati, G.; Dhakal, P.; Saito, K.; Singer, W.; Singer, X.; Myneni, G. R.


    As a result of collaboration between Jefferson Lab and niobium manufacturer Companhia Brasileira de Metalurgia e Mineração (CBMM), ingot niobium was explored as a possible material for superconducting radiofrequency (SRF) cavity fabrication. The first single cell cavity from large-grain high purity niobium was fabricated and successfully tested at Jefferson Lab in 2004. This work triggered research activities in other SRF laboratories around the world. Large-grain (LG) niobium became not only an interesting alternative material for cavity builders, but also material scientists and surface scientists were eager to participate in the development of this technology. Many single cell cavities made from material of different suppliers have been tested successfully and several multi-cell cavities have shown performances comparable to the best cavities made from standard fine-grain niobium. Several 9-cell cavities fabricated by Research Instruments and tested at DESY exceeded the best performing fine grain cavities with a record accelerating gradient of Eacc=45.6 MV/m. The quality factor of those cavities was also higher than that of fine-grain (FG) cavities processed with the same methods. Such performance levels push the state-of-the art of SRF technology and are of great interest for future accelerators. This contribution reviews the development of ingot niobium technology and highlights some of the differences compared to standard FG material and opportunities for further developments.

  7. First Demonstration of Electron Beam Generation and Characterization with an All Superconducting Radio-frequency (SRF) Photoinjector

    SciTech Connect

    Kamps, T; Barday, R; Jankowiak, A; Knobloch, J; Kugeler, O; Matveenko, A N; Neumann, A; Quast, T; Rudolph, J; Schubert, S G; Volker, J; Kneisel, P; Nietubyc, R; Sekutowicz, J K; Smedley, J; Volkov, V; Weinberg, G; Will, I


    In preparation for a high brightness, high average current electron source for the energy-recovery linac BERLinPro an all superconducting radio-frequency photoinjector is now in operation at Helmholtz-Zentrum Berlin. The aim of this experiment is beam demonstration with a high brightness electron source able to generate sub-ps pulse length electron bunches from a superconducting (SC) cathode film made of Pb coated on the backwall of a Nb SRF cavity. This paper describes the setup of the experiment and first results from beam measurements.


    SciTech Connect

    Kevin Jordan; Stephen V. Benson; David Douglas; Pavel Evtushenko; Carlos Hernandez-Garcia; George R. Neil


    Notional designs for energy-recovering linac (“ERL”) -driven high average power free electron lasers (“FEL”s) often invoke amplifier-based architectures. To date, however, amplifier FELs have been limited in average power output to values several orders of magnitude lower than those demonstrated in optical-resonator based systems; this is due at least in part to the limited electron beam powers available from their driver accelerators. In order to directly contrast the performance available from amplifiers to that provided by high-power cavity-based resonators, we have developed a scheme to test an amplifier FEL in the JLab SRF ERL driver. We describe an accelerator system design that can seamlessly and non-invasively integrate a 10 m wiggler into the existing system and which provides, at least in principle, performance that would support high-efficiency lasing in an amplifier configuration. Details of the design and an accelerator performance analysis will be presented


    SciTech Connect

    Chen Xu,Charles Reece,Michael Kelley


    The high-field performance of SRF cavities will eventually be limited by the realization of fundamental material limits, whether it is Hc1 or Hsh, or some derivative thereof, at which the superconductivity is lost. Before reaching this fundamental field limit at the macro level, it must be encountered at localized, perhaps microscopic, sites of field enhancement due to local topography. If such sites are small enough, they may produce thermally stabilized normal-conducting regions which contribute non-linear losses when viewed from the macro resonant field perspective, and thus produce degradation in Q0. We have undertaken a calculation of local surface magnetic field enhancement from specific fine topographic structure by conformal mapping method and numerically. A solution of the resulting normal conducting volume has been derived and the corresponding RF Ohmic loss simulated.

  10. RF Surface Impedance Characterization of Potential New Materials for SRF-based Accelerators

    SciTech Connect

    Xiao, Binping; Eremeev, Grigory V.; Reece, Charles E.; Phillips, H. Lawrence; Kelley, Michael J.


    In the development of new superconducting materials for possible use in SRF-based accelerators, it is useful to work with small candidate samples rather than complete resonant cavities. The recently commissioned Jefferson Lab RF Surface Impedance Characterization (SIC) system can presently characterize the central region of 50 mm diameter disk samples of various materials from 2 to 40 K exposed to RF magnetic fields up to 14 mT at 7.4 GHz. We report the recent measurement results of bulk Nb, thin film Nb on Cu and sapphire substrates, Nb{sub 3}Sn sample, and thin film MgB{sub 2} on sapphire substrate provided by colleagues at JLab and Temple University.

  11. QE Tests with Nb-Pb SRF Photoinjector and Arc Deposited Cathodes

    SciTech Connect

    J.K. Sekutowicz, P. Kneisel, R. Nietubyc, T. Rao, J. Smedley


    In this contribution, we report Quantum Efficiency (QE) test results with a hybrid lead/niobium superconducting RF (SRF) photoinjector at 2K and new Pb arc deposited cathodes at 300K. The ultimate goal of our effort is to build a Nb injector with the superconducting cathode made of lead, which, as reported in the past, demonstrated superior QE compared to other metallic superconducting elements. At first, we present the test results obtained with a 1.6-cell high purity Nb cavity with the emitting lead spot in the center of the back plate. The QE test results at room temperature and the SEM surface analysis of eight Pb cathodes, deposited recently under various conditions, are discussed in the second part of this contribution.

  12. Application of superconducting magnesium diboride (MGB2) in superconducting radio frequency cavities

    NASA Astrophysics Data System (ADS)

    Tan, Teng

    The superconductivity in magnesium diboride (MgB2) was discovered in 2001. As a BCS superconductor, MgB2 has a record-high Tc of 39 K, high Jc of > 107 A/cm2 and no weak link behavior across the grain boundary. All these superior properties endorsed that MgB2 would have great potential in both power applications and electronic devices. In the past 15 years, MgB2 based power cables, microwave devices, and commercial MRI machines emerged and the next frontier are superconducting radio frequency (SRF) cavities. SRF cavities are one of the leading accelerator technologies. In SRF cavities, applied microwave power generates electrical fields that accelerate particle beams. Compared with other accelerator techniques, SRF cavity accelerators feature low loss, high acceleration gradients and the ability to accelerate continuous particle beams. However, current SRF cavities are made from high-purity bulk niobium and work at 2 K in superfluid helium. The construction and operational cost of SRF cavity accelerators are very expensive. The demand for SRF cavity accelerators has been growing rapidly in the past decade. Therefore, a lot of effort has been devoted to the enhancement of the performance and the reduction of cost of SRF cavities. In 2010, an acceleration gradient of over 50 MV/m has been reported for a Nb-based SRF cavity. The magnetic field at the inner surface of such a cavity is ~ 1700 Oe, which is close to the thermodynamic critical field of Nb. Therefore, new materials and technologies are required to raise the acceleration gradient of future SRF cavity accelerators. Among all the proposed approaches, using MgB2 thin films to coat the inner surface of SRF cavities is one of the promising tactics with the potential to raise both the acceleration gradient and the operation temperature of SRF cavity accelerators. In this work, I present my study on MgB2 thin films for their application in SRF cavities. C-epitaxial MgB2 thin films grown on SiC(0001) substrates

  13. Status of the ILC Crab Cavity Development

    SciTech Connect

    Burt, G.; Dexter, A.; Beard, C.; Goudket, P.; McIntosh, P.; Bellantoni, L.; Grimm, T.; Li, Z.; Xiao, L.; /SLAC


    The International Linear Collider (ILC) will require two dipole cavities to 'crab' the electron and positron bunches prior to their collision. It is proposed to use two 9 cell SCRF dipole cavities operating at a frequency of 3.9 GHz, with a transverse gradient of 3.8MV/m in order to provide the required transverse kick. Extensive numerical modelling of this cavity and its couplers has been performed. Aluminium prototypes have been manufactured and tested to measure the RF properties of the cavity and couplers. In addition single cell niobium prototypes have been manufactured and tested in a vertical cryostat. The International Collider (ILC) [1] collides bunches of electrons and positrons at a crossing angle of 14 mrad. The angle between these bunches causes a loss in luminosity due to geometric effects [2]. The luminosity lost from this geometric effect can be recovered by rotating the bunches into alignment prior to collision. One possible method of rotating the bunches is to use a crab cavity [3]. A crab cavity is a transverse defecting cavity, where the phase of the cavity is such that the head and tail of the bunch receive equal and opposite kicks. As the bunches are only 500 nm wide in the horizontal plane, the cavity phase must be strictly controlled to avoid the bunch centre being deflected too much. In order to keep the phase stability within the required limits it is required that the cavity be superconducting to avoid thermal effects in both the cavity and its RF source. At the location of the crab cavity in the ILC there is only 23 cm separation between the centre of the cavity and the extraction line, hence the cavity must be small enough to fit in this space. This, along with the difficulty of making high frequency SRF components, set the frequency of the cavity to 3.9 GHz.

  14. Design and Development of Superconducting Parallel-Bar Deflecting/Crabbing Cavities

    SciTech Connect

    Payagalage Subashini Uddi De Silva, Jean Delayen


    The superconducting parallel-bar cavity is a deflecting/crabbing cavity with attractive properties that is being considered for a number of applications. We present the designs of a 499 MHz deflecting cavity developed for the Jefferson Lab 12 GeV Upgrade and a 400 MHz crabbing cavity for the LHC High Luminosity Upgrade. Prototypes of these two cavities are now under development and fabrication.

  15. Mirror smooth superconducting RF cavities by mechanical polishing with minimal acid use

    SciTech Connect

    Cooper, C.A.; Cooley, L.D.; /Fermilab


    A new mechanical technique for polishing the inside surface of niobium superconducting RF (SRF) cavities has been developed. Mirror-like finishes, the smoothest observed in cavities so far, were produced after fine polishing, with < 15 nm RMS roughness over 1 mm{sup 2} scan area. This is an order of magnitude less than the typical roughness produced by electropolishing. The processing equipment has advantages of modest installed and operating costs, simple associated technology, and no large quantities of acutely toxic chemicals or special handling procedures. Cavity quality factors above 10{sup 10} were maintained well above the 35 MV m{sup -1} benchmark for electropolished cavities, and this was achieved with an intermediate finish not as smooth as the final polish. Repair of a weld defect, which is intrinsic to this process, was also demonstrated. These transformational aspects could enable a new SRF cavity processing paradigm for future large scale particle accelerators such as the International Linear Collider.

  16. Cryogenic Testing of High-Velocity Spoke Cavities

    SciTech Connect

    Hopper, Christopher S.; Delayen, Jean R.; Park, HyeKyoung


    Spoke-loaded cavities are being investigated for the high-velocity regime. The relative compactness at low-frequency makes them attractive for applications requiring, or benefiting from, 4 K operation. Additionally, the large velocity acceptance makes them good candidates for the acceleration of high-velocity protons and ions. Here we present the results of cryogenic testing of a 325 MHz, β0= 0.82 single-spoke cavity and a 500 MHz, β0 = 1 double-spoke cavity.

  17. High intensity SRF proton linac workshop (vugraphs)

    SciTech Connect

    Rusnak, B.A.


    The meeting is divided into four sections. The first section is the general introduction and included opening remarks and an overview of APT (accelerator product of tritium). The second section contains vugraphs from the cavity-structures working group. The third section is comprised of vugraphs from the couplers and rf working group. And the fourth section contains vugraphs of the system integration group.

  18. Laser performance of diode-pumped Nd, Y-codoped CaF 2-SrF 2 mixed crystal

    NASA Astrophysics Data System (ADS)

    Liu, J.; Fan, M. W.; Su, L. B.; Jiang, D. P.; Ma, F. K.; Zhang, Q.; Xu, J.


    A disordered Nd, Y-codoped CaF2-SrF2 mixed crystal was obtained by the temperature gradient technique (TGT). The absorption and fluorescence spectra of the crystal were measured at room temperature. Diode-pumped continuous-wave (CW) and Q-switched laser operations were demonstrated at 1056 nm with a 0.65 at.% Nd, 10 at.% Y-codoped crystal, for the first time to our knowledge. The CW output power of 724 mW was obtained in a compact linear cavity. Also the Q-switched pulse characteristics of Nd, Y:CaF2-SrF2 laser crystal were reported based on Cr4+:YAG saturable absorbers in a folded cavity. The shortest pulse width of 110 ns and the highest peak power of 383 W were obtained when the initial transmission of the Cr4+:YAG crystals was 90%. The dependence of the operational parameters on the pump power was also investigated experimentally.

  19. Mechanical design and engineering of the 3.9 GHZ, 3rd harmonic SRF system at Fermilab

    SciTech Connect

    Don Mitchell et al.


    The mechanical development of the 3.9 GHz, 3rd Harmonic SRF System is summarized to include: the development of a full scale copper prototype cavity structure; the design of the niobium 3 cell and niobium 9 cell structures; the design of the helium vessel and cryostat; the HOM coupler design; and a preliminary look at the main coupler design. The manufacturing processes for forming, rolling, and e-beam welding the HOM coupler, cavity cells, and end tubes are also described. Due to the exotic materials and manufacturing processes used in this type of device, a cost estimate for the material and fabrication is provided. The 3rd harmonic design is organized via a web-based data management approach.

  20. Reactive RF Tuning For Compensation of a Detuned Accelerating Cavity

    SciTech Connect

    Yoon Kang; Michael Tiefenback; Pavel Chevtsov


    The resonant frequency of an accelerating RF cavity is detuned from the desired frequency by certain physical disturbances, such as thermal and other mechanical wall distortions. Cavity wall distortions due to microphonics (acoustic vibrations) and the Lorentz force (radiation pressure) can be serious problems in pulsed RF operation of superconducting (SRF) cavities with thin cavity walls and a high quality factor. The resulting detuning results a change of input reactance. The offset reactance at the cavity input may be tuned out properly with a reactive element in the input transmission line, so that the generator RF power can be delivered efficiently to the cavity. A fast response electrical tuner may be built for compensating high frequency detuning without any mechanical coupling.

  1. SRF regulates craniofacial development through selective recruitment of MRTF cofactors by PDGF signaling

    PubMed Central

    Vasudevan, Harish N.; Soriano, Philippe


    Summary Receptor tyrosine kinase signaling is critical for mammalian craniofacial development, but the key downstream transcriptional effectors remain unknown. We demonstrate that SRF is induced by both PDGF and FGF signaling in mouse embryonic palatal mesenchyme cells, and Srf neural crest conditional mutants exhibit facial clefting accompanied by proliferation and migration defects. Srf and Pdgfra mutants interact genetically in craniofacial development, but Srf and Fgfr1 mutants do not. This signal specificity is recapitulated at the level of cofactor activation: while both PDGF and FGF target gene promoters show enriched genome-wide overlap with SRF ChIP-seq peaks, PDGF selectively activates a network of MRTF-dependent cytoskeletal genes. Collectively, our results identify a novel role for SRF in proliferation and migration during craniofacial development and delineate a mechanism of receptor tyrosine kinase specificity mediated through differential cofactor usage, leading to a unique PDGF-responsive SRF-driven transcriptional program in the midface. PMID:25453829

  2. First-principles calculations of niobium hydride formation in superconducting radio-frequency cavities

    SciTech Connect

    Ford, Denise C.; Cooley, Lance D.; Seidman, David N.


    Niobium hydride is suspected to be a major contributor to degradation of the quality factor of niobium superconducting radio-frequency (SRF) cavities. In this study, we connect the fundamental properties of hydrogen in niobium to SRF cavity performance and processing. We modeled several of the niobium hydride phases relevant to SRF cavities and present their thermodynamic, electronic, and geometric properties determined from calculations based on density-functional theory. We find that the absorption of hydrogen from the gas phase into niobium is exothermic and hydrogen becomes somewhat anionic. The absorption of hydrogen by niobium lattice vacancies is strongly preferred over absorption into interstitial sites. A single vacancy can accommodate six hydrogen atoms in the symmetrically equivalent lowest-energy sites and additional hydrogen in the nearby interstitial sites affected by the strain field: this indicates that a vacancy can serve as a nucleation center for hydride phase formation. Small hydride precipitates may then occur near lattice vacancies upon cooling. Vacancy clusters and extended defects should also be enriched in hydrogen, potentially resulting in extended hydride phase regions upon cooling. We also assess the phase changes in the niobium-hydrogen system based on charge transfer between niobium and hydrogen, the strain field associated with interstitial hydrogen, and the geometry of the hydride phases. The results of this study stress the importance of not only the hydrogen content in niobium, but also the recovery state of niobium for the performance of SRF cavities.

  3. Superconducting multicell cavity development program at Los Alamos

    SciTech Connect

    Rusnak, B.; Spalek, G.: Gray, E.; DiMarco, J.N.; DeHaven, R.; Novak, J.; Walstrom, P.; Zumbro, J.; Thiessen, H.A. ); Langenbrunner, J. )


    The superconducting rf (SCRF) cavity Development Program at Los Alamos has designed, fabricated, and tested single-cell niobium cavities at 3-GHz and 805-MHz. This work is being done in preparation for procuring and testing a multicell niobium cavity. The multicell cavity is designed to accelerate protons at [beta] = 0.9; initial tests will be without beam. Progammmatic changes have required us to modify our plans to install a 6800-liter helium cryostat and a 12.8-g/s helium pump. We will use an installed cryostat to test the multicell cavity. Also, the cavity will be modified from a seven-cell to a four-cell structure to match the dimensions of the installed cryostat. Previous reports concentrated on 3-GHz results. In this paper, some of the latest results of the 805-MHz cavity tests are presented. Modifications to allow high pulsed power (HPP) testing on 805-MHz single- and four-cell cavities are proceeding. Glow discharge cleaning of an 805-MHz niobium cavity resulted in a decrease in cavity performance. The cavity was restored to previous performance levels with buffered chemical polishing (bcp). Initial results with high-pressure water cleaning show the process is useful in restoring cavity performance.

  4. Superconducting multicell cavity development program at Los Alamos

    SciTech Connect

    Rusnak, B.; Spalek, G.: Gray, E.; DiMarco, J.N.; DeHaven, R.; Novak, J.; Walstrom, P.; Zumbro, J.; Thiessen, H.A.; Langenbrunner, J.


    The superconducting rf (SCRF) cavity Development Program at Los Alamos has designed, fabricated, and tested single-cell niobium cavities at 3-GHz and 805-MHz. This work is being done in preparation for procuring and testing a multicell niobium cavity. The multicell cavity is designed to accelerate protons at {beta} = 0.9; initial tests will be without beam. Progammmatic changes have required us to modify our plans to install a 6800-liter helium cryostat and a 12.8-g/s helium pump. We will use an installed cryostat to test the multicell cavity. Also, the cavity will be modified from a seven-cell to a four-cell structure to match the dimensions of the installed cryostat. Previous reports concentrated on 3-GHz results. In this paper, some of the latest results of the 805-MHz cavity tests are presented. Modifications to allow high pulsed power (HPP) testing on 805-MHz single- and four-cell cavities are proceeding. Glow discharge cleaning of an 805-MHz niobium cavity resulted in a decrease in cavity performance. The cavity was restored to previous performance levels with buffered chemical polishing (bcp). Initial results with high-pressure water cleaning show the process is useful in restoring cavity performance.

  5. First Test Results of the bERLinPro 2-cell Booster Cavities

    SciTech Connect

    Burrill, Andrew; Anders, W.; Frahm, A.; Knobloch, Jens; Neumann, Axel; Ciovati, Gianluigi; Clemens, William; Kneisel, Peter; Turlington, Larry


    The bERLinPro Energy Recovery Linac (ERL) is currently being built at Helmholtz-Zentrum Berlin in order to study the physics of operating a high-current, a 100 mA, 50 MeV ERL utilizing all SRF cavity technology. This machine will utilize three unique SRF cryomodules for the photoinjector, booster and linac cryomodules respectively. The focus of this paper will be on the cavities contained within the booster cryomodule. Here there will be three 2-cell SRF cavities, based on the original design by Cornell University, but optimized to meet the needs of the project. All of the cavity fabrication, processing and testing was carried out at Jefferson Laboratory, where 4 cavities were produced, and the 3 cavities with the best RF performance were fitted with helium vessels for installation in the cryomodule. This paper will report on the test results of the cavities as measured in the vertical testing dewar at JLab after fabrication and again after outfitting with the helium vessels.

  6. A Study of Thermocurrent Induced Magnetic Fields in ILC Cavities

    SciTech Connect

    Crawford, Anthony C.; Cooley, Victoria


    The case of axisymmetric ILC type cavities with titanium helium vessels is investigated. A first order estimate for magnetic field within the SRF current layer is presented. The induced magnetic field is found to be not more than 1.4x10-8 Tesla = 0.14 milligauss for the case of axial symmetry. Magnetic fields due to symmetry breaking effects are discussed.

  7. Beam Pipe HOM Absorber for 750 MHz RF Cavity Systems

    SciTech Connect

    Johnson, Rolland; Neubauer, Michael


    This joint project of Muons, Inc., Cornell University and SLAC was supported by a Phase I and Phase II grant monitored by the SBIR Office of Science of the DOE. Beam line HOM absorbers are a critical part of future linear colliders. The use of lossy materials at cryogenic temperatures has been incorporated in several systems. The design in beam pipes requires cylinders of lossy material mechanically confined in such a way as to absorb the microwave energy from the higher-order modes and remove the heat generated in the lossy material. Furthermore, the potential for charge build-up on the surface of the lossy material requires the conductivity of the material to remain consistent from room temperature to cryogenic temperatures. In this program a mechanical design was developed that solved several design constraints: a) fitting into the existing Cornell load vacuum component, b) allowing the use of different material compositions, c) a thermal design that relied upon the compression of the lossy ceramic material without adding stress. Coating experiments were performed that indicated the design constraints needed to fully implement this approach for solving the charge build-up problem inherent in using lossy ceramics. In addition, the ACE3P program, used to calculate the performance of lossy cylinders in beam pipes in general, was supported by this project. Code development and documentation to allow for the more wide spread use of the program was a direct result of this project was well.

  8. Flux pinning characteristics in cylindrical ingot niobium used in superconducting radio frequency cavity fabrication

    SciTech Connect

    Dhavale Ashavai, Pashupati Dhakal, Anatolii A Polyanskii, Gianluigi Ciovati


    We present the results of from DC magnetization and penetration depth measurements of cylindrical bulk large-grain (LG) and fine-grain (FG) niobium samples used for the fabrication of superconducting radio frequency (SRF) cavities. The surface treatment consisted of electropolishing and low temperature baking as they are typically applied to SRF cavities. The magnetization data were fitted using a modified critical state model. The critical current density Jc and pinning force Fp are calculated from the magnetization data and their temperature dependence and field dependence are presented. The LG samples have lower critical current density and pinning force density compared to FG samples which implies a lower flux trapping efficiency. This effect may explain the lower values of residual resistance often observed in LG cavities than FG cavities.

  9. Physical and mechanical metallurgy of high purity Nb for accelerator cavities

    SciTech Connect

    Bieler, T. R.; Wright, N. T.; Pourboghrat, F.; Compton, C.; Hartwig, K. T.; Baars, D.; Zamiri, A.; Chandrasekaran, S.; Darbandi, P.; Jiang, H.; Skoug, E.; Balachandran, S.; Ice, Gene E; Liu, W.


    In the past decade, high Q values have been achieved in high purity Nb superconducting radio frequency (SRF) cavities. Fundamental understanding of the physical metallurgy of Nb that enables these achievements is beginning to reveal what challenges remain to establish reproducible and cost-effective production of high performance SRF cavities. Recent studies of dislocation substructure development and effects of recrystallization arising from welding and heat treatments and their correlations with cavity performance are considered. With better fundamental understanding of the effects of dislocation substructure evolution and recrystallization on electron and phonon conduction, as well as the interior and surface states, it will be possible to design optimal processing paths for cost-effective performance using approaches such as hydroforming, which minimizes or eliminates welds in a cavity.

