Science.gov

Sample records for mismatch-repair mmr proteins

  1. Biophysical modeling of mismatch repair proteins

    NASA Astrophysics Data System (ADS)

    Salsbury, Freddie

    2009-03-01

    Mismatch repair proteins play a vital role in the bology of cancer due to their dual functions as repair proteins and as sensors of DNA damage. Computational modeling of mismatch repair proteins in conjunction with biological experimentation has demonstrated the role of long-range communication in the functions of these proteins. Furthermore, different conformations have been shown to be associated with different cellular functions, and these differences are being exploited in drug discovery. The latest results in this modeling will be presented.

  2. The UvrD helicase and its modulation by the mismatch repair protein MutL.

    PubMed

    Matson, Steven W; Robertson, Adam B

    2006-01-01

    UvrD is a superfamily I DNA helicase with well documented roles in excision repair and methyl-directed mismatch repair (MMR) in addition to poorly understood roles in replication and recombination. The MutL protein is a homodimeric DNA-stimulated ATPase that plays a central role in MMR in Escherichia coli. This protein has been characterized as the master regulator of mismatch repair since it interacts with and modulates the activity of several other proteins involved in the mismatch repair pathway including MutS, MutH and UvrD. Here we present a brief summary of recent studies directed toward arriving at a better understanding of the interaction between MutL and UvrD, and the impact of this interaction on the activity of UvrD and its role in mismatch repair. PMID:16935885

  3. Protein-protein interactions in DNA mismatch repair.

    PubMed

    Friedhoff, Peter; Li, Pingping; Gotthardt, Julia

    2016-02-01

    The principal DNA mismatch repair proteins MutS and MutL are versatile enzymes that couple DNA mismatch or damage recognition to other cellular processes. Besides interaction with their DNA substrates this involves transient interactions with other proteins which is triggered by the DNA mismatch or damage and controlled by conformational changes. Both MutS and MutL proteins have ATPase activity, which adds another level to control their activity and interactions with DNA substrates and other proteins. Here we focus on the protein-protein interactions, protein interaction sites and the different levels of structural knowledge about the protein complexes formed with MutS and MutL during the mismatch repair reaction. PMID:26725162

  4. Role of mismatch repair proteins in the processing of cisplatin interstrand cross-links.

    PubMed

    Sawant, Akshada; Kothandapani, Anbarasi; Zhitkovich, Anatoly; Sobol, Robert W; Patrick, Steve M

    2015-11-01

    Mismatch repair (MMR) deficiency gives rise to cisplatin resistance and can lead to poor prognosis in cancers. Various models have been proposed to explain this low level of resistance caused due to loss of MMR proteins. We have shown that MMR proteins are required to maintain cisplatin interstrand cross-links (ICLs) on the DNA leading to increased cellular sensitivity. In our previous studies, we have shown that BER processing of the cisplatin ICLs is mutagenic. Polymerase β (Polβ) can generate mismatches which leads to the activation and the recruitment of mismatch repair proteins. In this paper, we distinguished between the requirement of different downstream MMR proteins for maintaining cisplatin sensitivity. We show that the MutSα (MSH2-MSH6) heterocomplex is required to maintain cisplatin sensitivity, whereas the Mutsβ complex has no effect. These results can be correlated with the increased repair of cisplatin ICLs and ICL induced DNA double strand breaks (DSBs) in the resistant cells. Moreover, we show that MLH1 proficient cells displayed a cisplatin sensitive phenotype when compared with the MLH1 deficient cells and the ATPase activity of MLH1 is essential to mediate this effect. Based on these results, we propose that MutSα as well as the downstream MMR pathway proteins are essential to maintain a cisplatin sensitive phenotype as a consequence of processing Polβ induced mismatches at sites flanking cisplatin ICLs. PMID:26519826

  5. Functional interactions and signaling properties of mammalian DNA mismatch repair proteins.

    PubMed

    Bellacosa, A

    2001-11-01

    The mismatch repair (MMR) system promotes genomic fidelity by repairing base-base mismatches, insertion-deletion loops and heterologies generated during DNA replication and recombination. This function is critically dependent on the assembling of multimeric complexes involved in mismatch recognition and signal transduction to downstream repair events. In addition, MMR proteins coordinate a complex network of physical and functional interactions that mediate other DNA transactions, such as transcription-coupled repair, base excision repair and recombination. MMR proteins are also involved in activation of cell cycle checkpoint and induction of apoptosis when DNA damage overwhelms a critical threshold. For this reason, they play a role in cell death by alkylating agents and other chemotherapeutic drugs, including cisplatin. Inactivation of MMR genes in hereditary and sporadic cancer is associated with a mutator phenotype and inhibition of apoptosis. In the future, a deeper understanding of the molecular mechanisms and functional interactions of MMR proteins will lead to the development of more effective cancer prevention and treatment strategies. PMID:11687886

  6. Mismatch repair and nucleotide excision repair proteins cooperate in the recognition of DNA interstrand crosslinks.

    PubMed

    Zhao, Junhua; Jain, Aklank; Iyer, Ravi R; Modrich, Paul L; Vasquez, Karen M

    2009-07-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, thus ICL-inducing agents such as psoralen, are clinically useful chemotherapeutics. Psoralen-modified triplex-forming oligonucleotides (TFOs) have been used to target ICLs to specific genomic sites to increase the selectivity of these agents. However, how TFO-directed psoralen ICLs (Tdp-ICLs) are recognized and processed in human cells is unclear. Previously, we reported that two essential nucleotide excision repair (NER) protein complexes, XPA-RPA and XPC-RAD23B, recognized ICLs in vitro, and that cells deficient in the DNA mismatch repair (MMR) complex MutSbeta were sensitive to psoralen ICLs. To further investigate the role of MutSbeta in ICL repair and the potential interaction between proteins from the MMR and NER pathways on these lesions, we performed electrophoretic mobility-shift assays and chromatin immunoprecipitation analysis of MutSbeta and NER proteins with Tdp-ICLs. We found that MutSbeta bound to Tdp-ICLs with high affinity and specificity in vitro and in vivo, and that MutSbeta interacted with XPA-RPA or XPC-RAD23B in recognizing Tdp-ICLs. These data suggest that proteins from the MMR and NER pathways interact in the recognition of ICLs, and provide a mechanistic link by which proteins from multiple repair pathways contribute to ICL repair. PMID:19468048

  7. Expression of Mismatch Repair Proteins in Early and Advanced Gastric Cancer in Poland.

    PubMed

    Karpińska-Kaczmarczyk, Katarzyna; Lewandowska, Magdalena; Ławniczak, Małgorzata; Białek, Andrzej; Urasińska, Elżbieta

    2016-01-01

    BACKGROUND Mutations in DNA of mismatch repair (MMR) genes result in failure to repair errors that occur during DNA replication in microsatellites, resulting in accumulation of frameshift mutations in these genes and leading to DNA mismatch replication errors and microsatellite instability. Gastric cancers (GCs) with high MSI (MSI-H) are a well-defined subset of carcinomas showing distinctive clinicopathological features. In this study we investigated the rate of MSI and the correlation between MSI status and clinicopathological features of GC. MATERIAL AND METHODS The study included 107 patients with GCs: 61 with advanced gastric cancers (AGC) and 46 with early gastric cancer (EGC). MSI deficiency in GCs was assessed by the immunohistochemical analysis of expression of MMR proteins - MLH1, MSH2, MSH6, and PMS2 - using formalin-fixed and paraffin-embedded tissue. RESULTS A total of 6 (5.6%) MSI-H were observed. The loss of MMR proteins expression was associated with the intestinal type of GC in Lauren classification, and tubular and papillary architecture in WHO classification. There was no statistically significant association between negative MMR expression and other selected clinical parameters: age, sex, tumor location, depth of invasion (EGC and AGC), lymph nodes status, presence of the ulceration, and lymphocytic infiltrate. CONCLUSIONS In the present era of personalized medicine, the histological type of GC and MMR proteins status in cancer cells are very important for the proper surveillance of patients with familial GC and sporadic GCs, as well as for selecting the proper follow-up and treatment. Larger collaborative studies are needed to verify the features of MSI-H GCs in Poland. PMID:27527654

