Science.gov

Sample records for mineiros-go um estudo

  1. Um Guia de Estudo 4 a Edicao

    E-print Network

    Cabral, Marco

    a grande dificuldade dos alunos compreende­ rem os conceitos principais: Classes de Equivalâ??encia, Anel define­se Im(f) = {b # B; b = f(a) com a # A}. Definiâ?ºcâ?ao: IMAGEM INVERSA -- Denota­se e define­se: f -1 (C) = {a # A; f(a) # C} . A imagem inversa â??e um subconjunto do domâ??�nio. Obs: Nâ?ao confundir com fun

  2. (continuao das responsabilidades) um estudo em que voc talvez se inscreva, possvel

    E-print Network

    (continuação das responsabilidades) um estudo em que você talvez se inscreva, é possível também que(locais) do estudo. · Seguir as instruções dos pesquisadores. · Certificar-se de que suas informações sobre passado/presente, se for relevante para o estudo. · Buscar a assistência à saúde para qualquer problema

  3. Um Guia de Estudo Marco Aurelio Palumbo Cabral

    E-print Network

    Cabral, Marco

    compreende- rem os conceitos principais: Classes de Equival^encia, Anel Quociente, Teorema do Homomorfismo}. Defini¸c~ao: IMAGEM INVERSA ­ Denota-se e define-se: f-1 (C) = {a A; f(a) C} . A imagem inversa ´e um subconjunto do dom´inio. Obs: N~ao confundir com fun¸c~ao inversa, que associa ele- mentos de B a A. A imagem

  4. Providing Meaningful Learning for Students of the Sixth Grade of Middle School: a Study on the Moon Phases. (Breton Title: Propiciando Aprendizagem Significativa Para Alunos do Sexto Ano do Ensino Fundamental: um Estudo sobre as Fases da Lua.) Propiciando el Aprendizaje Significativo Para Alumnos del Sexto Nivel de la Educación General Básica: un Estudio sobre Las Fases de la Luna

    NASA Astrophysics Data System (ADS)

    Darroz, Luiz Marcelo; Samudio Pérez, Carlos Ariel; da Rosa, Cleci Werner; Heineck, Renato

    2012-07-01

    We relate in this article a didactic experience studying the moon phases with a group of middle school students of a private school of the municipality of Passo Fundo, RS. Based on David Ausubel's Meaningful Learning Theory, we have sought to develop a proposal following a didactic model which simulates the phases of the Moon, as based on the previous conceptions of the students. The signs of learning were evidenced by means of memory registries of the activity. From the obtained results we believe that the proposal achieved its goals, since the students were able to identify, differentiate and transfer the phenomenon of the moon phases to new contexts. Thus, it is concluded that a methodology focused on a meaningful content for the students is fundamental to the construction and genuine grasping of what is being learned. Neste artigo, relata-se uma experiência didática de estudo das fases da Lua com uma turma do 6° ano do Ensino Fundamental, de uma escola privada do município de Passo Fundo, RS. Tendo como fundamentação teórica a Teoria da Aprendizagem Significativa de David Ausubel, buscou-se desenvolver a proposta a partir de um modelo didático que simula as fases da Lua e com base nas concepções prévias dos estudantes. Os indícios da aprendizagem foram constatados através de registros de memórias da atividade. Pelos resultados apresentados, acredita-se que a proposta alcançou seus objetivos, uma vez que os estudantes conseguiram identificar, diferenciar e transferir o fenômeno das fases da Lua para novos contextos. Assim, conclui-se que uma metodologia com enfoque em um conteúdo significativo ao estudante é fundamental para a construção e compreensão genuína do que está sendo aprendido. En este artículo se relata una experiencia didáctica de estudio de las fases de la Luna con una clase de 6º año de la educación general básica de una escuela privada del municipio de Passo Fundo, RS. Teniendo como fundamentación teórica la Teoría del Aprendizaje Significativo de David Ausubel, se buscó desenvolver la propuesta a partir de un modelo didáctico que simula las Fases de la Luna, usando como base las concepciones previas de los estudiantes. Los indicios del aprendizaje fueron verificados a través de registros de memorias de la actividad. Por los resultados obtenidos creemos que la propuesta alcanzó sus objetivos, una vez que los estudiantes consiguieron identificar y transferir el fenómeno de las fases de la Luna para nuevos contextos. Así, se concluye que una metodología con enfoque en un contenido significativo para el estudiante es fundamental para la construcción y comprensión genuina de lo que está siendo aprendido.

  5. Antonia Lucinelma Pessoa Albuquerque Cenarios Virtuais com um Estudo de

    E-print Network

    de Figueiredo, Luiz Henrique

    A maioria das refer^encias usadas neste trabalho, tanto livros quanto artigos, est~ao em ingl^es. Natural- mente, no decorrer dos anos formou-se uma terminologia t´ecnica da ´area, em ingl^es. A traduc¸~ao destes termos para o portugu^es, j´a largamente usados em ingl^es, ao inv´es de contribuir para

  6. On the Formation of a Study Group to the Realization of Workshops for Teachers: Astronomy in Basic Education in Umuarama-Pr (Spanish Title: De la Formación de un Grupo de Estudios a la Realización de los Talleres Para los Profesores: la Astronomía en la Educación Básica en Umuarama-Pr ) Da Formação de um Grupo de Estudos À Realização de Oficinas Para Professores: a Astronomia na Educação Básica em Umuarama-Pr

    NASA Astrophysics Data System (ADS)

    Belusso, Diane; Akira Sakai, Otávio

    2013-12-01

    In this article, we aimed to present the activities developed by the Astronomy Study Group (ASG) to contribute to the dissemination and improvement of the astronomy teaching-learning. The results of a research carried out in schools of Umuarama-PR are shown, with the intention of checking the students' knowledge and interest in relation to Astronomy. It is reported the realization of workshops for Science teachers linked to the Education Regional Nucleus. The research and the workshop execution promoted the direct contact of the study group with the community; the results were used to diagnose the state of astronomy teaching-learning, in the basic education in Umuarama-PR. En este artículo se intenta presentar las actividades desarrolladas por el Grupo de Estudios de Astronomía (GEA) y contribuir para la divulgación y mejoría de la enseñanza-aprendizaje de la Astronomía. Se presentan los resultados de una investigación realizada en las escuelas de Umuarama-PR, con la intención de determinar el grado de conocimiento y el interés de los estudiantes en relación a la astronomía. Se relata la realización de talleres de capacitación para los profesores de ciencias vinculados al Núcleo Regional del Educación. La ejecución de la investigación y de los talleres promovió el contacto directo del grupo de estudios con la comunidad; los resultados sirvieron de diagnóstico de la enseñanza aprendizaje de la astronomía en la educación básica en Umuarama-PR. Neste artigo, objetiva-se apresentar as atividades desenvolvidas pelo Grupo de Estudos de Astronomia (GEA) e contribuir para a divulgação e melhoria do ensino-aprendizagem de astronomia. São apresentados os resultados de uma pesquisa realizada nas escolas de Umuarama-PR, com o intuito de averiguar o conhecimento e o interesse dos estudantes em relação à astronomia. Relata-se a realização de oficinas de capacitação para professores de ciências vinculados ao Núcleo Regional de Educação. A execução da pesquisa e das oficinas promoveu o contato direto do grupo de estudos com a comunidade; os resultados serviram de diagnóstico do ensino-aprendizagem de astronomia, na educação básica, em Umuarama-PR.

  7. Scholarship Appeal Form Name: UM ID#:790-

    E-print Network

    Vonessen, Nikolaus

    Scholarship Appeal Form Name: UM ID#:790- E-Mail: Phone#: Will this be your first year attending UM? Yes No 2015/16 Grade Level: Freshman Sophomore Junior Senior I. Scholarship Information: Name of Renewable Scholarship: Full-time continuous enrollment (autumn/spring) is required for your scholarship. See

  8. Estudo comparativo entre estrelas centrais de nebulosas planetárias deficientes em hidrogênio

    NASA Astrophysics Data System (ADS)

    Marcolino, W. L. F.; de Araújo, F. X.

    2003-08-01

    Apresentamos neste trabalho o resultado de um estudo das principais características espectrais das estrelas centrais de nebulosas planetárias (ECNP) deficientes em hidrogênio. A origem e a evolução dessas estrelas ainda constitui um problema em aberto na evolução estelar. Geralmente esses objetos são divididos em [WCE], [WCL] e [WELS]. Os tipos [WCE] e [WCL] apresentam um espectro típico de uma estrela Wolf-Rayet carbonada de população I e as [WELS] apresentam linhas fracas de carbono e oxigênio em emissão. Existem evidências que apontam a seguinte sequência evolutiva : [WCL] = > [WCE] = > [WELS] = > PG 1159 (pré anã-branca). No entanto, tal cenário apresenta falhas como por exemplo a falta de ECNP entre os tipos [WCL] e [WCE]. Baseados em uma amostra de 24 objetos obtida no telescópio de 1.52m em La Silla, Chile (acordo ESO/ON), ao longo do ano 2000, apresentamos os resultados da comparação das larguras equivalentes de diversas linhas relevantes entre os tipos [WCL], [WCE] e [WELS]. Verificamos que nossos dados estão de acordo com a sequência evolutiva. Baseado nas linhas de C IV, conseguimos dividir pela primeira vez as [WELS] em dois grupos principais. Além disso, os dados reforçam a afirmação de que as [WCE] são as estrelas que possuem a maior temperatura entre as ECNP deficientes em hidrogênio. Discutimos ainda, a escassez de dados disponíveis na literatura e a necessidade da obtenção de parametros físicos para estes objetos.

  9. Otimização de procedimento de manobra para indução de reentrada de um satélite retornável

    NASA Astrophysics Data System (ADS)

    Schulz, W.; Suarez, M.

    2003-08-01

    Veículos espaciais que retornam à Terra passam por regimes de velocidade e condições de vôo distintos. Estas diferenças dificultam sua concepção aerodinâmica e o planejamento de seu retorno. A partir de uma proposta de um veículo orbital retornável (satélite SARA, em desenvolvimento no IAE/CTA) para realização de experimentos científicos e tecnológicos em ambiente de baixa gravidade, surge a necessidade de realizarem-se estudos considerando-se os aspectos relativos à sua aerodinâmica. Após o lançamento, o veículo deve permanecer em órbita pelo tempo necessário para a condução de experimentos, sendo depois direcionado à Terra e recuperado em solo. A concepção aerodinâmica é de importância para o vôo em suas diversas fases e deve considerar aspectos relativos à estabilização Aerodinâmica e ao arrasto atmosférico, sendo este último de importância crucial na análise do aquecimento a ser enfrentado. A manobra de retorno inclui considerações sobre as condições atmosféricas e dinâmica de reentrada, devendo ser calculada de forma mais precisa possível. O trabalho proposto avalia estudos da dinâmica de vôo de um satélite recuperável considerando aspectos relativos à determinação orbital com GPS, técnica utilizada com sucesso na CONAE, e seu comportamento aerodinâmico em vôo balístico de retorno, com ênfase em sua fase de reentrada atmosférica. Busca-se otimizar a manobra de reentrada de tal forma que a utilização do sistema GPS garanta minimizar a área de impacto com o solo.

  10. UM STUDENTS HELP DEMO NOAA HURRICANE BALLOONS

    E-print Network

    Miami, University of

    balloons to the launch site. #12;WWW.RSMAS.MIAMI.EDU (Continued from page 1) SOUNDINgS IS FOR golfUM STUDENTS HELP DEMO NOAA HURRICANE BALLOONS Meteorology and Physical Oceanography students, with the launch of new hurricane balloons to be used for improving hurricane track and intensity forecasts

  11. Estudo exaustivo e sistemático de erros nas provas da olimpíada brasileira de astronomia - resultados preliminares

    NASA Astrophysics Data System (ADS)

    Oliveira, F. S.; Canalle, J. B. G.; Villas da Rocha, J. F.

    2003-08-01

    A Olimpíada Brasileira de Astronomia (OBA) contou, em sua quinta edição, com a participação de mais de 60 mil alunos dos ensinos fundamental e médio de praticamente todo o território nacional. Uma das formas de controle que a sua coordenação nacional possui sobre a correção, levada a cabo pelos professores que as aplicaram, é a do envio, por parte destes professores, das 10 melhores provas de cada um dos três níveis nos quais a Olimpíada é realizada. Assim, e dado ao caráter discursivo das provas da Olimpíada, a sua coordenação nacional dispõe de um vasto acervo sobre as concepções, certas ou erradas, dos alunos que dela participaram. Este conjunto de dados jamais fora explorado até o presente trabalho que pretende ser, neste sentido, inaugural. Nas provas dos níveis I e II da V OBA, que abrangem todo o conjunto do ensino fundamental, uma das questões versava sobre a noção que os alunos tinham sobre como os habitantes da Terra situam-se sobre sua superfície. Fizemos um estudo sistemático das respostas a esta questão. Primeiramente, todas as modalidades de erros foram levantadas; em seguida, realizamos uma distribuição por idade tanto do índice de acerto como da ocorrência e da distribuição de cada erro. Como resultado, obtivemos que, em ambos os níveis: 1) as concepções errôneas não se apresentam distribuídas aleatoriamente; 2) há uma concentração no tipo de erro apresentado; 3) há uma tendência de progressivo acerto com relação à idade quando os dados são considerados em termos nacionais; 4) esta tendência nacional é fraca ou mesmo não é verificada em alguns dos estados com maior patamar de acerto.

  12. Passaremos agora ao estudo de sistemas com mais de um grau de liberdade. Existe a um salto qualitativo muito grande devido ao fato de que, em geral, sistemas com mais de um grau de liberdade so

    E-print Network

    de Aguiar, Marcus A. M.

    uma condição inicial ( ) ( ) q R q,0 = , a solução dessa equação diferencial é [22] [ ]dt no tempo t. Os momentos inicial e final são dados por p R q 0 0 = e p q = . Dessa forma, a evolução do tempo. Soluções completas dessa equação diferencial só existem quando o Hamiltoniano é integrável

  13. Isomeric-to-prompt fission ratios for the uranium fission isomers 236Um and 238Um

    NASA Astrophysics Data System (ADS)

    Tischler, R.; Kleinrahm, A.; Kroth, R.; Günther, C.

    1980-07-01

    Fission isomers in 236U and 238U have been populated in 235U(d, p)236Um, 236U(d, pn)236Um, and the 238U(d, pn)238Um reactions. Time spectra of fission fragments with respect to the cyclotron beam pulses have been measured. From these measurements the isomeric-to-prompt fission ratios are derived for deuteron energies ranging from 17 to 25 MeV. The isomeric-to-prompt ratios show a distinct maximum around 20 MeV for the (d, pn) reactions, whereas a monotonic decrease is observed for the 235U(d, p)236Um reaction. NUCLEAR REACTIONS, FISSION 235U(d, pf) and 236,238U(d, pnf), measured delayed fission fragment time spectra, deduced isomeric-to-prompt fission ratios.

  14. The rich 6 to 9 um spectrum of interstellar PAHs

    E-print Network

    E. Peeters; S. Hony; C. Van Kerckhoven; A. G. G. M. Tielens; L. J. Allamandola; D. M. Hudgins; C. W. Bauschlicher

    2002-05-23

    Here, we present 6-9 um spectra of a sample of RNe, HII regions, YSOs, evolved stars and galaxies that show strong unidentified infrared bands, obtained with the ISO-SWS. The IR emission features show pronounced variations. 1) The 6.2 um feature shifts and clearly shows profile variations. 2) The 7.7 um complex is comprised of at least two subpeaks peaking at 7.6 and one longwards of 7.7 um. In some cases the main peak can apparently shift up to 8 um. Two sources do not exhibit a 7.7 um complex but instead show a broad emission feature at 8.22 um. 3) The 8.6 um feature has a symmetric profile in all sources and some sources exhibit this band at slightly longer wavelengths. For the 6.2, 7.7 and 8.6 um features, the sources have been classified independently based on their profile and peak position. The classes derived for these features are directly linked with each other. Furthermore, the observed 6--9 um spectrum depends on the type of object. We attribute the observed 6.2 um profile and peak position to the combined effect of a PAH family and anharmonicity with pure PAHs representing the 6.3 um component and substituted/complexed PAHs representing the 6.2 um component. The 7.6 um component is well reproduced by both pure and substituted/complexed PAHs but the 7.8 um component remains an enigma. In addition, the exact identification of the 8.22 um feature remains unknown. The observed variations in the characteristics of the IR emission bands are linked to the local physical conditions. Possible formation and evolution processes that may influence the interstellar PAH class are highlighted.

  15. ARTIGO INTERNET Um milho de euros para estudar buracos negros

    E-print Network

    Instituto de Sistemas e Robotica

    NewsSearch ARTIGO INTERNET Um milhão de euros para estudar buracos negros in http estudar buracos negros Vítor Cardoso , investigador do Departamento de Física do Instituto Superior milhão de euros, para estudar a colisão de buracos negros - um processo fundamental em Relatividade Geral

  16. "Uh" and "Um" Revisited: Are They Interjections for Signaling Delay?

    ERIC Educational Resources Information Center

    O'Connell, Daniel C.; Kowal, Sabine

    2005-01-01

    Clark and Fox Tree (2002) have presented empirical evidence, based primarily on the London-Lund corpus (LL; Svartvik & Quirk, 1980), that the fillers "uh" and "um" are conventional English words that signal a speaker's intention to initiate a minor and a major delay, respectively. We present here empirical analyses of "uh" and "um" and of silent…

  17. Um Primeiro Curso sobre Teoria Ergdica com Aplicaes

    E-print Network

    Moreira, Carlos Gustavo

    Um Primeiro Curso sobre Teoria Ergódica com Aplicações #12;#12;Publicações Matemáticas Um Primeiro Curso sobre Teoria Ergódica com Aplicações Krerley Oliveira UFAL impa 25o Colóquio Brasileiro de Software Livre/Gratuito - Alejandro C. Frery e Francisco Cribari-Neto · Espaços de Hardy no Disco Unitário

  18. Instituto Nacional de Pesquisas Espaciais -INPE Centro de Previso de Tempo e Estudos Climticos -CPTEC

    E-print Network

    Instituto Nacional de Pesquisas Espaciais - INPE Centro de Previsão de Tempo e Estudos Climáticos acoplado OceanoAtmosfera (MCGOA) do Centro de Previsão de Tempo e Estudos Climáticos do Instituto Nacional

  19. Estudo de não gaussianidade nas anisotropias da RCF medidas Wmap

    NASA Astrophysics Data System (ADS)

    Andrade, A. P. A.; Wuensche, C. A.; Ribeiro, A. L. B.

    2003-08-01

    A investigação do campo de flutuações da Radiação Cósmica de Fundo (RCF) pode oferecer um importante teste para os modelos cosmológicos que descrevem a origem e a evolução das flutuações primordiais. De um lado, apresenta-se o modelo inflacionário que prevê um espectro de flutuações adiabáticas distribuídas segundo uma gaussiana e, de outro, os modelos de defeitos topológicos (dentre outros) que descrevem um mecanismo para a geração de flutuações de isocurvatura que obedecem a uma distribuição não gaussiana. Este trabalho tem como objetivo caracterizar traços do modelo não gaussiano de campo misto (entre flutuações adiabáticas e de isocurvatura) nos mapas do Wilkinson Microwave Anisotropy Probe (WMAP). Simulações das anisotropias da RCF no contexto de mistura indicam traços marcantes na distribuição das flutuações de temperatura, mesmo quando consideradas pequenas contribuições do campo de isocurvatura (da ordem de 0.001). O efeito da mistura entre os campos resulta na transferência de potência de flutuações em escalas angulares intermediárias para flutuações em pequenas escalas angulares. Este efeito pode ser caracterizado pela relação entre as amplitudes dos primeiros picos acústicos no espectro de potência da RCF. Neste trabalho, investigamos a contribuição do campo de isocurvatura, no contexto de mistura, sobre as observações recentes da RCF realizadas pelo WMAP. As previsões do modelo de campo misto, uma vez confrontadas com as observações em pequenas escalas angulares, podem ajudar a revelar a natureza das flutuações primordiais.

  20. Administrac~ao de Risco -2007 Guia de Estudos #1

    E-print Network

    Zubelli, Jorge Passamani

    1 e 2. 2. Apresente 3 exemplos de fun¸c~oes objetivo para um investidor, interpretando-as. 3. Defina´olio para: 1 #12;· VaR Delta-Normal · VaR Delta-Gama 7. Suponha que o objetivo do investidor ´e uma fun

  1. Commercial Motor Vehicle Roadside Technology Consor um (CMVRTC)

    E-print Network

    Commercial Motor Vehicle Roadside Technology Consor um (CMVRTC) The Commercial Motor Vehicle, evaluation, and showcase innovative commercial motor vehicle (CMV) safety technologies under real; · Support the development of functional specifications for a Smart Infrared Inspection System (SIRIS

  2. Priorities, Themes, & Strategic Objectives President Wolfe's UM System Priorities

    E-print Network

    Missouri-Rolla, University of

    Priorities, Themes, & Strategic Objectives President Wolfe's UM System Priorities I. Strategic, stimulating Missouri's economy with the creation of new businesses and jobs. VI. Effective Communication of our Value and Importance: Improve communication outreach by relaying how the university reaches every

  3. Uh and um revisited: are they interjections for signaling delay?

    PubMed

    O'Connell, Daniel C; Kowal, Sabine

    2005-11-01

    Clark and Fox Tree (2002) have presented empirical evidence, based primarily on the London-Lund corpus (LL; Svartvik & Quirk, 1980), that the fillers uh and um are conventional English words that signal a speaker's intention to initiate a minor and a major delay, respectively. We present here empirical analyses of uh and um and of silent pauses (delays) immediately following them in six media interviews of Hillary Clinton. Our evidence indicates that uh and um cannot serve as signals of upcoming delay, let alone signal it differentially: In most cases, both uh and um were not followed by a silent pause, that is, there was no delay at all; the silent pauses that did occur after um were too short to be counted as major delays; finally, the distributions of durations of silent pauses after uh and um were almost entirely overlapping and could therefore not have served as reliable predictors for a listener. The discrepancies between Clark and Fox Tree's findings and ours are largely a consequence of the fact that their LL analyses reflect the perceptions of professional coders, whereas our data were analyzed by means of acoustic measurements with the PRAAT software (www.praat.org). A comparison of our findings with those of O'Connell, Kowal, and Ageneau (2005) did not corroborate the hypothesis of Clark and Fox Tree that uh and um are interjections: Fillers occurred typically in initial, interjections in medial positions; fillers did not constitute an integral turn by themselves, whereas interjections did; fillers never initiated cited speech, whereas interjections did; and fillers did not signal emotion, whereas interjections did. Clark and Fox Tree's analyses were embedded within a theory of ideal delivery that we find inappropriate for the explication of these phenomena. PMID:16341914

  4. Prolegomenos a um estudo da lingua brasileira nos terreiros de origem africana (Prolegomena to a Study of the Brazilian Language of the Voodoo Rites of African Origin).

    ERIC Educational Resources Information Center

    Megenney, William W.

    Determination of the authenticity of lexical items with Sub-Saharan origin in the voodoo rites of candomble and umbanda in Brazil requires establishing a socio-historical basis for the African diaspora and the current configuration of terreiros. The terreiros demonstrate varying linguistic repertoires according to their affiliation with candomble…

  5. Impa, um centro de estudos que faz bonito no Rio Publicada em 23/05/2009 s 18h04m

    E-print Network

    de Figueiredo, Luiz Henrique

    ) no mesmo ano, reforça como o instituto mantém o país entre os melhores do gênero: 1,50, em pé de igualdade Aplicada (Impa) faz bonito na escala mundial de entidades do gênero. Segundo indicadores de produção

  6. UM05 -Personalization for e-Health Handheld computing

    E-print Network

    Grasso, Floriana

    , Roberto Valenti Università Campus Bio-Medico, Rome #12;UM05 - Personalization for e-Health Contents Design. Currently it includes the Faculty of Medicine and the Faculty of Engineering. The University Hospital (15 departments - 124 beds) is close to the didactic seat it includes an out patients Clinic, a day-hospital unit

  7. Universal Monitor (UM) for OTEC compact heat exchangers

    SciTech Connect

    Kuzay, T.M.

    1981-09-01

    Universal Monitor (UM), is a device-independent concept to measure, with precision, the initiation and progression of fouling in any given OTEC Compact Heat Exchanger model with or without the application of countermeasures. Design description and supporting analyses for the Universal Monitor for OTEC Compact Heat Exchangers are presented.

  8. RESEARCH ARTICLE QuorUM: An Error Corrector for Illumina

    E-print Network

    Yorke, James

    RESEARCH ARTICLE QuorUM: An Error Corrector for Illumina Reads Guillaume Marçais*, James A. Yorke@umd.edu (GM) Abstract Motivation Illumina Sequencing data can provide high coverage of a genome by relatively × coverage Illumina data on average has an error in some read at every base in the genome. These errors make

  9. UM-AR-GPS-ROVER AUGMENTED REALITY PLATFORM VISUALIZATION OF

    E-print Network

    Kamat, Vineet R.

    UM-AR-GPS-ROVER AUGMENTED REALITY PLATFORM VISUALIZATION OF CONSTRUCTION GRAPHICS IN OUTDOOR AUGMENTED REALITY By Amir H. Behzadan and Vineet R. Kamat UMCEE Report No. 05-09 Civil and Environmental the project objective and flows to the current state-of-the-art in Augmented Reality followed by a number

  10. The International Space Station Urine Monitoring System (UMS)

    NASA Technical Reports Server (NTRS)

    Feeback, Daniel L.; Cibuzar, Branelle R.; Milstead, Jeffery R.; Pietrzyk,, Robert A.; Clark, Mark S.F.

    2009-01-01

    A device capable of making in-flight volume measurements of single void urine samples, the Urine Monitoring System (UMS), was developed and flown on seven U.S. Space Shuttle missions. This device provided volume data for each urine void from multiple crewmembers and allowed samples of each to be taken and returned to Earth for post-flight analysis. There were a number of design flaws in the original instrument including the presence of liquid carry-over producing invalid "actual" micturition volumes and cross-contamination between successive users from residual urine in "dead" spots". Additionally, high or low volume voids could not be accurately measured, the on-orbit calibration and nominal use sequence was time intensive, and the unit had to be returned and disassembled to retrieve the volume data. These problems have been resolved in a new version, the International Space Station (ISS) UMS, that has been designed to provide real-time in-flight volume data with accuracy and precision equivalent to measurements made on Earth and the ability to provide urine samples that are unadulterated by the device. Originally conceived to be interfaced with a U.S.-built Waste Collection System (WCS), the unit now has been modified to interface with the Russian-supplied Sanitary Hygiene Device (ASY). The ISS UMS provides significant advantages over the current method of collecting urine samples into Urine Collection Devices (UCDs), from which samples are removed and returned to Earth for analyses. A significant future advantage of the UMS is that it can provide an interface to analytical instrumentation that will allow real-time measurement of urine bioanalytes allowing monitoring of crewmember health status during flight and the ability to provide medical interventions based on the results of these measurements. Currently, the ISS UMS is scheduled to launch along with Node-3 on STS-130 (20A) in December 2009. UMS will be installed and scientific/functional verification completed prior to placing the instrument into operation. Samples collected during the verification sequence will be returned for analyses on STS-131 (19A) currently scheduled for launch in March 2010. The presence of a UMS on ISS will provide the capability to conduct additional collaborative human life science investigations among the ISS International Partners.

  11. STS-40 Exp. No. 192 urine monitoring system (UMS) on OV-102's middeck

    NASA Technical Reports Server (NTRS)

    1991-01-01

    STS-40 Experiment No. 192, Fluid-Electrolyte Regulation During Space Flight, urine monitoring system (UMS) is set up on the middeck of Columbia, Orbiter Vehicle (OV) 102, at the side hatch. The UMS is attached to OV-102's waste collection system (WCS). The urine specimen tray with sample tubes appears to the right of the UMS equipment.

  12. On Um -numbers with small transcendence measure Kamil Alnia cik, Yusuf Avci (Istanbul)

    E-print Network

    Bugeaud, Yann

    ) The purpose of the present note is to present a new, e#11;ective method for constructing real Um -numbers #24 Proposition 1 below is e#11;ective. It is expected that there exist Um -numbers #24; with w #3; n (#24;) = nOn Um -numbers with small transcendence measure Kamil Alnia#24;cik, Yusuf Avci (Istanbul) & Yann

  13. UM Computer Science 2014-2015 Health History Form & Permission to Receive First Aid

    E-print Network

    Chu, Xi

    UM Computer Science 2014-2015 Health History Form & Permission to Receive First Aid Name of an accident while participating in the UM Computer Science program. Therefore, before you fill out this form permission for any representatives of the UM Computer Science program or The University of Montana to render

  14. UM Computer Science 2014-2015 Parent/Guardian Consent & Contact Form

    E-print Network

    Chu, Xi

    UM Computer Science 2014-2015 Parent/Guardian Consent & Contact Form Print Child's Name: __________ I/we give our son/daughter permission to participate in the UM Computer Science workshop to the provision of any necessary emergency treatment to my son/daughter during the program by UM Computer Science

  15. Usina do Trabalho do Ator: um teatro canibal

    E-print Network

    Icle, Gilberto

    1999-10-01

    , tomam os seus corpos e, juntos, dançam uma dança dramática. Contam a história de amor de um homem e de uma mulher. O casal enamorado é surpreendido por Anhangá-Pitã, demónio formado pelo resto da natureza, que faz cair a noite despertando a cobra de... fogo conhecida como Boitatá. A grande cobra devora os olhos da mulher e a dor do seu amado comove a Salamanca: uma Princesa Moura transformada em Lagartixa. A Salamanca revela ao homem as tres provas mágicas que farão nascer o dia e cessar todos os...

  16. STAR CLUSTER COMPLEXES AND THE HOST GALAXY IN THREE H II GALAXIES: Mrk 36, UM 408, AND UM 461

    SciTech Connect

    Lagos, P.; Telles, E.; Nigoche-Netro, A.

    2011-11-15

    We present a stellar population study of three H II galaxies (Mrk 36, UM 408, and UM 461) based on the analysis of new ground-based high-resolution near-infrared J, H, and K{sub p} broadband and Br{gamma} narrowband images obtained with Gemini/NIRI. We identify and determine the relative ages and masses of the elementary star clusters and/or star cluster complexes of the starburst regions in each of these galaxies by comparing the colors with evolutionary synthesis models that include the contribution of stellar continuum, nebular continuum, and emission lines. We found that the current star cluster formation efficiency in our sample of low-luminosity H II galaxies is {approx}10%. Therefore, most of the recent star formation is not in massive clusters. Our findings seem to indicate that the star formation mode in our sample of galaxies is clumpy, and that these complexes are formed by a few massive star clusters with masses {approx}>10{sup 4} M{sub Sun }. The age distribution of these star cluster complexes shows that the current burst started recently and likely simultaneously over short timescales in their host galaxies, triggered by some internal mechanism. Finally, the fraction of the total cluster mass with respect to the low surface brightness (or host galaxy) mass, considering our complete range in ages, is less than 1%.

  17. ComFiM -Um Jogo Colaborativo para Estimular a Comunicao de Crianas com Autismo

    E-print Network

    Barbosa, Alberto

    ComFiM - Um Jogo Colaborativo para Estimular a Comunicação de Crianças com Autismo Paula Ceccon desenvolvimento e a avalia¸c~ao de um jogo colaborativo chamado ComFiM, para interfa- ces m´oveis tang´iveis. O jogo foi desenvolvido com base nos requisitos de um grupo de crian¸cas com autismo, visando estimular

  18. Recovery Act: Novel Kerf-Free PV Wafering that provides a low-cost approach to generate wafers from 150um to 50um in thickness

    SciTech Connect

    Fong, Theodore E.

    2013-05-06

    The technical paper summarizes the project work conducted in the development of Kerf-Free silicon wafering equipment for silicon solar wafering. This new PolyMax technology uses a two step process of implantation and cleaving to exfoliate 50um to 120um wafers with thicknesses ranging from 50um to 120um from a 125mm or 156mm pseudo-squared silicon ingot. No kerf is generated using this method of wafering. This method of wafering contrasts with the current method of making silicon solar wafers using the industry standard wire saw equipment. The report summarizes the activity conducted by Silicon Genesis Corporation in working to develop this technology further and to define the roadmap specifications for the first commercial proto-type equipment for high volume solar wafer manufacturing using the PolyMax technology.

  19. F589 -QUINTA LISTA DE EXERCICIOS 1. Mostre, para um atomo de Thompson, que um eletron que esta em movimento em

    E-print Network

    de Aguiar, Marcus A. M.

    dada por = 2|E|/hn onde E ´e a energia total do el´etron. 6. (a)Mostre que no estado fundamental de um¸c~ao do el´etron, (i) a energia cin´etica, (j) a energia potencial e (k) a energia total? Como as quantias (b) e (k) variam com os n´umeros qu^anticos? 8. Quanta energia ´e necess´aria para remover um el

  20. Fu-Hao Chen 12/22/2014 Fabrication of small apertures (diameter of 10~30um) on 25 um-thick Teflon using

    E-print Network

    Movileanu, Liviu

    (Olympus IX51), a tip holder, a plastic film holder, and a tip. Micro tips are purchased from Signatone holder, loose the screw, put the 3.5 um tip in the groove, and screw at the middle of the tip. 2. Turn a rectangular Teflon film, whose dimension is 2.8 cm x 2.8 cm x 25 um. 8. Take the plastic film holder, loose

  1. Estudo revela que dunas da cratera de Gale em Marte esto ativas Autor: Catarina Solano

    E-print Network

    Instituto de Sistemas e Robotica

    Estudo revela que dunas da cratera de Gale em Marte estão ativas Autor: Catarina Solano Data de liderada pelo instituto norte-americano SETI concluiu que as dunas da cratera de Gale, no planeta Marte transporte de sedimentos em Marte", sublinha David Vaz, que também é investigador no Centro de Recursos

  2. September 2012 Help Sheet: Using "UM Jobs" to Hire Tenure-Track Faculty

    E-print Network

    Chu, Xi

    September 2012 Help Sheet: Using "UM Jobs" to Hire Tenure-Track Faculty Human Resource Services has. Prepare two versions of the job announcement. The first follows a standardized format and is posted on the UM Jobs website. An example can be found on the HR Recruitment page: http

  3. Um framework para renderizaes foto-realistas de cenas com realidade aumentada

    E-print Network

    de Figueiredo, Luiz Henrique

    CLE 2011 Um framework para renderizações foto-realistas de cenas com realidade aumentada Aldo René aumentada foto-realista é conseguir um resultado foto realista a traves de uma única renderização direta.elsevier.nl/locate/entcs #12;1 Introdução Para a industria do cinema e outras que dependem de imagens foto-realistas, é

  4. No vamos ser devorados por um buraco negro p26/27 Pode estar descansado

    E-print Network

    Instituto de Sistemas e Robotica

    Não vamos ser devorados por um buraco negro p26/27 #12;Pode estar descansado: nâo vamos ser devorados -'buraco negroTrês cientistas em Lisboa quiseram ver se todos os astros acabam um dia em buracos negros, objectos tão densos e maciços que atraem tudo o que está à volta. Para tal, fizeram cálculos num

  5. Armazenar energia mais rapidamente O armazenamento de energia um desafio tecnolgico ainda por vencer. Os supercondensadores

    E-print Network

    Instituto de Sistemas e Robotica

    Armazenar energia mais rapidamente O armazenamento de energia é um desafio tecnológico ainda por: armazena muita energia e de forma muito rápida. Além de ser fabricado através de um processo sim- ples, com de supercondensadores com elevada densidade de energia e potência, o que vem resolver a desvantagem

  6. Paramecium swimming in capillary tube Saikat Jana, Soong Ho Um, and Sunghwan Jung

    E-print Network

    Jung, Sunghwan "Sunny"

    velocity fields due to swimming algae Phys. Fluids 23, 091112 (2011) Extensibility enables locomotion underParamecium swimming in capillary tube Saikat Jana, Soong Ho Um, and Sunghwan Jung Citation: Phys swimming in capillary tube Saikat Jana,1 Soong Ho Um,2 and Sunghwan Jung1 1 Department of Engineering

  7. Common Correlations between 60, 100 and 140 um Intensities in the Galactic Plane and Magellanic Clouds

    E-print Network

    Yasunori Hibi; Hiroshi Shibai; Mitsunobu Kawada; Takafumi Ootsubo; Hiroyuki Hirashita

    2006-04-11

    We investigate the far-infrared SED of the Galaxy and the Magellanic Clouds by using the COBE (COsmic Background Explorer) / DIRBE (Diffuse InfraRed Background Experiment) ZSMA (Zodi - Subtracted Mission Average) maps at wavelengths of 60 um, 100 um and 140 um. We analyze three regions: the Galactic plane region with the Galactic latitude |b|much smaller in the far-infrared than in the visible, we may observe cumulative far-infrared radiation from regions with various interstellar radiation field (IRSF) in a line of sight. As consequence of considering such an effect, we find a common far-infrared color correlation between the 140 - 100 um and 60 - 100 um intensity ratios in all the three galaxies. Although this color correlation cannot be explained by any existing model, it fits very well the far-infrared color of nearby star forming galaxies.

  8. ARTIGO INTERNET Estudo diz que viajar no tempo vai continuar a ser fico cientfica

    E-print Network

    Instituto de Sistemas e Robotica

    dessa impossibilidade Um artigo publicado na revista científica "Physical Review Letters" diz ter inédita da velocidade máxima dessa partícula no vácuo. Demonstrou então que a unidade básica da luz as esperanças de algum tipo de viagem do tempo baseada na superação dessa velocidade". Vítor Cardoso acredita

  9. UM,CP Dive Manual Exam Page 1 Rev. 3/15/2012 Diving Safety Diving Manual Exam

    E-print Network

    Boynton, Walter R.

    UM,CP Dive Manual Exam Page 1 Rev. 3/15/2012 Diving Safety ­ Diving Manual Exam 1. AAUS records of dives equipment inspection and testing records all of the above #12;UM,CP Dive Manual Exam Page 2 Rev. 3/15/2012 8. Before conducting any diving operation under the auspices of the UM,CP

  10. 2 um Narrow-Band Imaging of the Sagittarius D H II region

    E-print Network

    R. D. Blum; A. Damineli

    1998-09-27

    We present 2 um narrow-band images of the core H II region in the Galactic star forming region Sagittarius D. The emission-line images are centered on 2.17 um (Brgamma) and 2.06 um (He I). The H II region appears at the edge of a well defined dark cloud, and the morphology suggests a blister geometry as pointed out in earlier radio continuum work. There is a deficit of stars in general in front of the associated dark cloud indicating the H II region is located in-between the Galactic center and the sun. The lesser spatial extent of the He I line emission relative to Brgamma places the effective temperature of the ionizing radiation field below 40,000 K. The He I 2.06 um to Brgamma ratio and Brgamma / far infrared dust emission put Teff at about 36,500 K to 40,000 K as derived from ionization models.

  11. 2.2um BSI CMOS image sensor with two layer photo-detector

    NASA Astrophysics Data System (ADS)

    Sasaki, H.; Mochizuki, A.; Sugiura, Y.; Hasumi, R.; Eda, K.; Egawa, Y.; Yamashita, H.; Honda, K.; Ohguro, T.; Momose, H. S.; Ootani, H.; Toyoshima, Y.; Asami, T.

    2015-03-01

    Back Side Illumination (BSI) CMOS image sensors with two-layer photo detectors (2LPDs) have been fabricated and evaluated. The test pixel array has green pixels (2.2um x 2.2um) and a magenta pixel (2.2um x 4.4um). The green pixel has a single-layer photo detector (1LPD). The magenta pixel has a 2LPD and a vertical charge transfer (VCT) path to contact a back side photo detector. The 2LPD and the VCT were implemented by high-energy ion implantation from the circuit side. Measured spectral response curves from the 2LPDs fitted well with those estimated based on light-absorption theory for Silicon detectors. Our measurement results show that the keys to realize the 2LPD in BSI are; (1) the reduction of crosstalk to the VCT from adjacent pixels and (2) controlling the backside photo detector thickness variance to reduce color signal variations.

  12. Die Leopold-Franzens-Universitt Innsbruck trauert um Ass.-Prof. Mag. Dr. Peter Mayrhofer

    E-print Network

    Nawratil, Georg

    Die Leopold-Franzens-Universität Innsbruck trauert um Ass.-Prof. Mag. Dr. Peter Mayrhofer Hilfsbereitschaft und nicht zuletzt auch seinen Humor schätzten. Die Leopold-Franzens-Universität betrauert den

  13. Um plano de rev italizao e propostas para travar a "degradao" do Areeiro

    E-print Network

    Instituto de Sistemas e Robotica

    definido "um plano de re- vitalização" para o território da an- tiga freguesia de São João de Deus. O pelo território da antiga freguesia de São João de Deus, que se fundiu com a do Alto do Pina, ganhando

  14. Fu-Hao Chen 12/22/2014 Fabrication of small apertures (diameter of 30~40um) on 25 um-thick Teflon using

    E-print Network

    Movileanu, Liviu

    electrodes are aligned into a straight line. 3. Loose the two screws which fix the two electrodes, so the two of the two arms are equal. After the length is correct, tighten the two screws to fix the electrodes. 5. Take um. 7. Squeeze the rectangular Teflon film in the cartridge holder, which are two plastic plates

  15. 31.5um imaging observations of AGN using SOFIA/FORCAST

    NASA Astrophysics Data System (ADS)

    Fuller, Lindsay; Lopez-Rodriguez, Enrique; Packham, Christopher C.; Los Piratas Team

    2016-01-01

    The unified model of active galactic nuclei (AGN) requires a toroidal region of optically and geometrically thick dust obscuring a central engine, accounting for various observed spectral features. Our aim is to investigate the overall torus properties to obtain analytical results for its physical parameters. We present 31.5um photometric observations of 12 nearby Seyfert galaxies from the 2.5m SOFIA telescope using the FORCAST camera. We used Clumpy torus models and a Bayesian approach to fit the IR (1.2-31.5um) nuclear SEDs and high angular resolution mid-IR (8-13um) spectroscopy. We found that the turnover of the torus emission does not occur at wavelengths <31.5um, which we interpret as a lower-limit for the peak torus emission. Including the 31.5um nuclear flux 1) reduces the dispersion of Clumpy torus models at wavelengths >30um, which better constrains the model parameters, 2) generally decreases the radial extent of the torus. We find torus radii ranging from ~1 - 8.5pc, with an average radius of 2.6pc, which is consistent with interferometric and high-spatial resolution observations.

  16. Spitzer Mid-Infrared Spectroscopy of 70um-Selected Distant Luminous Infrared Galaxies

    E-print Network

    Kate Brand; Dan W. Weedman; Vandana Desai; Emeric Le Floc'h; Lee Armus; Arjun Dey; Jim R. Houck; Buell T. Jannuzi; Howard A. Smith; B. T. Soifer

    2007-09-20

    We present mid-infrared spectroscopy obtained with the Spitzer Space Telescope of a sample of 11 optically faint, infrared luminous galaxies selected from a Spitzer MIPS 70um imaging survey of the NDWFS Bootes field. These are the first Spitzer IRS spectra presented of distant 70um-selected sources. All the galaxies lie at redshifts 0.3um silicate absorption features and no significant PAH emission features (6.2um equivalent widths < 0.03um). The large infrared luminosities and low f70/f24 flux density ratios suggests that these sources have AGN as the dominant origin of their large mid-infrared luminosities, although deeply embedded but luminous starbursts cannot be ruled out. If the absorbed sources are AGN-dominated, a significant fraction of all far-infrared bright, optically faint sources may be dominated by AGN.

  17. 1. Espacos de Baire Definic~ao e Proposic~ao 1.1. Um espaco topologico X e um espaco de Baire sse

    E-print Network

    Santos, João

    . Mostremos que U An = . U A1 = logo, como X ´e regular existe uma bola B1 tal que ¯B1 U A1. Podemos escolher B1 tal que diam B1 tal que ¯B2 B1 A2 e diam B2 aberto A X tal que o conjunto {f(x) : x A, I} ´e limitado. Demonstra¸c~ao. Fixemos um ponto y Y

  18. UM-PRS: An implementation of the procedural reasoning system for multirobot applications

    NASA Technical Reports Server (NTRS)

    Lee, Jaeho; Huber, Marcus J.; Durfee, Edmund H.; Kenny, Patrick G.

    1994-01-01

    The Procedural Reasoning System (PRS) is used in applications where predetermined situations might arise. The UM-PRS provides a reasoning system that represents robotic applications even in unpredictable domains, such as the robotic reconnaissance task domain outlined here. UM-PRS incorporates a changing context, rather than relying solely on a prearranged plan. The UM-PRS here provides representation important in the reasoning and interface between a mission plan and the executable map of an outdoor vehicle that changes its behavior based on what it comes in contact with in its environment. PRS is thus used in the dynamic control of such a vehicle, providing the basis for coordinating the joint task of multiple robotic vehicles by the their individual observations and representation.

  19. A Func~ao Zeta de um Corpo de Func~oes e o Teorema de Hasse-Weil

    E-print Network

    Torres, Fernando

    dependendo exclusivamente do g^enero g de F/Fq e de q. Este ser´a o Teorema da Cota de Hasse-Weil. A fun¸c~ao substancial provando para o caso particular de um corpo de fun¸c~oes com g^enero um, isto ´e, para curvas el propriedades. Em todo texto F denota um corpo de fun¸c~oes alg´ebricas de g^enero g cujo corpo de constantes 1

  20. O PAPEL DE UM INTELECTUAL: INSERO SOCIAL NA CIDADE DO RIO DE JANEIRO

    E-print Network

    Díaz, Lorenzo J.

    meio ambiente . Equipe do Grupo de Estudos sobre Cotidiano, Educação e Cultura(s) (GECEC) no Complexo produção de conhecimento sobre o tema, mas atua por diversos meios tentando emancipar as instituições suas pesquisas nas áreas econômica e de meio ambiente. Atua junto à sociedade civil na conscientização

  1. Gerhard Fischer 1 UM'99, June 1999 Wisdom is not the product of schooling

    E-print Network

    Fischer, Gerhard

    - claim: in many cases, it is not the preferred mode of communication · claims (Lucy Suchman, 1987 make use of linguistic, nonverbal, and inferential resources in finding the intelligibility of actions communication channel explicit communication channel #12;Gerhard Fischer 8 UM'99, June 1999 Knowledge

  2. Lamper, Karen Teresa From: UM Research Listserv on behalf of Lamper,

    E-print Network

    Shyu, Mei-Ling

    : Internal Competition for NIOSH, Occupational Safety and Health Education and Research Centers (T42): UM Institute for Occupational Safety and Health (NIOSH), Occupational Safety and Health Education and Research for Occupational Safety and Health (NIOSH), Centers for Disease Control and Prevention (CDC), invites grant

  3. 532. Jahrgang DezemberInhalt Nr. 5 rund um die Kugel

    E-print Network

    Schubart, Christoph

    532. Jahrgang DezemberInhalt Nr. 5 rund um die Kugel ·· siehe Seite 2 2007R e g e n s b u r g e r U-Fachexkursion 10 Kooperationen 11 aus der Forschung 13 Die UNO im Blick 14 Lebensraum Universität 15 Uni Regensburg Telegramm Jubiläums-Ausstellung DieAusstellung "40 Jahre Forschung und Lehre an der Universität

  4. Automating the Hunt for Volcanoes on Venus , U.M. Fayyad

    E-print Network

    Smyth, Padhraic

    Automating the Hunt for Volcanoes on Venus M.C. Burl ¢¡ , U.M. Fayyad ¡ , P. Perona , P. Smyth in the Magellan SAR database of Venus. Training for the specific volcano-detection task is obtained% of the surface of Venus with synthetic aperture radar (SAR), has provided planetaryscientists witha virtual

  5. Directions to U-M Occupational Health Services (3rd floor, Med Inn Building)

    E-print Network

    Kamat, Vineet R.

    Directions to U-M Occupational Health Services (3rd floor, Med Inn Building) C380 Med Inn Building a space designated for Occupational Health parking. FROM CENTRAL CAMPUS Head east on South University.1 a space designated for Occupational Health parking. FROM DEARBORN CAMPUS Take Southfield Freeway South

  6. 2.1 um CW Raman Laser in GeO2 Fiber

    E-print Network

    Cumberland, B A; Medvedkov, O I; Popov, S V; Taylor, J R; Vasilev, S A

    2007-01-01

    We report on 33 % efficient generation of the first Stokes in a high concentration GeO2 fiber Raman laser pumped by a 22 W Thulium doped fiber laser. An output power of 4.6 W at 2.105 um is demonstrated.

  7. Use of "um" in the Deceptive Speech of a Convicted Murderer

    ERIC Educational Resources Information Center

    Villar, Gina; Arciuli, Joanne; Mallard, David

    2012-01-01

    Previous studies have demonstrated a link between language behaviors and deception; however, questions remain about the role of specific linguistic cues, especially in real-life high-stakes lies. This study investigated use of the so-called filler, "um," in externally verifiable truthful versus deceptive speech of a convicted murderer. The data…

  8. Die Taufliege (Drosophila melanogaster) steht den Forschern um Bill Hansson in der Geruchsforschung Modell.

    E-print Network

    Falge, Eva

    Die Taufliege (Drosophila melanogaster) steht den Forschern um Bill Hansson in der Geruchsforschung Untersuchungsobjekt ist natürlich kein Zufall: ,,Kein Tier gibt uns so viele Möglichkeiten wie Drosophila", sagt Riechen bei Drosophila als Ganzes ver- stehen", sagt Hansson mit leicht schwe- dischem Akzent, also den

  9. Novas estratgias comunicativas como fator de qualidade na interao de surdos em um sistema organizacional

    E-print Network

    Barbosa, Alberto

    122 Novas estratégias comunicativas como fator de qualidade na interação de surdos em um sistema formulário web e verificar se o uso de novas estratégias comunicativas melhora a interação dos surdos. Foram (MAC), uma com a interface original do sistema, e outra com o uso de novas estratégias comunicativas

  10. Widefield Microwave Imaging in Alkali Vapor Cells with sub-100 um Resolution

    E-print Network

    Horsley, Andrew; Treutlein, Philipp

    2015-01-01

    We report on widefield microwave vector field imaging with sub um resolution using a microfabricated alkali vapor cell. The setup can additionally image dc magnetic fields, and can be configured to image microwave electric fields. Our camera-based widefield imaging system records 2D images with a 6x6 mm2 field of view at a rate of 10 Hz. It provides up to 50 um spatial resolution, and allows imaging of fields as close as 150 um above structures, through the use of thin external cell walls. This is crucial in allowing us to take practical advantage of the high spatial resolution, as feature sizes in near-fields are on the order of the distance from their source, and represents an order of magnitude improvement in surface-feature resolution compared to previous vapor cell experiments. We present microwave and dc magnetic field images above a selection of devices, demonstrating a microwave sensitivity of 1.4 uT/sqrt-Hz per 50x50x140 um3 voxel, at present limited by the speed of our camera system. Since we image ...

  11. 1/4 CBEB 2008 CITOMETRIA PTICO-MAGNTICA DE ROTAO: EXEMPLO DE UM

    E-print Network

    Alencar, Adriano Mesquita

    . Palavras-chave: Citometria óptico-magnética de oscilação, reologia celular, mecânica celular, viscoelasticidade. Introdução O esqueleto celular é formado por uma rede de fibras de actina que determina do esqueleto celular [8]. Nesse método, um sistema de aquisição/processamento de imagens integrado

  12. Del Rio, Karen T From: UM Research Listserv on behalf of Del Rio,

    E-print Network

    Shyu, Mei-Ling

    -L@LISTSERV.MIAMI.EDU Subject: Internal Competition for NEA, ART WORKS: UM Deadline 4/7/15 The University's internal deadline for the limited submission competition for the National Endowment for the Arts (NEA), Art Works is 4/7/15. If you are interested, please read on for details. Program Announcement: http://arts

  13. DOKBOT: UM AVATAR SEMI-AUT^ONOMO PARA APLICAC~OES TELE IMERSIVAS Kayran G. R. S. Domingos

    E-print Network

    Chaimowicz, Luiz

    DOKBOT: UM AVATAR SEMI-AUT^ONOMO PARA APLICA¸C~OES TELE IMERSIVAS Kayran G. R. S. Domingos , Ot avatar. O sistema desenvolvido ´e semi-aut^onomo e ´e tele-operado por um usu´ario remotamente localizado. Para melhor percep¸c~ao do ambiente remoto, o avatar envia ao usu´ario ´audio e v´ideo streams

  14. Convertendo um Documento do Word (doc/docx) para Se voc possuir Microsoft Office Word 2007 ou 2010

    E-print Network

    Paraná, Universidade Federal do

    Convertendo um Documento do Word (doc/docx) para PDF. Se você possuir Microsoft Office Word 2007 ou arquivo já estará pronto para ser utilizado. Se você possuir Microsoft Office Word 97 ou 2003: Primeiro 2010: Crie ou abra um Documento qualquer de Word, vá no menu e clique em "salvar como" (se preferir

  15. Estudo Comparativo de Trs Geossintticos no Reforo de Base de Pavimentos com Ensaios de Arrancamento de Pequenas

    E-print Network

    Zornberg, Jorge G.

    Estudo Comparativo de Três Geossintéticos no Reforço de Base de Pavimentos com Ensaios de da eficiência de diferentes geossintéticos no reforço de base de pavimentos de obras viárias com geogrelha de fibra de vidro. PALAVRAS-CHAVE: Reforço de Pavimentos, Ensaios de Arrancamento, Geogrelha de

  16. Observations of the new gravitational lens system UM 673 = Q 0142-100

    NASA Astrophysics Data System (ADS)

    Surdej, J.; Magain, P.; Swings, J.-P.; Borgeest, U.; Courvoisier, T. J.-L.; Kayer, R.; Kellermann, K. I.; Kuhr, H.; Refsdal, S.

    1988-06-01

    The authors have recently initiated a high resolution direct imaging survey of a selected sample of highly luminous quasars (HLQs). The observations are carried out with the 2.2 m telescope at ESO, and with the VLA at the NRAO, New Mexico. Following the first observing run at ESO, the authors have reported the discovery of a new gravitational lens system for the HLQ UM 673 = Q 0142-100. Additional observations supporting this interpretation are discussed here. Application of gravitational optometry to this system is given: a value of M0 = 2.4×1011M_sun; is derived for the mass of the lensing galaxy located between UM 673 A and B and a most likely estimate of ?t = 7 weeks is found for the expected delay between the arrival times of a similar variability event in the two lensed images of the quasar (H0 = 75 km s-1Mpc-1, q0 = 0).

  17. Metaheuristicas e um Problema de Cobertura de custo unico Douglas S. Goncalves,

    E-print Network

    Gomes, Francisco A. M.

    de uma aplica¸c~ao real que aparece em jogos de azar. O desempenho das heur´isticas foi testado em^o, aposentado, passa boa parte de seu tempo imaginando uma forma de ganhar na loteria. Um dos jogos que tem despertado interesse de meu av^o ´e a lotomaluca. Na lotomaluca, voc^e deve em cada jogo marcar n dentre m n

  18. Um Projeto de Intervenção nos Espaços de Exposições do Planetário do Parque do Ibirapuera

    NASA Astrophysics Data System (ADS)

    Elias, D. S.; Amaral, L. H.; de Araújo, C. F., Jr.; Matsuura, O. T.; Voelzke, M. R.

    2005-08-01

    Cada vez mais a humanidade, em sua imensa maioria, está alheia às próprias conquistas. A insatisfação com esta realidade tem levado muitos pesquisadores, instituições, empresas e governos a procurar formas alternativas de acompanhar e transmitir todo este acervo científico cultural à sociedade, buscando a melhoria da qualidade da divulgação científica e contribuindo para o processo de cultura e alfabetização científica. Não há tempo nem espaço nos limitados planos curriculares do ensino médio e mesmo nos programas de ensino que propiciem a cultura científica e o acompanhamento do vertiginoso progresso científico e tecnológico atual. Neste sentido, a educação formal escolar precisa ser complementada ou acrescida de uma educação informal, extra-escolar, que possa oferecer à sociedade o que a escola não pode oferecer. A interação do público com museus, feiras de ciências, planetários, exposições científicas e/ou culturais é de grande importância para a aquisição e difusão de conhecimentos relacionados ao mundo científico. Reconhecidamente como um modelo de alfabetização científica esses ambientes promovem uma interação social capaz de propiciar de forma efetiva uma melhor relação ensino-aprendizagem com o público. Partindo desta realidade a Universidade Cruzeiro do Sul e a Escola Municipal de Astronomia (EMA) vêm desenvolvendo um projeto de intervenção no espaço em torno do Planetário do Parque do Ibirapuera com o objetivo de se implantar um ambiente de aprendizagem motivador e desafiador que promova a popularização de conteúdos relacionados à astronomia, astrofísica e cosmologia. Busca-se, também, a aproximação e interação do público com exposições que estão sendo implementadas no planetário. Considerando que se trata de um projeto de mestrado em fase inicial o objetivo do presente trabalho é apresentar a concepção básica e os critérios que estão sendo utilizados do ponto de vista pedagógico para as indicações dos objetos e experimentos que serão expostos, procurando formas de construir, expor e apresen! tá-los d e maneira mais eficiente em termos de uma aprendizagem significativa. (Apoio: Fundação Vitae, CNPq)

  19. JAVARRAY UM ARRAY RECONFIGURVEL PARA REDUO DE CONSUMO DE ENERGIA EM ARQUITETURAS JAVA

    E-print Network

    Wagner, Flávio Rech

    JAVARRAY ­ UM ARRAY RECONFIGURÁVEL PARA REDU��O DE CONSUMO DE ENERGIA EM ARQUITETURAS JAVA João energia. Com a verificação das necessidades computacionais dos trechos mais relevantes de aplicações Java economizando-se energia. Mais de 50% do código pode ser executado no JavArray, acelerando-se portanto

  20. UTILIZAO DE UM MODELO DE CONTORNO ATIVO PARA EXTRAO DE ARESTAS EM IMAGENS

    E-print Network

    de Figueiredo, Luiz Henrique

    se deseja extrair, dessa forma a função de energia passa a funcionar como uma função objetivo de um mínima quando a Snake se encontre sobre as arestas da imagem. Dessa maneira o problema de extração de por Cohen. Dessa forma a Snake apresenta uma dinâmica interna que pode ser utilizada para "inflar" ou

  1. Um enfoque antropológico para o ensino de astronomia no nível médio

    NASA Astrophysics Data System (ADS)

    Costa, G. B.; Jafelice, L. C.