  10. Development of 325 MHz single spoke resonators at Fermilab

    SciTech Connect

    Apollinari, G.; Gonin, I.V.; Khabiboulline, T.N.; Lanfranco, G.; Mukherjee, A.; Ozelis, J.; Ristori, L.; Sergatskov, D.; Wagner, R.; Webber, R.; /Fermilab


    The High Intensity Neutrino Source (HINS) project represents the current effort at Fermilab to produce an 8-GeV proton linac based on 400 independently phased superconducting cavities. Eighteen ?=0.21 single spoke resonators, operating at 325 MHz, comprise the first stage of the linac cold section. In this paper we present the current status of the production and testing of the first two prototype cavities. This includes descriptions of the fabrication, frequency tuning, chemical polishing, high pressure rinse, and high-gradient cold tests.

  11. Design and first cold test of BNL superconducting 112 MHz QWR for electron gun applications

    SciTech Connect

    Belomestnykh, S.; Ben-Zvi, I.; Boulware, C.H.; Chang, X.; Grimm, T.L.; Siegel, B.; Than, R.; Winowski, M.


    Brookhaven National Laboratory and Niowave, Inc. have designed, fabricated, and performed the first cold test of a superconducting 112 MHz quarter-wave resonator (QWR) for electron gun experiments. The first cold test of the QWR cryomodule has been completed at Niowave. The paper discusses the cryomodule design, presents the cold test results, and outline plans to upgrade the cryomodule for future experiments. A quarter-wave resonator concept of superconducting RF (SRF) electron gun was proposed at BNL for electron cooling ion/proton beams at RHIC. QWRs can be made sufficiently compact even at low RF frequencies (long wavelengths). The long wavelength allows to produce long electron bunches, thus minimizing space charge effects and enabling high bunch charge. Also, such guns should be suitable for experiments requiring high average current electron beams. A 112 MHz QWR gun was designed, fabricated, and cold-tested in collaboration between BNL and Niowave. This is the lowest frequency SRF gun ever tested successfully. In this paper we describe the gun design and fabrication, present the cold test results, and outline plans for the cryomodule upgrade for future experiments.

  12. Compact 400-Mhz Half-Wave Spoke Resonator Crab Cavitiy for the LHC Update

    SciTech Connect

    Li, Zenghai; Xiao, Liling; Ng, Cho; Markiewicz, Thomas; /SLAC


    Crab cavities are proposed for the LHC upgrade to improve the luminosity. There are two possible crab cavity installations for the LHC upgrade: the global scheme at Interaction Region (IR) 4 where the beam-beam separation is about 420-mm, and the local scheme at the IR5 where the beam-beam separation is only 194-mm. One of the design requirements as the result of a recent LHC-Crab cavity workshop is to develop a 400-MHz cavity design that can be utilized for either the global or local schemes at IR4 or IR5. Such a design would offer more flexibility for the final upgrade installation, as the final crabbing scheme is yet to be determined, and save R&D cost. The cavity size of such a design, however, is limited by the beam-beam separation at IR5 which can only accommodate a cavity with a horizontal size of about 145-mm, which is a design challenge for a 400-MHz cavity. To meet the new design requirements, we have developed a compact 400-MHz half-wave spoke resonator (HWSR) crab cavity that can fit into the tight spaces available at either IR4 or IR5. In this paper, we present the optimization of the HWSR cavity shape and the design of HOM, LOM, and SOM couplers for wakefield damping.

  13. 120 MW, 800 MHz Magnicon for a Future Muon Collider

    SciTech Connect

    Jay L. Hirshfield


    Development of a pulsed magnicon at 800 MHz was carried out for the muon collider application, based on experience with similar amplifiers in the frequency range between 915 MHz and 34.3 GHz. Numerical simulations using proven computer codes were employed for the conceptual design, while established design technologies were incorporated into the engineering design. A cohesive design for the 800 MHz magnicon amplifier was carried out, including design of a 200 MW diode electron gun, design of the magnet system, optimization of beam dynamics including space charge effects in the transient and steady-state regimes, design of the drive, gain, and output cavities including an rf choke in the beam exit aperture, analysis of parasitic oscillations and design means to eliminate them, and design of the beam collector capable of 20 kW average power operation.

  14. BERLinPro Booster Cavity Design, Fabrication and Test Plans

    SciTech Connect

    Burrill, Andrew; Anders, W; Frahm, A.; Knobloch, Jens; Neumann, Axel; Ciovati, Gianluigi; Kneisel, Peter K.; Turlington, Larry D.


    The bERLinPro project, a 100 mA, 50 MeV superconducting RF (SRF) Energy Recovery Linac (ERL) is under construction at Helmholtz-Zentrum Berlin for the purpose of studying the technical challenges and physics of operating a high current, c.w., 1.3 GHz ERL. This machine will utilize three unique SRF cryomodules for the injector, booster and linac module respectively. The booster cryomodule will contain three 2-cell SRF cavities, based on the original design by Cornell University, and will be equipped with twin 115 kW RF power couplers in order to provide the appropriate acceleration to the high current electron beam. This paper will review the status of the fabrication of the 4 booster cavities that have been built for this project by Jefferson Laboratory and look at the challenges presented by the incorporation of fundamental power couplers capable of delivering 115 kW. The test plan for the cavities and couplers will be given along with a brief overview of the cryomodule design.

  15. Investigation of Microscopic Materials Limitations of Superconducting RF Cavities

    SciTech Connect

    Anlage, Steven


    The high-field performance of SRF cavities is often limited by breakdown events below the intrinsic limiting surface fields of Nb, and there is abundant evidence that these breakdown events are localized in space inside the cavity. Also, there is a lack of detailed understanding of the causal links between surface treatments and ultimate RF performance at low temperatures. An understanding of these links would provide a clear roadmap for improvement of SRF cavity performance, and establish a cause-and-effect ‘RF materials science’ of Nb. We propose two specific microscopic approaches to addressing these issues. First is a spatially-resolved local microwave-microscope probe that operates at SRF frequencies and temperatures to discover the microscopic origins of breakdown, and produce quantitative measurements of RF critical fields of coatings and films. Second, RF Laser Scanning Microscopy (LSM) has allowed visualization of RF current flow and sources of nonlinear RF response in superconducting devices with micro-meter spatial resolution. The LSM will be used in conjunction with surface preparation and characterization techniques to create definitive links between physical and chemical processing steps and ultimate cryogenic microwave performance. We propose to develop RF laser scanning microscopy of small-sample Nb pieces to establish surface-processing / RF performance relations through measurement of RF current distributions on micron-length scales and low temperatures.

  16. A Compact 500 MHz Femtosecond All-Fiber Ring Laser

    NASA Astrophysics Data System (ADS)

    Yang, Tong; Huang, Huichang; Yuan, Xiaozhi; Wei, Xiaoming; He, Xin; Mo, Shupei; Deng, Huaqiu; Yang, Zhongmin


    We demonstrate a fundamentally mode-locked all-fiber ring laser with the repetition rate up to 500 MHz and pulse duration of 250 fs at 1.5 µm. Only an optical integrated module, a 4.8 cm Er3+/Yb3+-codoped phosphate glass fiber, and a polarization controller are employed to construct the all-fiber ring cavity. Stable mode-locking laser is output by adjusting the polarization controller.

  17. Thermoluminescence dosimetry features of DY and Cu doped SrF2 nanoparticles under gamma irradiation.


    Zahedifar, M; Sadeghi, E; Kashefi biroon, M; Harooni, S; Almasifard, F


    Dy and Cu-doped SrF2 nanoparticles (NPs) were synthesized by using co-precipitation method and their possible application to solid state dosimetry were studied and compared to that of pure SrF2 NPs. X-ray diffraction (XRD), scanning electron microscopy (SEM) and energy dispersive spectrometer (EDS) were used for sample characterization. The highest thermoluminescence (TL) response of SrF2:Dy and SrF2:Cu NPs were found respectively at 0.5 and 0.7mol% of Dy and Cu impurities. Seven overlapping glow peaks at 384, 406, 421, 449, 569, 495, 508K and three component glow peaks at 381, 421 and 467K were identified respectively for SrF2:Dy and SrF2:Cu NPs employing Tm-Tstop and computerized glow curve deconvolution (CGCD) methods. The TL sensitivity of SrF2:Dy is approximately the same as that of LiF:Mg,Ti (TLD-100) cheeps. Linear dose response were observed for the SrF2:Dy and SrF2:Cu NPs up to the absorbed doses of 1kGy and 10kGy correspondingly. Regarding other dosimetry characteristics of the produced NPs such as fading, reproducibility and thermal treatment, Dy and Cu doped SrF2 NPs recommend for high dose TL dosimetry applications. PMID:26319090

  18. A selection of high gradient cavity experiments

    SciTech Connect

    Peter Kneisel


    In the two years since the 7th SRF workshop, a variety of cavity tests have been carried out with the objective to reproducibly achieve surface electric rf fields above 40 MV/m with no or only very little electron loading. This paper reports about a collection of tests on single cell and multi-cell cavities, which received standard surface treatments such as buffered chemical polishing and high pressure ultrapure water rinsing, but no heat treatments. Often the cavities were limited by quenches, posting a limit of 700 to 1,000 Oersted on achievable peak magnetic fields of high purity niobium RRR values between 200 and 250. In a seamless single cell cavity fabricated by V. Palmieri of INFN Legnaro by spinning, a very promising gradient of E{sub acc}=25 MV/m was measured. In collaboration with CERN, several tests on sputtering niobium prepared at CERN were also carried out, and accelerating gradients up to 25 MV/m were achieved. A single cell cavity, electron beam welded after electrochemical buffing, showed only good performance--E{sub p} > 50 MV/m--after the removal of more than 100 {micro}m of material. However, this cavity showed rather heavy Q disease even when cooled down rapidly; the Q degradation could be partially reversed by diffusing the oxygen from an anodized Nb{sub 2}O{sub 5} layer into the niobium by heating the cavity in-situ at T=250 C.

  19. Lorentz Force Detuning Analysis of the SNS Accelerating Cavities

    SciTech Connect

    R. Mitchell; K. Matsumoto; G. Ciovati; K. Davis; K. Macha; R. Sundelin


    The Spallation Neutron Source (SNS) project incorporates a superconducting radio-frequency (SRF) accelerator for the final section of the pulsed mode linac Cavities with geometrical {beta} values of {beta} = 0.61 and {beta} = 0.81 are utilized in the SRF section, and are constructed out of thin-walled niobium with stiffener rings welded between the cells near the iris. The welded titanium helium vessel and tuner assembly restrains the cavity beam tubes Cavities with {beta} values less than one have relatively steep and flat side-walls making the cavities susceptible to Ised RF induces cyclic Lorentz pressures that mechanically excite the cavities, producing a dynamic Lorentz force detuning different from a continuous RF system. The amplitude of the dynamic detuning for a given cavity design is a function of the mechanical damping, stiffness of the tuner/helium vessel assembly, RF pulse profile, and the RF pulse rate. This paper presents analysis and testing results to date, and indicates areas where more investigation is required.

  20. A path to higher Q0 with large grain niobium cavities

    SciTech Connect

    Pashupati Dhakal, Gianluigi Ciovati, Ganapati Rao Myneni


    The improvement of the quality factor Q{sub 0} of superconducting radio-frequency (SRF) cavities at medium accelerating gradients ({approx} 20 MV/m) is important in order to reduce the cryogenic losses in continuous wave accelerators for a variety of applications. In recent years, SRF cavities fabricated from ingot niobium have become a viable alternative to standard high-purity fine-grain Nb for the fabrication of high-performing SRF cavities with the possibility of significant cost reduction. Initial studies demonstrated the improvement of Q{sub 0} at medium field in cavities heat treated at 800-1000 C without subsequent chemical etching. To further explore this treatment procedure, a new induction furnace with an all-niobium hot-zone was commissioned. A single-cell 1.5 GHz cavity fabricated from ingot material from CBMM, Brazil, with RRR {approx} 200, was heat treated with the new furnace in the temperature range 600-1200 C for several hours. Residual resistance values 1-5 nano-ohm have been consistently achieved on this cavity as well as Q{sub 0} values above {approx} 2 x 10{sup 11} at 2 K and 100 mT peak surface magnetic field. Q{sub 0}-values of the order of 10{sup 11} have been measured at 1.5 K.

  1. Temperature Mapping of Nitrogen-doped Niobium Superconducting Radiofrequency Cavities

    SciTech Connect

    Makita, Junki; Ciovati, Gianluigi; Dhakal, Pashupati


    It was recently shown that diffusing nitrogen on the inner surface of superconducting radiofrequency (SRF) cavities at high temperature can improve the quality factor of the niobium cavity. However, a reduction of the quench field is also typically found. To better understand the location of rf losses and quench, we used a thermometry system to map the temperature of the outer surface of ingot Nb cavities after nitrogen doping and electropolishing. Surface temperature of the cavities was recorded while increasing the rf power and also during the quenching. The results of thermal mapping showed no precursor heating on the cavities and quenching to be ignited near the equator where the surface magnetic field is maximum. Hot-spots at the equator area during multipacting were also detected by thermal mapping.

  2. Fabrication and Testing of Deflecting Cavities for APS

    SciTech Connect

    Mammosser, John; Wang, Haipeng; Rimmer, Robert; Jim, Henry; Katherine, Wilson; Dhakal, Pashupati; Ali, Nassiri; Jim, Kerby; Jeremiah, Holzbauer; Genfa, Wu; Joel, Fuerst; Yawei, Yang; Zenghai, Li


    Jefferson Lab (Newport News, Virginia) in collaboration with Argonne National Laboratory (Argonne, IL) has fabricated and tested four first article, 2.8 GHz, deflecting SRF cavities, for Argonne's Short-Pulse X-ray (SPX) project. These cavities are unique in many ways including the fabrication techniques in which the cavity cell and waveguides were fabricated. These cavity subcomponents were milled from bulk large grain niobium ingot material directly from 3D CAD files. No forming of sub components was used with the exception of the beam-pipes. The challenging cavity and helium vessel design and fabrication results from the stringent RF performance requirements required by the project and operation in the APS ring. Production challenges and fabrication techniques as well as testing results will be discussed in this paper.

  3. Fundamental Study of Micro-Defects in Electropolished EB-Welded and Hydroformed SRF Accelerating Structures

    SciTech Connect

    Sumption, Mike


    In the area of niobium elecropolishing fundamentals, we focused on understanding the influence of the surface topology, and geometry (with effects from gravity included. The formation of a viscous film is essential for the electropolishing process to take place. The exact nature and composition of the film formed on niobium is still unknown because of its solubility in the electrolyte. Extensive pitting may take place at surface where a stable film cannot form. This has to be taken into consideration while determining the speed with which the SRF cavities are rotated while EP. Hydrodynamic aspects must be taken into consideration while optimizing the polishing parameters. There is improvement in surface finish with polishing time. There is a huge change in surface quality when the EP time is increased from 2 hours to 4 hours but not much change takes place when the time is further increased to 6 hours. So keeping the economic points in view, about 100 um defect layer removal may be sufficient to get the desired performance. In the area of Electropolishing of untreated and treated niobium with Weld Joints we studied untreated and treated Nb, especially for the heat affected areas next to welded bumps, electropolished for different durations. The electropolishing of the untreated Nb caused the formation of pits on the surface at about 15 min but they disappeared when the electropolishing duration was more than 15 min. Electropolishing for 120 min smoothened the surface of untreated Nb by levelling the surface, but the severe formation of pits on the whole surface was found after 240 min. The treatment of Nb significantly changed the Nb surface morphology which was covered by grains of different size that looked light or dark in the optical microscope. The treated Nb was susceptible to pitting during the entire electropolishing starting from 15 min and the dark grains had more susceptibility to pitting than the light grains. In addition, electropolishing for 240 min

  4. The 300 mA SRF ERL

    SciTech Connect

    Ben-Zvi, Ilan


    Energy Recovery Linacs (ERL) are important for a variety of applications, from high-power Free-Electron Lasers (FEL) to polarized-electron polarized-proton colliders. The ERL current is arguably the most important characteristic of ERLs for such applications. With that in mind, the Collider-Accelerator Department at Brookhaven National Laboratory embarked on the development of a 300 mA ERL to serve as an R and D test-bed for high-current ERL technologies. These include high-current, extremely well damped superconducting accelerating cavities, high-current superconducting laser-photocathode electron guns and high quantum-efficiency photocathodes. In this presentation I will cover these ERL related developments.

  5. Effect of Modified Mechanical Treatment Facilities on SRF Yield in Korea

    NASA Astrophysics Data System (ADS)

    Jo, Mi-Hyun; Lee, Byung-Jin; Lee, Jai-Young


    An SRF plant which can produce 100 ton/month of SRF, one of the largest manufacturing plants in Korea, was investigated in this study. The actual operated SRF yield at 21.7 % that showed a lower yield than expected; originally designed value was 25.0%. The cause of these results was the difference between characteristics of MSW applied to this plant originally and that which was actual incoming. The MSW led to decrease the separation efficiency of the mechanical treatment process. Thus, each element of the facility was modified. After modification, the SRF yield increased to 30.9%, whereas the physico-chemical properties of SRF were satisfied with domestic standard of SRF regardless of modifying MT facilities.

  6. Performance characteristics of Jefferson Lab's new SRF infrastructure

    SciTech Connect

    Reece, Charles E.; Denny, Philip; Reilly, Anthony


    In the past two years, Jefferson Lab has reconfigured and renovated its SRF support infrastructure as part of the Technology and Engineering Development Facility project, TEDF. The most significant changes are in the cleanroom and chemistry facilities. We report the initial characterization data on the new ultra-pure water systems, cleanroom facilities, describe the reconfiguration of existing facilities and also opportunities for flexible growth presented by the new arrangement.

  7. Elemental balance of SRF production process: solid recovered fuel produced from municipal solid waste.


    Nasrullah, Muhammad; Vainikka, Pasi; Hannula, Janne; Hurme, Markku; Oinas, Pekka


    In the production of solid recovered fuel (SRF), certain waste components have excessive influence on the quality of product. The proportion of rubber, plastic (hard) and certain textiles was found to be critical as to the elemental quality of SRF. The mass flow of rubber, plastic (hard) and textiles (to certain extent, especially synthetic textile) components from input waste stream into the output streams of SRF production was found to play the decisive role in defining the elemental quality of SRF. This paper presents the mass flow of polluting and potentially toxic elements (PTEs) in SRF production. The SRF was produced from municipal solid waste (MSW) through mechanical treatment (MT). The results showed that of the total input chlorine content to process, 55% was found in the SRF and 30% in reject material. Of the total input arsenic content, 30% was found in the SRF and 45% in fine fraction. In case of cadmium, lead and mercury, of their total input content to the process, 62%, 38% and 30%, respectively, was found in the SRF. Among the components of MSW, rubber material was identified as potential source of chlorine, containing 8.0 wt.% of chlorine. Plastic (hard) and textile components contained 1.6 and 1.1. wt.% of chlorine, respectively. Plastic (hard) contained higher lead and cadmium content compared with other waste components, i.e. 500 mg kg(-1) and 9.0 mg kg(-1), respectively. PMID:26608898

  8. Surface characterization of niobium for superconducting RF cavities

    NASA Astrophysics Data System (ADS)

    Cao, Chaoyue

    Surface characterization techniques including point contact tunneling (PCT) spectroscopy and Raman spectroscopy have been employed to study the surface of niobium (Nb) superconducting radio frequency (SRF) cavities. PCT spectroscopy provides a direct means of measuring the surface superconductivity, which is closely correlated with the cavity's performance characterized by the quality factor Q. Cavities with remarkably high Q show near ideal tunneling spectra with sharp coherent peaks and low zero bias conductance, consistent with the Bardeen-Cooper-Schrieffer (BCS) density of stats (DOS), and bulk gap parameter, Delta = 1.55-1.6 meV. Cavities with Q-drop often exhibit strong non-uniform heating during RF operations, with high loss regions identified as hot spots. PCT spectra on hot spots reveal suppressed superconductivity, broadened DOS and Kondo tunneling, consistent with magnetic impurities on the surface. Raman spectra on hot spots indicate the presence of various impurities on the surface including amorphous carbon, C-H chain compounds and NbC, providing insights into the formation of hot spots. The origin of the impurities is unclear at present but it is suggested that particular processing steps in SRF cavity fabrication may be responsible.

  9. First high gradient test results of a dressed 325 MHz superconducting single spoke resonator at Fermilab

    SciTech Connect

    Webber, R.C.; Khabiboulline, T.; Madrak, R.; Nicol, T.; Ristori, L.; Soyars, W.; Wagner, R.; /Fermilab


    A new superconducting RF cavity test facility has been commissioned at Fermilab in conjunction with first tests of a 325 MHz, {beta} = 0.22 superconducting single-spoke cavity dressed with a helium jacket and prototype tuner. The facility is described and results of full gradient, CW cavity tests with a high Q{sub ext} drive coupler are reported. Sensitivities to Q disease and externally applied magnetic fields were investigated. Results are compared to bare cavity results obtained prior to hydrogen degassing and welding into the helium jacket.

  10. Testing a GaAs cathode in SRF gun

    SciTech Connect

    Wang, E.; Kewisch, J.; Ben-Zvi, I.; Burrill, A.; Rao, T.; Wu, Q.; Holmes, D.


    RF electron guns with a strained superlattice GaAs cathode are expected to generate polarized electron beams of higher brightness and lower emittance than do DC guns, due to their higher field gradient at the cathode's surface and lower cathode temperature. We plan to install a bulk GaAs:Cs in a SRF gun to evaluate the performance of both the gun and the cathode in this environment. The status of this project is: In our 1.3 GHz 1/2 cell SRF gun, the vacuum can be maintained at nearly 10{sup -12} Torr because of cryo-pumping at 2K. With conventional activation of bulk GaAs, we obtained a QE of 10% at 532 nm, with lifetime of more than 3 days in the preparation chamber and have shown that it can survive in transport from the preparation chamber to the gun. The beam line has been assembled and we are exploring the best conditions for baking the cathode under vacuum. We report here the progress of our test of the GaAs cathode in the SRF gun. Future particle accelerators, such as eRHIC and the ILC require high-brightness, high-current polarized electrons. Strained superlattice GaAs:Cs has been shown to be an efficient cathode for producing polarized electrons. Activation of GaAs with Cs,O(F) lowers the electron affinity and makes it energetically possible for all the electrons, excited into the conduction band that drift or diffuse to the emission surface, to escape into the vacuum. Presently, all operating polarized electron sources, such as the CEBAF, are DC guns. In these devices, the excellent ultra-high vacuum extends the lifetime of the cathode. However, the low field gradient on the photocathode's emission surface of the DC guns limits the beam quality. The higher accelerating gradients, possible in the RF guns, generate a far better beam. Until recently, most RF guns operated at room temperature, limiting the vacuum to {approx}10{sup -9} Torr. This destroys the GaAs's NEA surface. The SRF guns combine the excellent vacuum conditions of DC guns and the high

  11. Measurement of HOMs in the RHIC RF Cavities

    SciTech Connect

    Abreu,N.P.; Choi, E. M.


    The authors present results of Higher Order Modes (HOMs) measurements in the RHIC accelerating (28 MHz system) and storage (197 MHz system) cavities. The power of the excited HOMs deposited into the HOM damper is measured and compared with an analytical calculation of the HOMs power. The quality factors (Q) are also measured and compared to previous measurements.

  12. Aircraft measurement of radio frequency noise at 121.5 MHz, 243MHz and 406MHz

    NASA Technical Reports Server (NTRS)

    Taylor, R. E.; Hill, J. S.