  8. Expression of Mismatch Repair Proteins in Early and Advanced Gastric Cancer in Poland

    PubMed Central

    Karpińska-Kaczmarczyk, Katarzyna; Lewandowska, Magdalena; Ławniczak, Małgorzata; Białek, Andrzej; Urasińska, Elżbieta

    2016-01-01

    Background Mutations in DNA of mismatch repair (MMR) genes result in failure to repair errors that occur during DNA replication in microsatellites, resulting in accumulation of frameshift mutations in these genes and leading to DNA mismatch replication errors and microsatellite instability. Gastric cancers (GCs) with high MSI (MSI-H) are a well-defined subset of carcinomas showing distinctive clinicopathological features. In this study we investigated the rate of MSI and the correlation between MSI status and clinicopathological features of GC. Material/Methods The study included 107 patients with GCs: 61 with advanced gastric cancers (AGC) and 46 with early gastric cancer (EGC). MSI deficiency in GCs was assessed by the immunohistochemical analysis of expression of MMR proteins – MLH1, MSH2, MSH6, and PMS2 – using formalin-fixed and paraffin-embedded tissue. Results A total of 6 (5.6%) MSI-H were observed. The loss of MMR proteins expression was associated with the intestinal type of GC in Lauren classification, and tubular and papillary architecture in WHO classification. There was no statistically significant association between negative MMR expression and other selected clinical parameters: age, sex, tumor location, depth of invasion (EGC and AGC), lymph nodes status, presence of the ulceration, and lymphocytic infiltrate. Conclusions In the present era of personalized medicine, the histological type of GC and MMR proteins status in cancer cells are very important for the proper surveillance of patients with familial GC and sporadic GCs, as well as for selecting the proper follow-up and treatment. Larger collaborative studies are needed to verify the features of MSI-H GCs in Poland. PMID:27527654

  9. Interdependence of DNA mismatch repair proteins MLH1 and MSH2 in apoptosis in human colorectal carcinoma cell lines.

    PubMed

    Hassen, Samar; Ali, Akhtar A; Kilaparty, Surya P; Al-Anbaky, Qudes A; Majeed, Waqar; Boman, Bruce M; Fields, Jeremy Z; Ali, Nawab

    2016-01-01

    The mammalian DNA mismatch repair (MMR) system consists of a number of proteins that play important roles in repair of base pair mismatch mutations and in maintenance of genomic integrity. A defect in this system can cause genetic instability, which can lead to carcinogenesis. For instance, a germline mutation in one of the mismatch repair proteins, especially MLH1 or MSH2, is responsible for hereditary non-polyposis colorectal cancer. These MMR proteins also play an important role in the induction of apoptosis. Accordingly, altered expression of or a defect in MLH1 or MSH2 may confer resistance to anti-cancer drugs used in chemotherapy. We hypothesized that the ability of these two MMR proteins to regulate apoptosis are interdependent. Moreover, a defect in either one may confer resistance to chemotherapy by an inability to trigger apoptosis. To this end, we studied three cell lines-SW480, LoVo, and HTC116. These cell lines were selected based on their differential expression of MLH1 and MSH2 proteins. SW480 expresses both MLH1 and MSH2; LoVo expresses only MLH1 but not MSH2; HCT116 expresses only MSH2 but not MLH1 protein. MTT assays, a measure of cytotoxicity, showed that there were different cytotoxic effects of an anti-cancer drug, etoposide, on these cell lines, effects that were correlated with the MMR status of the cells. Cells that are deficient in MLH1 protein (HCT116 cells) were resistant to the drug. Cells that express both MLH1 and MSH2 proteins (SW480 cells) showed caspase-3 cleavage, an indicator of apoptosis. Cells that lack MLH1 (HCT116 cells) did not show any caspase-3 cleavage. Expression of full-length MLH1 protein was decreased in MMR proficient (SW480) cells during apoptosis; it remained unchanged in cells that lack MSH2 (LoVo cells). The expression of MSH2 protein remained unchanged during apoptosis both in MMR proficient (SW480) and deficient (HCT116) cells. Studies on translocation of MLH1 protein from nucleus to cytosolic fraction, an

  10. Role of Cell Cycle Regulation and MLH1, A Key DNA Mismatch Repair Protein, In Adaptive Survival Responses. Final Report

    SciTech Connect

    David A. Boothman

    1999-08-11

    Due to several interesting findings on both adaptive survival responses (ASRs) and DNA mismatch repair (MMR), this grant was separated into two discrete Specific Aim sets (each with their own discrete hypotheses). The described experiments were simultaneously performed.

  11. Potential role of Escherichia coli DNA mismatch repair proteins in colon cancer.

    PubMed

    Khan, Shahanavaj

    2015-12-01

    The epithelium of gastrointestinal tract organizes many innate defense systems against microbial intruders such as integrity of epithelial, rapid eviction of infected cells, quick turnover of epithelial cell, intrinsic immune responses and autophagy. However, Enteropathogenic Escherichia coli (EPEC) are equipped with well developed infectious tricks that evade the host defense systems and utilize the gastrointestinal epithelium as a multiplicative foothold. During multiplication on and within the epithelium, EPEC secrete various toxins that can weaken, usurp, and use many host cellular systems. However, the possible mechanisms of pathogenesis are still poorly elusive. Recent study reveals the existence of EPEC in colorectal cancer patients and their potential role in depletion of DNA mismatch repair (MMR) proteins of host cell in colonic cell lines. The EPEC colonised intracellularly in colon mucosa of colorectal carcinoma whereas extracellular strain was detected in mucosa of normal colon cells. Interestingly, alteration in MutS, MutL complexes and MUTYH of mammalian cells may be involved in development of CRC. These data propose that MMR of E. coli may be potential therapeutic targets and early detection biomarkers for CRC. This article reviews the potential role of E. coli MutS, MutL and MutY protein in CRC aetiology. PMID:26014615

  12. Minor Changes in Expression of the Mismatch Repair Protein MSH2 Exert a Major Impact on Glioblastoma Response to Temozolomide.

    PubMed

    McFaline-Figueroa, José L; Braun, Christian J; Stanciu, Monica; Nagel, Zachary D; Mazzucato, Patrizia; Sangaraju, Dewakar; Cerniauskas, Edvinas; Barford, Kelly; Vargas, Amanda; Chen, Yimin; Tretyakova, Natalia; Lees, Jacqueline A; Hemann, Michael T; White, Forest M; Samson, Leona D

    2015-08-01

    Glioblastoma (GBM) is often treated with the cytotoxic drug temozolomide, but the disease inevitably recurs in a drug-resistant form after initial treatment. Here, we report that in GBM cells, even a modest decrease in the mismatch repair (MMR) components MSH2 and MSH6 have profound effects on temozolomide sensitivity. RNAi-mediated attenuation of MSH2 and MSH6 showed that such modest decreases provided an unexpectedly strong mechanism of temozolomide resistance. In a mouse xenograft model of human GBM, small changes in MSH2 were sufficient to suppress temozolomide-induced tumor regression. Using The Cancer Genome Atlas to analyze mRNA expression patterns in tumors from temozolomide-treated GBM patients, we found that MSH2 transcripts in primary GBM could predict patient responses to initial temozolomide therapy. In recurrent disease, the absence of microsatellite instability (the standard marker for MMR deficiency) suggests a lack of involvement of MMR in the resistant phenotype of recurrent disease. However, more recent studies reveal that decreased MMR protein levels occur often in recurrent GBM. In accordance with our findings, these reported decreases may constitute a mechanism by which GBM evades temozolomide sensitivity while maintaining microsatellite stability. Overall, our results highlight the powerful effects of MSH2 attenuation as a potent mediator of temozolomide resistance and argue that MMR activity offers a predictive marker for initial therapeutic response to temozolomide treatment. PMID:26025730