    2003-08-01

    Há uma enorme carência de materiais didático-pedagógicos em astronomia para professores do ensino médio, sobretudo materiais que explorem também aspectos humanísticos. A origem do Universo é um bom exemplo desta constatação central. Embora tal origem teve explicações culturais diversas, os professores não têm informações sobre isso e muito menos material que trabalhe diferentes visões de mundo e treinamento que os capacite a abordá-las devidamente. Conseqüentemente o ensino de astronomia costuma ser tecnicista e dissociado do aspecto humano que alimenta o grande interesse e curiosidade que esses temas despertam. Aqui apresentamos propostas visando contribuir para reverter esse quadro e trabalhamos distintas visões de Universo: espontâneas, autóctones e científicas. Desenvolvemos práticas, materiais instrucionais e textos para viabilizar a adoção de um enfoque antropológico para o ensino de astronomia no nível médio, no qual as culturas humanística e científica sejam integradas de uma maneira contextualizada e eficaz para aquele ensino. Estas propostas foram aplicadas em um curso de treinamento para professores da rede pública de diferentes disciplinas. A receptividade dos professores à abordagem proposta e os resultados alcançados foram muito estimulantes. Destes, destacamos: produção de roteiros de atividades; desenvolvimento de práticas didático-pedagógicas específicas (e.g., encenação de mitos; dança primordial guarani; "criação" de constelações e interpretações pluriculturais; etc.); e sugestões concretas para a efetiva realização de um ensino interdisciplinar contextualizado, onde questões cosmogônicas servem de mote para iniciar tal ensino. Discutimos estes resultados e como o enfoque adotado pode instrumentalizar os professores para leituras de mundo que incluem naturalmente aspectos culturais, sociais e históricos associados aos temas estudados. (PPGECNM/UFRN; PRONEX/FINEP; NUPA/USP; Temáticos/FAPESP)

  2. MyGFT: um Mdulo de Integrao entre MySQL e Google Fusion Tables

    E-print Network

    Hara, Carmem Satie

    MyGFT: um Módulo de Integração entre MySQL e Google Fusion Tables Alexandre Savaris1,2 , Carmem@inf.ufsc.br Abstract. This work presents MyGFT, a storage engine for integrating MySQL DBMS and Google Fusion Tables to MySQL and how its use can be a viable alternative to data retrieval for controlled and structured

  3. Fermentation optimization for the production of bioactive polysaccharides from Cordyceps sinensis fungus UM01.

    PubMed

    Wang, Lan-Ying; Cheong, Kit-Leong; Wu, Ding-Tao; Meng, Lan-Zhen; Zhao, Jing; Li, Shao-Ping

    2015-08-01

    The optimal fermentation conditions and medium for the production of bioactive polysaccharides from the mycelium of Cordyceps sinensis fungus UM01 were investigated by using orthogonal design and high performance size exclusion chromatography coupled with multi-angel laser light scattering and refractive index detector (HPSEC-MALLS-RID). Results showed that the optimal temperature, initial pH, rotation speed, medium capacity (ratio of medium volume to the volume of flask bottle) and inoculums volume for the mycelium growth were 15 °C, pH 6.0, 150 rpm, 2/5 (v/v), and 3% (v/v), respectively. Furthermore, bioactive polysaccharides from the mycelium of C. sinensis fungus UM01 were determined as polysaccharide fractions with the molecular weight above 10 kDa. The optimal fermentation medium was determined as a composition of glucose 30.0 g/L, sucrose 30.0 g/L, KH2PO4 1.0 g/L, CaCl2 0.5 g/L, yeast extract 3.0 g/L, and MgCl2 0.1g/L according to the maximum amount of the bioactive polysaccharides (486.16±19.60 mg/L) measured by HPSEC-MALLS/RID. Results are helpful to establish an efficient and controllable fermentation process for the industrial production of bioactive polysaccharides from C. sinensis UM01, and beneficial to develop a unique health and functional product in future. PMID:25936285

  4. GROUP FITNESS PROGRAM PARENTAL RELEASE AND INFORMED CONSENT STATEMENT-UM STUDENT / SPECIAL PROGRAM PARTICIPANT UNDER 18 YEARS OF AGE

    E-print Network

    Hill, Wendell T.

    GROUP FITNESS PROGRAM PARENTAL RELEASE AND INFORMED CONSENT STATEMENT- UM, for participation in RecWell Group Fitness program activities, including the use of Rec. I understand that my child's participation in the RecWell Group Fitness

  5. A Reappraising of Cosmography: the Interface Between Astronomical and Geographic Studies. (Breton Title: Releitura do Conceito de Cosmografia: a Interface Entre os Estudos Astronômicos e Geográficos.) Una Relectura del Concepto de Cosmografía: la Interfase Entre los Estudios Astronómicos y Geográficos

    NASA Astrophysics Data System (ADS)

    Azevedo Sobreira, Paulo Henrique

    2012-12-01

    The concept of "Cosmography" is in disuse since the 80s of the last century, but the astronomical themes previously discussed in the school subjects of Geography and Cosmography remain in current textbooks. The use of term "Cosmography" was rescued in this research, and the study of its re-signification prompted the appearance of the term Geographic Cosmography. The Geographic Cosmography is a field of studies of the Geography, whose set of knowledge and skills is predominantly scholar. It studies the interface between terrestrial and celestial knowledge, and assigns a geographic significance to them. It examines human and natural relationships with Sidereal Space and its consequences for society and nature. O conceito de "Cosmografia" está em desuso desde os anos 80 do século XX, mas os temas astronômicos anteriormente abordados nas disciplinas escolares de Cosmografia e de Geografia permanecem nos atuais livros didáticos. O uso do termo "Cosmografia" foi resgatado nesta pesquisa e o estudo de sua ressignificação proporcionou o surgimento do termo Cosmografia Geográfica. A Cosmografia Geográfica é um campo de estudos da Geografia, cujo conjunto de conhecimentos e habilidades é predominantemente escolar. Estuda a interface entre os conhecimentos terrestres e os celestes e lhes atribui significância geográfica. Analisa as relações humanas e naturais com o Espaço Sideral e suas consequências para a sociedade e a natureza.

    Aunque el concepto de "Cosmografía" no se usa desde la década de los '80 del siglo pasado, los temas astronómicos que se enseñaban anteriormente en las asignaturas escolares de Cosmografía y de Geografía permanecen en los actuales libros didácticos. El uso del término "Cosmografía" fue rescatado en esta investigación y el estudio de su resignificación proporcionó el surgimiento del término Cosmografía Geográfica. La Cosmografía Geográfica es un campo de estudio de la Geografía, donde el conjunto de conocimientos y habilidades es predominantemente escolar. Estudia la interfase entre los conocimientos terrestres y los celestes, dándoles un significado geográfico. Analiza las relaciones humanas y naturales con el Espacio Sideral y sus consecuencias para la sociedad y la naturaleza.

  6. Design of a ROIC with 15um pitch for MWIR FPAs

    NASA Astrophysics Data System (ADS)

    Liang, Qinghua; Jiang, Dazhao; Chen, Honglei; Zhang, Qiwen; Ding, Ruijun

    2015-10-01

    A 640×512 readout integrated circuit (ROIC) with 15um pixel pitch for middle-wave infrared focal plane arrays (MWIR FPAs) is designed in this paper. The 15um pixel pitch presents several challenges to the ROIC design, such as achieving the required charge storage capacity to preserve the high SNR and reading or processing the pixel signals correctly to achieve the required frame rate. A novel structure that four neighboring pixels share one integration capacitor is presented as a feasible approach to getting a large charge capacity in the limited pixel area. Meanwhile, the pixel circuit chooses the direct injection (DI) which occupies the small layout area as the input stage for MW and contains two sample and hold modules to further increase the charge capacity. Moreover,the peripheral analog signal chain circuit, which is composed of a PMOS source follower, a column amplifier and the complementary output stage, is designed to transfer the signals from unit cell with less voltage loss,lower power consumption, lower noise and higher linearity. More importantly, in our design, only half chain circuit are required therefore the corresponding power consumption will be reduced greatly. In order to accommodate this design, two kinds of pixel signal readout sequences are compared. By adopting the 0.18um 1P6M mixed signal CMOS process, the circuit architecture can make the effective charge capacity of 13Me- per pixel with 1.38V final output range. The 4×4 circuit layout will be fulfilled as a whole and in this way the effective integration capacitor can be increased. According to the simulation results, this circuit works well under 3.3V power supply and achieves 10MHZ readout rate and less than 0.1% nonlinearity.

  7. The UM-Dearborn Observatory: Variable-object Research from an Urban Site

    NASA Astrophysics Data System (ADS)

    Clyne, Elisabeth; Clarkson, William I.; Rasmussen, Eric J; Bord, Donald J.; Dage, Kristen; Matzke, David; Swift, Carrie

    2014-06-01

    Since its construction in 2007, the UM-Dearborn Observatory has provided a valuable educational tool both for students at UM-Dearborn and our neighbor-institution the Henry Ford Community College, and for the public at-large. We have recently (Jan 2014) added a systematic long-term research program with our 0.4m main telescope, to photometrically monitor a number of bright variable objects, including X-ray binaries and chemically-peculiar metal-poor stars over long timescales. We ultimately envision assembling a photometric database of (at least) four-color photometry over years-decades (i.e., many hundreds of orbital timescales for close binaries), with the preponderance of datapoints taken by undergraduates. To conduct this program, we have had to overcome a number of site challenges, the solutions of which will be useful to many programs using small telescopes at urban sites. The 0.4m telescope lies on a shared building within UM-Dearborn's main Fairlane campus - i.e., is about 20 meters above sea level, near several sources of water vapor (including an active steam vent less than 15 meters away), experiences significant mechanical vibrations from other building functions, and lies about 6 miles from central Detroit, well within the Detroit-Ann Arbor conurbation. Observing conditions are thus highly variable, with 5 arcsecond seeing typical and significant transparency variations observed even during a clear night. Nevertheless, we are now able to make scientifically useful observations in a semi-automatic way, to which our chosen scientific niche is well-suited. We present here our solutions to these challenges, along with initial results from our ongoing monitoring program.

  8. Uma Visão do Universo Segundo um Grupo de Alunos do Ensino Médio de São Paulo

    NASA Astrophysics Data System (ADS)

    Elias, D. S.; Araújo, M.; Amaral, L. H.; Voelzke, M. R.; Araújo, M.

    2005-08-01

    A astronomia, embora seja uma ciência popular, com inúmeras descobertas de interesse público, ainda é apresentada desconsiderando-se os aspectos históricos e científicos relacionados ao seu desenvolvimento, sendo geralmente veiculada nos meios de comunicação de maneira pouco esclarecedora e não raro com imprecisões. Neste trabalho analisou-se a concepção de um grupo de estudantes de Ensino Médio sobre conceitos de astronomia, visando identificar sua visão de mundo a respeito do Universo, envolvendo idéias sobre espaço e tempo. Para issso, foi aplicado um questionário em três escolas da grande São Paulo em um espaço amostral de 270 alunos. Constatou-se que, embora o ensino de astronomia esteja previsto nos PCNEM, os resultados obtidos na pesquisa mostram que há grande deficiência no conhecimento dos temas investigados. Nesse sentido, verificou-se que apenas 20% dos alunos eram capazes de relacionar a sucessão das semanas com as fases da lua, enquanto 28% associaram as estações do ano à inclinação do eixo de rotação da Terra. Por outro lado, somente 23% dos alunos tinham noções das distâncias entre os objetos celestes próximos da Terra e 56% conseguiram relacionar o Big Bang com a origem do Universo. Finalmente, constatou-se que 37% reconheciam o ano-luz como uma unidade de distância e 60% reconheciam o Sol como sendo uma estrela. Apesar de 60% dos alunos indicarem que a escola é a principal fonte para aquisição dos conhecimentos de astronomia, conclui-se que seus conceitos nessa área ainda são inadequados, havendo necessidade de ampliação e aprimoramento da abordagem desses conteúdos nos ambientes escolares.

  9. Comparing the genomes of Helicobacter pylori clinical strain UM032 and Mice-adapted derivatives

    PubMed Central

    2013-01-01

    Background Helicobacter pylori is a Gram-negative bacterium that persistently infects the human stomach inducing chronic inflammation. The exact mechanisms of pathogenesis are still not completely understood. Although not a natural host for H. pylori, mouse infection models play an important role in establishing the immunology and pathogenicity of H. pylori. In this study, for the first time, the genome sequences of clinical H. pylori strain UM032 and mice-adapted derivatives, 298 and 299, were sequenced using the PacBio Single Molecule, Real-Time (SMRT) technology. Result Here, we described the single contig which was achieved for UM032 (1,599,441 bp), 298 (1,604,216 bp) and 299 (1,601,149 bp). Preliminary analysis suggested that methylation of H. pylori genome through its restriction modification system may be determinative of its host specificity and adaptation. Conclusion Availability of these genomic sequences will aid in enhancing our current level of understanding the host specificity of H. pylori. PMID:23957912

  10. RAPID/RAM/UM - An integrated computer environment for performing system reliability assessments

    SciTech Connect

    Chu, B.B.; Rumble, E.T.; Stevens, C.R.

    1987-01-01

    Many nuclear utility companies have now performed plant-specific system reliability assessments (SRAs) for a variety of applications, such as determination of alternative system design modifications, assessment of testing and maintenance strategies, examination of procedural changes, responding to regulatory inquiries, etc. Manually updating the SRA logic models and component reliability data to keep them up-to-date is a tedious, time-consuming, man-power-intensive, and sometimes impractical task. The amount of information as well as the lack of adequate computer software for automated updating makes it difficult to keep the SRAs current. RAPID's RAM and UM software, which are part of the Electric Power Research Institute (EPRI's) RAPID software development effort under the risk assessment program of the Nuclear Power Division, are designed to overcome many of these difficulties and to provide a productive environment for performing various system reliability engineering activities. This paper summarizes the development and demonstration of the RAPID/RAM-UM software at Arizona Nuclear Power Project (ANPP's) Palo Verde Nuclear Generation Station.

  11. Estudo de cavidade reentrante supercondutora a ser utilizada nos transdutores paramétricos do detector brasileiro de ondas gravitacionais Mario Schenberg

    NASA Astrophysics Data System (ADS)

    Ribeiro, K. L.; Furtado, S. R.; Aguiar, O. D.; Frajuca, C.

    2003-08-01

    Cavidades reentrantes de nióbio vêm sendo utilizadas pelo grupo Australiano nos transdutores eletromecânicos paramétricos do detector de ondas gravitacionais Niobè. Esses transdutores paramétricos são ativados por um sinal AC na faixa de microondas (banda X), que é modulado pelo sinal mecânico da vibração da antena esférica, com a variação de um parâmetro, que, no caso, é a capacitância da cavidade. Nós estudamos esse tipo de cavidade, com o objetivo de transformá-la de reentrante aberta para reentrante fechada, de forma a utilizá-la nos transdutores paramétricos do detector brasileiro Mario Schenberg. O desempenho do transdutor depende de alguns parâmetros da cavidade, como a sua Figura de Mérito (Q elétrico) e o seu acoplamento elétrico com o circuito externo. Neste trabalho mostramos a medida do Q elétrico como função do acoplamento, do acabamento superficial interno e do vazamento de microondas da cavidade, e mostramos o desempenho esperado para o detector Mario Schenberg usando uma cavidade supercondutora reentrante fechada de nióbio.

  12. VizieR Online Data Catalog: XMM survey of 12um selected galaxies (Brightman+, 2011)

    NASA Astrophysics Data System (ADS)

    Brightman, M.; Nandra, K.

    2011-11-01

    We present an X-ray spectral analysis of 126 galaxies of the 12um galaxy sample (Rush et al. 1993, Cat. VII/157). By studying this sample at X-ray wavelengths, we aim to determine the intrinsic power, continuum shape and obscuration level in these sources. We improve upon previous works by the use of superior data in the form of higher signal-to-noise ratio spectra, finer spectral resolution and a broader bandpass from XMM-Newton. We pay particular attention to Compton thick active galactic nucleus (AGN) with the help of new spectral fitting models that we have produced, which are based on Monte Carlo simulations of X-ray radiative transfer, using both a spherical and torus geometry, and taking into account Compton scattering and iron fluorescence. (8 data files).

  13. Infrared Luminosities and Aromatic Features in the 24um Flux Limited Sample of 5MUSES

    E-print Network

    Wu, Yanling; Armus, Lee; Cormier, Diane; Shi, Yong; Dale, Daniel; Dasyra, Kalliopi; Smith, J D; Papovich, Casey; Draine, Bruce; Rahman, Nurur; Stierwalt, Sabrina; Fadda, Dario; Lagache, G; Wright, Edward L

    2010-01-01

    We study a 24\\,$\\mu$m selected sample of 330 galaxies observed with the Infrared Spectrograph for the 5\\,mJy Unbiased Spitzer Extragalactic Survey. We estimate accurate total infrared luminosities by combining mid-IR spectroscopy and mid-to-far infrared photometry, and by utilizing new empirical spectral templates from {\\em Spitzer} data. The infrared luminosities of this sample range mostly from 10$^9$L$_\\odot$ to $10^{13.5}$L$_\\odot$, with 83% in the range 10$^{10}$L$_\\odot ur sample than the ratios measured from the nuclear spectra of nearby normal galaxies, most probably indicating a difference in the ionization state or grain size distribution between the nuclear regions and the entire galaxy. Finally, we provide a calibration relating the monochromatic 5.8, 8, 14 and 24um continuum or Aromatic Feature luminosity to L$_{\\rm IR}$ for different types of objects.

  14. Comparative genomic analysis of Mycobacterium iranicum UM_TJL against representative mycobacterial species suggests its environmental origin

    PubMed Central

    Tan, Joon Liang; Ngeow, Yun Fong; Wee, Wei Yee; Wong, Guat Jah; Ng, Hien Fuh; Choo, Siew Woh

    2014-01-01

    Mycobacterium iranicum is a newly reported mycobacterial species. We present the first comparative study of M. iranicum UM_TJL and other mycobacteria. We found M. iranicum to have a close genetic association with environmental mycobacteria infrequently associated with human infections. Nonetheless, UM_TJL is also equipped with many virulence genes (some of which appear to be the consequence of transduction-related gene transfer) that have been identified in established human pathogens. Taken all together, our data suggest that M. iranicum is an environmental bacterium adapted for pathogenicity in the human host. This comparative study provides important clues and forms the basis for future functional studies on this mycobacterium. PMID:25417557

  15. Lista de Problemas da Area II 1. Modelo de Blume-Capel I (Salinas): Considere um modelo unidimensional

    E-print Network

    Stariolo, Daniel Adrián

    N 2 , u( , )f( )f( ) e S NkB = - f() ln f() respectivamente. Minimizando a energia livre U - TS . 6. Ponto tricrítico (Pathria): Considere um sistema descrito por uma energia livre de Landau da transferência. (b) Calcule expressões para a energia interna e a entropia por spin. (c) Qual o estado

  16. Evidence for Misaligned Disks in the T Tauri Triple System: 10 um Super-Resolution with MMTAO and Markov Chains

    E-print Network

    Andrew Skemer; Laird Close; Philip Hinz; William Hoffmann; Matthew Kenworthy; Douglas Miller

    2007-12-10

    Although T Tauri is one of the most studied young objects in astronomy, the nature of its circumstellar environment remains elusive due, in part, to the small angular separation of its three components (North-South and South a-b are separated by 0.68" and 0.12" respectively). Taking advantage of incredibly stable, high Strehl, PSFs obtained with Mid-IR adaptive optics at the 6.5 meter MMT, we are able to resolve the system on and off the 10um silicate dust feature (8.7um, 10.55um, and 11.86um; 10% bandwidth), and broad N. At these wavelengths, South a-b are separated by only ~0.3 lambda/D. This paper describes a robust Markov Chain Monte Carlo technique to separate all three components astrometrically and photometrically, for the first time, in the mid-IR. Our results show that the silicate feature previously observed in the unresolved T Tau South binary is dominated by T Tau Sa's absorption, while Sb does not appear to have a significant feature. This suggests that a large circumbinary disk around Sa-Sb is not likely the primary source of cool dust in our line-of-sight, and that T Tau Sa is enshrouded by a nearly edge-on circumstellar disk. Surprisingly, T Tau Sb does not appear to have a similarly oriented disk.

  17. Einstein apaixonado: A cincia mal-contada de um mito bem-traado Carlos Alberto dos Santos

    E-print Network

    dos Santos, C.A.

    Einstein apaixonado: A ciência mal-contada de um mito bem-traçado Carlos Alberto dos Santos Universidade Federal do Rio Grande do Sul, Instituto de Física O parágrafo de abertura de Einstein Apaixonado Einstein será revelado em toda a sua complexidade psicológica. Overbye manipula bem as palavras e constrói

  18. Um sistema de cache preditivo para o processamento em tempo-real de grandes volumes de dados graficos

    E-print Network

    de Figueiredo, Luiz Henrique

    Um sistema de cache preditivo para o processamento em tempo-real de grandes volumes de dados gr, 225, Rio de Janeiro, Brasil Abstract. Para visualizar objetos gr´aficos em tempo-real ´e necess´ario superar com dois tipos de problema: tempo limitado de para efetuar o processo de rendering e espa

  19. Avda. Teniente Flomesta, 5. Edif. Convalecencia. 30003 Murcia T. 868 883 000 F. 868 883 603 www.um.es

    E-print Network

    Acacio, Manuel

    , dependiente directamente del Rector y destinada a desarrollar las políticas de igualdad en materia de género la igualdad de género que se desarrollen tanto por iniciativa de la propia Universidad como por la de.um.es REGLAMENTO DE LA UNIDAD PARA LA IGUALDAD ENTRE MUJERES Y HOMBRESDELAUNIVERSIDADDEMURCIA (APROBADO EN CONSEJO

  20. Origin and characteristics of yardangs in the Um Al-Rimam depressions (N Kuwait)

    NASA Astrophysics Data System (ADS)

    Al-Dousari, Ali. M.; Al-Elaj, Maraheb; Al-Enezi, Eqbal; Al-Shareeda, Abdulaziz

    2009-03-01

    Although Arabia hosts one of the largest deserts in the world, studies regarding aeolian erosional features in general and yardangs in particular are rare. The principal aim of this study is to delineate and investigate the various forms of yardangs in the Um Al-Rimam depressions in the northern part of Kuwait. The study area consists of two main depressions connected by neck area made up of continental sediments. Both depressions are surrounded by a dissected escarpment and their floors host muddy playas. On lithological bases, three main types of yardang have been identified: 7 yardangs are sculptured in sandstones of Lower Fars Formation (Lower to Middle Miocene), 23 are carved in calcretic rocks of Ghar Formation (Oligocene to Lower Miocene), and 11 yardangs are developed in Quaternary sediments. Their mean orientation NW (297°) coincides with the prevailing direction of the strong local northwesterly wind called the shamal. The average length/width ratio is 1.5:1. The wide geographic distribution of yardangs around the margins of the northern depression is due to sand blasting. This is explained by the annual sand accumulation measured in the study area where the northern depression shows 143 times higher accumulation than the southern depression, the neck area and the platform above the depressions. Also, the field measurements for annual erosional rates show that the sides of the yardangs are more affected by erosion compared to their middle parts. Remarkably slight mineralogical variations were detected within the surface sediments of Um Al-Rimam depressions and the Quaternary muddy yardangs which indicate a common origin. The age of yardangs is unknown but annual erosional rates on a small Quaternary muddy yardang suggest that they range in age between 44 and 1500 years depending on yardang size. It is believed, as indicated from field observation and interpretation of aerial photos, that the majority of yardangs are pre-existing bedrock forms. These forms were developed by paleo-surface hydrological processes which were modified by wind action in latter phase.

  1. Lens or Binary? Chandra Observations of the Wide-Separation Broad Absorption Line Quasar Pair UM 425

    NASA Astrophysics Data System (ADS)

    Aldcroft, Thomas L.; Green, Paul J.

    2003-08-01

    We have obtained a 110 ks Chandra ACIS-S exposure of UM 425, a pair of QSOs at z=1.47 separated by 6.5", which show remarkably similar emission and broad absorption line (BAL) profiles in the optical/UV. Our 5000 count X-ray spectrum of UM 425A (the brighter component) is well fitted with a power law (photon spectral index ?=2.0) partially covered by a hydrogen column of 3.8×1022 cm-2. The underlying power-law slope for this object and for other recent samples of BALQSOs is typical of radio-quiet quasars, lending credence to the hypothesis that BALs exist in every quasar. Assuming the same ? for the much fainter image of UM 425B, we detect an obscuring column 5 times larger. We search for evidence of an appropriately large lensing mass in our Chandra image and find weak diffuse emission near the quasar pair, with an X-ray flux typical of a group of galaxies at redshift z~0.6. From our analysis of archival HST WFPC2 and NICMOS images, we find no evidence for a luminous lensing galaxy, but note a 3 ? excess of galaxies in the UM 425 field with plausible magnitudes for a z=0.6 galaxy group. However, the associated X-ray emission does not imply sufficient mass to produce the observed image splitting. The lens scenario thus requires a dark (high M/L ratio) lens or a fortuitous configuration of masses along the line of sight. UM 425 may instead be a close binary pair of BALQSOs, which would boost arguments that interactions and mergers increase nuclear activity and outflows.

  2. An evaluation of China's water cycle in the MetUM-GC2 coupled model

    NASA Astrophysics Data System (ADS)

    Rodriguez, Jose; Marzin, Charline

    2015-04-01

    There is a general consensus in climate projections that the global hydrological cycle is likely to experience significant changes in the future, in response to increased concentrations of greenhouse gases. At the regional scale, model simulations show large variations in the predictions of changes in the components of the water cycle. Increasing confidence in regional prediction of the water cycle is at the top of the NWP and climate research agenda, requiring a comprehensive evaluation of the physical processes which may play an important role. Here we present preliminary results of an evaluation of the capacity of the MetUM-GC2 coupled model to reproduce the characteristics of the water cycle in the region of China. Using water budget techniques in the atmospheric and terrestrial branches we test the water cycle components and the model's ability to replicate the climatological annual cycle and its interannual variability. Recent drought and flood events are evaluated and various metrics are employed to compare the role played by the atmospheric general circulation including the boreal summer and winter monsoon regimes and soil moisture feedback in model and observations.

  3. Diagnosing resolution sensitivity over the Maritime Continent in the MetUM

    NASA Astrophysics Data System (ADS)

    Woolnough, S. J.; Bush, S. J.; Schiemann, R.; Turner, A. G.; Martin, G.

    2014-12-01

    The Maritime Continent, with over 25,000 islands ranging from hundreds to 780,000 square kilometers, is a key challenge for cumulus-convection and coastal parameterizations in climate resolution GCMs. We studied the resolution sensitivity of precipitation over the Maritime Continent in the MetUM AGCM at horizontal resolutions ranging from approximately 200 to 40 km. We found robust increases in summer precipitation over the Maritime Continent Islands and decreases in summer precipitation over the northern Maritime Continent seas, similar to the resolution sensitivity seen in other studies. These precipitation changes near the Maritime Continent can be large, exceeding 5 mm/day, and are the largest changes in tropical precipitation as resolution is increased. To explore the source of these changes, we present novel experiments to diagnose the role of increased resolution of different components of the AGCM, such as the orography, coastlines and atmospheric dynamics, in the Maritime Continent domain. Our results suggest that total orographic precipitation in the Maritime Continent domain is resolution dependent at these scales. While increased precipitation associated with the higher resolution of the mean orography (see Figure 1) is compensated for by decreasing precipitation associated with changes in the subgrid orography and its effect on parameterized drag, the total orographic precipitation is not equal across resolutions. Changes in moisture convergence, precipitation and circulation due to improved resolution of the orography then affect precipitation in the wider Indo-Pacific region.

  4. Diagnosing resolution sensitivity over the Maritime Continent in the MetUM

    NASA Astrophysics Data System (ADS)

    Bush, Stephanie; Scheimann, Reinhard; Woolnough, Steve; Turner, Andrew; Martin, Gill

    2015-04-01

    The Maritime Continent, with over 25,000 islands ranging from hundreds to 780,000 square kilometers, is a key challenge for cumulus-convection and coastal parameterizations in climate resolution GCMs. We studied the resolution sensitivity of precipitation over the Maritime Continent in the MetUM AGCM at horizontal resolutions ranging from approximately 200 to 40 km. We found robust increases in summer precipitation over the Maritime Continent Islands and decreases in summer precipitation over the northern Maritime Continent seas, similar to the resolution sensitivity seen in other studies. These precipitation changes near the Maritime Continent can be large, exceeding 5 mm/day, and are the largest changes in tropical precipitation as resolution is increased. To explore the source of these changes, we present novel experiments to diagnose the role of increased resolution of different components of the AGCM, such as the orography, coastlines and atmospheric dynamics, in the Maritime Continent domain. Our results suggest that total orographic precipitation in the Maritime Continent domain is resolution dependent at these scales. While increased precipitation associated with the higher resolution of the mean orography is compensated for by decreasing precipitation associated with changes in the subgrid orography and its effect on parameterized drag, the total orographic precipitation is not equal across resolutions. Experiments are in progress to determine the impact of better resolving other boundary conditions, such as coastlines.

  5. 4/5/2014 Turbinados | Um canceriano sem lar. http://edsonjnovaes.wordpress.com/2014/04/02/turbinados/ 1/3

    E-print Network

    Chiao, Jung-Chih

    4/5/2014 Turbinados | Um canceriano sem lar. http://edsonjnovaes.wordpress.com/2014 canceriano sem lar. http://edsonjnovaes.wordpress.com/2014/04/02/turbinados/ 2/3 Technology uses micro Internet" Em "Arte" #12;4/5/2014 Turbinados | Um canceriano sem lar. http://edsonjnovaes.wordpress.com/2014

  6. Project UM-HAUL: A self-unloading reusable lunar lander

    NASA Technical Reports Server (NTRS)

    1991-01-01

    The establishment of a lunar base is technologically and financially challenging. Given the necessary resources and political support, it can be done. In addition to the geopolitical obstacles, however, there are logistical problems involved in establishing such bases that can only be overcome with the acquisition of a significant transportation and communications network in the Earth-Moon spatial region. Considering the significant number of payloads that will be required in this process, the mass-specific cost of launching these payloads, and the added risk and cost of human presence in space, it is clearly desirable to automate major parts of such an operation. One very costly and time-consuming factor in this picture is the delivery of payloads to the Moon. Foreseeable payloads would include atmospheric modules, inflatable habitat kits, energy and oxygen plant elements, ground vehicles, laboratory modules, crew supplies, etc. The duration of high-risk human presence on the Moon could be greatly reduced if all such payloads were delivered to the prospective base site in advance of crew arrival. In this view, the idea of a 'Self-Unloading Reusable Lunar Lander' (SURLL) arises naturally. The general scenario depicts the lander being brought to low lunar orbit (LLO) from Earth atop a generic Orbital Transfer Vehicle (OTV). From LLO, the lander shuttles payloads down to the lunar surface, where, by means of some resident, detachable unloading device, it deploys the payloads and returns to orbit. The general goal is for the system to perform with maximum payload capability, automation, and reliability, while also minimizing environmental hazards, servicing needs, and mission costs. Our response to this demand is UM-HAUL, or the UnManned Heavy pAyload Unloader and Lander. The complete study includes a system description, along with a preliminary cost analysis and a design status assessment.

  7. The response of chemistry and climate to the 11-year solar cycle in UM-UKCA

    NASA Astrophysics Data System (ADS)

    Bednarz, Ewa; Telford, Paul; Maycock, Amanda; Abraham, Luke; Braesicke, Peter; Pyle, John

    2014-05-01

    It is now generally agreed that the UV variability associated with the 11-year solar cycle leads to changes in ozone and temperature in the upper stratosphere. In addition, a range of observational and modelling studies suggest that such changes are the starting point for a chain of processes (including feedbacks) resulting in circulation changes in many areas of the atmosphere. However, precise details of the interactions between chemistry and meteorology induced by solar variability remain under question. In our study, we use a version of the UM-UKCA chemistry-climate model with consistent spectrally-resolved solar variability. While the solar cycle in heating rates has been applied with the method used in HadGEM2-ES, fine spectrally-resolved solar variability has been uniquely incorporated into the Fast-JX photolysis scheme. We perform two 50-year-long perpetual year solar maximum and solar minimum integrations and complement them with a three member ensemble of a transient 1960-2010 integration in which boundary conditions correspond by and large to the CCMI Ref-C1 scenario. We show how the inferred solar signals vary between the individual experiments. This indicates high natural variability and the resulting contamination of the solar signal with contributions from other processes as well as the existence of possible non-linearities between the solar cycle and other atmospheric forcings. Therefore, we highlight that long data series are needed to ensure correct attribution of the modelled and observed anomalies. In addition, we present results from two perpetual year experiments in which the solar cycle was applied exclusively in either short-wave heating or photolysis. We find large non-linearities in the modelled anomalies as compared to the realistic integration with both modulations included. This highlights the subtle nature of the dynamical response to the solar cycle forcing and indicates the need for interactive chemistry with a detailed photolysis scheme for modelling the solar-climate interactions fully.

  8. Black phosphorus mode-locked Er-doped ZBLAN fiber laser at 2.8 um wavelength

    E-print Network

    Qin, Zhipeng; Zhao, Chujun; Wen, Shuangchun; Yuan, Peng; Qian, Liejia

    2015-01-01

    Mid-infrared saturable absorber mirror is successfully fabricated by transferring the mechanically exfoliated black phosphorus onto the gold-coated mirror. With the as-prepared black phosphorus saturable absorber mirror, a continuous-wave passively mode-locked Er:ZBLAN fiber laser is demonstrated at the wavelength of 2.8 um, which delivers a maximum average output power of 613 mW, a repetition rate of 24 MHz and a pulse duration of 42 ps. To the best of our knowledge, it is the first time to demonstrate black phosphorus mode-locked laser at 2.8 um wavelength. Our results demonstrate the feasibility of black phosphorus flake as a new two-dimensional material for application in mid-infrared ultrafast photonics.

  9. Metforas de Perspectivas Culturais na (re) definio de padres de colaborao de um jogo de multi-toque para

    E-print Network

    Barbosa, Alberto

    112 Metáforas de Perspectivas Culturais na (re) definição de padrões de colaboração de um jogo de usuários com autismo. Inicialmente, concebemos padrões de colaboração no jogo colaborativo multi-toque PAR usuários a adoção dos mecanismos colaborativos do jogo e aproximá-los aos poucos à cultura colaborativa

  10. UM 625 REVISITED: MULTIWAVELENGTH STUDY OF A SEYFERT 1 GALAXY WITH A LOW-MASS BLACK HOLE

    SciTech Connect

    Jiang Ning; Dong Xiaobo; Yang Huan; Wang Junxian; Ho, Luis C. E-mail: xbdong@ustc.edu.cn

    2013-06-10

    UM 625, previously identified as a narrow-line active galactic nucleus (AGN), actually exhibits broad H{alpha} and H{beta} lines whose width and luminosity indicate a low black hole (BH) mass of 1.6 Multiplication-Sign 10{sup 6} M{sub Sun }. We present a detailed multiwavelength study of the nuclear and host galaxy properties of UM 625. Analysis of Chandra and XMM-Newton observations suggests that this system contains a heavily absorbed and intrinsically X-ray weak ({alpha}{sub ox} = -1.72) nucleus. Although not strong enough to qualify as radio loud, UM 625 does belong to a minority of low-mass AGNs detected in the radio. The broadband spectral energy distribution constrains the bolometric luminosity to L{sub bol} Almost-Equal-To (0.5-3) Multiplication-Sign 10{sup 43} erg s{sup -1} and L{sub bol}/L{sub Edd} Almost-Equal-To 0.02-0.15. A comprehensive analysis of Sloan Digital Sky Survey and Hubble Space Telescope images shows that UM 625 is a nearly face-on S0 galaxy with a prominent, relatively blue pseudobulge (Sersic index n = 1.60) that accounts for {approx}60% of the total light in the R band. The extended disk is featureless, but the central {approx}150-400 pc contains a conspicuous semi-ring of bright, blue star-forming knots, whose integrated ultraviolet luminosity suggests a star formation rate of {approx}0.3 M{sub Sun} yr{sup -1}. The mass of the central BH roughly agrees with the value predicted from its bulge velocity dispersion but is significantly lower than that expected from its bulge luminosity.

  11. Design, fabrication and testing of 17um pitch 640x480 uncooled infrared focal plane array detector

    NASA Astrophysics Data System (ADS)

    Jiang, Lijun; Liu, Haitao; Chi, Jiguang; Qian, Liangshan; Pan, Feng; Liu, Xiang

    2015-10-01

    Uncooled infrared focal plane array (UIRFPA) detectors are widely used in industrial thermography cameras, night vision goggles, thermal weapon sights, as well as automotive night vision systems. To meet the market requirement for smaller pixel pitch and higher resolution, we have developed a 17um pitch 640x480 UIRFPA detector. The detector is based on amorphous silicon (a-Si) microbolometer technology, the readout integrated circuit (ROIC) is designed and manufactured with 0.35um standard CMOS technology on 8 inch wafer, the microbolometer is fabricated monolithically on the ROIC using an unique surface micromachining process developed inside the company, the fabricated detector is vacuum packaged with hermetic metal package and tested. In this paper we present the design, fabrication and testing of the 17um 640x480 detector. The design trade-off of the detector ROIC and pixel micro-bridge structure will be discussed, by comparison the calculation and simulation to the testing results. The novel surface micromachining process using silicon sacrificial layer will be presented, which is more compatible with the CMOS process than the traditional process with polyimide sacrificial layer, and resulted in good processing stability and high fabrication yield. The performance of the detector is tested, with temperature equivalent temperature difference (NETD) less than 60mK at F/1 aperture, operability better than 99.5%. The results demonstrate that the detector can meet the requirements of most thermography and night vision applications.

  12. VizieR Online Data Catalog: 12um ISOCAM survey of the ESO-Sculptor field (Seymour+, 2007)

    NASA Astrophysics Data System (ADS)

    Seymour, N.; Rocca-Volmerange, B.; de Lapparent, V.

    2007-11-01

    We present a detailed reduction of a mid-infrared 12um (LW10 filter) ISOCAM open time observation performed on the ESO-Sculptor Survey field (Arnouts et al., 1997A&AS..124..163A). A complete catalogue of 142 sources (120 galaxies and 22 stars), detected with high significance (equivalent to 5{sigma}), is presented above an integrated flux density of 0.31mJy. Star/galaxy separation is performed by a detailed study of colour-colour diagrams. The catalogue is complete to 1mJy and, below this flux density, the incompleteness is corrected using two independent methods. The first method uses stars and the second uses optical counterparts of the ISOCAM galaxies; these methods yield consistent results. We also apply an empirical flux density calibration using stars in the field. For each star, the 12um flux density is derived by fitting optical colours from a multi-band {chi}2 to stellar templates (BaSel-2.0) and using empirical optical-IR colour-colour relations. This article is a companion analysis to our 2007 paper (Rocca-Volmerange et al. 2007A&A...475..801R) where the 12um faint galaxy counts are presented and analysed per galaxy type with the evolutionary code PEGASE.3. (1 data file).

  13. Microwave window breakdown experiments and simulations on the UM/L-3 relativistic magnetron.

    PubMed

    Hoff, B W; Mardahl, P J; Gilgenbach, R M; Haworth, M D; French, D M; Lau, Y Y; Franzi, M

    2009-09-01

    Experiments have been performed on the UM/L-3 (6-vane, L-band) relativistic magnetron to test a new microwave window configuration designed to limit vacuum side breakdown. In the baseline case, acrylic microwave windows were mounted between three of the waveguide coupling cavities in the anode block vacuum housing and the output waveguides. Each of the six 3 cm deep coupling cavities is separated from its corresponding anode cavity by a 1.75 cm wide aperture. In the baseline case, vacuum side window breakdown was observed to initiate at single waveguide output powers close to 20 MW. In the new window configuration, three Air Force Research Laboratory-designed, vacuum-rated directional coupler waveguide segments were mounted between the coupling cavities and the microwave windows. The inclusion of the vacuum side power couplers moved the microwave windows an additional 30 cm away from the anode apertures. Additionally, the Lucite microwave windows were replaced with polycarbonate windows and the microwave window mounts were redesigned to better maintain waveguide continuity in the region around the microwave windows. No vacuum side window breakdown was observed in the new window configuration at single waveguide output powers of 120+MW (a factor of 3 increase in measured microwave pulse duration and factor of 3 increase in measured peak power over the baseline case). Simulations were performed to investigate likely causes for the window breakdown in the original configuration. Results from these simulations have shown that in the original configuration, at typical operating voltage and magnetic field ranges, electrons emitted from the anode block microwave apertures strike the windows with a mean kinetic energy of 33 keV with a standard deviation of 14 keV. Calculations performed using electron impact angle and energy data predict a first generation secondary electron yield of 65% of the primary electron population. The effects of the primary aperture electron impacts, combined with multiplication of the secondary populations, were determined to be the likely causes of the poor microwave window performance in the original configuration. PMID:19791954

  14. User's manual (UM) for the enhanced logistics intratheater support tool (ELIST) database utility segment version 8.1.0.0 for solaris 7.

    SciTech Connect

    Dritz, K.

    2002-03-06

    This document is the User's Manual (UM) for the Enhanced Logistics Intratheater Support Tool (ELIST) Database Utility Segment. It tells how to use its features to administer ELIST database user accounts.

  15. ON THE COMPACT H II GALAXY UM 408 AS SEEN BY GMOS-IFU: PHYSICAL CONDITIONS

    SciTech Connect

    Lagos, Patricio; Telles, Eduardo; Munoz-Tunon, Casiana; Tenorio-Tagle, Guillermo E-mail: etelles@on.br E-mail: rcarrasco@gemini.edu E-mail: gtt@inaoep.mx

    2009-06-15

    We present Integral Field Unit GMOS-IFU data of the compact H II galaxy UM 408, obtained at the Gemini South telescope, in order to derive the spatial distribution of emission lines and line ratios, kinematics, plasma parameters, and oxygen abundances as well the integrated properties over an area of 3''x4.''4 equivalent with {approx}750 pc x 1100 pc located in the central part of the galaxy. The starburst in this area is resolved into two giant regions of about 1.''5 and 1'' ({approx}375 and {approx}250 pc) diameter, respectively and separated 1.5-2'' ({approx}500 pc). The extinction distribution concentrate its highest values close but not coincident with the maxima of H{alpha} emission around each one of the detected regions. This indicates that the dust has been displaced from the exciting clusters by the action of their stellar winds. The ages of these two regions, estimated using H{beta} equivalent widths, suggest that they are coeval events of {approx}5 Myr with stellar masses of {approx}10{sup 4} M {sub sun}. We have also used [O III]/H{beta} and [S II]/H{alpha} ratio maps to explore the excitation mechanisms in this galaxy. Comparing the data points with theoretical diagnostic models, we found that all of them are consistent with excitation by photoionization by massive stars. The H{alpha} emission line was used to measure the radial velocity and velocity dispersion. The heliocentric radial velocity shows an apparent systemic motion where the east part of the galaxy is blueshifted, while the west part is redshifted, with a relative motion of {approx}10 km s{sup -1}. The velocity dispersion map shows supersonic values typical for extragalactic H II regions. We derived an integrated oxygen abundance of 12+log(O/H) = 7.87 summing over all spaxels in our field of view. An average value of 12+log(O/H) = 7.77 and a difference of {delta}(O/H) = 0.47 between the minimum and maximum values (7.58 {+-} 0.06-8.05 {+-} 0.04) were found, considering all data points where the oxygen abundance was measured. The spatial distribution of oxygen abundance does not show any significant gradient across the galaxy. On the other hand, the bulk of data points are lying in a region of {+-}2{sigma} dispersion (with {sigma} = 0.1 dex) around the average value, confirming that this compact H II galaxy, like other previously studied dwarf irregular galaxies, is chemically homogeneous. Therefore, the new metals processed and injected by the current star formation episode are possibly not observed and reside in the hot gas phase, whereas the metals from previous events are well mixed and homogeneously distributed through the whole extent of the galaxy.

  16. 42 | dec 2014 | north american | SPectrUm.ieee.orG A MetAl MAnicure: the iHY hand picks

    E-print Network

    Haller, Gary L.

    ,DARPAaskedteamstodevelopmulti- fingered robotic hands that could com- plete a variety of tasks, like picking up a telephone handset42 | dec 2014 | north american | SPectrUm.ieee.orG A MetAl MAnicure: the iHY hand picks up a ball flat surfaces and form a cage to hold them. #12;All pHotogrApHs bY iRobot SPectrUm.ieee.orG | north

  17. Imagens do céu ontem e hoje - um multimídia interativo de astronomia e uma nova exposição no MAST

    NASA Astrophysics Data System (ADS)

    Caretta, C. A.; Lima, F. P.; Requeijo, F.; Vieira, G. G.; Alves, F.; Valente, M. E. A.; de Almeida, R.; de Garcia, G. C.; Quixadá, A. C.

    2003-08-01

    "Imagens do Céu Ontem e Hoje" é o título de uma nova exposição que está sendo inaugurada no Museu de Astronomia e Ciências Afins (MCT), que inclui experimentos interativos, maquetes, réplicas e 8 terminais de computador com um multimídia interativo sobre Astronomia para consulta dos visitantes. O multimídia apresenta um conteúdo bastante extenso, que engloba quase todos os temas em Astronomia, consistindo numa fonte de divulgação e pesquisa para um público que vai das crianças até estudantes universitários. O conteúdo está distribuído em mais de 500 páginas de texto divididas em 4 módulos: "O Universo", "Espectroscopia", "Telescópios" e "Observando o Céu". Cada módulo é subdividido em 5 seções, em média, cada uma iniciada por uma animação que ilustra os temas a serem abordados na seção. Ao final da animação, uma lista de temas é apresentada sob o título "Saiba Mais". Para exemplificar, o módulo "O Universo" contém as seguintes seções: "O Universo visto pelo homem", "Conhecendo o Sistema Solar", "Indo além do Sistema Solar", "Nossa Galáxia, a Via-Láctea" e "Indo mais além, a imensidão do Universo". A seção "Conhecendo o Sistema Solar", por sua vez, tem os seguintes temas: "A origem do Sistema Solar", "O Sol", "Os planetas", "Satélites, asteróides, cometas e outros bichos..." e "O Sistema Solar em números". Cada texto é repleto de imagens, quadros, desenhos, esquemas, etc, além de passatempos ao final de cada seção, incluindo jogos interativos, quadrinhos e curiosidades, que auxiliam o aprendizado de forma divertida. Apresentamos neste trabalho as idéias gerais que permearam a produção da exposição, e uma viagem pelo multimídia para exemplificar sua estrutura e conteúdo. O multimídia será posteriormente disponibilizado para o público externo pela página eletrônica do MAst e/ou por intermédio de uma publicação comercial.

  18. Community Structure and Activity of a Highly Dynamic and Nutrient-Limited Hypersaline Microbial Mat in Um Alhool Sabkha, Qatar

    PubMed Central

    Al-Thani, Roda; Al-Najjar, Mohammad A. A.; Al-Raei, Abdul Munem; Ferdelman, Tim; Thang, Nguyen M.; Shaikh, Ismail Al; Al-Ansi, Mehsin; de Beer, Dirk

    2014-01-01

    The Um Alhool area in Qatar is a dynamic evaporative ecosystem that receives seawater from below as it is surrounded by sand dunes. We investigated the chemical composition, the microbial activity and biodiversity of the four main layers (L1–L4) in the photosynthetic mats. Chlorophyll a (Chl a) concentration and distribution (measured by HPLC and hyperspectral imaging, respectively), the phycocyanin distribution (scanned with hyperspectral imaging), oxygenic photosynthesis (determined by microsensor), and the abundance of photosynthetic microorganisms (from 16S and 18S rRNA sequencing) decreased with depth in the euphotic layer (L1). Incident irradiance exponentially attenuated in the same zone reaching 1% at 1.7-mm depth. Proteobacteria dominated all layers of the mat (24%–42% of the identified bacteria). Anoxygenic photosynthetic bacteria (dominated by Chloroflexus) were most abundant in the third red layer of the mat (L3), evidenced by the spectral signature of Bacteriochlorophyll as well as by sequencing. The deep, black layer (L4) was dominated by sulfate reducing bacteria belonging to the Deltaproteobacteria, which were responsible for high sulfate reduction rates (measured using 35S tracer). Members of Halobacteria were the dominant Archaea in all layers of the mat (92%–97%), whereas Nematodes were the main Eukaryotes (up to 87%). Primary productivity rates of Um Alhool mat were similar to those of other hypersaline microbial mats. However, sulfate reduction rates were relatively low, indicating that oxygenic respiration contributes more to organic material degradation than sulfate reduction, because of bioturbation. Although Um Alhool hypersaline mat is a nutrient-limited ecosystem, it is interestingly dynamic and phylogenetically highly diverse. All its components work in a highly efficient and synchronized way to compensate for the lack of nutrient supply provided during regular inundation periods. PMID:24658360

  19. The U. S. Geological Survey, Digital Spectral Library: Version 1 (0.2 to 3.0um)

    USGS Publications Warehouse

    Clark, Roger N.; Swayze, Gregg A.; Gallagher, Andrea J.; King, Trude V.V.; Calvin, Wendy M.

    1993-01-01

    We have developed a digital reflectance spectral library, with management and spectral analysis software. The library includes 498 spectra of 444 samples (some samples include a series of grain sizes) measured from approximately 0.2 to 3.0 um . The spectral resolution (Full Width Half Maximum) of the reflectance data is <= 4 nm in the visible (0.2-0.8 um) and <= 10 nm in the NIR (0.8-2.35 um). All spectra were corrected to absolute reflectance using an NIST Halon standard. Library management software lets users search on parameters (e.g. chemical formulae, chemical analyses, purity of samples, mineral groups, etc.) as well as spectral features. Minerals from borate, carbonate, chloride, element, halide, hydroxide, nitrate, oxide, phosphate, sulfate, sulfide, sulfosalt, and the silicate (cyclosilicate, inosilicate, nesosilicate, phyllosilicate, sorosilicate, and tectosilicate) classes are represented. X-Ray and chemical analyses are tabulated for many of the entries, and all samples have been evaluated for spectral purity. The library also contains end and intermediate members for the olivine, garnet, scapolite, montmorillonite, muscovite, jarosite, and alunite solid-solution series. We have included representative spectra of H2O ice, kerogen, ammonium-bearing minerals, rare-earth oxides, desert varnish coatings, kaolinite crystallinity series, kaolinite-smectite series, zeolite series, and an extensive evaporite series. Because of the importance of vegetation to climate-change studies we have include 17 spectra of tree leaves, bushes, and grasses. The library and software are available as a series of U.S.G.S. Open File reports. PC user software is available to convert the binary data to ascii files (a separate U.S.G.S. open file report). Additionally, a binary data files are on line at the U.S.G.S. in Denver for anonymous ftp to users on the Internet. The library search software enables a user to search on documentation parameters as well as spectral features. The analysis system includes general spectral analysis routines, plotting packages, radiative transfer software for computing intimate mixtures, routines to derive optical constants from reflectance spectra, tools to analyze spectral features, and the capability to access imaging spectrometer data cubes for spectral analysis. Users may build customized libraries (at specific wavelengths and spectral resolution) for their own instruments using the library software. We are currently extending spectral coverage to 150 um. The libraries (original and convolved) will be made available in the future on a CD-ROM.

  20. 3/8/2015 Conhea duas gachas que, em realidades distintas, usam o estudo como bandeira pela igualdade de gnero -Zero Hora http://zh.clicrbs.com.br/rs/noticias/noticia/2015/03/conheca-duas-gauchas-que-em-realidades-distintas-usam-o-estudo-como-bandei... 1/5

    E-print Network

    Barbosa, Marcia C. B.

    igualdade de gênero - Zero Hora http://zh.clicrbs.com.br/rs/noticias/noticia/2015/03/conheca-duas-gauchas como bandeira pela igualdade de gênero Da alfabetização ao pósdoutorado, Delaidia e Márcia são exemplos estudo como bandeira pela igualdade de gênero - Zero Hora http

  1. The challenge and scientific application of the CO2 4.3 um atmospheric limb emission of Mars

    NASA Astrophysics Data System (ADS)

    Lopez-Valverde, M. A.; Piccialli, A.; Giuranna, M.; Funke, B.; López-Puertas, M.; Jurado-Navarro, A. A.; García-Comas, M.; González-Galindo, F.; López-Moreno, J. J.; Jiménez-Monferrer, S.

    2015-10-01

    The atmospheric fluorescent emissions of CO2 at 4.3- um have been observed in the daytime upper atmosphere of Mars from a limb geometry by the instruments OMEGA and PFS on board Mars Express [1, 8]. Initial analysis using non-local thermodynamic equilibrium (NLTE) models show that the emissions are well understood [7, 3, 6]. Yet they have not been exploited to derive important thermospheric parameters, like CO2 densities and temperatures. Our major goals are to improve current NLTE models with a joint study of OMEGA and PFS data, and to build an ambitious state-of-the-art NLTE retreival scheme for Mars. Recent progress has been made in these directions on Mars, Venus and Earth. We will present a summary of these efforts and the difficulties and expectatives for its application to the Mars Express data

  2. Integration of geophysical and geological data for delimitation of mineralized zones in Um Naggat area, Central Eastern Desert, Egypt

    NASA Astrophysics Data System (ADS)

    Gaafar, Ibrahim

    2015-06-01

    An integrated approach for geophysical, geological and mineralogical data was followed for Um Naggat area, Central Eastern Desert, Egypt, in order to delineate its mineralized zones. The albitized granites are well-defined on the Th- and U-channel images, by their anomalous shapes, reaching 150 ppm and 90 ppm respectively, beside low K content. Interpretations of the aeromagnetic maps delineated four regional structural trends oriented due NNW, NW, ENE and E-W directions. They are identified as strike-slip faults, which coincide well with field observations, where NW-trending faults cut and displace right laterally ENE-trending older ones. The interaction between these two strike-slip fault systems confining the albite granite is easily identified on the regional data presenting longer wavelength anomalies, implying deep-seated structures. They could represent potential pathways for migration of enriched mineralized fluids. Geochemically, albite granites of peraluminous characteristics that had suffered extensive post-magmatic metasomatic reworking, resulted into development of (Zr, Hf, Nb, Ta, U, Th, Sn) and albite-enriched and greisenized granite body of about 600 m thick, and more than 3 km in strike length. The albite granite is characterized by sharp increase in average rare metal content: Zr (830 ppm), Hf (51 ppm), Nb (340 ppm), Ta (44 ppm), and U (90 ppm). Thorite, uranothorite, uraninite and zircon are the main uranium-bearing minerals of magmatic origin within the enclosing granite. However, with respect to Zr, Nb, and Ta, the albitized granite can be categorized as rare metal granite. The integration of airborne geophysical (magnetic and ?-ray spectrometric), geological, geochemical and mineralogical data succeeded in assigning the albite granite of Um Naggat pluton as a mineralized zone. This zone is characterized by its high thorium and uranium of hydrothermal origin as indicated by its low Th/U ratio, with rare metals mineralization controlled by two main structural trends in the NW- and ENE-directions.

  3. Attitudes of Psychiatric Nurses about the Request for Euthanasia on the Basis of Unbearable Mental Suffering(UMS)

    PubMed Central

    Wampers, Martien; De Lepeleire, Jan; Correll, Christophe U.

    2015-01-01

    Introduction When psychiatric patients express a wish for euthanasia, this should first and foremost be interpreted as a cry for help. Due to their close day-to-day relationship, psychiatric nurses may play an important and central role in responding to such requests. However, little is known about nurses’ attitudes towards euthanasia motivated by unbearable mental suffering. Objectives The aim of this study was to provide insight into the attitudes and actions taken by psychiatric nurses when confronted with a patient’s euthanasia request based on unbearable mental suffering (UMS). Method A questionnaire was sent to 11 psychiatric hospitals in the Flemish part of Belgium. Results The overall response rate was 70% (N = 627). Psychiatric nurses were frequently confronted with a request for euthanasia, either directly (N = 329, 53%) or through a colleague (N = 427, 69%). A majority (N = 536, 84%) did not object to euthanasia in a psychiatrically ill population with UMS. Confounding factors were the psychiatric diagnosis and the type of ward where the nurses were working. Most participants acknowledged a lack of knowledge and skills to adequately address the euthanasia request (N = 434, 71%). Nearly unanimously (N = 618, 99%), study participants indicated that dealing with euthanasia requests and other end-of-life issues should be part of the formal training of nurses. Conclusion The results highlight the need for ethically sound and comprehensive provision of care. Psychiatric nurses play an important role in dealing with the complex issue of requests for euthanasia. There is also a need for education, training and clear guidelines on the level of health care organizations. PMID:26700007

  4. Mixed-Methods Study that Examines Nine Science Teachers' Perceptions of Slooh Robotic Telescope for Teaching Astronomy. (Breton Title: Métodos Mistos de Estudo que Examinam a Percepção de Nove Professores de Ciências sobre o Telescópio Robótico Slooh Para Ensino de Astronomia.) Métodos Mixtos de Estudio que Examinan la Percepcion de Nueve Profesores de Ciencias sobre EL Telescopio Robótico Slooh Para la Enseñanza de la Astronomía

    NASA Astrophysics Data System (ADS)

    Gershun, Daniel C.; Slater, Timothy F.; Berryhill, Katie J.

    2014-07-01

    Although previous studies show that robotic telescopes have the potential to enhance student learning, there is comparatively little research that focuses on teacher perceptions of this technology. This study investigates: "what is the academic merit of using SLOOH robotic telescopes to teach astronomy as perceived by science teachers?" Our sample consists of nine science teachers of students aged 13-18 years. Pre- and post-tests, interviews, and surveys were collected during two weeks of a summer online course about robotic telescopes. While pre and post-tests do not reveal a statistically significant gain in astronomy content knowledge, analysis of qualitative data reveals five themes which describe the most important aspects of using SLOOH according to participants: "Images," "Interface," "Classroom Application," "Instructor Impact," and "Logistical Issues." Analysis of these themes suggests that SLOOH can provide an interactive and social learning environment with capabilities to incorporate crossdisciplinary themes. Embora estudos anteriores mostram que os telescópios robóticos têm o potencial de melhorar a aprendizagem dos alunos, há relativamente pouca investigação focada nas percepções de professores a respeito desta tecnologia. Este estudo investiga: "qual é o mérito acadêmico da utilização de telescópios robóticos Slooh para ensinar astronomia, tal como percebido pelos professores de ciências?" Nossa amostra é composta por nove professores de ciências de estudantes com idades entre 13-18 anos pré e pós-testes, entrevistas, e levantamentos foram coletados durante duas semanas de um curso on-line de verão sobre telescópios robóticos. Enquanto os testes pré e pós não revelaram um ganho estatisticamente significativo no conhecimento do conteúdo astronomia, a análise de dados qualitativos revela cinco temas que descrevem os aspectos mais importantes da utilização Slooh de acordo aos participantes: "Imagens", "Interface", "Aplicação em sala de aula", "Impacto no Instrutor" e "Questões logísticas". A análise desses temas sugere que Slooh pode proporcionar um ambiente de aprendizagem interativo e social com capacidade de incorporar temas interdisciplinares. Aunque estudios previos muostraron que los telescopios robóticos tienen el potencial de mejorar el aprendizaje del estudiante, hay relativamente poca investigación centrada en las percepciones de lós profesores respecto de esta tecnología. Este estudio investiga: "¿cuál es el mérito académico de la utilización de telescopios robóticos SLOOH para enseñar astronomía según la percepción de los profesores de ciências?" Nuestra muestra está formada por nueve profesores de ciencias de estudiantes entre 13 a 18 años pre-y post-tests, entrevistas, y. encuestas se recogieron durante dos semanas de un curso on-line de verano sobre los telescopios robóticos. Si bien lós tests antes y después de las pruebas no revelaron un aumento estadísticamente significativo en el conocimiento de contenido astronómico, el análisis de lós datos cualitativos reveló cinco temas que describen los aspectos más importantes de la utilización de SLOOH de acuerdo con los participantes:. "Imágenes", "Interface", "aplicación en el aula", "Impacto en el Instructor" y "problemas logísticos" . El análisis de estos temas sugiere que SLOOH puede proporcionar un ambiente de aprendizaje interactivo y social, con capacidad para incorporar temas transversales.