    An airborne survey measurement of terrestrial radio-frequency noise over U.S. metropolitan areas has been made at 121.5, 243 and 406 MHz with horizontal-polarization monopole antennas. Flights were at 25,000 feet altitude during the period from December 30, 1976 to January 8, 1977. Radio-noise measurements, expressed in equivalent antenna-noise temperature, indicate a steady-background noise temperature of 572,000 K, at 121.5 MHz, during daylight over New York City. This data is helpful in compiling radio-noise temperature maps; in turn useful for designing satellite-aided, emergency-distress search and rescue communication systems.

  13. Preliminary results from Prototype Niobium Cavities for The JLab Ampere-Class FEL

    SciTech Connect

    Peter Kneisel; Gianluigi Ciovati; Richard Bundy; Bill Clemens; Daniel Forehand; Byron Golden; Stephen Manning; Bob Manus; Frank Marhauser; Roland Overton; Robert Rimmer; Gary Slack; Larry Turlington; Haipeng Wang


    In a previous paper the cavity [1] design for an Ampere-class cryomodule was introduced. We have since fabricated a 1500 MHz version of a single cell cavity with waveguide couplers for HOM and fundamental power, attached to one end of the cavity, a 5-cell cavity made from large grain niobium without couplers and. a 750 MHz single cell cavity without endgroups to get some information about obtainable Q-values, gradients and multipacting behavior at lower frequency. This contribution reports on the various tests of these cavities.

  14. Development of spoke cavities for RIA.

    SciTech Connect

    Shepard, K. W.; Kelly, M. P.; Fuerst, J.; Kedzie, M.; Conway, Z. A.; Physics


    This paper reports the development status of 345 MHz, 4 cm beam aperture, three-spoke-loaded, TEM-class superconducting cavities for particle velocities 0.4 < v/c < 0.8. Two prototype cavities have been operated cw at 4.2 K at accelerating gradients above 10 MV/m. Results of cold tests, including mechanical properties and microphonic behavior, are presented.

  15. Magnetic shielding for the Fermilab Vertical Cavity Test Facility

    SciTech Connect

    Ginsburg, Camille M.; Reid, Clark; Sergatskov, Dmitri A.; /Fermilab


    A superconducting RF cavity has to be shielded from magnetic fields present during cool down below the critical temperature to avoid freezing in the magnetic flux at localized impurities, thereby degrading the cavity intrinsic quality factor Q{sub 0}. The magnetic shielding designed for the Fermilab vertical cavity test facility (VCTF), a facility for CW RF vertical testing of bare ILC 1.3 GHz 9-cell SRF cavities, was recently completed. For the magnetic shielding design, we used two cylindrical layers: a room temperature 'outer' shield of Amumetal (80% Ni alloy), and a 2K 'inner' shield of Cryoperm 10. The magnetic and mechanical design of the magnetic shielding and measurement of the remanent magnetic field inside the shielding are described.

  16. First Characterization of a Fully Superconducting RF Photoinjector Cavity

    SciTech Connect

    Neumann, A; Barday, R; Jankowiak, A; Kamps, T; Knobloch, J; Kugeler, O; Matveenko, A N; Quast, T; Rudolph, J; Schubert, S G; Volker, J; Kneisel, P; Nietubyc, R; Sekutowicz, J K; Smedley, J; Volkov, V; Weinberg, G; Will, I


    As a first step towards a high brightness, high average current electron source for the BERLinPro ERL a fully superconducting photo-injector was developed by HZB in collaboration with JLab, DESY and the A. Soltan Institute. This cavity-injector ensemble is made up of a 1.6-cell superconducting cavity with a superconducting lead cathode deposited on the half-cell backwall. A superconducting solenoid is used for emittance compensation. This system, including a diagnostics beamline, has been installed in the HoBiCaT facility to serve as a testbed for beam dynamics studies and to test the combination SRF cavity and superconducting solenoid. This paper summarizes the characterization of the cavity in this configuration including Q measurements, dark current tests and field-stability analyses.

  17. SRF test facility for the superconducting LINAC ``RAON'' — RRR property and e-beam welding

    NASA Astrophysics Data System (ADS)

    Jung, Yoochul; Hyun, Myungook; Joo, Jongdae; Joung, Mijoung


    Equipment, such as a vacuum furnace, high pressure rinse (HPR), eddy current test (ECT) and buffered chemical polishing (BCP), are installed in the superconducting radio frequency (SRF) test facility. Three different sizes of cryostats (diameters of 600 mm for a quarter wave resonator (QWR), 900 mm for a half wave resonator (HWR), and 1200 mm for single spoke resonator 1&2 (SSR 1&2)) for vertical RF tests are installed for testing cavities. We confirmed that as-received niobium sheets (ASTM B393, RRR300) good electrical properties because they showed average residual resistance ratio (RRR) values higher than 300. However, serious RRR degradation occurred after joining two pieces of Nb by e-beam welding because the average RRR values of the samples were ˜179, which was only ˜60% of as-received RRR value. From various e-beam welding experiments in which the welding current and a speed at a fixed welding voltage were changed, we confirmed that good welding results were obtained at a 53 mA welding current and a 20-mm/s welding speed at a fixed welding voltage of 150 kV.

  18. Characterization of an SRF gun: a 3D full wave simulation

    SciTech Connect

    Wang, E.; Ben-Zvi, I.; Wang, J.


    We characterized a BNL 1.3GHz half-cell SRF gun is tested for GaAs photocathode. The gun already was simulated several years ago via two-dimensional (2D) numerical codes (i.e., Superfish and Parmela) with and without the beam. In this paper, we discuss our investigation of its characteristics using a three dimensional (3D) full-wave code (CST STUDIO SUITE{trademark}).The input/pickup couplers are sited symmetrically on the same side of the gun at an angle of 180{sup o}. In particular, the inner conductor of the pickup coupler is considerably shorter than that of the input coupler. We evaluated the cross-talk between the beam (trajectory) and the signal on the input coupler compared our findings with published results based on analytical models. The CST STUDIO SUITE{trademark} also was used to predict the field within the cavity; particularly, a combination of transient/eigenmode solvers was employed to accurately construct the RF field for the particles, which also includes the effects of the couplers. Finally, we explored the beam's dynamics with a particle in cell (PIC) simulation, validated the results and compare them with 2D code result.

  19. 47 CFR 27.501 - 746-763 MHz, 775-793 MHz, and 805-806 MHz bands subject to competitive bidding.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false 746-763 MHz, 775-793 MHz, and 805-806 MHz bands... Procedures for the 698-806 MHz Band § 27.501 746-763 MHz, 775-793 MHz, and 805-806 MHz bands subject to competitive bidding. Mutually exclusive initial applications for licenses in the 746-763 MHz, 775-793 MHz,...

  20. SMYD1, an SRF-Interacting Partner, Is Involved in Angiogenesis.


    Ye, Xiangli; Qian, Yu; Wang, Qian; Yuan, Wuzhou; Mo, Xiaoyang; Li, Yongqing; Jiang, Zhigang; Xu, Wei; Deng, Yun; Wan, Yongqi; Fan, Xiongwei; Wu, Xiushan; Wang, Yuequn


    Previous studies have demonstrated that Smyd1 plays a critical role in cardiomyocyte differentiation, cardiac morphogenesis and myofibril organization. In this study, we uncovered a novel function of Smyd1 in the regulation of endothelial cells (ECs). Our data showed that Smyd1 is expressed in vascular endothelial cells, and knockdown of SMYD1 in endothelial cells impairs EC migration and tube formation. Furthermore, Co-IP and GST pull-down assays demonstrated that SMYD1 is associated with the Serum Response Factor (SRF). EMSA assays further showed that SMYD1 forms a complex with SRF and enhances SRF DNA binding activity. Our studies indicate that SMYD1 serves as an SRF-interacting protein, enhances SRF DNA binding activity, and is required for EC migration and tube formation to regulate angiogenesis. PMID:26799706

  1. Ion Exchange Testing with SRF Resin FY2012

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Peterson, Reid A.


    Ion exchange using spherical resorcinol-formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection (DOE-ORP) for use in the Pretreatment Facility (PTF) of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in at-tank deployment. Numerous studies have shown SRF resin to be effective for removing 137Cs from a wide variety of actual and simulated tank waste supernatants (Adamson et al. 2006; Blanchard et al. 2008; Burgeson et al. 2004; Duignan and Nash 2009; Fiskum et al. 2006a; Fiskum et al. 2006b; Fiskum et al. 2006c; Fiskum et al. 2007; Hassan and Adu-Wusu 2003; King et al. 2004; Nash et al. 2006). Prior work at the Pacific Northwest National Laboratory (PNNL) has focused primarily on the loading behavior for 4 to 6 M Na solutions at 25 to 45°C. Recent proposed changes to the WTP ion exchange process baseline indicate that loading may include a broader range of sodium molarities (0.1 to 8 M) and higher temperatures (50°C) to alleviate post-filtration precipitation issues. This report discusses ion exchange loading kinetics testing activities performed in accordance with Test Plan TP-WTPSP-002, Rev. 3.0 , which was prepared and approved in response to the Test Specification 24590 PTF-TSP-RT-09-002, Rev. 0 (Lehrman 2010) and Test Exception 24590 PTF TEF RT-11-00003, Rev. 0 (Meehan 2011). This testing focused on column tests evaluating the impact of elevated temperature on resin degradation over an extended period of time and batch contacts evaluating the impact on Cs loading over a broad range of sodium concentrations (0.1 to 5 M). These changes may be required to alleviate post-filtration precipitation issues and broaden the data range of SRF resin loading under the conditions expected with the new equipment and process changes.

  2. Cesium Ion Exchange Loading Kinetics Testing with SRF Resin

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Brown, Garrett N.; Peterson, Reid A.


    Ion exchange using the Spherical Resorcinol-Formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection for use in the Pretreatment Facility of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in an at-tank deployment for removing 137Cs. Recent proposed changes to the WTP ion exchange process baseline indicate that loading may include a broader range of sodium molarities (2 to 8 M) due to caustic leaching and higher temperatures (50°C) to alleviate post-filtration precipitation issues prior to reaching the ion exchange columns. Therefore, it is important to understand the behavior of SRF resin performance under the conditions expected with the new equipment and process changes. This research examined the impact of linear load velocity (4, 6, 8 cm/min), initial sodium concentration (2, 5, 8 M), initial sodium-to-cesium ratio (1.4E+05, 2.1E+05, 2.8E+05 mol/mol), initial sodium-to-hydroxide ratio (2.0, 3.0, 4.0 mol/mol), and resin degradation during extended solution flow using elevated temperature (45°, 50°, 55°, 60°, 65°, 75°C). Testing was performed using a~2mL column packed with SRF resin with feed flowing through it in an up-flow pattern. Samples were taken at set intervals and the data analyzed to help understand the impact of these conditions on the SRF resin performance. It was found that the loading kinetics were not significantly impacted by the sodium concentration over the range tested. However, the loading kinetics were impacted by the linear load velocity. These results indicated that at the test temperature, the adsorption of cesium is strongly dependent on mass transfer through the film and not significantly impacted by interparticle diffusion. Testing for extended times at elevated temperatures showed that the resin does degrade and loading capacity is reduced at and above 45°C. Above 60°C the resin appears to not load at all.

  3. SRF binding to SRE in the rat heart: influence of age.


    Lu, X G; Azhar, G; Liu, L; Tsou, H; Wei, J Y


    One important promoter element at the 5' end of the c-fos gene is the serum response element (SRE). SRE is the site of attachment of the 67-kDa protein serum response factor (SRF) and several accessory proteins (Elk1, SAP1, SAP2/NET), termed the ternary complex factors. The binding of SRF to SRE plays an integral role in c-fos transcription and may occur independently of the association of the ternary complex factors. In the current study, we found that SRF protein expression was increased in the hearts of the old vs young adult rats in the basal condition. The hearts of old rats may have posttranslationally modified SRF proteins that are different compared to that of the young adults. The SRF increase was present both in the cytoplasm as well as in the nucleus in the old hearts. To test whether SRF protein levels in response to acute stress might be altered with age, we studied hearts of young adult and old rats during myocardial infarction. The young adult rat hearts responded to acute ischemic stress with an increase in both p62 and p67 SRF. The hearts of the old rats, however, did not exhibit a significant change in SRF protein expression. These findings demonstrate qualitative as well as quantitative age differences in SRF protein levels, both at baseline and following stimulation. The reduced SRF expression in response to acute cardiac ischemic stress in the old rats might contribute to the observed age-related decrease in the induction of immediate early genes such as c-fos in the heart. PMID:9467416

  4. Novel Geometries for the LHC Crab Cavity

    SciTech Connect

    Hall, B.; Burt, G.; Smith, J. D.A.; Rimmer, R.; Wang, H.; Delayen, J.; Calaga, R.


    In 2017 the LHC is envisioned to increase its luminosity via an upgrade. This upgrade is likely to require a large crossing angle hence a crab cavity is required to align the bunches prior to collision. There are two possible schemes for crab cavity implementation, global and local. In a global crab cavity the crab cavity is far from the IP and the bunch rotates back and forward as it traverses around the accelerator in a closed orbit. For this scheme a two-cell elliptical squashed cavity at 800 MHz is preferred. To avoid any potential beam instabilities all the parasitic modes of the cavities must be damped strongly, however crab cavities have lower order and same order modes in addition to the usual higher order modes and hence a novel damping scheme must be used to provide sufficient damping of these modes. In the local scheme two crab cavities are placed at each side of the IP two start and stop rotation of the bunches. This would require crab cavities much smaller transversely than in the global scheme but the frequency cannot be increased any higher due to the long bunch length of the LHC beam. This will require a novel compact crab cavity design. A superconducting version of a two rod coaxial deflecting cavity as a suitable design is proposed in this paper.

  5. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF

    SciTech Connect

    Sung, Zu-Hawn; Lee, Peter J. Polyanskii, Anatolii Balachandran, Shreyas Chetri, Santosh; Larbalestier, David C.


    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. They offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to the direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cutout single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.

  6. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF


    Sung, Zu -Hawn; Lee, Peter J.; Polyanskii, Anatolii; Balachandran, Shreyas; Chetri, Santosh; Larbalestier, David C.; Wang, Mingmin; Compton, Christopher; Bieler, Thomas R.


    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. In addition, they offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to themore » direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cut-out single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.« less

  7. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF

    SciTech Connect

    Sung, Zu -Hawn; Lee, Peter J.; Polyanskii, Anatolii; Balachandran, Shreyas; Chetri, Santosh; Larbalestier, David C.; Wang, Mingmin; Compton, Christopher; Bieler, Thomas R.


    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. In addition, they offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to the direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cut-out single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.

  8. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF

    NASA Astrophysics Data System (ADS)

    Sung, Zu-Hawn; Lee, Peter J.; Polyanskii, Anatolii; Balachandran, Shreyas; Chetri, Santosh; Larbalestier, David C.; Wang, Mingmin; Compton, Christopher; Bieler, Thomas R.


    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. They offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to the direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cutout single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.

  9. Phoxonic crystals and cavity optomechanics

    NASA Astrophysics Data System (ADS)

    Djafari-Rouhani, Bahram; El-Jallal, Said; Pennec, Yan


    Phoxonic crystals are dual phononic/photonic crystals exhibiting simultaneously band gaps for both types of excitations. Therefore, they have the ability to confine phonons and photons in the same cavity and in turn allow the enhancement of their interaction. In this paper, we review some of our theoretical works on cavity optomechanical interactions in different types of phoxonic crystals, including two-dimensional, slab, and nanobeam structures. Two mechanisms are behind the phonon-photon interaction, namely the photoelastic and the moving interface effects. Coupling rates of a few MHz are obtained with high-frequency phonons of a few GHz. Finally, we give some preliminary results about the optomechanical interaction when a metallic nanoparticle is introduced into the cavity, giving rise to coupled photon-plasmon modes or, in the case of very small particles, to an enhancement of the electric field at the position of the particle. xml:lang="fr"

  10. Laser nitriding for niobium superconducting radio-frequency accelerator cavities

    SciTech Connect

    Senthilraja Singaravelu, John Klopf, Gwyn Williams, Michael Kelley


    Particle accelerators are a key tool for scientific research ranging from fundamental studies of matter to analytical studies at light sources. Cost-forperformance is critical, both in terms of initial capital outlay and ongoing operating expense, especially for electricity. It depends on the niobium superconducting radiofrequency (SRF) accelerator cavities at the heart of most of these machines. Presently Nb SRF cavities operate near 1.9 K, well (and expensively) below the 4.2 K atmospheric boiling point of liquid He. Transforming the 40 nm thick active interior surface layer from Nb to delta NbN (Tc = 17 K instead of 9.2 K) appears to be a promising approach. Traditional furnace nitriding appears to have not been successful for this. Further, exposing a complete SRF cavity to the time-temperature history required for nitriding risks mechanical distortion. Gas laser nitriding instead has been applied successfully to other metals [P.Schaaf, Prog. Mat. Sci. 47 (2002) 1]. The beam dimensions and thermal diffusion length permit modeling in one dimension to predict the time course of the surface temperature for a range of per-pulse energy densities. As with the earlier work, we chose conditions just sufficient for boiling as a reference point. We used a Spectra Physics HIPPO nanosecond laser (l = 1064 nm, Emax= 0.392 mJ, beam spot@ 34 microns, PRF =15 – 30 kHz) to obtain an incident fluence of 1.73 - 2.15 J/cm2 for each laser pulse at the target. The target was a 50 mm diameter SRF-grade Nb disk maintained in a nitrogen atmosphere at a pressure of 550 – 625 torr and rotated at a constant speed of 9 rpm. The materials were examined by scanning electron microscopy (SEM), electron probe microanalysis (EPMA) and x-ray diffraction (XRD). The SEM images show a sharp transition with fluence from a smooth, undulating topography to significant roughening, interpreted here as the onset of ablation. EPMA measurements of N/Nb atom ratio as a function of depth found a constant

  11. BNL 56 MHz HOM damper prototype fabrication at JLAB

    SciTech Connect

    Huque, N.; McIntyre, G.; Daly, E. F.; Clemens, W.; Wu, Q.; Seberg, S.; Bellavia, S.


    A prototype Higher-Order Mode (HOM) Damper was fabricated at JLab for the Relativistic Heavy-Ion Collider’s (RHIC) 56 MHz cavity at Brookhaven National Laboratory (BNL). Primarily constructed from high RRR Niobium and Sapphire, the coaxial damper presented significant challenges in electron-beam welding (EBW), brazing and machining via acid etching. The results of the prototype operation brought about changes in the damper design, due to overheating braze alloys and possible multi-pacting. Five production HOM dampers are currently being fabricated at JLab. This paper outlines the challenges faced in the fabrication process, and the solutions put in place.

  12. BNL 56 MHz HOM Damper Prototype Fabrication at JLab

    SciTech Connect

    Huque, Naeem A.; Daly, Edward F.; Clemens, William A.; McIntyre, Gary T.; Wu, Qiong; Seberg, Scott; Bellavia, Steve


    A prototype Higher-Order Mode (HOM) Damper was fabricated at JLab for the Relativistic Heavy-Ion Collider's (RHIC) 56 MHz cavity at Brookhaven National Laboratory (BNL). Primarily constructed from high RRR Niobium and Sapphire, the coaxial damper presented significant challenges in electron-beam welding (EBW), brazing and machining via acid etching. The results of the prototype operation brought about changes in the damper design, due to overheating braze alloys and possible multi-pacting. Five production HOM dampers are currently being fabricated at JLab. This paper outlines the challenges faced in the fabrication process, and the solutions put in place.

  13. New OH masers at 13 441 MHz

    NASA Astrophysics Data System (ADS)

    Caswell, J. L.


    The Parkes radio telescope has been used to study maser emission from the 13441-MHz transition of highly excited OH. The targets were 56 catalogued sites of 6035-MHz maser emission. Eight 13441-MHz maser sites were detected, six of them new and two that had previously been reported. This more than doubles the number now known to 11. At every 13441-MHz maser site, spectral features occur as right- and left-hand circularly polarized matched pairs, with small, but mostly significant, frequency separation. This is attributed to the Zeeman effect in magnetic fields of a few mG. Some of the 13441-MHz maser sites show features at several different velocities. All of the 13441-MHz maser features have 6035-MHz counterparts that closely correspond in velocity. At three sites, features of 13441-MHz emission rival the intensities of their 6035-MHz counterparts; at the other sites, features are weaker than at 6035 MHz by factors of between 3 and 50. Upper limits at some sites searched can be set more than 2 orders of magnitude weaker than 6035-MHz emission. The detection statistics provide unique opportunities to test recent advances in maser modelling. A search for the 13434-MHz transition towards the same 56 targets yielded no detections.

  14. Performance of Large grain and Single Crystal Niobium Cavities

    SciTech Connect

    Kneisel, Peter; Ciovati, Gianluigi; Sekutowicz, Jacek


    We have fabricated and tested several single and one multi-cell cavity made from large grain niobium of four different ingots. Two cavities at a frequency of ~ 2.2 GHz were made from single crystal sheets. Large grain material was used for four single cell cavities of the HG â and OC shapes, a 7-cell cavity of the HG â shape â all resonating at 1500 MHz â and an ILC_LL single cell cavity at 1300 MHz. We began to explore also different chemical polishing baths such as a 1:1:1 and a 1:1:2 buffered solution and explored the change of cavity performance as a function of material removal. The results from these preliminary investigations are reported in this contribution.

  15. Nuclear PTEN functions as an essential regulator of SRF-dependent transcription to control smooth muscle differentiation.


    Horita, Henrick; Wysoczynski, Christina L; Walker, Lori A; Moulton, Karen S; Li, Marcella; Ostriker, Allison; Tucker, Rebecca; McKinsey, Timothy A; Churchill, Mair E A; Nemenoff, Raphael A; Weiser-Evans, Mary C M


    Vascular disease progression is associated with marked changes in vascular smooth muscle cell (SMC) phenotype and function. SMC contractile gene expression and, thus differentiation, is under direct transcriptional control by the transcription factor, serum response factor (SRF); however, the mechanisms dynamically regulating SMC phenotype are not fully defined. Here we report that the lipid and protein phosphatase, PTEN, has a novel role in the nucleus by functioning as an indispensible regulator with SRF to maintain the differentiated SM phenotype. PTEN interacts with the N-terminal domain of SRF and PTEN-SRF interaction promotes SRF binding to essential promoter elements in SM-specific genes. Factors inducing phenotypic switching promote loss of nuclear PTEN through nucleo-cytoplasmic translocation resulting in reduced myogenically active SRF, but enhanced SRF activity on target genes involved in proliferation. Overall decreased expression of PTEN was observed in intimal SMCs of human atherosclerotic lesions underlying the potential clinical importance of these findings. PMID:26940659

  16. Cavity magnomechanics.


    Zhang, Xufeng; Zou, Chang-Ling; Jiang, Liang; Tang, Hong X


    A dielectric body couples with electromagnetic fields through radiation pressure and electrostrictive forces, which mediate phonon-photon coupling in cavity optomechanics. In a magnetic medium, according to the Korteweg-Helmholtz formula, which describes the electromagnetic force density acting on a medium, magneostrictive forces should arise and lead to phonon-magnon interaction. We report such a coupled phonon-magnon system based on ferrimagnetic spheres, which we term as cavity magnomechanics, by analogy to cavity optomechanics. Coherent phonon-magnon interactions, including electromagnetically induced transparency and absorption, are demonstrated. Because of the strong hybridization of magnon and microwave photon modes and their high tunability, our platform exhibits new features including parametric amplification of magnons and phonons, triple-resonant photon-magnon-phonon coupling, and phonon lasing. Our work demonstrates the fundamental principle of cavity magnomechanics and its application as a new information transduction platform based on coherent coupling between photons, phonons, and magnons. PMID:27034983

  17. Cavity magnomechanics

    PubMed Central

    Zhang, Xufeng; Zou, Chang-Ling; Jiang, Liang; Tang, Hong X.