  13. Proteasome inhibition rescues clinically significant unstable variants of the mismatch repair protein Msh2

    PubMed Central

    Arlow, Tim; Scott, Kristan; Wagenseller, Aubrey; Gammie, Alison

    2013-01-01

    MSH2 is required for DNA mismatch repair recognition in eukaryotes. Deleterious mutations in human MSH2 account for approximately half of the alleles associated with a common hereditary cancer syndrome. Previously, we characterized clinically identified MSH2 missense mutations, using yeast as a model system, and found that the most common cause of defective DNA mismatch repair was low levels of the variant Msh2 proteins. Here, we show that increased protein turnover is responsible for the reduced cellular levels. Increasing gene dosage of more than half of the missense alleles fully restored function. A titration experiment revealed that raising the expression level of one variant to less than wild-type levels restored mismatch repair, suggesting that overexpression is not always required to regain function. We found that the ubiquitin-mediated proteasome degradation pathway is the major mechanism for increased turnover of the Msh2 variants and identified the primary ubiquitin ligase as San1. Deletion of San1 restored protein levels for all but one variant, but did not elevate wild-type Msh2 levels. The unstable variants interacted with San1, whereas wild-type Msh2 did not. Additionally, san1Δ suppressed the mismatch repair defect of unstable variants. Of medical significance, the clinically approved drug Bortezomib partially restored protein levels and mismatch repair function for low-level variants and reversed the resistance to cisplatin, a common chemotherapeutic. Our results provide the foundation for an innovative therapeutic regime for certain mismatch-repair-defective cancers that are refractory to conventional chemotherapies. PMID:23248292

  14. Does a helicase activity help mismatch repair in eukaryotes?

    PubMed

    Song, Limin; Yuan, Fenghua; Zhang, Yanbin

    2010-07-01

    Mismatch repair (MMR) corrects innate DNA replication infidelities. Many components of eukaryotic MMR have been identified, the molecular mechanism of MMR has been largely demonstrated, and furthermore the nick-directed MMR reactions have been reconstituted with purified human proteins in vitro. However, some fundamental questions still remain to be answered. One such question is whether a DNA helicase activity is required for MMR in eukaryotes. This short review presents an overview of the interactions between eukaryotic DNA helicases and MMR factors, and suggests a possible mechanism for how DNA helicases may be involved in repair of DNA mismatches. PMID:20552646

  15. Heterogenous mismatch-repair status in colorectal cancer

    PubMed Central

    2014-01-01

    Abstract Background Immunohistochemical staining for mismatch repair proteins is efficient and widely used to identify mismatch repair defective tumors. The tumors typically show uniform and widespread loss of MMR protein staining. We identified and characterized colorectal cancers with alternative, heterogenous mismatch repair protein staining in order to delineate expression patterns and underlying mechanisms. Methods Heterogenous staining patterns that affected at least one of the mismatch repair proteins MLH1, PMS2, MSH2 and MSH6 were identified in 14 colorectal cancers. Based on alternative expression patterns macro-dissected and micro-dissected tumor areas were separately analyzed for microsatellite instability and MLH1 promoter methylation. Results Heterogenous retained/lost mismatch repair protein expression could be classified as intraglandular (within or in-between glandular formations), clonal (in whole glands or groups of glands) and compartmental (in larger tumor areas/compartments or in between different tumor blocks). These patterns coexisted in 9/14 tumors and in the majority of the tumors correlated with differences in microsatellite instability/MLH1 methylation status. Conclusions Heterogenous mismatch repair status can be demonstrated in colorectal cancer. Though rare, attention to this phenomenon is recommended since it corresponds to differences in mismatch repair status that are relevant for correct classification. Virtual Slides The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1771940323126788 PMID:24968821

  16. Screening for Lynch syndrome and referral to clinical genetics by selective mismatch repair protein immunohistochemistry testing: an audit and cost analysis.

    PubMed

    Colling, Richard; Church, David N; Carmichael, Juliet; Murphy, Lucinda; East, James; Risby, Peter; Kerr, Rachel; Chetty, Runjan; Wang, Lai Mun

    2015-12-01

    Lynch syndrome (LS) accounts for around 3% of colorectal cancers (CRCs) and is caused by germline mutations in mismatch repair (MMR) genes. Recently, screening strategies to identify patients with LS have become popular. We audited CRCs screened with MMR immunohistochemistry (IHC) in 2013. 209 tumours had MMR IHC performed at a cost of £12 540. 47/209 (21%) cases showed IHC loss of expression in at least one MMR protein. 28/44 cases with loss of MLH1 had additional BRAF V600E testing, at a cost of £5040. MMR IHC reduced the number of potential clinical genetics referrals from 209 to 47. BRAF mutation testing, performed in a subset of cases with MLH1 loss, further reduced this to 21. At a cost of £1340 per referral, this model of LS screening for clinical genetics referral had significant potential savings (£234 340) and can be easily implemented in parallel with MMR IHC done for prognostication in CRCs. PMID:26201544

  17. Reduction of DNA mismatch repair protein expression in airway epithelial cells of premenopausal women chronically exposed to biomass smoke.

    PubMed

    Mukherjee, Bidisha; Dutta, Anindita; Chowdhury, Saswati; Roychoudhury, Sanghita; Ray, Manas Ranjan

    2014-02-01

    Biomass burning is a major source of indoor air pollution in rural India. This study examined whether chronic inhalation of biomass smoke causes change in the DNA mismatch repair (MMR) pathway in the airway cells. For this, airway cells exfoliated in sputum were collected from 72 premenopausal nonsmoking rural women (median age 34 years) who cooked with biomass (wood, dung, crop residues) and 68 control women who cooked with cleaner fuel liquefied petroleum gas (LPG) for the past 5 years or more. The levels of particulate matters with diameters less than 10 and 2.5 μm (PM10 and PM2.5) in indoor air were measured by real-time aerosol monitor. Benzene exposure was monitored by measuring trans,trans-muconic acid (t,t-MA) in urine by high-performance liquid chromatography with ultraviolet detector. Generation of reactive oxygen species (ROS) and level of superoxide dismutase (SOD) in airway cells were measured by flow cytometry and spectrophotometry, respectively. Immunocytochemical assay revealed lower percentage of airway epithelial cells expressing MMR proteins mutL homolog 1 (MLH1) and mutS homolog 2 (MSH2) in biomass-using women compared to LPG-using controls. Women who cooked with biomass had 6.7 times higher level of urinary t,t-MA, twofold increase in ROS generation, and 31 % depletion of SOD. Indoor air of biomass-using households had three times more particulate matters than that of controls. ROS, urinary t,t-MA, and particulate pollution in biomass-using kitchen had negative correlation, while SOD showed positive correlation with MSH2 and MLH1 expression. It appears that chronic exposure to biomass smoke reduces MMR response in airway epithelial cells, and oxidative stress plays an important role in the process. PMID:24146321

  18. Importance of universal mismatch repair protein immunohistochemistry in patients with sebaceous neoplasia as an initial screening tool for Muir-Torre syndrome.

    PubMed

    Jessup, Chad J; Redston, Mark; Tilton, Erin; Reimann, Julie D R

    2016-03-01

    Muir-Torre syndrome, a Lynch syndrome variant, is characterized by sebaceous neoplasia plus one or more malignancies, typically colon cancer. The significance of DNA mismatch repair (MMR) deficiency detection by immunohistochemistry (IHC) in colorectal carcinomas is well established and is recommended as a screening tool for Lynch syndrome in newly diagnosed colorectal carcinomas. In comparison, literature on IHC application to detect MMR proteins (MLH1, MSH2, MSH6, and PMS2) in sebaceous neoplasia has been less studied and has been derived almost exclusively from tertiary care centers. Herein we describe the largest series to date characterizing MMR deficiency in sebaceous neoplasms, as well as the relative frequencies of each deficiency. Two hundred sixteen consecutive sebaceous neoplasms (216 patients) were analyzed from a community practice setting (133 sebaceous adenomas, 68 sebaceomas, 15 sebaceous carcinomas). One hundred forty-three were MMR deficient (66%), of which 90 were MSH2/MSH6 deficient (63%), 27 MLH1/PMS2 deficient (19%), 22 MSH6 deficient (15%), and 4 PMS2 deficient (3%). MMR deficiency was significantly associated with site, with tumors off of the head and neck more likely to be MMR deficient (specificity 96%). In contrast to prior reports, no significant trend in MMR-deficient versus -nondeficient tumors was seen in age at presentation (median age, 68 versus 66), tumor-infiltrating lymphocytes, or tumor type. Given the low sensitivity of age < 60 years (30%), location off of the head and neck (41%), or presence of tumor-infiltrating lymphocytes (29%) in MMR deficiency detection, IHC screening programs should test all sebaceous neoplasms for MMR deficiency, regardless of their clinicopathological features. PMID:26826402

  19. Selenium compounds activate ATM-dependent DNA damage responses via the mismatch repair protein hMLH1 in colorectal cancer cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Epidemiological and animal studies indicate that selenium supplementation suppresses risk of colorectal and other cancers. The majority of colorectal cancers are characterized by a defective DNA mismatch repair (MMR) process. Here, we have employed the MMR-deficient HCT 116 colorectal cancer cells ...