  5. Mental health problems of undocumented migrants (UMs) in the Netherlands: a qualitative exploration of help-seeking behaviour and experiences with primary care

    PubMed Central

    Teunissen, Erik; Sherally, Jamilah; van den Muijsenbergh, Maria; Dowrick, Chris; van Weel-Baumgarten, Evelyn; van Weel, Chris

    2014-01-01

    Objective To explore health-seeking behaviour and experiences of undocumented migrants (UMs) in general practice in relation to mental health problems. Design Qualitative study using semistructured interviews and thematic analysis. Participants 15 UMs in the Netherlands, varying in age, gender, country of origin and education; inclusion until theoretical saturation was reached. Setting 4 cities in the Netherlands. Results UMs consider mental health problems to be directly related to their precarious living conditions. For support, they refer to friends and religion first, the general practitioner (GP) is their last resort. Barriers for seeking help include taboo on mental health problems, lack of knowledge of and trust in GPs competencies regarding mental health and general barriers in accessing healthcare as an UM (lack of knowledge of the right to access healthcare, fear of prosecution, financial constraints and practical difficulties). Once access has been gained, satisfaction with care is high. This is primarily due to the attitude of the GPs and the effectiveness of the treatment. Reasons for dissatisfaction with GP care are an experienced lack of time, lack of personal attention and absence of physical examination. Expectations of the GP vary, medication for mental health problems is not necessarily seen as a good practice. Conclusions UMs often see their precarious living conditions as an important determinant of their mental health; they do not easily seek help for mental health problems and various barriers hamper access to healthcare for them. Rather than for medication, UMs are looking for encouragement and support from their GP. We recommend that barriers experienced in seeking professional care are tackled at an institutional level as well as at the level of GP. PMID:25416057

  6. The c2d Spitzer Spectroscopic Survey of Ices Around Low-Mass Young Stellar Objects: I. H2O and the 5-8 um Bands

    E-print Network

    A. Boogert; K. Pontoppidan; C. Knez; F. Lahuis; J. Kessler-Silacci; E. van Dishoeck; G. Blake; J. Augereau; S. Bisschop; S. Bottinelli; T. Brooke; J. Brown; A. Crapsi; N. Evans II; H. Fraser; V. Geers; T. Huard; J. Jorgensen; K. Oberg; L. Allen; P. Harvey; D. Koerner; L. Mundy; D. Padgett; A. Sargent; K. Stapelfeldt

    2008-01-08

    With the goal to study the physical and chemical evolution of ices in solar-mass systems, a spectral survey is conducted of a sample of 41 low luminosity YSOs using 3-38 um Spitzer and ground-based spectra. The long-known 6.0 and 6.85 um bands are detected toward all sources, with the Class 0-type YSOs showing the deepest bands ever observed. In almost all sources the 6.0 um band is deeper than expected from the bending mode of pure solid H2O. The depth and shape variations of the remaining 5-7 um absorption indicate that it consists of 5 independent components, which, by comparison to laboratory studies, must be from at least 8 different carriers. Simple species are responsible for much of the absorption in the 5-7 um region, at abundances of 1-30% for CH3OH, 3-8% for NH3, 1-5% for HCOOH, ~6% for H2CO, and ~0.3% for HCOO- with respect to solid H2O. The 6.85 um band likely consists of one or two carriers, of which one is less volatile than H2O because its abundance relative to H2O is enhanced at lower H2O/tau_9.7 ratios. It does not survive in the diffuse interstellar medium (ISM), however. The similarity of the 6.85 um bands for YSOs and background stars indicates that its carrier(s) must be formed early in the molecular cloud evolution. If an NH4+ salt is the carrier its abundance with respect to solid H2O is typically 7%, and low temperature acid-base chemistry or cosmic ray induced reactions must have been involved in its formation. Possible origins are discussed for the carrier of an enigmatic, very broad absorption between 5 and 8 um. Finally, all the phenomena observed for ices toward massive YSOs are also observed toward low mass YSOs, indicating that processing of the ices by internal ultraviolet radiation fields is a minor factor in the early chemical evolution of the ices. [abridged

  7. PRIMEIRA LISTA -FI002 -Teorias de Perturbac~ao 1. Uma particula esta aprisionada em um poco de potencial nulo para

    E-print Network

    de Aguiar, Marcus A. M.

    perturba¸c~ao V (x) = -g(x - L/2). Calcule a corre¸c~ao nos n´iveis de energia at´e segunda ordem no par uma transi¸c~ao para o estado de um el´etron no n´ivel (1s) e outro livre. Aproxime o estado livre por

  8. Technology Development for High-Efficiency Solar Cells and Modules Using Thin (<80 um) Single-Crystal Silicon Wafers Produced by Epitaxy: June 11, 2011 - April 30, 2013

    SciTech Connect

    Ravi, T. S.

    2013-05-01

    Final technical progress report of Crystal Solar subcontract NEU-31-40054-01. The objective of this 18-month program was to demonstrate the viability of high-efficiency thin (less than 80 um) monocrystalline silicon (Si) solar cells and modules with a low-cost epitaxial growth process.

  9. VizieR Online Data Catalog: 70um-1.2mm and N2H+ maps of IRDC18454 (W43) (Beuther+,

    NASA Astrophysics Data System (ADS)

    Beuther, H.; Tackenberg, J.; Linz, H.; Henning, T.; Krause, O.; Ragan, S.; Nielbock, M.; Launhardt, R.; Schmiedeke, A.; Schuller, F.; Carlhoff, P.; Nguyen-Luong, Q.; Sakai, T.

    2011-11-01

    The cloud complex with a size of ~6'x6' was observed with PACS on Herschel on 2010 March 9. Maps at 250, 350, and 500um were obtained with SPIRE 2010) on 2010 March 11. We observed IRDC18454-1 with the Plateau de Bure Interferometer during five nights in October and November 2009 at 93GHz in the C and D configurations. The N2H+ data has been observed using the BEARS receiver at the NRO 45m telescope in Nobeyama, Japan. The different velocity components have been observed one in April 2010 with an average system temperature of Tsys=206K, the second in June, at slightly lower Tsys. The MIPS 24um data (from MIPSGAL) as well as the IRAC 8um observations (from GLIMPSE) are taken from the Spitzer archive. The 1.2mm continuum data were first presented in Beuther et al. (2002, Cat. J/ApJ/566/945) and the APEX 870um data are part of the ATLASGAL survey of the Galactic plane (Schuller et al., 2009A&A...504..415S). (2 data files).

  10. 48 SBA Controle & Automao Vol. 10 no. 01 / Jan., Fev., Mar, Abril de 1999 OTIMIZAO DE UM SISTEMA DE GERAO DE ENERGIA ELICA

    E-print Network

    Simões, Marcelo Godoy

    SISTEMA DE GERAÇÃO DE ENERGIA EÓLICA ATRAVÉS DE CONTROLE FUZZY M. Godoy Simões, N.N. Franceschetti, Bimal lógica e controle fuzzy visando melhorias no desempenho de um sistema de geração de energia eólica, em paralelização de sistemas. Esforços governamentais estão incentivando a utilização de energia gerada de fontes

  11. Instrues de utilizao O badge do Centenrio do IST --que se apresenta e configura como um hyperlink para o respectivo website comemorativo

    E-print Network

    Instituto de Sistemas e Robotica

    como um hyperlink para o respectivo website comemorativo --, será a forma oficial de associação dos diversos websites dos serviços e/ou iniciativas do IST ao mesmo, por forma a assegurar uma consistência no canto superior direito do website. Assegure-se --através do visionamento do código-fonte-- que está

  12. Request for Crystal Structure Determination UM# ________ Peter Y. Zavalij X-ray Crystallographi Center 091 Chemistry Bldg. / College Park, MD 20742

    E-print Network

    Thirumalai, Devarajan

    Request for Crystal Structure Determination UM# ________ Peter Y. Zavalij X-ray Crystallographi/Division: Address: UMD FRS# CreditCard/PO# Expiration date: PI signature: Billing contact: Graphic/Structural formula: Check Preliminary Structure Temp.[-123°C] Solvents, Full Structure Determination max 2 [55

  13. The dependence of land-atmosphere interactions on atmospheric parametrizations in the JULES/UM modelling system

    NASA Astrophysics Data System (ADS)

    Johnson, Helen; Best, Martin

    2015-04-01

    It has been understood for a while now that atmospheric behaviour is affected by land surface processes, modelling this relationship however still presents challenges. Most numerical weather prediction (NWP) models couple an atmospheric model to a land surface model in order to forecast the weather and/or climate. The Global Land-Atmosphere Coupling Experiment (GLACE) demonstrated that soil moisture variability has considerable control over atmospheric behaviour, particularly impacting on precipitation and temperature variability. The study also suggested that differences in coupling strengths between models may be due to differences in atmospheric parametrizations. There have since been other studies which support this claim but it is not yet clear which parameters control the land-atmosphere coupling strength or indeed what it should be. In this study we investigate whether certain atmospheric parameters hold more control than others over model sensitivity to land surface changes. We focus on the interaction of the JULES (Joint UK Land Environment Simulator) land surface model with the Met Office Unified Model (UM) that is used for operational NWP and climate prediction. For computational efficiency we ran the UM at a single site using a single column model (SCM) rather than running a global model simulation. A site in the Sahel region of West Africa was chosen as this is an area that was identified by GLACE as being especially responsive to changes in soil moisture. JULES was run several times with various different initial soil moisture profiles to create an ensemble of surface sensible and latent heat fluxes that could be used to force a set of different SCM runs in order to simulate a range of different atmospheric conditions. Various atmospheric parameters in the SCM were then perturbed to create additional sets of SCM runs with different sensitivities to soil moisture changes. By analysing the difference in spread between the standard configuration and the perturbed parameter sets of SCM runs, we gain insight into which atmospheric parameters have the most control over land-atmosphere interactions. The methodology for this experiment shall be introduced and initial results presented. This work is distributed under the Creative Commons Attribution 3.0 Unported License together with an author copyright. This license does not conflict with the regulations of the Crown Copyright.

  14. Calcareous benthonic foraminifera across the Cretaceous/Paleocene transition of Gebel Um El-Ghanayem, Kharga Oasis, Egypt

    NASA Astrophysics Data System (ADS)

    Orabi, Orabi H.; Khalil, Hamza M.

    2014-08-01

    The studies of benthic calcareous foraminifera of the Maastrichtian-early Paleocene Dakhla Formation in Gebel Um El-Ghanayem (Western Desert, Egypt), improve reconstruction of depositional environments of these successions. In total, 68 taxa of benthic foraminifera were identified in the studied succession. The late Maastrichtian assemblages (Zone CF3) are dominated by calcareous foraminifera with tapered tests, this tapered taxon Loxostomum applinae, Lox. tegulatum various dentalinid taxa, and Buliminella cushmani dominate in CF3 Biozone. We thus interpret these faunas as being dominated by infaunal morphogroups, suggesting a moderately eutrophic environment. Danian assemblages are characterized by abundant epifaunal trochospiral species, such as Cibicidoides abudurbensis, Cibicidoides farafraensis, and Gyroidinoides girardanus. The infaunal morphogroups make up 25-47% of fauna in the Danian, in contrast to 62-76% in the Upper Maastrichtian. This dominance of the Danian benthic foraminiferal assemblages by epifaunal or mixed epifaunal/infaunal morphogroups suggests that the food supply to the benthos was less abundant than in the latest Cretaceous. The Cretaceous/Paleocene boundary (K/Pg) is within the upper unit of the Lower Kharga Member and marked by a hiatus in at least the top of CF3 Zone of the Upper Maastrichtian to the Lower Paleocene (base Plc Zone).

  15. Rund um die Wirtschaftswissenschaftliche

    E-print Network

    Rossak, Wilhelm R.

    Governance: Management and Corporate Control / Decision & Risk / Education, Labour Relations and Employment / Strategy, Management and Marketing / Supply Chain Management / Managing International Enterprises BWL für

  16. YFIRLITSKORT UM BYGGINGUNA

    E-print Network

    Karlsson, Brynjar

    WC M.1.13 M.1.16 3 1 2 4 5 6 7 9 8 10 11 12 13 14 16 18 15 Ú101 Ú102 Ú103 Ú104 Ú105 Ú106 Ú107 Ú108 Ú112 M113 M111 M114 M115 M119 M120 M121 M122 M118 V104 V105 V106 V118 V117 V114 V115 V113 V112 V111 V

  17. 161. Anthony Skjell um, Lawrence Livermore Nati onal Laboratory, 7000 East Ave. , L-316, P. O. Box 808 Li vermore, CA94551

    E-print Network

    Dongarra, Jack

    , 69364 Lyon cedex 07, France 167. Hank Van der Vorst, Dept. of Techn. Mathemati cs and Computer Sci ence versi ty of Namur, FUNOP, 61 rue de Bruxel l es, B-Namur, Bel gi um 166. Bernard Tourancheau, LIP, ENS-Lyon Rockmont Ci rcl e Boul der, CO80303 180. Mary F. Wheel er, Ri ce Uni versi ty, Department of Mathemati cal

  18. Charged particle detection performances of CMOS pixel sensors produced in a 0.18 um process with a high resistivity epitaxial layer

    E-print Network

    Serhiy Senyukov; Jerome Baudot; Auguste Besson; Gilles Claus; Loic Cousin; Andrei Dorokhov; Wojciech Dulinski; Mathieu Goffe; Christine Hu-Guo; Marc Winter

    2013-03-07

    The apparatus of the ALICE experiment at CERN will be upgraded in 2017/18 during the second long shutdown of the LHC (LS2). A major motivation for this upgrade is to extend the physics reach for charmed and beauty particles down to low transverse momenta. This requires a substantial improvement of the spatial resolution and the data rate capability of the ALICE Inner Tracking System (ITS). To achieve this goal, the new ITS will be equipped with 50 um thin CMOS Pixel Sensors (CPS) covering either the 3 innermost layers or all the 7 layers of the detector. The CPS being developed for the ITS upgrade at IPHC (Strasbourg) is derived from the MIMOSA 28 sensor realised for the STAR-PXL at RHIC in a 0.35 um CMOS process. In order to satisfy the ITS upgrade requirements in terms of readout speed and radiation tolerance, a CMOS process with a reduced feature size and a high resistivity epitaxial layer should be exploited. In this respect, the charged particle detection performance and radiation hardness of the TowerJazz 0.18 um CMOS process were studied with the help of the first prototype chip MIMOSA 32. The beam tests performed with negative pions of 120 GeV/c at the CERN-SPS allowed to measure a signal-to-noise ratio (SNR) for the non-irradiated chip in the range between 22 and 32 depending on the pixel design. The chip irradiated with the combined dose of 1 MRad and 10^13 n_eq/cm^2 was observed to yield a SNR ranging between 11 and 23 for coolant temperatures varying from 15 C to 30 C. These SNR values were measured to result in particle detection efficiencies above 99.5% and 98% before and after irradiation respectively. These satisfactory results allow to validate the TowerJazz 0.18 um CMOS process for the ALICE ITS upgrade.

  19. Explaining the [CII]158um Deficit in Luminous Infrared Galaxies - First Results from a Herschel/PACS Study of the GOALS Sample

    E-print Network

    Diaz-Santos, T; Charmandaris, V; Stierwalt, S; Murphy, E J; Haan, S; Inami, H; Malhotra, S; Meijerink, R; Stacey, G; Petric, A O; Evans, A S; Veilleux, S; van der Werf, P P; Lord, S; Lu, N; Howell, J H; Appleton, P; Mazzarella, J M; Surace, J A; Xu, C K; Schulz, B; Sanders, D B; Bridge, C; Chan, B H P; Frayer, D T; Iwasawa, K; Melbourne, J; Sturm, E

    2013-01-01

    We present the first results of a survey of the [CII]158um emission line in 241 luminous infrared galaxies (LIRGs) comprising the Great Observatories All-sky Survey (GOALS) sample, obtained with the PACS instrument on board Herschel. The [CII] luminosities of the LIRGs in GOALS range from ~10^7 to 2x10^9 Lsun. We find that LIRGs show a tight correlation of [CII]/FIR with far-IR flux density ratios, with a strong negative trend spanning from ~10^-2 to 10^-4, as the average temperature of dust increases. We find correlations between the [CII]/FIR ratio and the strength of the 9.7um silicate absorption feature as well as with the luminosity surface density of the mid-IR emitting region (Sigma_MIR), suggesting that warmer, more compact starbursts have substantially smaller [CII]/FIR ratios. Pure star-forming (SF) LIRGs have a mean [CII]/FIR ~ 4x10^-3, while galaxies with low 6.2um PAH equivalent widths (EWs), indicative of the presence of active galactic nuclei (AGN), span the full range in [CII]/FIR. However, we...

  20. The Universe in a Box: Introduction to the Study of Astronomy in the Initial Formation of Physics Teachers. (Spanish Title: El Universo Representado en Una Caja: Introducción al Estudio de la Astronomía en la Formación Inicial de Profesores de Física.) O Universo Representado em Uma Caixa: Introdução ao Estudo da Astronomia NA Formação Inicial de Professores de Física

    NASA Astrophysics Data System (ADS)

    Longhini, Marcos Daniel

    2009-07-01

    This is a report of an activity of introduction to the study of Astronomy developed with a group of future Physics teachers at a Brazilian public university. Such activity had the goal of giving privileged emphasis to notions of spatiality, alternative conceptions of the participants and the process of interaction among peers, and consisted of the representation, in a three dimensional space, of the models of the universe that the participants had. The results, which were categorized as miscellaneous, geocentric, heliocentric and acentric models of the universe, were qualitatively analyzed. Analyses of the activity in the perspective of the participants are indicated and additional considerations are made regarding its use as a resource for teaching Astronomy and for teacher training. Este es el informe de una actividad para presentar un estudio introductorio de la Astronomía, desarrollado con una clase de futuros profesores de física en una universidad pública brasileña. Esta actividad tuvo como objetivo centrar las nociones de espacialidad, las concepciones alternativas de los participantes y el proceso de interacción entre pares, y consistió en la representación en un espacio tridimensional, de los modelos del universo que los participantes habían. Los resultados, que se clasificaron en universo miscelania, geocéntrico, heliocéntrico y acentrico, se analizaron cualitativamente. Son identificadas análisis de la actividad por los participantes, e hizo observaciones sobre su uso como recurso para la enseñanza de la astronomía y la formación de docentes. Trata-se do relato de uma atividade de introdução ao estudo da Astronomia, desenvolvida com uma turma de futuros professores de Física, em uma universidade pública brasileira. Tal atividade teve como meta privilegiar noções de espacialidade, as concepções alternativas dos participantes e o processo de interação entre pares e constou da representação, em um espaço tridimensional, dos modelos de universo que os participantes possuíam. Os resultados, que foram categorizados em universo miscelânea, geocêntrico, heliocêntrico e acêntrico, foram analisados qualitativamente. São apontadas as análises da atividade na ótica dos participantes, além de tecidas considerações sobre seu emprego como recurso ao ensino de Astronomia e na formação docente.

  1. Conv^enio IMPA-Univ. Pierre et Marie Curie (Jussieu, Paris) Foi assinado recentemente um conv^enio entre o IMPA e a Universidade Pierre et Marie Curie

    E-print Network

    Moreira, Carlos Gustavo

    Conv^enio IMPA-Univ. Pierre et Marie Curie (Jussieu, Paris) Foi assinado recentemente um conv^enio entre o IMPA e a Universidade Pierre et Marie Curie (UPMC, Jussieu, Paris). Est~ao previstas atividades

  2. 3.6-7.9 um Photometry of L and T Dwarfs and the Prevalence of Vertical Mixing in their Atmospheres

    E-print Network

    S. K. Leggett; D. Saumon; M. S. Marley; T. R. Geballe; D. A. Golimowski; D. Stephens; X. Fan

    2006-10-06

    We present new L' (3.75 um) photometry of six L and T dwarfs, and M' (4.70 um) photometry of ten L and T dwarfs, observed at Gemini Observatory, and new 3.55, 4.49, 5.73 and 7.87 um photometry of nine L and T dwarfs, obtained with the Spitzer Space Telescope. The sample includes unusually blue and red dwarfs from our near-infrared studies. The data are combined with published L', M' and Spitzer photometry of L and T dwarfs, and trends of colors with spectral type and other colors are examined. Model atmospheres by Marley and Saumon are used to generate synthetic colors for ranges of effective temperature, gravity, grain sedimentation efficiency, metallicity and vertical mixing efficiency. We explore how these parameters affect the mid-infrared colors of L and T dwarfs and find that the data are modelled satisfactorily only if substantial vertical mixing occurs in both L- and T-dwarf atmospheres. The location and range of the L and T dwarf sequences in IRAC color-color and color - magnitude diagrams is also only reproduced if this mixing occurs, with a range of efficiency described by K_zz ~ 10^2-10^6 cm^2/s. The colors of the unusually red dwarfs are best reproduced by non-equilibrium models with low sedimentation efficiency, i.e. thick cloud decks, and those of the unusually blue dwarfs by non-equilibrium models with high sedimentation efficiency, i.e. thin cloud decks. The K-L' and Spitzer [3.55]-[4.49] colors can be used as indicators of effective temperature for L and T dwarfs, but care must be taken to include gravity and metallicity effects for late-T dwarfs and vertical mixing for both late-L and T dwarfs.

  3. Vínculos sobre um modelo de quartessência de Chaplygin usando observações do satélite chandra da fração de massa de gás em aglomerados de galáxias

    NASA Astrophysics Data System (ADS)

    de Souza, R. S.

    2003-08-01

    Observações de Supernovas do tipo Ia mostram que a expansão do Universo está acelerando. Segundo as equações de Einstein uma componente com pressão negativa (energia escura) é necessária para explicar a aceleração cósmica. Além da energia escura é usualmente admitido que no Universo há também uma matéria exótica com pressão zero, que é chamada de matéria escura. Essa componente possui um papel fundamental na formação de estruturas no Universo. Recentemente tem se explorado a possibilidade de que matéria e energia escura poderiam ser unificadas através de uma única componente, que tem sido denominada de quartessência. Um exemplo de fluido com essas características é o Gás de Chaplygin Generalizado, que possui uma equação de estado da forma p = -A/ra. Inicialmente consideramos o caso especial a = 1 (gás de Chaplygin) e vinculamos parâmetros do modelo utilizando observações em raios-X do satélite Chandra da fração de massa de gás em aglomerados de galáxias. Uma comparação dos vínculos obtidos com esse teste com outros testes, tais como supernovas e idade do Universo, mostra que esse teste é bastante restritivo. Exibiremos ainda resultados para o caso em que a curvatura é nula e o parâmetro a está compreendido no intervalo -1 < a 1.

  4. Learning about the Sky from the Environment: An Experience Working Along One Year with Students of Elementary Education. (Spanish Title: Aprendiendo sobre EL Cielo Desde el Entorno: Una Experiencia Trabajando Durante un Año Junto a Estudiantes del Primario.) Aprendendo sobre o Céu a Partir do Entorno: Uma Experiência de Trabalho ao Longo de um Ano com Alunos de Ensino Fundamental

    NASA Astrophysics Data System (ADS)

    Longhini, Marcos Daniel; Gomide, Hanny Angeles

    2014-12-01

    Research developed with 95 students of the 6th year of elementary education in a public school of Uberlândia, Minas Gerais. It was a continuous work from February to December 2013, which led the students to participate in activities of observation of the environment, specifically the sky, analyzing the changes occurred. We focused on the study of variations in temperature, rainfall, day length, variations in the size of the shadows and changes in the aspect of the Moon. Our focus of analysis targeted the discussion of the knowledge that these students had about the topics indicated and as they entered the stage during the implementation of the proposal. The results showed a limited perception that students have of their environment, however, lately expanded due to the undertaken activities, especially in relation to the Moon. Working with systematic measure procedures reveals the careful handling of data so that they become understandable to students, and working with the shadows points towards the students first understand how shadows are formed, and then apply this knowledge to Astronomy. Finally, we conclude that the lived process consisted of an initial step of a work that should be encouraged for the subsequent years of training of these students. Proyecto de investigación desarrollado con 95 alumnos del sexto año de primaria en una escuela pública de Uberlândia, Minas Gerais. Fue un trabajo continuo, de febrero a diciembre de 2013, que llevó a los estudiantes a participar en actividades de observación de su entorno, entre ellas, el cielo, analizando los cambios ocurridos. Nos centramos en el estudio de las variaciones en la temperatura, las precipitaciones, la duración del día, las variaciones en el tamaño de las sombras y los cambios en los aspectos de la Luna. Nuestro foco de análisis se centró en discutir el conocimiento que estos estudiantes tenían sobre los temas indicados al inicio y término de la propuesta. Los resultados mostraron una percepción limitada que los estudiantes tienen de su alrededor la cual, sin embargo, se expandió debido a las actividades llevadas a cabo, sobre todo en relación con la Luna. Trabajar con medidas sistemáticas revela el manejo cuidadoso de los datos para que sean comprensibles para los estudiantes, así como el trabajo con las sombras para que comprendan primero como se forman estas para después trabajarlas en Astronomía. Por último, llegamos a la conclusión de que el proceso desarrollado consistió en una etapa inicial de una obra que debe ser profundizado en los años posteriores de la formación de estos estudiantes. Projeto de pesquisa desenvolvido com 95 alunos do 6º ano do Ensino Fundamental de uma escola pública estadual de Uberlândia, Minas Gerais. Foi um trabalho contínuo, de fevereiro a dezembro de 2013, o qual levou os alunos a participarem de atividades de observação do entorno, dentre ele, o céu, analisando as mudanças ocorridas. Focamos no estudo das variações de temperaturas, chuvas, duração do dia, variações do tamanho das sombras e mudanças nos aspectos da Lua. Nosso foco de análise centrou-se em discutir os conhecimentos que os referidos alunos tinham acerca dos temas indicados no início e ao término da implementação da proposta. Os resultados mostraram a percepção limitada que os estudantes possuem de seu entorno, todavia, ampliada em função das atividades desenvolvidas, principalmente no que se refere à Lua. O trabalho com medidas sistemáticas revela o cuidado no tratamento dos dados para que eles se tornem compreensíveis aos alunos, assim como o trabalho com as sombras sinaliza para que os alunos primeiramente compreendam como as sombras são formadas para depois trabalhar isso em Astronomia. Por fim, concluímos que o processo vivido constituiu-se em uma etapa inicial de um trabalho que deve ser estimulado para os anos subsequentes da formação desses alunos.

  5. Progri!lrnll de Ps-GradUi!l.50 em Estudos di!l Tri!ldu!o (PGET1/UFSC , Progrllmi!l de Ps-Gri!ldlli!l5Q em lnl5 (PPG1)NFSC Progri!lma de Ps-gradua.50 em Educa5Q (POSEDU)/UFOP Grupo PACTEjUAB

    E-print Network

    Hanazaki, Natalia

    RODRÍGUEZ-INES Os seminários e cursos serão gratuitos e são destinados a pesquisadores em Estudos da PROFISSIONAIS E ORIENTAÇÃO LABORAL Os seminários e cursos serão ministrados pelas professoras: ORA. AMPARO

  6. User's manual (UM) for the enhanced logistics intratheater support tool (ELIST) software segment version 8.1.0.0 for solaris 7.

    SciTech Connect

    Dritz, K.

    2002-03-06

    This document is the User's Manual (UM) for the Enhanced Logistics Intratheater Support Tool (ELIST) Software Segment. It tells how to use the end-user and administrative features of the segment. The instructions in Sections 4.2.1, 5.3.1, and 5.3.2 for the end-user features (Run ELIST and Run ETEdit) only cover the launching of those features in the DII COE environment; full details on the operation of ELIST and ETEdit in any environment can be found in the documents listed in Section 2.1.3 and referenced elsewhere in this document. On the other hand, complete instructions for the administrative features (Add Map Data and Delete Map Data) are presented in Sections 4.2.2, 5.3.3, and 5.3.4 of this document.

  7. Análise sobre o Conhecimento de um Grupo de Alunos do Ensino Médio da Rede Estadual de São Paulo sobre Termos e Fenômenos Astronômicos do Cotidiano

    NASA Astrophysics Data System (ADS)

    de Oliveira, E. F.; Voelzke, M. R.; Amaral, L. H.

    2007-08-01

    Embora os Parâmetros Curriculares Nacionais do Ensino Médio (PCN-EM) e as orientações complementares a esses Parâmetros (PCN+) apontem a importância de uma abordagem significativa de conceitos relacionados à astronomia nas aulas de Física, muitos estudantes terminam o Ensino Médio (EM) sem compreender a razão de certos acontecimentos de origem celeste, ainda que estes façam parte de seu cotidiano. Este trabalho tem por objetivo analisar os conhecimentos básicos em astronomia dos alunos de EM da escola estadual Batista Renzi, bem como investigar os meios através dos quais estes conhecimentos foram adquiridos. Para tanto foi elaborado um questionário de múltipla escolha aplicado a 310 alunos distribuídos entre as três séries do EM dos períodos matutino e noturno. Dessa forma, observou-se que apenas 34,5% relacionaram as estações do ano à inclinação do eixo de rotação da Terra, 21,3% indicaram a influência gravitacional da Lua e do Sol como responsáveis pelo fenômeno das marés, 24,5% indicaram corretamente quais são os objetos celestes mais próximos da Terra, 36,1% identificaram ano-luz como uma medida de distância e 34,2% reconheceram uma estrela cadente como meteoro. Em contrapartida, 67,1% compreendiam a sucessão entre dia e noite, 73,9% identificaram o Sol como estrela e 52,3% relacionaram o Big Bang à origem do Universo. Além disso, foram comparadas as respostas de alunos de diferentes séries e períodos, observando-se, dentre outras coisas, que os estudantes do terceiro ano apresentam um percentual de acertos semelhante ao dos alunos do primeiro, caracterizando que a abordagem de tópicos relacionados à astronomia no EM não tem contribuído para uma maior compreensão dos fenômenos e conceitos.

  8. Automating the Hunt for Volcanoes on Venus M.C. Burl yz , U.M. Fayyad z , P. Perona y , P. Smyth z , and M.P. Burl z

    E-print Network

    Smyth, Padhraic

    Automating the Hunt for Volcanoes on Venus M.C. Burl yz , U.M. Fayyad z , P. Perona y , P. Smyth z database of Venus. Training for the specific volcano­detection task is obtained by synthesizing feature% of the surface of Venus with synthetic aperture radar (SAR), has provided planetary scientists witha virtual

  9. BEAR BUCKS: Beginning Fall Semester 2013, all students including students on UM Dining Meal Plans, will have access to the Bear Bucks Program. Bear Bucks is a declining balance account offering campus-wide

    E-print Network

    Chu, Xi

    BEAR BUCKS: Beginning Fall Semester 2013, all students including students on UM Dining Meal Plans, will have access to the Bear Bucks Program. Bear Bucks is a declining balance account offering campus-wide dining flexibility. New Bear Bucks accounts can be opened with as little as $20! FEATURES OF BEAR BUCKS

  10. Project UM-HAUL (UnManned Heavy pAyload Unloader and Lander): The design of a reusable lunar lander with an independent cargo unloader

    NASA Technical Reports Server (NTRS)

    1991-01-01

    Project UM-Haul is the preliminary design of a reusable lunar transportation vehicle that travels between a lunar parking orbit and the lunar surface. This vehicle is an indispensible link in the overall task of establishing a lunar base as defined by the NASA Space Exploration Initiative. The response to this need consists of two independent vehicles: a lander and an unloader. The system can navigate and unload itself with a minimum amount of human intervention. The design addresses structural analysis, propulsion, power, controls, communications, payload handling and orbital operations. The Lander has the capacity to decend from low lunar orbit (LLO) to the lunar surface carrying a 7000 kg payload, plus the unloader, plus propellant for ascent to LLO. The Lander employs the Unloader by way of a motorized ramp. The Unloader is a terrain vehicle capable of carrying cargoes of 8,500 kg mass and employs a lift system to lower payloads to the ground. The system can perform ten missions before requiring major servicing.

  11. UM ID NUMBER RSMAS General

    E-print Network

    Miami, University of

    , State, Zip Code City, State, Zip Code ( ) - ( ) - Mobile Phone Fee: OFFICE USE ONLY Hardtop Convertible APPLICATION Campus Address Entered By: Sale Replacement Exchange Payment: Credit Card Check Money Order Other

  12. Age-related changes in auditory nerve-inner hair cell connections, hair cell numbers, auditory brain stem response and gap detection in UM-HET4 mice.

    PubMed

    Altschuler, R A; Dolan, D F; Halsey, K; Kanicki, A; Deng, N; Martin, C; Eberle, J; Kohrman, D C; Miller, R A; Schacht, J

    2015-04-30

    This study compared the timing of appearance of three components of age-related hearing loss that determine the pattern and severity of presbycusis: the functional and structural pathologies of sensory cells and neurons and changes in gap detection (GD), the latter as an indicator of auditory temporal processing. Using UM-HET4 mice, genetically heterogeneous mice derived from four inbred strains, we studied the integrity of inner and outer hair cells by position along the cochlear spiral, inner hair cell-auditory nerve connections, spiral ganglion neurons (SGN), and determined auditory thresholds, as well as pre-pulse and gap inhibition of the acoustic startle reflex (ASR). Comparisons were made between mice of 5-7, 22-24 and 27-29 months of age. There was individual variability among mice in the onset and extent of age-related auditory pathology. At 22-24 months of age a moderate to large loss of outer hair cells was restricted to the apical third of the cochlea and threshold shifts in the auditory brain stem response were minimal. There was also a large and significant loss of inner hair cell-auditory nerve connections and a significant reduction in GD. The expression of Ntf3 in the cochlea was significantly reduced. At 27-29 months of age there was no further change in the mean number of synaptic connections per inner hair cell or in GD, but a moderate to large loss of outer hair cells was found across all cochlear turns as well as significantly increased ABR threshold shifts at 4, 12, 24 and 48 kHz. A statistical analysis of correlations on an individual animal basis revealed that neither the hair cell loss nor the ABR threshold shifts correlated with loss of GD or with the loss of connections, consistent with independent pathological mechanisms. PMID:25665752

  13. Advancements in the Retrieval of CO2 from an Airborne IM-CW Lidar operating in 1.57-um Region

    NASA Astrophysics Data System (ADS)

    Harrison, F.; Browell, E.; Dobler, J.; Kooi, S.; McGregor, D.; Choi, Y.

    2012-04-01

    Accurate understanding of carbon balance in the environment is critical to projections of the future evolution of the Earth's climate. Uncertainties in the modeling of carbon sources and sinks remain large due to the limited set of observations from the current network of in-situ and surface measurements. Global, spaceborne measurements of atmospheric CO2 can reduce these uncertainties. As a result, the NRC Decadal Survey (DS) of Earth Science and Applications from Space identified Active Sensing of CO2 Emissions over Nights, Days, and Seasons (ASCENDS) as an important mid-term (Tier II) mission. The active space remote measurement of the column CO2 mixing ratio (XCO2) that is called for by the NRC in the ASCENDS mission requires the simultaneous measurement of the CO2 number density column and the O2 number density column to derive the average XCO2 column. The NRC recommendation calls for XCO2 to be measured to a precision of less than 2 ppm and must be made without bias from aerosols, dust, or clouds. This paper discusses the latest flight test results from the Multi-Functional Fiber Laser Lidar (MFLL), a laser absorption spectrometer (LAS) system under developed by ITT Exelis under evaluation by NASA LaRC for the ASCENDS mission. The MFLL is a multi-frequency intensity-modulated continuous-wave (IM-CW) LAS operating near 1.57 um to obtain remote CO2 column measurements. During these tests, encoded modulation techniques for minimizing the impact of thin clouds on CO2 measurements were demonstrated and the MFLL remote CO2 column measurements were evaluated against airborne in situ CO2 profile measurements under a wide variety of surface and atmospheric conditions. This paper describes the modulation techniques employed and presents algorithms minimizing bias from thin clouds on CO2 retrievals. MFLL and in situ CO2 data comparisons are presented and observations of CO2 column enhancements in the Four Corner's power plant plumes and CO2 uptake over the cornfields in Nebraska and Iowa are discussed.

  14. Estudo da Influncia de Seqncias Polipeptdicas e

    E-print Network

    Neshich, Goran

    no ASTRAL SCOP Genetic Domain Sequence (Brenner et al., 2000) que é derivada da base de dados PDB SEQRES. Foram então escolhidos três bancos de dados com diferentes níveis de similaridade: ASTRAL SCOP 10, ASTRAL SCOP 40 e ASTRAL SCOP 70, com valores máximos de 10

  15. Estudo de Equaes Diferenciais Ordinrias e

    E-print Network

    Paraná, Universidade Federal do

    ) A tangente à linha elástica no meio da viga é paralela ao eixo x , ou seja, é nulo para .Dessa forma temos: (2) A deformação vertical nos apoios da viga é nula, ou seja, e . Dessa forma temos . Ou seja: #12;Como a deflexão máxima da viga ocorre no meio da viga, ou seja, em , temos: para Dessa forma obtemos

  16. UmSistema Sistema AnimaoBaseado

    E-print Network

    de Figueiredo, Luiz Henrique

    of information between system's modules. #12; l Basic entities -- virtual actor: skeletal structure. -- motionsCapturado (AMotion Capture BasedAnimation System) (AMotion Capture BasedAnimation System) FernandoWagner Fernando obtained from traditional methods -- a specific approach is required. l Traditional animation systems

  17. Ensino superior perdeu quase um quinto

    E-print Network

    Instituto de Sistemas e Robotica

    , a intenção era pagar as propinas com o dinheiro dos subsídios de férias e de Natal. Como entretanto esse dinheiro foi cortado deixou de ter condições", conta. O presidente do Conselho Coorde- nador dos Institutos

  18. UM Ventures Director November 16, 2012

    E-print Network

    Zeng, Ning

    Development as director of technology and international business, and as executive are writing to inform you of the latest positive development in the University across both institutions. Technology transfer policies and procedures

  19. UM Taubman College Metals Lab Handbook

    E-print Network

    Papalambros, Panos

    of welding technologies including MIG, TIG, stick welding as well as high and low temperature brazing and tool introductions are scheduled at the beginning of each semester. Welding tutorials are provided for unsupervised use. #12;5 Welding Tutorials and Tool Introductions A major goal of the Metals Lab is to empower

  20. UM Space REU Final Report Eric Haengel

    E-print Network

    De Roo, Roger

    Appendix B: RF tone generation and ADC12 code. 8 7 Appendix C: Data collection via arduino. 15 8 Appendix D to resonate in the ISM band. When this resonator is immersed in a dielectric material, the change in resonant microprocessor capable of controlling an ISM band RF transmitter was necessary. After some shopping around

  1. Halema'um'ua Lava Activity

    USGS Multimedia Gallery

    This ponded lava begins to drain away, forming a vortex on the lava surface. The curved streaks around the spattering point at the bottom of the image show where lava is beginning to move in a clockwise direction. ...

  2. The Shadow of a Gnomon Along a Year: Routine Observations and Teaching of Apparent Motion of the Sun and the Four Seasons. (Spanish Title: La Sombra de un Gnomon lo Largo de un Año: Observaciones de Rutina y la Enseñanza del Movimiento Aparente del Sol y Las Cuatro Estaciones.) A Sombra de um Gnômon ao Longo de um Ano: Observações Rotineiras e o Ensino do Movimento Aparente do Sol E das Quatro Estações

    NASA Astrophysics Data System (ADS)

    Trogello, Anderson Giovani; Danhoni Neves, Marcos Cesar; de Carvalho Rutz da Silva, Sani

    2013-12-01

    Many misconceptions are recognized among the various groups of students, especially in the elementary school. Among them, the apparent motion of the Sun, in spite of its daily occurrence, is subject to varied interpretations. Thus, the observation and recording of the motion of the stars in the celestial vault is a necessary task for astronomy education. The work presented here proposes the presentation of the results of observations of the apparent movement of the sun by marking the shadow of a vertical gnomon by the students in a class of sixth graders of elementary rural school of Paraná. The project itself was conducted in four stages, on dates near the March equinox, the June solstice, the September equinox and the December solstice. In addition, lectures were developed in the classroom. Such methods sought to build concepts around the apparent movement of the Sun and the alternation of the seasons. Given the results of the activities, an evaluation was applied and the data demonstrated a desired student learning such as: the recognition of the cardinal points, the description of the apparent solar motion and the occurrence of the seasons and their alternation from astronomical observations at naked eye. Muchos conceptos aternativos son conocidos entre los distintos grupos de alumnos, sobre todo en la educación básica. Entre ellos, el movimiento aparente del Sol, por más cotidiano que sea, se presta a interpretaciones variadas. Por lo tanto, observar y registrar el movimiento de las estrellas en la bóveda celeste se torna una tarea necesaria para la educación en astronomía. El trabajo que aquí se presenta propone la presentación de los resultados de la observación del movimiento aparente del sol a través de la marcación de la sombra del gnomon vertical a cargo de los estudiantes en una división de sexto grado de de la escuela primaria rural de Paraná. El proyecto en sí se llevó a cabo en cuatro etapas, en fechas cercanas al equinoccio de marzo, al solsticio de junio, al equinoccio de septiembre y al solsticio de diciembre. Además, se dictaron clases teóricas en la sala de aula. Estos métodos buscaron construir conceptos en torno al movimiento aparente del Sol y la sucesión de las estaciones. Teniendo en cuenta los resultados de las actividades se aplicó una evaluación cuyos datos demuestran la existencia de un aprendizaje deseado por los estudiantes en cuanto a: el reconocimiento de los puntos cardinales, la descripción del movimiento solar aparente y la aparición de las estaciones y su alternancia a partir de observaciones astronómicas visuales sin instrumentos. Muitas concepções alternativas são reconhecidas entre os diversos grupos de estudantes, em especial nos da educação básica. Dentre elas, o movimento aparente do Sol, por mais quotidiano que seja, proporciona variadas interpretações. Deste modo, observar e registrar o movimento dos astros na abóboda celeste é uma tarefa necessária ao ensino de Astronomia. O trabalho que ora se apresenta propõe a apresentação dos resultados da observação do movimento aparente do Sol por intermédio da marcação da sombra de um gnômon vertical por alunos de uma turma do sexto ano do ensino fundamental de uma escola do campo do Paraná. O projeto em si ocorreu em quatro etapas, em datas próximas do equinócio de março, do solstício de junho, do equinócio de setembro e do solstício de dezembro. Além disso, foram desenvolvidas aulas teóricas em sala de aula. Tais métodos buscaram construir conceitos em torno da movimentação aparente do Sol e da alternância das estações do ano. Diante dos resultados provenientes das atividades desenvolvidas foi aplicada uma avaliação e os dados demonstraram um aprendizado desejado dos alunos quanto: ao reconhecimento dos pontos cardeais; à descrição do movimento solar aparente e a ocorrência das estações do ano e sua alternância a partir de observações astronômicas a olho nu.

  3. RECONSTRU C~AO DE IMAGENS DE RESSON^ANCIA MAGNETICA DE FLUXO COM IMAGEAMENTO PARALELO

    E-print Network

    Carvalho, João Luiz

    ´inuo de tratamentos e do conhecimento sobre anato- mia e fisiologia humanas. Trabalhos nessa ´area¨ontgen. Essa tecnologia per- mitiu estudos avan¸cados sobre anatomia, com um entendimento maior da conforma

  4. Treatment of precious metal bearing recycled materials at UM`s Hoboken smelter

    SciTech Connect

    Vanbellen, F.

    1995-12-31

    In Union Miniere`s Hoboken smelter and refinery for complex non-ferrous materials, the treatment of recycling products, containing precious metals, occupies a dominant place. For all feed materials, the first step, prior to their treatment, is to classify them in order to select an accurate and economical procedure for sampling as well as to dispatch them to the optimal process scheme. More than 150 different procedures for sampling are commonly used. The most important ones are briefly discussed in the paper. Precious metals bearing recycling materials vary widely with respect to their physical aspect, their chemical composition and the value of their precious metal content. All these parameters are taken into consideration to select the most appropriate process among the multiple possibilities of Union Miniere`s flexible integrated flow-sheet. Different stages of the operations as well as the main flow-sheets are described. Specific hydrometallurgical and pyrometallurgical processes have been developed for the extraction and the refining of: precious metals -- Ag, Au, Pt, Pd, Rh; base metals -- Pb, Cu, Sb, Sn, Bi; and special metals -- Se, In, Te.

  5. O Algoritmo de Cayley-Dickson e Alguns Teoremas de Classificac~ao

    E-print Network

    Torres, Fernando

    oct^onions e almejando um projeto de ´algebras de dimens~ao 2n . Segundo [2], enquanto Graves se empenhava nesses estudos, Arthur Cayley publicou um trabalho que consagrou os oct^onions, a partir de ent-Dickson e uma delas, os oct^onions, n~ao ´e associativa, vamos utilizar essa defini¸c~ao menos restritiva

  6. Guia de Estudo de Anlise Real Marco Cabral

    E-print Network

    Cabral, Marco

    a imagem direta da função. (b) diferença entre a função inversa e a imagem inversa da função. (c) para os reais como classes de equivalência de sequências de Cauchy. A seção 3.3 apresenta a denição muito

  7. Solar Physics Topics in High School: Analysis of a Course with Practical Activities at Dietrich Schiel Observatory. (Spanish Title: Temas de Física Solar Para Estudiantes de Escuelas Secundarias: un Análisis de un Curso con Enfoque Práctico en el Observatorio Dietrich Schiel.) Tópicos de Física Solar no Ensino Médio: Análise de um Curso com Atividades Práticas no Observatório Dietrich Schiel

    NASA Astrophysics Data System (ADS)

    Calbo Aroca, Silvia; Donizete Colombo, Pedro, Jr.; Celestino Silva, Cibelle

    2012-12-01

    This work analyses results obtained in a solar physics course for high school students promoted at the Dietrich Schiel Observatory of the University of São Paulo (USP). The course was elaborated by the authors with the intention of investigating student's concepts about the Sun, teaching topics of modern physics related to the Sun and providing students with knowledge about our star as well. The methodology of data gathering consisted of audio and video records of classes and of semi-structured interviews, and analysis of answers to written questionnaires. The results showed that most high school students conceived the Sun as made of fire, while sunspots were thought to be holes in the Sun. Even though some students did know that a spectrum is formed using a prism or diffraction grating, most of them ignored the nature of the observed spectral lines. Through the course, this topic was developed by means of a practical approach with solar and lamp spectra observations. The results obtained in the course point to the importance of science centers as partners in formal education. In this specific case, the Solar Room at the Dietrich Schiel Observatory is as a favorable environment for teaching modern physics in high school. Este artículo analiza los resultados obtenidos en un curso sobre la física solar, auspiciado por el Observatorio Dietrich Schiel de la USP para estudiantes de las escuelas secundarias. El curso fue diseñado por los autores con la intención de investigar las concepciones sobre el sol, enseñar temas relacionados con la física moderna del Sol y conocimientos generales sobre el astro rey. La metodología utilizada para la recolección de datos consistió en grabar, en audio y video, las clases, las entrevistas semi-estructuradas y las respuestas a los cuestionarios escritos. Los resultados mostraron que la mayoría de los participantes conciben el Sol como constituido por fuego y las manchas solares en la superficie solar como agujeros. Aunque algunos estudiantes sabían que un espectro puede estar formado por un prisma o red de difracción, la mayor parte de ellos desconocía la naturaleza de las líneas espectrales. A lo largo del curso, esta cuestión fue trabajada con un enfoque práctico mediante la observación del espectro solar y de las lámparas durante clases expositivas/dialogadas. Los resultados obtenidos en el curso mustran la importancia de los centros de ciencia como un apoyo en la educación formal. En este caso en particular, la Sala Solar del Observatorio Dietrich Schiel se destaca como un entorno favorable para la enseñanza de la física moderna en la escuela secundaria. Este trabalho analisa resultados obtidos em um curso sobre física solar para alunos do ensino médio promovido pelo Observatório Dietrich Schiel da USP. O curso foi elaborado pelos autores com a intenção de investigar concepções sobre o Sol, ensinar tópicos de física moderna relacionados ao Sol e conhecimentos gerais sobre o astro rei. A metodologia de coleta de dados consistiu em gravação em áudio e vídeo das aulas e das entrevistas semi-estruturadas, e respostas a questionários escritos. Os resultados mostraram que a maioria dos participantes concebeu o Sol como constituído por fogo e as manchas solares como buracos na superfície solar. Embora alguns alunos soubessem que um espectro pode ser formado por um prisma ou rede de difração, a maior parte deles desconhecia a natureza das linhas espectrais. Ao longo do curso, este tema foi trabalhado com uma abordagem prática com observação do espectro solar e de lâmpadas e em aulas expositivo-dialogadas. Os resultados obtidos no curso apontam para a importância dos centros de ciências como parceiros da educação formal. Neste caso específico, a Sala Solar do Observatório Dietrich Schiel é um ambiente propício para o ensino de física moderna no ensino médio.

  8. Astronomy Teaching and Teachers Continuing Education: the Interdisciplinarity during a Total Lunar Eclipse. (Spanish Title: Enseñanza de la Astronomía y la Formación Continua de Profesores: la Interdisciplinariedad Durante un Eclipse Total de Luna.) Educação EM Astronomia E Formação Continuada de Professores: a Interdisciplinaridade Durante um Eclipse Lunar TOTAL

    NASA Astrophysics Data System (ADS)

    Langhi, Rodolfo

    2009-07-01

    This paper describes how 67 teachers from 23 cities, could awaken, in students, the scientific interest, using a natural astronomical phenomenon: a total lunar eclipse. Before and after of eclipse, meetings for continuing education were characterized by interdisciplinarity of astronomy and the importance of these observations. Working groups were formed by teachers and students, who organized the survey data, mobilizing the people in their cities. The results point ways about how to provide the scientific culture and the motivation to learn science in students, using approaches between the following communities: scientific, amateur and school. En este artículo se describe cómo 67 profesores de 23 ciudades, despertó el interés científico en los estudiantes mediante un fenómeno astronómico: un eclipse total de Luna. Antes y después del eclipse, reuniones para la formación continua se centraron en la interdisciplinariedad de la astronomía, y la importancia de las observaciones de este tipo de fenómeno. Profesores y estudiantes formaron grupos de trabajo para investigar datos durante el eclipse, con el participación de la comunidad en sus ciudades. Los resultados apuntan a las opciones que conducen a la cultura científica y la motivación para aprender la ciencia, utilizando las relaciones de los siguientes grupos: científicos, aficionados y la escuela. Este texto relata como 67 professores, provenientes de 23 cidades, puderam despertar, nos alunos, o interesse científico utilizando um fenômeno natural astronômico: um eclipse lunar total. O evento foi precedido e procedido por encontros de formação continuada, onde se caracterizou a interdisciplinaridade da astronomia e a importância das observações de fenômenos como estes. Grupos de trabalho foram formados por professores e alunos, que se organizaram para o levantamento conjunto de dados durante o fenômeno, além do envolvimento da comunidade em suas respectivas cidades. Os resultados apontam para caminhos que podem proporcionar a motivação e a cultura científica, através de aproximações entre as comunidades científica, amadora e escolar.

  9. Approved as UM Policy September 1994 Revised April 2002

    E-print Network

    Thirumalai, Devarajan

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 MEDICAL CONSULTATION AND EXAMINATIONS . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 FIRE EMERGENCY PROCEDURE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Appendix I LAB-SPECIFIC PRIOR APPROVALS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Appendix II LAB

  10. um schnelles Rechnen (das Rechnen wollte der kleine

    E-print Network

    Nejdl, Wolfgang

    verblüf- fend zu beobachten, dass die Als der gro�e Mathematiker Carl Friedrich Gau� (1777 ­ 1855) noch ein kleiner Junge war, unterrichtete sein Lehrer Büttner, wie damals üblich, alle Kinder der ersten schon nach kurzer Zeit rief Carl Friedrich: »Da ligget se!« ­ nämlich die Zahl, die Lösung 5050. Dem

  11. UC Davis alUms drive "clean" vehicle breakthroughs

    E-print Network

    California at Davis, University of

    , "to make a car that would drive like all the others on the road, while getting 100 miles to the gallon--for the batteries--was missing; so was the technology for the necessary transmission. So that's where my work went he brought along to UC Davis in 1985. ("A flywheel is essentially a mechanical battery," he explains

  12. Strategien, um sicher ans Ziel zu kommen Orientierung

    E-print Network

    Analysis of Sensations, which was published in 1886, physicist Ernst Mach made the following success by Johannes Muller, has also assumed an al- most exclusively physical character." When Ernst Mach in this issue describe the interplay of such disparate sensory faculties for navigation. Ernst Mach continued

  13. TO: UM/RSMAS Divers FR: Diving Safety Officer

    E-print Network

    Miami, University of

    their expenses in the event of a scuba diving accident requiring Recompression/Hyperbaric Oxygen Therapy to the claims department of your insurance company and be sure to specify "SCUBA diving accidents requiring certify this insurance policy covers Hyperbaric Oxygen Therapy in a recompression chamber for SCUBA diving

  14. Spatial deconvolution of IRAS galaxies at 60 UM

    NASA Technical Reports Server (NTRS)

    Low, Frank J.

    1987-01-01

    Using IRAS in a slow scan observing mode to increase the spatial sampling rate and a deconvolution analysis to increase the spatial resolution, several bright galaxies were resolved at 60 micron. Preliminary results for M 82, NGC 1068, NGC 3079 and NGC 2623 show partially resolved emission from 10 to 26 arcsec., full width at half maximum, and extended emission from 30 to 90 arcsec. from the center. In addition, the interacting system, Arp 82, along with Mark 231 and Arp 220 were studied using the program ADDSCAN to average all available survey mode observations. The Arp 82 system is well resolved after deconvolution and its brighter component is extended; the two most luminous objects are not resolved with an upper limit of 15 arcsec. for Arp 220.

  15. U-M AFRICAN PRESIDENTIAL SCHOLARS PROGRAM RESEARCH SYMPOSIUM II

    E-print Network

    Kamat, Vineet R.

    | RACKHAM ASSEMBLY HALL DETERMINING TRACE ELEMENTS IN IRON ORE BY METHODS OF ICP-MS AND XRD Abstract: CA study of trace element of iron ore samples from Tokada Mines in northeastern Liberia in two acid. The major elements in the iron ore include: Fe, Al, Si, Ti and O. Some traces of V, Ni, Zn, Cu, Co, Mn and Y

  16. Instructions for Completing the Employee Expense Worksheet (UM 1612)

    E-print Network

    Weiblen, George D

    ) 1. Employee ID: Enter the employee ID number. 2. Name: Enter employee's name. 3. Email: Enter the employee's email address. 4. Address: Enter the employee's home address. 5. City/State/Zip: Enter the city, state, and zip of the employee's home address. 6. Travel Destination, Purchase Location: Enter

  17. Um Olhar sobre "Beleza Americana" (A Look at "American Beauty").

    ERIC Educational Resources Information Center

    Bissoto, Maria Luisa

    2000-01-01

    Discusses the film "American Beauty" in light of a reading of Karl Marx. Finds that the film shows the circularity which marks bourgeois society, even though the rhythm of industry and renovation of the society masks it. States that Marx praises the industry, invention, and innovation of the bourgeoisie. (BT)

  18. Astronomy in High School: Using a Mini-Planetarium to Understand Details of the Apparent Movement of Stars. (Spanish Title: Astronomía en la Escuela Secundaria: Comprendiendo los Detalles del Movimiento Aparente de Las Estrellas con un Miniplanetario.) Astronomia no Ensino Médio: Compreendendo Detalhes do Movimento Aparente das Estrelas com um Miniplanetário

    NASA Astrophysics Data System (ADS)

    dos Santos Leão, Demetrius

    2013-07-01

    The aim of this article is to present part of the results obtained by the intervention made from the author's Master degree project, which consisted in the development of a set of Astronomy classes for first year of High School students from a private school in the "Distrito Federal", Brasilia, Brazil, making use of a didactical material called mini-planetarium (MP) as the main resource. Using Paulo Freire's contextualization and dialogicity ideas as a theoretical framework guided by these lessons, it was proposed to the students the assembly and application of that resource in a planetarium session. During the project, some subjects such as the apparent trajectory of stars through Brasilia's sky, the location of the cardinal points beginning from the Southern Cross constellation, the color of stars and the stars being seen from a particular place were emphasized. It was found that the students showed an improvement of their understanding about these subjects, as well as a significant excitement with the developed methodology. El objetivo de este trabajo es presentar algunos de los resultados obtenidos en el proyecto de la tesis de maestría del autor, que incluyó el desarrollo de algunas clases de Astronomía, con estudiantes del primer año del bachillerato de una escuela privada del Distrito Federal (Brasilia, Brasil), utilizando como materia prima didáctica el recurso llamado miniplanetario (MP). Utilizando como base teórica orientadora de esas clases las ideas de contextualización y dialógica de Paulo Freire, fue propuesto a los estudiantes el montaje y la utilización de este recurso en una función de planetario. Durante el proyecto, se enfatizaron asuntos tales como la trayectoria aparente de las estrellas del cielo de Brasilia, la ubicación de los puntos cardinales a partir de la constelación de la Cruz del Sur, los colores de las estrellas y las estrellas vistas desde una localidad determinada. Se constató que los estudiantes mostraron una mejora en la comprensión de estas cuestiones y demostraron un gran interés por esta metodología. O objetivo deste artigo é apresentar parte dos resultados obtidos com a intervenção feita como projeto da dissertação de mestrado do autor, que consistiu no desenvolvimento de um conjunto de aulas de Astronomia, com alunos do 1º Ano do Ensino Médio de uma escola da rede privada do Distrito Federal (Brasília, Brasil), empregando como recurso principal um material didático chamado miniplanetário (MP). Utilizando como pressuposto teórico norteador dessas aulas as ideias de contextualização e dialogicidade de Paulo Freire, foi proposta aos estudantes a montagem e utilização desse recurso em uma sessão de planetário. Durante o projeto, enfatizaram-se assuntos como a trajetória aparente das estrelas para o céu de Brasília, a localização dos pontos cardeais a partir da constelação do Cruzeiro do Sul, as cores das estrelas e as estrelas vistas de uma determinada localidade. Apurou-se que os alunos apresentaram melhoria na compreensão desses assuntos, bem como demonstraram expressiva empolgação com essa metodologia desenvolvida.

  19. UmUm SistemaSistema dede Animao BaseadoAnimao Baseado emem Movimento CapturadoMovimento Capturado

    E-print Network

    de Figueiredo, Luiz Henrique

    of information between system's modules. #12;q Basic entities ­ virtual actor: skeletal structure. ­ motionsMovimento Capturado (A Motion Capture Based Animation System)(A Motion Capture Based Animation System) Fernando Wagner from traditional methods ­ a specific approach is required. q Traditional animation systems ­ treat

  20. High-resolution superconducting x-ray spectrometers with an active area of 282 um x 282 um

    SciTech Connect

    Mears, C.A.; Labov, S.E.; Frank, M.; Netel, H.; Hiller, L.J.; Lindeman, M.A.; Chow, D.; Barfknecht, A.T.

    1996-09-11

    Superconducting tunnel junctions coupled to superconducting absorbers may be used as high-resolution, high-efficiency X-ray spectrometers. We have tested devices with niobium X-ray absorbing layers coupled to aluminum layers that serve as quasiparticle traps. In this work we measured the current pulses from a large area tunnel junction using an amplifier based on an array of 100 SQUIDs. Using this amplifier and a 282 micron X 282 micron junction, we have measured an energy resolution of 19 eV FWHM for 1.5 keV X rays and 21 eV for 2.6 keV X rays. The area of this junction is eight times the area of any junction previously measured to have such high energy resolution.

  1. Discussions about the Nature of Science in a Course on the History of Astronomy. (Spanish Title: Discusiones sobre la Naturaleza de la Ciencia en un Curso sobre Historia de la Astronomía.) Discussões sobre a Natureza da Ciência em um Curso sobre a História da Astronomia

    NASA Astrophysics Data System (ADS)

    Pires de Andrade, Victória Flório; L'Astorina, Bruno

    2010-07-01

    There are an increasing number of researches in science education that affirm the importance of discussions on the "nature of science" in basic education level as well as in teacher training. The history of science applied to education is a way to contextualize epistemological discussions, allowing both the understanding of scientific content and learning about science concepts. We present some reasonably consensual definitions on the nature of science that have been widely discussed by the academic community. We show also some episodes in the history of astronomy which can lead to discussions involving some aspects of the nature of science, and how they can do it. Hay un número creciente de investigaciones en la enseñanza de las ciencias que afirman la importancia de debates sobre la "naturaleza de la ciencia" en la educación básica y formación del profesorado. La historia de la ciencia aplicada a la educación es una manera de contextualizar los debates de la epistemología, lo que permite tanto la comprensión de los contenidos científicos como el aprendizaje de conceptos científicos. En esto trabajo, presentamos algunas definiciones bastante consensuales sobre la naturaleza de la ciencia que han sido ampliamente discutidas por la comunidad académica y mostramos cómo algunos episodios en la historia de la astronomía pueden llevar a discusiones sobre algunos aspectos de la naturaleza de la ciencia. Há um número crescente de pesquisas na área de ensino de ciências que afirmam a importância de discussões sobre a "natureza da ciência" na educação básica e na formação de professores. A história da ciência aplicada ao ensino é uma maneira de contextualizar discussões epistemológicas, permitindo tanto a compreensão de conteúdos científicos quanto o aprendizado de noções sobre as ciências. Neste trabalho apresentamos algumas definições razoavelmente consensuais sobre a natureza da ciência que foram amplamente discutidas pela comunidade acadêmica e mostramos como alguns episódios da história da astronomia podem levar a discussões envolvendo alguns dos aspectos da natureza da ciência.