    A dielectric body couples with electromagnetic fields through radiation pressure and electrostrictive forces, which mediate phonon-photon coupling in cavity optomechanics. In a magnetic medium, according to the Korteweg-Helmholtz formula, which describes the electromagnetic force density acting on a medium, magneostrictive forces should arise and lead to phonon-magnon interaction. We report such a coupled phonon-magnon system based on ferrimagnetic spheres, which we term as cavity magnomechanics, by analogy to cavity optomechanics. Coherent phonon-magnon interactions, including electromagnetically induced transparency and absorption, are demonstrated. Because of the strong hybridization of magnon and microwave photon modes and their high tunability, our platform exhibits new features including parametric amplification of magnons and phonons, triple-resonant photon-magnon-phonon coupling, and phonon lasing. Our work demonstrates the fundamental principle of cavity magnomechanics and its application as a new information transduction platform based on coherent coupling between photons, phonons, and magnons. PMID:27034983

  18. Endothelial depletion of murine SRF/MRTF provokes intracerebral hemorrhagic stroke

    PubMed Central

    Weinl, Christine; Castaneda Vega, Salvador; Riehle, Heidemarie; Stritt, Christine; Calaminus, Carsten; Wolburg, Hartwig; Mauel, Susanne; Breithaupt, Angele; Gruber, Achim D.; Wasylyk, Bohdan; Olson, Eric N.; Adams, Ralf H.; Pichler, Bernd J.; Nordheim, Alfred


    Intracerebral hemorrhagic stroke and vascular dementia are age- and hypertension-associated manifestations of human cerebral small vessel disease (SVD). Cerebral microvessels are formed by endothelial cells (ECs), which are connected through tight junctions, adherens junctions, and stabilizing basement membrane structures. These endothelial connections ensure both vessel stability and blood–brain barrier (BBB) functions, the latter enabling selective exchange of ions, bioactive molecules, and cells between the bloodstream and brain tissue. SrfiECKO mice, permitting conditional EC-specific depletion of the transcription factor Serum Response Factor (SRF), suffer from loss of BBB integrity and intracerebral hemorrhaging. Cerebral microbleeds and larger hemorrhages developed upon postnatal and adult depletion of either SRF or its cofactors Myocardin Related Transcription Factor (MRTF-A/-B), revealing essential requirements of ongoing SRF/MRTF activity for maintenance of cerebral small vessel integrity. In vivo magnetic resonance imaging allowed detection, localization, and time-resolved quantification of BBB permeability and hemorrhage formation in SrfiECKO brains. At the molecular level, direct and indirect SRF/MRTF target genes, encoding structural components of tight junctions (Claudins and ZO proteins), adherens junctions (VE-cadherin, α-Actinin), and the basement membrane (Collagen IV), were down-regulated upon SRF depletion. These results identify SRF and its MRTF cofactors as major transcriptional regulators of EC junctional stability, guaranteeing physiological functions of the cerebral microvasculature. We hypothesize that impairments in SRF/MRTF activity contribute to human SVD pathology. PMID:26221020

  19. Increasing output power of an 850 MHz tetrode with a floating-deck modulator

    SciTech Connect

    Rees, D.; Friedrichs, C.


    Designers of high-power amplifiers generally regard the region above 300 MHz as a domain dominated by velocity-modulated (klystron/TWT) devices. However, as the power requirements diminish, there are attractive alternatives. The high-power 850-MHz requirements of the ground test accelerator (GTA) program can be filled by 1-MW klystrons, but it would be more efficient to use a lower-power device for a 50-kW requirement. To meet the 850-MHz medium-power requirements, Los Alamos National Laboratory is developing an 850-MHz tetrode amplifier. These amplifiers will provide rf power to the momentum compactor and bunch rotator cavities of the GTA. Available tubes provide only a limited safety margin for a low-risk design at the power levels and duty factor required for GTA cavities. At 850 MHz, the output power capability of available tubes is reduced because of transit time effects and limited anode voltage holdoff. Pulsing the anode of the output tetrode amplifier will allow higher output power with minimum design risk. A floating-deck modulator acts as a high-voltage/high-current switch, so voltage is applied to the anode of the gridded tube only during the rf pulse. The anode voltage holdoff capability of the tube is substantially enhanced by operating in this mode. This paper will describe the design of the floating deck modulator and its impact on the design risk of the 850-MHz tetrode amplifier.


    SciTech Connect

    Kang, Yoon W; Broyles, Michael R; Crofford, Mark T; Geng, Xiaosong; Kim, Sang-Ho; Lee, Sung-Woo; Phibbs, Curtis L; Shin, Ki; Strong, William Herb


    Qualification of the superconducting radio-frequency (SRF) cavities in the cryomodules for the accelerating performance needs to be done through high power processing. A four-way waveguide power distribution system with independent control of power outputs has been being developed for testing the multi-cavity cryomodules for the SNS linac. SNS is employing two types of cryomodules: one type with three medium beta six-cell cavities and the other with four high beta six-cell cavities. The cryomodule that is being manufactured as a spare and the new crymodules for the future power upgrade project (PUP) of SNS will be high beta types. The four-way power distribution with independently controlled power outputs was considered useful for powering all cavities at the same time with a klystron amplifier since the SNS test facility was configured for a single klystron operation. Since certain interaction between the cavities under severe field emission was suspected in existing cryomodules, this type of high power test can be valuable for characterization of SRF cavities. By implementing a vector modulator at each arm of the splitting system, the amplitudes and the phases of RF outputs can be controlled independently. This paper discusses the present status of the development.

  1. First high power pulsed tests of a dressed 325 MHz superconducting single spoke resonator at Fermilab

    SciTech Connect

    Madrak, R.; Branlard, J.; Chase, B.; Darve, C.; Joireman, P.; Khabiboulline, T.; Mukherjee, A.; Nicol, T.; Peoples-Evans, E.; Peterson, D.; Pischalnikov, Y.; /Fermilab


    In the recently commissioned superconducting RF cavity test facility at Fermilab (SCTF), a 325 MHz, {beta} = 0.22 superconducting single-spoke resonator (SSR1) has been tested for the first time with its input power coupler. Previously, this cavity had been tested CW with a low power, high Q{sub ext} test coupler; first as a bare cavity in the Fermilab Vertical Test Stand and then fully dressed in the SCTF. For the tests described here, the design input coupler with Q{sub ext} {approx} 10{sup 6} was used. Pulsed power was provided by a Toshiba E3740A 2.5 MW klystron.

  2. Precision vector control of a superconducting RF cavity driven by an injection locked magnetron

    SciTech Connect

    Chase, Brian; Pasquinelli, Ralph; Cullerton, Ed; Varghese, Philip


    The technique presented in this paper enables the regulation of both radio frequency amplitude and phase in narrow band devices such as a Superconducting RF (SRF) cavity driven by constant power output devices i.e. magnetrons [1]. The ability to use low cost high efficiency magnetrons for accelerator RF power systems, with tight vector regulation, presents a substantial cost savings in both construction and operating costs - compared to current RF power system technology. An operating CW system at 2.45 GHz has been experimentally developed. Vector control of an injection locked magnetron has been extensively tested and characterized with a SRF cavity as the load. Amplitude dynamic range of 30 dB, amplitude stability of 0.3% r.m.s, and phase stability of 0.26 degrees r.m.s. has been demonstrated.

  3. Surface Science Laboratory for Studying the Surfaces of Superconducting Radio Frequency Cavities

    SciTech Connect

    Andy Wu


    A Surface Science Laboratory (SSL) has been established at JLab to study surfaces relevant to superconducting radio frequency (SRF) cavities. Current operational facilities include a scanning electron microscope equipped with energy dispersive x-ray analysis, a secondary ion mass spectrometry, a metallographic optical microscope, a transmission electron microscope, a high precision and large scan area 3-D profilometer, a scanning field emission microscope, and a fully equipped sample preparation room. A scanning Auger microscope is being commissioned, and will be available for routine usage soon. Results from typical examples of the R&D projects on SRF cavities that were supported in the past through the use of the facilities in the SSL will be briefly reported.

  4. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian


    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  5. Nd3+, Y3+-codoped SrF2 laser ceramics

    NASA Astrophysics Data System (ADS)

    Li, Weiwei; Mei, Bingchu; Song, Jinghong


    0.15 at.% Nd3+, 5 at.% Y3+-codoped SrF2 laser ceramic based on single crystal was prepared by extensive plastic deformation. Microstructure, optical and laser properties of the Nd3+, Y3+:SrF2 ceramic were investigated. The lasing of Nd3+, Y3+-codoped SrF2 ceramics with diode pumping have been observed and true CW laser operation around 1057 nm and 1050 nm was obtained with a slope efficiency of 31.9%. In particular, the fracture toughness of the ceramic is 0.98 MPa m1/2, which is approximately two times higher than that of single crystal.

  6. Ion Exchange Testing with SRF Resin FY 2012

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Peterson, Reid A.


    Ion exchange using spherical resorcinol-formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection (DOE-ORP) for use in the Pretreatment Facility (PTF) of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in at-tank deployment. Numerous studies have shown SRF resin to be effective for removing 137Cs from a wide variety of actual and simulated tank waste supernatants (Adamson et al. 2006; Blanchard et al. 2008; Burgeson et al. 2004; Duignan and Nash 2009; Fiskum et al. 2006a; Fiskum et al. 2006b; Fiskum et al. 2006c; Fiskum et al. 2007; Hassan and Adu-Wusu 2003; King et al. 2004; Nash et al. 2006). Prior work at the Pacific Northwest National Laboratory (PNNL) has focused primarily on the loading behavior for 4 to 6 M Na solutions at 25 to 45°C. Recent proposed changes to the WTP ion exchange process baseline indicate that loading may include a broader range of sodium molarities (0.1 to 8 M) and higher temperatures (50°C) to alleviate post-filtration precipitation issues. This report discusses ion exchange loading kinetics testing activities performed in accordance with Test Plan TP-WTPSP-002, Rev. 3.01, which was prepared and approved in response to the Test Specification 24590-PTF-TSP-RT-09-002, Rev. 0 (Lehrman 2010) and Test Exception 24590-PTF-TEF-RT-11-00003, Rev. 0 (Meehan 2011). This testing focused on column tests evaluating the impact of elevated temperature on resin degradation over an extended period of time and batch contacts evaluating the impact on Cs loading over a broad range of sodium concentrations (0.1 to 5 M). These changes may be required to alleviate post-filtration precipitation issues and broaden the data range of SRF resin loading under the conditions expected with the new equipment and process changes.

  7. Springback in Deep Drawn High Purity Niobium for Superconductor Cavities

    SciTech Connect

    Ganapati Rao Myneni; Peter Kneisel


    Superconducting radio frequency (SRF) cavities made from deep drawn high-purity niobium have become a popular approach for the design of particle accelerators. A number of current accelerators use this technology and it is a leading candidate for future designs. The development of this technology has required significant advances in many scientific fields including metallurgy, high vacuum physics, surface science, and forming. Recently proposed modifications to the current process for fabrication of these cavities has resulted in increased concern about the distribution of deformation, residual stress patterns, and springback. This presentation will report on the findings of a recently initiated program to study plastic flow and springback in the fabrication of these cavities and the influence of metallurgical variables including grain size and impurity content.


    SciTech Connect

    Pattalwar, S. M.; Bate, R.


    ALICE, a prototype accelerator developed at the Daresbury laboratory UK, has successfully demonstrated the energy-recovery technique by circulating the electron beam to more than 20 MeV. At the heart of ALICE is a superconducting linac operating at 2 K. At high average-current operation the performance of Superconducting RF (SRF) cavities suffer from instabilities due to the generation of higher-order modes (HOM) as well as microphonics. HOMs are extracted out of the cavities using HOM absorbers operating at 80 K. This, however, increases the demand for cooling power at intermediate temperatures, i.e. at 80 K and 5 K, by more than an order of magnitude.In order to provide this extra cooling capacity with gaseous helium a new cryogenic system, 'COOL-IT,'(System for cooling to intermediate temperatures) is being developed. It will provide two streams of helium gases at 80 K and 5 K. COOL-IT uses a set of heat exchangers cooled by liquid helium and liquid nitrogen to generate two cold streams. It will be integrated into the existing cryo-system for ALICE for automatic operation. This paper describes the COOL-IT system in detail.

  9. Conceptual design of the 26. 7 MHz RF system for RHIC

    SciTech Connect

    Rose, J.; Deng, D.P.; McKenzie-Wilson, R.; Pirkl, W.; Ratti, A.


    The 26.7 MHz (harmonic No. h=342) RF system will be used to capture the injected bunched beam from the AGS and accelerate it to a kinetic energy of up to 250 GeV for protons; 100 GeV/u for gold ions. All ions except protons cross transition, and are finally transferred to a storage RF system working at 196 MHz. Each RHIC ring will be provided with two single-ended capacitively loaded quarter-wave cavities; each of these can be dynamically tuned by 100 kHz to compensate for the change in speed of the beam, and can deliver at least 200 kV voltage. A 100 kW tetrode amplifier with local RF feedback is directly coupled to the cavity to minimize phase delay. Prototypes of cavity and amplifier have been built and first test results are presented.

  10. Conceptual design of the 26.7 MHz RF system for RHIC

    SciTech Connect

    Rose, J.; Deng, D.P.; McKenzie-Wilson, R.; Pirkl, W.; Ratti, A.


    The 26.7 MHz (harmonic No. h=342) RF system will be used to capture the injected bunched beam from the AGS and accelerate it to a kinetic energy of up to 250 GeV for protons; 100 GeV/u for gold ions. All ions except protons cross transition, and are finally transferred to a storage RF system working at 196 MHz. Each RHIC ring will be provided with two single-ended capacitively loaded quarter-wave cavities; each of these can be dynamically tuned by 100 kHz to compensate for the change in speed of the beam, and can deliver at least 200 kV voltage. A 100 kW tetrode amplifier with local RF feedback is directly coupled to the cavity to minimize phase delay. Prototypes of cavity and amplifier have been built and first test results are presented.

  11. Cryogenic testing of the 2.1 GHz five-cell superconducting RF cavity with a photonic band gap coupler cell

    NASA Astrophysics Data System (ADS)

    Arsenyev, Sergey A.; Temkin, Richard J.; Haynes, W. Brian; Shchegolkov, Dmitry Yu.; Simakov, Evgenya I.; Tajima, Tsuyoshi; Boulware, Chase H.; Grimm, Terrence L.; Rogacki, Adam R.


    We present results from cryogenic tests of the multi-cell superconducting radio frequency (SRF) cavity with a photonic band gap (PBG) coupler cell. Achieving high average beam currents is particularly desirable for future light sources and particle colliders based on SRF energy-recovery-linacs (ERLs). Beam current in ERLs is limited by the beam break-up instability, caused by parasitic higher order modes (HOMs) interacting with the beam in accelerating cavities. A PBG cell incorporated in an accelerating cavity can reduce the negative effect of HOMs by providing a frequency selective damping mechanism, thus allowing significantly higher beam currents. The multi-cell cavity was designed and fabricated of niobium. Two cryogenic (vertical) tests were conducted. The high unloaded Q-factor was demonstrated at a temperature of 4.2 K at accelerating gradients up to 3 MV/m. The measured value of the unloaded Q-factor was 1.55 × 108, in agreement with prediction.

  12. Fiber Optic Based Thermometry System for Superconducting RF Cavities

    SciTech Connect

    Kochergin, Vladimir


    Thermometry is recognized as the best technique to identify and characterize losses in SRF cavities. The most widely used and reliable apparatus for temperature mapping at cryogenic temperatures is based on carbon resistors (RTDs). The use of this technology on multi-cell cavities is inconvenient due to the very large number of sensors required to obtain sufficient spatial resolution. Recent developments make feasible the use of multiplexible fiber optic sensors for highly distributed temperature measurements. However, sensitivity of multiplexible cryogenic temperature sensors was found extending only to 12K at best and thus was not sufficient for SRF cavity thermometry. During the course of the project the team of MicroXact, JLab and Virginia Tech developed and demonstrated the multiplexible fiber optic sensor with adequate response below 20K. The demonstrated temperature resolution is by at least a factor of 60 better than that of the best multiplexible fiber optic temperature sensors reported to date. The clear path toward at least 10times better temperature resolution is shown. The first to date temperature distribution measurements with ~2.5mm spatial resolution was done with fiber optic sensors at 2K to4K temperatures. The repeatability and accuracy of the sensors were verified only at 183K, but at this temperature both parameters significantly exceeded the state of the art. The results of this work are expected to find a wide range of applications, since the results are enabling the whole new testing capabilities, not accessible before.

  13. The ESS spoke cavity cryomodules

    SciTech Connect

    Bousson, Sebastien; Duthil, Patxi; Reynet, Denis; Thermeau, Jean-Pierre


    The European Spallation Source (ESS) is a multi-disciplinary research centre under design and construction in Lund, Sweden. This new facility is funded by a collaboration of 17 European countries and is expected to be up to 30 times brighter than today’s leading facilities and neutron sources. The ESS will enable new opportunities for researchers in the fields of life sciences, energy, environmental technology, cultural heritage and fundamental physics. A 5 MW long pulse proton accelerator is used to reach this goal. The pulsed length is 2.86 ms, the repetition frequency is 14 Hz (4 % duty cycle), and the beam current is 62.5 mA. It is composed of one string of spoke cavity cryomodule and two strings of elliptical cavity cryomodules. This paper introduces the thermo-mechanical design and expected operation of the ESS spoke cavity cryomodules. These cryomodules contain two double spoke bulk Niobium cavities operating at 2 K and at a frequency of 352.21 MHz. The superconducting section of the Spoke Linac accelerates the beam from 90 MeV to 220 MeV. A Spoke Cavity Cryomodule Technology Demonstrator will be built and tested in order to validate the ESS series production.

  14. The ESS elliptical cavity cryomodules

    NASA Astrophysics Data System (ADS)

    Darve, Christine; Bosland, Pierre; Devanz, Guillaume; Olivier, Gilles; Renard, Bertrand; Thermeau, Jean-Pierre


    The European Spallation Source (ESS) is a multi-disciplinary research centre under design and construction in Lund, Sweden. This new facility is funded by a collaboration of 17 European countries and is expected to be up to 30 times brighter than today's leading facilities and neutron sources. The ESS will enable new opportunities for researchers in the fields of life sciences, energy, environmental technology, cultural heritage and fundamental physics. A 5 MW long pulse proton accelerator is used to reach this goal. The pulsed length is 2.86 ms, the repetition frequency is 14 Hz (4 % duty cycle), and the beam current is 62.5 mA. The superconducting section of the Linac accelerates the beam from 80 MeV to 2.0 GeV. It is composed of one string of spoke cavity cryomodule and two strings of elliptical cavity cryomodules. These cryomodules contain four elliptical Niobium cavities operating at 2 K and at a frequency of 704.42 MHz. This paper introduces the thermo-mechanical design, the prototyping and the expected operation of the ESS elliptical cavity cryomodules. An Elliptical Cavity Cryomodule Technology Demonstrator (ECCTD) will be built and tested in order to validate the ESS series production.

  15. The ESS spoke cavity cryomodules

    NASA Astrophysics Data System (ADS)

    Bousson, Sebastien; Darve, Christine; Duthil, Patxi; Elias, Nuno; Molloy, Steve; Reynet, Denis; Thermeau, Jean-Pierre


    The European Spallation Source (ESS) is a multi-disciplinary research centre under design and construction in Lund, Sweden. This new facility is funded by a collaboration of 17 European countries and is expected to be up to 30 times brighter than today's leading facilities and neutron sources. The ESS will enable new opportunities for researchers in the fields of life sciences, energy, environmental technology, cultural heritage and fundamental physics. A 5 MW long pulse proton accelerator is used to reach this goal. The pulsed length is 2.86 ms, the repetition frequency is 14 Hz (4 % duty cycle), and the beam current is 62.5 mA. It is composed of one string of spoke cavity cryomodule and two strings of elliptical cavity cryomodules. This paper introduces the thermo-mechanical design and expected operation of the ESS spoke cavity cryomodules. These cryomodules contain two double spoke bulk Niobium cavities operating at 2 K and at a frequency of 352.21 MHz. The superconducting section of the Spoke Linac accelerates the beam from 90 MeV to 220 MeV. A Spoke Cavity Cryomodule Technology Demonstrator will be built and tested in order to validate the ESS series production.

  16. The ESS elliptical cavity cryomodules

    SciTech Connect

    Darve, Christine; Bosland, Pierre; Devanz, Guillaume; Renard, Bertrand; Olivier, Gilles; Thermeau, Jean-Pierre


    The European Spallation Source (ESS) is a multi-disciplinary research centre under design and construction in Lund, Sweden. This new facility is funded by a collaboration of 17 European countries and is expected to be up to 30 times brighter than today’s leading facilities and neutron sources. The ESS will enable new opportunities for researchers in the fields of life sciences, energy, environmental technology, cultural heritage and fundamental physics. A 5 MW long pulse proton accelerator is used to reach this goal. The pulsed length is 2.86 ms, the repetition frequency is 14 Hz (4 % duty cycle), and the beam current is 62.5 mA. The superconducting section of the Linac accelerates the beam from 80 MeV to 2.0 GeV. It is composed of one string of spoke cavity cryomodule and two strings of elliptical cavity cryomodules. These cryomodules contain four elliptical Niobium cavities operating at 2 K and at a frequency of 704.42 MHz. This paper introduces the thermo-mechanical design, the prototyping and the expected operation of the ESS elliptical cavity cryomodules. An Elliptical Cavity Cryomodule Technology Demonstrator (ECCTD) will be built and tested in order to validate the ESS series production.

  17. Project-X Srf, and Very Large Power Stations

    NASA Astrophysics Data System (ADS)

    Ankenbrandt, Charles M.; Johnson, Rolland P.; Popovic, Milorad


    We seek to develop accelerator-driven subcritical (ADS) nuclear power stations operating at more than 5 to 10 GW in an inherently safe region below criticality, generating no greenhouse gases, producing minimal nuclear waste and no byproducts that are useful to rogue nations or terrorists, incinerating waste from conventional nuclear reactors, and efficiently using abundant thorium fuel that does not need enrichment. First, the feasibility of the accelerator technology must be demonstrated. Fermilab is developing concepts for Project X, which would use a superconducting RF (SRF) linear proton accelerator to provide beams for particle physics at the intensity and energy frontiers. We propose to extend this linac design to serve as a prototype for a practical accelerator that can drive several ADS reactors at once and also provide beams for reactor development.


    SciTech Connect

    Robert Rimmer


    Steady development in SRF accelerator technology combined with the success of large scale installations such as CEBAF at Jefferson Laboratory and the SNS Linac at ORNL gives credibility to the concept of very high average power CW machines for light sources or Proton drivers. Such machines would be powerful tools for discovery science in themselves but could also pave the way to reliable cost effective drivers for such applications as neutrino factories, an energy-frontier muon collider, nuclear waste transmutation or accelerator driven subcritical reactors for energy production. In contrast to machines such as ILC that need maximum accelerating gradient, the challenges in these machines are mainly in efficiency, reliability, beam stability, beam loss and of course cost. In this paper the present state of the art is briefly reviewed and options for a multi-GeV, multi-MW CW linac are discussed.

  19. Vibrational Stability of SRF Accelerator Test Facility at Fermilab

    SciTech Connect

    McGee, M.W.; Volk, J.T.; /Fermilab


    Recently developed, the Superconducting Radio Frequency (SRF) Accelerator Test Facilities at Fermilab support the International Linear Collider (ILC), High Intensity Neutrino Source (HINS), a new high intensity injector (Project X) and other future machines. These facilities; Meson Detector Building (MDB) and New Muon Lab (NML) have very different foundations, structures, relative elevations with respect to grade level and surrounding soil composition. Also, there are differences in the operating equipment and their proximity to the primary machine. All the future machines have stringent operational stability requirements. The present study examines both near-field and ambient vibration in order to develop an understanding of the potential contribution of near-field sources (e.g. compressors, ultra-high and standard vacuum equipment, klystrons, modulators, utility fans and pumps) and distant noise sources to the overall system displacements. Facility vibration measurement results and methods of possible isolation from noise sources are presented and discussed.