  20. The immunohistochemical detection of mismatch repair gene proteins (MLH1, MSH2, MSH6, and PMS2): practical aspects in antigen retrieval and biotin blocking protocols.

    PubMed

    Manavis, Jim; Gilham, Peter; Davies, Ruth; Ruszkiewicz, Andrew

    2003-03-01

    The immunohistochemical detection of the mismatch repair (MMR) proteins is used as a screening test with microsatellite instability for the detection of hereditary nonpolyposis colon cancer (HNPCC). The authors describe a simple and cost-effective method using a pressure cooker and microwave oven for antigen retrieval and a modified method for applying a commercial biotin blocking kit. Colorectal tumors of 20 patients of the HNPCC spectrum were included in this study. Eighty paraffin sections were cut and submitted for immunohistochemical analysis using a routine protocol and a pressure cooker protocol. Parallel sections for biotin blocking were also run, including the modified biotin block for each protocol. The sections were incubated with the following antibodies: MLH1, MSH2, MSH6, and PMS2. All cases examined exhibited a normal expression of the MMR proteins in the nucleus and adjacent nonneoplastic tissue elements and consequently defined as having a normal expression of these proteins. Cases with tumor that exhibited a loss of the nuclear staining with the MMR proteins with a concurrent staining of the adjacent nonneoplastic cells were classified as abnormal MMR expression. The series of 20 cases using pressure cooker antigen retrieval produced superior results to the routine immunohistochemical protocol used previously in our laboratory. The modified biotin block also gave consistent results. The reproducibility and consistency of this procedure has resulted it in being used routinely for suspected HNPCC cases, both current and archival. PMID:12610360

  1. Mismatch repair mRNA and protein expression in intestinal adenocarcinoma in sika deer (Cervus nippon) resembling heritable non-polyposis colorectal cancer in man.

    PubMed

    Jahns, H; Browne, J A

    2015-01-01

    Intestinal adenocarcinomas seen in an inbred herd of farmed sika deer (Cervus nippon) morphologically resembled human hereditary non-polyposis colorectal cancer (HNPCC). Features common to both included multiple de novo sites of tumourigenesis in the proximal colon, sessile and non-polyposis mucosal changes, the frequent finding of mucinous type adenocarcinoma, lymphocyte infiltration into the neoplastic tubules and Crohn's-like lymphoid follicles at the deep margin of the tumour. HNPCC is defined by a germline mutation of mismatch repair (MMR) genes resulting in their inactivation and loss of expression. To test the hypothesis that similar MMR gene inactivation occurs in the deer tumours, the expression of the four most important MMR genes, MSH2, MLH1, MSH6 and PMS2, was examined at the mRNA level by reverse transcriptase polymerase chain reaction (n = 12) and at the protein level by immunohistochemistry (n = 40) in tumour and control tissues. All four genes were expressed equally in normal and neoplastic tissues, so MMR gene inactivation could not be implicated in the carcinogenesis of this tumour in sika deer. PMID:25678423

  2. Ovarian endometrioid adenocarcinoma: incidence and clinical significance of the morphologic and immunohistochemical markers of mismatch repair protein defects and tumor microsatellite instability.

    PubMed

    Aysal, Anil; Karnezis, Anthony; Medhi, Irum; Grenert, James P; Zaloudek, Charles J; Rabban, Joseph T

    2012-02-01

    A subset of women with uterine cancer exhibiting defective mismatch repair (MMR) proteins and microsatellite instability (MSI) may have Lynch syndrome, which also confers a risk for colorectal cancer and other cancers in the patient and in her family. Screening algorithms based on clinical and pathologic criteria are effective in determining which patients with uterine cancer are most likely to benefit from definitive genetic testing for Lynch syndrome. Ovarian cancer, particularly endometrioid adenocarcinoma, is also associated with Lynch syndrome, although the risk is much smaller than for uterine cancer. This study evaluated whether the morphologic criteria [tumor-infiltrating lymphocytes (TILs), peritumoral lymphocytes (PTLs), dedifferentiated morphology)] currently used to screen uterine cancer for further Lynch syndrome testing can be applied to ovarian cancer. Among 71 patients with pure ovarian endometrioid adenocarcinoma treated at a single institution, 13% had a tumor with TILs, 3% had PTLs, and none had dedifferentiated morphology. Overall, 10% of tumors had abnormal MMR protein status, defined as complete immunohistochemical loss of expression of MLH1, MSH2, MSH6, and/or PMS2. Each of these tumors with abnormal MMR status demonstrated MSI using a polymerase chain reaction-based assay evaluating 5 mononucleotide repeat markers. No relationship was found between patient age, TILs, PTLs, or a spectrum of other morphologic variables and MMR protein status/MSI. Only 1/7 tumors with abnormal MMR/MSI had TILs/PTLs. Among 14 patients who died, 12 (86%) had normal MMR status. Among 7 patients with tumors with abnormal MMR/MSI, 5 (71%) were alive without disease. Concurrent uterine tumor was present in 5/7 patients whose ovarian tumor had abnormal MMR/MSI. This study suggests that the morphologic criteria used to screen patients with uterine cancer for further Lynch syndrome testing are not applicable in patients with ovarian cancer. Although abnormal MMR/MSI did

  3. Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus

    PubMed Central

    2004-01-01

    Lichen planus is a mucocutaneous disease of inflammatory nature and unknown etiology. It is characterized by a cell-mediated immunological response to induced antigenic change in skin and/or mucosa. The possible malignant transformation of lichen planus remains a subject of controversial discussions in the literature. hMSH2 is one of the human DNA mismatch repair (hMMR) genes and it plays an important role in reducing mutation and maintaining genomic stability. hMSH2 alterations have been reported in oral squamous cell carcinoma and there are evidences suggesting the association between oral lichen planus and squamous cell carcinoma. In this study, we aim to investigate the immunolocalization of hMSH2 protein in oral lichen planus compared to oral normal mucosa epithelium. We examined the expression of hMSH2 protein by immunohistochemistry in twenty-six cases of oral lichen planus. Clinically, 12 of them were categorized into reticular subtype and 14 were atrophic/erosive. Ten cases of normal mucosa were added to the control group. Results showed that the percentage of positive cells to hMSH2 was smaller in reticular (46.54%; p=0,006) and atrophic/erosive (48.79%; p=0,028) subtypes of oral lichen planus compared to normal mucosa (61.29%). The reduced expression of hMSH2 protein in oral lichen planus suggests that this lesion is more susceptible to mutation and therefore facilitate the development of oral squamous cell carcinoma. PMID:15912193

  4. Methylation-induced G2/M arrest requires a full complement of the mismatch repair protein hMLH1

    PubMed Central

    Cejka, Petr; Stojic, Lovorka; Mojas, Nina; Russell, Anna Marie; Heinimann, Karl; Cannavó, Elda; di Pietro, Massimiliano; Marra, Giancarlo; Jiricny, Josef

    2003-01-01

    The mismatch repair (MMR) gene hMLH1 is mutated in ∼50% of hereditary non-polyposis colon cancers and transcriptionally silenced in ∼25% of sporadic tumours of the right colon. Cells lacking hMLH1 display microsatellite instability and resistance to killing by methylating agents. In an attempt to study the phenotypic effects of hMLH1 downregulation in greater detail, we designed an isogenic system, in which hMLH1 expression is regulated by doxycycline. We now report that human embryonic kidney 293T cells expressing high amounts of hMLH1 were MMR-proficient and arrested at the G2/M cell cycle checkpoint following treatment with the DNA methylating agent N-methyl-N′-nitro-N-nitrosoguanidine (MNNG), while cells not expressing hMLH1 displayed a MMR defect and failed to arrest upon MNNG treatment. Interestingly, MMR proficiency was restored even at low hMLH1 concentrations, while checkpoint activation required a full complement of hMLH1. In the MMR-proficient cells, activation of the MNNG-induced G2/M checkpoint was accompanied by phosphorylation of p53, but the cell death pathway was p53 independent, as the latter polypeptide is functionally inactivated in these cells by SV40 large T antigen. PMID:12727890

  5. Novel DNA mismatch repair activity involving YB-1 in human mitochondria

    PubMed Central

    de Souza-Pinto, Nadja C.; Mason, Penelope A.; Hashiguchi, Kazunari; Weissman, Lior; Tian, Jingyan; Guay, David; Lebel, Michel; Stevnsner, Tinna V.; Rasmussen, Lene Juel; Bohr, Vilhelm A.