  2. Astronomical Perception of the Secondary School's Students in São Paulo's State School in Suzano City. (Spanish Title: Percepción Astronómica de Alumnos de la Enseñanza Media de la Red Estatal de San Pablo en la Ciudad de Suzano.) Percepção Astronômica de um Grupo de Alunos do Ensino Médio da Rede Estadual de São Paulo da Cidade de Suzano

    NASA Astrophysics Data System (ADS)

    França de Oliveira, Edilene; Voelzke, Marcos Rincon; Amaral, Luis Henrique

    2007-12-01

    Although Astronomy is one of the oldest Sciences in the world and many of its concepts are popular, it is possible to observe that a major part of the students do not know about them. This work aims to analyse the basic knowledge of the secondary school's students of a state school in the city of Suzano, related to the astronomical phenomena, which surround them. It was carried out a questionnaire of multiple choice to 34 students from the first grade, night classes, of the state school Batista Renzi. From the sample, 34 students, only 29.4% of them could understand the succession of the days; 20.6% could explain the seasons of the year and 20.6% had some idea about celestial objects nearer to the Earth. In turn, 67.6% correctly classified the Sun as a star; 55.9% related the Big Bang to the origin of Universe; only 20.6% identified the light-year as an unit of distance and 32.4% recognized a falling star as a meteor. The actual analysis was expanded to more 310 students of other classes, grades and periods of the same school. In this first stage, it can be noted the students' little discernment of the astronomical events and mainly the great confusion about the appropriate meaning of popular astronomical terms. Aunque la Astronomía es una de las ciencias más antiguas de la humanidad y muchos de los conceptos astronómicos son populares, se observa que una parcela significativa de los estudiantes se encuentra al margen de estas informaciones. El presente trabajo pretende analizar el nivel de conocimiento básico de los alumnos de la Enseñanza Media de la Red Estatal de la ciudad de Suzano con relación a los fenómenos astronómicos que los rodean. Con este objetivo fue elaborado un formulario constando de preguntas de selección múltipla, aplicado en el primer año nocturno de la Escuela Estatal Batista Renzi. En un universo de 34 alumnos se constató que solamente 29,4% comprendían la sucesión de los días; 20,6% explicaron correctamente las estaciones del año y 20,6% tenían la idea de cuales son los objetos celestes más cercanos de la Tierra. En contraposición, 67,6% clasificaron correctamente el Sol como una estrella; 55,9% relacionaron el Big Bang al origen del Universo; solamente 20,6% identificaron un año-luz como unidad de distancia y 32,4% reconocieron una estrella fugaz como meteoro. El presente análisis fue expandido para otros grupos de la Enseñanza Media, no solamente del período nocturno, sino también diurno de la misma escuela. En esta primera fase se nota el pequeño conocimiento de los alumnos sobre eventos astronómicos y principalmente la gran confusión sobre el significado correcto de los términos astronómicos populares. Embora a Astronomia seja uma das ciências mais antigas da humanidade e muitos dos conceitos astronômicos serem populares, observa-se que uma parcela significativa dos estudantes encontra-se à margem dessas informações. O presente trabalho visa analisar o nível de conhecimento básico dos alunos do Ensino Médio da Rede Estadual da cidade de Suzano quanto aos fenômenos astronômicos que os rodeiam. Para tanto foi elaborado um formulário constando de questões de múltipla escolha, aplicado no primeiro ano noturno da Escola Estadual Batista Renzi. Num espaço amostral de 34 alunos constatou-se que apenas 29,4% compreendiam a sucessão dos dias; 20,6% explicaram corretamente as estações do ano e 20,6% tinham idéia de quais são os objetos celestes mais próximos da Terra. Em contraposição, 67,6% classificaram corretamente o Sol como estrela; 55,9% relacionaram o Big Bang à origem do Universo; apenas 20,6% identificaram um ano-luz como unidade de distância e 32,4% reconheceram uma estrela cadente como meteoro. A presente análise foi expandida para mais 310 alunos de outras classes de Ensino Médio, não somente do período noturno, mas também diurno da mesma escola. Nesta primeira fase nota-se o pequeno discernimento dos alunos sobre eventos astronômicos e principalmente a grande confusão sobre o significado correto de termos astronômicos populares.

  3. The Practice of Research of a Basic Education Teacher Involving Mental Models of the Phases of the Moon and Eclipses. (Spanish Title: La Práctica de Investigación de un Maestro de Educación BÁsica con El Uso de los Modelos Mentales de Las Fases de la Luna Y Eclipses.) A Prática de Pesquisa de um Professor do Ensino Fundamental Envolvendo Modelos Mentais de Fases da Lua e Eclipses

    NASA Astrophysics Data System (ADS)

    Pessôa Queiroz, Glória; Jubitipan Borges de Sousa, Carlos; Auxiliadora Delgado Machado, Maria

    2009-12-01

    The inclusion of basic education teachers in the survey domain is a controversial issue and fully debated in the academy. The opportunity for a collective work that incorporated school teachers from a public school to a university's group of physics teaching at university allowed us to glimpse the redefinition of the function of a science teacher (a coauthor of this paper) by himself, such that now he includes research on the knowledge construction by students in his teacher practice. The formation of inter-institutional groups for action planning and research in these areas has proved productive for the task of knowledge construction to support educational processes in school, while the university enriches its collection of experiences critically validated, and can consider the results in teachers initial and continued education. The active participation of the teacher in a research group at the university led him to reflect on the possible didactical ways to be described, analyzed and communicated to other teachers. The construction of a pedagogy that took into account the mental models of students on the basic topics of astronomy, and the changes developed resulting from the lessons taught, led to far-reaching consequences on the pedagogy adopted by the teacher, who incorporates now a new vision of science and alternative forms to dialogue with students, essential components for a researcher in Science Education. La inclusión de los maestros de la escuela básica en el universo de la investigación es polémica y está en amplio debate en el mundo académico. La oportunidad de trabajo colectivo de los maestros de una escuela pública en Río de Janeiro con un grupo universitario de enseñanza de la física nos ha permitido vislumbrar la redefinición de la función de un maestro de ciencias (uno de los coautores de este documento) por él mismo, ahora para incluir la investigación sobre la construcción del conocimiento por los alumnos en su práctica como docente. La formación de grupos interinstitucionales para la planificación de la acción y la investigación ha resultado productiva para el trabajo de construcción de conocimiento de apoyo a los procesos educativos en la escuela, mientras que la universidad enriquece su colección de experiencias validadas, considerando los resultados de la educación inicial y continua de maestros. La participación activa del maestro en un grupo de investigación en la universidad lo llevó a reflexiones sobre los posibles caminos didácticos que pueden ser descriptos, analizados y comunicados a los demás docentes. La construcción de una pedagogía propia, que tuvo en cuenta los modelos mentales de los estudiantes sobre los temas básicos de astronomía, y los cambios desarrollados a partir de las lecciones que enseñó, trajeron consecuencias de largo alcance sobre la pedagogía adoptada por el maestro, que ahora incorpora una nueva visión de la ciencia y formas alternativas al diálogo con los estudiantes, los componentes esenciales para un investigador en Educaciónen Ciencias. A inclusão do professor da escola básica no universo da pesquisa é questão controvertida e em pleno debate no meio acadêmico. A oportunidade de trabalho coletivo que incorporou professores de uma escola municipal no Rio de Janeiro a um grupo de ensino de Física da universidade nos possibilitou vislumbrar a ressignificação da função de um professor de Ciências (co-autor deste trabalho) por ele próprio, agora passando a incluir a pesquisa sobre a construção de conhecimento pelos alunos em sua prática como docente. A formação de grupos interinstitucionais para o planejamento de ações e de pesquisas tem-se mostrado produtiva para um trabalho de construção de conhecimentos a fim de subsidiar processos educativos na escola, ao mesmo tempo em que a universidade enriquece seu acervo de experiências validadas criticamente, podendo considerar seus resultados na formação inicial e continuada de professores. A participação ativa do professor num grupo de pesquisa na universidade o

  4. UNIVERSIDADE ESTADUAL DE CAMPINAS Aluno: Jos Luiz Mazza RA: 149247

    E-print Network

    Torres, Fernando

    , Estatística e Computação Científica (IMECC) O Último Teorema de Fermat: a trajetória histórica do "enigma Abril/2014 #12;2 RESUMO Este trabalho tem como objetivo realizar um estudo acerca do último teorema de Fermat; teorema esse que afirma não existir nenhum conjunto de inteiros positivos , , e com > 2 que

  5. O que bilíngues bimodais têm a nos dizer sobre desenvolvimento bilíngue?

    PubMed Central

    de Quadros, Ronice Müller; Lillo-Martin, Diane; Pichler, Deborah Chen

    2013-01-01

    O objetivo deste trabalho é apresentar o que as pesquisas que estamos desenvolvendo com crianças ouvintes, filhas de pais surdos, adquirindo Língua Brasileira de Sinais (Libras) e Português e Língua de Sinais Americana (ASL) e Inglês (Lillo-Martin et al. 2010) têm a nos dizer sobre desenvolvimento bilíngue. Os dados deste estudo fazem parte de um banco de dados de interações espontâneas coletadas longitudinalmente, alternando contextos de aquisição da Libras e do português como língua alvo, no Brasil e dados coletados longitudinalmente. nos mesmos contextos, de crianças adquirindo ASL e inglês1. Além disso, há também dados do estudo experimental com testes aplicados nos dois pares de línguas que se agregam ao presente estudo. Uma visão geral dos estudos desenvolvidos sobre a aquisição bilíngue bimodal por crianças ouvintes, filhas de pais surdos, será apresentada e, então, serão expostos alguns aspectos linguísticos deste tipo de aquisição, considerando as discussões sobre aquisição bilíngue a partir da pesquisa realizada. PMID:24431480

  6. Casos de Estudo com a Bolsa de Objectos de Aprendizagem: Anlise na Perspectiva da Computao

    E-print Network

    da Silva, Alberto Rodrigues

    propor o sistema BOA (Bolsa de Objectos de Aprendizagem) como uma plataforma de Objectos de Aprendizagem utilizadores, privilegiando uma competitividade saudável e consequente qualidade dos OA submetidos. O BOA popularidade. Por outro lado, os utilizadores são recompensados com créditos sempre que interagem no BOA, quer

  7. Estudo de Viabilidade de uma Plataforma de Baixo Custo para Data Warehouse

    E-print Network

    de Almeida, Eduardo Cunha

    2011-01-01

    Often corporations need tools to improve their decision making in a competitive market. In general, these tools are based on data warehouse platforms to mange and analyze large amounts of data. However, several of these corporations do not have enough resources to buy such platforms because of the high cost. This work is dedicated to a feasibility study of a low cost platform to data warehouse. We consider as a low cost platform the use of open source software like the PostgreSQL database system and the GNU/Linux operational system. We verify the feasibility of this platform by executing two benchmarks that simulate a data warehouse workload. The workload reproduces a multi-user environment with the execution of complex queries, which executes: aggregations, nested sub queries, multi joins, in-line views and more. Considering the results we were able to highlight some problems on the PostgreSQL database system, and discuss improvements in the context of data warehouse.

  8. Comparing the use of 4.6 um lasers versus 10.6 um lasers for mitigating damage site growth on fused silica surfaces

    SciTech Connect

    Yang, S T; Matthews, M J; Elhadj, S; Cooke, D; Guss, G M; Draggoo, V G; Wegner, P J

    2010-10-21

    The advantage of using mid-infrared (IR) 4.6 {micro}m lasers, versus far-infrared 10.6 {micro}m lasers, for mitigating damage growth on fused silica is investigated. In contrast to fused silica's high absorption at 10.6 {micro}m, silica absorption at 4.6 {micro}m is two orders of magnitude less. The much reduced absorption at 4.6 {micro}m enables deep heat penetration into fused silica when it is heated using the mid-IR laser, which in turn leads to more effective mitigation of damage sites with deep cracks. The advantage of using mid-IR versus far-IR laser for damage growth mitigation under non-evaporative condition is quantified by defining a figure of merit (FOM) that relates the crack healing depth to laser power required. Based on our FOM, we show that for damage cracks up to at least 500 {micro}m in depth, mitigation using a 4.6 {micro}m mid-IR laser is more efficient than mitigation using a 10.6 {micro}m far-IR laser.

  9. Representaes Qunticas no Espao de Fases Uma funo de onda abstrata | > um vetor em um espao de Hilbert. Esse vetor pode ser expresso

    E-print Network

    de Aguiar, Marcus A. M.

    espaço de Hilbert. Esse vetor pode ser expresso em termos de uma infinidade de representações ortonormais. Assim nenhuma função das coordenadas (q,p) pode ser definida de forma a ser interpretada como" dado o Princípio da Incerteza. Uma excelente revisão desse formalismo pode ser encontrado em [13,14]. 2

  10. Avda. Teniente Flomesta, 5. Edif. Convalecencia. 30003 Murcia Tfs. 86 888 3695/96 Fax. 86 888 3603 sgeneral@um.es -www.um.es

    E-print Network

    Acacio, Manuel

    ,O=FNMT,C=ES; Código seguro de verificación: RUxFMo4j-jp4g3GL5-3X9Ih/dx-4fiVqJWv COPIA ELECTRÓNICA - Página 1 de 2 Esta: RUxFMo4j-jp4g3GL5-3X9Ih/dx-4fiVqJWv COPIA ELECTRÓNICA - Página 2 de 2 Esta es una copia auténtica

  11. Um Modelo de Gest~ao E ciente de Recursos Computacionais Marcos Castilho Renato Carmo

    E-print Network

    Hexsel, Roberto A

    ~ao. A implementa#24;c~ao da solu#24;c~ao exposta, fortemente baseada no uso de Software Livre e no rea compatibilidade, seguran#24;ca, atualiza#24;c~ao, desempenho, etc, que acabam por consumir todas as energias dos

  12. Development of extended red (1.0- to 1.3-um) image intensifiers

    NASA Astrophysics Data System (ADS)

    Estrera, Joseph P.; Sinor, Timothy W.; Passmore, Keith T.; Rector, M. K.

    1995-09-01

    We present the development of extended near infrared based image intensifiers with InGaAs semiconductor and multi-alkali based photocathodes having 1.0-1.3 micrometers and 1.0-1.1 micrometers spectral sensitivities, respectively. For the InGaAs based image intensifiers, we study their material characteristics using transmission, photoluminescence, micro-Raman, and scanning Auger spectroscopies. Direct spectral comparison of the InGaAs image intensifiers are made to standard Generation II and III image intensifiers. Then we study the sealed NEA InGaAs image tube performance parameters such as spectral sensitivity, whitelight photoresponse, equivalent background illumination, signal-to-noise, modulation transfer function, and optical system-image intensifier field performance data. For the multi-alkali based image intensifiers, we present a direct spectral comparison of it to our NEA InGaAs and standard super Gen II image tubes. Finally, we examine the advancement of our near infrared devices into the 1.5-2.0 micrometers spectral regime.

  13. Lamper, Karen Teresa From: UM Research Listserv on behalf of Lamper,

    E-print Network

    Shyu, Mei-Ling

    the George E. Brown, Jr. Network for Earthquake Engineering Simulation (NEES). NEES was established by NSF Coordination Office (NCO), Computational Modeling and Simulation Center (SimCenter), and Post-Disaster, Rapid as a distributed, multi-user, national research infrastructure for earthquake engineering through a facility

  14. Thomas/Fischer 1 UM-96 Using Agents to Improve the

    E-print Network

    Fischer, Gerhard

    of the system. Keywords: intelligent/adaptive user interfaces, information retrieval and information filtering it is located, and how to use the information when it is retrieved. For many computer systems of the WWW will not be realized if users cannot retrieve information easily and efficiently. The principal

  15. 4.13.12 cml UM Electrical Engineering and Computer Science Fall 2012

    E-print Network

    Cafarella, Michael J.

    ): EECS 498-001: Advanced Embedded Systems (4 cr.) Meeting Time: MW 3:00-4:30 Instructor(s): Mark Brehob.umich.edu/eecs/about/articles/Hands-On-Robotics-EECS498-Revzen.pdf Course (Cr Hrs): EECS 598-001: Network Info Theory (3 cr.) Meeting Time: 12 598-002: Power Sys Dynamics and Control (3 cr.) Meeting Time: WF 10:30-12:00 Instructor(s): Ian

  16. 09.06.12 cml UM Electrical Engineering and Computer Science Fall 2012

    E-print Network

    Cafarella, Michael J.

    instructor CS: Upper Level CS Elec. Course (Cr Hrs): EECS 498-001: Advanced Embedded Systems (4 cr.) U.umich.edu/eecs/about/articles/Hands-On-Robotics-EECS498-Revzen.pdf CS: Flex. Tech. Elec. Course (Cr Hrs): EECS 598-001: Network Info Theory (3 cr.) U Dynamics and Control (3 cr.) U/G Requirement: Instructor(s): Ian Hiskens EE: ULEE Elec. Prerequisite

  17. Del Rio, Karen T From: UM Research Listserv on behalf of Del Rio,

    E-print Network

    Shyu, Mei-Ling

    such risks, so this award includes a mentoring component. Potential Scholars should have a promising track that builds stronger theory and empirical evidence in these two areas. We intend for the research we support to inform change. While we do not expect that any one study will create that change, the research should

  18. Lamper, Karen Teresa From: UM Research Listserv on behalf of Lamper,

    E-print Network

    Shyu, Mei-Ling

    -L@LISTSERV.MIAMI.EDU Subject: Internal Competition for NSF, Collections in Support of Biological Research (CSBR): Deadline 7/27/15 The University's internal deadline for the limited submission competition for the National Science Foundation and DNA libraries. Note: In a single round of the CSBR competition, only one proposal may be submitted

  19. VizieR Online Data Catalog: Chamaeleon III 870um sources maps (Belloche+, 2011)

    NASA Astrophysics Data System (ADS)

    Belloche, A.; Parise, B.; Schuller, F.; Andre, P.; Bontemps, S.; Menten, K. M.

    2011-06-01

    The 870 micron dust continuum emission map of the Chamaeleon III molecular cloud displayed in Fig. 2 is available at CDS in FITS format. The data were obtained with the bolometer camera LABOCA at the APEX telescope. They were calibrated, reduced, co-added, gridded, smoothed to an effective angular resolution of 21.2" (FWHM), and written in FITS format with the BoA software. The flux density unit is Jy/21.2"-beam. The coordinates are equatorial (J2000) and the offsets are in RADIO projection. (1 data file).

  20. VizieR Online Data Catalog: Chamaeleon I 870um sources (Belloche+, 2011)

    NASA Astrophysics Data System (ADS)

    Belloche, A.; Schuller, F.; Parise, B.; Andre, P.; Hatchell, J.; Jorgensen, J. K.; Bontemps, S.; Weiss, A.; Menten; K. M.; Muders, D.

    2011-01-01

    Table 2 lists the sources extracted with GAUSSCLUMPS from the filtered 870 micron continuum emission map of Chamaeleon I obtained with the bolometer camera LABOCA at the APEX telescope. These sources are listed in the order in which they were found by GAUSSCLUMPS, i.e. roughly in order of decreasing peak flux density. The 870 micron dust continuum emission map of the Chamaeleon I molecular cloud is available in FITS format. The data were obtained with the bolometer camera LABOCA at the APEX telescope. They were calibrated, reduced, co-added, gridded, smoothed to an effective angular resolution of 21.2" (FWHM), and written in FITS format with the BoA software. The flux density unit is Jy/21.2"-beam. The coordinates are equatorial (J2000) and the offsets are in RADIO projection. (6 data files).

  1. Zum Auf und Ab des Meeresspiegels in Skandinavien: Langer Streit um Eustasie oder Isostasie

    NASA Astrophysics Data System (ADS)

    Seibold, Eugen; Seibold, Ilse

    2012-03-01

    The phenomenon of the rise of the Scandinavian shield during the Holocene and the concomitant fall in level of the Baltic Sea has been investigated for centuries. Already in medieval times, there were reports about the coastlines of the Gulf of Bothnia that are full of relevant observations. During the eighteenth century, scientists such as Celsius and Linnaeus collected observations such as these. The result was that the search for the possible explanations of this rise-and-fall phenomenon intensified. The generally favoured explanation was that there was an active sinking of sea level in the Baltic rather than an active rising of the land surface in Fennoscandia. This was because water was seen as mobile, in contrast to a „terra firma". The relevant discussion was often emotional, and here, we try to illustrate it using material from the Geologenarchiv Freiburg (von Hoff, von Buch and Goethe). No more than a few decades later, it became obvious by the theory of Ice Age that both the sea level and the land could be mobile (eustatic sea level changes—glacial isostasy). Additionally, of course, plate tectonics had some influence: Norway is situated at the western end of the Eurasian plate and is part of a passive continental margin. There are still open research problems, many of which can be addressed using modern methods of satellite-based geophysics and geodesy. Some other aspects as the permanent uplift trend of Scandinavia since the Cambrium or the rhythmic to and fro of magma in the upper mantle during the Pleistocene are mentioned.

  2. Mix-and-match lithography processes for 0.1-um MOS transistor device fabrication

    NASA Astrophysics Data System (ADS)

    Yew, Jen Y.; Chen, Lih J.; Nakamura, Kazumitsu; Chao, Tien S.; Lin, Horng-Chih

    1996-05-01

    The mix-and-match method is an effective method to meet the requirements of minimizing the exposure time and the feature size, in which only the critical gate layer is exposed by electron beam lithography system, and the other ones by conventional g-line stepper. The negative type chemically amplified resist SAL601, made by Shipley, has been used for gate fabrication. The optimum conditions for the electron beam lithography including mark dimension, resist process and etching process have been investigated. The accelerating voltage and the beam current were fixed to be 40 kV and 0.25 nA, respectively. The mark of the electron beam lithography has the trench cross shape of 0.5 micrometers in depth, 20 micrometers in length and 3 micrometers in width. The sensitivity of SAL601 resist has been 20 (mu) C/cm2 for 0.1 micrometers patterning at 40 kV accelerating voltage. The polysilicon gate was etched by electron cyclotron resonance with SiO2 thin mask in HBr/O2 gas, for the appropriate anisotropy of etching and for the polysilicon-to-oxide selectivity of HBr/O2 gas plasma. The well defined profile of polysilicon gate with 0.1 micrometers width has been obtained successfully.

  3. Eye-safe coherent lidar detection using a 1.5-um Raman laser

    NASA Astrophysics Data System (ADS)

    Monarski, Timothy W.; Hannon, Stephen M.; Gatt, Philip

    2001-09-01

    We present data on a novel short-pulse eyesafe lidar transceiver for utilization in high-resolution heterodyne detection Doppler wind sensing. Operating at 20 Hz, the transmitter is a 1.3 micrometers pumped solid state Raman laser running at 1.556 micrometers , and is injection seeded using a direct diode master oscillator. This system is coupled to a hemispherical scanner to measure atmospheric winds, with the data validated against a commercially-available 2 micrometers lidar system. We typically measured atmospheric returns from greater than 2 km, with range resolution less than 6 m.

  4. Lamper, Karen Teresa From: UM Research Listserv on behalf of Lamper,

    E-print Network

    Shyu, Mei-Ling

    and Engineering (DESE); proposals are encouraged also on any non-DESE interdisciplinary research theme submits only one Traineeship Track proposal, it can be on either DESE or another theme. If an institution submits two Traineeship Track proposals, at least one must be a DESE proposal. In either case (DESE or non-DESE

  5. Molecular interaction between parkin and PINK1 in mammalian neuronal cells Ji Won Um a

    E-print Network

    Lübbert, Hermann

    Available online 8 January 2009 Keywords: Parkinson's disease Parkin PINK1 Lewy bodies Proteasome Parkinson Elsevier Inc. All rights reserved. Introduction Parkinson disease (PD) is a devastating neurodegenerative disease characterized by a distinct set of motor symptoms, including muscle rigidity, tremor, postural

  6. Kinase Reference Description Labeling SiteSequence Torin1 1uM Torin1

    E-print Network

    Sabatini, David M.

    /threonine-protein kinase [Homo sapiens (Human)]Lys2 DLkSNNIFLHEDLTVK3.2 4.9 -15.1 >10 -16.9 15.2 BTK UniRef100_Q06187Tyrosine-protein kinase BTK [Homo sapiens]Activation LoopYVLDDEYTSSVGSkFPVR10.0 5.2 8.8 >10 35.1 -4.5 CaMK1

  7. Lamper, Karen Teresa From: UM Research Listserv on behalf of Lamper,

    E-print Network

    Shyu, Mei-Ling

    , and current protection and prevention measures); (2) appropriate application of controls and worker protection-L@LISTSERV.MIAMI.EDU Subject: Internal Competition for NIEHS, Ebola Biosafety and Infectious Disease Response Training (UH4 for the National Institute of Environmental Health Sciences (NIEHS), Ebola Biosafety and Infectious Disease

  8. Del Rio, Karen T From: UM Research Listserv on behalf of Del Rio,

    E-print Network

    Shyu, Mei-Ling

    healthy choices Housing and Affordability $185,000 prevent homelessness by addressing housing and economic issues create pathways to economic stability for residents who are homeless and lowincome residents atrisk of becoming homeless provide lowincome or homeless residents access to basic needs (food

  9. Teaching Advanced Concepts in Computer Networks: VNUML-UM Virtualization Tool

    ERIC Educational Resources Information Center

    Ruiz-Martinez, A.; Pereniguez-Garcia, F.; Marin-Lopez, R.; Ruiz-Martinez, P. M.; Skarmeta-Gomez, A. F.

    2013-01-01

    In the teaching of computer networks the main problem that arises is the high price and limited number of network devices the students can work with in the laboratories. Nowadays, with virtualization we can overcome this limitation. In this paper, we present a methodology that allows students to learn advanced computer network concepts through…

  10. Effect of impurity concentration on 1.54 um emission from GaN:Er

    NASA Astrophysics Data System (ADS)

    Abernathy, Cammy R.; Overberg, Mark J.; Mackenzie, John D.; Hoemmerich, Uwe; Pearton, Stephen J.; Wilson, R. G.; Zavada, John M.

    2000-04-01

    The surface morphology and the room temperature 1.54 micrometers photoluminescence (PL) intensity have been investigated as a function of Er flux in GaN:Er grown by gas source molecular beam epitaxy using below bandgap excitation energy. Unlike AlN, GaN:Er showed improved surface smoothness as evidenced by atomic force microscopy and scanning electron microscopy, with RMS roughness values improving from 18.1 to 2.0 nm as the Er concentration is increased. Similarly the PL emission increased with increasing Er concentration and showed no evidence of saturation or concentration quenching. Even further improvements in 1.54 micrometers PL intensity from GaN:Er have been obtained through the introduction via ion implantation of carbon or oxygen, with carbon appearing to produce the greatest increase. Increasing the C concentration through the use of CBr4 during growth initially improved the surface smoothness, with RMS roughness improving by a factor of seven over undoped GaN. The PL also improved dramatically. However, the highest amounts of C investigated produced a decrease in the PL as well as a roughening of the film surface. These effects indicate that the GaN:Er had reached its C solubility limit, producing an increased amount of defect induced nonradiative recombination.

  11. Lamper, Karen Teresa From: UM Research Listserv on behalf of Lamper,

    E-print Network

    Shyu, Mei-Ling

    and non-allergic), chronic rhinosinusitis, atopic dermatitis, food allergy, and drug allergy Institute of Allergy and Infectious Diseases (NIAID), Asthma and Allergic Diseases Cooperative Research. The program will support centers that integrate clinical and basic research to conduct studies

  12. Modelling Expectation in the Self-Repair Processing of Annotat-, um, Listeners

    E-print Network

    Purver, Matthew

    Queen Mary University of London {j.hough,m.purver}@qmul.ac.uk Abstract This paper describes ] repair Mary continuation In addition to this structural vocabulary, from here on we consider the repair parallelism. The interpretation of self-repairs by both an- notators assigning bracketing on transcripts

  13. 30 | dec 2014 | north american | SPectrUm.ieee.orG DEstruCtion

    E-print Network

    Cortes, Corinna

    , and solar thermal power systems, which capture the sun's energy as heat. For us, designing and building- mistic assumptions about cost reductions in solar power, wind power, energy stor- age, and electricR&D.Itsaspirationalgoal:toproduce a gigawatt of renewable power more cheaply than a coal-fired plant could, and to achieve this in years

  14. Robust and fast OPC approach for metal interconnects of 0.13um logic devices

    NASA Astrophysics Data System (ADS)

    Park, Ji-Soong; Kim, Dong-Hyun; Park, Chul-Hong; Kim, Yoo-Hyon; Yoo, Moon-Hyun; Kong, Jeong-Taek; Kim, Hyun-Woo; Yoo, Sun-Il

    2002-03-01

    Insufficient metal overlaps over contacts and/or vias impact serious yield loss especially in the borderless-contact- style random logic devices. Vias which are not fully covered by interconnects cause not only the functional error due to the high via resistance but also the reliability problem such as electro migration. It is not sufficient to compensate only optical proximity effects such as line-end shortening and corner rounding for the overlap margin. Since mis-alignment between interconnects and over/underlying features is not negligible even using an advanced alignment system of step and scanner. Therefore, the need for aggressive OPC is increased to cope with the proximity effect and overlay error in metal interconnects. The proposed OPC approach gives a robust metal overlap with fast runtime and allowable data complexity by selective correction for the improperly overlapped contacts and vias. Experimental results for the test design show that the correction time of the metal interconnects takes 11 hours at HP5600 system by applying the proposed correction algorithm.

  15. Mec^anica Estatistica Lista 1 1. Considere um modelo de N ions magne-

    E-print Network

    Levin, Yan

    ´iveis para uma dada energia E. (b) Calcule a entropia por part´icula. (c) Calcule o calor espec´ifico por´iculas que podem ser encontradas em dois estados com energia 0 ou . Calcule: (a) (E, N). (b) A entropia s(u). (c) A temperatura T(u). (d) A energia u(T). (e) Para uma dada temperatura T, qual fra¸c~ao de part

  16. Mec^anica Estatistica Lista 2 1. Considere um modelo de N ions magne-

    E-print Network

    Levin, Yan

    ´iveis para uma dada energia E. (b) Calcule a entropia por part´icula. (c) Calcule o calor espec´ifico por´iculas que podem ser encontradas em dois estados com energia 0 ou . Calcule: (a) (E, N). (b) A entropia s(u). (c) A temperatura T(u). (d) A energia u(T). (e) Para uma dada tem- peratura T, qual fra¸c~ao de part

  17. Synchronous and asynchronous multiplexer circuits for medical imaging realized in CMOS 0.18um technology

    NASA Astrophysics Data System (ADS)

    D?ugosz, R.; Iniewski, K.

    2007-05-01

    Multiplexers are one of the most important elements in readout front-end ASICs for multi-element detectors in medical imaging. The purpose of these ASICs is to detect signals appearing randomly in many channels and to collect the detected data in an ordered fashion (de-randomization) in order to send it to an external ADC. ASIC output stage functionality can be divided into two: pulse detection and multiplexing. The pulse detection block is responsible for detecting maximum values of signals arriving from the shaper, sending a flag signal indicating that the peak signal has been detected and storing the pulse in an analog memory until read by ADC. The multiplexer in turn is responsible for searching for active flags, controlling the channel that has detected the peak signal and performing reset functions after readout. There are several types of multiplexers proposed in this paper, which can be divided into several classes: synchronous, synchronized and asynchronous. Synchronous circuits require availability of the multiphase clock generator, which increases the power dissipation, but simultaneously provide very convenient mechanism that enables unambiguous choice of the active channel. This characteristics leads to 100% effectiveness in data processing and no data loss. Asynchronous multiplexers do not require clock generators and because of that have simpler structure, are faster and more power efficient, especially when data samples occur seldom at the ASIC's inputs. The main problem of the asynchronous solution is when data on two or more inputs occur almost at the same time, shorter than the multiplexer's reaction time. In this situation some data can be lost. In many applications loss of the order of 1% of the data is acceptable, which makes use of asynchronous multiplexers possible. For applications when the lower loss is desirable a new hierarchy mechanism has been introduced. One of proposed solutions is a synchronized binary tree structure, that uses many simple asynchronous clock generators. This circuit joins advantages of synchronous and asynchronous solutions resulting in low power dissipation, high speed of operation and 100% effectiveness.

  18. LASER-UND QUANTENOPTIKSEMINAR Freitag, 06.02.2015, um 10:00 Uhr

    E-print Network

    Kaus, Boris

    of artificial micro- and nano- structures with unique magnetic configurations. To this end, by engineering Institute for Integrative Nanosciences, IFW Dresden Curved magnetic nanomembranes Fundamental and applied aspects of magnetism on curved surfaces will be presented with emphasize on the design and understanding

  19. UM-HSRI-BI-75-5 FINAL REPORT MAY 31, 1975

    E-print Network

    of a three-year study designed t o collect analyze, and reduce selected anthropometric data on 4027 infants data was recorded automatically by a portable NOVA 1220 mini-computer system. Center of gravity i n diameters, hand clearance, and grip size dimensions. Data are presented i n both tabular and graphical

  20. Educacao Fisica Escolar: A Construcao de um Conceito (School Physical Education: The Construction of a Concept).

    ERIC Educational Resources Information Center

    Colpas, Ricardo Ducatti

    2000-01-01

    Seeks to understand school physical education praxis in light of the human development theories of Lev Vygotsky. Develops a methodology of teaching and a conception of learning that enables students to recognize physical education as a school discipline connected to a dynamic curriculum. (BT)

  1. Mezi folklorem a um?ním, mezi zem?mi a existencí

    E-print Network

    Pavera, Libor

    2009-01-01

    najdeme nejvýrazn?ji zastoupeny u F. L. ?elakovského (Ohlas písní ruských, 1829; Ohlas písní ?eských, 1839), K. S. Šnajdra, J. V. Kamarýta, J. K. Chmelenského nebo V. J. Picka-Podsvijanského, kte?í byli v podstat? epigony ohlasové tvorby ?elakovského. V... najdeme nejvýrazn?ji zastoupeny u F. L. ?elakovského (Ohlas písní ruských, 1829; Ohlas písní ?eských, 1839), K. S. Šnajdra, J. V. Kamarýta, J. K. Chmelenského nebo V. J. Picka-Podsvijanského, kte?í byli v podstat? epigony ohlasové tvorby ?elakovského. V...

  2. Tipps und Infos rund ums Studium Wo geht`s lang?

    E-print Network

    Berlin,Technische Universität

    Beratung: Mo 9.30 - 12.30 Uhr Di - 14.00 - 18.00 Uhr Mi - - Do 9.30 - 12.30 Uhr 14.00 - 16.00 Uhr Fr 9 Sprechzeit: Mo - Do 9.00 - 17.00 Uhr Fr 9.00 - 14.00 Uhr telefonservice@tu-berlin.de Psychologische Beratung Sprechstunde: Di 15.00 - 17.00 Uhr Do 10.30 - 12.30 Uhr Telefonische Sprechzeiten: Mo, Mi, Do 14.00 - 14.30 Uhr

  3. The impact of atmospheric waves on the O2 1.27-um nightglow distribution

    NASA Astrophysics Data System (ADS)

    Hoshino, Naoya; Fujiwara, Hitoshi; Takagi, Masahiro; Kasaba, Yasumasa; Takahashi, Yukihiro

    O2 -1.27µm nightglow is the indicator of the general circulation at about 95 km in Venus. Recent nightglow observations reported that the nightglow emission showed the temporal variations with a timescale of a few hours and days [e.g.,Gerard et al., 2008]. The temporal variations are thought to be caused by wind fluctuations due to atmospheric waves propagating from the lower atmosphere. In recent years, the importance of planetary-scale waves on the general circulation of the Venusian atmosphere has been recognized. Forbes and Konopliv [2007] suggested the propagation of planetary-scale waves originated in the cloud deck into the upper atmosphere. However, the impact of the planetary-scale waves on the Venusian upper atmosphere has not been investigated yet. In this study, we have performed numerical simulations with a general circulation model (GCM), which includes the altitude region of 80 -about 200 km in order to understand the impact of atmospheric waves on the nightglow distribution. Our model considers the chemical processes and calculates the O2 -1.27µm nightglow intensity. The planetary-scale waves (thermal tides, Kelvin wave, and Rosbby wave) are imposed at the lower boundary. The amplitudes and phase velocities of the waves are assumed from the study by Del Genio and Rossow [1990]. The simulation results show dominance of the Kelvin wave at about 80 -120 km with a vertical wavelength of about 40 -50 km. The amplitude of the zonal wind fluctuation caused by the Kelvin wave has a maximum value of about 9 m/s at about 95 km. Our results suggest that the Kelvin wave would cause the wind variation of the nightglow emission region between the 00:00LT -00:40LT with a period of 4 days. In this presentation, we will show the details of our simulation results considering the planetary-scale waves. In addition, we will present the initial results of a simulation considering the small-scale gravity wave.

  4. Com criatividade e alguns conhecimentos, j possvel criar um aparelho eletrnico

    E-print Network

    Instituto de Sistemas e Robotica

    as informações pretendidas. A primeira placa eletrónica sobre a qual se debruçaram foi o Arduino, tendo sido desenho próprio mas inspirado no Arduino, que superava os constrangimen- tos encontrados. Nascia o Bl Arduino, é o facto de poder adquirir sinais múltiplos sem grandes complicações, graças a uma eficaz

  5. Isolation of UmRrm75, a gene involved in dimorphism and virulence of Ustilago maydis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ustilago maydis displays dimorphic growth, alternating between a saprophytic haploid yeast form and a filamentous dikaryon, generated by mating of haploid cells and which is an obligate parasite. Induction of the dimorphic transition of haploid strains in vitro by change in ambient pH has been used...

  6. Application of 2-um wavelength holmium lasers for treatment of skin diseases

    NASA Astrophysics Data System (ADS)

    Shcherbakov, Ivan A.; Klimov, Igor V.; Tsvetkov, Vladimir B.; Nerobeev, Alexander I.; Sadovnikova, Lija B.; Eliseenko, Vladimir I.

    1994-09-01

    Theoretical and experimental analysis of the efficiency of application of 2 micrometers pulsed holmium laser for cosmetic and plastic surgery and dermatology is carried out. Preliminary experiments were carried out on rats. Solid state 2 micrometers pulsed laser was allowed to operate in free running mode with pulse energy up to 1.5 J and pulse repetition rate up to 5 Hz. To deliver emission to the object a flexible quartz fiber without further focusing of 2.5 m in length and 400 micrometers of the core diameter was used. The effect of the different power density emission on the skin was studied. The second stage was the study of the influence of 2 micrometers emission on human skin. The results of the removal of hemangioma, papilloma, telangiectasia, nevus, nevus acantholytic, xanthelasma palpebral, verruca, chloasma, pigmental spots, tattoos, etc. are presented. Precision, simplicity, efficiency, and the high cosmetic effect of these operations is noted.

  7. "I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"

    ERIC Educational Resources Information Center

    McNair, Jonda C.

    2008-01-01

    This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…

  8. Distribution of benthic foraminifers (>125 um) in the surface sediments of the Arctic Ocean

    USGS Publications Warehouse

    Osterman, Lisa E.; Poore, Richard Z.; Foley, Kevin M.

    1999-01-01

    Census data on benthic foraminifers (>125 ?m) in surface sediment samples from 49 box cores are used to define four depth-controlled biofacies, which will aid in the paleoceanographic reconstruction of the Arctic Ocean. The shelf biofacies contains a mix of shallow-water calcareous and agglutinated species from the continental shelves of the Beaufort and Chukchi Seas and reflects the variable sedimentologic and oceanic conditions of the Arctic shelves. The intermediate-depth calcareous biofacies, found between 500 and 1,100 meters water depth (mwd), contains abundant Cassidulina teretis , presumably indicating the influence of Atlantic-derived water at this depth. In water depths between 1,100 and 3,500 m, a deepwater calcareous biofacies contains abundant Oridorsalis umbonatus . Below 3,500 mwd, the deepwater mixed calcareous/agglutinated biofacies of the Canada, Makarov, and Eurasian Basins reflects a combination of low productivity, dissolution, and sediment transport. Two other benthic foraminiferal species show specific environmental preferences. Fontbotia wuellerstorfi has a depth distribution between 900 and 3,500 mwd, but maximum abundance occurs in the region of the Mendeleyev Ridge. The elevated abundance of F. wuellerstorfi may be related to increased food supply carried by a branch of Atlantic water that crosses the Lomonosov Ridge near the Russian Continental Shelf. Triloculina frigida is recognized to be a species preferring lower slope sediments commonly disturbed by turbidites and bottom currents. INTRODUCTION At present, our understanding of the Arctic Ocean lags behind our understanding of other oceans, and fundamental questions still exist about its role in and response to global climate change. The Arctic Ocean is particularly sensitive to climatic fluctuations because small changes in the amounts of sea-ice cover can alter global albedo and thermohaline circulation (Aagaard and Carmack, 1994). Numerous questions still exist regarding the nature and timing of paleoclimatic events in the Arctic Ocean. In order to attempt to answer some of these questions, baseline studies are imperative. This report discusses the distribution of benthic foraminifers in surface sediment samples from 49 box cores (figs. 1 and 2, table 1) collected by the U.S. Geological Survey (USGS) with the assistance of the U.S. Coast Guard (USCG). A modern data set of benthic foraminiferal distribution is necessary for interpreting the paleoclimatic and oceanographic history of the Arctic Ocean.

  9. Um Framework para Proviso de QoS em Redes Mveis Sem Fio1

    E-print Network

    Colcher, Sérgio

    provisão de QoS em redes móveis sem fio integrando soluções isoladas encontradas na literatura. Esses gerenciamento de suas localizações. Pode-se encontrar na literatura uma gama de trabalhos propondo soluções para

  10. Optical properties of dental enamel at 9 to 11 um derived from time-resolved radiometry

    NASA Astrophysics Data System (ADS)

    Zuerlein, Michael J.; Fried, Daniel; Seka, Wolf D.; Featherstone, John D. B.; Konkol, Kent

    1997-05-01

    Accurate determination of the optical properties of dental enamel is important for modeling the energy redistribution of laser radiation incident on the tissue. The high absorption coefficients of dental enamel in the mid-IR preclude the use of conventional transmission methods for the determination of optical properties, therefore non- conventional methods must be used. Enamel was irradiated with 9.3 micrometers , 9.6 micrometers , 10.3 micrometers , and 10.6 micrometers light from a CO2 laser with a pulse duration of approximately 100 microsecond(s) . Samples were irradiated with fluences up to 2 J/cm2. These fluences produce temperature excursions below the melting point for the tissue. Surface temperatures were monitored using time resolved radiometric measurements with 1 microsecond(s) temporal resolution. A 1D heat conduction model was used to estimate the temperature increase in enamel. By varying the absorption coefficient, the model temperature versus time profile was fitted to the experimental profile. The absorption coefficients of enamel were found to fall well below values in the literature determined using angular-resolved reflectance measurements at the same wavelengths. The new absorption coefficients were used in our heat conduction model to determine temperature excursions below the surface of the tooth. This study is a vital step in determining the optimum laser parameters for caries preventive treatments.

  11. Thermal response of hard dental tissues to 9- through 11- um CO2-laser irradiation

    NASA Astrophysics Data System (ADS)

    Fried, Daniel; Seka, Wolf D.; Glena, Richard E.; Featherstone, John D.

    1996-07-01

    The morphology and the chemistry of dental enamel and dentin can be modified by irradiation with a CO2 laser to increase the acid resistance of the intrinsic mineral. The changes induced in hard dental tissues after laser irradiation are predominantly determined by the photothermally induced temperature rise in the tissue. Therefore the temperature rise in the irradiated enamel and dentin must be determined under controlled laser conditions. Surface and subsurface temperatures were monitored after multiple-pulse CO2-laser irradiation at (lambda) equals 9.3, 9.6, 10.3, and 10.6 micrometers with 1- and 20-J/cm2 pulses of 50- to 500-microsecond(s) duration using radiometry and microthermocouples. Surface temperatures were significantly higher after 9.3- and 9.6-micrometers irradiation than for the more commonly utilized 10.6-micrometers CO2-laser wavelength. Permanent changes in the temperature response of enamel and dentin were observed at fluences greater than 2 J/cm2 and 100-microsecond(s) duration for dentin and 5 J/cm2 for enamel. CO2-laser irradiation changes the thermal and the optical properties of these tissues, substantially changing the energy deposition for subsequent laser pulses. These changes affect both the amount of energy absorbed and the depth of absorption. The more efficient absorption at (lambda) equals 9.3 and 9.6 micrometers may be advantageous for both caries-preventive treatments and ablation of exposed hard dental tissues while minimizing heat deposition in the tooth.

  12. Lamper, Karen Teresa From: UM Research Listserv on behalf of Lamper,

    E-print Network

    Shyu, Mei-Ling

    deficit/hyperactivity disorder and autism spectrum disorder, cerebral palsy and mental illnesses) using, inflammatory bowel disease, sickle cell disease, malnutrition, developmental disabilities including attention

  13. Modelamento, Construo, Instrumentao, Localizao, Simulao e Controle de um Veculo Areo

    E-print Network

    Williams, Brian C.

    matemático Formalismo de Euler-Lagrange (Lagrangiano) Leis de Newton Isaac Newton Leonhard Euler Joseph matemático Formalismo de Euler-Lagrange (Lagrangiano) Leis de Newton Isaac Newton Leonhard Euler Joseph.H.R.Q.A. Santana, M.A. Braga 29 3. Modelamento matemático Lagrangiano 2ª Lei de Newton #12;Brasília, 09 de julho de

  14. MRC-SPECT: A Sub-500 um Resolution MR-Compatible SPECT System for Simultaneous Dual-

    E-print Network

    Arizona, University of

    Detector hybrids Wire-bonding Copper heat sink Connector for receiving external trigger signal · High.3 cm x 4.5 cm x 2 mm Four 2048-channel readout ASICs Copper Heat sink Rapid prototyping supporting copper heat sink Current Detector for the SPECT-MRI System Rapid prototyping supporting frame FPGA

  15. Como os Alunos do Ensino Médio da Rede Estadual de São Paulo obtém Conhecimentos Astronômicos?

    NASA Astrophysics Data System (ADS)

    da Cunha, W. S.; Voelzke, M. R.; Amaral, L. H.

    2005-08-01

    Atualmente vivencia-se um mundo globalizado onde os computadores e a internet permitiram um acesso rápido e seguro a todo tipo de informação e conhecimento. O presente trabalho visa analisar a maneira pela qual alunos de segundo grau da rede estadual da cidade de São Paulo obtiveram, caso tenham, conhecimentos básicos de astronomia quanto aos fenômenos celestes que os rodeiam, tais como a sucessão dos dias e das estações do ano, além de questioná~los sobre fatos genéricos tais como: o que vem a ser o Sol, o Big Bang, o que ocasionou a extinção dos dinossauros. Para tanto foi elaborado um formulário constando de questões de múltipla escolha, o qual foi aplicado no primeiro colegial diurno da Escola Estadual Guilherme de Almeida. Num espaço amostral de 44 alunos constatou-se que 41% dos alunos adquiriram seus conhecimentos astronômicos na escola e 59% através da mídia em geral. Neste mesmo espaço amostral apenas 11% dos alunos usaram computadores na escola, 41% na residência, 5% no trabalho e 43% não utilizaram. O presente estudo revelou também que para 50% dos alunos o professor jamais utilizou um programa de computador a respeito de astronomia ou fez alguma apresentação sobre o tema. Embora em sua fase inicial este estudo revela claramente que a maioria dos alunos não obtém na escola seus conhecimentos astronômicos, estes provém de fontes não especificamente didático-pedagógicas tais como filmes e revistas populares que não raramente geram conhecimentos incompletos e em muitos casos inclusive falhos.

  16. Experiências internacionais da aplicação de sistemas de apoio à decisão clínica em gastroenterologia

    PubMed Central

    Tenório, Josceli Maria; Hummel, Anderson Diniz; Sdepanian, Vera Lucia; Pisa, Ivan Torres; de Fátima Marin, Heimar

    2015-01-01

    Objetivo Descrever as experiências recentes com a aplicação de sistemas de apoio à decisão clínica em gastroenterologia, de forma a estabelecer o nível de desenvolvimento, testes e vantagens conferidas à prática médica com a introdução desses softwares. Métodos Foi realizada busca nas bases de dados PubMed, LILACS e ISI Web of Knowledge, utilizando termos relacionados à sistemas de apoio à decisão e à gastroenterogia, incluindo artigos originais publicados no período entre 2005 e 2010. Foram recuperadas 104 publicações, na busca inicial e, após a aplicação dos critérios de inclusão e exclusão, foram eleitos nove estudos para leitura do texto completo. Resultados Os sistemas de apoio à decisão clínica apresentam grande multiplicidade de problemas clínicos e investigação de doenças. Em 89% dos casos, são descritos modelos experimentais para o desenvolvimento de sistemas de apoio à decisão clínica. A descrição dos resultados obtidos por técnicas de inteligência artificial em 78% das publicações. Em dois dos estudos foram realizadas comparações com o médico e em apenas uma publicação um estudo controlado foi descrito, mostrando evidências de melhorias na prática médica. Conclusão Os estudos mostram potenciais benefícios dos sistemas de apoio à decisão clínica à prática médica, porém, estudos controlados em ambiente real devem ser realizados para comprovar esta perspectiva. PMID:26491625

  17. A preliminary inventory of the catfishes of the lower Rio Nhamundá, Brazil (Ostariophysi, Siluriformes)

    PubMed Central

    Duarte Ribeiro, Emanuell; Nogueira Machado, Valéria; Hrbek, Tomas; Farias, Izeni Pires

    2015-01-01

    Abstract The Rio Nhamundá is a poorly-known clearwater river draining the southern Guiana Shield of Brazil. In this study we report the findings of a preliminary ichthyological survey, focusing on catfishes (Siluriformes). We identify a total of 36 species (31 genera, seven families) from the Nhamundá, including 11 species already recorded from the river. Overall, our survey results show that even rapid surveys can provide important information on Amazon fish biodiversity, suggesting potential new species, providing range extensions for nominal species, and additionally highlighting taxa in need of taxonomic revision and genetic study. As well as the traditional forms of data collected on biodiversity surveys (i.e. preserved specimen vouchers), our study also provides "new" types of data in the form of DNA barcodes and images of fishes exhibiting colouration in life, information that will be invaluable in future work addressing difficult groups. O Rio Nhamundá é um rio de água clara, pouco conhecido, que drena parte do Escudo das Guianas em território brasileiro. Nesse estudo, nós reportamos os resultados de um levantamento ictiofaunístico preliminar dessa área, tendo como foco os bagres (Siluriformes). Nós identificamos um total de 36 espécies (31 gêneros, sete famílias) provenientes de nossa coleta, e adicionamos 11 espécies já conhecidas para o rio. De maneira geral, os resultados de nossa pesquisa mostram que mesmo levantamentos rápidos podem gerar informações importantes sobre a biodiversidade de peixes amazônicos, sugerindo potenciais espécies novas, ampliando a área de distribuição de espécies, além de apontar a necessidade de revisões taxonômicas e estudos genéticos para alguns taxa. Para além das formas tradicionais de dados coletados em pesquisas de biodiversidade (i.e. espécimes preservados), nosso estudo fornece "novas" formas de dados, como DNA barcodes e imagens com o padrão de coloração dos espécimes vivos, informações essas que serão de valor inestimável para futuros estudos que abordem grupos taxonômicos difíceis. PMID:25977611

  18. A preliminary inventory of the catfishes of the lower Rio Nhamundá, Brazil (Ostariophysi, Siluriformes).

    PubMed

    Collins, Rupert A; Duarte Ribeiro, Emanuell; Nogueira Machado, Valéria; Hrbek, Tomas; Farias, Izeni Pires

    2015-01-01

    The Rio Nhamundá is a poorly-known clearwater river draining the southern Guiana Shield of Brazil. In this study we report the findings of a preliminary ichthyological survey, focusing on catfishes (Siluriformes). We identify a total of 36 species (31 genera, seven families) from the Nhamundá, including 11 species already recorded from the river. Overall, our survey results show that even rapid surveys can provide important information on Amazon fish biodiversity, suggesting potential new species, providing range extensions for nominal species, and additionally highlighting taxa in need of taxonomic revision and genetic study. As well as the traditional forms of data collected on biodiversity surveys (i.e. preserved specimen vouchers), our study also provides "new" types of data in the form of DNA barcodes and images of fishes exhibiting colouration in life, information that will be invaluable in future work addressing difficult groups. O Rio Nhamundá é um rio de água clara, pouco conhecido, que drena parte do Escudo das Guianas em território brasileiro. Nesse estudo, nós reportamos os resultados de um levantamento ictiofaunístico preliminar dessa área, tendo como foco os bagres (Siluriformes). Nós identificamos um total de 36 espécies (31 gêneros, sete famílias) provenientes de nossa coleta, e adicionamos 11 espécies já conhecidas para o rio. De maneira geral, os resultados de nossa pesquisa mostram que mesmo levantamentos rápidos podem gerar informações importantes sobre a biodiversidade de peixes amazônicos, sugerindo potenciais espécies novas, ampliando a área de distribuição de espécies, além de apontar a necessidade de revisões taxonômicas e estudos genéticos para alguns taxa. Para além das formas tradicionais de dados coletados em pesquisas de biodiversidade (i.e. espécimes preservados), nosso estudo fornece "novas" formas de dados, como DNA barcodes e imagens com o padrão de coloração dos espécimes vivos, informações essas que serão de valor inestimável para futuros estudos que abordem grupos taxonômicos difíceis. PMID:25977611

  19. Revista de Documentacao de Estudos em Linguistica Teorica e Aplicada (DELTA): Novos Estudos em Gamatica Gerativa, 2001 (Journal of Documentary Studies in Theoretical and Applied Linguistics [DELTA]: New Studies in Generative Grammar, 2001).

    ERIC Educational Resources Information Center

    Barbara, Leila, Ed.; Rajagopalan, Kanavillil, Ed.

    2001-01-01

    These two issues of volume 17, include the following articles: "The Competing Motivation Model in the Functional Domains of Negation" (M. Angelica Furtado da Cunha); "Discursive Resonance and Politeness in Reading and Writing Practices" (Silvana Serrani Infante); "The Acquisition of Relative Clauses in Brazilian Portuguese" (Maria Cecilia…

  20. Laser activity at 1.18 um, 1.07 um, and 0.97 umin the low phonon energy crystalline hosts KPb2Br5 and RbPb2Br5 doped with Nd3+

    SciTech Connect

    Rademaker, K; Heumann, E; Payne, S A; Huber, G; Krupke, W F; Isaenko, L I; Burger, A

    2004-09-15

    For the first time laser activity has been achieved in the low phonon energy, moisture-resistant bromide host crystals, neodymium-doped potassium lead bromide (Nd{sup 3+}:KPb{sub 2}Br{sub 5}) and rubidium lead bromide (Nd{sup 3+}:RbPb{sub 2}Br{sub 5}). Laser activity at 1.07 {micro}m was observed for both crystalline materials. Laser operation at the new wavelengths 1.18 {micro}m and 0.97 {micro}m resulting from the {sup 4}F{sub 5/2} + {sup 2}H{sub 9/2} {yields} {sup 4}I{sub J} transitions (J=13/2 and 11/2) in Nd:RPB was achieved for the first time in a solid state laser material. Rare earth- doped MPb{sub 2}Br{sub 5} (M=K, Rb) is a promising candidate for long wavelength infrared applications because of its low phonon frequencies and other favorable features. In principle, Nd{sup 3+}:MPb{sub 2}Br{sub 5} has high potential for laser operation at new wavelengths as well as for the realization of short-wavelength lasing due to upconversion processes.

  1. A 2.4 GHz Phase Modulator for a WLAN OFDM Polar Transmitter in 0.18 um CMOS 

    E-print Network

    Arbabi, Shokoufeh

    2014-09-11

    provides a constant envelope phase modulated signal to the Power amplifier(PA) , operating in nonlinear high efficient switching mode. The core design of the phase modulator is based on linear vector-sum phase shifting topology to differential quadrature...

  2. DETERMINATION OF THE STRONG ACIDITY OF ATMOSPHERIC FINE PARTICLES (<2.5 UM) USING ANNULAR DENUDER TECHNOLOGY

    EPA Science Inventory

    This report is a standardized methodology description for the determination of strong acidity of fine particles (less than 2.5 microns) in ambient air using annular denuder technology. his methodology description includes two parts: art A - Standard Method and Part B - Enhanced M...

  3. Regulamento do 3 AnimaCatarina O evento 3 AnimaCatarina visa promover um espao de discusso sobre

    E-print Network

    Hanazaki, Natalia

    principal a apresentação de obras estudantis e valorização das melhores animações e games (jogos digitais.2 Game: Serão aceitos jogos digitais que trabalhem com elementos interativos que possuam metas ou animações e jogos digitais inscritos pela comissão de especialistas. 16 de novembro - Divulgação, através do

  4. An Upper Bound on the Flux Ratio of rho CrB's Companion at 1.6um

    E-print Network

    C. Bender; M. Simon; L. Prato; T. Mazeh; S. Zucker

    2004-09-17

    We use high resolution infrared spectroscopy to investigate the 2001 report by Gatewood and colleagues that rho CrB's candidate extrasolar planet companion is really a low-mass star with mass 0.14+-0.05 Msun. We do not detect evidence of such a companion; the upper bounds on the (companion/primary) flux ratio at 1.6 microns are less than 0.0024 and 0.005 at the 90 and 99% confidence levels, respectively. Using the H-band mass-luminosity relationship calculated by Baraffe and colleagues, the corresponding upper limits on the companion mass are 0.11 and 0.15 Msun. Our results indicate that the infrared spectroscopic technique can detect companions in binaries with flux ratios as low as 0.01 to 0.02.

  5. The relationship between English language learning strategies and gender among pre-university students: An overview of UMS

    NASA Astrophysics Data System (ADS)

    Kiram, Johannah Jamalul; Sulaiman, Jumat; Swanto, Suyansah; Din, Wardatul Akmam

    2014-06-01

    This study aims to analyze the effects psychological gender differences on the relationship between language learning strategies and their proficiency in English language for pre-university students. Previous researchers found that the more employment of language learning strategies, the more successful the learners are and those with higher level of strategy use are female rather than male. In this study, fifty-six pre-university students (22 males, 34 females) of University Malaysia Sabah participated in this study. Oxford's Strategy Inventory for Language Learning (SILL) self-report questionnaire was adopted to identify the students' language learning strategies, whereas their proficiencies were based on their Malaysian University English Test (MUET) results. Pearson's correlation coefficient, one-way analysis of variance (ANOVA) and the t-test were utilized to make statistical interpretation about the relationship. The knowledge obtained from this study will be helpful for future studies on how to improve the quality of learning and proficiency in English.

  6. Observation of nonlinear optical phenomena in fused silica and air using a 100 GW, 1.54 um source.

    SciTech Connect

    Rudd, James Van; Law, R. J.; Luk, Ting Shan; Naudeau, Madeline L.; Nelson, Thomas Robert; Cameron, Stewart M.

    2006-02-01

    A 100-GW optical parametric chirped-pulse amplifier system is used to study nonlinear effects in the 1.54 {micro}m regime. When focusing this beam in air, strong third-harmonic generation (THG) is observed, and both the spectra and efficiency are measured. Broadening is observed on only the blue side of the third-harmonic signal and an energy conversion efficiency of 0.2% is achieved. When propagated through a 10-cm block of fused silica, a collimated beam is seen to collapse and form multiple filaments. The measured spectral features span 400-2100 nm. The spectrum is dominated by previously unobserved Stokes emissions and broad emissions in the visible.

  7. VizieR Online Data Catalog: 24um fluxes of GOODS-S AGN (Garcia-Gonzalez+, 2015)

    NASA Astrophysics Data System (ADS)

    Garcia-Gonzalez, J.; Alonso-Herrero, A.; Perez-Gonzalez, P. G.; Hernan-Caballero, A.; Sarajedini, V. L.; Villar, V.

    2015-06-01

    We compiled all the data taken around the GOODS South field with the MIPS instrument at 24?m by querying the Spitzer Heritage Archive.1 This field was observed by Spitzer during several campaigns from 2004 January to 2007 March. We focused our study on a region around RA=03:32:36 (J2000) and DE=-27:48:39 (J2000). These data correspond to different observing proposals from different PI, including the Guaranteed Time Observations programme (GTO, PI: G. Rieke) and the GOODS programme (PI: M. Dickinson). We have obtained 151 AORs (Astronomical Observation Request) but only downloaded 127 because the others were from the SWIRE (Spitzer Wide-area InfraRed Extragalactic) survey and were not sufficiently deep. (2 data files).