  20. Study of AC/RF properties of SRF ingot niobium

    SciTech Connect

    Dhakal, Pashupati; Tsindlekht, Menachem I; Genkin, Valery M; Ciovati, Gianluigi; Myneni, Ganapati Rao


    In an attempt to correlate the performance of superconducting radiofrequency cavities made of niobium with the superconducting properties, we present the results of the magnetization and ac susceptibility of the niobium used in the superconducting radiofrequency cavity fabrication. The samples were subjected to buffer chemical polishing (BCP) surface and high temperature heat treatments, typically applied to the cavities fabrications. The analysis of the results show the different surface and bulk ac conductivity for the samples subjected to BCP and heat treatment. Furthermore, the RF surface impedance is measured on the sample using a TE011 microwave cavity for a comparison to the low frequency measurements.

  1. Low and Intermediate Beta Cavity Design - A Tutorial

    SciTech Connect

    Jean Delayen


    The design of low-velocity superconducting structures has been an active area of the superconducting rf (srf) technology for more than 3 decades. More recently, with the growing interest in medium-energy ion and proton accelerators, a sustained world-wide effort has been directed toward the development of the superconducting structures for the intermediate velocity region. In this tutorial we address the design issues that are specific to low- and medium-velocity superconducting cavities. Simple electrostatic and electrodynamic models based on transmission lines are presented, and scaling laws are derived.

  2. Physical and Mechanical Properties of Niobium for SRF Science and Technology

    SciTech Connect

    Ganapati Rao Myneni


    Optimized mechanical and physical properties of high purity niobium are crucial for obtaining high performance SRF particle beam accelerator structures consistently. This paper summarizes these important material properties for both high purity polycrystalline and single crystal niobium.

  3. Calculations of HOMs and coupled bunch instabilities due to the RHIC rf cavities

    SciTech Connect

    Rose, J.


    The cavities for the two RHIC rf systems have been defined, a 26.7 MHz cavity developed by the RHIC rf group and the well documented CERN SPS 200 MHz cavity tuned to 196.1 MHz for operation in RHIC. Calculations of the shunt impedances and Q`s of the higher order modes (HOMs) are summarized along with beadpull measurements of R/Q of selected modes. Estimates of coupled bunch instability growth rates are calculated with both analytical techniques and using the code ZAP and used to make projections of mode damping requirements.

  4. Thermal design studies in superconducting rf cavities: Phonon peak and Kapitza conductance

    NASA Astrophysics Data System (ADS)

    Aizaz, A.; Grimm, T. L.; Wright, N. T.


    Thermal design studies of superconducting radio frequency (SRF) cavities involve two thermal parameters, namely the temperature dependent thermal conductivity of Nb at low temperatures and the heat transfer coefficient at the Nb-He II interface, commonly known as the Kapitza conductance. During the fabrication process of the SRF cavities, Nb sheet is plastically deformed through a deep drawing process to obtain the desired shape. The effect of plastic deformation on low temperature thermal conductivity as well as Kapitza conductance has been studied experimentally. Strain induced during the plastic deformation process reduces the thermal conductivity in its phonon transmission regime (disappearance of phonon peak) by 80%, which may explain the performance limitations of the defect-free SRF cavities during their high field operations. Low temperature annealing of the deformed Nb sample could not recover the phonon peak. However, moderate temperature annealing during the titanification process recovered the phonon peak in the thermal conductivity curve. Kapitza conductance measurements for the Nb-He II interface for various surface topologies have also been carried out before and after the annealing. These measurements reveal consistently increased Kapitza conductance after the annealing process was carried out in the two temperature regimes.

  5. RF cavity with co -based amorphous core

    NASA Astrophysics Data System (ADS)

    Kanazawa, M.; Misu, T.; Sugiura, A.; Sato, K.; Katsuki, K.; Kusaka, T.


    A compact cavity for acceleration has been developed with cobalt-based amorphous cores, which is a part of research and development (R&D) for a synchrotron in a cancer therapy facility. This core has high permeability that enables the cavity length to be made short, and its low Q-value of about 0.5 permits an RF system without tuning control of the cavity. The developed acceleration cavity consists of two acceleration gaps; at both sides of the gap there are quarter-wave coaxial resonators. The total length of the cavity is as short as 1.5 m and the inner diameter of the vacuum chamber is 190 mm. Considering the requirements for easy operation and maintenance, a transistor RF amplifier was used instead of the commonly used tetrode in the final stage. Each resonator has a maximum impedance of 400 Ω at 2 MHz, and a 1:9 impedance transformer has been attached to use a solid state amplifier of 50 Ω output impedance. In the frequency range from 0.4 to 8 MHz, an acceleration voltage of more than 4 kV can be obtained with a total input RF power of 8 kW. In this paper the structure of the cavity, the obtained core impedance, and their performances under high-power test are presented.

  6. Microwave induced plasma discharge in multi-cell superconducting radio-frequency cavity

    SciTech Connect

    Ahmed, Shahid; Mammosser, John D.


    A R&D effort for in situ cleaning of 1.5 GHz Superconducting Radio Frequency (SRF) cavities at room temperature using the plasma processing technique has been initiated at Jefferson Lab. This is a step toward the cleaning of cryomodules installed in the Continuous Electron Beam Accelerator Facility (CEBAF). For this purpose, we have developed an understanding of plasma discharge in a 5-cell CEBAF-type SRF cavity having configurations similar to those in the main accelerator. The focus of this study involves the detailed investigations of developing a plasma discharge inside the cavity volume and avoids the breakdown condition in the vicinity of the ceramic RF window. A plasma discharge of the gas mixture Ar–O{sub 2} (90%:10%) can be established inside the cavity volume by the excitation of a resonant 4π/5 TM{sub 010}-mode driven by a klystron. The absence of any external magnetic field for generating the plasma is suitable for cleaning cavities installed in a complex cryomodule assembly. The procedures developed in these experimental investigations can be applied to any complex cavity structure. Details of these experimental measurements and the observations are discussed in the paper.

  7. Microwave induced plasma discharge in multi-cell superconducting radio-frequency cavity

    NASA Astrophysics Data System (ADS)

    Ahmed, Shahid; Mammosser, John D.


    A R&D effort for in situ cleaning of 1.5 GHz Superconducting Radio Frequency (SRF) cavities at room temperature using the plasma processing technique has been initiated at Jefferson Lab. This is a step toward the cleaning of cryomodules installed in the Continuous Electron Beam Accelerator Facility (CEBAF). For this purpose, we have developed an understanding of plasma discharge in a 5-cell CEBAF-type SRF cavity having configurations similar to those in the main accelerator. The focus of this study involves the detailed investigations of developing a plasma discharge inside the cavity volume and avoids the breakdown condition in the vicinity of the ceramic RF window. A plasma discharge of the gas mixture Ar-O2 (90%:10%) can be established inside the cavity volume by the excitation of a resonant 4π/5 TM010-mode driven by a klystron. The absence of any external magnetic field for generating the plasma is suitable for cleaning cavities installed in a complex cryomodule assembly. The procedures developed in these experimental investigations can be applied to any complex cavity structure. Details of these experimental measurements and the observations are discussed in the paper.

  8. Microwave induced plasma discharge in multi-cell superconducting radio-frequency cavity.


    Ahmed, Shahid; Mammosser, John D


    A R&D effort for in situ cleaning of 1.5 GHz Superconducting Radio Frequency (SRF) cavities at room temperature using the plasma processing technique has been initiated at Jefferson Lab. This is a step toward the cleaning of cryomodules installed in the Continuous Electron Beam Accelerator Facility (CEBAF). For this purpose, we have developed an understanding of plasma discharge in a 5-cell CEBAF-type SRF cavity having configurations similar to those in the main accelerator. The focus of this study involves the detailed investigations of developing a plasma discharge inside the cavity volume and avoids the breakdown condition in the vicinity of the ceramic RF window. A plasma discharge of the gas mixture Ar-O2 (90%:10%) can be established inside the cavity volume by the excitation of a resonant 4π/5 TM010-mode driven by a klystron. The absence of any external magnetic field for generating the plasma is suitable for cleaning cavities installed in a complex cryomodule assembly. The procedures developed in these experimental investigations can be applied to any complex cavity structure. Details of these experimental measurements and the observations are discussed in the paper. PMID:26233368

  9. Design and performance of a new induction furnace for heat treatment of superconducting radiofrequency niobium cavities

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Myneni, Ganapati Rao; Rigby, Wayne; Wallace, John


    Superconducting radio frequency (SRF) cavities made of high purity niobium (Nb) are the building blocks of many modern particle accelerators. The fabrication process includes several cycles of chemical and heat treatment at low ({approx}120 Degree-Sign C) and high ({approx}800 Degree-Sign C) temperatures. In this contribution, we describe the design and performance of an ultra-high-vacuum furnace which uses an induction heating system to heat treat SRF cavities. Cavities are heated by radiation from the Nb susceptor. By using an all-niobium hot zone, contamination of the Nb cavity by foreign elements during heat treatment is minimized and allows avoiding subsequent chemical etching. The furnace was operated up to 1400 Degree-Sign C with a maximum pressure of {approx}1 Multiplication-Sign 10{sup -5} Torr and the maximum achievable temperature is estimated to be higher than 2000 Degree-Sign C. Initial results on the performance of a single cell 1.5 GHz cavity made of ingot Nb heat treated at 1200 Degree-Sign C using this new induction furnace and without subsequent chemical etching showed a reduction of the RF losses by a factor of {approx}2 compared to cavities made of fine-grain Nb which underwent standard chemical and heat treatments.

  10. Design and performance of a new induction furnace for heat treatment of superconducting radiofrequency niobium cavities

    SciTech Connect

    Pashupati Dhakal, Gianluigi Ciovati, Wayne Rigby, John Wallace, Ganapati Rao Myneni


    Superconducting radio frequency (SRF) cavities made of high purity niobium (Nb) are the building blocks of many modern particle accelerators. The fabrication process includes several cycles of chemical and heat treatment at low ({approx}120 deg C) and high ({approx}800 deg C) temperatures. In this contribution, we describe the design and performance of an ultra-high-vacuum furnace which uses an induction heating system to heat treat SRF cavities. Cavities are heated by radiation from the Nb susceptor. By using an all-niobium hot zone, contamination of the Nb cavity by foreign elements during heat treatment is minimized and allows avoiding subsequent chemical etching. The furnace was operated up to 1400 deg C with a maximum pressure of {approx}1 x 10{sup -5} Torr and the maximum achievable temperature is estimated to be higher than 2000 deg C. Initial results on the performance of a single cell 1.5 GHz cavity made of ingot Nb heat treated at 1200 deg C using this new induction furnace and without subsequent chemical etching showed a reduction of the RF losses by a factor of {approx}2 compared to cavities made of fine-grain Nb which underwent standard chemical and heat treatments.

  11. Lorentz force detuning analysis of the Spallation Neutron Source (SNS) accelerating cavities.

    SciTech Connect

    Mitchell, R.R.; Matsumoto, K. Y.; Ciovati, G.; Davis, K.; Macha, K.; Sundelin, R. M.


    The Spallation Neutron Source (SNS) project incorporates a superconducting radio-frequency (SRF) accelerator for the final section of the pulsed mode linac. Cavities with geometrical {beta} values of {beta}=0.61 and {beta}=0.81 are utilized in the SRF section, and are constructed out of thin-walled niobium with stiffener rings welded between the cells near the iris. The welded titanium helium vessel and tuner assembly restrains the cavity beam tubes. Cavities with {beta} values less than one have relatively steep and flat side-walls making the cavities susceptible to Lorentz force detuning. In addition, the pulsed RF induces cyclic Lorentz pressures that mechanically excite the cavities, producing a dynamic Lorentz force detuning different from a continuous RF system. The amplitude of the dynamic detuning for a given cavity design is a function of the mechanical damping, stiffness of the tuner/helium vessel assembly, RF pulse profile, and the RF pulse rate. This paper presents analysis and testing results to date, and indicates areas where more investigation is required.

  12. A low noise 500 MHz frequency source

    NASA Astrophysics Data System (ADS)

    Vulcan, A.; Bloch, M.; Tanski, W.

    A low-noise signal source providing multiple 500 MHz and 400 MHz outputs is presented whose noise characteristics approach the thermal limit at frequencies spaced greater than 1 MHz from the carrier. The unit uses bulk and surface acoustic wave resonators to insure low phase noise and spurious outputs and is totally redundant for failsafe operation. The packaging concept minimizes subassembly interconnections and provides both physical and electrical independence of two redundant generators; package shielding insures minimum conducted and radiated susceptibility.

  13. An equivalent circuit model and power calculations for the APS SPX crab cavities.

    SciTech Connect

    Berenc, T. )


    An equivalent parallel resistor-inductor-capacitor (RLC) circuit with beam loading for a polarized TM110 dipole-mode cavity is developed and minimum radio-frequency (rf) generator requirements are calculated for the Advanced Photon Source (APS) short-pulse x-ray (SPX) superconducting rf (SRF) crab cavities. A beam-loaded circuit model for polarized TM110 mode crab cavities was derived. The single-cavity minimum steady-state required generator power has been determined for the APS SPX crab cavities for a storage ring current of 200mA DC current as a function of external Q for various vertical offsets including beam tilt and uncontrollable detuning. Calculations to aid machine protection considerations were given.

  14. RF cavity vacuum interlock system

    NASA Astrophysics Data System (ADS)

    Jordan, K.; Crawford, K.; Bundy, R.; Dylla, H. F.; Heckman, J.; Marshall, J.; Nichols, R.; Osullivan, S.; Preble, J.; Robb, J.


    The Continuous Electron Beam Accelerator Facility (CEBAF), a continuous wave (CW) 4 GeV Electron Accelerator is undergoing construction in Newport News, Virginia. When completed in 1994, the accelerator will be the largest installation of radio-frequency superconductivity. Production of cryomodules, the fundamental building block of the machine, has started. A cryomodule consists of four sets of pairs of 1497 MHz, 5 cell niobium cavities contained in separate helium vessels and mounted in a cryostat with appropriate end caps for helium supply and return. Beam vacuum of the cavities, the connecting beam piping, the waveguides, and the cryostat insulating vacuum are crucial to the performance of the machine. The design and initial experience of the vacuum systems for the first 2 1/4 cryomodules that makeup the 45 MEV injector are discussed.

  15. The IPNS RCS RF-system third cavity upgrade.

    SciTech Connect

    Middendorf, M.E.; Brumwell, F. R.; Dooling, J.C.; Lein, M. K.; McMichael, G. E.; Intense Pulsed Neutron Source


    The IPNS RCS is a rapid cycling synchrotron used to accelerate protons from 50 MeV to 450 MeV, 30 times per second. Currently, two single-gap, ferrite-loaded coaxial cavities, located 180 degrees apart, provide a total peak accelerating voltage of approximately 21 kV over the 2.2 MHz to 5.1 MHz revolution frequency band. An amplifier chain, which includes a 2 kW predriver, a 20 kW driver and a 100 kW final, drives each cavity. A third RF system, consisting of a cavity, cavity bias supply, and amplifier chain, is currently under construction. When complete, this upgrade will provide flexibility in operation that is expected to enhance reliability (i.e., three cavity operation at higher total accelerating voltage, three cavity operation at lower voltage per cavity, or two cavity operation with an on-line spare). In addition, the third cavity will provide an experimental station for second harmonic RF cavity studies. We report progress to date.

  16. 1.4-MHz repetition rate electro-optic Q-switched Nd:YVO4 laser.


    Horiuchi, Ryusuke; Adachi, Koji; Watanabe, Goro; Tei, Kazuyoku; Yamaguchi, Shigeru


    An electro-optic (EO) deflector was used for Q-switching of a laser cavity with a Nd-doped yttrium vanadate (Nd:YVO(4)), enabling a short pulse width and a high peak power to be achieved at a high repetition rate of over 1 MHz. The EO deflector has a low optical loss during Q-switching without polarizers and can be used to form a short laser cavity. A repetition rate of 1.4 MHz with a pulse width of 39 ns was achieved. An output power of 2.7 W was obtained at a pump power of 6.5 W. PMID:18852782

  17. Superconducting spoke cavities for high-velocity applications

    SciTech Connect

    Hopper, Christopher S.; Delayen, Jean R.


    To date, superconducting spoke cavities have been designed, developed, and tested for particle velocities up to {beta}{sub 0}~0.6, but there is a growing interest in possible applications of multispoke cavities for high-velocity applications. We have explored the design parameter space for low-frequency, high-velocity, double-spoke superconducting cavities in order to determine how each design parameter affects the electromagnetic properties, in particular the surface electromagnetic fields and the shunt impedance. We present detailed design for cavities operating at 325 and 352 MHz and optimized for {beta}{sub 0}~=0.82 and 1.

  18. Measurements of shielding effectiveness and cavity characteristics of airplanes

    NASA Astrophysics Data System (ADS)

    Hill, D. A.; Crawford, M. L.; Johnk, R. T.; Ondrejka, A. R.; Camell, D. G.


    We present measured data for shielding effectiveness, cavity Q, and cavity time constant of three small (twin-engine) airplanes for frequencies from 400 MHz to 18 GHz. Both CW and time-domain measurement methods were used, and the time-domain method yields higher values of cavity Q. Both methods yield Q values below a theoretical upper bound determined by window leakage losses. The measured shielding effectiveness is quite variable, but averages about 15 dB. The measured time constants are also variable and average about 15 ns. This short time constant is a result of the low Q of the aircraft cavities.

  19. Ion Exchange Temperature Testing with SRF Resin - 12088

    SciTech Connect

    Russell, R.L.; Rinehart, D.E.; Brown, G.N.; Peterson, R.A.


    Ion exchange using the Spherical Resorcinol-Formaldehyde (SRF) resin has been selected by the U.S. Department of Energy's Office of River Protection for use in the Pretreatment Facility of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in an at-tank deployment for removing Cs-137. Recent proposed changes to the WTP ion exchange process baseline indicate that higher temperatures (50 deg. C) to alleviate post-filtration precipitation issues prior to reaching the ion exchange columns may be required. Therefore, it is important to understand the behavior of SRF resin performance under the conditions expected with the new equipment and process changes. This research examined the impact of elevated temperature on resin loading and resin degradation during extended solution flow at elevated temperature (45 deg., 50 deg., 55 deg., 60 deg., 65 deg., 75 deg. C). Testing for extended times at elevated temperatures showed that the resin does degrade and loading capacity is reduced at and above 45 deg. C. Above 60 deg. C the resin appears to not load at all. It was observed that the resin disintegrated at 75 deg. C until not much was left and partially disintegrated at 65 deg. C, which caused the column to plug in both tests after ∼336 hours. The results indicate that WTP will lose resin loading capacity if the ion exchange process is performed above 25 deg. C, and the resin will disintegrate above 65 deg. C. Therefore, WTP will have a restricted operating range of temperatures to perform the ion exchange process with this resin. PNNL and WTP are currently evaluating the operating limits of the resin in further detail. Aging in 0.5 M HNO{sub 3} also caused the resin to lose capacity above 25 deg. C and to completely dissolve at 55 deg. C. Again, WTP will have a restricted operating range of temperatures when eluting the resin with nitric acid in order to maintain resin loading capacity and avoid disintegration of the resin

  20. Analysis of HOM Properties of Superconducting Parallel-Bar Deflecting/Crabbing Cavities

    SciTech Connect

    S.U. De Silva, J.R. Delayen


    The superconducting parallel-bar cavity is currently being considered for a number of deflecting and crabbing applications due to improved properties and compact design geometries. The 499 MHz deflecting cavity proposed for the Jefferson Lab 12 GeV upgrade and the 400 MHz crab cavity for the proposed LHC luminosity upgrade are two of the major applications. For high current applications the higher order modes must be damped to acceptable levels to eliminate any beam instabilities. The frequencies and R/Q of the HOMs and mode separation are evaluated and compared for different parallel-bar cavity designs.

  1. Expression of Human Frataxin Is Regulated by Transcription Factors SRF and TFAP2

    PubMed Central

    Li, Kuanyu; Singh, Anamika; Crooks, Daniel R.; Dai, Xiaoman; Cong, Zhuangzhuang; Pan, Liang; Ha, Dung; Rouault, Tracey A.


    Background Friedreich ataxia is an autosomal recessive neurodegenerative disease caused by reduced expression levels of the frataxin gene (FXN) due to expansion of triplet nucleotide GAA repeats in the first intron of FXN. Augmentation of frataxin expression levels in affected Friedreich ataxia patient tissues might substantially slow disease progression. Methodology/Principal Findings We utilized bioinformatic tools in conjunction with chromatin immunoprecipitation and electrophoretic mobility shift assays to identify transcription factors that influence transcription of the FXN gene. We found that the transcription factors SRF and TFAP2 bind directly to FXN promoter sequences. SRF and TFAP2 binding sequences in the FXN promoter enhanced transcription from luciferase constructs, while mutagenesis of the predicted SRF or TFAP2 binding sites significantly decreased FXN promoter activity. Further analysis demonstrated that robust SRF- and TFAP2-mediated transcriptional activity was dependent on a regulatory element, located immediately downstream of the first FXN exon. Finally, over-expression of either SRF or TFAP2 significantly increased frataxin mRNA and protein levels in HEK293 cells, and frataxin mRNA levels were also elevated in SH-SY5Y cells and in Friedreich ataxia patient lymphoblasts transfected with SRF or TFAP2. Conclusions/Significance We identified two transcription factors, SRF and TFAP2, as well as an intronic element encompassing EGR3-like sequence, that work together to regulate expression of the FXN gene. By providing new mechanistic insights into the molecular factors influencing frataxin expression, our results should aid in the discovery of new therapeutic targets for the treatment of Friedreich ataxia. PMID:20808827

  2. Short-cavity squeezing in barium

    NASA Technical Reports Server (NTRS)

    Hope, D. M.; Bachor, H-A.; Manson, P. J.; Mcclelland, D. E.


    Broadband phase sensitive noise and squeezing were experimentally observed in a system of barium atoms interacting with a single mode of a short optical cavity. Squeezing of 13 +/- 3 percent was observed. A maximum possible squeezing of 45 +/- 8 percent could be inferred for out experimental conditions, after correction for measured loss factors. Noise reductions below the quantum limit were found over a range of detection frequencies 60-170 MHz and were best for high cavity transmission and large optical depths. The amount of squeezing observed is consistent with theoretical predictions from a full quantum statistical model of the system.

  3. Dysbindin is a potent inducer of RhoA–SRF-mediated cardiomyocyte hypertrophy

    PubMed Central

    Rangrez, Ashraf Yusuf; Bernt, Alexander; Poyanmehr, Reza; Harazin, Violetta; Boomgaarden, Inka; Kuhn, Christian; Rohrbeck, Astrid


    Dysbindin is an established schizophrenia susceptibility gene thoroughly studied in the context of the brain. We have previously shown through a yeast two-hybrid screen that it is also a cardiac binding partner of the intercalated disc protein Myozap. Because Dysbindin is highly expressed in the heart, we aimed here at deciphering its cardiac function. Using a serum response factor (SRF) response element reporter-driven luciferase assay, we identified a robust activation of SRF signaling by Dysbindin overexpression that was associated with significant up-regulation of SRF gene targets, such as Acta1 and Actc1. Concurrently, we identified RhoA as a novel binding partner of Dysbindin. Further phenotypic and mechanistic characterization revealed that Dysbindin induced cardiac hypertrophy via RhoA–SRF and MEK1–ERK1 signaling pathways. In conclusion, we show a novel cardiac role of Dysbindin in the activation of RhoA–SRF and MEK1–ERK1 signaling pathways and in the induction of cardiac hypertrophy. Future in vivo studies should examine the significance of Dysbindin in cardiomyopathy. PMID:24385487


    SciTech Connect

    Gianluigi Ciovati


    One of the most interesting phenomenon occurring in superconducting radio-frequency (SRF) cavities made of bulk niobium is represented by a sharp decrease of the quality factor above peak surface magnetic field of about 90 mT and is referred to as "high field Q-slope" or "Q-drop". This phenomenon was observed first in 1997 and since then some effort was devoted to the understanding of the causes behind it. Still, no clear physical interpretation of the Q-drop has emerged, despite several attempts. In this contribution, I will review the experimental results for various cavities measured in many laboratories and I will try to identify common features and differences related to the Q-drop.