    2009-01-01

    Maintenance of the mitochondrial genome (mtDNA) is essential for proper cellular function. The accumulation of damage and mutations in the mtDNA leads to diseases, cancer, and aging. Mammalian mitochondria have proficient base excision repair, but the existence of other DNA repair pathways is still unclear. Deficiencies in DNA mismatch repair (MMR), which corrects base mismatches and small loops, are associated with DNA microsatellite instability, accumulation of mutations, and cancer. MMR proteins have been identified in yeast and coral mitochondria; however, MMR proteins and function have not yet been detected in human mitochondria. Here we show that human mitochondria have a robust mismatch-repair activity, which is distinct from nuclear MMR. Key nuclear MMR factors were not detected in mitochondria, and similar mismatch-binding activity was observed in mitochondrial extracts from cells lacking MSH2, suggesting distinctive pathways for nuclear and mitochondrial MMR. We identified the repair factor YB-1 as a key candidate for a mitochondrial mismatch-binding protein. This protein localizes to mitochondria in human cells, and contributes significantly to the mismatch-binding and mismatch-repair activity detected in HeLa mitochondrial extracts, which are significantly decreased when the intracellular levels of YB-1 are diminished. Moreover, YB-1 depletion in cells increases mitochondrial DNA mutagenesis. Our results show that human mitochondria contain a functional MMR repair pathway in which YB-1 participates, likely in the mismatch binding and recognition steps. PMID:19272840

  6. DNA Mismatch Repair

    PubMed Central

    MARINUS, M. G.

    2014-01-01

    DNA mismatch repair functions to correct replication errors in newly synthesized DNA and to prevent recombination between related, but not identical (homeologous), DNA sequences. The mechanism of mismatch repair is best understood in Escherichia coli and is the main focus of this review. The early genetic studies of mismatch repair are described as a basis for the subsequent biochemical characterization of the system. The effects of mismatch repair on homologous and homeologous recombination are described. The relationship of mismatch repair to cell toxicity induced by various drugs is included. The VSP (Very Short Patch) repair system is described in detail. PMID:26442827

  7. MCM9 Is Required for Mammalian DNA Mismatch Repair.

    PubMed

    Traver, Sabine; Coulombe, Philippe; Peiffer, Isabelle; Hutchins, James R A; Kitzmann, Magali; Latreille, Daniel; Méchali, Marcel

    2015-09-01

    DNA mismatch repair (MMR) is an evolutionarily conserved process that corrects DNA polymerase errors during replication to maintain genomic integrity. In E. coli, the DNA helicase UvrD is implicated in MMR, yet an analogous helicase activity has not been identified in eukaryotes. Here, we show that mammalian MCM9, a protein involved in replication and homologous recombination, forms a complex with MMR initiation proteins (MSH2, MSH3, MLH1, PMS1, and the clamp loader RFC) and is essential for MMR. Mcm9-/- cells display microsatellite instability and MMR deficiency. The MCM9 complex has a helicase activity that is required for efficient MMR since wild-type but not helicase-dead MCM9 restores MMR activity in Mcm9-/- cells. Moreover, MCM9 loading onto chromatin is MSH2-dependent, and in turn MCM9 stimulates the recruitment of MLH1 to chromatin. Our results reveal a role for MCM9 and its helicase activity in mammalian MMR. PMID:26300262

  8. Unusual Mismatch Repair Immunohistochemical Patterns in Endometrial Carcinoma.

    PubMed

    Watkins, Jaclyn C; Nucci, Marisa R; Ritterhouse, Lauren L; Howitt, Brooke E; Sholl, Lynette M

    2016-07-01

    Universal screening for Lynch syndrome through mismatch repair (MMR) immunohistochemistry (IHC) on tumor samples has brought to light several heterogenous MMR staining patterns. At our institution, a prospective study of universal Lynch syndrome screening using MMR IHC on 125 endometrial cancers (EC) led to the identification of subclonal loss of MMR protein expression within the tumor (n=9). We also interrogated the MMR staining patterns in MMR-deficient EC with concurrent endometrial intraepithelial neoplasia (EIN; n=14) and all mixed-type ECs (n=14) to look for concordant or discordant profiles between the various components. MLH1 promoter methylation and microsatellite instability testing was performed on discordant subclones. Abrupt and complete subclonal loss of MMR expression was identified in 9 cases (7.2%; 7 subclonal MLH1/PMS2 loss, 1 subclonal loss of MLH1 and complete loss of PMS2, and 1 subclonal MSH6 loss). All subclonal MLH1 losses were associated with epigenetic silencing. In cases with concomitant EIN (n=14), 7 cases showed concordant MMR IHC between EC and EIN, and 4 cases showed MMR protein loss confined to the EC. The remaining 3 cases demonstrated subclonal staining in the EIN. In mixed tumors (n=14), subclonal or total MMR IHC deficiency was confined to endometrioid components. In summary, discrete subclonal loss of MMR protein expression occurs in up to 7.2% of EC and, in our experience, only in endometrioid components. Importantly, subclonal MLH1 MMR defects appear to be a biological phenomenon that can be explained by methylation and somatic events, without evidence of underlying germline alterations. PMID:27186853

  9. Human mismatch-repair protein MutL homologue 1 (MLH1) interacts with Escherichia coli MutL and MutS in vivo and in vitro: a simple genetic system to assay MLH1 function.

    PubMed Central

    Quaresima, Barbara; Alifano, Pietro; Tassone, Pierfrancesco; Avvedimento, Enrico V; Costanzo, Francesco S; Venuta, Salvatore

    2003-01-01

    A simple genetic system has been developed to test the effect of over-expression of wild-type or mutated human MutL homologue 1 (hMLH1) proteins on methyl-directed mismatch repair (MMR) in Escherichia coli. The system relies on detection of Lac(+) revertants using MMR-proficient or MMR-deficient E. coli strains carrying a lac +1 frameshift mutation expressing hMLH1 proteins. We report that expression of wild-type hMLH1 protein causes an approx. 19-fold increase in mutation rates. The mutator phenotype was due to the ability of hMLH1 protein to interact with bacterial MutL and MutS proteins, thereby interfering with the formation of complexes between MMR proteins and mismatched DNA. Conversely, expression of proteins encoded by alleles deriving from hereditary-non-polyposis-colon-cancer (HNPCC) families decreases mutation rates, depending on the specific amino acid substitutions. These effects parallel the MutL-and MutS-binding and ATP-binding/hydrolysis activities of the mutated proteins. PMID:12513688

  10. DNA Triplet Repeat Expansion and Mismatch Repair

    PubMed Central

    Iyer, Ravi R.; Pluciennik, Anna; Napierala, Marek; Wells, Robert D.