  8. VizieR Online Data Catalog: 867um image of SBS 0335-052 with ALMA (Hunt+, 2014)

    NASA Astrophysics Data System (ADS)

    Hunt, L. K.; Testi, L.; Casasola, V.; Garcia-Burillo, S.; Combes, F.; Nikutta, R.; Caselli, P.; Henkel, C.; Maiolino, R.; Menten, K. M.; Sauvage, M.; Weiss, A.

    2013-11-01

    The observations were carried out in five separate sessions from Jul. 30 through Aug. 14, 2012 with the ALMA observatory as part of Early Science Cycle 0. The average number of antennas was 24 and the array was in the Early Science extended configuration providing baselines up to 400m. SBS 0335-052 was observed with Band 7, simultaneously in the continuum and in the 12CO(3-2) transition, with a rest frequency of 345.79599GHz. The central sky frequencies of the upper and lower sidebands were ~352GHz and ~340GHz, respectively. The observations were done as 6 executions of the same scheduling block. The unresolved extragalactic source J0339-017 was used for complex gain calibration, while Callisto or Uranus were used as flux calibrators. The measured fluxes of J0339-017 during the various observing sessions were consistently found to be ~0.98Jy and ~0.95Jy at 340GHz and 352GHz, respectively. The flux density scale accuracy is expected to be better than 5%. (2 data files).

  9. Room temperature continuous wave InGaAsN quantum well vertical cavity lasers emitting at 1.3 um

    SciTech Connect

    CHOQUETTE,KENT D.; KLEM,JOHN F.; FISCHER,ARTHUR J.; SPAHN,OLGA B.; ALLERMAN,ANDREW A.; FRITZ,IAN J.; KURTZ,STEVEN R.; BREILAND,WILLIAM G.; SIEG,ROBERT M.; GEIB,KENT M.; SCOTT,J.W.; NAONE,R.L.

    2000-06-05

    Selectively oxidized vertical cavity lasers emitting at 1294 nm using InGaAsN quantum wells are reported for the first time which operate continuous wave at and above room temperature. The lasers employ two n-type Al{sub 0.94}Ga{sub 0.06}As/GaAs distributed Bragg reflectors each with a selectively oxidized current aperture adjacent to the optical cavity, and the top output mirror contains a tunnel junction to inject holes into the active region. Continuous wave single mode lasing is observed up to 55 C. These lasers exhibit the longest wavelength reported to date for vertical cavity surface emitting lasers grown on GaAs substrates.

  10. Chemical optimization of resist/developer systems tuned for sub-0.4-um process window expansion

    NASA Astrophysics Data System (ADS)

    Toukhy, Medhat A.; Schlicht, Karin R.; Tarbox, Kimberly

    1997-07-01

    In order to perform 0.2 micrometer processes, one needs to study the diffusion of photoacid generators within the photoresist system, since diffusion during post exposure bake time has an influence on the critical dimension (CD). We have developed a new method to study the diffusion of photoacid generators within a polymer film. This new method is based on monitoring the change of the fluorescence intensity of a pH- sensitive fluorescent dye caused by the reaction with photoacid. A simplified version of this experiment has been conducted by introducing acid vapor to quench the fluorescence intensity of this pH sensor. A thin polymer film is spin cast onto the sensor to create a barrier to the acid diffusion process. During the acid diffusion process, the fluorescence intensity of this pH sensor is measured in situ, using excitation and emission wavelengths at 466 nm and 516 nm, respectively. Fluoresceinamine, the pH sensitive fluorescent dye, is covalently bonded onto the treated quartz substrate to form a single dye layer. Poly(hydroxystyrene) (Mn equals 13k, Tg equals 180 degrees Celsius) in PGMEA (5% - 18% by weight) is spin cast onto this quartz substrate to form films with varying thickness. The soft bake time is 60 seconds at 90 degrees Celsius and a typical film has a thickness of 1.4 micrometers. Trifluoroacetic acid is introduced into a small chamber while the fluorescence from this quartz window is observed. Our study focuses on finding the diffusion constant of the vaporized acid (trifluoroacetic acid) in the poly(hydroxystyrene) polymer film. By applying the Fick's second law, (It - Io)/(I(infinity ) - Io) equals erfc [L/(Dt)1/2] is obtained. The change of fluorescence intensity with respect to the diffusion time is monitored. The above equation is used for the data analysis, where L represents the film thickness and t represents the average time for the acid to diffuse through the film. The diffusion constant is calculated to be at the order of 10-10 cm2/s to 10-12 cm2/s. All the experiments are conducted at room temperature and are valid only for acid vapor. With different film thickness, it was found that the acid diffuses through the film with a similar diffusion constant. The diffusion is faster with increased solvent residue in the film (controlled by spin coating speed). The theoretical computer modeling of the local acid concentration with respect to acid diffusion is also performed.

  11. Please print or type. Please do not staple. Social Security or UM ID Number: Date of Birth _______ / _______ / _______________

    E-print Network

    Shyu, Mei-Ling

    ___ Lighting ___ Technical Direction Stage Management Theatre Management 2. High School Drama Teacher SAT Score the Common Application. #12;4. Please list any training outside of your high school/current college (attach résumé if you wish). 5. Please list any other theatre experience from high school, summer stock

  12. High-speed laser diagnostics at 1.06 um with simultaneous percussion hole drilling of aerospace materials

    NASA Astrophysics Data System (ADS)

    Cunningham, Philip R.; Fahndrich, Marc; Oliver, Jeffrey W.; Bertlesen, Thomas S.; Frye, Richard W.

    1993-06-01

    A diagnostic system was designed, fabricated and tested for measuring a Nd:YAG laser's performance using a five-axis laser machining center. Far field beam profile, beam quality, beam tilt and beam power were measured at high frequencies while holes were simultaneously percussion drilled in aerospace materials used in gas turbine engines. The system allowed determination of effects of varying laser and machine operating parameters on materials processing performance. Variations were made in laser pulse length, pulse energy, pulse repetition rate, drilling standoff distances from part, incident angles and other parameters. Measured laser beam performance was compared directly with drilled holes. A number of identically drilled holes provided hole-to-hole variance, allowing the machine center operators to optimize materials processing by tuning the laser operating parameters. The results also gave the operator additional understanding of variations of processing performance.

  13. Simplifying strong electronic correlations in uranium: Localized uranium heavy-fermion UM2Zn20 (M=Co,Rh) compounds

    E-print Network

    Lawrence, Jon

    into their underlying physics. Uranium-based heavy-fermion HF metals share charac- teristic behavior with rare-earth This common scaling behavior obscures an important underlying difference: the rare-earth 4f orbitals. The local-moment character of rare-earth HF compounds allows for detailed fits of the spe- cific heat

  14. Avda. Teniente Flomesta, 5. Edif. Convalecencia. 30003 Murcia T. 968 363 000 F. 968 363 506 www.um.es

    E-print Network

    Acacio, Manuel

    ejercicio de mi derecho a no aportar datos y documentos que obren en poder de las Administraciones Públicas datos y documentos exigibles en este procedimiento por medios electrónicos y los incorpore a sus ficheros para su tratamiento. Autorizo a la Universidad de Murcia a recabar a través de medios electrónicos

  15. Espectroscopia infravermelha para a determinacao de carbono do solo: Perspectiva de um metodo economicamente viavel e ambientalmente seguro

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Kyoto Protocol is an agreement among many of the world’s nations to, among other things, reduce atmospheric carbon dioxide concentrations in order to reduce global warming. One potential method to do so is to sequester carbon in soils. This has had the effect of stimulating the establishment of ...

  16. Research at the University of Virginia School of Engineering & Applied Science VolUmE12,NUmbER2

    E-print Network

    Huang, Wei

    Web Site Security More-Flexible Processors High-Resolution Ultrasound Genetic Debugging 3 4 5 6 7 8 9 with undergraduates, work- ing together in conference rooms, grabbing a bite at Einstein's Ba- gels and studying

  17. The relationship between English language learning strategies and proficiency of pre-university students: A study case of UMS

    NASA Astrophysics Data System (ADS)

    Kiram, Johannah Jamalul; Sulaiman, Jumat; Swanto, Suyansah; Din, Wardatul Akmam

    2014-07-01

    This paper seeks to investigate the relationship between language learning strategies and proficiency in English. Fifty-six pre-university students (22 males, 34 females) of University Malaysia Sabah participated in this study. Oxford's Strategy Inventory for Language Learning (SILL) self-report questionnaire was adopted to identify the students' language learning strategies, whereas their proficiencies were judged based on their Malaysian University English Test (MUET) Results. Pearson's correlation coefficient, Spearman's rank correlation coefficient and the t-test were utilized to make statistical interpretation about the relationship. The knowledge obtained from this study will be helpful for future studies on how to improve the quality of learning and proficiency in English.

  18. Photoablation with the free-electron laser between 10 and 15 um in biological soft tissue (cornea)

    NASA Astrophysics Data System (ADS)

    Walker, Rudolf; Ostertag, Manfred; van der Meer, Alexander F.; Bende, Thomas; Schmiedt, Karl C.; Jean, Benedikt J.

    1997-04-01

    The ablation depth and collateral thermal damage for pulsed IR photoablation as a function of wavelength with the free- electron laser (FEL) at 10.1, 11.8, 12.8, and 14.5 micrometers wavelengths is investigated. FEL data are compared with the blow-off and the continuous ablation models. Porcine cadaver corneas were used as target material. The experimental data are compared with theoretical calculations for both models. At low water absorption the additional absorption of the cornea was taken into account. FEL data were: energy per pulse between 15.6 and 17.8 mJ, ablation zone around 0.2 mm2, and pulse length 4 microsecond(s) . In this wavelength range an effective photoablation of biological materials with a high water content can be achieved. The measured FEL data of ablation depth fail to confirm the blow-off model, describing ablation depth sufficiently well. The wavelength, collagen absorption contributes to the overall absorption of corneal tissue. The ablation depth can only be described by the continuous ablation model; however, the collateral thermal damage pattern can be described by both models.

  19. Spectrally Consistent Scattering, Absorption, and Polarization Properties of Atmospheric Ice Crystals at Wavelengths from 0.2 to 100 um

    NASA Technical Reports Server (NTRS)

    Yang, Ping; Bi, Lei; Baum, Bryan A.; Liou, Kuo-Nan; Kattawar, George W.; Mishchenko, Michael I.; Cole, Benjamin

    2013-01-01

    A data library is developed containing the scattering, absorption, and polarization properties of ice particles in the spectral range from 0.2 to 100 microns. The properties are computed based on a combination of the Amsterdam discrete dipole approximation (ADDA), the T-matrix method, and the improved geometric optics method (IGOM). The electromagnetic edge effect is incorporated into the extinction and absorption efficiencies computed from the IGOM. A full set of single-scattering properties is provided by considering three-dimensional random orientations for 11 ice crystal habits: droxtals, prolate spheroids, oblate spheroids, solid and hollow columns, compact aggregates composed of eight solid columns, hexagonal plates, small spatial aggregates composed of 5 plates, large spatial aggregates composed of 10 plates, and solid and hollow bullet rosettes. The maximum dimension of each habit ranges from 2 to 10,000 microns in 189 discrete sizes. For each ice crystal habit, three surface roughness conditions (i.e., smooth, moderately roughened, and severely roughened) are considered to account for the surface texture of large particles in the IGOM applicable domain. The data library contains the extinction efficiency, single-scattering albedo, asymmetry parameter, six independent nonzero elements of the phase matrix (P11, P12, P22, P33, P43, and P44), particle projected area, and particle volume to provide the basic single-scattering properties for remote sensing applications and radiative transfer simulations involving ice clouds. Furthermore, a comparison of satellite observations and theoretical simulations for the polarization characteristics of ice clouds demonstrates that ice cloud optical models assuming severely roughened ice crystals significantly outperform their counterparts assuming smooth ice crystals.

  20. CONTINUOUS MEASUREMENT OF PARTICLES (0.01-20.0 UM) IN AN OCCUPIED HOME, REED AND WALLACE, AAAR.

    EPA Science Inventory

    To better understand the contribution of outdoor and indoor sources to particle concentrations found in residential indoor air, an extensive monitoring effort has been undertaken in a three-story townhouse located in Reston, VA. Of particular interest was the determination of i...

  1. Optimization of <= 200 um pitch CZT detectors for future high-resolution X-ray instrumentation in astrophysics

    E-print Network

    Zajczyk, Anna; Dowkontt, Paul; Guo, Qingzhen; Kislat, Fabian; Krawczynski, Henric; De Geronimo, Gianluigi; Li, Shaorui; Beilicke, Matthias

    2015-01-01

    Cadmium Zinc Telluride and Cadmium Telluride are the detector materials of choice for the detection of X-rays in the X-ray energy band E >= 5keV with excellent spatial and spectral resolution and without cryogenic cooling. Owing to recent breakthroughs in grazing incidence mirror technology, next-generation hard X-ray telescopes will achieve angular resolution between 5 and 10 arc seconds - about an order of magnitude better than that of the NuSTAR hard X-ray telescope. As a consequence, the next generation of X-ray telescopes will require pixelated X-ray detectors with pixels on a grid with a lattice constant of science drivers for a high angular-resolution X-ray mission include studies and measurements of black hole spins, the cosmic evolution of super-massive black holes, active galactic nuclei feedback, and the behaviour of matter at very high densities. In this...

  2. Modeling the language learning strategies and English language proficiency of pre-university students in UMS: A case study

    NASA Astrophysics Data System (ADS)

    Kiram, J. J.; Sulaiman, J.; Swanto, S.; Din, W. A.

    2015-10-01

    This study aims to construct a mathematical model of the relationship between a student's Language Learning Strategy usage and English Language proficiency. Fifty-six pre-university students of University Malaysia Sabah participated in this study. A self-report questionnaire called the Strategy Inventory for Language Learning was administered to them to measure their language learning strategy preferences before they sat for the Malaysian University English Test (MUET), the results of which were utilised to measure their English language proficiency. We attempted the model assessment specific to Multiple Linear Regression Analysis subject to variable selection using Stepwise regression. We conducted various assessments to the model obtained, including the Global F-test, Root Mean Square Error and R-squared. The model obtained suggests that not all language learning strategies should be included in the model in an attempt to predict Language Proficiency.

  3. Determinação de elementos próprios dos asteróides troianos: comparação entre as teorias semi-analítica e sintética

    NASA Astrophysics Data System (ADS)

    Roig, F.; Beaugé, C.

    2003-08-01

    Além do cálculo semi-analítico de elementos próprios dos asteróides Troianos (Beaugé & Roig 2001, Icarus 153, 391), recentemente foi apresentado um novo conjunto destes elementos próprios determinado através de uma teoria sintética (Knenezevic & Milani 2003, comunicação pessoal). As bases de dados contendo estas determinações estão disponiveis na pagina web do Asteroid Dynamical Site (http://hamilton.dm.unipi.it/cgi-bin/astdys/astibo). Nesta comunicação apresentamos os primeiros resultados de um estudo comparativo entre ambos conjuntos de elementos próprios, analisando suas vantagens e desvantagens, assim como os limites de precisão de cada conjunto. Mostramos que os elementos próprios sintéticos são mais precisos que os smi-analíticos para grandes amplitudes de libração do ângulo s = l-lJup, embora acontece o contrario para os corpos cuja amplitude de libração é muito pequena. Finalmente discutimos a influencia destes erros na determinação de familias de asteroides e da estrutura resonante em torno dos pontos Lagrangeanos L4 e L5.

  4. Uma análise do fenômeno “alternância de línguas” na fala de bilíngues intermodais (Libras e Português)

    PubMed Central

    de Sousa, Aline Nunes; de Quadros, Ronice Müller

    2013-01-01

    Um interessante fenômeno lingüístico presente nas interações das pessoas bilíngues é a alternância de línguas. Neste trabalho, estamos investigando a alternância entre a língua portuguesa oral e a língua de sinais brasileira – Libras, numa mesma cadeia enunciativa, com o objetivo de identificar e analisar o uso dessa alternância na fala de uma criança e de um adulto (ambos ouvintes, filhos de pais surdos), interagindo em uma situação de bilinguismo intermodal, com interlocutores surdos e ouvintes. A alternância de línguas, nesse caso, ocorre quando se para de falar em português e se alterna para sinalizar. O presente trabalho se caracteriza como um estudo inicial, com análise qualitativa de dados. Fazem parte do nosso corpus nove sessões de interações em Libras e em português oral, gravadas em vídeo, que fazem parte do Projeto Desenvolvimento Bilíngue Bimodal da UFSC. Os dados revelam que as características da alternância de línguas pelo adulto e pela criança parecem ter semelhanças e diferenças. O sujeito adulto parece ter feito um uso da alternância mais preocupado com o curso da interação. A criança, por sua vez, não parece tê-la usado com propósitos pragmáticos específicos. Quanto à extensão das alternâncias, pode-se perceber que tanto a criança quanto o adulto utilizaram enunciados maiores do que uma única palavra isolada. O papel dos interlocutores parece ter sido decisivo nas interações aqui investigadas – especialmente nas do adulto, já que a criança ainda está em processo de tomada de consciência do papel do interlocutor na interação. PMID:24379831

  5. A causa das estações do ano: modelos mentais

    NASA Astrophysics Data System (ADS)

    de Campos, J. A. S.; de Araujo, J. F. S.

    2003-08-01

    A década de 70 do século passado foi marcada pelo estudo das concepções alternativas que os alunos trazem para a sala de aula. A identificação destas concepções foi o ponto de partida para promover a mudança conceitual, onde as pré-concepções seriam trocadas pelas concepções científicas. Na década seguinte, surgiram muitas propostas de estratégias educacionais para facilitar esta troca, na sua maioria baseadas na idéia do conflito cognitivo, proposta por Piaget. Entretanto, os resultados pouco animadores conduziram à percepção de que a mudança conceitual é um processo mais complexo. Pelas idéias da Ciência Cognitiva, a mudança conceitual é uma mudança progressiva dos modelos mentais que o aluno tem sobre o mundo físico, através de enriquecimento e revisão. A causa das Estações do Ano é um tópico sobre o qual a maioria dos estudantes apresenta concepções alternativas. Os autores fizeram um levantamento sobre as pré-concepções encontradas em trabalhos sobre o tema (16 referências), procurando encontrar elementos comuns que indicassem a presença de modelos mentais específicos. As pré-concepções encontradas na literatura foram obtidas usando-se diversas metodologias (desde entrevistas clínicas até questionários de múltipla escolha) e envolvendo alunos e professores de diferentes regiões geográficas. A partir de uma análise aprofundada de cada trabalho, e utilizando-se a técnica das Redes Sistêmicas, chegou-se a conclusão que as diversas pré-concepções identificadas (em torno de 50), poderiam ser representadas por 6 modelos mentais, onde a explicação da causa das estações do ano tem um mecanismo causal responsável. Os mecanismos causais identificados foram: a dependência da distância, a dependência da orientação, a dependência conjunta da distância e orientação, a dependência da obstrução, a dependência da velocidade e a dependência da inclinação dos raios solares. Foram ainda identificadas associações alternativas, que são um conjunto de pré-concepções, onde não existe a idéia de um modelo científico completo mas, sim, fragmentos de observação do dia a dia das pessoas.

  6. Tendências de teses e dissertações sobre ensino de astronomia no Brasil

    NASA Astrophysics Data System (ADS)

    Bretones, P. S.; Megid Neto, J.

    2003-08-01

    Neste trabalho são apresentados os resultados de uma pesquisa do tipo estado da arte sobre teses e dissertações defendidas no Brasil e relativas ao ensino de Astronomia. Teve por objetivo identificar essa produção e conhecer as principais tendências da pesquisa nesse campo. O procedimento inicial consistiu de um levantamento bibliográfico junto ao Centro de Documentação em Ensino de Ciências (CEDOC) da Faculdade de Educação da UNICAMP e ao Banco de Teses da CAPES disponível na Internet. Foram localizadas 13 dissertações de mestrado e 3 teses de doutorado, as quais foram estudadas em função dos seguintes aspectos: instituição, ano de defesa, nível escolar abrangido no estudo, foco temático do estudo e gênero de trabalho acadêmico. Deste conjunto de pesquisas, 13 (81,3%) delas foram defendidas a partir da segunda metade dos anos 90, indicando uma preocupação mais recente com temas relativos ao ensino de Astronomia no conjunto da produção acadêmica em programas de pós-graduação no Brasil. Verificou-se que 43,7% dos trabalhos foram produzidas na USP e 18,8% na UNICAMP. Quanto ao nível escolar abrangido nos estudos, predominaram os estudos direcionados ao Ensino Fundamental de 5a a 8a séries (62,5%). No que diz respeito ao foco temático das pesquisas, as principais tendências voltaram-se: 56,3% para Conteúdo e Método; 43,8% para Concepções do Professor; 37,5% para Currículo e Programas; 37,5% para Recursos Didáticos. Quanto ao gênero de trabalho acadêmico, verificou-se que 43,8% são de Pesquisa Experimental e 31,3% de Pesquisa de Análise de Conteúdo. Estudos de revisão bibliográfica como este visam colaborar com a divulgação ampla da produção acadêmica em determinada área, traçando algumas de suas tendências. Ao mesmo tempo possibilita, a partir de investigações decorrentes, apontar as suas contribuições para o ensino e sinalizar com necessidades a serem supridas por futuras pesquisas.

  7. Modelo Análogo Acústico ao Buraco Negro de Schwarzschild

    E-print Network

    Júnior Diniz Toniato

    2011-04-13

    Um fluido em movimento pode agir sobre o som da mesma forma que os espa\\c{c}o-tempos curvos podem influenciar na trajet\\'oria da luz na relatividade geral. Com isso, pode-se descrever a propaga\\c{c}\\~ao dessas ondas sonoras atrav\\'es de uma m\\'etrica efetiva, sob a qual elas seguir\\~ao geod\\'esicas nulas. Esta disserta\\c{c}\\~ao faz uma revis\\~ao destes estudos concentrando-se em uma analogia ac\\'ustica para um buraco negro de Schwarzschild, demonstrando suas vantagens e limita\\c{c}\\~oes quando aplicada para o estudo da teoria de Hawking. A fluid in moviment can act on the sound the same way that curved space-time can influence on light trajectory in the general relativity. So, one can describe the propagation these sound waves through an effective metric, under wich they will follow null geodesics. This thesis makes a review of these studies focusing in an analogy to Schwarzschild black hole using an acoustic system, showing its advantages and limitations when applied in the study of Hawking's theory.

  8. Modelo An\\'alogo Ac\\'ustico ao Buraco Negro de Schwarzschild

    E-print Network

    Toniato, Júnior Diniz

    2011-01-01

    Um fluido em movimento pode agir sobre o som da mesma forma que os espa\\c{c}o-tempos curvos podem influenciar na trajet\\'oria da luz na relatividade geral. Com isso, pode-se descrever a propaga\\c{c}\\~ao dessas ondas sonoras atrav\\'es de uma m\\'etrica efetiva, sob a qual elas seguir\\~ao geod\\'esicas nulas. Esta disserta\\c{c}\\~ao faz uma revis\\~ao destes estudos concentrando-se em uma analogia ac\\'ustica para um buraco negro de Schwarzschild, demonstrando suas vantagens e limita\\c{c}\\~oes quando aplicada para o estudo da teoria de Hawking. A fluid in moviment can act on the sound the same way that curved space-time can influence on light trajectory in the general relativity. So, one can describe the propagation these sound waves through an effective metric, under wich they will follow null geodesics. This thesis makes a review of these studies focusing in an analogy to Schwarzschild black hole using an acoustic system, showing its advantages and limitations when applied in the study of Hawking's theory.

  9. UNIVERSIDADE FEDERAL DE SANTA CATARINA CENTRO DE CINCIAS DA EDUCAO

    E-print Network

    Floeter, Sergio Ricardo

    : __________________________________________________________________________________________________________ Fone Comercial e/ ou Estudo: _______________________ Fone Res: ___________________________ Fone Celular: ___________________________________________________________________________________________________________ Fone Comercial e/ ou Estudo: _______________________ Fone Res: ___________________________ Fone Celular: ___________________________________________________________________________________________________________ Fone Comercial e/ ou Estudo: _______________________ Fone Res: ___________________________ Fone Celular

  10. A Influência da Escola e da Mídia na Obtenção dos Conhecimentos Astronômicos

    NASA Astrophysics Data System (ADS)

    da Cunha, W. S.; Voelzke, M. R.; Amaral, L. H.

    2006-08-01

    O universo em que vivemos possui segredos jamais imaginados pelo homem, fruto da pequena proporção que ocupamos diante de um cosmos infinito. A astronomia funciona como um instrumento que sacia a sede humana em desvendar esses segredos, estudando as galáxias, quasares, pulsares além da existência de todos os elementos que preenchem o espaço cósmico, o vácuo, não mais vazio como se pensou em outros tempos. A mídia explora esse campo de forma mística e também científica. A difusão adequada e dentro dos padrões educacionais vigentes, de conceitos astronômicos, se faz necessária, devido sua presença nos conteúdos escolares, centros de ciência e na mídia, de modo geral. A reforma do Currículo Básico da Escola Pública da maioria dos Estados brasileiros introduziu conceitos astronômicos desde a pré-escola até o Ensino Médio. Num estudo realizado com 1.032 alunos do Ensino Médio de seis escolas estaduais, revelou-se através da aplicação de um questionário que abordava conheciment os básicos em astronomia, como estes foram adquiridos e qual era a infra-estrutura oferecida pela escola: para 66,2% dos entrevistados o professor já fez alguma apresentação a respeito de astronomia. O presente estudo revelou também que 44,5% dos alunos entrevistados adquiriram seus conhecimentos astronômicos na escola, 28,1% através da televisão e 27,4% afirmaram que seus conhecimentos foram obtidos através de outros tipos de mídia (internet, filmes e revistas). Embora o estudo revele claramente que há certo equilíbrio na forma em que os alunos obtiveram seus conhecimentos astronômicos, a mídia ainda explora e muitas vezes desperta o interesse pela astronomia com assuntos que não fazem parte de nosso cotidiano como, por exemplo, o homem na Lua, os projetos espaciais e a primeira viagem de um astronauta brasileiro no espaço. Porém, em certos casos, a mídia pode promover conhecimentos incompletos ou mesmo equivocados sobre os conceitos que envolvam a astronomia, como por exemplo a propagação do som no vácuo observado na maioria dos filmes de f icção científica ou da existência das estações do ano em função da distância da Terra ao Sol, em conformidade com o questionário aplicado.

  11. Revista de Documentacao de Estudos em Linguistica Teorica e Aplicada, 1999 (Journal of Documentary Studies in Linguistic Theory and Application, 1999).

    ERIC Educational Resources Information Center

    Barbara, Leila, Ed.; Rajagopalan, Kanavillil, Ed.

    1999-01-01

    These issues include the following articles: "Portuguese Philology in Brazil" (Heitor Megale, Cesar Nardelli Cambraia); "Implications of Brazilian Portuguese Data for Current Controversies in Phonetics: Towards Sharpening Articulatory Phonology" (Eleonora Cavalconte Albano); "Morphological Studies in Brazil: Data and Issues" (Margarida Maria de…

  12. Ciclo de estudos em obras raras: as competncias para a gesto de colees especiais, n. 2/ organizado por Alessandro de Oliveira

    E-print Network

    Liu, I-Shih

    Deus. Rio de Janeiro: Universidade Federal do Rio de Janeiro, 2014. 22 p. 1. Obras raras ­ congressos. Ribeiro, Alessandro de Oliveira Ossola (org.). II. Sérgio, Leonisses Manhã (org.). III. Deus, Cássia C. D

  13. Tcnicas Inferenciais e de Suporte Deciso Aplicadas ao Estudo de Adequabilidade de Stio: O Caso da Implantao de Terminais Intermodais ao Longo do Piracicaba Navegvel

    E-print Network

    Camara, Gilberto

    rios Tietê e Paraná. Em vista do desnível de cerca de 231 m entre o reservatório da usina de Barra curso, a partir do seu entroncamento com o reservatório de Barra Bonita. Neste trecho, a hidrovia terá

  14. Evolução rotacional de corpos reacumulados

    NASA Astrophysics Data System (ADS)

    Penteado, P.; Lazzaro, D.; Roig, F.; Duffard, R.; Kodama, T.

    2003-08-01

    Asteróides reacumulados (rubble-piles) são corpos formados por um conjunto de fragmentos agregados primariamente pela sua gravidade. A importância do estudo de corpos reacumulados para a compreensão da evolução do Cinturão de Asteróides tem sido bastante evidenciada, não apenas pela constatação de que estes devem corresponder a uma grande parcela da população de asteróides, mas também por recentes estudos da estrutura e evolução colisional deste tipo de asteróide. A evolução rotacional de corpos reacumulados e a formação de famílias têm sido estudadas pelo nosso grupo, com base no modelo de elipsóides interagentes. Este modelo foi desenvolvido recentemente pelo grupo, e baseia-se na integração numérica das equações de movimento para translação e rotação de corpos formados por um conjunto de elipsóides que interagem entre si pela sua gravidade, força de contato e dissipação de energia por atrito. Considerar a rotação de cada fragmento é a principal diferenciação do nosso modelo em relação aos que têm sido desenvolvidos recentemente. Apresentamos aqui os resultados obtidos para a evolução da rotação de populações de corpos reacumulados. Estes foram submetidos a séries de colisões com projéteis de altas velocidades (5Km/s, típicas do Cinturão atual), distribuídos em uma lei de potências de tamanhos. Estes resultados são comparados com os de Harris (1979), um dos poucos trabalhos analíticos existentes para evolução rotacional de asteróides. O principal resultado obtido por Harris foi a distribuição final de velocidades de rotação como uma lei de potências para corpos pequenos, passando de forma bem definida para rotação constante para os grandes. Nas nossas simulações observamos que as distribuições de velocidades de rotação resultantes tendem a leis de potência, com a inclinação evoluindo no decorrer de colisões subsequentes.

  15. Uma Comparação entre Técnicas de Propagação de Erros em Astrofísica: Monte Carlo x Bootstrap

    NASA Astrophysics Data System (ADS)

    Zabot, Alexandre; Baptista, Raymundo

    2005-07-01

    Neste trabalho é feito um estudo comparativo entre dois algoritmos numéricos usados para propagação de erros em dados experimentais. Um deles é conhecido por Método de Monte carlo e o outro por Método de Bootstrap. Recentemente, Dhullon & Watson argüiram que a aplicação do método de Monte Carlo introduz ruído nos dados, e propuseram então a utilização do Bootstrap como alternativa capaz de produzir resultados superiores. O objetivo deste trabalho é testar a validade dessa afirmação. As duas técnicas foram aplicadas a três problemas diferentes: o ajsute de modelos de emissão LTE simples e atmosfera estelar a espectros estelares observados e o ajuste de curvas de luz de eclipses de Variáveis Cataclísmicas para a detemrinação da distribuição radial de brilho dos seus discos de acréscimo. Os métodos foram testados quanto à sua robusteza, ou seja, a capacidade de prover resultados coerentes enre si. Além disso, as soluções dos métodos foram comparadas. Os resultados indicam que não existe evidência de superioridade de um métodos em relação ao outro.

  16. Incorporando a variabilidade no processo de identificação do modelo de máximo global no Grade of Membership (GoM): considerações metodológicas

    PubMed Central

    Guedes, Gilvan Ramalho; Siviero, Pamila Cristina Lima; Caetano, André Junqueira; Machado, Carla Jorge; Brondízio, Eduardo

    2012-01-01

    A disponibilidade de bases de dados cada vez mais complexas e multidimensionais é um dos principais motivadores para o aumento do número de estudos que utilizam análises multivariadas baseadas em lógica de conjuntos nebulosos. Apesar da disseminação do método Grade of Membership nos trabalhos empíricos brasileiros da área de ciências sociais e saúde, questões relativas à identificabilidade e estabilidade dos parâmetros finais estimados pelo programa GoM 3.4 não foram suficientemente aprofundadas. Dada a relevância de se obterem parâmetros únicos e estáveis, Guedes et al. (2010) propuseram um procedimento empírico para localizar um modelo de máximo global (MG) com parâmetros estáveis. Entretanto, seu localizador de MG não incorpora qualquer medida de variabilidade. Neste artigo, tal limitação é contornada por meio da utilização de uma estatística de ponderação – Máximo Global Ponderado (MGP) – semelhante ao coeficiente de variação. Esse indicador busca não penalizar de forma desproporcional situações nas quais os desvios médios, apesar de diferentes de zero, são muito pequenos. Apresentam-se evidências de que o localizador MGP reduz a distância do modelo identificado à real estrutura latente dos dados em análise, quando comparados ao modelo identificado pelo localizador não ponderado, MG. PMID:23293402

  17. Controle orbital de satélites artificiais com propulsão e uso de gravidade lunar

    NASA Astrophysics Data System (ADS)

    Torres, K. S.; de Almeida Prado, A. F. B.

    2003-08-01

    A redução do custo de combustível de uma manobra é atualmente a grande prioridade de todos os programas espaciais existentes no mundo. As manobras assistidas pela gravidade são uma ótima forma de se contornar o problema pois proporcionam economias com vasto impacto no custo final da missão. Neste trabalho é feito um estudo particular do controle orbital de um satélite artificial da Terra usando a gravidade da Lua. O objetivo é estudar uma técnica econômica para uma mudança de plano de um satélite que está em órbita em volta da Terra. A idéia principal desta abordagem é enviar primeiramente o veículo espacial em direção à Lua usando uma manobra mono-impulsiva para que assim o campo gravitacional da Lua possa fazer a mudança de plano desejada (sem custo de combustível) e só então retornar o veículo aos valores iniciais de semi-eixo e excentricidade usando uma manobra bi-impulsiva tipo Hohmann. Para tanto, é assumido que a espaçonave inicia em uma órbita circular coplanar à órbita da lua em torno da Terra e a meta é colocá-la em uma órbita similar que difere da órbita inicial somente pela inclinação. São usadas equações analíticas baseadas na abordagem Patched Conics para se calcular a variação na velocidade, momento angular, energia e inclinação do veículo espacial que realiza esta manobra. Várias simulações são feitas para se avaliar as economias de combustível envolvidas.

  18. '~nd'Vf {1 R f 0 10 A I 1 (I N ISP:tUm~ UHP:M~ UIYI~UJt4 ANN ARBOR,MICH

    E-print Network

    Rathbun, Julie A.

    processing, and input/output. The executive also decommutates the main frarne sync pattern, housekeeping count1 mode ID, and in addition, processes word 3 3 {Central Station Housekeeping) and word 46 {command the housekeeping subcom is in lock, {after two complete 90 word passes}, automatic printing will occur when either

  19. Confusion about a little observatory: the history of the first high school observatory (German Title: Verwirrung um eine kleine Sternwarte: Die Geschichte der ersten Chemnitzer Schulsternwarte )

    NASA Astrophysics Data System (ADS)

    Pfitzner, Elvira

    By means of a small watercolor, painted by a musicologist, the existence of the highschool observatory of Chemnitz was rediscovered. The small observatory was build in 1893 by means of funds and a donation: after WW I it was also used for popular education. During Nazi times, the observatory fell into neglect, and the mechanical damage made it impossible to put it back into operation after WW II The building was torn down in 1964 and forgotten.

  20. University of Massachusetts, Department of Computer Science, Technical Report UM-CS-1999-065 Logically Central, Physically Distributed Control in a Process

    E-print Network

    Cass, Aaron G.

    -065 Logically Central, Physically Distributed Control in a Process Runtime Environment Aaron G. Cass Barbara of process definition languages. Keywords Process, Workflow, Distribution, Static Analysis, Dynamic Execution An effective process definition language must be powerful, yet clear. It must also have well defined semantics

  1. Um Sistema de Simulao 3D de Evacuao de Emergncia em Plataformas de A 3D Simulation System for Emergency Evacuation in Offshore Platforms

    E-print Network

    Barbosa, Alberto

    arquitetura uma engine de jogos (Unity). A solução desenvolvida foi testada em modelos de plataformas reais; Multidão; Engine de Jogos; Petróleo e Gás; 3D Abstract--An application for evacuation simulation using

  2. Derivation of a Large Isotopic Diffuse Sky Emission Component at 1.25 and 2.2um from the COBE/DIRBE Data

    NASA Astrophysics Data System (ADS)

    Sano, K.; Kawara, K.; Matsuura, S.; Kataza, H.; Arai, T.; Matsuoka, Y.

    2015-10-01

    Using all-sky maps obtained with COBE/DIRBE, we reanalyzed the diffuse sky brightness at 1.25 and 2.2 ? {{m}}, which consists of zodiacal light, diffuse Galactic light (DGL), integrated starlight (ISL), and isotropic emission including the extragalactic background light. Our new analysis including an improved estimate of the DGL and the ISL with the 2MASS data showed that deviations of the isotropic emission from isotropy were less than 10% in the entire sky at high Galactic latitude (| b| \\gt 35^\\circ ). We derived the DGL to 100 ?m brightness ratios of ˜4.79 and ˜1.49 n W m-2 MJy-1 at 1.25 and 2.2 ?m, respectively. The result of our analysis revealed a significantly large isotropic component at 1.25 and 2.2 ? {{m}} with intensities of 60.15 ± 16.14 and 27.68+/- 6.21 {{n}} {{W}} {{{m}}}-2 {{sr}}-1, respectively. This intensity is larger than the integrated galaxy light, upper limits from ?-ray observation, and potential contribution from exotic sources (i.e., Population III stars, intrahalo light, direct collapse black holes, and dark stars). We therefore conclude that the excess light may originate from the local universe: the Milky Way and/or the solar system.

  3. 2011-2012 (Updated: 11/11/14 km) UM-EECS: CS-Eng Page 1 of 10 (2004-) Winter'2012 Computer Science Program -Engineering

    E-print Network

    Cafarella, Michael J.

    and be in good standing (3) Have completed or earned credit by exam or transfer for at least one course in each with the CS-Eng Chief Program Advisor (CPA) to discuss your situation. Getting Advice and Information If you

  4. Fall 2009 Summer 2013 (Updated: 6/24/14 cml) UM-EECS: Electrical Engineering 1 Fall 2009 -Summer 2013 Electrical Engineering Program

    E-print Network

    Cafarella, Michael J.

    and be in good standing (3) Have completed or earned credit by exam or transfer for at least one course in each with the EE Chief Program Advisor (CPA) to discuss your situation. Getting Advice and Information: If you

  5. 2012-2015 (Updated 11/11/14 km) UM-EECS: CS-Eng Page 1 of 8 Computer Science Program-Engineering

    E-print Network

    Cafarella, Michael J.

    by exam or transfer for at least one course in each of these categories a. Calculus (e.g. Math 115, 116 Advisor (CPA) to discuss your situation. Getting Advice and Information If you are a CS-Eng Major

  6. Updated 7/27/15 clf U-M EECS: DS-Eng Page 1 of 4 Data Science Program Engineering

    E-print Network

    Awtar, Shorya

    ) Have completed or earned credit by exam or transfer for at least one course in each of these categories with the DS-Eng Chief Program Advisor (CPA) to discuss your situation. THIS DOCUMENT DESCRIBES THE DATA

  7. Updated 4/9/15 clf U-M EECS: DS-Eng Page 1 of 4 Data Science Program Engineering

    E-print Network

    Cafarella, Michael J.

    ) Have completed or earned credit by exam or transfer for at least one course in each of these categories with the DS-Eng Chief Program Advisor (CPA) to discuss your situation. THIS DOCUMENT DESCRIBES THE DATA

  8. 2012-2016 (Updated 7/27/15 clf) UM-EECS: CS-Eng Page 1 of 8 Computer Science Program-Engineering

    E-print Network

    Awtar, Shorya

    by exam or transfer for at least one course in each of these categories: a. Calculus (e.g. Math 115, 116 Advisor (CPA) to discuss your situation. Getting Advice and Information If you are a CS-Eng Major

  9. 2015 2016 (Updated: 6/2/15 cml) UM-EECS: Electrical Engineering Page 1 of 9 (2013-)2016 Electrical Engineering Program

    E-print Network

    Cafarella, Michael J.

    and be in good standing (3) Have completed or earned credit by exam or transfer for at least one course in each with the EE Chief Program Advisor (CPA) to discuss your situation. Getting Advice and Information: If you

  10. Rtsel um Sauerstoff drfte gelst sein http://derstandard.at/druck/?id=2037748 1 of 2 5/6/2005 9:08 AM

    E-print Network

    Fennel, Katja

    Stickstoffverbindungen, einem Grundnahrungsmittel der Lebewesen, meinen Katja Fennel und Paul Falkowski von der Rutgers diesem Teufelskreis? Fennel und Falkowski meinen, die Ursache liege unter dem Meeresboden. Nach einiger

  11. A Synchrotron-Based Facility for the in-situ Location, Chemical and Mineralogical Characterization of ~10 um Particles Captured in Aerogel

    SciTech Connect

    Flynn, G.; Sutton, S; Lanzirotti, A

    2009-01-01

    NASA's Stardust mission collected dust from the coma of Comet Wild-2 on January 2nd, 2004, by direct capture into aerogel cells that flew through the dust coma at 6 km/s. Stardust collected several hundred comet particles >10 {mu}m in size. These comet samples were delivered to Earth on January 15th, 2006. We developed a facility at the National Synchrotron Light Source at Brookhaven National Laboratory (Upton, NY, USA) for the in-situ characterization of 10 {mu}m particles collected in aerogel. These analytical instruments allow us to perform extensive chemical, mineralogical, and size-frequency characterization of particles captured in aerogel. These analyses are conducted without any invasive extraction, minimizing the possibility of contamination or particle loss during preparation. This facility was used to determine the chemical composition, the oxidation state, the mineralogy and to provide an indication of the grain size of the Wild-2 particles before they were removed from the aerogel. This information provides a catalog of particle types, allowing a more reasoned allocation of the particles to subsequent investigators based on a relatively detailed knowledge of the chemical composition and mineralogy of each particle. These measurements allowed a comparison of the chemical and mineralogical properties of the Wild-2 particles with other types of extraterrestrial materials, including interplanetary dust particles and meteorites. The success of in-situ analysis for Wild 2 particles demonstrates that synchrotron-based facilities will be important for the analysis of particles collected in aerogel on future earth-orbiting satellites and spacecraft.

  12. Heavy-ion broad-beam and microprobe studies of single-event upsets in 0.20 um SiGe heterojunction bipolar transistors and circuits.

    SciTech Connect

    Fritz, Karl; Irwin, Timothy J.; Niu, Guofu; Fodness, Bryan; Carts, Martin A.; Marshall, Paul W.; Reed, Robert A.; Gilbert, Barry; Randall, Barbara; Prairie, Jason; Riggs, Pam; Pickel, James C.; LaBel, Kenneth; Cressler, John D.; Krithivasan, Ramkumar; Dodd, Paul Emerson; Vizkelethy, Gyorgy

    2003-09-01

    Combining broad-beam circuit level single-event upset (SEU) response with heavy ion microprobe charge collection measurements on single silicon-germanium heterojunction bipolar transistors improves understanding of the charge collection mechanisms responsible for SEU response of digital SiGe HBT technology. This new understanding of the SEU mechanisms shows that the right rectangular parallele-piped model for the sensitive volume is not applicable to this technology. A new first-order physical model is proposed and calibrated with moderate success.

  13. [Inhibition of decomposing leaf litter of Cinnamomum camphora on growth of Capsicum annu- um and the alleviation effect of nitrogen application].

    PubMed

    Chen, Hong; Hu, Ting-xing; Wang, Qian; Hu, Hong-ling; Jiang, Xue; Zhou, Guang-liang; Chen, Gang

    2015-02-01

    Effects of decomposing leaf litter of Cinnamomum camphora on growth, physiological and phenological traits of Capsicum annuum, and modification of these effects by nitrogen application were investigated using a pot experiment. C. camphora leaf litter was applied at rate of 0, 25, 50 100 g per pot, resulting into four treatments, i.e., CK (the control), L25, L50, and L100. Nitrogen application was firstly performed on the 39th d of decomposition (3.0 g urea was added to each pot six times). Leaf area, plant height, basal diameter and biomass production of C. annuum were all inhibited sharply by exposure to the leaf litter, and the inhibition effect increased with the increasing leaf litter in terms of both the intensity and the stability. Treated with L25, budding number reduced by 88.7% averagely during 55th-75th d, and the rate of fructification plant decreased by 40% on the 96th d of decomposition, while neither buds nor fruits were observed when exposed to L50 and L100 at that time. Pigment contents and net photosynthetic rate (Pn) were impacted due to leaf litter addition, and malonaldehyde (MDA) was only markedly promoted by L100. Inhibition on growth and development of C. annuum caused by leaf litter decomposition could be alleviated by nitrogen application. Leaf area treated with leaf litter recovered to the control level on the 52nd d after nitrogen application, and similar results appeared on the 83rd d after nitrogen application for other growth traits. Budding and fructification status were also visibly improved. PMID:26094461

  14. 860 nature neuroscience volume 3 no 9 september 2000 um-dependent refilling is reported as well9. One possibility is

    E-print Network

    Makous, Walter

    of the releasable pool. Relevant findings in adrenal chromaffin cells indicate that retrieval of vesicle mem- branes into the plasma membrane. Addi- tional work will address the mechanism of fast synaptic fatigue in shi. The pre- sent finding that shi synapses exhibit rapid synaptic fatigue sup- ports a role for dynamin

  15. Ascher, U.M. & Petzold, L.R., 1998. Computer Methods for Ordinary Differential Equations and DifferentialAlgebraic Equations, SIAM, Philadelphia.

    E-print Network

    Hanyk, Ladislav

    --428. 50 #12; References 51 Gasperini, P. & Sabadini, R., 1990. Finite element modeling of lateral. A Practical Guide to Pseudospectral Methods, Cambridge University Press, New York. Gasperini, P. & Sabadini, R. The viscoelastic relaxation of a realistically stratified earth, and a further analysis of postglacial rebound

  16. Ascher, U.M. & Petzold, L.R., 1998. Computer Methods for Ordinary Differential Equations and Differential-Algebraic Equations, SIAM, Philadelphia.

    E-print Network

    Hanyk, Ladislav

    ­428. 50 #12;References 51 Gasperini, P. & Sabadini, R., 1990. Finite element modeling of lateral viscosity. A Practical Guide to Pseudospectral Methods, Cambridge University Press, New York. Gasperini, P. & Sabadini, R relaxation of a realistically stratified earth, and a further analysis of postglacial rebound, Geophys. J

  17. Historia Oral, Experiencias de Aprendizagem e Enraizamento Sociocultural--Um Projeto em Curso (Oral History, Learning Experiences, and Sociocultural Setting--A Project in Process).

    ERIC Educational Resources Information Center

    Vidigal, Luis

    1995-01-01

    Examines education and childhood in Portugal. Uses oral history methods in an educational context, exploring oral statements pedagogically. Considers these statements especially suitable to maintaining aspects of collective memory and social identity, reinforcing students' national and regional identities. Suggests this is very important in…

  18. Our Day-Care Centers Respect Children: Quality Criteria for Day-Care = Criterios para um Atendimento em Creches que Respeite os Direitos Fundamentais das Criancas.

    ERIC Educational Resources Information Center

    Campos, Maria Malta; Rosemberg, Fulvia

    Prepared as part of an effort to attain minimum quality standards for Brazilian day care centers, this document focuses on day-to-day provision of day care services for children from birth to 6 years old as well as broader day care administrative concerns. The first version of this document was prepared as part of a training project for day care…

  19. 1.06-um optically addressable liquid crystal spatial light modulator for an HV target of the indoor laser radar system

    NASA Astrophysics Data System (ADS)

    Itoh, Hideo; Yamamoto, Yoshinov; Yamamoto, Sachiko; Iwata, Mitsuru; Nishiyama, Eiji; Matsuda, Toyonori; Watanabe, Masanobu

    2000-05-01

    Research and development project of an indoor laser radar communication system has been going on to establish one of wireless communication network environments. In the project, corner-reflecting laser communicating target `the Hyper Versatile (HV) target', is used for a free-space laser data communication with low power consumption and for accurate position detection of the target. Reflective-type Liquid Crystal Spatial Light Modulator (LC SLM) is a possible attractive component of the HV target to solve the above subjects. The indoor laser radar system should operate at eye-safe wavelength region, however, no infrared operating SLM has been released because conventional SLMs have been designed and manufactured only for visible light operations. In this paper, infrared (1.06 micrometers ) operating Parallel Aligned nematic Liquid-crystal Spatial Light Modulator (PAL- SLM) is described for an application for the indoor laser radar system. Characteristics of the SLM and numerical simulations for corner-reflecting operations are indicated.

  20. Johannes Kepler Universitt Linz, Altenberger Strae 69, 4040 Linz, sterreich, www.jku.at, DVR 0093696 JKU Pond-Race: Das verrckte Rennen um den Uni-Teich

    E-print Network

    Hochreiter, Sepp

    Johannes Kepler Universität Linz, Altenberger Straße 69, 4040 Linz, Österreich, www.jku.at, DVR-Race ging am 11. Juni 2014 eine Benefizveranstaltung der besonderen Art an der Johannes Kepler Universität

  1. "O Ensaio como Forma" ou Um Ensaio acerca da Teoria Critica da Sociedade ("The Essay as Form" or An Essay about the Critical Theory of Society).

    ERIC Educational Resources Information Center

    Giordano, Rosely

    2000-01-01

    Illuminates the critical theory project, with themes permeating the theoretical constructions of Frankfurt (Germany). Debates the predominance of positivism in the production of knowledge. Speculates that "the essay as form" constitutes itself as a representation of the concept of the Enlightenment. Concludes with a dialogue between Theodor Adorno…

  2. I Workshop de Tec. da Inf. Apl. ao Meio Ambiente -CBComp 2003 Sis. de Apoio Tomada de Deciso DESIGN DE UM SISTEMA DE SUPORTE DECISO BASEADO

    E-print Network

    Cengarle, María Victoria

    I Workshop de Tec. da Inf. Apl. ao Meio Ambiente - CBComp 2003 Sis. de Apoio à Tomada de Decisão Workshop de Tec. da Inf. Apl. ao Meio Ambiente - CBComp 2003 Sis. de Apoio à Tomada de Decisão 1895 de conhecimento com base em modelos fornecem meios para tornar disponível o conhecimento de

  3. IV JORNADA DE EDUCAO EM SENSORIAMENTO REMOTO NO MBITO DO MERCOSUL "Um novo desafio na Educao: Preparar o cidado do Sculo 21"

    E-print Network

    Educação: Preparar o cidadão do Século 21" 11 A 13 DE AGOSTO DE 2004 Pré-Cursos 9 e 10 de agosto de 2004 Acesso Gratuito via Internet - Potencialidade dos Dados CBERS Luís Geraldo Ferreira Hermann Teixeira, Norberto Dani, Nelson Amoreti Lisboa 15:35-15:55 25 O ENSINO DO SENSORIAMENTO NO CURSO DE GRADUAÇÃO EM

  4. Long-range micro-pulse aerosol lidar at 1.5 um with an up-conversion single-photon detector

    E-print Network

    Haiyun Xia; Guoliang Shentu; Mingjia Shangguan; Xiuxiu Xia; Xiaodong Jia; Chong Wang; Jun Zhang; Qiang Zhang; Xiankang Dou; Jianwei Pan

    2014-12-09

    A micro-pulse lidar at eye-safe wavelength is constructed based on an up-conversion single-photon detector. The ultralow noise detector enables using integration technique to improve the signal-to-noise ratio of the atmospheric backscattering even at daytime. With the pulse energy of 110uJ, the pulse repetition rate of 15 kHz, the optical antenna diameter of 100 mm and integration time of 5 minutes, a horizontal detection range of 7 km is realized. In the demonstration experiment, atmospheric visibility over 24 hours is monitored continuously, with results in accordance with the weather forecasts.

  5. Dental hard tissue modification and removal using sealed transverse excited atmospheric-pressure lasers operating at lambda=9.6 and 10.6 um

    NASA Astrophysics Data System (ADS)

    Fried, Daniel; Ragadio, Jerome N.; Akrivou, Maria; Featherstone, John D.; Murray, Michael W.; Dickenson, Kevin M.

    2001-04-01

    Pulsed CO2 lasers have been shown to be effective for both removal and modification of dental hard tissue for the treatment of dental caries. In this study, sealed transverse excited atmospheric pressure (TEA) laser systems optimally tuned to the highly absorbed 9.6 micrometers wavelength were investigated for application on dental hard tissue. Conventional TEA lasers produce an initial high energy spike at the beginning of the laser pulse of submicrosecond duration followed by a long tail of about 1 - 4 microsecond(s) . The pulse duration is well matched to the 1 - 2 microsecond(s) thermal relaxation time of the deposited laser energy at 9.6 micrometers and effectively heats the enamel to the temperatures required for surface modification at absorbed fluences of less than 0.5 J/cm2. Thus, the heat deposition in the tooth and the corresponding risk of pulpal necrosis from excessive heat accumulation is minimized. At higher fluences, the high peak power of the laser pulse rapidly initiates a plasma that markedly reduces the ablation rate and efficiency, severely limiting applicability for hard tissue ablation. By lengthening the laser pulse to reduce the energy distributed in the initial high energy spike, the plasma threshold can be raised sufficiently to increase the ablation rate by an order of magnitude. This results in a practical and efficient CO2 laser system for caries ablation and surface modification.

  6. Sunspots and the Newcomb-Benford Law. (Spanish Title: Manchas Solares y la Ley de Newcomb-Benford.) Manchas Solares e a Lei de Newcomb-Benford

    NASA Astrophysics Data System (ADS)

    Alves, Mauro A.; Lyra, Cássia S.

    2008-12-01

    The Newcomb-Benford's Law (LNB) of first digits is introduced to high school students in an extracurricular activity through the study of sunspots. The LNB establishes that the first digits of various sets of data describing natural occurrences are not distributed uniformly, but according to a logarithmic distribution of probability. The LNB is counter-intuitive and is a good example of how mathematics applied to the study of natural phenomena can provide surprising and unexpected results serving also as a motivating agent in the study of physical sciences. En este trabajo se describe una actividad extracurricular donde se presenta a los estudiantes la ley de los primeros dígitos de Newcomb-Benford (LNB) con el estudio de manchas solares. La LNB establece que los primeros dígitos de algunos tipos de dados de ocurrencia natural no están distribuidos en manera uniforme, pero sí de acuerdo con una distribución logarítmica de probabilidad. La LNB es contra-intuitiva y es un excelente ejemplo de como las matemáticas aplicadas al estudio de fenómenos naturales pueden sorprender al estudiante, sirviendo también como elemento motivador en la educación de ciencias y de matemáticas. Este trabalho descreve uma atividade extracurricular na qual a lei dos primeiros dígitos de Newcomb-Benford (LNB) é introduzida a estudantes através do estudo de manchas solares. A LNB estabelece que os primeiros dígitos de vários tipos de conjunto de dados de ocorrência natural não são distribuídos de maneira uniforme, mas sim de acordo com uma distribuição logarítmica de probabilidade. A LNB é contra-intuitiva e é um ótimo exemplo de como a matemática aplicada ao estudo de fenômenos naturais pode fornecer resultados surpreendentes e inesperados, servindo também como um agente motivador no ensino de ciências e matemática.

  7. Lauric Acid/Wood Fiber Blends for Shape Stable Phase Change Material

    E-print Network

    Collins, Gary S.

    in preparing wood fiber (WF) composites. The goal in developing this material is to produce a shape stabilized.) ·Thermal mechanical pulp of softwood fiber (Plum Creek) Wood Fiber Particle Size 23% 51% 4% 4% 3% 3% 12% 833 um 833 um 425 um 250 um 180 um 150 um 125 um Method ·Wood fiber (WF) was oven dried with a 2

  8. Qual o Papel da Escola e da Mídia na Obtenção dos Conhecimentos Astronômicos?

    NASA Astrophysics Data System (ADS)

    da Cunha, W. S.; Voelzke, M. R.; Amaral, L. H.

    2007-08-01

    É amplamente reconhecido que as pessoas em geral têm grande fascínio e interesse pela Astronomia. Por outro lado, o conteúdo dessa área incluído no ensino formal está longe de ser abrangente e suficiente para suprir a demanda. Esse interesse permite aperfeiçoar a divulgação e o ensino não formal de Astronomia através da mídia aliando a adequação do conteúdo à expectativa das pessoas. A reforma do Currículo Básico da Escola Pública da maioria dos Estados brasileiros tem introduzido Astronomia desde a pré-escola até o Ensino Médio. Num estudo realizado com 1180 alunos do Ensino Médio de seis escolas estaduais, revelou-se através da aplicação de um formulário contendo questões que abordavam conhecimentos básicos em Astronomia, como foram adquiridos tais conhecimentos e à infra-estrutura da escola. Para 66,1% dos entrevistados o professor já fez alguma apresentação a respeito de Astronomia. O presente estudo revelou também que 54,4% dos alunos entrevistados adquiriram seus conhecimentos astronômicos na escola, 18,4% através da televisão e 27,1% afirmaram que seus conhecimentos foram obtidos através de outros tipos de mídia (internet, livros didáticos, filmes e revistas). Embora o estudo revele claramente que há certo equilíbrio no meio em que os alunos obtiveram seus conhecimentos astronômicos, a mídia busca não somente sua difusão, mas a disponibilização desse conhecimento de maneira correta, que às vezes, não é atingido, apresentando conceitos sem fundamentação e incorretos. Por outro lado, no dia-a-dia escolar, é comum encontrar professores que vêm para as aulas com concepções prévias, que podem diferir substancialmente das idéias a serem ensinadas, dificultando o aprendizado de futuros conceitos científicos. Uma avaliação criteriosa, avaliando as dificuldades dos professores em determinar o sentido correto dos conceitos e observando a metodologia que utilizam no ensino, poderá proporcionar uma melhor compreensão sobre as concepções alternativas, presentes no ensino de Astronomia.

  9. Earth and Heavens: Two Separate Universes? (Spanish Title: Tierra y Cielos: ¿Dos Universos Separados?) Terra e Céus: Dois Universos Separados?

    NASA Astrophysics Data System (ADS)

    Carrascosa, Jaime; Gil-Pérez, Daniel; Solbes, Jordi; Vilches, Amparo

    2005-12-01

    The study of gravitation constitutes an exceptional occasion to show the richness and complexity of science and technology, contemplating, among other things: the problematic situations which are at the heart of the scientific knowledge, the difficulties encountered in the construction of knowledge and, especially, the necessity of overcoming "common-sense evidence" that proclaimed the existence of an insurmountable barrier between Earth and Heavens, hindering scientific development during many centuries. In this paper we present a program of activities to orient the study of Gravitation atUpperHigh School, favoring students' participation in the reconstruction of this first scientific revolution and giving them the opportunity to see the importance of Astronomy both in the history of science and today. El estudio de la gravitación constituye una ocasión excepcional para mostrar la ciencia y la tecnología en toda su riqueza y complejidad, considerando, entre otros aspectos:

  10. Las situaciones problemáticas relevantes que llevaron a la construcción de los conocimientos,
  11. las dificultades de todo tipo con las que hubo que enfrentarse y, muy en particular,
  12. la necesidad de superar las "evidencias de sentido común" que establecían una supuesta barrera infranqueable entre la Tierray los Cielos y que obstaculizaron durante siglos el desarrollo científico.
  13. En este trabajo presentamos un programa de actividades para el estudio de la gravitación en la secundaria superior, orientado a favorecer la participación de los estudiantes, en alguna medida, en la reconstrucción de este proceso que constituyó la denominada primera gran revolución científica y asomándonos al estudio de una de las ciencias más antiguas, la Astronomía, que hoy sigue despertando gran interés. O estudo da gravitação constitui uma ocasião excepcional para mostrar a ciência e a tecnologia em toda sua riqueza e complexidade, considerando, entre outros aspectos: as situações problemáticas relevantes que levaram à construção dos conhecimentos, as dificuldades de todo tipo que se teve que enfrentar nessa construção e, muito em particular,a necessidade de se superar as "evidências do senso comum" que estabeleciam uma suposta barreira intransponível entre a Terra e os Céus e que foram um obstáculo durante séculos para o desenvolvimento científico. Neste trabalho apresentamos um programa de atividades para o estudo da gravitação nos últimos anos do ensino médio, orientado a favorecer a participação dos estudantes, em alguma medida, na reconstrução deste processo que constituiu a denominada primeira grande revolução científica e a nos aproximarmos do estudo de uma das ciências mais antigas, a Astronomia, que hoje continua despertando grande interesse.