  5. Prototype superconducting triple-spoke cavity for beta = 0.63.

    SciTech Connect

    Shepard, K. W.; Kelly, M. P.; Fuerst, J. D.; Kedzie, M.; Conway, Z. A.; Physics


    This paper reports the development status of a 345 MHz, three-spoke-loaded, TEM-class superconducting cavity with a transit-time factor peaked at = v/c = 0.63. The cavity has a 4 cm diameter beam aperture, a transverse diameter of 45.8 cm, and an interior length of 85 cm. The cavity is the second of two three-spoke loaded cavities being developed for the RIA driver linac and other high-intensity ion linac applications. Construction of a prototype niobium cavity has been completed and the cavity has been chemically processed. Results of initial cold tests are discussed.

  6. Superconducting triple-spoke cavity for beta = 0.5 ions.

    SciTech Connect

    Shepard, K. W.; Kelly, M. P.; Fuerst, J. D.; Kedzie, M.; Conway, Z. A.; Physics


    This paper reports the development status of a 345 MHz, three-spoke-loaded, TEM-class superconducting cavity with a transit-time factor peaked at = v/c = 0.63. The cavity has a 4 cm diameter beam aperture, a transverse diameter of 45.8 cm, and an interior length of 85 cm. The cavity is the second of two three-spoke loaded cavities being developed for the RIA driver linac and other high-intensity ion linac applications. Construction of a prototype niobium cavity has been completed and the cavity has been chemically processed. Results of initial cold tests are discussed.

  7. Assembly and commissioning of a new SRF cryomodule for the ATLAS intensity upgrade

    SciTech Connect

    Conway, Z. A.; Barcikowski, A.; Cherry, G. L.; Fischer, R. L.; Fuerst, J. D.; Jansma, W. G.; Gerbick, S. M.; Kedzie, M. J.; Kelly, M. P.; Kim, S. H.; MacDonald, S. W. T.; Murphy, R. C.; Ostroumov, P. N.; Reid, T. C.; Shepard, K. W.


    The Argonne National Laboratory Physics Division is in the final stages of a major upgrade to the Argonne Tandem Linear Accelerator System national user facility, referred to as the intensity upgrade. The intensity upgrade project will substantially increase beam currents for experimenters working with the existing ATLAS stable and in-flight rare isotope beams and for the neutron-rich beams from the Californium Rare Isotope Breeder Upgrade. This project includes the replacement of three existing cryomodules, containing 18 superconducting accelerator cavities and 9 superconducting solenoids, with a single cryomodule with seven SC 72.75 MHz accelerator cavities optimized for ion velocities of 7.7% the speed of light and 4 SC solenoids all operating at 4.5 K. This presentation will report: how we minimized the heat load into the 4 K and 80 K coolant streams feeding the cryomodule, a comparison of the calculated and measured static heat loads at 80 K and the mechanical design of the vacuum vessel.

  8. Performance characteristics of a 425 MHz RFQ linac

    SciTech Connect

    Stovall, J.E.; Crandall, K.R.; Hamm, R.W.


    A radio-frequency quadrupole (RFQ) focused proton linac has been developed and successfully tested at the Los Alamos Scientific Laboratory (LASL) for the purpose of evaluating its performance and applicability as a low-beta accelerator. The geometry of the structure was designed to accept a 100-keV beam, focus, bunch, and accelerate it to 640 keV in 1.1 m with a high-capture efficiency and minimum emittance growth. The accelerator test facility includes an injector, low-energy transport section for transverse matching, and a high-energy transport section for analysis of the beam properties. The accelerator cavity is exited through a manifold powered by a 450-MHz klystron. Diagnostic instrumentation was prepared to facilitate operation of the accelerator and to analyze its performance. Measurements of the beam properties are presented and compared with the expected properties resulting from numerical calculations of the beam dynamics.

  9. Multipacting Simulation Study for 56 MHz Quarter Wave Resonator using 2D Code

    SciTech Connect

    Naik,D.; Ben-Zvi, I.


    A beam excited 56 MHz Radio Frequency (RF) Niobium Quarter Wave Resonator (QWR) has been proposed to enhance RHIC beam luminosity and bunching. Being a RF cavity, multipacting is expected; therefore an extensive study was carried out with the Multipac 2.1 2D simulation code. The study revealed that multipacting occurs in various bands up to peak surface electric field 50 kV/m and is concentrated mostly above the beam gap and on the outer conductor. To suppress multipacting, a ripple structure was introduced to the outer conductor and the phenomenon was successfully eliminated from the cavity.

  10. Proposed Cavity for Reduced Slip-Stacking Loss

    SciTech Connect

    Eldred, J.; Zwaska, R.


    This paper employs a novel dynamical mechanism to improve the performance of slip-stacking. Slip-stacking in an accumulation technique used at Fermilab since 2004 which nearly double the proton intensity. During slip-stacking, the Recycler or the Main Injector stores two particles beams that spatially overlap but have different momenta. The two particle beams are longitudinally focused by two 53 MHz 100 kV RF cavities with a small frequency difference between them. We propose an additional 106 MHz 20 kV RF cavity, with a frequency at the double the average of the upper and lower main RF frequencies. In simulation, we find the proposed RF cavity significantly enhances the stable bucket area and reduces slip-stacking losses under reasonable injection scenarios. We quantify and map the stability of the parameter space for any accelerator implementing slip-stacking with the addition of a harmonic RF cavity.

  11. Cavities and Cryomodules for the RIA Driver Linac

    SciTech Connect

    Fuerst, J.D.; Shepard, K.W.; Kedzie, M.; Kelly, M.P.


    We describe cavities, cryomodules, and associated subsystem concepts for the Rare Isotope Accelerator (RIA) driver linac baseline design. Some alternative concepts are also presented. Beams from protons to uranium are accelerated with superconducting RF cavities operating from 57.5 MHz to 805 MHz. Substantial cost reduction over the baseline design may be achieved by replacing three classes of elliptical cell structures operating at 2 K by two classes of three-spoke drift tube structures. Cavity count and tunnel length are reduced while efficient cooling at 4.5 K for all linac structures may be possible. Issues include RF power requirements, microphonics, clean handling techniques, separate cavity and insulating vacuum systems, and heat load.

  12. Development of a 402.5 MHz 140 kW Inductive Output Tube

    SciTech Connect

    R. Lawrence Ives; Michael Read, Robert Jackson


    This report contains the results of Phase I of an SBIR to develop a Pulsed Inductive Output Tube (IOT) with 140 kW at 400 MHz for powering H-proton beams. A number of sources, including single beam and multiple beam klystrons, can provide this power, but the IOT provides higher efficiency. Efficiencies exceeding 70% are routinely achieved. The gain is typically limited to approximately 24 dB; however, the availability of highly efficient, solid state drivers reduces the significance of this limitation, particularly at lower frequencies. This program initially focused on developing a 402 MHz IOT; however, the DOE requirement for this device was terminated during the program. The SBIR effort was refocused on improving the IOT design codes to more accurately simulate the time dependent behavior of the input cavity, electron gun, output cavity, and collector. Significant improvement was achieved in modeling capability and simulation accuracy.

  13. Progress in cavity and cryomodule design for the Project X linac

    SciTech Connect

    Champion, M.; Barbanotti, S.; Foley, M.; Ginsburg, S.; Gonin, I; Grimm, C.; Kerby, J.; Nagaitsev, S.; Nicol, T.; Peterson, T.; Ristori, L.; /Fermilab


    The continuous wave 3 GeV Project X Linac requires the development of two families of cavities and cryomodules at 325 and 650 MHz. The baseline design calls for three types of superconducting single-spoke resonators at 325 MHz having betas of 0.11, 0.22, and 0.42 and two types of superconducting five-cell elliptical cavities having betas of 0.61 and 0.9. These cavities shall accelerate a 1 mA H- beam initially and must support eventual operation at 4 mA. The electromagnetic and mechanical designs of the cavities are in progress and acquisition of prototypes is planned. The heat load to the cryogenic system is up to 25 W per cavity in the 650 MHz section, thus segmentation of the cryogenic system is a major issue in the cryomodule design. Designs for the two families of cryomodules are underway.

  14. Hydroforming of Tesla Cavities at Desy

    SciTech Connect

    W. Singer; H. Kaiser; X. Singer; I. Gonin; I. Zhelezov; T. Khabibullin; P. Kneisel; K. Saito


    Since several years the development of seamless niobium cavity fabrication by hydro forming is being pursued at DESY. This technique offers the possibility of lower cost of fabrication and perhaps better rf performance of the cavities because of the elimination of electron-beam welds, which in the standard fabrication technique have sometimes lead to inferior cavity performance due to defects. Several single cell 1300 MHz cavities have been formed from high purity seamless niobium tubes, which are under computer control expanded with internal pressure while simultaneously being swaged axially. The seamless tubes have been made by either back extrusion and flow forming or by spinning or deep drawing. Standard surface treatment techniques such as high temperature post purification, buffered chemical polishing (BCP), electropolishing (EP) and high pressure ultra pure water rinsing (HPR) have been applied to these cavities. The cavities exhibited high Q - values of 2 x 10{sup 10} at 2K and residual resistances as low as 3 n{Omega} after the removal of a surface layer of app. 100 {micro}m by BCP. Surprisingly, even at high gradients up to the maximum measured values of E{sub acc} {approx} 33 MV/m the Q-value did not decrease in the absence of field emission as often observed. After electropolishing of additional 100 {micro}m one of the cavities reached an accelerating gradient of E{sub acc} {ge} 42 MV/m.

  15. Superradiance on the mHz linewidth clock transition in 87Sr

    NASA Astrophysics Data System (ADS)

    Norcia, Matthew; Winchester, Matthew; Cline, Julia; Thompson, James


    In this talk, I will discuss our recent experimental explorations of superradiant emission from the mHz linewidth clock transition in an ensemble of cold 87 Sr atoms confined within a high-finesse optical cavity. Recent proposals suggest that superradiant lasers based on such dipole-forbidden transitions in alkaline earth atoms could achieve linewidths below the current state of the art, with reduced sensitivity to environmental perturbations.

  16. CEBAF SRF Performance during Initial 12 GeV Commissioning

    SciTech Connect

    Bachimanchi, Ramakrishna; Allison, Trent; Daly, Edward; Drury, Michael; Hovater, J; Lahti, George; Mounts, Clyde; Nelson, Richard; Plawski, Tomasz


    The Continuous Electron Beam Accelerator Facility (CEBAF) energy upgrade from 6 GeV to 12 GeV includes the installation of eleven new 100 MV cryomodules (88 cavities). The superconducting RF cavities are designed to operate CW at an accelerating gradient of 19.3 MV/m with a QL of 3×107. Not all the cavities were operated at the minimum gradient of 19.3 MV/m with the beam. Though the initial 12 GeV milestones were achieved during the initial commissioning of CEBAF, there are still some issues to be addressed for long term reliable operation of these modules. This paper reports the operational experiences during the initial commissioning and the path forward to improve the performance of C100 (100 MV) modules.

  17. 47 CFR 101.79 - Sunset provisions for licensees in the 1850-1990 MHz, 2110-2150 MHz, and 2160-2200 MHz bands.

    Code of Federal Regulations, 2014 CFR


    ... incumbent, as determined by TIA TSB 10-F (for terrestrial-to-terrestrial situations) or TIA TSB 86 (for MSS... determined as follows: (1) For the 2110-2150 MHz and 2160-2175 MHz and 2175-2180 MHz bands, ten years after the first ET license is issued in the respective band; and (2) For the 2180-2200 MHz band, for...

  18. Luminescence study in Ce3+ doped SrF2 nanocrystals

    NASA Astrophysics Data System (ADS)

    Patle, Anita; Patil, R. R.; Moharil, S. V.


    In this work enhancement of SrF2:Ce nanophosphor which was synthesized by co-precipitation method is presented. Synthesized phosphor was characterized by SEM and PL measurements. Average particle size is found to be in the range 150nm-200 nm and PL studies showed emission peaks at 330nm,360nm,380nm when samples were excited by 254nm.The observed double humped emission is characteristic emission of Ce3+ similar to that observed in bulk SrF2. However under identical condition it is observed that intensity of emission get enhanced and is about nearly 1.75 times in Ce3+ doped SrF2 nanocrystals than the bulk.

  19. Organization of the MADS box from human SRF revealed by tyrosine perturbation.


    Profantová, Barbora; Coïc, Yves-Marie; Profant, Václav; Štěpánek, Josef; Kopecký, Vladimír; Turpin, Pierre-Yves; Alpert, Bernard; Zentz, Christian


    MADS box family transcription factors are involved in signal transduction and development control through DNA specific sequence recognition. The DNA binding domain of these proteins contains a conservative 55-60 amino acid sequence which defines the membership of this large family. Here we present a thorough study of the MADS segment of serum response factor (MADS(SRF)). Fluorescence, UV-absorption, and Raman spectroscopy studies were performed in order to disclose its behavior and basic functional properties in an aqueous environment. The secondary structure of MADS(SRF) estimated by analysis of Raman spectra and supported by CD has revealed only the C-terminal part as homologous with those of free core-SRF, while the N-terminal part has lost the stable α-helical structure found in both the free core-SRF and its specific complex with DNA. The three tyrosine residues of the MADS(SRF) were used as spectroscopic inner probes. The effect of environmental conditions, especially pH variations and addition of variously charged quenchers, on their spectra was examined. Two-component fluorescence quenching was revealed using factor analysis and corresponding Stern-Volmer constants determined. Factor analysis of absorbance and fluorescence pH titration led to determination of three dissociation constants pKa1 = 6.4 ± 0.2, pKa2 = 7.3 ± 0.2, and pKa3 = 9.6 ± 0.6. Critical comparison of all experiments identified the deprotonation of His193 hydrogen bonded to Tyr195 as a candidate for pKa1 (and that of Tyr158 as a candidate for pKa2). Within MADS(SRF), His193 is a key intermediary between the N-terminal primary DNA binding element and the hydrophobic C-terminal protein dimerization element. PMID:25558766

  20. First attempt of at-cavity cryogenic X-ray detection in a CEBAF cryomodule for field emission monitoring

    SciTech Connect

    Geng, Rongli; Daly, Edward; Drury, Michael; Palczewski, Ari


    We report on the first result of at-cavity X-ray detection in a CEBAF cryomodule for field emission monitoring. In the 8-cavity cryomodule F100, two silicon diodes were installed near the end flange of each cavity. Each cavity was individually tested during the cryomodule test in JLab’s cryomodule test facility. The behaviors of these at-cavity cryogenic X-ray detectors were compared with those of the standard ‘in air’ Geiger-Muller (G-M) tubes. Our initial experiments establish correlation between X-ray response of near diodes and the field emission source cavity in the 8-cavity string. For two out of these eight cavities, we also carried out at-cavity X-ray detection experiment during their vertical testing. The aim is to track field emission behavior uniquely from vertical cavity testing to horizontal cavity testing in the cryomodule. These preliminary results confirmed our expectation and warrant further effort toward the establishment of permanent at-cavity cryogenic X-ray detection for SRF development and operation.

  1. Development of vertical electropolishing process applied on 1300 and 704 MHz superconducting niobium resonators

    NASA Astrophysics Data System (ADS)

    Eozénou, F.; Boudigou, Y.; Carbonnier, P.; Charrier, J.-P.; Gasser, Y.; Maurice, L.; Peauger, F.; Roudier, D.; Servouin, C.; Muller, K.


    An advanced setup for vertical electropolishing of superconducting radio-frequency niobium elliptical cavities has been installed at CEA Saclay. Cavities are vertically electropolished with circulating standard HF-HF-H2SO4 electrolytes. Parameters such as voltage, cathode shape, acid flow, and temperature have been investigated. A low voltage (between 6 and 10 V depending on the cavity geometry), a high acid flow (25 L /min), and a low acid temperature (20° C) are considered as promising parameters. Such a recipe has been tested on single-cell and nine-cell International Linear Collider (ILC) as well as 704 MHz five-cell Super Proton Linac (SPL) cavities. Single-cell cavities showed similar performances at 1.6 K being either vertically or horizontally electropolished. The applied baking process provides similar benefit. An asymmetric removal is observed with faster removal in the upper half-cells. Multicell cavities (nine-cell ILC and five-cell SPL cavities) exhibit a standard Q0 value at low and medium accelerating fields though limited by power losses due to field emitted electrons.

  2. 805 MHz Beta = 0.47 Elliptical Accelerating Structure R & D

    SciTech Connect

    S. Bricker; C. Compton; W. Hartung; M. Johnson; F. Marti; J. Popierlarski; R. C. York; et al


    A 6-cell 805 MHz superconducting cavity for acceleration in the velocity range of about 0.4 to 0.53 times the speed of light was designed. After single-cell prototyping, three 6-cell niobium cavities were fabricated. In vertical RF tests of the 6-cell cavities, the measured quality factors (Q{sub 0}) were between 7 {center_dot} 10{sup 9} and 1.4 {center_dot} 10{sup 10} at the design field (accelerating gradient of 8 to 10 MV/m). A rectangular cryomodule was designed to house 4 cavities per cryomodule. The 4-cavity cryomodule could be used for acceleration of ions in a linear accelerator, with focusing elements between the cryomodules. A prototype cryomodule was fabricated to test 2 cavities under realistic operating conditions. Two of the 6-cell cavities were equipped with helium tanks, tuners, and input coupler and installed into the cryomodule. The prototype cryomodule was used to verify alignment, electromagnetic performance, frequency tuning, cryogenic performance, low-level RF control, and control of microphonics.

  3. Proof-of-principle demonstration of Nb3Sn superconducting radiofrequency cavities for high Q0 applications

    NASA Astrophysics Data System (ADS)

    Posen, S.; Liepe, M.; Hall, D. L.


    Many future particle accelerators require hundreds of superconducting radiofrequency (SRF) cavities operating with high duty factor. The large dynamic heat load of the cavities causes the cryogenic plant to make up a significant part of the overall cost of the facility. This contribution can be reduced by replacing standard niobium cavities with ones coated with a low-dissipation superconductor such as Nb3Sn. In this paper, we present results for single cell cavities coated with Nb3Sn at Cornell. Five coatings were carried out, showing that at 4.2 K, high Q0 out to medium fields was reproducible, resulting in an average quench field of 14 MV/m and an average 4.2 K Q0 at quench of 8 × 109. In each case, the peak surface magnetic field at quench was well above Hc1, showing that it is not a limiting field in these cavities. The coating with the best performance had a quench field of 17 MV/m, exceeding gradient requirements for state-of-the-art high duty factor SRF accelerators. It is also shown that—taking into account the thermodynamic efficiency of the cryogenic plant—the 4.2 K Q0 values obtained meet the AC power consumption requirements of state-of-the-art high duty factor accelerators, making this a proof-of-principle demonstration for Nb3Sn cavities in future applications.

  4. Commissioning Results of the 2nd 3.5 Cell SRF Gun for ELBE

    SciTech Connect

    Arnold, A; Freitag, M; Murcek, Petr; Teichert, Jochen; Vennekate, H; Xiang, R; Ciovati, Gianluigi; Kneisel, Peter K.; Turlington, Larry D,


    As in 2007 the first 3.5 cell superconducting radio frequency (SRF) gun was taken into operation, it turned out that the specified performance has not been achieved. However, to demonstrate the full potential of this new type of electron source, a second and slightly modified SRF gun II was built in collaboration with Thomas Jefferson National Accelerator Facility (TJNAF). We will report on commissioning and first results of the new gun, which includes in particular the characterization of the most important RF properties as well as their comparison with previous vertical test results.

  5. Application of ILC superconducting cavities for acceleration of protons

    SciTech Connect

    Ostroumov, P.N.; Aseev, V.N.; Gonin, I.V.; Rusnak, B.; /LLNL, Livermore


    Beam acceleration in the International Linear Collider (ILC) will be provided by 9-cell 1300 MHz superconducting (SC) cavities. The cavities are designed for effective acceleration of charged particles moving with the speed of light and are operated on {pi}-mode to provide maximum accelerating gradient. Significant R&D effort has been devoted to develop ILC SC technology and its RF system which resulted excellent performance of ILC cavities. Therefore, the proposed 8-GeV proton driver in Fermilab is based on ILC cavities above {approx}1.2 GeV. The efficiency of proton beam acceleration by ILC cavities drops fast for lower velocities and it was proposed to develop squeezed ILC-type (S-ILC) cavities operating at 1300 MHz and designed for {beta}{sub G} = 0.81, geometrical beta, to accelerate protons or H{sup -} from {approx}420 MeV to 1.2 GeV. This paper discusses the possibility of avoiding the development of new {beta}{sub G} = 0.81 cavities by operating ILC cavities on 8/9{pi}-mode of standing wave oscillations.

  6. Qualification of the Second Batch Production 9-Cell Cavities Manufactured by AES and Validation of the First US Industrial Cavity Vendor for ILC

    SciTech Connect

    Geng, R. L.; Golden, B. A.; Kushnick, P.; Overton, R. B.; Calderaro, M.; Peterson, E.; Rathke, J.; Champion, M. S.; Follkie, J.; Crawford, A. C.; Forehand, D.


    One of the major goals of ILC SRF cavity R&D is to develop industrial capabilities of cavity manufacture and processing in all three regions. In the past several years, Jefferson Lab, in collaboration with Fermi National Accelerator Laboratory, has processed and tested all the 9-cell cavities of the first batch (4 cavities) and second batch (6 cavities) production cavities manufactured by Advanced Energy Systems Inc. (AES). Over the course, close information feedback was maintained, resulting in changes in fabrication and processing procedures. A light buffered chemical polishing was introduced, removing the weld splatters that could not be effectively removed by heavy EP alone. An 800 Celsius 2 hour vacuum furnace heat treatment procedure replaced the original 600 Celsius 10 hour procedure. Four out of the six 9-cell cavities of the second production bath achieved a gradient of 36-41 MV/m at a Q0 of more than 8E9 at 35 MV/m. This result validated AES as the first ''ILC certified'' industrial vendor in the US for ILC cavity manufacture.

  7. Optomechanic interactions in phoxonic cavities

    SciTech Connect

    Djafari-Rouhani, Bahram; Oudich, Mourad; Pennec, Yan; El-Jallal, Said


    Phoxonic crystals are periodic structures exhibiting simultaneous phononic and photonic band gaps, thus allowing the confinement of both excitations in the same cavity. The phonon-photon interaction can be enhanced due to the overlap of both waves in the cavity. In this paper, we discuss some of our recent theoretical works on the strength of the optomechanic coupling, based on both photoelastic and moving interfaces mechanisms, in different (2D, slabs, strips) phoxonic crystals cavities. The cases of two-dimensional infinite and slab structures will enable us to mention the important role of the symmetry and degeneracy of the modes, as well as the role of the materials whose photoelastic constants can be wavelength dependent. Depending on the phonon-photon pair, the photoelastic and moving interface mechanisms can contribute in phase or out-of-phase. Then, the main part of the paper will be devoted to the optomechanic interaction in a corrugated nanobeam waveguide exhibiting dual phononic/photonic band gaps. Such structures can provide photonic modes with very high quality factor, high frequency phononic modes of a few GHz inside a gap and optomechanical coupling rate reaching a few MHz.