    2016-01-01

    DNA mismatch repair is a conserved antimutagenic pathway that maintains genomic stability through rectification of DNA replication errors and attenuation of chromosomal rearrangements. Paradoxically, mutagenic action of mismatch repair has been implicated as a cause of triplet repeat expansions that cause neurological diseases such as Huntington disease and myotonic dystrophy. This mutagenic process requires the mismatch recognition factor MutSβ and the MutLα (and/or possibly MutLγ) endonuclease, and is thought to be triggered by the transient formation of unusual DNA structures within the expanded triplet repeat element. This review summarizes the current knowledge of DNA mismatch repair involvement in triplet repeat expansion, which encompasses in vitro biochemical findings, cellular studies, and various in vivo transgenic animal model experiments. We present current mechanistic hypotheses regarding mismatch repair protein function in mediating triplet repeat expansions and discuss potential therapeutic approaches targeting the mismatch repair pathway. PMID:25580529

  11. Deficient mismatch repair: Read all about it (Review)

    PubMed Central

    RICHMAN, SUSAN

    2015-01-01

    Defects in the DNA mismatch repair (MMR) proteins, result in a phenotype called microsatellite instability (MSI), occurring in up to 15% of sporadic colorectal cancers. Approximately one quarter of colon cancers with deficient MMR (dMMR) develop as a result of an inherited predisposition syndrome, Lynch syndrome (formerly known as HNPCC). It is essential to identify patients who potentially have Lynch syndrome, as not only they, but also family members, may require screening and monitoring. Diagnostic criteria have been developed, based primarily on Western populations, and several methodologies are available to identify dMMR tumours, including immunohistochemistry and microsatellite testing. These criteria have provided evidence supporting the introduction of reflex testing. Yet, it is becoming increasingly clear that tests have a limited sensitivity and specificity and may yet be superseded by next generation sequencing. In this review, the limitations of diagnostic criteria are discussed, and current and emerging screening technologies explained. There is now useful evidence supporting the prognostic and predictive value of dMMR status in colorectal tumours, but much less is known about their value in extracolonic tumours, that may also feature in Lynch syndrome. This review assesses current literature relating to dMMR in endometrial, ovarian, gastric and melanoma cancers, which it would seem, may benefit from large-scale clinical trials in order to further close the gap in knowledge between colorectal and extracolonic tumours. PMID:26315971

  12. Mismatch repair deficiency testing in clinical practice.

    PubMed

    Buza, Natalia; Ziai, James; Hui, Pei

    2016-05-01

    Lynch syndrome, an autosomal dominant inherited disorder, is caused by inactivating mutations involving DNA mismatch repair (MMR) genes. This leads to profound genetic instability, including microsatellite instability (MSI) and increased risk for cancer development, particularly colon and endometrial malignancies. Clinical testing of tumor tissues for the presence of MMR gene deficiency is standard practice in clinical oncology, with immunohistochemistry and PCR-based microsatellite instability analysis used as screening tests to identify potential Lynch syndrome families. The ultimate diagnosis of Lynch syndrome requires documentation of mutation within one of the four MMR genes (MLH1, PMS2, MSH2 and MSH6) or EPCAM, currently achieved by comprehensive sequencing analysis of germline DNA. In this review, the genetic basis of Lynch syndrome, methodologies of MMR deficiency testing, and current diagnostic algorithms in the clinical management of Lynch syndrome, are discussed. PMID:26895074

  13. Expression of human DNA mismatch-repair protein, hMSH2, in patients with oral lichen planus.

    PubMed

    Li, Hao-Bo; Zhang, Ying-Huai; Chen, Hui-Zhen; Chen, Yong

    2015-01-01

    hMSH2 is one of the human DNA mismatch repair genes that plays an important role in reducing mutations and maintaining genomic stability. The aim of the present study was to detect the expression and significance of hMSH2 protein in patients with oral lichen planus (OLP). The expression levels of hMSH2 in the OLP group (n=51) and control group with normal oral mucosa (NM; n=40) were detected using an immunohistochemical method and subsequently assessed. The positive rate of hMSH2 expression in the OLP group was 52.94%, while the rate was 80% in the control group, exhibiting a statistically significant difference (χ(2)=7.1993; P<0.05). However, the expression of hMSH2 in the OLP tissues was not shown to significantly correlate with the patient gender, age and type of OLP (P>0.05). In conclusion, the protein expression levels of hMSH2 in the OLP tissues were significantly reduced as compared with that in the NM tissues, indicating that hMSH2 plays a role in the development of OLP. Therefore, hMSH2 may be used as a biomarker for evaluating the cancer risk of patients with OLP. PMID:25452803

  14. Purification, crystallization and preliminary X-ray diffraction analysis of the human mismatch repair protein MutS[beta

    SciTech Connect

    Tseng, Quincy; Orans, Jillian; Hast, Michael A.; Iyer, Ravi R.; Changela, Anita; Modrich, Paul L.; Beese, Lorena S.

    2012-03-16

    MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification of recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.

  15. New Therapeutic Opportunities Based on DNA Mismatch Repair and BRAF Status in Metastatic Colorectal Cancer.

    PubMed

    Cohen, Romain; Svrcek, Magali; Dreyer, Chantal; Cervera, Pascale; Duval, Alex; Pocard, Marc; Fléjou, Jean-François; de Gramont, Aimery; André, Thierry

    2016-03-01

    Recently, colorectal cancer (CRC) subtyping consortium identified four consensus molecular subtypes (CMS1-4). CMS1 is enriched for deficient mismatch repair (dMMR) and BRAF (V600E) tumors. Intriguingly, this subtype has better relapse-free survival but worse overall survival after relapse compared with the other subtypes. Growing evidence is accumulating on the benefit of specific therapeutic strategies such as immune checkpoint inhibition therapy in dMMR tumors and mitogen-activated protein kinase (MAPK) pathway targeted therapy in tumors harboring BRAF (V600E) mutation. After reviewing dMMR prognostic value, immune checkpoints as major targets for dMMR carcinomas will be highlighted. Following, BRAF (V600E) prognostic impact will be reviewed and therapeutic strategies with the combination of cytotoxic agents and especially the combinations of BRAF and MAPK inhibitors will be discussed. PMID:26861657

  16. Isolation and Characterization of Two Saccharomyces Cerevisiae Genes Encoding Homologs of the Bacterial Hexa and Muts Mismatch Repair Proteins

    PubMed Central

    Reenan, R. A.; Kolodner, R. D.

    1992-01-01

    Homologs of the Escherichia coli (mutL, S and uvrD) and Streptococcus pneumoniae (hexA, B) genes involved in mismatch repair are known in several distantly related organisms. Degenerate oligonucleotide primers based on conserved regions of E. coli MutS protein and its homologs from Salmonella typhimurium, S. pneumoniae and human were used in the polymerase chain reaction (PCR) to amplify and clone mutS/hexA homologs from Saccharomyces cerevisiae. Two DNA sequences were amplified whose deduced amino acid sequences both shared a high degree of homology with MutS. These sequences were then used to clone the full-length genes from a yeast genomic library. Sequence analysis of the two MSH genes (MSH = mutS homolog), MSH1 and MSH2, revealed open reading frames of 2877 bp and 2898 bp. The deduced amino acid sequences predict polypeptides of 109.3 kD and 109.1 kD, respectively. The overall amino acid sequence identity with the E. coli MutS protein is 28.6% for MSH1 and 25.2% for MSH2. Features previously found to be shared by MutS homologs, such as the nucleotide binding site and the helix-turn-helix DNA binding motif as well as other highly conserved regions whose function remain unknown, were also found in the two yeast homologs. Evidence presented in this and a companion study suggest that MSH1 is involved in repair of mitochondrial DNA and that MSH2 is involved in nuclear DNA repair. PMID:1459447

  17. Mismatch repair ensures fidelity of replication and recombination in the radioresistant organism Deinococcus radiodurans.

    PubMed

    Mennecier, S; Coste, G; Servant, P; Bailone, A; Sommer, S

    2004-11-01

    We have characterized the mismatch repair system (MMR) of the highly radiation-resistant type strain of Deinococcus radiodurans, ATCC 13939. We show that the MMR system is functional in this organism, where it participates in ensuring the fidelity of DNA replication and recombination. The system relies on the activity of two key proteins, MutS1 and MutL, which constitute a conserved core involved in mismatch recognition. Inactivation of MutS1 or MutL resulted in a seven-fold increase in the frequency of spontaneous RifR mutagenesis and a ten-fold increase in the efficiency of integration of a donor point-mutation marker during bacterial transformation. Inactivation of the mismatch repair-associated UvrD helicase increased the level of spontaneous mutagenesis, but had no effect on marker integration--suggesting that binding of MutS1 and MutL proteins to a mismatched heteroduplex suffices to inhibit recombination between non identical (homeologous) DNAs. In contrast, inactivation of MutS2, encoded by the second mutS -related gene present in D. radiodurans, had no effect on mutagenesis or recombination. Cells devoid of MutS1 or MutL proteins were as resistant to gamma-rays, mitomycin C and UV-irradiation as wild-type bacteria, suggesting that the mismatch repair system is not essential for the reconstitution of a functional genome after DNA damage. PMID:15503140