  14. Estudo da utilizacao da biomassa florestal como fonte de produtos quimicos e energia atraves de processos quimicos e biotechnologicos (Utilization of forest biomass for chemicals and energy by chemical and biotechnological processes). Master's thesis

    SciTech Connect

    de Miranda, I.M.S.S.

    1989-04-01

    The chemical composition and the non-structural carbohydrate composition were determined for 1-year-old Eucalyptus globulus Labill trees, grown in an experimental plantation with different nutrient and water supplies (C-trees, where no treatment was made and IL-trees, which received a nutrient supply and irrigation). Leaf carbohydrates were determined for the same conditions. Pulping experiments were made using kraft cooks of eucalyptus wood. The results of the pretreatments are complemented with scanning electron microscopy observations. Average wood composition was: ash 1.6%, total extractives 5.2%, Klason lignin 21.0%, soluble lignin 3.1% (% of o.d. weight). The results did not show statistical significant differences between the two growth conditions. The average wood carbohydrate composition was: glucose 2.7%, frutose 4.1% sucrose 1.3% and starch 0.5%. The average carbohydrate composition of leaves was: glucose 1.0%, frutose 1.7%, sucrose 0.1% and starch 4.1%. The average yield for the kraft wood delinification was 49%. The saccharification of pretreated eucalyptus chips with a steam-explosion pretreatment was: For H2SO4 impregnation 26.6% and for H2O impregnation 44.2%.

  15. O mtodo WKB exposto no ltimo captulo no pode ser aplicado diretamente a sistemas genricos com mais de um grau de liberdade. A razo para isso ficar mais clara no captulo 6, onde trataremos de

    E-print Network

    de Aguiar, Marcus A. M.

    ¢¡ £¢¤¦¥§¡©¨ ¢¢ ¢¡ ©¨©§¢¢¢ ¢©¨ O método WKB exposto no último capítulo não pode ser aplicado) quanto sobre as funções de onda (os resíduos). Como discutimos no capítulo 1, G± pode ser obtida da intervalo de tempo finito pode ser expresso em termos de propagadores infinitesimais. O intervalo t é

  16. Spectral reflectance properties (0.4-2.5 um) of secondary Fe-oxide, Fe-hydroxide, and Fe-sulfate-hydrate minerals associated with sulfide-bearing mine waste

    USGS Publications Warehouse

    Crowley, J.K.; Williams, D.E.; Hammarstrom1, J.M.; Piatak, N.; Mars, J.C.; Chou, I-Ming

    2006-01-01

    Fifteen Fe-oxide, Fe-hydroxide, and Fe-sulphate-hydrate mineral species commonly associated with sulphide bearing mine wastes were characterized by using X-ray powder diffraction and scanning electron microscope methods. Diffuse reflectance spectra of the samples show diagnostic absorption features related to electronic processes involving ferric and/or ferrous iron, and to vibrational processes involving water and hydroxyl ions. Such spectral features enable field and remote sensing based studies of the mineral distributions. Because secondary minerals are sensitive indicators of pH, Eh, relative humidity, and other environmental conditions, spectral mapping of these minerals promises to have important applications to mine waste remediation studies. This report releases digital (ascii) spectra (spectral_data_files.zip) of the fifteen mineral samples to facilitate usage of the data with spectral libraries and spectral analysis software. The spectral data are provided in a two-column format listing wavelength (in micrometers) and reflectance, respectively.

  17. The controversy between Alexander Friedmann and Albert Einstein about the possibility of a non-static world (German Title: Die Kontroverse zwischen Alexander Friedmann und Albert Einstein um die Möglichkeit einer nichtstatischen Welt)

    NASA Astrophysics Data System (ADS)

    Singer, Georg

    Einstein's treatment of the cosmological problem as well as his unshakeable adherence to his own static solution of the complete field equations was throughout determined by Ernst Mach's idea of relativity of inertia. Friedmann, however, like Eddington, Weyl and others did not consider Mach's principle to be a part of general relativity, and so he regarded a time dependent developing spatial geometry as being consistent with world matter at relative rest. In his final statement to the controversy, Einstein acknowledged just formal correctness of Friedmann's results. Actually his criticism was not due ``to a miscalculation'', as he was ready to admit, but was owed to a fundamental fixed idea which continued to exist and which was the cause of his disavowal of physical significance of dynamical solutions.

  18. The UM students from Montana listed below made the spring semester 2015 Dean's List. Double asterisks after a name indicate the student earned a GPA of 4.0. A single asterisk

    E-print Network

    Vonessen, Nikolaus

    Nygaard,* Shareena O'Dell* ANACONDA: Ashley Flachmeyer,* Kiernan Gallagher,* Carly Johns,* Lisa Laslovich,* Kaitlin Wagner,* Katy Warner,* McKenzie Watterson,* Chrislin Webb,**Phoebe Webb,** Carter Webber,* Ryan

  19. Michael Mästlin's role in the polemic against the calendar reform of pope Gregor XIII. (German Title: Die Rolle Michael Mästlins in der Polemik um die Kalenderreform von Papst Gregor XIII)

    NASA Astrophysics Data System (ADS)

    Hamel, Jürgen

    Because of theological resistance, the calendar reform of 1582 was introduced only in countries under catholic rule. Michael Mästlin is found among the spokesmen of opposition against this feared attempted of the pope to gain influence in the protestant church, nevertheless, Mästlin had no doubt that a calendar reform was necessary. This article retraces Mästlin's argumentation and puts it into context with contemporary discussions about a calendar reform.

  20. Compilação de dados atômicos e moleculares do UV ao IV próximo para uso em síntese espectral

    NASA Astrophysics Data System (ADS)

    Coelho, P.; Barbuy, B.; Melendez, J.; Allen, D. M.; Castilho, B.

    2003-08-01

    Espectros sintéticos são utéis em uma grande variedade de aplicações, desde análise de abundâncias em espectros estelares de alta resolução ao estudo de populações estelares em espectros integrados. A confiabilidade de um espectro sintético depende do modelo de atmosfera adotado, do código de formação de linhas e da qualidade dos dados atômicos e moleculares que são determinantes no cálculo das opacidades da fotosfera. O nosso grupo no departamento de Astronomia no IAG tem utilizado espectros sintéticos há mais de 15 anos, em aplicações voltadas principalmente para a análise de abundâncias de estrelas G, K e M e populações estelares velhas. Ao longo desse tempo, as listas de linhas vieram sendo construídas e atualizadas continuamente, e alguns acréscimos recentes podem ser citados: Castilho (1999, átomos e moléculas no UV), Schiavon (1998, bandas moleculares de TiO) e Melendez (2001, átomos e moléculas no IV próximo). Com o intuito de calcular uma grade de espectros do UV ao IV próximo para uso no estudo de populações estelares velhas, se fazia necessário compilar e homogeneizar as diversas listas em apenas uma lista atômica e uma molecular. Nesse processo, a nova lista compilada foi correlacionada com outras bases de dados (NIST, Kurucz Database, O' Brian et al. 1991) para atualização dos parâmetros que caracterizam a transição atômica (comprimento de onda, log gf e potencial de excitação). Adicionalmente as constantes de interação C6 foram calculadas segundo a teoria de Anstee & O'Mara (1995) e artigos posteriores. As bandas moleculares de CH e CN foram recalculadas com o programa LIFBASE (Luque & Crosley 1999). Nesse poster estão detalhados os procedimentos citados acima, as comparações entre espectros calculados com as novas listas e espectros observados em alta resolução do Sol e de Arcturus, e uma análise do impacto decorrente da utilização de diferentes modelos de atmosfera no espectro sintético. Ao final, temos uma lista de linhas atômicas com mais de 24.000 linhas e uma lista molecular com as moléculas CN, CH, OH, NH, MgH, C2, TiO Gama, CO, FeH, adequadas ao estudo de estrelas G, K e M e populações estelares velhas.

  21. Apparent Motion of the Sun, Shadows of Objects and Measurement of Time in the View of Seventh Grade Students of Middle School. (Breton Title: Movimento Aparente do Sol, Sombras dos Objetos e Medição do Tempo na Visão de Alunos do Sétimo Ano do Ensino Fundamental.) Movimiento Aparente del Sol, Sombras de los Objetos y Medición del Tiempo en la Visión de Estudiantes del Séptimo Grado del Ciclo Pirmario

    NASA Astrophysics Data System (ADS)

    Iria Machado, Daniel

    2013-07-01

    The apparent motion of the Sun on the celestial sphere and the behavior of the shadows of objects over time are observable phenomena in everyday life. However, students often do not have a proper understanding of such occurrences, and can even display misconceptions about them. Therefore, we performed a research in order to know students' notions about these subjects and to evaluate the contribution to their understanding brought about by an activity performed with an interactive sundial in an informal learning environment. We investigated the ideas of 43 students from the seventh grade of middle school by applying a test with open questions before and after an activity with an analemmatic sundial, conducted by a monitor. A significant proportion of students were initially unaware of most of the phenomena treated. The intervention performed helped the students to assimilate new concepts, providing the contact with new phenomena and to a lesser degree, the development of explanations about them, indicating an educational potential of this action. However, the contribution to the understanding of some of the ideas explored was small, pointing to the need to make additional observations, studies and discussions. O movimento aparente do Sol na esfera celeste e o comportamento das sombras dos objetos com o passar do tempo são fenômenos observáveis no dia a dia. No entanto, muitas vezes os estudantes não possuem uma compreensão adequada de tais ocorrências, podendo inclusive exibir concepções alternativas a seu respeito. Por isso, efetuou-se uma pesquisa com o intuito de conhecer as noções dos alunos sobre esses temas e avaliar a contribuição para seu entendimento propiciada por uma atividade feita com um relógio de Sol interativo, em um ambiente de ensino informal. Foram investigadas as ideias de 43 alunos do sétimo ano do Ensino Fundamental mediante a aplicação de um teste com questões abertas antes e depois de uma atividade com um relógio de Sol analemático, conduzida por um monitor. Uma proporção significativa de estudantes desconhecia inicialmente a maioria dos fenômenos tratados. A intervenção realizada colaborou para uma parte dos alunos assimilar novos conceitos, propiciando o contato com novos fenômenos e, em menor grau, a elaboração de explicações a respeito destes, indicando um potencial educativo dessa ação. Porém, a contribuição para o entendimento de algumas das ideias exploradas foi pequena, apontando para a necessidade de se fazer observações, estudos e discussões complementares. El movimiento aparente del Sol en la esfera celeste y el comportamiento de las sombras de los objetos a lo largo del tiempo son fenómenos observables en la vida cotidiana. Sin embargo, los estudiantes a menudo no tienen una adecuada comprensión de dichos problemas, e incluso pueden mostrar conceptos erróneos acerca de ellos. Por lo tanto, se realizó una investigación a fin de conocer las nociones de los estudiantes acerca de estas cuestiones y evaluar la contribución a su comprensión proporcionada por una actividad realizada con un reloj de Sol interactivo, en un entorno informal de aprendizaje. Se investigaron las ideas de 43 estudiantes del séptimo grado del ciclo primario mediante la aplicación de un test con preguntas abiertas antes y después de una actividad con un reloj de Sol analemático, dirigida por un monitor. Una proporción significativa de los estudiantes inicialmente desconocía la mayoría de los fenómenos tratados. La intervención realizada contribuyó para que los estudiantes asimilasen nuevos conceptos, proporcionando el contacto con nuevos fenómenos y, en menor medida, desarrollasen explicaciones acerca de estos, lo que indica un potencial educativo de esta acción. Sin embargo, la contribución a la comprensión de algunas de las ideas exploradas fue pequeña, lo que apunta a la necesidad de hacer observaciones, estudios y debates adicionales.

  22. Aquisição de Estreptococos Mutans e Desenvolvimento de Cárie Dental em Primogênitos

    PubMed Central

    NOCE, Erica; RUBIRA, Cassia Maria Fischer; da Silva ROSA, Odila Pereira; da SILVA, Salete Moura Bonifácio; BRETZ, Walter Antonio

    2011-01-01

    Objetivo Avaliar o momento de aquisição de estreptococos mutans (EM), desenvolvimento de cárie dental e as variáveis a eles associadas no decorrer de 23 meses, em primogênitos de famílias de baixo nível socioeconômico, desde os sete meses de idade. Método A amostra foi selecionada com base em mães densamente colonizadas por EM, incluindo todos os membros de 14 famílias que conviviam na mesma casa. Foram envolvidos no estudo 14 mães, pais e primogênitos e 8 parentes, na maioria avós. Exames clínicos e radiográficos iniciais determinaram os índices de cárie e condição periodontal dos adultos. Contagens de EM foram feitas em todos os adultos nas duas primeiras visitas. Nas crianças foram avaliados os níveis de EM, o número de dentes e de cáries, em quatro visitas. Resultados A prevalência de EM nos adultos foi alta, estando ausente em apenas um dos pais. EM foram detectados em 1, 2, 3 e 10 crianças, respectivamente nas visitas #1, 2, 3 e 4. A cárie dental foi detectada em apenas três crianças na última visita (aos 30 meses de idade), as quais apresentaram escores de EM significantemente maiores que as crianças sem cárie, na mesma visita. Conclusão Exclusivamente a condição social de baixa renda e mães densamente colonizadas por EM não são sinônimo de colonização precoce e alta atividade de cárie em crianças cuidadas em casa. O desenvolvimento de cárie está significantemente associado a escores elevados de EM nas crianças. PMID:22022218

  23. Observações no âmbito dos "additional programs" do satélite COROT

    NASA Astrophysics Data System (ADS)

    Janot Pacheco, E.

    2003-08-01

    O satélite Fraco-europeu COROT fará fotometria de altissima precisão (pretende-se atingir uma parte em um milhão), grande campo (3x3 graus) e por longos períodos, de duas regiões pré-determinadas do céu, com 10 graus de raio. Suas finalidades básicas serão estudos em sismologia estelar e a procura de exoplanetas. A comunidade astronômica brasileira participará dessa missão espacial, com direitos iguais aos dos parceiros europeus. Isso se deve a que o satélite utilizará a estação de recepção de dados de Natal (INPE), 5 a 6 brasileiros participarão das equipes de software e cientistas do país atuarão na fase de pré-lançamento. Apresentamos nesta comunicação sugestões para a preparação de propostas de observações com COROT, no âmbito dos Programas Adicionais, que contemplam outros projetos que não de sismologia ou exoplanetas. As últimas definições técnicas e decisões tomadas na 4th Corot Week de junho último serão igualmente apresentadas, em particular quanto às regiões de observação escolhidas e quanto aos procedimentos a seguir para se propor observações.

  24. Difficulties of First Years Elementary School Teachers with the Teaching of Astronomy. (Breton Title: Dificuldades de Professores dos Anos Iniciais do Ensino Fundamental em Relação ao Ensino da Astronomia. ) Dificultades de LOS Profesores de los Primeros Años de la Escuela Primaria en Relación a la Enseñanza de la Astronomía

    NASA Astrophysics Data System (ADS)

    Langhi, Rodolfo; Nardi, Roberto

    2005-12-01

    This paper reports Primary School teachers' discourses analysis about their difficulties related to the teaching of Astronomy. It reports partial data of a master's level research carried out in the last two years, named "An exploratory study for inserting Astronomy in primary school teachers' education" (LANGHI, 2004). The study took into consideration students' and teachers' common sense conceptions about astronomical phenomena, conceptual mistakes in textbooks, and Astronomy's suggestions given by the PCN (Parâmetros Curriculares Nacionais - The Brazilian National Curriculum Standards). The paper aims to characterize teachers' difficulties, in order to provide subsides to the implementation of an initial or continuing education program. This study is justified by the fact that courses plans like these only will be adapted to the teacher's (and students') reality, if there is a primary investigation about what the teachers really need to know about Astronomy. This fact was possible here by the enunciations interpretation of a teachers' sample using semi-structured interviews, according to discourse analysis procedures. The research outcomes show difficulties related to factors like: those of personal order, methodological, on teacher's formation, educational infrastructure and other related to information sources for educators. Este artigo, que relata as dificuldades de professores em relação ao ensino da Astronomia, faz parte de um estudo exploratório para a inserção da Astronomia na formação de professores dos anos iniciais do Ensino Fundamental. Esse estudo leva em consideração as concepções alternativas de alunos e professores sobre fenômenos astronômicos, os erros conceituais em livros didáticos e as sugestões de conteúdos de Astronomia constantes nos PCN (Parâmetros Curriculares Nacionais). Caracterizar as dificuldades dos professores é a questão central deste texto, apontando para o objetivo de contribuir com subsídios para um futuro programa de formação continuada neste tema. O estudo se justifica mediante o fato de que planejamentos de cursos como estes só se adequarão à realidade do professor (e do aluno) se houver uma investigação antecipada sobre o que os docentes precisam saber e saber fazer a respeito da Astronomia, o que se concretizou em nosso caso pela interpretação dos discursos de uma amostra de professores coletados através de entrevistas semi-estruturadas, utilizando para interpretação os princípios e métodos da análise do discurso em sua linha francesa. Os resultados da pesquisa indicaram dificuldades de ordem pessoal, metodológica, de formação, de infra-estrutura e outras relacionadas às fontes de informações para docentes. Este artículo que relata las dificultades de los profesores en relación a la enseñanza da laAstronomía es parte de un estudio preliminar para la implantación dela Astrnomía enla formación de profesores de ls primeros años del ciclo primario.El estudio considera las concepciones alternativas de alumnos y profesores respecto a los fenómenos astronómicos, los errores conceptuales en los libros didácticos y las sugerencias de contenidos de Astronomía que constan en los Parámetros Curriculares Nacionales del Brasil. Caracterizar las dificultades de los profesores constituye la cuestión central de este texto, apuntando para el objetivo de contribuir para un futuro programa de educación contínua en este tema. El estudio se justifica mediante el hecho que la planificación de cursos de este tipo solo se adecuarán a la realidade del profesor (y del alumno) si existe una investigación anterior a respecto de lo que los docentes precisan saber y saber realizar en Astronomía, lo cual se concretó en nuestro caso por medio de la interpretación de los discursos de una muestra de profesores obtenidos através de entrevistas semiestructuradas, utilizand para esta interpretación los principios y métodos de análisis del discurso en su línea francesa. Los resultados mostraron dificultades de orden personal, metodológica,

  1. Severe maternal morbidity: a case-control study in Maranhao, Brazil

    PubMed Central

    2013-01-01

    Background Maternal mortality and morbidity are among the top public health priorities in Brazil, being quite high, especially among the most disadvantage women. A case control study was developed to identify risk factors for severe maternal morbidity in Sao Luis, one of the poorest Brazilian State Capitals. Methods The case–control study was carried out between 01/03/2009 and 28/02/2010 in two public high-risk maternities facilities and in two intensive care units (ICUs) for referral of obstetric cases. All cases hospitalized due to complications during gestation period, childbirth or up to 42 days of puerperium and who fulfilled any of Mantel's and/or Waterstone's criteria were identified. Two controls per case were randomly selected among patients of the same clinics discharged for other reasons. Data were obtained through a structured interview as well as from medical charts and prenatal cards and included sociodemographic variables, clinical and obstetric histories, behavioral factors and exposure to stress factors during pregnancy, pre-natal assistance and obstetric complication and childbirth care. Results In the final model of the unconditional logistic regression analysis, being older than 35 years (OR=3.11; 95% CI:1.53-6.31), previous hypertension (OR=2.52; 95% CI:1.09-5.80), history of abortion (OR=1.61; 95% CI:0.97-2.68), 4–5 pre-natal consultations (OR=1.78; 95% CI:1.05-3.01) and 1–3 pre-natal consultations (OR=1.89; 95% CI:1.03-3.49) were independently associated with severe maternal morbidity. Conclusions The results corroborate the importance of reproductive healthcare, of identifying a high-risk pregnancy and of a qualified and complete prenatal care to prevent severe morbid events. Resumo Introdução A mortalidade e morbidade maternas estão entre os tópicos prioritários da Saúde Pública brasileira, especialmente na população de menor nível socioeconômico. Um estudo caso-controle foi desenvolvido para identificar os fatores de risco para morbidade materna grave em São Luís, capital de um dos estados mais pobres do Brasil. Método Estudo caso-controle realizado em duas maternidades públicas de alto risco e duas UTIs de referência aos casos obstétricos entre 01/03/2009 e 28/02/2010. Foram incluídas todas as pacientes internadas por complicação do período grávido-puerperal e que preenchiam os critérios de Waterstone e/ou Mantel para morbidade materna grave. Foram selecionados para cada caso, dois controles por sorteio aleatório dentre as pacientes internadas no mesmo período e mesma maternidade que o caso. As informações de domínio sociodemográfico, clínico, obstétrico, comportamental, exposição a eventos estressores na gestação, assistência ao pré-natal, intercorrências obstétricas e atenção ao parto, foram obtidas por meio de entrevista estruturada. As variáveis foram analisadas por modelo de regressão logística múltipla não condicional, baseado em modelo hierarquizado a priori. Resultados Foram identificados como fatores de risco para morbidade materna grave: idade >35 anos (OR=3,11; IC 95%:1,53-6,31), hipertensão prévia à gestação (OR=2,52; IC 95%:1,09-5,80), antecedente de aborto (OR=1,61; IC 95%:0,97-2,68), ter realizado 4–5 consultas pré-natais (OR=1,78; IC 95%:1,05-3,01) ou 1–3 consultas (OR=1,89; IC 95%:1,03-3,49). Conclusão Os resultados do estudo corroboram a importância da assistência à saúde reprodutiva e o pré-natal completo e qualificado na prevenção de eventos mórbidos graves durante o ciclo grávido-puerperal. PMID:23399443

  2. ASIGNATURA DE Gestin de ecosistemas acuticos

    E-print Network

    Murcia, Universidad de

    profesional: Profesora Titular de Universidad E-mail: jvelasco@um.es Páginas Web: http://www.um.es/ecoaqua El, Dep. Ecología, ala izquierda 2º cuatrimestre L, Ma y Mi 10 11 868887009, Fac. Biología, 4ª planta, Dep@um.es Páginas Web: http://www.um.es/ecoaqua El profesor está adscrito a las tutorías electrónicas. Horario de

  3. Teaching astronomy mediated by information and communication technologies: a preliminary approach

    NASA Astrophysics Data System (ADS)

    Rosa, R. H. L.; Voelzke, M. R.

    2014-08-01

    O presente trabalho é parte preliminar de um estudo mais amplo em nível de doutorado sobre o ensino de astronomia mediado pelas tecnologias da informação e comunicação, utilizando dispositivos compactos, móveis e pessoais. Este estudo também faz parte do projeto institucional do CEFETMG sobre ambientes diversificados de aprendizagem sob fomento da agência estadual FAPEMIG (Fundação de Amparo à Pesquisa do Estado de Minas Gerais). Esta apresentação aborda o resultado das concepções prévias de estudantes em relação a conhecimentos básicos de astronomia, ligados à percepção e observação direta do céu. Três turmas de estudantes de 1ª série e uma turma de 3ª série do ensino integrado médio técnico da Educação Básica, Técnica e Tecnológica (EBTT) do CEFETMG Campus II - Belo Horizonte/MG foram submetidas a uma avaliação prévia através de questionário estruturado. Este questionário foi elaborado de forma a abordar a percepção dos estudantes em relação aos recursos gráficos (figuras e desenhos) representativos de conhecimentos básicos de astronomia, comuns em livros didáticos. Após a análise dos resultados desta avaliação, organizou-se uma estratégia de intervenção didática em sala de aula sobre o conteúdo de astronomia, utilizando-se de recursos de mediação baseados nas tecnologias da informação e comunicação. Os temas selecionados para esta estratégia didática foram relacionados aos assuntos básicos de astronomia em que ocorreu maior nível de desconhecimento dos estudantes. Os estudantes foram submetidos a avaliação posterior elaborada com os mesmos pressupostos da avaliação prévia. A análise dos resultados foi realizada a partir dos pressupostos da aprendizagem significativa (Ausubel; Novak e Hanesian, 1983). O ensino de astronomia por mediação das tecnologias da informação e comunicação indica uma alternativa preliminar aos trabalhos de campo usuais orientados na prática escolar, tais como, visita a planetários e a observatórios. Os estudantes ficaram muito sensibilizados pela possibilidade de percepção do céu em tempo real e à luz do dia dentro da sala de aula no contexto escolar. Os resultados deste levantamento preliminar indicam que os níveis de ensino fundamental e médio não foram capazes de internalizar conhecimentos básicos de astronomia, a despeito das orientações específicas contidas nos documentos oficiais da educação básica brasileira (Brasil, 1997 e 2000). Os estudantes pesquisados apresentaram conhecimentos e concepções rudimentares sobre o tema astronomia básica, indicando a ausência de abordagem do tema astronomia, tampouco de observação direta do céu em trabalhos de campo escolares na educação básica. Finalmente, esta abordagem didática suscitou nos estudantes grande interesse para futuros trabalhos de observação de campo. D.P. Ausubel; J.D. Novak; H. Hanesian. Psicología Educativa: un punto de vista cognoscitivo. México: Trillas, 1983. BRASIL. Secretaria de Educação Básica. Parâmetros Curriculares Nacionais: Ensino Fundamental (PCN), 1997, e Ensino Médio (PCNEM), 2000. Brasília. MEC/SEB.

  4. University Students' Conceptions about the Moon Phases. (Spanish Title: Concepciones de Estudiantes Universitários sobre Las Fases de la Luna.) Concepções de Estudantes Universitários sobre as Fases da Lua

    NASA Astrophysics Data System (ADS)

    de Fátima Oliveira Saraiva, Maria; da Silveira, Fernando Lang; Steffani, Maria Helena

    2011-07-01

    In this article we describe the development of a multiple choice test about lunar phases and analyze the results of its application to ten groups of Physics students at the UFRGS. During the improvement of the test, we noticed that the percentage of right answers about some concepts increased significantly when associated with the reformulation of the question, emphasizing the importance of being careful to avoid incorrect answers generated by unclear questions, and not by ignorance on the matter. We confirm the results of other studies that show that students have great difficulty to relate the Moon's phase with its position in the sky at given time. On the other hand, our results suggest that, in general, students of Physics understand the phenomenon of lunar phases better than the average of university students. En estese artículo se describe la elaboración de una prueba de opción múltiple sobre las fases de la Luna y se analizan los resultados de su aplicación en diez grupos de estudiantes de Física de UFRGS. Durante el mejoramiento de la prueba observamos que el porcentaje de aciertos creció considerablemente cuando considerada una nueva redacción de la pregunta, destacando el cuidado que se debe tomar a fin de evitar respuestas incorrectas generadas por preguntas poco claras y no a causa de la ignorancia de los estudiantes sobre el tema. Confirmamos los resultados de otros estudios que las mayores dificultades de los alumnos sobre el tema fases de la Luna están en relacionar la fase de la Luna con su posición en el cielo en determinado momento. Por otra parte, nuestros resultados sugieren que, en general, los estudiantes de la Física comprenden mejor el fenómeno de las fases lunares que el promedio de los estudiantes universitarios. Neste artigo descrevemos a elaboração de um teste de múltipla escolha sobre as fases da Lua e analisamos os resultados de sua aplicação em dez grupos de estudantes de Física da UFRGS. Durante o aprimoramento do teste notamos que a porcentagem de acertos a respeito de alguns conceitos teve um aumento significativo associado à reformulação da pergunta, ressaltando a importância de tomar cuidado para evitar respostas erradas geradas por perguntas pouco claras e não por ignorância do respondente sobre o assunto. Confirmamos os resultados de outros estudos de que as maiores dificuldades dos alunos sobre o tema Fases da Lua dizem respeito a relacionar a fase que a Lua apresenta com a sua posição no céu em determinada hora. Por outro lado, nossos resultados sugerem que, em geral, os estudantes de Física entendem melhor o fenômeno das fases lunares do que a média dos estudantes universitários.

  5. Uso de modelos mecânicos em curso informal de astronomia para deficientes visuais. Resgate de uma experiência

    NASA Astrophysics Data System (ADS)

    Tavares, E. T., Jr.; Klafke, J. C.

    2003-08-01

    O presente trabalho propõe-se a resgatar uma experiência que teve lugar no Planetário de São Paulo nos anos 60. Em 1962, o Sr. Acácio, então com 37 anos, deficiente visual desde os 27, passou a assistir às aulas ministradas pelo Prof. Aristóteles Orsini aos integrantes do corpo de servidores do Planetário. O Sr. Acácio era o único deficiente da turma e, embora possuísse conhecimentos básicos e relativamente avançados de matemática, enfrentava dificuldades na compreensão e acompanhamento da exposição, como também em estudos posteriores. Com o intuito de auxiliá-lo na superação desses problemas, o Prof. Orsini solicitou a construção de modelos mecânicos que, através do sentido do tato, permitissem o acompanhamento das aulas e a transposição do modelo para o "constructo" mental. Essa prática mostrou-se tão eficaz que facilitou sobejamente o aprendizado da matéria pelo sujeito. O Sr. Acácio passou a integrar o corpo de professores do Planetário/Escola Municipal de Astrofísica, tendo ficado responsável pelo curso de "Introdução à Astronomia" por vários anos. Além disso, a experiência foi tão bem sucedida que alguns dos modelos tiveram seus elementos constitutivos pintados diferencialmente para serem utilizados em cursos regulares do Planetário, tornando-se parte integrante do conjunto de recursos didáticos da instituição. É pensando nessa eficácia, tanto em seu objetivo original permitir o aprendizado de um deficiente visual quanto no subsidiário recurso didático sistemático da instituição que decidimos resgatar essa experiência. Estribados nela, acreditamos ser extremamente produtivo, em termos educacionais, o aperfeiçoamento dos modelos originais, agora resgatados e restaurados, e a criação de outros que pudessem ser utilizados no ensino dessa ciência a deficientes visuais.

  6. Teaching of Astronomy: Scenarios of Teaching Practice in Elementary Schools. (Spanish Title: Enseñanza de la Astronomía: Semblanzas de la Práctica Docente en Educación Primaria.) Ensino de Astronomia: Cenários da Prática Docente no Ensino Fundamental

    NASA Astrophysics Data System (ADS)

    Marchi Gonzatti, Sônia Elisa; Spessatto De Maman, Andréia; Fernandes Borragini, Eliana; Kerber, Júlia Cristina; Haetinger, Werner

    2013-12-01

    The present work presents the main results of a research carried out within the Astronomy Education field with Elementary School teachers from two regions of Rio Grande do Sul. The study aimed to show the regional panorama of teaching Astronomy compared to the national panorama already discussed in several studies in the area. It was divided into three main issues: identifying the main topics of Astronomy developed in class, verifying which were the methodological strategies used, and which were the difficulties teachers faced when developing their practice. Regarding the contents, it was found a wide range of covered topics although Earth motion and astronomical phenomena were cited by most participants. Concerning the strategies used in class, two-dimensional resources such as movies, texts, maps and web searching were mainly used. The most relevant difficulties were the lack of specific education related to Astronomy contents and abstraction level, which complicated the understanding for both students and teachers. In general, the indicators met the results already found in other studies that investigated Astronomy teaching practice, in which the teacher's original education deficiency - or even the lack of it - hampers the proper development of Astronomy contents in class. En este trabajo se presentan los principales resultados de una investigación hecha en el campo de la Educación en Astronomía, con profesores de la Enseñanza Fundamental de dos regiones de Rio Grande do Sul. El presente estudio tuvo como objetivo caracterizar el panorama regional de la enseñanza de Astronomía, estableciendo una comparación con el panorama nacional ya presentado en trabajos de referencia en el área. Ese estudio abordó tres cuestiones: identificar los principales temas de astronomía trabajados, las estrategias metodológicas y cuáles fueron las dificultades sufridas por los profesores al presentar su práctica. Con relación a los contenidos, se encontró una atomización de los asuntos, aunque temas como movimientos de la Tierra y fenómenos astronómicos hayan sido citados por la mayoría de los participantes. En cuanto a las estrategias, se verifico que se emplean principalmente clases con el apoyo de recursos bidimensionales, como películas, textos, mapas y búsqueda en internet. Las principales dificultades fueron la falta de formación específica con respecto a los contenidos de Astronomía, y el nivel de abstracción exigido por los contenidos. De modo general, esos indicadores convergen para los resultados ya encontrados en otros estudios, en el que las deficiencias de la formación inicial de los profesores, o incluso su ausencia, dificulta el adecuado abordaje de la Astronomía en las clases. Neste trabalho são apresentados os principais resultados de uma investigação realizada no campo da Educação em Astronomia, com professores do ensino fundamental de duas regiões do Rio Grande do Sul. O objetivo do estudo foi caracterizar o cenário regional do ensino de Astronomia, estabelecendo um comparativo com o cenário nacional. Esse estudo abordou três questões: identificar os principais temas de astronomia trabalhados em sala de aula, as estratégias metodológicas e quais as dificuldades apresentadas pelos professores ao desenvolver sua prática. Quanto aos conteúdos, encontrouse uma pulverização dos assuntos abordados, embora temas como movimentos da Terra e fenômenos astronômicos tenham sido citados pela maioria dos participantes. Sobre estratégias, são utilizadas principalmente aulas com apoio de recursos bidimensionais, como filmes, textos, mapas e pesquisa na internet. As principais dificuldades foram: falta de formação específica em relação a conteúdos de Astronomia; nível de abstração dos conteúdos, que dificultam sua compreensão, tanto pelos alunos quanto pelos próprios professores. De maneira geral, esses indicadores convergem para resultados já encontrados em outros estudos que investigam a prática docente em Astronomia, em que as deficiências da formação inicial dos profess

  7. Contreras-M., A. & Spooner, D.M. (1999). Revision of Sola~um section Etuberosum (subgenus Potatoe).In: M. Nee, D.E. Symon, R.N. Lester &J.P. Jessop (editors). Solanaceae IV, pp. 227-245.

    E-print Network

    Spooner, David

    1999-01-01

    ).In: M. Nee, D.E. Symon, R.N. Lester &J.P. Jessop (editors). Solanaceae IV, pp. 227-245. Royal and Intrageneric Relationships The genus Solanum is the largest genus in the Solanaceae, with 1,000-1,100 species), described from plants grown in Scotland from seed 227 ~ #12;Solanaceae IV 70" ..;.--,..,~ ... ~/ " ' :..132

  8. Essays on Eclipses, Transits and Occultations as Teaching Tools in the Introductory Astronomy College Course. (Spanish Title: Ensayos sobre Eclipses, Tránsitos y Ocultaciones Como Herramientas de Enseñanza en el Curso Universitario Introductorio a la Astronomía.) Ensaios sobre Eclipses, Trânsitos e Ocultações Como Ferramentas de Ensino em um Curso Universitário Introdutório de Astromomia

    NASA Astrophysics Data System (ADS)

    Dcruz, Noella L.

    2014-07-01

    We occasionally include projects in our learner-centered introductory astronomy college course to enable non-science major students explore some astronomical concepts in more detail than otherwise. Such projects also highlight ongoing or upcoming astronomical events. We hope that students will feel more interested in astronomy through projects tied to astronomical events. In Spring 2012, we offered short essays focused on eclipses, transits and occultations to promote the rare transit of Venus that occurred on June 5th, 2012. We asked students to write two short essays from three that were offered. The essays contained descriptive and conceptual parts. They were meant to serve as teaching tools. 62% of 106 essays from 55 students earned A, B or C grades. 21% of 47 feedback survey respondents felt the essays increased their interest in astronomy. 49% of respondents felt that the essays were not educationally beneficial and should not be offered again. The most common written response to our survey indicated that students need more guidance and better preparation in writing successful essays. Since students found the conceptual parts of the essays difficult, in the future we will provide relevant activities prior to essay deadlines to help students create successful essays. Ocasionalmente, incluimos proyectos en nuestro curso de introducción a la astronomía universitario centrado en el alumno para permitir que los estudiantes de carreras no científicas exploren algunos conceptos astronómicos en más detalle que lo habitual. Estos proyectos también ponen en relevancia eventos astronómicos en curso o futuros. Esperamos que los estudiantes se sientan más interesados en la astronomía a través de proyectos vinculados a eventos astronómicos. En el período de primavera de 2012 (EUA), propusimos breves ensayos centrados en los eclipses, tránsitos y ocultaciones para promover el raro tránsito de Venus que se produjo el 5 de junio de 2012. Le pedimos a los estudiantes que escribieran dos ensayos cortos de tres que se proponían. Los ensayos contenían partes descriptivas y conceptuales. Los mismos estaban destinados a servir como herramientas de enseñanza. 62% de los 106 ensayos de 55 estudiantes obtuvo grados A, B o C. 21% de los 47 encuestados que respondieron al cuestionario posterior consideró que los ensayos aumentaron su interés por la astronomía. 49% de los encuestados consideró que los ensayos no eran educacionalmente útiles y que no deben ser propuestos de nuevo. Las respuestas escritas más comunes a nuestra encuesta indicaran que los estudiantes necesitan más orientación y una mejor preparación en la redacción de ensayos exitosos. Dado que los estudiantes encontraron las piezas conceptuales de los ensayos difíciles, en el futuro vamos a ofrecer actividades pertinentes antes de los plazos de redacción para ayudar a los estudiantes a crear ensayos de mayor calidad. Nós ocasionalmente incluímos projetos em nosso curso universitário introdutório centrado no aluno para permitir aos estudantes que pertencem às carreiras não científicas explorar alguns conceitos astronômicos em mais detalhes do que o normal. Tais projetos também enfatizam eventos astronômicos em curso ou futuros. Esperamos que os alunos se sintam mais interessados na astronomia através de projetos ligados a eventos astronômicos. No termo de Primavera de 2012 (EUA), propomos ensaios curtos focados em eclipses, trânsitos e ocultações para promover o raro trânsito de Vênus que ocorreu no dia 5 de junho de 2012. Pedimos aos alunos que escrevessem dois ensaios curtos dentre três que foram propostos. Os ensaios continham partes descritivas e conceituais. Eles foram feitos para servir como ferramentas de ensino. 62% de 106 ensaios de 55 alunos ganhou graus A, B ou C. 21% dos 47 entrevistados que responderam ao levantamento posterior sentiu que os ensaios aumentaram seu interesse na astronomia. 49% dos inquiridos consideraram que os ensaios não eram benéficos para a educação e que não devem ser propostos novamente. As resp

  9. Clinical Outcomes in Patients with Intermediate Coronary Stenoses: MINIATURE Investigators (Korea MultIceNter TrIal on Long-Term Clinical Outcome According to the Plaque Burden and Treatment Strategy in Lesions with MinimUm Lumen ARea lEss Than 4 mm2 Using Intravascular Ultrasound)

    PubMed Central

    Hong, Young Joon; Choi, Yun Ha; Park, Soo Young; Nam, Chang Wook; Cho, Jang Hyun; Kang, Won Yu; Lee, Sang Rok; Lee, Sung Yun; Kim, Sang Wook; Lim, Sang Yeob; Yun, Kyung Ho; Kim, Jung Sun; Kim, Jin Won; Kang, Woong Chol; Kim, Ki Seok; Choi, Jin Ho; Chung, Joong Wha; Kim, Soo Joong; Ahn, Youngkeun

    2014-01-01

    Background and Objectives We evaluated the two-year clinical outcomes in patients with angiographically intermediate lesions according to the plaque burden and treatment strategy. Subjects and Methods We prospectively enrolled patients with angiographically intermediate lesions (diameter stenosis 30-70%) with an intravascular ultrasound (IVUS) minimum lumen area (MLA) <4 mm2 with 50-70% plaque burden of 16 Korean percutaneous coronary intervention centers. Patients were divided into medical therapy group (n=85) and zotarolimus-eluting stent group (ZES; Resolute) group (n=74). We evaluated the incidences of two-year major adverse cardiovascular events (MACE). Results A two-year clinical follow-up was completed in 143 patients and MACE occurred in 12 patients. There were no significant differences in the incidences of death (1.3% vs. 3.0%, p=0.471), target vessel-related non-fatal myocardial infarction (0.0% vs. 0.0%, p=1.000) and target vessel revascularizations (7.8% vs. 4.5%, p=0.425) between medical and ZES groups. Independent predictors of two-year MACE included acute myocardial infarction {odds ratio (OR)=2.87; 95% confidence interval (CI) 1.43-6.12, p=0.014}, diabetes mellitus (OR=2.46; 95% CI 1.24-5.56, p=0.028) and non-statin therapy (OR=2.32; 95% CI 1.18-5.24, p=0.034). Conclusion Medical therapy shows comparable results with ZES, and myocardial infarction, diabetes mellitus and non-statin therapy were associated with the occurrence of two-year MACE in patients with intermediate lesion with IVUS MLA <4 mm2 with 50-70% of plaque burden. PMID:24876855

  10. Resolving the Youngest Episode of Zircon Rim Growth with High-Spatial Resolution SIMS: U-Pb Ages and Trace Element Analyses from <1 um Thick Metamorphic Zircon Rims from the Zanskar Shear Zone and Tso Morari UHP Complex, NW Himalaya

    NASA Astrophysics Data System (ADS)

    Coble, M. A.; Leech, M. L.

    2014-12-01

    Dating the youngest phase of metamorphic or magmatic zircon growth by in-situ techniques on sectioned zircons can be challenging when rims are only a few microns thick; in the worst case, geologically meaningless measurements result from mixing between different age and/or compositional growth domains. This is especially true for zircons from the Zanskar Shear Zone and Tso Morari UHP Complex, NW Himalaya, which contain Eocene to Miocene rims that grew over Paleozoic and Proterozoic protolith cores during peak and retrograde metamorphism. These metamorphic rims are typically only 0.5 to 3.0 microns thick and require high-spatial resolution to resolve. We used the SHRIMP-RG ion-microprobe to perform new U-Pb depth-profiling analyses on zircon surfaces (non-polished) pressed into indium metal. Zircons from a leucogranite dike from Malung Tokpo along the Zanskar Shear Zone, which have 2000-5000 ppm U rims, were selected for detailed depth-profiling to evaluate the depth-resolution by SIMS for U-Pb and trace element analyses. Due to the high U concentration, we were able to decrease the primary beam intensity (sputter rate) and the count times for U and Pb isotopes, and increase the number of cycles through the run-table (45 peak-hopping scans). As a result, each cycle yielded a 0.04 micron depth-resolved zircon age and trace element composition. The youngest 13 scans yielded a U-Pb age of 21.3 ± 0.5 Ma, representing a 0.6 micron rim with uniform U, Th, and Hf concentrations. At 1.15 microns, the primary beam sputtered into a ~600 Ma core; this older age is complicated by the fact that it reflects mixing between the bottom of the sputter volume and the Miocene ages of the pit margins and rim, because the diameter of the spot tends to increase with time. Trace element analyses on zircon surfaces from the Tso Morari UHP Complex are highly reproducible, showing enriched HREE profiles with negative Eu anomalies - a result that is difficult to reproduce by analyses of sectioned crystals.

  11. The genetic basis of uveal melanoma.

    PubMed

    Nielsen, M; Dogrusöz, M; Bleeker, J C; Kroes, W G; van Asperen, C A; Marinkovic, M; Luyten, G P M; Jager, M J

    2015-06-01

    Uveal melanoma (UM) is the most common intraocular malignancy in adults with an incidence of about 1/100,000 new cases per year in the Western world. Risk factors are having a light skin, blond hair and blue eyes. As some UM patients have a young age at diagnosis or an affected family history for UM or other malignancies, there may be an underlying genetic basis. This review discusses known or suspected risk factors for UM, the cancer risk in UM patients and their family members, and the genes that have been reported to predispose to UM (germline mutations) and tumor development (somatic mutations). PMID:25976137

  12. Chad Chandler Oral History

    E-print Network

    Chandler, Chad; Brown, Diana

    2014-01-01

    to be extremely careful about who you're gonna trust in doing something and in fact, um, you know, in shamanism you see a lot of, um, hallucinogenic drug use, um, because they're trying to achieve a higher plane and they use hallucinogenics as a tool to help... of the '60s, um, and, and very open minded, and continues to impress me on that front because like all the changes within the last two years, she has just totally rolled with and is cool with. Um, her husband now is, um, a recovering alcoholic and drug...

  13. Astronomy Teaching in Argentina in the 19th Century. (Spanish Title: La Enseñanza de la Astronomía en la Argentina del Siglo XIX.) O Ensino de Astronomia na Argentina no Século XIX

    NASA Astrophysics Data System (ADS)

    Norberto Cornejo, Jorge; Santilli, Haydée

    2010-12-01

    Sarmiento believed that Copernican astronomy was one of the critical scientific disciplines to the formation of a "modern" citizen. In this work, we shall study astronomical science from two points of view: from the scientific knowledge and the educational presentation of such knowledge. Our study will address in Argentina in 19th century, starting from the initiative of Bernardino Rivadavia in 1821, who founded an astronomic observatory at Buenos Aires, until the first activities of the observatories at Córdoba and La Plata. On both lines, scientific and educative, we shall analyze the influence of positivist ideas. We shall highlight epistemological differences between both observatories, Córdoba's based on French positivism and La Plata's based on German positivism. We shall also show the different attitude of both observatories towards education. We shall see the way in which positivist ideas had great relevance in the training of elementary school teachers. We shall also establish the relevant influence of the socio-historical context over the astronomical development, and show that astronomy was a fundamental social factor at Argentina history. Domingo F. Sarmiento consideraba que la astronomía copernicana era una de las disciplinas científicas fundamentales para la conformación de un ciudadano "moderno". En este trabajo estudiaremos la ciencia astronómica desde dos vertientes: la referida específicamente al conocimiento científico y aquella vinculada con la presentación educativa de dicho conocimiento. Nuestro estudio se desarrollará en Argentina durante el siglo XIX, desde la iniciativa de Bernardino Rivadavia en 1821, de establecer en Buenos Aires un observatorio astronómico, hasta las primeras actividades de los observatorios de Córdoba y de La Plata. En ambas vertientes, científica y educativa, analizaremos la influencia de las ideas positivistas. Resaltaremos las diferencias epistemológicas entre los dos observatorios, orientado el primero según el positivismo francés, y el segundo de acuerdo al positivismo alemán. También señalaremos la distinta actitud de ambos observatorios frente a la educación. En esta última dimensión veremos cómo las ideas positivistas tuvieron gran importancia en la formación de maestros impartida en las Escuelas Normales. Estableceremos también la relevante influencia del contexto socio-histórico en el desarrollo de la astronomía, y, a su vez, apreciaremos que esta última fue un actor social fundamental en la Historia Argentina. Domingo F. Sarmiento acreditava que a astronomia de Copérnico fosse uma das disciplinas científicas fundamentais para a formação de um cidadão "moderno". Neste trabalho estudaremos astronomia a partir de duas perspectivas: a científica e a educacional Nosso estudo será desenvolvido para a Argentina no século XIX, a partir da iniciativa de Bernardino Rivadavia, em 1821, que estabeleceu um observatório astronômico em Buenos Aires, até as primeiras atividades dos observatórios de Córdoba e La Plata. Em ambas as perspectivas, científica e educativa, vamos analisar a influência das ideias positivistas. Discutiremos como existiram diferenças epistemológicas entre eles, o Observatório de Córdoba orientado de acordo com o positivismo francês, e La Plata, de acordo com o positivismo alemão. Ambos os observatórios tinha uma atitude diferente em relação à educação. As ideias positivistas foram muito importantes para treinar professores do ensino primário na Argentina. Nós iremos enfatizar a importante influência do contexto sócio-histórico na astronomia, já que esta ciência foi um importante ator social na história da Argentina.

  14. Michael Kraft MEMS Research at ECS with contributions from

    E-print Network

    Kraft, Michael

    : no out of plane warping + spring constant depends only on applied voltages + online trade-off between #12;Michael Kraft MEMS Research at ECS Development Batch: Progress SOI wafer Base: 400 um BOX: 0.8 um

  15. Interplanetare Raumfahrt Vorgeschichte Flyby-Anomalie Zusammenfassung Ein kosmisches Mysterium

    E-print Network

    Aste, Andreas

    durch Venus, erm¨oglichte Umlaufbahn um Merkur. 3 / 15 Ein kosmisches Mysterium: Die Flyby-Anomalie bei durch Venus, erm¨oglichte Umlaufbahn um Merkur. Vorteile Kosten-, Zeit- und Treibstoffeinsparungen. H

  16. Subatomic Physics Detector Laboratory J.W. Martin

    E-print Network

    Martin, Jeff

    : ­ Nanosystems Fabrication Lab at UM EE (CFI, C. Shafai) ­ Detector Lab at UM Physics (CFI, M. Gericke) ­ PET;Benefits to Canada · My science is discovery science. · Basic discoveries are the cornerstone of every

  17. Instituto Nacional de Pesquisas Espaciais Exame para o curso de ps-graduao em Astrofsica

    E-print Network

    for Extraterrestrial Intelligence), afirmava que o grande radiotelescópio de Arecibo, em Porto Rico, "pode detectar um magnético? b) A que aceleração ele é submetido? #12;6. Frank Drake, um dos criadores do projeto SETI (Search

  18. Development of an Enterprise-wide Energy Information and Utility Monitoring System in a Major Hotel Chain: The Hyatt Hotels Corporation Experience 

    E-print Network

    Burke, B.; McBride, J.; Kimble, K.

    2003-01-01

    consumption data is automatically summarized for the web reports. Hotels without the UMS enter monthly utility data manually on the website. The base UMS at the hotels consists of electric, gas and domestic water consumption and local temperature and relative...

  19. The Journey from Classical to Quantum Thinking: An Analysis of Student Understanding Through the Lens of Atomic Spectra

    E-print Network

    Rao, Sandhya Kolla

    2012-01-01

    piece  of  paper   with  table]   Um,  I  think  first  piece  of  paper   with  table] S: um  I  think  first  first  step   I: 08:44  Can  you  draw  an  energy  level  diagram  of  Hydrogen?    [hand  piece  of  paper  

  20. Freshwater Community Responses to Mixtures of Agricultural Pesticides: Synergistic Effects of Atrazine and Bifenthrin 

    E-print Network

    Hoagland, Kyle D.; Drenner, Ray W.

    1991-01-01

    , chlorophyll, green colonies, Bosmina, rotifers, and particulate phosphorus (>200 um and 20-200 um) on day 7. Bifenthrin had a negative impact on Bosmina, copepod nauplii, rotifers, primary productivity, chlorophyll, green colonies, and all particulate...

  1. Saldo Capitalizavel e Saldo N~ao Capitalizavel: Novos Algoritmos para o Regime de Juros Simples

    E-print Network

    Forger, Frank Michael

    investidor que se compromete a investir um determinado capital C durante um determinado tempo, este expresso (Capitaliza¸c~ao Simples ou Linear): Em cada per´iodo T, o investidor recebe juros sobre o capital investido

  2. Protocolo Tolerante a Faltas Bizantinas para Bases de Dados Transacionais

    E-print Network

    Correia, Miguel

    ¸~oes ´e um problema bastante discutido na literatura, onde ele ´e referenciado como confirmac¸~ao at¸~ao de novos protocolos para sistemas confi´aveis. Na literatura, ´e encontrado um vasto conjunto de

  3. VizieR Online Data Catalog: IAS Stacking Library in IDL (Bethermin+, 2010)

    NASA Astrophysics Data System (ADS)

    Bethermin, M.; Dole, H.; Beelen, A.; Aussel, H.

    2010-04-01

    Number counts reach 35uJy, 3.5mJy and 40mJy at 24um, 70um, and 160um, respectively. We reach deeper flux densities of 0.38mJy at 70, and 3.1 at 160um with a stacking analysis. Products (point spread function, counts, CIB, contributions, software) are publicly available for download at http://www.ias.u-psud.fr/irgalaxies/ (2 data files).

  4. O Problema da Ambigidade Lexical de Sentido na Comunicao Multilinge

    E-print Network

    Specia, Lucia

    , demonstrar a importância de um módulo dessa natureza em um sistema de comunicação multilingüe inglês normalmente emprega um módulo dessa natureza para identificar a tradução correta de um dado termo de busca nas língua-fonte (LF). Ambigüidades dessa natureza caracterizam sempre uma escolha imprescindível e cujos

  5. Resumos de Mec^anica Geometrica 10 de Julho de 2003

    E-print Network

    Natário, José

    locais, f vi xi = yi xj vj yi . 6. Um difeomorfismo ´e uma bijec¸c~ao de classe C cuja inversa ´e tamb classe C f : Q R. Se U Q ´e um aberto com p U e xi : U R (i = 1, . . . , n) ´e um sistema de Einstein de subentender uma soma sobre todos os´indices repetidos). Dado um caminho c : R Q de classe C

  6. Precificac~ao via arbitragem Modelo Binomial

    E-print Network

    Zubelli, Jorge Passamani

    , . . . , sN e M poss´iveis estados. Um investidor toma uma posi¸c~ao inicial e, ap´os um per´iodo, um estado ´e escolhido e a posi¸c~ao do investidor ´e liquidada. O modelo fica totalmente especificado ativos ´e um vetor = (1, . . . , N)t RN , onde i > 0 significa que o investidor est´a comprado no ativo

  7. UNIVERSIDADE FEDERAL DE SANTA CATARINA CENTRO DE CINCIAS BIOLGICAS

    E-print Network

    Floeter, Sergio Ricardo

    , ecossistemas, biomas e biosfera. VII. CONTEÚDO PROGRAMÁTICO #12;Conteúdo Teórico: - Histórico e áreas de estudo e comunidades; - Conceito de espécie, ecossistemas, biomas e biosfera; - Ecologia de Populações

  8. UNIVERSIDADE FEDERAL DE SANTA CATARINA CENTRO DE CINCIAS BIOLGICAS

    E-print Network

    Floeter, Sergio Ricardo

    , Branchiura, Isopoda) e Annelida (Hirudinea) Unidade 3: Organismos cultivados em ambientes aquáticos. Estudo ecológicos dos seguintes taxa: Porifera, Cnidaria (Hydrozoa e Anthozoa), Annelida (Polychaeta), Crustacea

  9. The effect of increased convective entrainment on Asian monsoon biases in

    E-print Network

    Wirosoetisno, Djoko

    The effect of increased convective entrainment on Asian monsoon biases in the MetUM General) The effect of increased convective entrainment on Asian monsoon biases in the MetUM General Circulation Model The effect of increased convective entrainment on Asian monsoon biases in the MetUM general circulation model

  10. The effect of increased convective entrainment on Asian monsoon biases in

    E-print Network

    Wirosoetisno, Djoko

    The effect of increased convective entrainment on Asian monsoon biases in the MetUM General entrainment on Asian monsoon biases in the MetUM General Circulation Model. Quarterly Journal of the Royal on Asian monsoon biases in the MetUM General Circulation Model Stephanie J. Bushab, Andrew G. Turnera

  11. REDUCTIVE DEHALOGENATION OF HEXACHLOROETHANE, CARBON TETRACHLORIDE, AND BROMOFORM BY ANAHYDROQUINONE DISULFONATE AND HUMIC ACID

    EPA Science Inventory

    The reductive dehalogenation of hexachloroethane (C2CI6), carbon tetrachloride (CC14), and bromoform (CHBr3) was examined at 50 degrees C in aqueous solutions containing either (1) 500 uM of 2,6-anthrahydroquinone disulfonate (AHQDS), (2) 250 uM Fe2+, or (3) 250 uM HS. The pH ran...

  12. DESIGN AND EVALUATION OF A HIGH FLOW RATE DICHOTOMOUS AEROSOL SAMPLER

    EPA Science Inventory

    Two prototype high flow dichotomous samplers, each simultaneously collecting fine (0.0-2.5 um), coarse (2.5-10.0 um), and total (0.0-10.0 um) particle samples from a single air stream, have been designed and evaluated. eries of tests were conducted to estimate the prototype sampl...

  13. WETLANDS, Vol. 23, No. 4, December 2003, pp. 897910 2003, The Society of Wetland Scientists

    E-print Network

    Afton, Alan D.

    of an infaunal class of invertebrates (Nematoda, 63 to 199 m) was greater in UM marsh ponds than in those of IM marsh ponds than in those of UM marshes. The observed reduction in Nematoda due to SMM also, sediment hardness, carbon, and C:N. Nematoda, Foraminifera, and Copepoda generally were associated with UM

  14. Visit us on the web: www.umich.edu/~umarc

    E-print Network

    Cafarella, Michael J.

    Visit us on the web: www.umich.edu/~umarc The University of Michigan Amateur Radio Club Information is Amateur Radio? Amateur Radio is also known as "Ham Radio". Amateur radio operators use radio to talk. Our Station: W8UM Amateur radio station W8UM is the center of club activity. The W8UM radio "shack

  15. 16 dcembre 2014 Facult de Mdecine RTH Laennec Amphi 3 JOURNE SCIENTIFIQUE DE LA SFR SANTE LYON-EST

    E-print Network

    Maume-Deschamps, Véronique

    INSERM 1 #12;Introduction de la journée 2UMS 3453 CNRS - US 7 INSERM Germain Gillet Guy Mouchiroud #12 INSERM 5 #12;UMS 3453 CNRS - US 7 INSERM 6 Sophie Rome #12;UMS 3453 CNRS - US 7 INSERM 7 Olivier

  16. c Lerche, Uni. Freiburg, 1 Statistik: Zwischen

    E-print Network

    Lerche, Hans Rudolf

    . Datenerhebung #12;c Lerche, Uni. Freiburg, 13 Strittige Sozialstatistiken I. Verbreitung der Prostitution um Prostitution um 1850 in New York a) Sch¨atzung des Bischofs der Methodistenkirche (1866): 11 000 ­ 12 000 b Sozialstatistiken I. Verbreitung der Prostitution um 1850 in New York a) Sch¨atzung des Bischofs der

  17. c Lerche, Uni. Freiburg, 1 Statistik: Zwischen

    E-print Network

    Lerche, Hans Rudolf

    Sozialstatistiken I. Verbreitung der Prostitution um 1850 in New York a) Sch¨atzung des Bischofs der Sozialstatistiken I. Verbreitung der Prostitution um 1850 in New York a) Sch¨atzung des Bischofs der Lerche, Uni. Freiburg, 13 Strittige Sozialstatistiken I. Verbreitung der Prostitution um 1850 in New York

  18. Portal Monitor Future Development Work: Hardware Improvements

    SciTech Connect

    Browne, Michael C.

    2012-07-03

    LANL portal monitor was a modification of a previously installed (permanent) unattended monitoring system (UMS). Modifications to the UMS to make the portal were sometimes based on mistaken assumptions about exercise-specific installation and access. Philosophical approach to real-time portal differs in some areas from UMS.

  19. Uma equipa de investigadores portugueses pretende fazer o mapeamento 3D das Ilhas

    E-print Network

    Instituto de Sistemas e Robotica

    da Península Antártica. Na bagagem, leva um drone por Hugo Séneca m 50 anos, a temperatura média da cartografia de Marte, uma campanha de crowdfunding e um drone que promete acelerar a capacidade de mapeamento de um drone EBEE, da fabricante SenseFly, para o mapeamento 3D da península Antár- Os investigadores

  20. Classification of Change: Associated Action and Form Requirements /Approval Form Required

    E-print Network

    Minnesota, University of

    Request (UM1648) Major revision to a policy (e.g., whole new direction) X X X Comp Review or Change Request (UM1648) One or more new requirements - policy X X X Comp Review or Change Request (UM1648) Change on final classification New Exception X Depends on final classification New or Revised Definitions X None

  1. IOV&T OTM MrOYtXt^CLl Nas universidades portuguesas nasceram ou esto a surgir tecnologias capazes de conquistar o interesse de todo o mundo. Das criaes que salvam vidas,

    E-print Network

    Instituto de Sistemas e Robotica

    incontinentes, passando por meios de reutilizar excedentes da agricultura como combustíveis ou testes deADNà uva " à frente de um hambúrguer e de uma cer- veja", não foi um fim em si mas um meio para continuar

  2. The unusual silicate dust around HV 2310, an evolved star in the LMC

    E-print Network

    Sloan, G C; Bernard-Salas, J; Wood, P R; Houck, J R

    2006-01-01

    The spectrum of HV 2310, an evolved star in the Large Magellanic Cloud, taken with the Infrared Spectrograph (IRS) on the Spitzer Space Telescope reveals the presence of an optically thin shell of silicate dust with unusual spectral structure in the 10 um feature, with an emission peak at 9.7 um, a saddle at 10.4 um, and an extended shoulder to 11.2 um. This structure is similar to spectra from crystalline silicate grains, and of the available optical constants, forsterite provides the best fit. The spectrum also shows structure at 14 um which may arise from an unidentified dust feature.