  8. State of the art of multicell SC cavities and perspectives

    SciTech Connect

    Peter Kneisel


    Superconducting cavity technology has made major progresses in the last decade with the introduction of high purity niobium on an industrial scale and, at the same time, by an improved understanding of the limiting processes in cavity performance, such as multipacting, field emission loading and thermal break-down. Multicell niobium cavities for beta = 1 particle acceleration, e.g. for the TESLA project, are routinely exceeding gradients of Eacc = 20 MV/m after the application of surface preparation techniques such as buffered chemical polishing or electropolishing, high pressure ultrapure water rinsing, UHV heat treatment and clean room assembly. The successes of the technology for beta = 1 accelerators has triggered a whole set of possible future applications for beta < 1 particle acceleration such as spallation neutron sources (SNS, ESS), transmutation of nuclear waste (TRASCO, ASH) or rare isotopes (RIA). The most advanced of these projects is SNS now under construction at Oak Ridge National Laboratory. This paper will review the technical solutions adopted to advance SRF technology and their impact on cavity performance, based on the SNS prototyping efforts. 2K at these high gradients are no longer out of reach. For the accelerator builder the challenge remains to come up with a good and reasonable design, which takes into account the status of the technology and does not over-estimate the achievable cavity performances in a large assembly such as, e.g., a multi-cavity cryo-module. In the following the criteria for multi-cell sc cavity design are reviewed and it is attempted to give a snapshot of the present status of multi-cell cavity performances.

  9. Design of Superconducting Multi-Spoke Cavities for High-Velocity Applications

    SciTech Connect

    Hopper, C. S.; Delayen, J. R.


    Superconducting spoke cavities have been designed and tested for particle velocities up to {beta}{sub 0} ~ 0.6 and are currently being designed for velocities up to {beta}{sub 0} = 1. We present the electromagnetic designs for two-spoke cavities operating at 325 MHz for {beta}{sub 0} = 0.82 and {beta}{sub 0} = 1.

  10. Characterization and Fabrication of Spoke Cavities for High-Velocity Applications

    SciTech Connect

    Hopper, Christopher S.; Park, HyeKyoung; Delayen, Jean R.


    A 500 MHz, velocity-of-light, two-spoke cavity has been designed and optimized for possible use in a compact light source. Here we present the mechanical analysis and steps taken in fabrication of this cavity at Jefferson Lab.

  11. Cleaved-coupled-cavity lasers with large cavity length ratios for enhanced stability

    SciTech Connect

    Bowers, J.E.; Bjorkholm, J.E.; Burrus, C.A.; Coldren, L.A.; Hemenway, B.R.; Wilt, D.P.


    The fabrication and operation of the first cleaved-coupled-cavity (C/sup 3/) semiconductor lasers with large cavity length ratios are described. The internal cleaved facet is precisely positioned by photochemically etching a groove through most of the wafer. Single longitudinal mode operation is obtained over a temperature range of 21 /sup 0/C and over a current range of threshold to greater than four times threshold. Sidemode suppression of 100:1 was measured when the laser was modulated at 350 MHz with an extinction ratio greater than 10:1. These results are experimentally and theoretically compared to approximately equal length C/sup 3/ lasers.

  12. Developments and directions in 200 MHz very high power RF at LAMPF

    SciTech Connect

    Cliff, R.; Bush, E.D.; DeHaven, R.A.; Harris, H.W.; Parsons, M.


    The Los Alamos Meson Physics Facility (LAMPF), is a linear particle accelerator a half-mile long. It produces an 800 million electron- volt hydrogen-ion beam at an average current of more than one milliamp. The first RF section of the accelerator consists of four Alvarez drift-tube structures. Each of these structures is excited by an amplifier module at a frequency of 201.25 MHz. These amplifiers operate at a duty of 13 percent or more and at peak pulsed power levels of about 2.5 million watts. The second RF accelerator section consists of forty-four side-coupled-cavity structures. Each of these is excited by an amplifier module at a frequency of 805 MHz. These amplifiers operate at a duty of up to 12 percent and at peak pulsed power levels of about 1.2 million watts. The relatively high average beam current in the accelerator places a heavy demand upon components in the RF systems. The 201-MHz modules have always required a large share of maintenance efforts. In recent years, the four 201.25 MHz modules have been responsible for more than twice as much accelerator down-time as have the forty-four 805 MHz modules. This paper reviews recent, ongoing, and planned improvements in the 201-MHz systems. The Burle Industries 7835 super power triode is used in the final power amplifiers of each of the 201-MHz modules. This tube has been modified for operation at LAMPF by the addition of Penning ion vacuum pumps.'' This has enabled more effective tube conditioning and restarting. A calorimetry system of high accuracy is in development to monitor tube plate-power dissipation.

  13. RF cavity resonator and split-resonator designs.


    Mansfield, P; McJury, M; Glover, P; Clemence, M


    A simple high-pass cavity resonator has been constructed for NMR imaging use at 500 MHz. A capacitative circuit arrangement is used to drive the device. A novel split-coil or half-resonator design is also introduced for lower-frequency operation with applications in whole-body medical imaging. PMID:2067387

  14. Fabrication of the APS Storage Ring radio frequency accelerating cavities

    SciTech Connect

    Primdahl, K.; Bridges, J.; DePaola, F.; Kustom, R.; Snee, D.


    Specification, heat treatment, strength, and fatigue life of the Advanced Photon Source (APS) Storage Ring 352-MHz radio frequency (RF) accelerating cavity copper is discussed. Heat transfer studies, including finite element analysis, and configuration of water cooling is described. Requirements for and techniques of machining are considered. Braze and electron beam joint designs are compared. Vacuum considerations during fabrication are discussed.

  15. Cavity magnomechanics

    NASA Astrophysics Data System (ADS)

    Zhang, Xufeng; Zou, Changling; Jiang, Liang; Tang, Hong X.

    Mechanical oscillators have been recently widely utilized to couple with optical and microwave photons in a variety of hybrid quantum systems, but they all lack the tunability. The magnetostrictive force provides an alternative mechanism to allow phonon to couple with a different type of information carrier-magnon, the collective excitation of magnetization whose frequency can be tuned by a bias magnetic field. Here, we demonstrate an intriguing hybrid system that consists of a magnonic, a mechanical, and a microwave resonator. The magnon-phonon interaction results in hallmark coherent phenomena such as magnomechanically induced transparency/absorption and magnomechanical parametric amplification. The magnetic field dependence of magnon provides our system with unprecedented tunability. Moreover, the great flexibility of our system allows us to achieve triple resonance among magnon, phonon and photon, which drastically enhances the magnomechanical interaction. Our work demonstrates the fundamental principle of cavity magnetomechanics, opening up great opportunities in various applications, such as tunable microwave filter and amplifier, long-lifetime quantum memories, microwave-to-optics conversion.


    SciTech Connect

    Johnson, Rolland


    Many present and future particle accelerators are limited by the maximum electric gradient and peak surface fields that can be realized in RF cavities. Despite considerable effort, a comprehensive theory of RF breakdown has not been achieved and mitigation techniques to improve practical maximum accelerating gradients have had only limited success. Part of the problem is that RF breakdown in an evacuated cavity involves a complex mixture of effects, which include the geometry, metallurgy, and surface preparation of the accelerating structures and the make-up and pressure of the residual gas in which plasmas form. Studies showed that high gradients can be achieved quickly in 805 MHz RF cavities pressurized with dense hydrogen gas, as needed for muon cooling channels, without the need for long conditioning times, even in the presence of strong external magnetic fields. This positive result was expected because the dense gas can practically eliminate dark currents and multipacting. In this project we used this high pressure technique to suppress effects of residual vacuum and geometry that are found in evacuated cavities in order to isolate and study the role of the metallic surfaces in RF cavity breakdown as a function of magnetic field, frequency, and surface preparation. One of the interesting and useful outcomes of this project was the unanticipated collaborations with LANL and Fermilab that led to new insights as to the operation of evacuated normal-conducting RF cavities in high external magnetic fields. Other accomplishments included: (1) RF breakdown experiments to test the effects of SF6 dopant in H2 and He gases with Sn, Al, and Cu electrodes were carried out in an 805 MHz cavity and compared to calculations and computer simulations. The heavy corrosion caused by the SF6 components led to the suggestion that a small admixture of oxygen, instead of SF6, to the hydrogen would allow the same advantages without the corrosion in a practical muon beam line. (2) A

  17. Phase and Frequency Locked Magnetrons for SRF Sources

    SciTech Connect

    Neubauer, Michael; Johnson, Rolland


    There is great potential for a magnetron power source that can be controlled both in phase and frequency. Such a power source could revolutionize many particle accelerator systems that require lower capital cost and/or higher power efficiency. Beyond the accelerator community, phase and frequency locked magnetons could improve radar systems around the world and make affordable phased arrays for wireless power transmission for solar powered satellites. This joint project of Muons, Inc., Fermilab, and L-3 CTL was supported by an STTR grant monitored by the Nuclear Physics Office of the DOE Office of Science. The object of the program was to incorporate ferrite materials into the anode of a magnetron and, with appropriate biasing of the ferrites, to maintain frequency lock and to allow for frequency adjustment of the magnetron without mechanical tuners. If successful, this device would have a dual use both as a source for SRF linacs and for military applications where fast tuning of the frequency is a requirement. In order to place the materials in the proper location, several attributes needed to be modeled. First the impact of the magnetron’s magnetic field needed to be shielded from the ferrites so that they were not saturated. And second, the magnetic field required to change the frequency of the magnetron at the ferrites needed to be shielded from the region containing the circulating electrons. ANSYS calculations of the magnetic field were used to optimize both of these parameters. Once the design for these elements was concluded, parts were fabricated and a complete test assembly built to confirm the predictions of the computer models. The ferrite material was also tested to determine its compatibility with magnetron tube processing temperatures. This required a vacuum bake out of the chosen material to determine the cleanliness of the material in terms of outgassing characteristics, and a subsequent room temperature test to verify that the characteristics of

  18. Results from the first single cell Nb3Sn cavity coatings at JLab

    SciTech Connect

    Eremeev, Grigory


    Nb3Sn is a promising superconducting material for SRF applications and has the potential to exceed the limitations of niobium. We have used the recently commissioned Nb3Sn coating system to investigate Nb3Sn coatings on several single cell cavities by applying the same coating procedure on several different single cells with different history and pre-coating surface preparation. We report on our findings with four 1.5 GHz CEBAF-shape single cell and one 1.3 GHz ILC-shape single cavities that were coated, inspected, and tested.

  19. Probing the fundamental limit of niobium in high radiofrequency fields by dual mode excitation in superconducting radiofrequency cavities

    SciTech Connect

    Eremeev, Grigory; Geng, Rongli; Palczewski, Ari


    We have studied thermal breakdown in several multicell superconducting radiofrequency cavity by simultaneous excitation of two TM{sub 010} passband modes. Unlike measurements done in the past, which indicated a clear thermal nature of the breakdown, our measurements present a more complex picture with interplay of both thermal and magnetic effects. JLab LG-1 that we studied was limited at 40.5 MV/m, corresponding to B{sub peak} = 173 mT, in 8{pi}/9 mode. Dual mode measurements on this quench indicate that this quench is not purely magnetic, and so we conclude that this field is not the fundamental limit in SRF cavities.

  20. MKL1/2 and ELK4 co-regulate distinct serum response factor (SRF) transcription programs in macrophages

    PubMed Central


    Background Serum response factor (SRF) is a widely expressed transcription factor involved in multiple regulatory programs. It is believed that SRF can toggle between disparate programs of gene expression through association with different cofactors. However, the direct evidence as to how these factors function on a genome-wide level is still lacking. Results In the present study, I explored the functions of SRF and its representative cofactors, megakaryoblastic leukemia 1/2 (MKL1/2) and ETS-domain protein 4 (ELK4), during fungal infection challenge in macrophages. The knockdown study, combined with gene expression array analysis, revealed that MKL1/2 regulated SRF-dependent genes were related to actin cytoskeleton organization, while ELK4 regulated SRF-dependent genes were related to external stimulus responses. Subsequent chromatin immunoprecipitation coupled with massively parallel sequencing (ChIP-seq) suggested that many of these regulations were mediated directly in cis. Conclusions I conclude that SRF utilizes MKL1/2 to fulfill steady state cellular functions, including cytoskeletal organization, and utilizes ELK4 to facilitate acute responses to external infection. Together, these findings indicate that SRF, along with its two cofactors, are important players in both cellular homeostasis and stress responses in macrophages. PMID:24758171

  1. Study of medium beta elliptical cavities for CADS

    NASA Astrophysics Data System (ADS)

    Wen, Liangjian; Zhang, Shenghu; Li, Yongming; Wang, Ruoxu; Guo, Hao; Zhang, Cong; Jia, Huan; Jiang, Tiancai; Li, Chunlong; He, Yuan


    The China Accelerator-Driven Sub-critical System (CADS) is a high intensity proton facility to dispose of nuclear waste and generate electric power. CADS is based on a 1.5 GeV, 10 mA CW superconducting (SC) linac as a driver. The high energy section of the linac is composed of two families of SC elliptical cavities which are designed with geometrical beta 0.63 and 0.82. In this paper, the 650 MHz β=0.63 SC elliptical cavity is studied, including cavity optimization, multipacting, high order modes (HOMs) and generator RF power calculation. Supported by National Natural Science Foundation of China (91426303)

  2. Calculation of mechanical vibration frequencies of stiffened superconducting cavities

    SciTech Connect

    Black, S.J.; Spalek, G.


    We calculated the frequencies of transverse and longitudinal mechanical-vibration modes of the HEPL- modified, CERN/DESY four-cell superconducting cavity, using finite-element techniques. We compared the results of these calculations, including the stiffening of the cavity with rods, with mode frequencies measured at HEPL. The correlation between data was significant. The same techniques were also used to design and optimize the stiffening scheme for the seven-cell 805-MHz superconducting cavity being developed at Los Alamos. In this report, we describe the final stiffening scheme and the results of our calculations.

  3. Calculation of mechanical vibration frequencies of stiffened superconducting cavities

    SciTech Connect

    Black, S.J.; Spalek, G.


    We calculated the frequencies of transverse and longitudinal mechanical-vibration modes of the HEPL- modified, CERN/DESY four-cell superconducting cavity, using finite-element techniques. We compared the results of these calculations, including the stiffening of the cavity with rods, with mode frequencies measured at HEPL. The correlation between data was significant. The same techniques were also used to design and optimize the stiffening scheme for the seven-cell 805-MHz superconducting cavity being developed at Los Alamos. In this report, we describe the final stiffening scheme and the results of our calculations.

  4. RF cavity design for KIRAMS-430 superconducting cyclotron

    NASA Astrophysics Data System (ADS)

    Jung, In Su; Hong, Bong Hwan; Kang, Joonsun; Kim, Hyun Wook; Kim, Chang Hyeuk; Kwon, Key Ho


    The Korea Heavy Ion Medical Accelerator (KHIMA) has developed a superconducting cyclotron for the carbon therapy, which is called KIRAMS-430. The cyclotron is designed to accelerate only 12C6+ ions up to the energy of 430 MeV/u. It uses two normal conducting RF cavities. The RF frequency is about 70.76 MHz. The nominal dee voltage is 70 kV at the center and 160 kV at the extraction. The RF cavity was designed with 4 stems by using CST microwave studio (MWS). In this paper, we represent the simulation results and the optimized design of the RF cavity for the KIRAMS-430.

  5. 20 MHz/40 MHz Dual Element Transducers for High Frequency Harmonic Imaging

    PubMed Central

    Kim, Hyung Ham; Cannata, Jonathan M.; Liu, Ruibin; Chang, Jin Ho; Silverman, Ronald H.; Shung, K. Kirk


    Concentric annular type dual element transducers for second harmonic imaging at 20 MHz / 40 MHz were designed and fabricated to improve spatial resolution and depth of penetration for ophthalmic imaging applications. The outer ring element was designed to transmit the 20 MHz signal and the inner circular element was designed to receive the 40 MHz second harmonic signal. Lithium niobate (LiNbO3), with its low dielectric constant, was used as the piezoelectric material to achieve good electrical impedance matching. Double matching layers and conductive backing were used and optimized by KLM modeling to achieve high sensitivity and wide bandwidth for harmonic imaging and superior time-domain characteristics. Prototype transducers were fabricated and evaluated quantitatively and clinically. The average measured center frequency for the transmit ring element was 21 MHz and the one-way –3 dB bandwidth was greater than 50%. The 40 MHz receive element functioned at 31 MHz center frequency with acceptable bandwidth to receive attenuated and frequency downshifted harmonic signal. The lateral beam profile for the 20 MHz ring elements at the focus matched the Field II simulated results well, and the effect of outer ring diameter was also examined. Images of a posterior segment of an excised pig eye and a choroidal nevus of human eye were obtained both for single element and dual element transducers and compared to demonstrate the advantages of dual element harmonic imaging. PMID:19126492

  6. Optical properties of bismuth-doped KCl and SrF2 crystals

    NASA Astrophysics Data System (ADS)

    Firstov, S. V.; Zhao, M.; Su, L.; Yang, Q.; Iskhakova, L. D.; Firstova, E. G.; Alyshev, S. V.; Riumkin, K. E.; Dianov, E. M.


    Structural and spectroscopic properties of the pristine and γ-irradiated Bi-doped KCl and SrF2 crystals grown by the Bridgman technique were studied. New emission bands in the visible and near IR regions from the irradiated crystals were observed. An origin of optical centers responsible for near IR luminescence is discussed.

  7. SRF Vs. Rapeseed: Insights from soil respiration and combustion heat per area

    NASA Astrophysics Data System (ADS)

    Zurba, Kamal; Matschullat, Jörg


    Bioenergy crops may be important to mitigate global warming risks. They are a renewable energy source and have the potential to offset CO2 emissions by storing C in soils. In this study, a comparison between willow and poplar short rotation forestry (SRF) with rapeseed cultivation was made to estimate the ratio between the emitted quantities of carbon dioxide from soil (soil respiration) and the combustion heat obtained from the extracted products per hectare. This ratio is valuable because it delivers a three dimensional information: soil respiration (kg CO2), combustion heat values (GJ) and area of used land (ha). A manual static closed chamber (SEMACH-FG) was applied to measure CO2 emissions at the SRF and rapeseed sites during the growing season 2014 (April-October). Our results showed that poplar and willow SRF has a very low ratio comparing to rapeseed (157.78±12.03, 199.91±31.3 and 1128.14 kg CO2 GJ-1, respectively). We thus recommend poplar and willow SRF as renewable sources for bioenergy over the currently prevalent rapeseed production.

  8. MRTF/SRF dependent transcriptional regulation of TAZ in breast cancer cells

    PubMed Central

    Liu, Chen-Ying; Chan, Siew Wee; Guo, Fusheng; Toloczko, Aleksandra; Cui, Long; Hong, Wanjin


    Dysregulation of Hippo pathway results in activation of transcriptional co-activators YAP/TAZ in breast cancer. Previously, we showed that overexpression of TAZ in breast cancer promotes cell migration, invasion and tumorigenesis. Here, we show that upregulation of TAZ in breast cancers could also be due to dysregulation of TAZ transcription. Heregulin β1 (HRG1) increases TAZ mRNA level in breast cancer cells. TAZ is a direct target of MRTF/SRF transcriptional factors which are activated by HRG1. Both MRTF/SRF and TAZ are the important downstream effectors enhancing cell migration induced by HRG1. TAZ mRNA level is correlated with nuclear localization of MRTF in breast cancer cells and the mRNA level of MRTF/SRF direct target genes in breast cancers, indicating the correlation between MRTF/SRF activity and TAZ expression. Our results provide new insights into the transcriptional regulation of TAZ and dysregulation mechanism of TAZ in breast cancer, which could be a new therapeutic strategy for breast cancer. PMID:26885614

  9. Repression of SRF target genes is critical for Myc-dependent apoptosis of epithelial cells

    PubMed Central

    Wiese, Katrin E; Haikala, Heidi M; von Eyss, Björn; Wolf, Elmar; Esnault, Cyril; Rosenwald, Andreas; Treisman, Richard; Klefström, Juha; Eilers, Martin


    Oncogenic levels of Myc expression sensitize cells to multiple apoptotic stimuli, and this protects long-lived organisms from cancer development. How cells discriminate physiological from supraphysiological levels of Myc is largely unknown. Here, we show that induction of apoptosis by Myc in breast epithelial cells requires association of Myc with Miz1. Gene expression and ChIP-Sequencing experiments show that high levels of Myc invade target sites that lack consensus E-boxes in a complex with Miz1 and repress transcription. Myc/Miz1-repressed genes encode proteins involved in cell adhesion and migration and include several integrins. Promoters of repressed genes are enriched for binding sites of the serum-response factor (SRF). Restoring SRF activity antagonizes Myc repression of SRF target genes, attenuates Myc-induced apoptosis, and reverts a Myc-dependent decrease in Akt phosphorylation and activity, a well-characterized suppressor of Myc-induced apoptosis. We propose that high levels of Myc engage Miz1 in repressive DNA binding complexes and suppress an SRF-dependent transcriptional program that supports survival of epithelial cells. PMID:25896507

  10. Simulation of ELBE SRF gun II for high-bunch-charge applications

    NASA Astrophysics Data System (ADS)

    Lu, P.; Arnold, A.; Teichert, J.; Vennekate, H.; Xiang, R.


    The SRF gun at ELBE will benefit most of the local user beamlines for future high-bunch-charge operations. Parallel to its development, simulation-based investigations have been performed to improve the beam quality for THz experiments and Compton backscattering experiments. These two applications have the most challenging requirements: THz experiments benefit significantly from short bunch lengths at the sub-ps level, while Compton backscattering experiments demand small transverse beam sizes of about 30 μm. The beam dynamics of the SRF gun are simulated with ASTRA and the beam transport is optimized using Elegant. Important physical effects included in simulations are introduced first, where the interesting phenomenon of "slice mismatch" is generally quantified and numerically studied. Afterwards, beam transport strategies and optimization methods are proposed which are based on the specific settings of ELBE but also applicable to similar accelerator setups. Finally, optimizations of the SRF gun and the beam transport in ELBE are presented. Results show that the SRF gun is capable of providing 500 pC bunches for both applications with better beam qualities than the currently 100 pC bunches supplied by the existing thermionic DC source.

  11. The B-box dominates SAP-1-SRF interactions in the structure of the ternary complex.


    Hassler, M; Richmond, T J


    The serum response element (SRE) is found in several immediate-early gene promoters. This DNA sequence is necessary and sufficient for rapid transcriptional induction of the human c-fos proto-oncogene in response to stimuli external to the cell. Full activation of the SRE requires the cooperative binding of a ternary complex factor (TCF) and serum response factor (SRF) to their specific DNA sites. The X-ray structure of the human SAP-1-SRF-SRE DNA ternary complex was determined (Protein Data Bank code 1hbx). It shows SAP-1 TCF bound to SRF through interactions between the SAP-1 B-box and SRF MADS domain in addition to contacts between their respective DNA-binding motifs. The SAP-1 B-box is part of a flexible linker of which 21 amino acids become ordered upon ternary complex formation. Comparison with a similar region from the yeast MATalpha2-MCM1-DNA complex suggests a common binding motif through which MADS-box proteins may interact with additional factors such as Fli-1. PMID:11406578

  12. Road Map for Studies to Produce Consistent and High Performance SRF Accelerator Structures

    SciTech Connect

    Ganapati Rao Myneni; John F. O’Hanlon


    Superconducting Radio Frequency (SRF) accelerator structures made from high purity niobium are becoming the technological choice for a large number of future accelerators and energy recovery LINAC’s (ERL). Most of the presently planned accelerators and ERL requirements will be met with some effort by the current SRF technology where accelerating gradients of about 20 MV/m can be produced on a routine basis with an acceptable yield. However, the XFEL at DESY and the planned ILC require acceleration gradients more than 28 MV/m and 35 MV/m respectively. At the recent ILC meeting at Snowmass (2005) concern was expressed regarding the wide spread in the achieved accelerator gradients and the relatively low yields. For obtaining accelerating gradients of 35 MV/m in SRF accelerator structures consistently, a deeper understanding of the causes for the spread has to be gained and advances have to be made in many scientific and high technology fields, including materials, surface and vacuum sciences, application of reliable processes and procedures, which provide contamination –free surfaces and avoid recontamination and cryogenics related technologies. In this contribution a road map for studies needed to produce consistent and high performance SRF accelerator structures from the needed materials development to clean and non-recontaminating processes and procedures will be presented.