  18. Proteomic analysis of mismatch repair-mediated alkylating agent-induced DNA damage response

    PubMed Central

    2013-01-01

    Background Mediating DNA damage-induced apoptosis is an important genome-maintenance function of the mismatch repair (MMR) system. Defects in MMR not only cause carcinogenesis, but also render cancer cells highly resistant to chemotherapeutics, including alkylating agents. To understand the mechanisms of MMR-mediated apoptosis and MMR-deficiency-caused drug resistance, we analyze a model alkylating agent (N-methyl-N’-nitro-N-nitrosoguanidine, MNNG)-induced changes in protein phosphorylation and abundance in two cell lines, the MMR-proficient TK6 and its derivative MMR-deficient MT1. Results Under an experimental condition that MNNG-induced apoptosis was only observed in MutSα-proficient (TK6), but not in MutSα-deficient (MT1) cells, quantitative analysis of the proteomic data revealed differential expression and phosphorylation of numerous individual proteins and clusters of protein kinase substrates, as well differential activation of response pathways/networks in MNNG-treated TK6 and MT1 cells. Many alterations in TK6 cells are in favor of turning on the apoptotic machinery, while many of those in MT1 cells are to promote cell proliferation and anti-apoptosis. Conclusions Our work provides novel molecular insights into the mechanism of MMR-mediated DNA damage-induced apoptosis. PMID:24330662

  19. Visualization of mismatch repair complexes using fluorescence microscopy.

    PubMed

    Schmidt, Tobias T; Hombauer, Hans

    2016-02-01

    DNA mismatch repair (MMR) is a surveillance mechanism present in most living organisms, which repairs errors introduced by DNA polymerases. Importantly, loss of MMR function due to inactivating mutations and/or epigenetic silencing results in the accumulation of mutations and as consequence increased cancer susceptibility, as observed in Lynch syndrome patients. During the past decades important progress has been made in the MMR field resulting in the identification and characterization of essential MMR components, culminating in the in vitro reconstitution of 5' and 3' nick-directed MMR. However, several mechanistic aspects of the MMR reaction remain not fully understood, therefore alternative approaches and further investigations are needed. Recently, the use of imaging techniques and, more specifically, visualization of MMR components in living cells, has broadened our mechanistic understanding of the repair reaction providing more detailed information about the spatio-temporal organization of MMR in vivo. In this review we would like to comment on mechanistic aspects of the MMR reaction in light of these and other recent findings. Moreover, we will discuss the current limitations and provide future perspectives regarding imaging of mismatch repair components in diverse organisms. PMID:26725956

  20. Mismatch repair proficiency is not required for radioenhancement by gemcitabine

    SciTech Connect

    Bree, Chris van . E-mail: c.vanbree@amc.uva.nl; Rodermond, Hans M.; Vos, Judith de; Haveman, Jaap; Franken, Nicolaas

    2005-08-01

    Purpose: Mismatch repair (MMR) proficiency has been reported to either increase or decrease radioenhancement by 24-h incubations with gemcitabine. This study aimed to establish the importance of MMR for radioenhancement by gemcitabine after short-exposure, high-dose treatment and long-exposure, low-dose treatment. Methods and Materials: Survival of MMR-deficient HCT116 and MMR-proficient HCT116 + 3 cells was analyzed by clonogenic assays. Mild, equitoxic gemcitabine treatments (4 h, 0.1 {mu}M vs. 24 h, 6 nM) were combined with {gamma}-irradiation to determine the radioenhancement with or without recovery. Gemcitabine metabolism and cell-cycle effects were evaluated by high-performance liquid chromatography analysis and bivariate flow cytometry. Results: Radioenhancement after 4 h of 0.1 {mu}M of gemcitabine was similar in both cell lines, but the radioenhancement after 24 h of 6 nM of gemcitabine was reduced in MMR-proficient cells. No significant differences between both cell lines were observed in the gemcitabine metabolism or cell-cycle effects after these treatments. Gemcitabine radioenhancement after recovery was also lower in MMR-proficient cells than in MMR-deficient cells. Conclusion: Mismatch repair proficiency decreases radioenhancement by long incubations of gemcitabine but does not affect radioenhancement by short exposures to a clinically relevant gemcitabine dose. Our data suggest that MMR contributes to the recovery from gemcitabine treatment.

  1. Activation of Saccharomyces cerevisiae Mlh1-Pms1 Endonuclease in a Reconstituted Mismatch Repair System.

    PubMed

    Smith, Catherine E; Bowen, Nikki; Graham, William J; Goellner, Eva M; Srivatsan, Anjana; Kolodner, Richard D

    2015-08-28

    Previous studies reported the reconstitution of an Mlh1-Pms1-independent 5' nick-directed mismatch repair (MMR) reaction using Saccharomyces cerevisiae proteins. Here we describe the reconstitution of a mispair-dependent Mlh1-Pms1 endonuclease activation reaction requiring Msh2-Msh6 (or Msh2-Msh3), proliferating cell nuclear antigen (PCNA), and replication factor C (RFC) and a reconstituted Mlh1-Pms1-dependent 3' nick-directed MMR reaction requiring Msh2-Msh6 (or Msh2-Msh3), exonuclease 1 (Exo1), replication protein A (RPA), RFC, PCNA, and DNA polymerase δ. Both reactions required Mg(2+) and Mn(2+) for optimal activity. The MMR reaction also required two reaction stages in which the first stage required incubation of Mlh1-Pms1 with substrate DNA, with or without Msh2-Msh6 (or Msh2-Msh3), PCNA, and RFC but did not require nicking of the substrate, followed by a second stage in which other proteins were added. Analysis of different mutant proteins demonstrated that both reactions required a functional Mlh1-Pms1 endonuclease active site, as well as mispair recognition and Mlh1-Pms1 recruitment by Msh2-Msh6 but not sliding clamp formation. Mutant Mlh1-Pms1 and PCNA proteins that were defective for Exo1-independent but not Exo1-dependent MMR in vivo were partially defective in the Mlh1-Pms1 endonuclease and MMR reactions, suggesting that both reactions reflect the activation of Mlh1-Pms1 seen in Exo1-independent MMR in vivo. The availability of this reconstituted MMR reaction should now make it possible to better study both Exo1-independent and Exo1-dependent MMR. PMID:26170454

  2. Deficient DNA mismatch repair is associated with favorable prognosis in Thai patients with sporadic colorectal cancer

    PubMed Central

    Korphaisarn, Krittiya; Pongpaibul, Ananya; Limwongse, Chanin; Roothumnong, Ekkapong; Klaisuban, Wipawi; Nimmannit, Akarin; Jinawath, Artit; Akewanlop, Charuwan

    2015-01-01

    AIM: To determine the prognostic significance of deficient mismatch repair (dMMR) and BRAF V600E in Thai sporadic colorectal cancer (CRC) patients. METHODS: We studied a total of 211 out of 405 specimens obtained from newly diagnosed CRC patients between October 1, 2006 and December 31, 2007 at Siriraj Hospital, Mahidol University. Formalin-fixed paraffin-embedded blocks of CRC tissue samples were analyzed for dMMR by detection of MMR protein expression loss by immunohistochemistry or microsatellite instability using polymerase chain reaction (PCR)-DHPLC. BRAF V600E mutational analysis was performed in DNA extracted from the same archival tissues by two-round allele-specific PCR and analyzed by high sensitivity DHPLC. Associations between patient characteristics, MMR and BRAF status with disease-free survival (DFS) and overall survival (OS) were determined by Kaplan-Meier survival plots and log-rank test together with Cox’s proportional hazard regression. RESULTS: dMMR and BRAF V600E mutations were identified in 31 of 208 (14.9%) and 23 of 211 (10.9%) tumors, respectively. dMMR was more commonly found in patients with primary colon tumors rather than rectal cancer (20.4% vs 7.6%, P =0.01), but there was no difference in MMR status between the right-sided and left-sided colon tumors (20.8% vs 34.6%, P = 0.24). dMMR was associated with early-stage rather than metastatic disease (17.3% vs 0%, P = 0.015). No clinicopathological features such primary site or tumor differentiation were associated with the BRAF mutation. Six of 31 (19.3%) samples with dMMR carried the BRAF mutation, while 17 of 177 (9.6%) with proficient MMR (pMMR) harbored the mutation (P = 0.11). Notably, patients with dMMR tumors had significantly superior DFS (HR = 0.30, 95%CI: 0.15-0.77; P = 0.01) and OS (HR = 0.29, 95%CI: 0.10-0.84; P = 0.02) compared with patients with pMMR tumors. By contrast, the BRAF V600E mutation had no prognostic impact on DFS and OS. CONCLUSION: The prevalence of dMMR and