  3. Spitzer 70 and 160-micron Observations of the Extragalactic First Look Survey

    E-print Network

    D. T. Frayer; D. Fadda; L. Yan; F. R. Marleau; P. I. Choi; G. Helou; B. T. Soifer; P. N. Appleton; L. Armus; R. Beck; H. Dole; C. W. Engelbracht; F. Fang; K. D. Gordon; I. Heinrichsen; D. Henderson; T. Hesselroth; M. Im; D. M. Kelly; M. Lacy; S. Laine; W. B. Latter; W. Mahoney; D. Makovoz; F. J. Masci; J. E. Morrison; M. Moshir; A. Noriega-Crespo; D. L. Padgett; M. Pesenson; D. L. Shupe; G. K. Squires; L. J. Storrie-Lombardi; J. A. Surace; H. I. Teplitz; G. Wilson

    2005-09-21

    We present Spitzer 70um and 160um observations of the Spitzer extragalactic First Look Survey (xFLS). The data reduction techniques and the methods for producing co-added mosaics and source catalogs are discussed. Currently, 26% of the 70um sample and 49% of the 160um-selected sources have redshifts. The majority of sources with redshifts are star-forming galaxies at z<0.5, while about 5% have infrared colors consistent with AGN. The observed infrared colors agree with the spectral energy distribution (SEDs) of local galaxies previously determined from IRAS and ISO data. The average 160um/70um color temperature for the dust is Td~= 30+/-5 K, and the average 70um/24um spectral index is alpha~= 2.4+/-0.4. The observed infrared to radio correlation varies with redshift as expected out to z~1 based on the SEDs of local galaxies. The xFLS number counts at 70um and 160um are consistent within uncertainties with the models of galaxy evolution, but there are indications that the current models may require slight modifications. Deeper 70um observations are needed to constrain the models, and redshifts for the faint sources are required to measure the evolution of the infrared luminosity function.

  4. UNIVERSIDADE FEDERAL DE SANTA CATARINA CENTRO DE CINCIAS BIOLGICAS

    E-print Network

    Floeter, Sergio Ricardo

    da placa de Petri, biologia molecular, técnicas moleculares para estudo de diversidade microbiana.; Lewis, J.; Raff, M.; Roberts, K.; Walter, P. 2010. Biologia Molecular da Célula. 5 ed. Artmed, Porto.9692www.poseco.ufsc.br/ e-mail: poseco@ccb.ufsc.br DISCIPLINA ­ TÉCNICAS MOLECULARES PARA ESTUDO DE

  5. A Regra de L'Hospital Michael Willian Conradt

    E-print Network

    Paraná, Universidade Federal do

    A Regra de L'Hospital Michael Willian Conradt Bacharelado em Direito - UFPR mike conradt-chave: Regra de L'Hospital, Limites Indeterminados. Resumo: A partir de estudos sobre Limites, no estudo de tipos de indeterminac¸ ~oes podem ser resolvidos usando a Regra de L'Hospital, que possui 4 vers

  6. Fotometria diferencial de estrelas T Tauri

    NASA Astrophysics Data System (ADS)

    Pereira, P. C. R.; Santos-Júnior, J. M.; Cruz, W. S.

    2003-08-01

    Neste trabalho apresentamos os resultados preliminares de um monitoramento de estrelas jovens, que pretende ser de longa duração. As estrelas estão em sua maioria localizadas no complexo Lupus-Scorpius. Nosso objetivo principal é o estudo da variabilidade em escalas de tempo de minutos até vários dias para estrelas cujos períodos não estão determinados ou apresentam discrepâncias entre diferentes publicações. A técnica utilizada foi a fotometria diferencial, com exposições de 60s e 90s, com as câmaras CCD SBIG ST7E e ST8E acopladas aos telescópios Schmidt-Cassegrain LX200 (10 e 12 polegadas), instalados na Fundação Planetário da Cidade do Rio de Janeiro. Os primeiros resultados indicam que a técnica é bastante sólida com relação à instabilidade na transparência do céu, mesmo com o uso de telescópios de pequeno porte. Objetos de magnitude 14, no telescópio de 10 polegadas, apresentam dispersões na diferença de magnitudes das comparações, em torno de 0,008mag nas exposições de 60s. Note-se, ainda, que a dispersão pode ser melhorada utilizando-se a técnica de soma de imagens. Destacamos AK Sco, GW Lup, GQ Lup e TW Hya. AK Sco é uma binária que, apesar de ter a sua órbita e período cobertos espectroscopicamente (13,6dias), nunca teve seus eclipses estudados por meio de fotometria. GW Lup não tem período determinado na literatura. Temos acompanhado este objeto há alguns anos, e sugestões de períodos entre 5 e 6 dias têm sido encontradas. O objeto que mereceu maior atenção foi TW Hya por apresentar vários trabalhos fotométricos e espectroscópicos com resultados discrepantes quanto ao período rotacional, que varia de 1,8 a 4,4 dias (Rucinsky & Krautter 1983, A&A 121, 217; Herbst & Koret 1988, AJ 96, 1949; Mekkaden 1988, A&A 340, 135; Batalha et al. 2002, ApJ 580, 343). Dedicamos 13 noites para essa estrela, totalizando cerca de 2.000 pontos na curva de luz. Nossos dados indicam a presença de uma modulação com dois períodos possíveis: 2,2 ou 3,8 dias, além de variações irregulares superpostas. Foram observados, também, dois eventos súbitos, espaçados de uma hora, com amplitudes de 0,05mag e duração de aproximadamente 30 minutos. Admitindo-se que tal modulação seja originada por acréscimo sobre a superfície estelar, dois cenários são possíveis. No caso do menor período, apenas uma mancha quente seria visível. No outro caso, duas manchas seriam necessárias, explicando assim a presença de dois picos ao se colocar os pontos em fase.

  7. Lunar Phases and Earthly Events: Beliefs from Different Education Levels. (Spanish Title: Fases de la Luna y Acontecimientos Terrestres: Creencia de Distintos Niveles de Instrucción.) As Fases da Lua e os Acontecimentos Terrestres: a Crença de Diferentes Níveis de Instrução

    NASA Astrophysics Data System (ADS)

    Darroz, Luiz Marcelo; da Rosa, Cleci Teresinha Werner; Alves Vizzotto, Patrick; Becker da Rosa, Álvaro

    2013-12-01

    This article presents the result of a research carried out in the first semester of 2013 with a group of 80 subjects from different education levels. In this research, we sought to investigate the earthly events that this group of people attributes to the phenomenon of lunar phases. For data collection we used semi-structured interviews guided by questions that aimed to keep the focus on subjects of the investigation. Interviews were recorded and transcribed, and the results were compared to scientific studies in the area after being quantitatively and qualitatively analyzed. Research data showed that the Moon and the phenomenon of lunar phases still fascinate and raise the interest of people. However, the lack of knowledge to find correct explanations to the phenomena involving the moon ends up originating a series of beliefs about its influence on earthly events. En este artículo se presenta el resultado de una investigación realizada en el primer semestre de 2013 con a un grupo de 80 individuos de distintos niveles de instrucción. En esta investigación, tratamos de averiguar cuáles son los acontecimientos terrestres que este grupo de personas atribuye al fenómeno las fases lunares. Como instrumento de colecta de datos, se emplearon entrevistas semiestructuradas guiadas por preguntas que trataban de mantener la atención de los entrevistados en el objeto investigado. Las entrevistas fueron grabadas y transcriptas, y los resultados, después de ser analizados cuantitatativa y cualitativamente, fueron confrontados con estudios científicos del área. Los datos de la investigación demuestran que la Luna y de sus fases continúan fascinando y despertando el interés de la población. Sin embargo, la falta de conocimientos para encontrar explicaciones correctas relacionadas a los fenómenos que ocurren con el astro acaba originando una serie de creencias en la población sobre su influencia en los sucesos terrestres. Apresenta-se neste artigo o resultado de uma pesquisa realizada no primeiro semestre de 2013 junto a um grupo de 80 sujeitos de diferentes níveis de instrução. Nesta pesquisa, buscou-se averiguar os acontecimentos terrestres que esse grupo de pessoas atribui ao fenômeno das fases lunares. Como instrumento de coleta de dados, foram empregadas entrevistas semiestruturadas guiadas por questões que buscavam manter a atenção dos entrevistados no objeto de investigação. As entrevistas foram gravadas e transcritas, e os resultados, após serem analisados quanti e qualitativamente, foram confrontados com estudos científicos da área. Os dados da pesquisa demonstram que a Lua e suas fases continuam fascinando e despertando o interesse da população. No entanto, a falta de conhecimentos para proferir explicações corretas relativas aos fenômenos que ocorrem com o astro acaba originando uma série de crenças na população sobre sua influência nos acontecimentos terrestres.

  8. Astronomy in Science Textbooks: An Analysis of Pnld 2008. (Spanish Title: Astronomía en los Libros de Ciencia: un Análisis del Pnld 2008.) Astronomia Nos Livros Didáticos de Ciências: Uma Análise do Pnld 2008

    NASA Astrophysics Data System (ADS)

    Amaral, Patrícia; Quintanilha Vaz de Oliveira, Carlos Eduardo

    2011-12-01

    The importance of the textbooks in classrooms is revealed when studies are pointing that these pedagogical sources are, most of the times, the only source used by the elementary school teachers when preparing their Science lessons. When we analyzed the Astronomy contents in the textbooks approved by the Brazilian Textbook Program 2008 and which, in theory, are the best available in the Brazilian editorial market, we examined some categories in the 2008 Textbook Guide. This research characterizes the frequency of Astronomical contents appearing in the texts, in the pictures, and in the hands-on activities. Additionally, it describes some misconceptions and presents additional information on the collections. La importancia de los libros de texto en las aulas se pone de manifiesto cuando los estudios indican que este recurso educativo es a menudo la única fuente de consulta utilizada por el profesor de ciencias de la escuela primaria para preparar sus lecciones. Cuando analizamos el contenido presente en los libros de texto de astronomía aprobados por el Programa Nacional de Libros de Texto de 2008 y que, en teoría, son los mejores libros disponibles en el mercado editorial brasileño, buscamos examinar algunas categorías que figuran en los libros de texto de la Guía de Libros Didácticos de 2008. El estudio caracteriza la frecuencia del contenido de Astronomía en el texto, en las figuras, y en las actividades de experimentación. También describe algunos errores conceptuales y presenta un conjunto de información adicional sobre las colecciones. A importância dos livros didáticos nas salas de aula revela-se quando estudos apontam que este recurso pedagógico é, muitas vezes, a única fonte de consulta utilizada pelo professor de Ciências do ensino fundamental para a preparação de suas aulas. Quando analisamos os conteúdos de Astronomia presentes nos livros didáticos aprovados no Programa Nacional do Livro Didático de 2008 e que, teoricamente, são os melhores livros disponíveis no mercado editorial brasileiro, buscamos esquadrinhar algumas categorias constantes no Guia de Livros Didáticos de 2008. A pesquisa caracteriza a freqüência do conteúdo de Astronomia no texto, nas figuras e nas atividades de experimentação. Além disso, descreve alguns erros conceituais e apresenta um conjunto de informações adicionais sobre as coleções.

  9. A Proposed Activity for a Meaningful Learning about the Moon Phases. (Breton Title: Uma Proposta de Atividade Para a Aprendizagem Significativa sobre as Fases da Lua.) Una Actividad Propuesta Para EL Aprendizaje Significativo Acerca de Las Fases de la Luna

    NASA Astrophysics Data System (ADS)

    Martins, Bruno Andrade; Langhi, Rodolfo

    2012-12-01

    This paper presents one of the concepts of Astronomy and its consequent failure in teaching this topic in high school, even when the official documents point out the necessity of Astronomy teaching at this school level. Among the spontaneous conceptions in Astronomy that high school students carry with them, even after the end of the school, we emphasized in this research the Moon phases. The development of different strategies in relation to traditional methods, aimed to teaching-learning process on this topic was considered in this study. These strategies were devised based on the reference frame of the Meaningful Learning, as elaborated by Ausubel. The proposals presented here include the active participation of students in experimental activities and other didactic activities, for their continuous evaluation during the process. These activities finished with a Comics elaboration about the Moon phases. Therefore, the objective of this paper is to present a proposal for differentiated teaching activity about Moon phases supported by the theoretical principles of Meaningful Learning at Physics classes. Este texto foca um dos conteúdos de Astronomia e a consequente falha no ensino deste tema no ensino médio, apesar de os documentos oficiais apresentarem a necessidade de se trabalhar a Astronomia neste nível de ensino. Dentre as concepções alternativas em Astronomia que os alunos do ensino médio carregam consigo, mesmo após o término dos estudos, destacamos, nesta pesquisa, o fenômeno das fases da Lua. O desenvolvimento de estratégias diferenciadas em relação ao ensino tradicional, visando o processo de ensino-aprendizagem sobre este tema, foi contemplado neste trabalho como um dos resultados obtidos sob a luz dos referenciais da aprendizagem significativa, fundamentados em Ausubel. Segundo a proposta aqui apresentada, a participação ativa dos alunos na execução de uma atividade experimental e outras atividades didáticas, que visam sua contínua avaliação durante o processo, culmina com a elaboração de uma história em quadrinhos envolvendo as fases da Lua. Portanto, o objetivo deste trabalho é apresentar uma proposta de atividade didática diferenciada sustentada pelos princípios teóricos da aprendizagem significativa aplicada ao ensino das fases da Lua durante as aulas de Física no ensino médio. En este trabajo se presenta uno de los contenidos de la Astronomía y el evidente fracaso en la enseñanza del tema en la escuela secundaria, a pesar del hecho que los documentos oficiales apuntan para la necesidad de trabajar contenidos de Astronomía en este nivel. Entre los conceptos alternativos en Astronomía que los alumnos secundarios llevan consigo, aún después de terminados los estudios, destacamos aquí el fenómeno de las fases de la Luna. El desarrollo de diferentes estrategias en relación con los métodos tradicionales, dirigidas al proceso de enseñanza-aprendizaje en este tema fue considerado en este trabajo como uno de los resultados obtenidos a la luz de los referenciales del aprendizaje significativo, tal como fueron fundamentados por Ausubel. Según la propuesta que aquí se presenta, la participación activa de los estudiantes en la ejecución de una actividad experimental y otras actividades educativas destinadas a la evaluación continua durante el proceso culminó en la elaboración de una historieta respecto de las fases de la Luna. Por lo tanto, el objetivo de este trabajo es presentar una propuesta de actividad de enseñanza diferenciada con el apoyo de los principios teóricos del aprendizaje significativo aplicado a la enseñanza de las fases de la luna durante las clases de física del ciclo secundario.

  10. Infrared Spectral Energy Distributions of Nearby Galaxies

    E-print Network

    D. A. Dale; G. J. Bendo; C. W. Engelbracht; K. D. Gordon; M. W. Regan; L. Armus; J. M. Cannon; D. Calzetti; B. T. Draine; G. Helou; R. D. Joseph; R. C. Kennicutt; A. Li; E. J. Murphy; H. Roussel; F. Walter; H. M. Hanson; D. J. Hollenbach; T. H. Jarrett; L. J. Kewley; C. A. Lamanna; C. Leitherer; M. J. Meyer; G. H. Rieke; M. J. Rieke; K. Sheth; J. D. T. Smith; M. D. Thornley

    2005-07-28

    The Spitzer Infrared Nearby Galaxies Survey (SINGS) is carrying out a comprehensive multi-wavelength survey on a sample of 75 nearby galaxies. The 1-850um spectral energy distributions are presented using broadband imaging data from Spitzer, 2MASS, ISO, IRAS, and SCUBA. The infrared colors derived from the globally-integrated Spitzer data are generally consistent with the previous generation of models that were developed based on global data for normal star-forming galaxies, though significant deviations are observed. Spitzer's excellent sensitivity and resolution also allow a detailed investigation of the infrared spectral energy distributions for various locations within the three large, nearby galaxies NGC3031 (M81), NGC5194 (M51), and NGC7331. Strong correlations exist between the local star formation rate and the infrared colors f_nu(70um)/f_nu(160um) and f_nu(24um)/f_nu(160um), suggesting that the 24 and 70um emission are useful tracers of the local star formation activity level. Preliminary evidence indicates that variations in the 24um emission, and not variations in the emission from polycyclic aromatic hydrocarbons at 8um, drive the variations in the f_nu(8.0um)/f_nu(24um) colors within NGC3031, NGC5194, and NGC7331. If the galaxy-to-galaxy variations in spectral energy distributions seen in our sample are representative of the range present at high redshift then extrapolations of total infrared luminosities and star formation rates from the observed 24um flux will be uncertain at the factor-of-five level (total range). The corresponding uncertainties using the redshifted 8.0um flux (e.g. observed 24um flux for a z=2 source) are factors of 10-20. Considerable caution should be used when interpreting such extrapolated infrared luminosities.

  11. Synthesis and nanostructures of several tetrathiafulvalene derivatives having the side chains composed of chiral and hydrogen-bonding groups and their charge-transfer complexes.

    PubMed

    Tatewaki, Yoko; Watanabe, Takanori; Watanabe, Koji; Kikuchi, Kohei; Okada, Shuji

    2013-12-01

    Tetrathiafulvalene (TTF) derivatives TTF-Bor, TTF-2UM and TTF-4UM having chiral urethane groups were prepared. Among them, TTF-2UM, TTF-4UM and their charge-transfer (CT) complexes with F4TCNQ organized the nanowires. The intermolecular hydrogen bonding of the chiral urethane groups and ?-stacking of TTF moieties or the formation of CT complexes resulted in a long one-dimensional nanowires. The chiral moieties were responsible for the molecular orientation of TTF cores to give helical structures. Electronic conductivity of the films of nanowires composed of TTF-2UM and TTF-4UM with F4TCNQ were determined to be 8.0 × 10(-2) and 3.2 × 10(-2) S cm(-1), respectively. PMID:24022061

  12. F589 -TERCEIRA LISTA DE EXCERCICIOS 1. Ilumina-se uma superficie de aluminio com luz de comprimento de onda 2000A. No

    E-print Network

    de Aguiar, Marcus A. M.

    ser usada? 4. (a) Mostre que um el´etron livre n~ao pode absorver um f´oton e conservar energia e mo comprimento de onda 2000°A. No alum´inio s~ao necess´arios 4.2 eV para remover um el´etron. Qual a energia cin. Deve usar a express~ao relativ´istica para a energia cin´etica do el´etron no efeito fo- toel

  13. Rhizotoxic effects of silver in cowpea seedlings

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Silver (Ag) is highly toxic to aquatic organisms, including algae, invertebrate animals and fish, but there is little information on Ag rhizotoxicity in higher plants. In two solution culture experiments with ca. 1000 uM Ca(NO3)2 and 5 uM H3BO3 (pH 5.4), 20 to 37 % of added Ag (= 2 uM) was lost fro...

  14. CONTRIBUTIONS TO THE COMPACTNESS THEORY OF THE DEL-BAR NEUMANN OPERATOR 

    E-print Network

    Celik, Mehmet

    2010-01-16

    that the subsequence is Cauchy in L2(0;q)( ) and hence 25 converges: kf(un um)k2 "Q(un um;un um)| {z }

  15. By Leigh Haldeman -Most common form of inherited form

    E-print Network

    Brutlag, Doug

    ://www.google.com/imgres?um=1&hl=en&sa=N&biw=1366&bih=653&tbm=isch&tbnid=BReSkIrah32bIM:&imgrefurl=http://medgen.genetics.utah Second image: http://www.google.com/imgres?um=1&hl=en&sa=N&biw=1366&bih=653&tbm=isch&tbnid=lMoTBqnl9m=163&dur=234 Third Image: http://www.google.com/imgres?um=1&hl=en&sa=N&biw=1366&bih=653&tbm

  16. Organ Site-Specific SPOREs | Translational Research Program (TRP)

    Cancer.gov

    Since its inception in 1995, the University of Michigan (UM) Prostate SPORE has endeavored to tap the vast intellectual and physical resources of the UM community to decrease the morbidity and mortality of prostate cancer (PCa). The UM Prostate SPORE supports an interactive group of basic and clinical investigators in a translational research program that has led to major discoveries in the diagnosis, prevention and treatment of prostate cancer.

  17. Acting into Action: Teatro Arena's Zumbi

    E-print Network

    Milleret, Margo

    1987-10-01

    calls "opresor vs. oprimido" (83). Although the plot includes references to the population of Palmares, the conflict is between the hero, Zumbi, and the government-backed military forces. The presentation of events in the play moves quickly from... to criticize social conditions. For example, da Matta observed that in a samba de enredo there is "[uma] inversão entre o desfilante (um pobre, geralmente negro ou mulato) e a figura que ele representa no desfile (um nobre, um rei, uma figura mitológica...

  18. A Subset of Nuclear Receptors are Uniquely Expressed in Uveal Melanoma Cells

    PubMed Central

    Huffman, Kenneth Edward; Carstens, Ryan; Martinez, Elisabeth D.

    2015-01-01

    Uveal melanoma (UM) is recognized as the most common intraocular malignancy and the second most common form of melanoma. Nearly 50% of UM patients develop untreatable and fatal metastases. The 48-member nuclear receptor (NR) superfamily represents a therapeutically targetable group of transcription factors known for their regulation of key cancer pathways in numerous tumor types. Here, we profiled the expression of the 48 human NRs by qRT-PCR across a melanoma cell line panel including 5 UM lines, 9 cutaneous melanoma (CM) lines, and normal primary melanocytes. NR expression patterns identified a few key features. First, in agreement with our past studies identifying RXRg as a CM-specific marker, we found that UM cells also exhibit high levels of RXRg expression, making it a universal biomarker for melanoma tumors. Second, we found that LXRb is highly expressed in both UM and CM lines, suggesting that it may be a therapeutic target in a UM metastatic setting as it has been in CM models. Third, we found that RARg, PPARd, EAR2, RXRa, and TRa expressions could subdivide UM from CM. Previous studies of UM cancers identified key mutations in three genes: GNAQ, GNA11, and BRAF. We found unique NR expression profiles associated with each of these UM mutations. We then performed NR-to-NR and NR-to-genome expression correlation analyses to find potential NR-driven transcriptional programs activated in UM and CM. Specifically, RXRg controlled gene networks were identified that may drive melanoma-specific signaling and metabolism. ERRa was identified as a UM-defining NR and genes correlated with its expression confirm the role of ERRa in metabolic control. Given the plethora of available NR agonists, antagonists, and selective receptor modulators, pharmacologic manipulation of these NRs and their transcriptional outputs may lead to a more comprehensive understanding of key UM pathways and how we can leverage them for better therapeutic alternatives. PMID:26217306

  19. Tiragem: 16000 Pas: Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    de 50 mil feridos e um número de desaloja- dos que facilmente chegaria ao meio milhar. As contas comando", ou seja, tratou-se de um exercício que não envolveu "movimentação real de meios no terreno". Um dos comandos envolvidos é o de Car- naxide (Lisboa), onde é feita a gestão dos meios e a resposta aos

  20. Analise Matematica IV Semestre de 2005/06

    E-print Network

    Girão, Pedro M.

    de Cauchy num rect^angulo com um ponto removido. Teorema de Cauchy num disco. Ler pp. 111-113 de [2]. 3.10.05 Teorema de Cauchy num disco com um ponto removido. Indice de um ponto em relac~ao a uma. As series de pot^encias de#12;nem func~oes holomorfas no interior do disco de converg^encia. As func

  1. Driving bubbles out of glass

    NASA Technical Reports Server (NTRS)

    Mattox, D. M.

    1981-01-01

    Surface tension gradient in melt forces gas bubbles to surface, increasing glass strength and transparency. Conventional chemical and buoyant fining are extremely slow in viscous glasses, but tension gradient method moves 250 um bubbles as rapidly as 30 um/s. Heat required for high temperature part of melt is furnished by stationary electrical or natural-gas heater; induction and laser heating are also possible. Method has many applications in industry processes.

  2. Co-design of Reliable Signal and Power Interconnects in 3D Stacked ICs

    E-print Network

    Lim, Sung Kyu

    , the power consumed by a single chip will reach 200W in a few years. Even in the packages of today's industry/G wires. 4) We rip up and reroute signal nets with routing capacity violations. We used the thermal and the Interconnect Focus Center (IFC). 10um P/G thick wire P/G thin wire power TSVground TSV 400um 9.75um P/G tile 4

  3. Information Technology Theorie chemischer Organisationen angewendet auf Infektionsmodelle

    E-print Network

    Dittrich, Peter

    Information Technology Theorie chemischer Organisationen angewendet auf Infektionsmodelle Chemical into another. Zusammenfassung Die Theorie chemischer Organisationen er¨offnet einen neuen Weg um komplexe

  4. Distributed Channel Assignment for Interference-Aware Wireless Mesh Networks

    E-print Network

    Broadcast-Eigenschaft des �bertragungsmedi- ums werden Nachrichten potentiell von allen Netzwerkstationen un- synchronisierten Medienzugri mehrere Nachrichten beim Empfänger kollidieren und nicht korrekt

  5. Heterogeneity revealed by integrated genomic analysis uncovers a molecular switch in malignant uveal melanoma.

    PubMed

    de Lange, Mark J; van Pelt, Sake I; Versluis, Mieke; Jordanova, Ekaterina S; Kroes, Wilma G M; Ruivenkamp, Claudia; van der Burg, Sjoerd H; Luyten, Grégorius P M; van Hall, Thorbald; Jager, Martine J; van der Velden, Pieter A

    2015-11-10

    Gene expression profiles as well as genomic imbalances are correlated with disease progression in uveal melanoma (UM). We integrated expression and genomic profiles to obtain insight into the oncogenic mechanisms in development and progression of UM. We used tumor tissue from 64 enucleated eyes of UM patients for profiling. Mutations and genomic imbalances were quantified with digital PCR to study tumor heterogeneity and molecular pathogenesis. Gene expression analysis divided the UM panel into three classes. Class I presented tumors with a good prognosis and a distinct genomic make up that is characterized by 6p gain. The UM with a bad prognosis were subdivided into class IIa and class IIb. These classes presented similar survival risks but could be distinguished by tumor heterogeneity. Class IIa presented homogeneous tumors while class IIb tumors, on average, contained 30% of non-mutant cells. Tumor heterogeneity coincided with expression of a set of immune genes revealing an extensive immune infiltrate in class IIb tumors. Molecularly, class IIa and IIb presented the same genomic configuration and could only be distinguished by 8q copy number. Moreover, UM establish in the void of the immune privileged eye indicating that in IIb tumors the infiltrate is attracted by the UM. Combined our data show that chromosome 8q contains the locus that causes the immune phentotype of UM. UM thereby provides an unique opportunity to study immune attraction by tumors. PMID:26462151

  6. Biological properties and molecular targets of umbelliprenin--a mini-review.

    PubMed

    Shakeri, Abolfazl; Iranshahy, Milad; Iranshahi, Mehrdad

    2014-01-01

    7-Prenyloxycoumarins are a group of secondary metabolites found mainly in plants belonging to the families Rutaceae and Apiaceae. Auraptene, umbelliprenin (UM), and 7-isopentenyloxycoumarin are some examples of prenylated coumarins. UM occurs in various edible plant species including celery, coriander, angelica, lemon, and particularly, Ferula species. Although UM was isolated more than 50 years ago, its biological activities have been studied since the last two decades. Besides anticancer activities, biological activities including anti-inflammatory, antioxidant, and antileishmanial activities have been reported from this natural compound. The present mini-review deals with the biological activities and mechanism of actions reported for UM. PMID:24852499

  7. Instituto Superior Tecnico Departamento de Matematica

    E-print Network

    Godinho, Leonor

    que F ´e de classe C1 em R3 , e R3 ´e um conjunto em estrela, F ´e um gradiente. Um potencial para F = (()) - ((0)) = (0, e , ) - (0, 1, 0) = . (5) (a) Enuncie o teorema da fun¸c~ao inversa.(1 val.) (b) D^e um exemplo de uma fun¸c~ao G : R2 R2 que satisfa¸ca as condi¸c~oes do(1 val.) teorema da fun¸c~ao inversa em

  8. Introduo Dinmica de Aplicaes do Tipo Twist

    E-print Network

    Moreira, Carlos Gustavo

    - Vladimir Pestov · Elementos de Estatística Computacional usando Plataformas de Software Livre/Gratuito · Topics in Inverse Problems - Johann Baumeister and Antonio Leitão · Um Primeiro Curso sobre Teoria

  9. Schubert Calculus: An Algebraic Introduction

    E-print Network

    Moreira, Carlos Gustavo

    - Vladimir Pestov · Elementos de Estatística Computacional usando Plataformas de Software Livre/Gratuito · Topics in Inverse Problems - Johann Baumeister and Antonio Leitão · Um Primeiro Curso sobre Teoria

  10. UNIVERSIDADE DE BRASLIA PROGRAMA DE PS-GRADUAO EM EDUCAO FSICA

    E-print Network

    Maier, Rudolf Richard

    Sociais e Pedagógicos da Educação Física, Esporte e Lazer Estudo sobre Práticas Corporais, Escola, Cultura e Natureza Ingrid, Dulce e Arthur 3 4 Políticas de Esporte e Lazer Fernando e Athayde 3 1 Formação

  11. UNIVERSIDADE FEDERAL DE SANTA CATARINA CENTRO DE CINCIAS BIOLGICAS

    E-print Network

    Floeter, Sergio Ricardo

    técnicas básicas para análise desses fatores. 3. Noções de espécies, ecossistemas, biomas e biosfera. 4 espécie, ecossistemas, biomas e biosfera; - Fatores abióticos do meio ambiente; - Métodos de estudo para

  12. Surface freshwater storage and dynamics in the Amazon basin during the 2005 exceptional This article has been downloaded from IOPscience. Please scroll down to see the full text article.

    E-print Network

    , France 4 IRD; LEGOS, F-31400 Toulouse, France 5 Universidade do Estado do Amazonas (UEA), Centro de Estudos do Tr´opico ´Umido (CESTUAv), Djalma Batista, 3578, Flores, Manaus, Amazonas, Brazil 6 CNRS

  13. Construir.pt Pas: Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    | Publituris | Construir | Computerworld | Meios&Publicidade | CXO © Copyright 2012 Construir.pt. Todos os meios à disposição para ensaios e estudos são proporcionalmente muito inferiores aos que são usados

  14. UNIVERSIDADE DE BRASLIA PROGRAMA DE PS-GRADUAO EM CINCIAS E TECNOLOGIAS EM SADE

    E-print Network

    Maier, Rudolf Richard

    deglutição. Dor orofacial. 1 1 Biologia Molecular aplicada ao estudo de fungos patogênicos humanos 1 0 deglutição. Dor orofacial. 1 1 Biologia Molecular aplicada PROCESSOS BIOLÓGICOS EM SAÚDE 1.1. Mecanismos Moleculares e Funcionais da Saúde Humana Mecanismos

  15. Universidade Estadual de Campinas Instituto de Matemtica, Estatstica e Computao Cientfica

    E-print Network

    Gomes, Francisco A. M.

    -Graduação: Mestrado em Matemática Aplicada #12;iii #12;v #12;vii AGRADECIMENTOS Agradeço primeiramente a DEUS por a DEUS por ter uma família tão maravilhosa que sempre me apoiou em meus estudos, mesmo não entendendo

  16. Jornal Hardmsica.pt Pas: Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    Trienal de Arquitectura de Lisboa no Palácio Sinel de Cordes A Trienal de Arquitectura de Lisboa vai ficar notícias estudo traça perfil do turista que visita o Porto e o Norte 2012-02-07 Trienal de Arquitectura de

  17. Serum Potassium Levels Inversely Correlate with D-Dimer In Patients with Acute-Onset Atrial Fibrillation.

    PubMed

    Cervellin, Gianfranco; Bonfanti, Laura; Picanza, Alessandra; Lippi, Giuseppe

    2014-12-01

    Background: D-dimer values are frequently increased in patients with atrial fibrillation (AF) compared to subjects in sinus rhythm. Hypokalemia plays a role in several cardiovascular diseases, but little is known about the association with AF. Objective: D-dimer values are frequently increased in patients with atrial fibrillation (AF) compared with subjects in sinus rhythm. Hypokalemia plays a role in several cardiovascular diseases, but little is known about the association with AF. The aim of this study was to investigate correlations between D-dimer and serum potassium in acute-onset AF (AAF). Methods: To investigate the potential correlation between the values of serum potassium and D-dimer in patients with AAF, we retrospectively reviewed clinical and laboratory data of all emergency department visits for AAF in 2013. Results: Among 271 consecutive AAF patients with D-dimer assessments, those with hypokalemia (n = 98) had significantly higher D-dimer values than normokalemic patients (139 versus 114 ng/mL, p = 0.004). The rate of patients with D-dimer values exceeding the diagnostic cut-off was higher in the group of patients with hypokalemia than in those with normal serum potassium (26.5% versus 16.2%; p = 0.029). An inverse and highly significant correlation was found between serum potassium and D-dimer (r = -0.21; p < 0.001), even after adjustments for age and sex (beta coefficient -94.8; p = 0.001). The relative risk for a positive D-dimer value attributed to hypokalemia was 1.64 (95% CI, 1.02 to 2.63; p = 0.040). The correlation remained statistically significant in patients free from antihypertensive drugs (r = -0.25; p = 0.018), but not in those taking angiotensin-receptor blockers, angiotensin-converting enzyme inhibitors, or diuretics. Conclusions: The inverse correlation between values of potassium and D-dimer in patients with AAF provides important and complementary information about the thromboembolic risk of these patients.Fundamento: Valores de D-dímero são frequentemente aumentada em pacientes com fibrilação atrial (FA) em comparação com indivíduos em ritmo sinusal. A hipocalemia desempenha um papel em várias doenças cardiovasculares, mas pouco se sabe sobre a associação com FA. Objetivo: As concentrações de D-dímero encontram-se frequentemente aumentadas em pacientes com FA, quando comparados com indivíduos em ritmo sinusal. A hipopotassemia desempenha um papel importante nas doenças cardiovasculares, porém, pouco é conhecido sobre sua associação com a FA. O objetivo deste estudo foi investigar a correlação entre os níveis séricos de D-dímero e potássio na FA aguda (FAA). Métodos: Para investigar a existência de uma potencial correlação entre os níveis séricos de potássio e D-dímero em pacientes com FAA, realizamos uma revisão retrospectiva de dados clínicos e laboratoriais relacionados a todas as visitas ao departamento de emergência devido à FAA, no ano de 2013. Resultados: Entre os 271 pacientes com FAA, aqueles com hipopotassemia (n = 98) mostraram aumento significativo nos níveis de D-dímero, quando comparados com pacientes com concentrações normais de potássio (139 versus 114 ng/mL, p = 0,004). A taxa de pacientes com níveis de D-dímero excedendo o valor limiar de diagnóstico foi maior no grupo de pacientes com hipopotassemia, quando comparado com o grupo de pacientes com concentrações normais de potássio (26,5% versus 16,2%; p = 0,029). Detectamos uma correlação inversa e altamente significativa entre os níveis séricos de potássio e D-dímero (r = -0,21; p < 0,001), até mesmo após ajuste para idade e sexo (coeficiente beta -94,8; p = 0,001). O risco relativo de um valor positivo de D-dímero estar relacionado à hipopotassemia foi de 1,64 (95% CI, 1,02 to 2,63; p = 0,040). A correlação permaneceu estatisticamente significativa em pacientes livres de medicamentos hipertensivos (r = -0,25; p = 0,018), porém não nos pacientes em tratamento com bloqueadores do receptor de angiotensina, inibidores da enzima conversora de angiotensin

  18. FLOW CYTOMETRIC ANALYSIS OF THE MECHANISM OF METHYLMERCURY CYTOTOXICITY

    EPA Science Inventory

    The target and degree of methylmercury cytotoxicity are dose-dependent. ollowing 6 h exposure to 2.5 -7.5 uM, ethylmercury (MeHg) progressively inhibits DNA synthesis and induces chromosomal damage In murine erythroleukemic cells. However, following exposure to 10 - 50 uM MeHg, t...

  19. Exame de Mec^anica Geometrica 22 de Junho de 2002 9 horas

    E-print Network

    Natário, José

    ´icula livre que se move ao longo de uma superf´icie esf´erica, descrita pelo Lagrangeano L : TS2 R dado em¸c~ao energia potencial U C(SO(3)) admite uma infinidade de movimentos peri´odicos. D^e um exemplo de um

  20. PSEC4 Analog Card Specifications 21Nov2011 6 Layer Board

    E-print Network

    & 5) Silkscreen on Component and Solder Sides Immersion Gold over copper, with min. Ni: 2.55 um; Au: 0.050.2 um. Apply Solder Mask over bare copper Impedance control: 50 Ohm +/ 5% on 14 mil traces Test Width (mil) Z0 ohm 1 DIELECTRIC_1 Dielectric Solder Mask 2 SIGNAL_1 Metal Signal 0.7 14 49

  1. Mode-Area Scaling of Helical-Core Dual-Clad Fiber Lasers and Amplifiers

    SciTech Connect

    Jiang, Z.; Marciante, J.R.

    2005-09-30

    Helical-core, dual-clad fibers have been designed for single-mode operation with 60-um cores and 0.10 NA. Helical fibers are shown to perform where conventional coiled fibers cannot operate, with possible scaling to 200-um-diameter helical cores.

  2. Study Abroad for Chinese University Presidents: How China Is Reforming Higher Education

    ERIC Educational Resources Information Center

    Cook, Constance Ewing

    2008-01-01

    In 2006, the Chinese Ministry of Education sent presidents and party secretaries from its top-ranked universities to the University of Michigan (UM) to learn more about the leadership of research universities. Both the ministry and UM worked hard to make the visit productive, and both parties gained from it. A year later, with the support of the…

  3. Measuring cattle feedlot dust using laser diffraction analysis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Considerable amounts of particulate matter (PM), including total suspended particulates (TSP), particulates with equivalent aerodynamic diameter less than or equal to 10 um (PM10), and particulates with equivalent aerodynamic diameter less than or equal to 2.5 um (PM2.5), are emitted from large beef...

  4. Darwin als Sehhilfe für die Psychologie - Evolutionspsychologie

    NASA Astrophysics Data System (ADS)

    Schwab, Frank

    Im Folgenden geht es um Einäugige, stereoskopisches Sehen, weite und enge Horizonte, Monokel und Sonnenbrillen. Der Beitrag versucht die Metapher des Sehens und der Sehhilfen anzuwenden, um so zu verdeutlichen, welchen Gewinn die herkömmliche Psychologie durch die Verwendung einer Darwin'schen Brille erlangen kann.

  5. Anwendungen fr Nachrichten Proseminar Auszeichnungssprachen

    E-print Network

    Morik, Katharina

    Anwendungen für Nachrichten (RSS) Proseminar Auszeichnungssprachen 26.06.2007 Olivier Dounla ­ Jan Format, welches entwickelt wurde, um Nachrichten und andere Webinhalte auszutauschen. · RSS erlaubt es · Newsseiten (www.cnn.com, www.tagesschau.de, www.reuters.com) verwenden RSS, um tagesaktuelle Nachrichten

  6. Mais Superior Online Visitas dirias: 821

    E-print Network

    Instituto de Sistemas e Robotica

    ://www.maissuperior.com/2015/05/31/ist-ajuda-te-nos-sismos/ O Instituto Superior Técnico (IST) está a desenvolver um jogo que IST estão a desenvolver um jogo dirigido às crianças e com o intuito de estas serem ensinadas na compreensivas para as crianças, daí o desenvolvimento deste jogo, o Treme-Treme. Este jogo pode ser acedido de

  7. Oeiras Digital Online Visitas dirias: 155

    E-print Network

    Instituto de Sistemas e Robotica

    ID: 59330926 18-05-2015 Taguspark é sede de fabrico de um dos mais famosos jogos móveis URL: http jogo tinha mais de 8,250 milhões de utilizadores por dia no telemóvel e conta com mais de 100 milhões desafio a Sérgio Varanda de abrir um escritório de desenvolvimento de jogos móveis, nada fazia prever o

  8. 12 JORNAL DA UNICAMP Campinas, 24 a 30 de agosto de 2009 LUIZ SUGIMOTO

    E-print Network

    de Aguiar, Marcus A. M.

    ) reuniu 30 fotos inéditas por meio das quais propõe um jogo lúdico relacional com o visitante observador trabalho artisticamente maduro e com uma dose de ousadia, desafiando o observador ao jogo, com referências propõe um jogo lúdico relacional com o visitante observador: o convite é para brincar de associar objetos

  9. SIC Notcias Online Pas: Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    /2004 viveu de perto a morte do húngaro Miklos Feher, durante um jogo entre o Benfica e o Vitória de húngaro, que morreu aos 24 anos, Pavão também seguiu esse destino, num jogo entre o FC Porto e o Vitória inanimado durante um jogo devido a uma paragem cardíaca, tendo sido salvo pela rapidez da assistência

  10. Transfer^encia de Dados entre Grupos de Processos no Modelo BAR

    E-print Network

    Rodrigues, Luís E.T.

    comportamento de um sistema com n´os Racionais, ´e poss´ivel recorrer `a Teoria de Jogos[16], na qual o conjunto de interac¸c~oes entre n´os ´e visto como um jogo, em que os jogadores correspondem `as entidades e

  11. Jornal de Notcias Online Pas: Portugal

    E-print Network

    Instituto de Sistemas e Robotica

    jogo entre o Benfica e o Vitória de Guimarães, no Minho. "É um passo enorme na medicina desportiva. Com jogo entre o FC Porto e o Vitória de Setúbal, em 1973, assim como o basquetebolista Paulo Pinto, que Inglaterra, que caiu inanimado durante um jogo devido a uma paragem cardíaca, tendo sido salvo pela rapidez

  12. Scientific uncertainty and the assessment of risks posed by non-native freshwater fishes

    E-print Network

    Olden, Julian D.

    Recherche pour le De´veloppement (UR131), Antenne au Muse´um National d'Histoire Naturelle, 43 rue Cuvier by the editors and peer reviewed. Etymology of Ghoti George Bernard Shaw (1856-1950), polymath, playwright, Nobel Recherche pour le De´veloppement (UR131), Antenne au Muse´um National d'Histoire Naturelle, 43 rue Cuvier

  13. Proyecto final Metodos avanzados en aprendizaje automatico

    E-print Network

    Bellogin, Alejandro

    ANT (17754) 2 Cuadro 1: Estad´isticas del conjunto inicial N´um. ejemplos N´um. atributos 72702 42 resume algunas estad´isticas sobre el conjunto de datos inicial. Dado el gran n´umero de par´ametros es

  14. DETERMINING COARSE PARTICULATE MATTER CONCENTRATIONS: A PERFORMANCE EVALUATION OF CANDIDATE METHODOLOGIES - STUDY DESIGN AND RESULTS FROM THE RTP EQUIPMENT SHAKEDOWN

    EPA Science Inventory

    The main objective of this study is to evaluate the performance of candidate sampling methods for potential use as a Federal Reference Method (FRM) capable of providing an estimate of coarse particle (PMc: particulate matter with an aerodynamic diameter between 2.5 um and 10 um...

  15. DETERMINING COARSE PARTICULATE MATTER CONCENTRATIONS: A PERFORMANCE EVALUATION OF CANDIDATE METHODOLOGIES UNDER WINTERTIME CONDITIONS

    EPA Science Inventory

    The main objective of this study is to evaluate the performance of sampling methods for potential use as a Federal Reference Method (FRM) capable of providing an estimate of coarse particle (PMc: particulate matter with an aerodynamic diameter between 2.5 um and 10 um) mass con...

  16. Description of Globodera ellingtonae n. sp. (Nematoda: Heteroderidae) from Oregon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new species of cyst nematode, Globodera ellingtoni, is described from soil collected from a field with a cropping history including potatoes in Oregon. It is characterized in having second-stage juveniles (J2) with a body length of 450 um (365-515), stylet length of 20.9 um (19-22.5) with basal kn...

  17. I2C Demonstration Board 2005-1 Quick Start Guide Rev. 01 --13 June 2006 User manual

    E-print Network

    Berns, Hans-Gerd

    UM10206 I2C Demonstration Board 2005-1 Quick Start Guide Rev. 01 -- 13 June 2006 User manual Field Application Engineers, designers and educators to use their Personal Computer (PC) to easily test Semiconductors UM10206 I2C Demonstration Board 2005-1 Quick Start Guide Revision history Rev Date Description 01

  18. Ricardo Oliveira Duarte Storyteller_PT Email BURACOS NEGROS ESPAO FSICA INSTITUTO SUPERIOR TCNICO

    E-print Network

    Instituto de Sistemas e Robotica

    Ricardo Oliveira Duarte Storyteller_PT Email BURACOS NEGROS ESPAÇO FÍSICA INSTITUTO SUPERIOR negros." Investigador português ganha bolsa de um milhão e meio de euros - Obs... http buracos negros é importante porque estamos a perceber que a grande maioria das galáxias tem um buraco

  19. Paul Nurse entra no debate do financiamento cientfico

    E-print Network

    Instituto de Sistemas e Robotica

    esta área por Filomena Naves Michael Faraday, o aprendiz de encadernador que se tornou assistente de um suas invenções elétricas, Faraday terá respondido: "Senhor primeiro-ministro, um dia poderá cobrar económi- cos continuarem, ainda hoje, tal como o pri- meiro-ministro do tempo de Faraday, "a não

  20. Aufgaben: Rotation (3) Aufgabe 1 (Losung siehe Spong S. 44)

    E-print Network

    Moeller, Ralf

    Aufgaben: Rotation (3) Aufgabe 1 (L¨osung siehe Spong S. 44) Eine Rotation sei wie folgt, um die zu- sammengesetzte Rotation als nur eine Rotation darzustellen. Aufgabe 2 (L¨osung siehe Spong mit 3. Rotation um z2 mit Aufgabe 3 (L¨osung siehe Spong S. 46) Berechnen Sie die Rotationsmatrix f

  1. RADIATION BALANCE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The balance of energy on the earth's surface represents the difference between incoming and outgoing radiation. There are two components in both the incoming and ongoing fractions and are separated by wavelength as shortwave (less than 5 um) and longwave (greater than 5 um). Shortwave radiation or...

  2. The Role of Iron in Libby Amphibole-Induced Lung Injury and Inflammation

    EPA Science Inventory

    Complexation of host iron (Fe) on the surface of inhaled asbestos fibers has been postulated to cause oxidative stress contributing to in vivo pulmonary injury and inflammation. We examined the role of Fe in Libby amphibole (LA; mean length 4.99um ± 4.53 and width 0.28um ± 0.19)...

  3. NOTAS DISPERSAS SOBRE FILTRAGEM DE KALMAN

    E-print Network

    Ribeiro,Isabel

    . O problema da estima¸c~ao do estado de um Sistema Linear estoc'astico 'e tratado como um problema de (n~ao tratado nestas notas) â?? x(jjk); j = k ­ Filtragem #12; Notas Dispersas sobre Filtragem de

  4. UNIVERSIDADE TCNICA DE LISBOA INSTITUTO SUPERIOR TCNICO

    E-print Network

    Instituto de Sistemas e Robotica

    Visão para Robótica Móvel: Detecção de Obstáculos sobre Pavimento Plano José António da Cruz Pinto. A hipótese de deslocação do robot sobre um pavimento plano é usada explicitamente na caracterização do problema perceptual. Um obstáculo é definido como qualquer ponto não pertencente ao plano do pavimento

  5. Bambuina bambui: a new genus and species of cave cricket from Brazil (Orthoptera: Grylloidea: Phalangopsidae: Luzarinae).

    PubMed

    De Mello, Francisco De A G; Horta, Lília S; Bolfarini, Marcio P

    2013-01-01

    Bambuina bambui, um novo gênero e espécie de grilo falangopsídeo é descrito a partir de espécimes obtidos na Gruta do Centenário, uma caverna de quartzo localizada na Serra do Inficionado, um subconjunto de montanhas pertencentes ao complexo da Serra do Caraça no estado de Minas Gerais, Brasil. PMID:24583818

  6. UMR New Faculty Programs www.campus.umr.edu/newfac UMR Freshman Faculty Program www.campus.umr.edu/newfac/freshfac

    E-print Network

    Missouri-Rolla, University of

    in these activities. September 28-30 Building your Academic Portfolio; Lodge of Four Seasons, Lake Ozark February 22 experiences to enhance student learning; Lodge of Four Seasons, Lake Ozark #12;UMR Faculty Teaching Resource Cohen System-wide events for all NFTSs from the four UM campuses Participants in these UM-system events

  7. Lifetime estimation of intrinsic silicon nitride MIM capacitors in a gan MMIC process

    E-print Network

    Demirtas, Sefa

    We have studied the reliability of intrinsic SiN MIM capacitors designed for 48 V and 125 [superscript 0]C operation and manufactured in a GaN process flow. It is shown that very small area capacitors (10um x 10um) with a ...

  8. MASTER BIOS2 (BIO-MED) BIOPHYSIQUE, STRUCTURES et SYSTMES

    E-print Network

    Radulescu, Ovidiu

    MASTER BIOS2 (BIO-MED) BIOPHYSIQUE, STRUCTURES et SYSTÈMES Responsables: Ovidiu.Radulescu@um2.fr), Andrea.Parmeggiani@um2.fr (DIMNP-L2C) Torsten Wittmann - NIGMS Kusumi's lab Approcher et invéstiguer les défis de la biologie et la medicine par la biophysique, la biochimie structurale et la biologie des

  9. Introduo aos Sinais Pedro M. Q. Aguiar, Lus M. B. Almeida

    E-print Network

    Almeida, Luis B.

    de um sinal a |x(t)|2 (ou |x(n)|2 ). A energia total de um sinal é então denida como o integral (ou denições permitem classicar cada sinal como pertencendo a uma das seguintes classes: · Energia total nita, i.e., E Energia

  10. FSICA MODERNA I -2o SEMESTRE 2008 3a LISTA DE EXERCCIO

    E-print Network

    Ribas, Roberto Vicençotto

    emite raios X? Explique. (2) Um fóton de energia E tem massa? (3) Por que, no espalhamento Compton, é.124 nm. Qual a tensão de aceleração dos elétrons nesse tubo? R: 10 kV. 2. Um fóton de energia inicial de energia do fóton no espalhamento Compton, é igual a (h /moc2)(1 - cos ). 4. Qual a energia cinética máxima

  11. Universal IP Multicast Delivery # Beichuan Zhang

    E-print Network

    California at Los Angeles, University of

    lowers the deployment barrier of multicast technology by moving multicast functionality from routers islands to achieve ubiquitous multicast delivery. We intend UM to be a general framework that can work ``islands.'' The design of UM takes full advantage of deployed IP multi­ cast where available and utilizes

  12. Universal IP Multicast Delivery Beichuan Zhang

    E-print Network

    Zhang, Beichuan

    lowers the deployment barrier of multicast technology by moving multicast functionality from routers islands to achieve ubiquitous multicast delivery. We intend UM to be a general framework that can work "islands." The design of UM takes full advantage of deployed IP multi- cast where available and utilizes

  13. NUTRIENT LIMITATION OF PHYTOPLANKTON GROWTH AND PHYSIOLOGY IN A SUBTROPICAL ESTUARY (PENSACOLA BAY, FL)

    EPA Science Inventory

    Phytoplankton nutrient limitation was studied in a sub-estuary of lower Pensacola Bay using several techniques. Results for <5 um and . 5 um phytoplankton were similar. Nutrient-addition bioassays indicated year-round nutrient limitation, in contrast to seasonal patterns often ...

  14. Genetic and functional analysis of topoisomerase II in vertebrates 

    E-print Network

    Petruti-Mot, Anca

    2000-01-01

    line, which showed an increased resistance to topo II inhibitors. Paradoxically, 150 uM etoposide or 100 uM mitoxanthrone induced apoptosis within 5 hours in the topo ll? (-1+1+) cell line, more rapidly as compared to the normal DT 40 cells. A topo II?...

  15. JOVENS. DESEMPREGO ENTRE OS 15 E OS 24 ANOS PASSA OS 35% COMO CONSEGUIR

    E-print Network

    Instituto de Sistemas e Robotica

    as questões óbvias. Por Patrícia Silva AlveseAna Cláudia Damas Era um incentivo. Se Catarina Morei- ra fosse-lhe ao telefone. Catarina, com um mestrado em Sistemas de Informação Empresarial e média de 19 valores. "Vemos alguém que não sabe bem o que quer", explica Maria João Que- lhas, consultora da Page Personnel

  16. Optical-Fiber-to-Channel-Waveguide Coupler

    NASA Technical Reports Server (NTRS)

    Ramer, G. O.

    1983-01-01

    Holding device made by etching V-shaped grooves in silicon in coupler close tolerances are achieved for high-efficiency coupling between optical fibers with core diameter of 5 um and 110 um in cross section. Fibers are held in V-shaped grooves on silicon chips.

  17. USING CERAMIC MEMBRANES TO RECYCLE TWO NONIONIC ALKALINE METAL-CLEANING SOLUTIONS

    EPA Science Inventory

    One ZrO2 ultrafilter (0.05 um pore size) and two a-Al2O3 microfilters (0.2 and 0.8 um) were used to remove one synthetic ester oil and two polyalphaolefin-based and two petroleum hydrocarbon-based oils and greases from two nonionic alkaline cleaning solutions (e.g., Turco 4215-NC...

  18. CHARACTERIZATION OF A NEW THERMOPHILIC SULFATE-REDUCING BACTERIUM THERMODESULFOVIBRIO YELLOWSTONII GEN. NOV. AND SP. NOV.: ITS PHYLOGENETIC RELATIONSHIP TO THERMODESULFOBACTERIUM COMMUNE AND THEIR ORIGINS DEEP WITHIN THE BACTERIAL DOMAIN

    EPA Science Inventory

    A thermophilic sulfate-reducing vibrio isolated from thermal vent water in Yellowstone Lake, Wyoming USA, is described. he Gram-negative, curve rod-shaped cells averaged 0.3 um wide and 1.5 um long. hey were motile by means of a single polar flagellum. rowth was observed between ...

  19. Vo encerrar 16 cursos no superior

    E-print Network

    Instituto de Sistemas e Robotica

    Vão encerrar 16 cursos no superior por falta de procura Há um ano eram quase 200 mas nem todos encerraram. E há cursos que não podem aumentar vagas devido ao índice de desemprego Pl5 #12;Falta de procura encerra 16 cursos do ensino superior no próximo ano Há um ano, eram cerca de 200 na mesma situação, ainda

  20. THE BIMODAL DISTRIBUTION: DEVELOPMENT OF THE CONCEPT OF FINE AND COARSE PARTICLES AS SEPARATE AND DISTINCT COMPONENTS OF AIRBORNE PARTICULATE MATTER

    EPA Science Inventory

    In the early 1970s, it was understood that combustion particles were formed mostly in sizes below 1 um diameter, and windblown dust was suspended in sizes mostly above 1 um diameter. However, particle size distribution was thought of as a single mode. Particles were thought to f...

  1. Half-hairpin Array hybridization (July 2011) This protocol is used for the MSCV-driven shRNA retroviral library developed by

    E-print Network

    Richardson, David

    -hairpin DNA sequences PCR Primers JH353F: TAGTGAAGCCACAGATGTA HHR2L: ATGTATCAAAGAGATAGCAAGGTATTCAG The pair JH 10xdNTP 64 ul JH353F 4 ul (100 uM) JH353R 4 ul (100 uM) DMSO 16 ul HotstartTaq (5U/ul, Takara) 8 ul H

  2. (ura avio teleco-mandado no tri-

    E-print Network

    Instituto de Sistemas e Robotica

    Lançar um drone (ura avião teleco- mandado não tri- pulado) na Antárti- da e esperar que ele) controlou a ansie- dade e arriscou lançar o drone . O objetivo do 'Projeto 3D An- tártida' é ajudar'é perceber como o aumento da temperatura está a alterar o ecossistema A equipa lançou um drone de 20 mileuros

  3. Workshop On Definition Extraction 2009 -Borovets, Bulgaria, pages 2632, Evolutionary Algorithms for Definition Extraction

    E-print Network

    Workshop On Definition Extraction 2009 - Borovets, Bulgaria, pages 26­32, Evolutionary Algorithms for Definition Extraction Claudia Borg Dept. of I.C.S. University of Malta claudia.borg@um.edu.mt Mike Rosner Dept. of I.C.S. University of Malta mike.rosner@um.edu.mt Gordon Pace Dept. of Computer Science

  4. As interfaces grficas vem sendo desenvolvidas em TCL/TK em conjunto com a sua extenso, o iTCL/iTK.

    E-print Network

    de Figueiredo, Luiz Henrique

    Distribuída. SIBGRAPI'96. Caxambu, MG, Out., 1996. p. 15­22. C. Esperança et al., 3D Viewer: Um Visualizador 3D Utilizando OpenGL e TCL/TK. SIBGRAPI'96. Caxambu, MG, Out, 1996. p. 345­346. M. Zuffo et al., Um utilização de scanners espaciais, em especial na Medicina, como a Tomografia Computadorizada (TC

  5. Emerging High-Efficiency Low-Cost Solar Cell Technologies

    E-print Network

    McGehee, Michael

    (In,Ga)Se2 ~ 1-2 um c-Si ~ 180 um #12;Efficiency Records Chart available at: h6p://www.nrel.gov/ncpv/images/efficiency_chart.jpg. The chart above was downloaded on 2/27/2014. #12;National Renewable Energy Laboratory Goodrich AddiVonal NREL Contributors: #12;21 An Example Process Flow for Making Single

  6. DEVELOPMENT OF A SAMPLING PROCEDURE FOR LARGE NITROGEN- AND SULFUR-BEARING AEROSOLS

    EPA Science Inventory

    A single-stage impactor was modified to utilize a removable TFE impaction surface mounted on the end of an annular denuder. hen used with a polycarbonate filter coated with silicone oil, its cut point was 2.5 um and bounce was <1% for 8-um particles. ignificant bounce occurred wi...

  7. TRIBUTYLTIN AND DEXAMETHASONE INDUCE APOPTOSIS IN RAT THYMOCYTES BY MUTUALLY ANTAGONISTIC MECHANISMS

    EPA Science Inventory

    We observed that rat thymocyte cultures exposed to 1.O'- 2. 5 uM tri-n-butyltin methoxide (TBT) exhibiteda rapid time- and concentration-dependent induction of apoptosis, with > 85% of cells exhibiting reduced DNAcontent within 1 hr after ensure to 2.0 - 2,5 uM TBT. Moreover, wit...

  8. Universidade Estadual de Campinas Instituto de Matemtica, Estatstica e Computao Cientfica

    E-print Network

    Torres, Fernando

    matemático irlandês, Sir William Rowan Hamilton (1805-1865), deu a fundamentação definitiva dos números de números reais (, ). A partir desta observação, Hamilton desenvolve a teoria formalmente, definindo: (, ) + (, ) = ( + , + ) (, )(, ) = ( - , + ) Hamilton adota um ponto de vista formal. Ele era também um físico e percebia claramente as implicações de

  9. Study of factors affecting growth and cold acclimation of Vitis callus cultures

    SciTech Connect

    Deng, L.

    1987-01-01

    In vitro grape tissue culture initiation, growth, and cold acclimation were studied. Factors involved were genotypes, media, plant growth regulators, age, light, temperature, antioxidant, clearing and adsorbing agents, sucrose level, osmotic potential, ABA, chilling and freezing treatments. Murashige and Skoog (MS) medium containing 1 ..mu..M 2,4-d + 0.1 uM Ba, MS containing 1 uM 2,4-D, and woody plant medium containing 1 uM 2,4-D + 0.1 uM BA produced abundant callus tissue for most grape genotypes; either WPM or MS containing 1 uM BA stimulated shoot growth in all the 12 genotypes tested. Adding 1 uM abscisic acid (ABA) to the B5 medium with 1 uM 2,4-D and 0.5 uM BA enhanced growth and quality of Chancellor callus. /sup 3/H-ABA was taken up actively by callus tissue at 12 days after subculture, but by 20 d this effect disappeared. When /sup 14/C-sucrose was added to the medium. /sup 14/C level of cells reached a plateau after 48 h; this plateau was higher if ABA was also present in the medium. Cells on media containing ABA were larger in size, lighter in color, and more loosely connected.