  13. Resonant cavity Vircator driven by a thermionic cathode electron beam gun

    SciTech Connect

    Kraft, R.


    A resonant cavity Vircator (virtual cathode oscillator) driven by an electron beam emitted from a broad area thermionic cathode has been tested at Textron Defense Systems. Narrow bandwidth (1.0 MHz at the {minus}3 dB level) excitation of the TM{sub 0.23} mode of a cylindrical resonant cavity was observed at a frequency of 986 MHz with a pulse length of 1.2 {mu}s. The single cavity mode excitation is attributed to the constant voltage and current electron beam emitted form the thermionic cathode.

  14. A 50 MHz System for GMRT

    NASA Astrophysics Data System (ADS)

    Udaya Shankar, N.; Dwarakanath, K. S.; Amiri, S.; Somashekar, R.; Girish, B. S.; Laus, W.; Nayak, A.


    This paper describes a 50~MHz system being developed for GMRT to provide imaging capability in the frequency range 30-90~MHz. Due to its larger collecting area and higher antenna efficiency, the low-frequency GMRT system will be several times more sensitive than the present 74~MHz VLA system and is likely to remain a competitive instrument in this frequency band. In the first phase of this project, receiver systems consisting of V-dipole feeds and front-ends have been installed on four of the thirty GMRT antennas. Test observations were carried out on a number of bright 3CR sources. The initial results are encouraging. This paper will also describe results of simultaneous observations carried out using the existing GMRT correlator, the new GMRT software correlator and a system employing digitization and direct recording of signals at two antenna bases.

  15. Nonthermal galactic emission below 10 MHz

    NASA Technical Reports Server (NTRS)

    Novaco, J. C.; Brown, L. W.


    The Radio Astronomy Explorer-2 (RAE-2) satellite has provided new measurements of the nonthermal galactic radio emission at frequencies below 10 MHz. Measurements of the emission spectra are presented for the center, anticenter, north polar, and south polar directions at 22 frequencies between 0.25 and 9.18 MHz. Survey maps of the spatial distribution of the observed low frequency galactic emission at 1.31, 2.20, 3.93, 4.70, 6.55, and 9.18 MHz are presented. The observations were obtained with the 229-meter traveling-wave V-antenna on this lunar orbiting spacecraft. The improved frequency coverage offers additional insights into structure of the local galactic neighborhood.

  16. High power 325 MHz vector modulators for the Fermilab High Intensity Neutrino Source (HINS)

    SciTech Connect

    Madrak, Robyn Leigh; Wildman, David; /Fermilab


    One of the goals of the low energy 60 MeV section of the HINS H{sup -} linac [1] is to demonstrate that a total of {approx}40 RF cavities can be powered by a single 2.5 MW, 325 MHz klystron. This requires individual vector modulators at the input of each RF cavity to independently adjust the amplitude and phase of the RF input signal during the 3.5 ms RF pulse. Two versions of vector modulators have been developed; a 500 kW device for the radiofrequency quadrupole (RFQ) and a 75 kW modulator for the RF cavities. High power tests showing the vector modulator phase and amplitude responses will be presented.

  17. 503MHz repetition rate femtosecond Yb: fiber ring laser with an integrated WDM collimator.


    Wang, Aimin; Yang, Hongyu; Zhang, Zhigang


    We demonstrate 503MHz fundamental high repetition rate operation in a ring cavity passively mode-locked Yb:fiber laser incorporating a novel wavelength-division-multiplexing collimator and a piece of all-solid photonic bandgap fiber. The Yb doped fiber was directly fabricated as one fiber pigtail into the functional collimator, greatly shortening the cavity length and facilitating the splicing operation. A 5cm long photonic bandgap fiber with abnormal dispersion at the lasing wavelength (centered at 1030nm) decreases the net dispersion for shorter output pulses. The spectral bandwidth of the pulse was 34nm. The direct output pulse was measured to be 156fs and the dechirped pulse was about 76fs. With this innovative Yb:fiber pigtailed WDM collimator, the ring cavity laser has the potential to work at a repetition rate up to GHz. PMID:22273932

  18. Detection of new pulsars at 111 MHz

    NASA Astrophysics Data System (ADS)

    Tyul'bashev, S. A.; Tyul'bashev, V. S.; Oreshko, V. V.; Logvinenko, S. V.


    The first results of a search for pulsars using the Large Phased Array of the Lebedev Physical Institute at 111 MHz for right ascensions 0h-24h and declinations 21°-42° are reported. Data with a time resolution of 100 ms in six frequency channels within a 2.5-MHz frequency band have been processed. Thirty-four pulsars have been detected, of which seventeen were observed on this telescope earlier; ten known pulsars had not been observed earlier. Seven new pulsars have been discovered.

  19. Long-term stabilization of single longitudinal mode in external cavity semiconductor lasers

    SciTech Connect

    Zhang Hanyi; Zhou Jianying; Wu Yuanxing; Li Jian; Pang Zhengwu; Zhou Bingkun


    Long-term frequency stabilization of a single longitudinal mode (SLM) external cavity semiconductor laser has been demonstrated by using multisegment composite-cavity configuration and automatic frequency control loop with feedback to control the external cavity length. The time period of mode-hopping free SLM operation has been observed to be more than 24 hours with a frequency shift of about 28 MHz and a linewidth of less than 200 kHz.

  20. Tests of an RF Dipole Crabbing Cavity for an Electron-Ion Collider

    SciTech Connect

    Castilla Loeza, Alejandro; Delayen, Jean R.


    On the scheme of developing a medium energy electron-ion collider (MEIC) at Jefferson Lab, we have designed a compact superconducting rf dipole cavity at 750 MHz to crab both electron and ion bunches and increase luminosities at the interaction points (IP) of the machine. Following the design optimization and characterization of the electromagnetic properties such as peak surface fields and shunt impedance, along with field nonuniformities, multipole components content, higher order modes (HOM) and multipacting, a prototype cavity was built by Niowave Inc. The 750 MHz prototype crab cavity has been tested at 4 K and is ready for re-testing at 4 K and 2 K at Jefferson Lab. In this paper we present the detailed results of the rf tests performed on the 750 MHz crab cavity prototype.

  1. Preliminary Experience with ''In-Site'' Baking of Niobium Cavities

    SciTech Connect

    P. Kneisel


    In a series of experiments several single cell and multi-cell niobium cavities made from reactor grade and high RRR niobium (frequencies were 700 MHz, 1300 MHz and 1497 MHz) have been baked--after initial testing--in-situ around 145 C for up to 90 hours prior to being recooled. Surprisingly, all cavities showed significant improvements in Q-values between 4.2 and 1.6K. The BCS surface resistance was lowered by nearly a factor of two. This cannot be explained by solely a reduction of dielectric losses caused by adsorbates at the surface or by a decrease of the mean free path due to possibly diffusion of oxygen into the surface layer. In several experiments also the high field behavior of the cavity improved after the in-situ baking procedure. The observed effect opens the possibility for the CEBAF upgrade cavities, which in turn will permit to run the cavities at higher gradients if field emission loading can be prevented. Utilizing this effect can possibly translate into sizeable cost savings since fewer modules are needed for the upgrade program.

  2. Dual frequency optical cavity


    George, E.V.; Schipper, J.F.

    Method and apparatus for generating two distinct laser frequencies in an optical cavity, using a T configuration laser cavity and means for intermittently increasing or decreasing the index of refraction n of an associated transmission medium in one arm of the optical cavity to enhance laser action in one arm or the second arm of the cavity.

  3. Dual frequency optical cavity


    George, E. Victor; Schipper, John F.


    Method and apparatus for generating two distinct laser frequencies in an optical cavity, using a "T" configuration laser cavity and means for intermittently increasing or decreasing the index of refraction n of an associated transmission medium in one arm of the optical cavity to enhance laser action in one arm or the second arm of the cavity.



    Baker, W.R.


    A cavity excitation circuit is described for rapidly building up and maintaining high-level oscillations in a resonant cavity. The circuit overcomes oscillation buildup slowing effects such as ion locking in the cavity by providing for the selective application of an amplified accelerating drive signal to the main cavity exciting oscillator during oscillation buildup and a direct drive signal to the oscillator thereafter.

  5. Fiber-coupled, Littrow-grating cavity displacement sensor.


    Allen, Graham; Sun, Ke-Xun; Byer, Robert


    We have demonstrated a compact, optical-fiber-fed, optical displacement sensor utilizing a Littrow-mounted diffraction grating to form a low-finesse Fabry-Perot cavity. Length changes of the cavity are read out via the Pound-Drever-Hall rf modulation technique at 925 MHz. The sensor has a nominal working distance of 2 cm and a total dynamic range of 160 nm. The displacement noise floor was less than 3x10(-10) m/sqrt[Hz] above 10(-2) Hz, limited by the frequency drift of the reference laser. A frequency-stabilized laser would reduce the noise floor to below 10(-12) m/sqrt[Hz]. The use of a 925 MHz modulation frequency demonstrates high-precision readout of a low-finesse compact resonant cavity. PMID:20410986


    SciTech Connect

    Delayen, Jean; De Silva, Paygalage Subashini


    Recent interests in designing compact deflecting and crabbing structures for future accelerators and colliders have initiated the development of novel rf structures. The superconducting rf-dipole cavity is one of the first compact designs with attractive properties such as higher gradients, higher shunt impedance, the absence of lower order modes and widely separated higher order modes. Two rf-dipole designs of 400 MHz and 499 MHz have been designed, fabricated and tested as proof-of-principle designs of compact deflecting and crabbing cavities for the LHC high luminosity upgrade and Jefferson Lab 12 GeV upgrade. The first rf tests have been performed on the rf-dipole geometries at 4.2 K and 2.0 K in a vertical test assembly with excellent results. The cavities have achieved high gradients with high intrinsic quality factors, and multipacting levels were easily processed.

  7. Cryogenic Infrastructure for Fermilab's Ilc Vertical Cavity Test Facility

    NASA Astrophysics Data System (ADS)

    Carcagno, R.; Ginsburg, C.; Huang, Y.; Norris, B.; Ozelis, J.; Peterson, T.; Poloubotko, V.; Rabehl, R.; Sylvester, C.; Wong, M.


    Fermilab is building a Vertical Cavity Test Facility (VCTF) to provide for R&D and pre-production testing of bare 9-cell, 1.3-GHz superconducting RF (SRF) cavities for the International Linear Collider (ILC) program. This facility is located in the existing Industrial Building 1 (IB1) where the Magnet Test Facility (MTF) also resides. Helium and nitrogen cryogenics are shared between the VCTF and MTF including the existing 1500-W at 4.5-K helium refrigerator with vacuum pumping for super-fluid operation (125-W capacity at 2-K). The VCTF is being constructed in multiple phases. The first phase is scheduled for completion in mid 2007, and includes modifications to the IB1 cryogenic infrastructure to allow helium cooling to be directed to either the VCTF or MTF as scheduling demands require. At this stage, the VCTF consists of one Vertical Test Stand (VTS) cryostat for the testing of one cavity in a 2-K helium bath. Planning is underway to provide a total of three Vertical Test Stands at VCTF, each capable of accommodating two cavities. Cryogenic infrastructure improvements necessary to support these additional VCTF test stands include a dedicated ambient temperature vacuum pump, a new helium purification skid, and the addition of helium gas storage. This paper describes the system design and initial cryogenic operation results for the first VCTF phase, and outlines future cryogenic infrastructure upgrade plans for expanding to three Vertical Test Stands.


    SciTech Connect

    Carcagno, R.; Ginsburg, C.; Huang, Y.; Norris, B.; Ozelis, J.; Peterson, T.; Poloubotko, V.; Rabehl, R.; Sylvester, C.; Wong, M.


    Fermilab is building a Vertical Cavity Test Facility (VCTF) to provide for R and D and pre-production testing of bare 9-cell, 1.3-GHz superconducting RF (SRF) cavities for the International Linear Collider (ILC) program. This facility is located in the existing Industrial Building 1 (IB1) where the Magnet Test Facility (MTF) also resides. Helium and nitrogen cryogenics are shared between the VCTF and MTF including the existing 1500-W at 4.5-K helium refrigerator with vacuum pumping for super-fluid operation (125-W capacity at 2-K). The VCTF is being constructed in multiple phases. The first phase is scheduled for completion in mid 2007, and includes modifications to the IB1 cryogenic infrastructure to allow helium cooling to be directed to either the VCTF or MTF as scheduling demands require. At this stage, the VCTF consists of one Vertical Test Stand (VTS) cryostat for the testing of one cavity in a 2-K helium bath. Planning is underway to provide a total of three Vertical Test Stands at VCTF, each capable of accommodating two cavities. Cryogenic infrastructure improvements necessary to support these additional VCTF test stands include a dedicated ambient temperature vacuum pump, a new helium purification skid, and the addition of helium gas storage. This paper describes the system design and initial cryogenic operation results for the first VCTF phase, and outlines future cryogenic infrastructure upgrade plans for expanding to three Vertical Test Stands.

  9. Cryogenic infrastructure for Fermilab's ILC vertical cavity test facility

    SciTech Connect

    Carcagno, R.; Ginsburg, C.; Huang, Y.; Norris, B.; Ozelis, J.; Peterson, T.; Poloubotko, V.; Rabehl, R.; Sylvester, C.; Wong, M.; /Fermilab


    Fermilab is building a Vertical Cavity Test Facility (VCTF) to provide for R&D and pre-production testing of bare 9-cell, 1.3-GHz superconducting RF (SRF) cavities for the International Linear Collider (ILC) program. This facility is located in the existing Industrial Building 1 (IB1) where the Magnet Test Facility (MTF) also resides. Helium and nitrogen cryogenics are shared between the VCTF and MTF including the existing 1500-W at 4.5-K helium refrigerator with vacuum pumping for super-fluid operation (125-W capacity at 2-K). The VCTF is being constructed in multiple phases. The first phase is scheduled for completion in mid 2007, and includes modifications to the IB1 cryogenic infrastructure to allow helium cooling to be directed to either the VCTF or MTF as scheduling demands require. At this stage, the VCTF consists of one Vertical Test Stand (VTS) cryostat for the testing of one cavity in a 2-K helium bath. Planning is underway to provide a total of three Vertical Test Stands at VCTF, each capable of accommodating two cavities. Cryogenic infrastructure improvements necessary to support these additional VCTF test stands include a dedicated ambient temperature vacuum pump, a new helium purification skid, and the addition of helium gas storage. This paper describes the system design and initial cryogenic operation results for the first VCTF phase, and outlines future cryogenic infrastructure upgrade plans for expanding to three Vertical Test Stands.

  10. Photon storage cavities

    SciTech Connect

    Kim, K.J.; Sessler, A.M.


    A general analysis is presented of a photon storage cavity, coupled to free-electron laser (FEL) cavity. It is shown that if the coupling between the FEL cavity and the storage cavity is unidirectional (for example, a ring resonator storage cavity) then storage is possible, but that if the coupling is bi-directional then storage is not possible. Parameters are presented for an infra-red FEL storage cavity giving an order of magnitude increase in the instantaneous photon power within the storage cavity. 4 refs., 3 figs.

  11. Segmented trapped vortex cavity

    NASA Technical Reports Server (NTRS)

    Grammel, Jr., Leonard Paul (Inventor); Pennekamp, David Lance (Inventor); Winslow, Jr., Ralph Henry (Inventor)


    An annular trapped vortex cavity assembly segment comprising includes a cavity forward wall, a cavity aft wall, and a cavity radially outer wall there between defining a cavity segment therein. A cavity opening extends between the forward and aft walls at a radially inner end of the assembly segment. Radially spaced apart pluralities of air injection first and second holes extend through the forward and aft walls respectively. The segment may include first and second expansion joint features at distal first and second ends respectively of the segment. The segment may include a forward subcomponent including the cavity forward wall attached to an aft subcomponent including the cavity aft wall. The forward and aft subcomponents include forward and aft portions of the cavity radially outer wall respectively. A ring of the segments may be circumferentially disposed about an axis to form an annular segmented vortex cavity assembly.

  12. A new microphonics measurement method for superconducting RF cavities

    SciTech Connect

    Gao, Zheng; He, Yuan; Chang, Wei; Powers, Tom; Yue, Wei-ming; Zhu, Zheng-long; Chen, Qi


    Mechanical vibrations of the superconducting cavity, also known as microphonics, cause shifts in the resonant frequency of the cavity. In addition to requiring additional RF power, these frequency shifts can contribute to errors in the closed loop phase and amplitude regulation. In order to better understand these effects, a new microphonics measurement method was developed, and the method was successfully used to measure microphonics on the half-wave superconducting cavity when it was operated in a production style cryostat. The test cryostat held a single β=0.1 half-wave cavity which was operated at 162.5 MHz [1] and [2]. It's the first time that the National Instruments PXIe-5641R intermediate frequency transceiver has been used for microphonics measurements in superconducting cavities. The new microphonics measurement method and results will be shown and analyzed in this paper.

  13. 47 CFR 15.245 - Operation within the bands 902-928 MHz, 2435-2465 MHz, 5785-5815 MHz, 10500-10550 MHz, and 24075...

    Code of Federal Regulations, 2010 CFR


    ... limited to intentional radiators used as field disturbance sensors, excluding perimeter protection systems... field disturbance sensors operating in the 24075-24175 MHz band and for other field disturbance sensors... disturbance sensors, 7.5 mV/m. (iii) Field disturbance sensors designed to be used in motor vehicles...

  14. 47 CFR 15.245 - Operation within the bands 902-928 MHz, 2435-2465 MHz, 5785-5815 MHz, 10500-10550 MHz, and 24075...

    Code of Federal Regulations, 2011 CFR


    ... limited to intentional radiators used as field disturbance sensors, excluding perimeter protection systems... field disturbance sensors operating in the 24075-24175 MHz band and for other field disturbance sensors... disturbance sensors, 7.5 mV/m. (iii) Field disturbance sensors designed to be used in motor vehicles...

  15. 47 CFR 15.245 - Operation within the bands 902-928 MHz, 2435-2465 MHz, 5785-5815 MHz, 10500-10550 MHz, and 24075...

    Code of Federal Regulations, 2014 CFR


    ... limited to intentional radiators used as field disturbance sensors, excluding perimeter protection systems... field disturbance sensors operating in the 24075-24175 MHz band and for other field disturbance sensors... disturbance sensors, 7.5 mV/m. (iii) Field disturbance sensors designed to be used in motor vehicles...

  16. 47 CFR 15.245 - Operation within the bands 902-928 MHz, 2435-2465 MHz, 5785-5815 MHz, 10500-10550 MHz, and 24075...

    Code of Federal Regulations, 2012 CFR


    ... limited to intentional radiators used as field disturbance sensors, excluding perimeter protection systems... field disturbance sensors operating in the 24075-24175 MHz band and for other field disturbance sensors... disturbance sensors, 7.5 mV/m. (iii) Field disturbance sensors designed to be used in motor vehicles...

  17. 47 CFR 15.245 - Operation within the bands 902-928 MHz, 2435-2465 MHz, 5785-5815 MHz, 10500-10550 MHz, and 24075...

    Code of Federal Regulations, 2013 CFR


    ... limited to intentional radiators used as field disturbance sensors, excluding perimeter protection systems... field disturbance sensors operating in the 24075-24175 MHz band and for other field disturbance sensors... disturbance sensors, 7.5 mV/m. (iii) Field disturbance sensors designed to be used in motor vehicles...


    SciTech Connect

    Massaro, F.; Funk, S.; Giroletti, M.; Paggi, A.; D'Abrusco, R.; Tosti, G.


    Blazars are the most extreme class of active galactic nuclei. Despite a previous investigation at 102 MHz for a small sample of BL Lac objects and our recent analysis of blazars detected in the Westerbork Northern Sky Survey, a systematic study of the blazar spectral properties at frequencies below 100 MHz has been never carried out. In this paper, we present the first analysis of the radio spectral behavior of blazars based on the recent Very Large Array Low-frequency Sky Survey (VLSS) at 74 MHz. We search for blazar counterparts in the VLSS catalog, confirming that they are detected at 74 MHz. We then show that blazars present radio-flat spectra (i.e., radio spectral indices of ∼0.5) when evaluated, which also about an order of magnitude in frequency lower than previous analyses. Finally, we discuss the implications of our findings in the context of the blazars-radio galaxies connection since the low-frequency radio data provide a new diagnostic tool to verify the expectations of the unification scenario for radio-loud active galaxies.

  19. Determination of bulk and surface superconducting properties of N2-doped cold worked, heat treated and electro-polished SRF grade niobium

    SciTech Connect

    Chetri, Santosh; Larbalestier, David C.; Lee, Peter J.; Dhakal, Pashupati; Sung, Zu -Hawn


    In this study, nitrogen-doped cavities show significant performance improvement in the medium accelerating field regime due to a lowered RF surface resistivity. However, the mechanism of enhancement has not been clearly explained. Our experiments explore how N2-doping influences Nb bulk and surface superconducting properties, and compare the N2-doped properties with those obtained previously with conventionally treated samples. High purity Nb-rod was mechanically deformed and post treated based on a typical SRF cavity treatment recipe. The onset of flux penetration at Hc1, and the upper and the surface critical fields, Hc2 and Hc3, were characterized by magnetic hysteresis and AC susceptibility techniques. The surface depth profile responsible for superconductivity was examined by changing AC amplitude in AC susceptibility, and the microstructure was directly observed with EBSD-OIM. We are also investigating surface chemistry for detailed composition using XPS. We have found that N2-doping at 800 °C significantly reduces the Hc3/Hc2 ratio towards the ideal value of ~1.7, and conclude that AC susceptibility is capable of following changes to the surface properties induced by N2-doping.

  20. Determination of bulk and surface superconducting properties of N2-doped cold worked, heat treated and electro-polished SRF grade niobium


    Chetri, Santosh; Larbalestier, David C.; Lee, Peter J.; Dhakal, Pashupati; Sung, Zu -Hawn


    In this study, nitrogen-doped cavities show significant performance improvement in the medium accelerating field regime due to a lowered RF surface resistivity. However, the mechanism of enhancement has not been clearly explained. Our experiments explore how N2-doping influences Nb bulk and surface superconducting properties, and compare the N2-doped properties with those obtained previously with conventionally treated samples. High purity Nb-rod was mechanically deformed and post treated based on a typical SRF cavity treatment recipe. The onset of flux penetration at Hc1, and the upper and the surface critical fields, Hc2 and Hc3, were characterized by magnetic hysteresis and AC susceptibilitymore » techniques. The surface depth profile responsible for superconductivity was examined by changing AC amplitude in AC susceptibility, and the microstructure was directly observed with EBSD-OIM. We are also investigating surface chemistry for detailed composition using XPS. We have found that N2-doping at 800 °C significantly reduces the Hc3/Hc2 ratio towards the ideal value of ~1.7, and conclude that AC susceptibility is capable of following changes to the surface properties induced by N2-doping.« less