  10. The mid-IR Luminosity Function at z<0.3 from 5MUSES: Understanding the Star-formation/AGN Balance from a Spectroscopic View

    E-print Network

    Wu, Yanling; Helou, George; Armus, Lee; Dale, Daniel A; Papovich, Casey; Rahman, Nurur; Dasyra, Kalliopi; Stierwalt, Sabrina

    2011-01-01

    We present rest-frame 15 and 24 um luminosity functions and the corresponding star-forming luminosity functions at z<0.3 derived from the 5MUSES sample. Spectroscopic redshifts have been obtained for ~98% of the objects and the median redshift is ~0.12. The 5-35 um IRS spectra allow us to estimate accurately the luminosities and build the luminosity functions. Using a combination of starburst and quasar templates, we quantify the star-formation and AGN contributions in the mid-IR SED. We then compute the star-formation luminosity functions at 15 um and 24 um, and compare with the total 15 um and 24 um luminosity functions. When we remove the contribution of AGN, the bright end of the luminosity function exhibits a strong decline, consistent with the exponential cutoff of a Schechter function. Integrating the differential luminosity function, we find that the fractional contribution by star formation to the energy density is 58% at 15 um and 78% at 24 um, while it goes up to ~86% when we extrapolate our mid...

  11. Vienna in the Early Twentieth Century: The Cultural Response to Modernization. Curriculum Units, NEH Institute, Summer 1993.

    ERIC Educational Resources Information Center

    Oregon Univ., Eugene.

    These curriculum units were developed by participants in the National Endowment for the Humanities seminar at the University of Oregon in 1993. The lessons include: (1) "Schule, Freunde, Liebe: Wien um die Jahrhundertwende (School, Friends, Love: Vienna at the Turn of the Century)" (Linda Hansen; Glenn Tetterton-Opheim); (2) "Kultur in Wien um die…

  12. The Michigan Data Science Initiative Challenge thrust information and teaming meetings

    E-print Network

    -TS) · Hadoop, SPARK · SQL, NoSQL databases · Analytics Platforms · Integration with HPC Flux Platform UM, SPARK · SQL, NoSQL databases · Analytics Platforms · Integration with the Flux HPC Platform #12;U-M Data- portation Social Sciences Health Sciences Analytics and Visualization of Complex Data Machine Learning

  13. Optimizac~ao e Algoritmos (2004/2005) Instituto Superior Tecnico Engenharia Electrotecnica e de Computadores

    E-print Network

    Instituto de Sistemas e Robotica

    resolver (1) aproximadamente. Ou seja, basta localizar um ponto "aceit´avel". O algoritmo para localiza¸c~ao de pontos aceit´aveis (introduzido na s´erie de problemas anterior) est´a reproduzido na tabela 2. 1¸c~ao de um ponto aceit´avel Coment´arios: · Iremos usar sempre a regra de Wolfe A = { t > 0 : (t) (0

  14. 28 Mdulo do Programa de Aperfeioamento para Professores de Matemtica do Ensino Mdio (PAPMEM) -Parceria UFMG/IMPA

    E-print Network

    Procacci, Aldo

    .sbm.org.br/index.php/temas-e-problemas-elementares.html). O curso é gratuito e os candidatos nono anos (7ª e 8ª séries) do Ensino Fundamental ou licenciados em Matemática. O curso se realizará em frequentes receberão um certificado de Curso de Atualização emitido pela Pró-Reitoria de Extensão da UFMG, um

  15. Chapter 1 Overview of the University (5 Chapter 1 Overview of the University

    E-print Network

    Awtar, Shorya

    the graduation of 11 men. Women were first admitted in 1870. The University has grown to include 19 schools Medical School 1850 Law School 1859 College of Literature, Science & the Arts 1875 School of Dentistry.2.1 Student Enrollment, Fall 1841-2014. SOURCE: U-M Statistical Reference Book (1966); U-M Office

  16. Sex GENOTYPING PROTOCOL PCR PROTOCOL NAME: Sex1

    E-print Network

    Shoubridge, Eric

    Sex GENOTYPING PROTOCOL GENE NAME: PCR PROTOCOL NAME: Sex1 PCR REAGENTS: 10X NEB THERMOPOL PCR) PRIMERS: Sex1 Forward (20uM Standard Working Concentration) Sex1 Reverse (20uM Standard Working CONDITIONS: Sex (or Sex1) 95 C for 3 min 95 C for 30 sec 60 C for 1 min 35 cycles

  17. Universidade Federal do Rio Grande do Sul Instituto de Fisica Departamento de Fisica

    E-print Network

    Arenzon, Jeferson J.

    for um disco uniforme, e se m = M, a energia cin´etica de translac¸~ao do corpo suspenso ser´a o dobro da energia cin´etica de rotac¸~ao do disco. d) Se o objeto for um disco uniforme de raio R = 12 cm e M = 400

  18. U.S.-MEXICO BORDER PROGRAM ARIZONA BORDER STUDY--PARTICULATE MATTER IN AIR ANALYTICAL RESULTS

    EPA Science Inventory

    The Particulate Matter in Air data set contains analytical results for measurements of 2 particle sizes in 344 air samples over 86 households. Samples were taken by pumping standardized air volumes through filters using impactors with a 10-um outpoint or with a 2.5-um outpoint. ...

  19. GHG Inventory Update Summary December 2014

    E-print Network

    Vonessen, Nikolaus

    December 2014 and indicated a reduction in overall emissions. UM's 2011 and 2012 inventories also indicated1 GHG Inventory Update Summary December 2014 Data: FY 2013 & FY 2014 Submitted by: Eva Rocke biannual updates to university greenhouse gas (GHG) inventories. UM's third update was completed in early

  20. Mater. Res. Soc. Symp. Proc. Vol. 1346 2011 Materials Research Society DOI: 10.1557/opl.2011.

    E-print Network

    Kummel, Andrew C.

    of single cell seceretions. Two methods of deep silicon etching were compared: cryogenic deep reactive ion substrate. Cryogenic DRIE allowed for the reliable fabrication of 75-100um deep microwells with 60x60um from small numbers of tumor cells. Several existing techniques such as flow cytometry, ELISA

  1. Effects of temperature on near-infrared spectroscopic measurement of glucose 

    E-print Network

    Jung, Byung Jo

    1998-01-01

    spectra (2.0-2.5 Jim) of glucose solution. It is known that the positions of water absorption bands centered at 1.923 and 2.623 um depend heavily on temperature effects while the glucose bands (-2.105, 2.237, and 2.326 um) are temperature insensitive...

  2. TPC-like readout for thermal neutron detection using a GEM-detector

    E-print Network

    Flierl, Bernhard; Hertenberger, Ralf; Zeitelhack, Karl

    2015-01-01

    Spatial resolution of less than 200 um is challenging for thermal neutron detection. A novel readout scheme based on the time-projection-chamber (TPC) concept is used in a gaseous electron multiplier (GEM) detector. Thermal neutrons are captured in a single 2 um thick Boron-10 converter cathode and secondary Helium and Lithium ions are produced with a combined energy of 2.8 MeV. These ions have sufficient energy to form straight tracks of several mm length. With a time resolving 2-dimensional readout of 400 um pitch in both directions, based on APV25 chips, the ions are tracked and their respective origin in the cathode converter foil is reconstructed. Using an Ar-CO2 93:7% gas mixture, a resolution of 100 um (FWHM 235 um) has been observed with a triple GEM-detector setup at the Garching neutron source (FRMII) for neutrons of 4.7 Angstrom.

  3. TPC-like readout for thermal neutron detection using a GEM-detector

    E-print Network

    Bernhard Flierl; Otmar Biebel; Ralf Hertenberger; Karl Zeitelhack

    2015-09-08

    Spatial resolution of less than 200 um is challenging for thermal neutron detection. A novel readout scheme based on the time-projection-chamber (TPC) concept is used in a gaseous electron multiplier (GEM) detector. Thermal neutrons are captured in a single 2 um thick Boron-10 converter cathode and secondary Helium and Lithium ions are produced with a combined energy of 2.8 MeV. These ions have sufficient energy to form straight tracks of several mm length. With a time resolving 2-dimensional readout of 400 um pitch in both directions, based on APV25 chips, the ions are tracked and their respective origin in the cathode converter foil is reconstructed. Using an Ar-CO2 93:7% gas mixture, a resolution of 100 um (FWHM 235 um) has been observed with a triple GEM-detector setup at the Garching neutron source (FRMII) for neutrons of 4.7 Angstrom.

  4. Submillimeter Polarization Spectrum in the Vela C Molecular Cloud

    E-print Network

    Gandilo, Natalie N; Angilè, Francesco E; Ashton, Peter; Benton, Steven J; Devlin, Mark J; Dober, Bradley; Fissel, Laura M; Fukui, Yasuo; Galitzki, Nicholas; Klein, Jeffrey; Korotkov, Andrei L; Li, Zhi-Yun; Martin, Peter G; Matthews, Tristan G; Moncelsi, Lorenzo; Nakamura, Fumitaka; Netterfield, Calvin B; Novak, Giles; Pascale, Enzo; Poidevin, Frédérick; Santos, Fabio P; Savini, Giorgio; Scott, Douglas; Shariff, Jamil A; Soler, Juan Diego; Thomas, Nicholas E; Tucker, Carole E; Tucker, Gregory S; Ward-Thompson, Derek

    2015-01-01

    Polarization maps of the Vela C molecular cloud were obtained at 250um, 350um, and 500um during the 2012 flight of the balloon-borne telescope BLASTPol. These measurements are used in conjunction with 850um data from Planck to study the submillimeter spectrum of the polarization fraction for this cloud. The spectrum is relatively flat and does not exhibit the minimum at \\lambda ~350um observed in previous measurements of other molecular clouds. The shape of the spectrum does not depend strongly on the radiative environment of the dust, as quantified by the column density or the dust temperature obtained from Herschel data. The polarization ratios observed in Vela C are consistent with a model of a porous clumpy molecular cloud being uniformly heated by the interstellar radiation field.

  5. Infrared Properties of Radio-Selected Submillimeter Galaxies in the Spitzer First Look Survey Verification Field

    E-print Network

    D. T. Frayer; S. C. Chapman; L. Yan; L. Armus; G. Helou; D. Fadda; R. Morganti; M. A. Garrett; P. Appleton; P. Choi; F. Fang; I. Heinrichsen; M. Im; M. Lacy; F. Marleau; F. J. Masci; D. L. Shupe; B. T. Soifer; G. K. Squires; L. J. Storrie-Lombardi; J. A. Surace; H. I. Teplitz; G. Wilson

    2004-06-15

    We report on submillimeter and infrared observations of 28 radio-selected galaxies in the Spitzer First Look Survey Verification field (FLSV). All of the radio-selected galaxies that show evidence for emission at 850um with SCUBA have Spitzer counterparts at 24um, while only half of the radio-selected galaxies without 850um emission have detectable counterparts at 24um. The data show a wide range of infrared colors (S70/S24 < 5--30, S8/S3.6 < 0.3--4), indicative of a mixture of infrared-warm AGN and cooler starburst dominated sources. The galaxies showing 850um emission have Spitzer flux densities and flux density ratios consistent with the range of values expected for high-redshift (z=1--4) ultraluminous infrared galaxies.

  6. Digital PCR Validates 8q Dosage as Prognostic Tool in Uveal Melanoma

    PubMed Central

    Versluis, Mieke; de Lange, Mark J.; van Pelt, Sake I.; Ruivenkamp, Claudia A. L.; Kroes, Wilma G. M.; Cao, Jinfeng; Jager, Martine J.; Luyten, Gre P. M.; van der Velden, Pieter A.

    2015-01-01

    Background Uveal melanoma (UM) development and progression is correlated with specific molecular changes. Recurrent mutations in GNAQ and GNA11 initiate UM development while tumour progression is correlated with monosomy of chromosome 3 and gain of chromosome 8q. Hence, molecular analysis of UM is useful for diagnosis and prognosis. The aim of this study is to evaluate the use of digital PCR (dPCR) for molecular analysis of UM. Methods A series of 66 UM was analysed with dPCR for three hotspot mutations in GNAQ/GNA11 with mutation specific probes. The status of chromosomes 3 and 8 were analysed with genomic probes. The results of dPCR analysis were cross-validated with Sanger sequencing, SNP array analysis, and karyotyping. Results Using dPCR, we were able to reconstitute the molecular profile of 66 enucleated UM. With digital PCR, GNAQ/GNA11 mutations were detected in 60 of the 66 UM. Sanger sequencing revealed three rare variants, and, combined, these assays revealed GNAQ/GNA11 mutations in 95% of UM. Monosomy 3 was present in 43 and chromosome 8 aberrations in 52 of the 66 UM. Survival analysis showed that increasing 8q copy numbers were positively correlated with metastasis risk. Conclusion Molecular analysis with dPCR is fast and sensitive. Just like the recurrent genomic aberrations of chromosome 3 and 8, hotspot mutations in GNAQ and GNA11 are effectively detected in heterogeneous samples. Increased sensitivity contributes to the number of mutations and chromosomal aberrations detected. Moreover, quantification of copy number with dPCR validated 8q dosage as a sensitive prognostic tool in UM, of which implementation in disease prediction models will further improve prognostication. PMID:25764247

  7. Spitzer observations of MAMBO galaxies: weeding out active nuclei in starbursting proto-ellipticals

    E-print Network

    R. J. Ivison; T. R. Greve; S. Serjeant; F. Bertoldi; E. Egami; A. M. J. Mortier; A. Alonso-Herrero; P. Barmby; L. Bei; H. Dole; C. W. Engelbracht; G. G. Fazio; D. T. Frayer; K. D. Gordon; D. C. Hines; J. -S. Huang; E. Le Floch; K. A. Misselt; S. Miyazaki; J. E. Morrison; C. Papovich; P. G. Perez-Gonzalez; M. J. Rieke; G. H. Rieke; J. Rigby; D. Rigopoulou; I. Smail; G. Wilson; S. P. Willner

    2004-06-07

    We present Spitzer observations in five wavebands between 3.6 and 24um of an unbiased sample of 9 luminous, dusty galaxies selected at 1200um by the MAMBO camera on the IRAM 30-m telescope, a population akin to the well-known submm or `SCUBA' galaxies (hereafter SMGs). Owing to the coarse resolution of submm/mm instrumentation, SMGs have traditionally been difficult to identify at other wavelengths. We compare our multi-wavelength catalogs to show that the overlap between 24 and 1200um must be close to complete at these flux levels. We find that all (4/4) of the most secure >=4sigma SMGs have robust >=4sigma counterparts at 1.4GHz, while the fraction drops to 7/9 using all >=3sigma SMGs. We show that combining mid-IR and marginal (>=3sigma) radio detections provides plausible identifications in the remaining cases, enabling us to identify the complete sample. Accretion onto an obscured central engine is betrayed by the shape of the mid-IR continuum emission for several sources, confirming Spitzer's potential to weed out active galaxies. We demonstrate the power of a S(24um)/S(8um) vs S(8um)/S(4.5um) color-color plot as a diagnostic for this purpose. However, we conclude that the majority (~75%) of SMGs have rest-frame mid-/far-IR SEDs commensurate with obscured starbursts. Sensitive 24-um observations are clearly a useful route to identify and characterize reliable counterparts to high-redshift far-IR-bright galaxies, complementing what is possible via deep radio imaging.

  8. [What change was caused under short-time treatment by the Ueda method for severely disabled infants with cerebral palsy? Report of two cases].

    PubMed

    Tojo, M

    1998-01-01

    A new physical therapy, Ueda method (UM), were performed on two patients with severe motor and intellectual disabilities syndrome and spastic cerebral palsy (CP). The period of the UM therapy was 5 days in one case with spastic CP and 10 days in another case with rigo-spastic CP. They showed the remarkable reduction of abnormal muscle tone and interesting phenomena such as postural changes of extremities and changes of some primitive reflexes. First, peculiar postures of treated extremities appeared on the first day of the UM therapy, associated with the reducing muscle tone of extremities only in the treated side. One case showed immediate change of the posture of treated upper extremity from internal to external rotation of the shoulder joint. Another case disclosed immediate appearance of internal rotation of the hip joint of the treated lower extremity and scissoring posture of legs. These phenomena were transient and disappeared under the UM treatment. Secondly, interesting phenomena in some primitive reflexes were observed after the beginning of the UM therapy. Moro reflex was elicited only in the treated upper extremity, which could not be obtained by stimuli before the UM therapy. After the UM therapy on bilateral arms. Moro reflex appeared bilaterally in two cases. On the other hand, the degree of asymmetrical tonic neck reflex (ATNR) in one case with spastic CP reduced on 5th days under the UM therapy. In another case with rigo-spastic CP automatic walking disappeared on 3rd days after the UM therapy and ATNR appeared. The first phenomena could be due to imbalances of the reduced muscle tones by the UM therapy. Second phenomena could result from the interaction between the nervous systems of Moro reflex, ATNR and automatic walking and the nervous system owing to the abnormal muscle hypertone. Moro reflex might be suppressed by abnormal muscle hypertone. The disappearance of some primitive reflexes might not depend on the maturation of the central nervous system. PMID:9436413

  9. Characterization of Extragalactic 24micron Sources in the Spitzer First Look Survey

    E-print Network

    Lin Yan; G. Helou; D. Fadda; F. R. Marleau; M. Lacy; G. Wilson; B. T. Soifer; I. Drozdovsky; F. Masci; L. Armus; H. I. Teplitz; D. T. Frayer; J. Surace; L. J. Storrie-Lombardi; P. N. Appleton; S. Chapman; P. Choi; F. Fan; I. Heinrichsen; M. Im; M. Schmitz; D. L. Shupe; G. K. Squires

    2004-05-31

    In this Letter, we present the initial characterization of extragalactic 24um sources in the Spitzer First Look Survey (FLS) by examining their counterparts at 8um and R-band. The color-color diagram of 24-to-8 vs. 24-to-0.7um is populated with 18,734 sources brighter than the 3sigma flux limit of 110uJy, over an area of 3.7sq.degrees. The 24-to-0.7um colors of these sources span almost 4 orders of magnitudes, while the 24-to-8um colors distribute at least over 2 orders of magnitudes. In addition to identifying ~30% of the total sample with infrared quiescent, mostly low redshift galaxies, we also found that: (1) 23% of the 24um sources (~1200/sq.degrees) have very red 24-to-8 and 24-to-0.7 colors and are probably infrared luminous starbursts with L(IR)>3x10^(11)Lsun at z>1. In particular, 13% of the sample (660/sq.degrees) are 24um detected only, with no detectable emission in either 8um or R-band. These sources are the candidates for being ULIRGs at z>2. (2) 2% of the sample (85/sq.degrees) have colors similar to dust reddened AGNs, like Mrk231 at z~0.6-3. (3) We anticipate that some of these sources with extremely red colors may be new types of sources, since they can not be modelled with any familiar type of spectral energy distribution. We find that 17% of the 24um sources have no detectable optical counterparts brighter than R limit of 25.5mag. Optical spectroscopy of these optical extremely faint 24um sources would be very difficult, and mid-infrared spectroscopy from the Spitzer would be critical for understanding their physical nature (Abridged).

  10. Resonances and Tides in Natural Satellites Systems. (Breton Title: Ressonâncias e Marés em Sistemas de Satélites Naturais.) Resonancias y Mareas en Sistemas de Satélites Naturales

    NASA Astrophysics Data System (ADS)

    Callegari, Nelson, Jr.

    2006-12-01

    In this work we describe some aspects of the dynamics of the mean-motion resonances. Emphasis to the case of resonances between regular satellites of the giant planets will be given, even so some aspects of the physics of the resonances in extra-solar planetary systems are also briefly treated. The role of the resonances in satellites systems is discussed through examples, showing how certain resonances, and its relations with the tidal dissipation effects, can be the key of the explanation of some phenomena still not explained in the Solar System. Amongst some examples we highlight the problem of the resurfacing of Enceladus, the existence of active volcanoes in Io, and the possible existence of the subsurface ocean in Europe. This work has as objective the divulgation of some topics in Celestial Mechanics and Planetary Sciences for an undergraduate public in exact sciences, as Astronomy and Physics, and not their detailed description. Neste trabalho descrevemos alguns aspectos da dinâmica de ressonâncias de movimentos médios. Será dada ênfase maior ao caso de ressonâncias entre satélites regulares dos planetas gigantes, embora alguns aspectos da física das ressonâncias em sistemas planetários extra-solares também sejam discutidos brevemente. A importância do estudo de ressonâncias em sistemas de satélites é discutida mais detalhadamente através de exemplos, mostrando como certas ressonâncias e suas relações com efeitos de dissipação de maré podem ser a chave de parte da explicação de alguns fenômenos ainda não explicados no Sistema Solar. Dentre vários exemplos destacamos o problema da remodelagem da superfície do satélite Enceladus, a existência de vulcões ativos em Io, e a possível existência do oceano subterrâneo em Europa. Este trabalho tem como objetivo a divulgação de alguns tópicos de Mecânica Celeste e Planetologia para um público de nível de graduação em disciplinas na área de exatas, em especial Astronomia e Física, e não a descrição detalhada dos conceitos aqui discutidos. Describimos en este trabajo algunos aspectos de la dinámica de resonancias de movimientos promedio. Será dado un énfasis mayor al caso de las resonancias entre satélites regulares de los planetas gigantes, aunque también son discutidos brevemente algunos aspectos de la física de resonancias en sistemas panetarios extrasolares. La importancia del estudio de las resonancias en sistemas de satélites es discutida más detalladamente através de ejemplos, mostrando cómo ciertas resonancias y los efectos de disipación por mareas pueden ser la clave de parte de la explicación de algunos fenómenos aún no comprendidos en el Sistema Solar. Entre varios ejemplos se destacan el problema de la superficie remodelada del satélite Enceladus, la existencia de volcanes activos en Io y la posible existencia de un océano subterráneo en Europa. Este trabajo tiene como objetivo la divulgación de algunos tópicos en Mecánica Celeste y Planetología para un público universitario de ciencias exactas, en particular Astronomía y Física, y no la descripción detallada de los conceptos aquí discutidos.

  11. High School Students' Previous Knowledge about the Stars. (Spanish Title: Conocimientos Previos de Estudiantes de Secundaria Acerca de Las Estrellas.) O Conhecimento Prévio de Alunos do Ensino Médio sobre as Estrelas

    NASA Astrophysics Data System (ADS)

    Iachel, Gustavo

    2011-12-01

    Based on the readings of articles related to Astronomy Education published in Brazil, it was noticed a lack of research on previous knowledge of students about the physical characteristics of stars, a fact that motivated us to develop this study. Previous knowledge of 125 students (approximated 15 years old) constituted the study sample; data was collected through written questionnaires (Appendix A) for analysis. From the content analysis of these responses it was possible to achieve some inferences as, for example, many students have some difficult to develop an explanatory model on the functioning of a star; there are few who say that the stars have a certain length of existence; some students have said that stars have tips; few recognize that a star is formed by a mass of gas; some previous knowledge come from purely visual aspects; furthermore, some students do not have the habit of observing nature in detail. We see this research as a reference in which science teachers can recognize the importance of previous knowledge for practice teaching and acquire resources for planning their lessons. De la lectura de artículos relacionados con la Educación en Astronomía publicados en el Brasil, se encuentra una falta de investigaciones acerca del conocimiento previo de los estudiantes sobre las características físicas de las estrellas, hecho que nos motivó a desarrollar este estudio. Los datos analizados se obtuvieron al aplicar un cuestionario a 125 estudiantes de secundaria, para posteriormente realizar un análisis de contenido, tal cuestionario se presenta en el Anexo A. Al realizar el análisis de contenido de las respuestas obtenidas, fue posible hacer algunas inferencias, como por ejemplo; muchos estudiantes tienen dificultades para desarrollar un modelo explicativo acerca del funcionamiento de una estrella; pocos estudiantes dicen que las estrellas tienen un cierto tiempo de vida; algunos estudiantes imaginan que las estrellas tienen puntas; pocos reconocen que una estrella es formada por una masa de gas; varios conocimientos previos parten de aspectos puramente visuales; por otro lado, los estudiantes no tienen el hábito de observar la naturaleza detalladamente, entre otros problemas. Vemos esta investigación como una probable fuente de referencia en la que los profesores de ciencias pueden reconocer la importancia del conocimiento previo, y la forma como interfieren con su práctica de enseñanza, además de la adquisición de recursos para la planificación de sus clases. Com base em leituras de artigos relacionados ao ensino de Astronomia publicados no Brasil, verificou-se a inexistência de investigações sobre o conhecimento prévio de estudantes acerca das características físicas das estrelas, fato que nos motivou a desenvolver a pesquisa apresentada. Os conhecimentos prévios de 125 estudantes do primeiro ano do ensino médio constituíram os dados do estudo, os quais foram inferidos através da análise das respostas cedidas em questionários impressos (Apêndice A). A partir da análise de conteúdo dessas respostas tornou-se possível realizar algumas inferências como, por exemplo: vários estudantes possuem dificuldade em elaborar um modelo explicativo sobre o funcionamento de uma estrela; são poucos os que dizem que as estrelas possuem certo tempo de existência; alguns alunos as imaginam com pontas; poucos reconhecem que uma estrela é formada por uma massa de gás; vários conhecimentos prévios partem de aspectos meramente visuais; ainda assim, os estudantes não possuem o hábito de observar a natureza mais detalhadamente, entre outras. Vemos essa pesquisa como uma provável fonte de consulta na qual os professores de ciências poderão, além de reconhecer a importância dos conhecimentos prévios para o ensino e como eles interferem em sua prática, adquirir subsídios para o planejamento de suas aulas.

  12. The Astronomy Club of Araranguá: Educating Science Teachers as Science Communicators. (Breton Title: Clube de Astronomia de AraranguÁ: a Formação de Professores de Ciências Como Divulgadores Científicos. ) Club de Astronomía de Araranguá: la Formación del Profesorado Como Comunicadores de la Ciencia

    NASA Astrophysics Data System (ADS)

    Damasio, Felipe; Allain, Olivier; Antunes Rodrigues, Adriano

    2013-07-01

    The study reported in this work takes place since 2009 at the Federal Institute of Education, Science and Technology of Santa Catarina, Campus Araranguá. Our main goal is to help form teachers, training undergraduate students in Natural Sciences with specialization in Physics as science communicators, as well as to promote actions of broader scientific popularization in the region of the town of Araranguá through an Astronomy Club called CA2. Among the actions of scientific popularization that the students promote are: video production, radio broadcasts, lectures, nightly observations, preparation and exhibition of posters, physics teaching for children, continuing education activities for teachers and regular physics teaching using Astronomy as a theme. The Club's teacher education and scientific dissemination work is based on the Theory of Meaningful Learning, always trying to reach the student's predisposition to learn and produce potentially meaningful material, the two essential conditions for meaningful learning to occur. O estudo que este trabalho relata ocorre desde 2009 no Instituto Federal de Educação, Ciência e Tecnologia de Santa Catarina, campus Araranguá. Nele procura-se formar divulgadores científicos durante a formação inicial de docentes do curso de Licenciatura em Ciências da Natureza com habilitação em Física, além de promover ações de divulgação científica para o público geral da região da cidade de Araranguá por meio de um Clube de Astronomia chamado CA² (Clube de Astronomia de Araranguá). Entre as ações de divulgação científica que os licenciandos promovem estão: produção de vídeos, programas de rádio, palestras, observações noturnas, confecção e exposição de pôsteres, ensino de física para crianças, formação continuada de professores em atividades e ensino de Física regular utilizando a Astronomia como tema gerador. O trabalho de formação docente e divulgação científica do Clube fundamenta-se na Teoria da Aprendizagem Significativa, sempre procurando alcançar a pré-disposição em aprender e produzir material potencialmente significativo, as duas condições necessárias para que a aprendizagem significativa ocorra. El estudio relatado en este trabajo se lleva a cabo desde 2009 en el Instituto Federal de Educação, Ciência e Tecnología de Santa Catarina, campus Araranguá. En él se busca formar a comunicadores de la ciencia durante la formación inicial de los docentes Licenciatura en Ciencias Naturales con especialidad en Física, y también promover acciones de divulgación científica para el público en general en la región de Araranguá a través de un club de astronomía llamado CA2 (Clube de Astronomia Araranguá). Entres las acciones de los estudiantes que se promueven están: producción de videos, programas de radio, conferencias, observaciones nocturnas, la preparación y exposición de carteles, la educación en física para los niños, actividades de formación permanente del profesorado y enseñanza de la física de con el tema generador Astronomía. El trabajo de la formación del profesorado y la difusión de club científico se basa en la teoría del aprendizaje significativo, buscando siempre la predisposición para aprender y producir material potencialmente significativo, las dos condiciones necesarias para que ocurra el aprendizaje significativo.

  13. Conversations with Marcgrave: the Origin of Modern Astronomy in the Southern Hemisphere (Spanish Title: Conversando con Marcgrave: El Origen de la Astronomía Moderna en el Hemisferio Sur) Conversando Com Marcgrave: a Origem da Moderna Astronomia no Hemisfério Sul

    NASA Astrophysics Data System (ADS)

    Medeiros, Alexandre; Araújo, Fábio

    2005-12-01

    The year 2004 signals the 400th anniversary of the birth of count Mauricio of Nassau, an important character in the history of Brazil. The present text is related to the period of Dutch domination in Pernambuco. The article attempts to rescue the beginnings of Astronomy study in the South hemisphere. Therefore, we idealized a dramatization of a fictitious interview with German astronomer Georg Marcgrave, who was the constructor of the first astronomical observatory in this hemisphere and the author of the first systematic astronomical observations using telescopes in this side of the world. Our "conversation" with Marcgrave is idealized in the old Recife scenario, a place where he lived in Mauricio of Nassau's period and gathers some fellow teachers who love the teaching of Astronomy. The story, this way, is reported in a possibly light and funny atmosphere. Nevertheless, the conceptual and historical framework presented is based on reliable bibliographical sources pointed out at the end of the text. The sources range from the original book of that scientist, in which a solar eclipse is reported, passing through some other classical texts, such as that of Professor Juliano Moreira, up to more recent sources such as the very influential work of professor John North. Other influential texts about the Dutch period in Brazil, such as the classical works of Charles Boxer, Bouman and Boogaart, among others, are also used in the construction of this pedagogical dramatization, which involves an interesting chapter of the history of Astronomy. El año 2004 marca los 400 años del nacimineto del conde Mauricio de Nassau, un importante personaje de la historia del Brasil. El presente texto está relacionado con el período del dominio holandés en Pernambuco. El artículo intenta rescatar los comienzos del estudio de la Astronomía en el hemisferio Sur. Para esto, ideamos una dramatización de una entrevista ficticia con el astrónomo alemán Georg Marcgrave, constructor del primer observatorio astronómico del hemisferio y autor de las primeras observaciones astronómicas sistemáticas utilizando telescopios de este lado del mundo. Nuestra "conversación" con Marcgrave es imaginada en el marco del Recife antiguo, lugar donde él vivió durante el período de Mauricio de Nassau, y reune algunos colegas profesores apasionados por la enseñanza de la Astronomía. La historia es contada, de esta forma, dentro de un clima ameno y hasta un poco divertido, si bien las informaciones históricas y conceptuales contenidas en ella están basadas en fuentes bibliográficas confiables, debidamente referenciadas al final del texto. Estas fuentes van desde la obra original de este científico, en la cual aparece su relato sobre la observación de un eclipse solar en Recife, pasando por obras clásicas respecto de él mismo, como la del profesor Juliano Moreira, hasta fuentes mucho más recientes como el influyente trabajo del profesor John North. Otros textos importantes referidos al período de la colonización holandesa en el Brasil, tales como las obras clásicas de Charles Boxer, Bouman y Boogaart entre otros, son también utilizados en la construcción de esta dramatización pedagógica que se refiere a un interesante capítulo de la Historia de la Astronomía. O ano de 2004 assinala os 400 anos do nascimento do conde Maurício de Nassau, um importante personagem da história do Brasil. O presente texto está relacionado com o período do domínio holandês em Pernambuco. O artigo tenta resgatar o começo do estudo da Astronomia no hemisfério Sul. Para tal, idealizamos uma dramatização de uma entrevista fictícia com o astrônomo alemão Georg Marcgrave, construtor do primeiro observatório astronômico deste hemisfério e autor das primeiras observações astronômicas sistemáticas com o uso de telescópios neste lado do mundo. Nossa "conversa" com Marcgrave é idealizada no cenário do Recife antigo, local em que ele viveu no período de Maurício de Nassau e reúne alguns colegas professores apaixonados

  14. Value of the Qrs-T Angle in Predicting the Induction of Ventricular Tachyarrhythmias in Patients with Chagas Disease.

    PubMed

    Zampa, Hugo Bizetto; Moreira, Dalmo Ar; Ferreira Filho, Carlos Alberto Brandão; Souza, Charles Rios; Menezes, Camila Caldas; Hirata, Henrique Seichii; Armaganijan, Luciana Vidal

    2014-10-28

    Background: The QRS-T angle correlates with prognosis in patients with heart failure and coronary artery disease, reflected by an increase in mortality proportional to an increase in the difference between the axes of the QRS complex and T wave in the frontal plane. The value of this correlation in patients with Chagas heart disease is currently unknown. Objective: Determine the correlation of the QRS-T angle and the risk of induction of ventricular tachycardia / ventricular fibrillation (VT / VF) during electrophysiological study (EPS) in patients with Chagas disease. Methods: Case-control study at a tertiary center. Patients without induction of VT / VF on EPS were used as controls. The QRS-T angle was categorized as normal (0-105º), borderline (105-135º) or abnormal (135-180º). Differences between groups for continuous variables were analyzed with the t test or Mann-Whitney test, and for categorical variables with Fisher's exact test. P values < 0.05 were considered significant. Results: Of 116 patients undergoing EPS, 37.9% were excluded due to incomplete information / inactive records or due to the impossibility to correctly calculate the QRS-T angle (presence of left bundle branch block and atrial fibrillation). Of 72 patients included in the study, 31 induced VT / VF on EPS. Of these, the QRS-T angle was normal in 41.9%, borderline in 12.9% and abnormal in 45.2%. Among patients without induction of VT / VF on EPS, the QRS-T angle was normal in 63.4%, borderline in 14.6% and abnormal in 17.1% (p = 0.04). When compared with patients with normal QRS-T angle, those with abnormal angle had a fourfold higher risk of inducing ventricular tachycardia / ventricular fibrillation on EPS [odds ratio (OR) 4; confidence interval (CI) 1.298-12.325; p = 0.028]. After adjustment for other variables such as age, ejection fraction (EF) and QRS size, there was a trend for the abnormal QRS-T angle to identify patients with increased risk of inducing VT / VF during EPS (OR 3.95; CI 0.99-15.82; p = 0.052). The EF also emerged as a predictor of induction of VT / VF: for each point increase in EF, there was a 4% reduction in the rate of sustained ventricular arrhythmia on EPS. Conclusions: Changes in the QRS-T angle and decreases in EF were associated with an increased risk of induction of VT / VF on EPS.Fundamento: O ângulo QRS-T mostra correlação com prognóstico em pacientes com insuficiência cardíaca e doença coronariana, traduzido por um aumento na mortalidade proporcional ao aumento na diferença entre os eixos do complexo QRS e da onda T no plano frontal. Até hoje, nenhuma informação a este respeito foi obtida em pacientes com cardiopatia chagásica. Objetivo: Correlacionar o ângulo QRS-T com a indução de taquicardia ventricular / fibrilação ventricular (TV / FV) em chagásicos durante estudo eletrofisiológico (EEF). Métodos: Estudo caso-controle em centro terciário. Pacientes sem indução de TV / FV ao EEF foram utilizados como controles. O ângulo QRS-T foi categorizado como normal (0-105º), limítrofe (105-135º) e anormal (135-180º). As diferenças entre os grupos foram analisadas pelo teste t ou teste de Mann-Whitney para variáveis contínuas, e teste exato de Fisher ou qui-quadrado para variáveis categóricas. Valores de p < 0,05 foram considerados significativos. Resultados: De 116 pacientes submetidos ao EEF, 37,9% foram excluídos por estarem com dados incompletos / prontuários inativos ou pela impossibilidade de se calcular corretamente o ângulo QRS-T (presença de bloqueio de ramo esquerdo e fibrilação atrial). De 72 pacientes incluídos, 31 induziram TV / FV ao EEF. Destes, o ângulo QRS-T se encontrava normal em 41,9%, limítrofe em 12,9% e anormal em 45,2%. No grupo de pacientes sem indução de TV / FV, o ângulo QRS-T se encontrava normal em 63,4%, limítrofe em 14,6% e anormal em 17,1% (p = 0,04). Quando comparados aos pacientes com ângulo QRS-T normal, o risco de indução de TV / FV nos pacientes com ângulo anormal foi quatro vezes maior [odds ratio (OR) 4; intervalo de confia

  15. The local sub-mm luminosity functions and predictions from ASTRO-F/SIRTF to Herschel

    E-print Network

    Stephen Serjeant; Diana Harrison

    2003-09-23

    We present new determinations of the local sub-mm luminosity functions. We find the local sub-mm luminosity density converging to 7.3+/-0.2 x 10^19 W/Hz/Mpc^3 /h_65 at 850um solving the ``sub-mm Olbers' Paradox.'' Using the sub-mm colour temperature relations from the SCUBA Local Universe Galaxy Survey, and the discovery of excess 450um excess emission in these galaxies, we interpolate and extrapolate the IRAS detections to make predictions of the SEDs of all 15411 PSC-z galaxies from 50-3000um. Despite the long extrapolations we find excellent agreement with (a) the 90um luminosity function of Serjeant et al. (2001), (b) the 850um luminosity function of Dunne et al. (2000), (c) the mm-wave photometry of Andreani & Franceschini (1996); (d) the asymptotic differential and integral source count predictions at 50-3000um by Rowan-Robinson (2001). Remarkably, the local luminosity density and the extragalactic background light together strongly constrain the cosmic star formation history for a wide class of evolutionary assumptions. We find that the extragalactic background light, the 850um 8mJy source counts, and the Omega_* constraints all independently point to a decline in the comoving star formation rate at z>1.

  16. Effects of Lutein and Zeaxanthin on LPS-Induced Secretion of IL-8 by Uveal Melanocytes and Relevant Signal Pathways

    PubMed Central

    Chao, Shih-Chun; Vagaggini, Tommaso; Nien, Chan-Wei; Huang, Sheng-Chieh; Lin, Hung-Yu

    2015-01-01

    The effects of lutein and zeaxanthin on lipopolysaccharide- (LPS-) induced secretion of IL-8 by uveal melanocytes (UM) were tested in cultured human UM. MTT assay revealed that LPS (0.01–1??g/mL) and lutein and zeaxanthin (1–10??M) did not influence the cell viability of cultured UM. LPS caused a dose-dependent increase of secretion of IL-8 by cultured UM. Lutein and zeaxanthin did not affect the constitutive secretion of IL-8. However, lutein and zeaxanthin decreased LPS-induced secretion of IL-8 in cultured UM in a dose-dependent manner. LPS significantly increased NF-?B levels in cell nuclear extracts and p-JNK levels in the cell lysates from UM, but not p-p38 MAPK and p-ERG. Lutein or zeaxanthin significantly reduced LPS-induced increase of NF-?B and p-JNK levels, but not p38 MAPK and ERG levels. The present study demonstrated that lutein and zeaxanthin inhibited LPS-induced secretion of IL-8 in cultured UM via JNK and NF-?B signal pathways. The anti-inflammatory effects of lutein and zeaxanthin might be explored as a therapeutic approach in the management of uveitis and other inflammatory diseases of the eye. PMID:26609426

  17. Identification of chemoresistant factors by protein expression analysis with iTRAQ for head and neck carcinoma

    PubMed Central

    Nishimura, K; Tsuchiya, Y; Okamoto, H; Ijichi, K; Gosho, M; Fukayama, M; Yoshikawa, K; Ueda, H; Bradford, C R; Carey, T E; Ogawa, T

    2014-01-01

    Background: Cisplatin and other anticancer drugs are important in the treatment of head and neck squamous cell carcinoma; however, some tumours develop drug resistance. If chemoresistance could be determined before treatment, unnecessary drug administration would be avoided. Here, we investigated chemoresistance factors by comprehensive analyses at the protein level. Methods: Four human carcinoma cell lines were used: cisplatin-sensitive UM-SCC-23, UM-SCC-23-CDDPR with acquired cisplatin resistance, naturally cisplatin-resistant UM-SCC-81B, and UM-SCC-23/WR with acquired 5-fluorouracil resistance. Extracted proteins were labelled with iTRAQ and analysed by tandem mass spectrometry to identify resistance. Protein expression was confirmed by western blotting and functional analysis was carried out using siRNA. Results: Thirteen multiple-drug resistance proteins were identified, as well as seven proteins with specific resistance to cisplatin, including ?-enolase. Differential expression of these proteins in cisplatin-resistant and -sensitive cell lines was confirmed by western blotting. Functional analysis for ?-enolase by siRNA showed that cisplatin sensitivity significantly was increased in UM-SCC-81B and slightly in UM-SCC-23-CDDPR but not in UM-SCC-23/WR cells. Conclusions: We identified proteins thought to mediate anticancer drug resistance using recent proteome technology and identified ?-enolase as a true cisplatin chemoresistance factor. Such proteins could be used as biomarkers for anticancer agent resistance and as targets of cancer therapy. PMID:25032734

  18. On telescópio remoto do Observatório Abrahão de Moraes - Obelix

    NASA Astrophysics Data System (ADS)

    Neres, N. L.; Raffaelli, J. C.; Medina Tanco, G. A.; Horvath, J. E.; Maluhy, R.; Martins, A.; Orselli, M. I. V.

    2003-08-01

    Foi desenvolvido um telescópio totalmente automático situado no Observatório Abrahão de Moraes, em Valinhos-SP, que possibilita observações remotas via Internet tanto para fins profissionais como didáticos. Usando um programa navegador da WWW, o observador tem acesso a páginas interativas que permitem não só apontar o telescópio e receber as imagens, como também controlar a abertura e o fechamento da cúpula, monitorar temperatura, umidade e orvalho e receber imagens das câmaras de segurança. O fechamento da cúpula é feito automaticamente em caso de perigo de condensação. O sistema consiste de uma câmara Apogee, uma roda de filtros SBIG modelo CFW-8 com filtros RGB e um telescópio Meade. A observação remota é feita usando programas comerciais da área. Uma caixa de controle com lógica programável controla o movimento da cúpula e a energização do telescópio. Um software em LabView adquire os dados da estação meteorológica, que inclui um sensor de chuva desenvolvido no IAG, e apresenta seus valores atuais e históricos. Usando uma facilidade do próprio LabView, a saída desse software é exportada para a Internet. Um programa em C disponibiliza as imagens das câmaras de segurança usando uma placa de captura de vídeo e um seqüencial de vídeo que foi adaptado para ser controlado pelo PC. O sistema completo já se encontra operacional.

  19. Bevacizumab and intraocular tumors: an intriguing paradox

    PubMed Central

    Ly, Long V.; Luyten, Gregorius P.M.; Versluis, Mieke; Grossniklaus, Hans E.; van der Velden, Pieter A.; Jager, Martine J.

    2012-01-01

    Purpose Bevacizumab, a humanized monoclonal antibody to vascular endothelial growth factor-A (VEGF-A), was originally developed as an anti-tumor treatment. In ocular oncology, it is being used to treat macular edema due to radiation retinopathy, but it may also be useful for the treatment of primary uveal melanoma (UM) or its metastases. We determined the effect of bevacizumab on the growth of B16F10 cells inside the eye and on B16F10 and UM cells cultured in vitro. Methods B16F10 melanoma cells were placed into the anterior chamber of the eye of C57Bl/6 mice and tumor growth was monitored after injection of different doses of bevacizumab or mock injection. In addition, the effect of bevacizumab on in vitro growth of B16F10 and human UM cells and on the expression of VEGF-A, GLUT-1, and HIF-1? was evaluated. Results Following intraocular injection of bevacizumab into murine B16 tumor-containing eyes, an acceleration of tumor growth was observed, with the occurrence of anterior chamber hemorrhages. Bevacizumab did not affect proliferation of B16F10 cells in vitro, while it inhibited UM cell proliferation. Expression analysis demonstrated that addition of bevacizumab under hypoxic conditions induced VEGF-A, GLUT-1 and HIF-1? in B16F10 cells as well as in UM cell lines and two of four primary UM tumor cultures. Conclusions In contrast with expectations, intraocular injection of bevacizumab stimulated B16F10 melanoma growth in murine eyes. In vitro exposure of B16 and human UM cells to bevacizumab led to paradoxical VEGF-A upregulation. The use of VEGF inhibitors for treatment of macular edema (due to radiation retinopathy) after irradiation of UM should be considered carefully, because of the possible adverse effects on residual UM cells. PMID:23077404

  20. Effects of mTOR Inhibitor Everolimus (RAD001) on Bladder Cancer Cells

    PubMed Central

    Chiong, Edmund; Lee, I-Ling; Dadbin, Ali; Sabichi, Anita L; Harris, Loleta; Urbauer, Diana; McConkey, David; Dickstein, Rian Jason; Cheng, Tiewei; Grossman, H. Barton

    2014-01-01

    Purpose We investigated the effect of the mTOR inhibitor everolimus (RAD001) on human bladder cancer (BC) cells in vitro and in vivo. Experimental Design The effect of RAD001 on the growth of UM-UC-3, UM-UC-6, UM-UC-9, and UM-UC-14 BC cells were assessed by crystal violet and [3H]Thymidine incorporation assays . Flow cytometry cell cycle analyses were performed to measure the apoptotic cell fraction. Protein synthesis was measured using tritium-labeled leucine–incorporation assays. The effects of RAD001 on the mTOR pathway were analyzed by western blotting. To test the effects of RAD001 in vivo, UM-UC-3, UM-UC-6, and UMUC-9 cells were subcutaneously implanted into nude mice. Tumor-bearing mice were treated orally with RAD001 or placebo. Tumors were harvested for immunohistochemical analysis. Results In vitro, RAD001 transiently inhibited BC cell growth in a dose-dependent manner. This effect was augmented by retreatment of cells after 3 days. UM-UC-14 cells were the most sensitive to RAD001, while UM-UC-9 cells were the least sensitive. After retreatment with RAD001, only sensitive cell lines showed G1 phase arrest, with no evidence of apoptosis. RAD001 significantly inhibited the growth of tumors that were subcutaneously implanted in mice. Inhibition of protein synthesis through the S6K and 4E-BP1 pathways appears to be the main mechanism for the RAD001-induced growth inhibition. However, inhibition of angiogenesis was the predominant mechanism of RAD001's effect on UM-UC-9 cells. Conclusions The mTOR inhibitor RAD001 inhibits growth of BC cells in vitro. RAD001 is effective in treating BC tumors in an in vivo nude mouse model despite the heterogeneity of in vitro responses. PMID:21415218

  1. Modelagem Matematica de Sistemas 10 de marco de 2008

    E-print Network

    Rosa, Ricardo M. S.

    ´igidos 57 1. Representa¸c~ao do movimento de um corpo r´igido 57 2. Energia cin´etica de um corpo r´igido 60 75 Cap´itulo 7. Sistemas cont´inuos 77 1. Exemplos 77 2. Conserva¸c~ao de energia 80 Cap´itulo 8 de um corpo de massa m > 0 em queda livre vertical ao longo do eixo z, dado na forma ¨z = -g, onde g

  2. Teatro no Brasil: Como transmitir sinais de dentro das chamas.

    E-print Network

    Peixoto, Fernando

    1973-10-01

    intelectualmente morrem sem consciência. Para outros, a consciência é a causa mortis. E o que acontece com o teatro, acontece também com o cinema, com a literatura, com a música, com as artes plásticas, etc. O impasse do teatro, acentuado à partir da crise... sérias são ainda superficiais. Em essência permanece um teatro alienado e, mesmo quando se propõe ao contrário, alienante. A esperança é que um novo saia das cinzas. Um teatro que mergulhe com firmeza e decisão na realidade do país e dela consiga...

  3. Supplemental Methods Table of Contents 2-6 Brown Lab protocols

    E-print Network

    . The spike-in was labeled with the red channel dye (Alexa Fluor-647) and the control was labeledM) pH 7.9 375ul oligo 102 (40uM stock) 375ul oligo 103 (40uM stock) Heat at 95o C for 5 minx Thermopol buffer (NEB) 5ul 2.5mM dNTP mix 1.25ul of 40uM oligo (the longer oligo in the linker

  4. Scribere Est Agere ou O Direito ao Grito: O Intelectual Oprimido e a Hora do Subalterno em A Hora da Estrela

    E-print Network

    Tosta, Antonio L.

    2009-01-05

    ” (HE 30). E este encontro com o “outro” deve gerar uma refl exão individual e também coletiva: “que cada um a reconheça em si mesmo porque todos nós somos um e quem não tem pobreza de dinheiro tem pobreza de espírito ou saudade por lhe faltar coisa... transparecer o quão distante sua realidade realmente é da que “vive” a protagonista: “Sou um homem que tem mais dinheiro do que os que passam fome” (HE 18); “Rua do Acre. Mas que lugar. [...] Lá é que não piso pois tenho terror sem nenhuma vergonha do pardo...

  5. Landsat 7 - First Cloud-free Image of Yellowstone National Park

    NASA Technical Reports Server (NTRS)

    2002-01-01

    This image of Yellowstone Lake, in the center of Yellowstone National Park, was taken by Landsat 7 on July 13, 1999. Bands 5 (1.65um),4 (.825um), and 2 (.565um) were used for red, green, and blue, respectively. Water appears blue/black, snow light blue, mature forest red/green, young forest pink, and grass and fields appear light green. Southwest of the lake is young forest that is growing in the wake of the widespread fires of 1988. For more information, see: Landsat 7 Fact Sheet Landsat 7 in Mission Control Image by Rich Irish, NASA GSFC

  6. Application of atomic magnetometry in magnetic particle detection

    E-print Network

    Xu, S; Donaldson, M H; Pines, A; Rochester, S M; Yashchuk, V V

    2006-01-01

    We demonstrate the detection of magnetic particles carried by water in a continuous flow using an atomic magnetic gradiometer. Studies on three types of magnetic particles are presented: a single cobalt particle (diameter ~150 um, multi-domain), a suspension of superparamagnetic magnetite particles (diameter \\~1 um), and ferromagnetic cobalt nanoparticles (diameter ~10 nm, 120 kA/m magnetization). Estimated detection limits are 20 um diameter for a single cobalt particle at a water flow rate 30 ml/min, 5x10^3 magnetite particles at 160 ml/min, and 50 pl for the specific ferromagnetic fluid at 130 ml/min. Possible applications of our method are discussed.

  7. Latino, Eu? The Paradoxical Interplay of Identity in Brazuca Literature

    E-print Network

    Tosta, Antonio Luciano

    2004-09-01

    camiseta de malha, e com um desconfiado olhar de lobo doido" (Boas 24). In 4&h Street: O Caminho Americano, a Mexican who works at a porn shop is compared to a monster: "O mexicano tinha os cabelos da grossura de um lapis, ldbios enormes, dentes apon...- Brazuca Literatu re 581 tados para fora e em todas as diodes. E dentro daquela caixinha... Nossa Senhora! O mexicano parecia um monstrinho asteca na embalagem" (Scotto 16). In another scene, Carlos, a Brazilian researcher, feels superior to his Peruvian...

  8. Resumos de Mecanica Geometrica 29 de Abril de 2011

    E-print Network

    Natário, José

    j v j # #y i . 6. Um difeomorfismo â??e uma bijecâ?ºcâ?ao de classe C # cuja inversa â??e tambâ??em de classeâ?ºcâ?oes de classe C # f : Q # R. Se U # Q â??e um aberto com p # U e x i : U # R (i = 1, . . . , n) â??e um caminho c : R # Q de classe C # , designamos por â?? c(t) # T c(t) Q a derivaâ?ºcâ?ao â?? c(t) · f = d dt f

  9. Uncooled infrared detector and imager development at DALI Technology

    NASA Astrophysics Data System (ADS)

    Jiang, Lijun; Liu, Haitao; Chi, Jiguang; Qian, Liangshan; Pan, Feng; Liu, Xiang; Zhu, Xiaorong; Ma, Zhigang

    2015-06-01

    Zhejiang Dali Technology Co. Ltd. is one of the major players in the China Infrared industry. The company has been working on infrared imagers using uncooled FPAs for about 15 years. It started the research and development of uncooled microbolometer detectors since 2006, and has brought several uncooled detectors into mass production, including 35um 384x288, 25um 160x120, 384x288, 640x480, and 17um 384x288, 640x480. In this presentation, we will describe the uncooled infrared detector and imager development at DALI Technology.

  10. Analise Matematica III Exame -21 de Janeiro de 95

    E-print Network

    Girão, Pedro M.

    ´inimo absoluto estrito no ponto (-1, 0). c) Para todo o k, a pot^encia fk ´e integr´avel no disco de raio um, cen no disco de raio um, centrado na origem. Portanto, ´e imposs´ivel alterar os valores de f nos pontos com no disco de raio um, centrado na origem. 2. a) x [( x2 + y2-R)2 +z2 -2 ] = 2( x2 + y2-R) x x2+y2 = 0 e ( x

  11. O Prazer da Influência: John Gay, Bertolt Brecht e Chico Buarque de Hollanda

    E-print Network

    Bernucci, Leopoldo M.

    1994-04-01

    desaparecimento {o malandro já era . ..); e outra que se aproximasse da esfera discursiva, literária e canónica que o acolhe, ou seja, do universo das narrativas de um género no qual um indivíduo espertalhão desempenha um papel principal. A história das três... coloca as duas rivais em pé de igualdade e em ato de contrição. Não se defende a honra aqui porque ela obviamente não existe e no pior dos casos a sua presença nos faria recordar que estamos no mundo da ópera-bufa, mantendo-nos no doce sonho da ficção...

  12. A correlação índice espectral vs. luminosidade em QSOs e suas implicações

    NASA Astrophysics Data System (ADS)

    Garcia-Rissmann, A.

    2003-08-01

    Estudos de variabilidade de núcleos ativos já demonstraram ser comum o fato de seu contínuo óptico/UV tornar-se mais "duro" à medida que a luminosidade aumenta. Essa tendência ocorre tanto de forma individual quanto global, e pode ter implicações importantes (1) para estudos fotométricos de variabilidade conduzidos numa banda fixa no referencial do observador, comparando objetos a diferentes redshifts, e (2) no cálculo da correção K, com consequente impacto na determinação de massas de buracos negros e bojos de galáxias hospedeiras (através da relação de Magorrian). Confirmo aqui as correlações positivas entre o índice espectral e a luminosidade óptica, utilizando dados espectroscópicos de 11 QSOs monitorados no Brasil e no Chile, durante ~2 anos. O estudo é complementado com parâmetros extraídos de espectros e de dados fotométricos públicos de quasares. Destaco ainda as diferenças observadas em tais correlações para objetos do tipo radio-loud e radio-quiet. Este projeto é financiado pelo I. Milênio/CNPq.

  13. Tendências De Teses e Dissertações Sobre Educação em Astronomia No Brasil

    NASA Astrophysics Data System (ADS)

    Bretones, Paulo Sergio; Megid Neto, Jorge

    2005-07-01

    Apresentam-se os resultados de uma pesquisa do tipo estado da arte sobre teses e dissertações defendidas no Brasil e relativas ao ensino de Astronomia, com objetivo de identificar essa produção e conhecer as principais tendências da pesquisa nesse campo. Foram localizadas 13 dissertações de mestrado e 3 teses de doutorado, as quais foram estudadas em função dos seguintes aspectos: isntituição, ano de defesa, nível escolar abrangido no estudo, foco temático do estudo e gênero de trabalho acadêmico. Pretende-se assim colaborar com a divulgação ampla da produção acadêmica na área. Ao mesmo tempo o estudo possibilita, a partir de investigações decorrentes, apontar as contribuições dessa produção para o ensino e sinalizar com necessidades a serem supridas por futuras pesquisas.

  14. JOHANNES KEPLER UNIVERSITT LINZ

    E-print Network

    Hochreiter, Sepp

    SATZUNG der JOHANNES KEPLER UNIVERSITÄT LINZ Akademische Ehrungen #12;Mitteilungsblatt vom 23 Leistungen in Fachkreisen international hohes Ansehen genießen oder sich um die durch die Johannes Kepler Kepler Universität Linz zuständig ist, ohne Erfüllung der in den Studienvorschriften geforderten

  15. Modeling and fabrication of micro 3K-2-type planetary gear reducer utilizing SU-8 photoresist as alternative LIGA technology

    NASA Astrophysics Data System (ADS)

    Zhang, Weiping; Chen, Wenyuan; Chen, Di; Chen, Xiaomei; Wu, Xiaosheng; Xu, Zhengfu

    2001-10-01

    The LIGA type process, utilizing SU-8 photoresist as alternative LIGA technology, can fabricate high aspect ratio microstructures without employing synchrotron light and suitable X-ray mask. Based on LIGA type process in this paper, detailed investigations of the modeling and fabrication of micro 3K-2 type planetary gear reducer, such as the modeling and design of micro reducer, CAD of micro gear mask, SU-8 UV photolithography, micro electroforming, micro molding, have been performed. And 400 um thickness sun gear, 400 um thickness planet gear, 200 um thickness fixed inner gear, and 200 um thickness rotary inner gear, whose teeth are 15,11,36,39 respectively, have been obtained. Utilizing these gears, the micro reducer whose modulus, outer diameter and velocity ratio are 0.03, 2mm, 44.2:1, has been assembled and applied in (phi) 2mm micro electro magnetic motor successfully.

  16. Lista 1, Fundamentos da Matematica, Primeiro Semestre 2014

    E-print Network

    Torres, Fernando

    ´ia: Escolher um dos temas: (a) Teorema do Binomio de Newton (incluir o triangulo de Pascal). (b) Historia sobre as nota¸c~oes 0, 1, 2 . . ., 0 (cardinalidade de N), c (cardinalidade de R). (c) O ´ultimo Teorema de

  17. Urine Monitoring System

    NASA Technical Reports Server (NTRS)

    Feedback, Daniel L.; Cibuzar, Branelle R.

    2009-01-01

    The Urine Monitoring System (UMS) is a system designed to collect an individual crewmember's void, gently separate urine from air, accurately measure void volume, allow for void sample acquisition, and discharge remaining urine into the Waste Collector Subsystem (WCS) onboard the International Space Station. The Urine Monitoring System (UMS) is a successor design to the existing Space Shuttle system and will resolve anomalies such as: liquid carry-over, inaccurate void volume measurements, and cross contamination in void samples. The crew will perform an evaluation of airflow at the ISS UMS urinal hose interface, a calibration evaluation, and a full user interface evaluation. o The UMS can be used to facilitate non-invasive methods for monitoring crew health, evaluation of countermeasures, and implementation of a variety of biomedical research protocols on future exploration missions.

  18. ARBEITSGRUPPEN DEPARTEMENT FR CHEMIE UND BIOCHEMIE

    E-print Network

    Mühlemann, Oliver

    : Crystal Structure of Enzyme I of the Phosphoenolpyruvate Sugar Phosphotransferase System, Niederhauser B, Baumann UM: The crystal structure of apo-FtsH reveals domain movements necessary for substrate

  19. FORSCHUNG & GESELLSCHAFT 68 M A X P L A N C K F O R S C H U N G 1 / 2 0 0 7 1 / 2 0 0 7 M A X P L A N C K F O R S C H U N G 69

    E-print Network

    Falge, Eva

    Etappensieg im Kampf gegen Krebs- erreger. Doch die Lobbyisten streiten wei- ter. Ist das Gesetz viel zu milde Medien und die öffentliche Meinung zu beeinflussen versucht ­ ein jahrelanger Kampf um Lobbyisten gelten

  20. Die Abteilung V Forschung bietet Serviceleistungen in den Bereichen

    E-print Network

    Berlin,Technische Universität

    Die Abteilung V Forschung bietet Serviceleistungen in den Bereichen · Forschungsförderung rund um die Promotion » Begleitung der Promotionsprogramme (insb. Graduiertenkollegs der DFG Forschung informiert, berät und unterstützt die Wissenschaftler/innen der TU Berlin in Fragen der Einwerbung