  3. DNA mismatch repair: molecular mechanisms and biological function.

    PubMed

    Schofield, Mark J; Hsieh, Peggy

    2003-01-01

    DNA mismatch repair (MMR) guards the integrity of the genome in virtually all cells. It contributes about 1000-fold to the overall fidelity of replication and targets mispaired bases that arise through replication errors, during homologous recombination, and as a result of DNA damage. Cells deficient in MMR have a mutator phenotype in which the rate of spontaneous mutation is greatly elevated, and they frequently exhibit microsatellite instability at mono- and dinucleotide repeats. The importance of MMR in mutation avoidance is highlighted by the finding that defects in MMR predispose individuals to hereditary nonpolyposis colorectal cancer. In addition to its role in postreplication repair, the MMR machinery serves to police homologous recombination events and acts as a barrier to genetic exchange between species. PMID:14527292

  4. Mismatch Repair and Colon Cancer: Mechanisms and Therapies Explored.

    PubMed

    Li, Stephen K H; Martin, Alberto

    2016-04-01

    Colorectal cancer (CRC) remains one of the most prevalent cancers worldwide. In sporadic CRC, mutations frequently occur in the DNA mismatch repair (MMR) pathway. In addition, germline MMR mutations have been linked to Lynch syndrome, the most common form of hereditary CRC. Although genetic mutations, diet, inflammation, and the gut microbiota can influence CRC, it is unclear how MMR deficiency relates to these factors to modulate disease. In this review, the association of MMR to the etiology of CRC is examined, particularly in the context of microRNAs (miRNAs), inflammation, and the microbiome. We also discuss the most current targeted therapies, methods of prevention, and molecular biomarkers against MMR-deficient CRC, all of which are encouraging advancements in the field. PMID:26970951

  5. Proteogenomic analysis reveals unanticipated adaptations of colorectal tumor cells to deficiencies in DNA mismatch repair

    PubMed Central

    Halvey, Patrick J.; Wang, Xiaojing; Wang, Jing; Bhat, Ajaz A.; Dhawan, Punita; Li, Ming; Zhang, Bing; Liebler, Daniel C.; Slebos, Robbert J.C.

    2014-01-01

    Summary A growing body of genomic data on human cancers poses the critical question of how genomic variations translate to cancer phenotypes. We employed standardized shotgun proteomics and targeted protein quantitation platforms to analyze a panel of 10 colon cancer cell lines differing by mutations in DNA mismatch repair (MMR) genes. In addition, we performed transcriptome sequencing (RNA-seq) to enable detection of protein sequence variants from the proteomic data. Biological replicate cultures yielded highly consistent proteomic inventories with a cumulative total of 6,513 protein groups with a protein FDR of 3.17% across all cell lines. Networks of co-expressed proteins with differential expression based on MMR status revealed impact on protein folding, turnover and transport, on cellular metabolism and on DNA and RNA synthesis and repair. Analysis of variant amino acid sequences suggested higher stability of proteins affected by naturally occurring germline polymorphisms than of proteins affected by somatic protein sequence changes. The data provide evidence for multi-system adaptation to MMR deficiency with a stress response that targets misfolded proteins for degradation through the ubiquitin-dependent proteasome pathway. Enrichment analysis suggested epithelial-to-mesenchymal transition (EMT) in RKO cells, as evidenced by increased mobility and invasion properties compared to SW480. The observed proteomic profiles demonstrate previously unknown consequences of altered DNA repair and provide an expanded basis for mechanistic interpretation of MMR phenotypes. PMID:24247723

  6. Proteomic Analysis Reveals a Novel Mutator S (MutS) Partner Involved in Mismatch Repair Pathway.

    PubMed

    Chen, Zhen; Tran, Mykim; Tang, Mengfan; Wang, Wenqi; Gong, Zihua; Chen, Junjie

    2016-04-01

    The mismatch repair (MMR) family is a highly conserved group of proteins that function in correcting base-base and insertion-deletion mismatches generated during DNA replication. Disruption of this process results in characteristic microsatellite instability (MSI), repair defects, and susceptibility to cancer. However, a significant fraction of MSI-positive cancers express MMR genes at normal levels and do not carry detectable mutation in known MMR genes, suggesting that additional factors and/or mechanisms may exist to explain these MSI phenotypes in patients. To systematically investigate the MMR pathway, we conducted a proteomic analysis and identified MMR-associated protein complexes using tandem-affinity purification coupled with mass spectrometry (TAP-MS) method. The mass spectrometry data have been deposited to the ProteomeXchange with identifier PXD003014 and DOI 10.6019/PXD003014. We identified 230 high-confidence candidate interaction proteins (HCIPs). We subsequently focused on MSH2, an essential component of the MMR pathway and uncovered a novel MSH2-binding partner, WDHD1. We further demonstrated that WDHD1 forms a stable complex with MSH2 and MSH3 or MSH6,i.e.the MutS complexes. The specific MSH2/WDHD1 interaction is mediated by the second lever domain of MSH2 and Ala(1123)site of WDHD1. Moreover, we showed that, just like MSH2-deficient cells, depletion of WDHD1 also led to 6-thioguanine (6-TG) resistance, indicating that WDHD1 likely contributes to the MMR pathway. Taken together, our study uncovers new components involved in the MMR pathway, which provides candidate genes that may be responsible for the development of MSI-positive cancers. PMID:27037360

  7. Modulation of mismatch repair and genomic stability by miR-155

    PubMed Central

    Valeri, Nicola; Gasparini, Pierluigi; Fabbri, Muller; Braconi, Chiara; Veronese, Angelo; Lovat, Francesca; Adair, Brett; Vannini, Ivan; Fanini, Francesca; Bottoni, Arianna; Costinean, Stefan; Sandhu, Sukhinder K.; Nuovo, Gerard J; Alder, Hansjuerg; Gafa, Roberta; Calore, Federica; Ferracin, Manuela; Lanza, Giovanni; Volinia, Stefano; Negrini, Massimo; McIlhatton, Michael A.; Amadori, Dino; Fishel, Richard; Croce, Carlo M.

    2010-01-01

    Inactivation of mismatch repair (MMR) is the cause of the common cancer predisposition disorder Lynch syndrome (LS), also known as hereditary nonpolyposis colorectal cancer (HNPCC), as well as 10–40% of sporadic colorectal, endometrial, ovarian, gastric, and urothelial cancers. Elevated mutation rates (mutator phenotype), including simple repeat instability [microsatellite instability (MSI)] are a signature of MMR defects. MicroRNAs (miRs) have been implicated in the control of critical cellular pathways involved in development and cancer. Here we show that overexpression of miR-155 significantly down-regulates the core MMR proteins, hMSH2, hMSH6, and hMLH1, inducing a mutator phenotype and MSI. An inverse correlation between the expression of miR-155 and the expression of MLH1 or MSH2 proteins was found in human colorectal cancer. Finally, a number of MSI tumors with unknown cause of MMR inactivation displayed miR-155 overexpression. These data provide support for miR-155 modulation of MMR as a mechanism of cancer pathogenesis. PMID:20351277

  8. Modulation of mismatch repair and genomic stability by miR-155.

    PubMed

    Valeri, Nicola; Gasparini, Pierluigi; Fabbri, Muller; Braconi, Chiara; Veronese, Angelo; Lovat, Francesca; Adair, Brett; Vannini, Ivan; Fanini, Francesca; Bottoni, Arianna; Costinean, Stefan; Sandhu, Sukhinder K; Nuovo, Gerard J; Alder, Hansjuerg; Gafa, Roberta; Calore, Federica; Ferracin, Manuela; Lanza, Giovanni; Volinia, Stefano; Negrini, Massimo; McIlhatton, Michael A; Amadori, Dino; Fishel, Richard; Croce, Carlo M

    2010-04-13

    Inactivation of mismatch repair (MMR) is the cause of the common cancer predisposition disorder Lynch syndrome (LS), also known as hereditary nonpolyposis colorectal cancer (HNPCC), as well as 10-40% of sporadic colorectal, endometrial, ovarian, gastric, and urothelial cancers. Elevated mutation rates (mutator phenotype), including simple repeat instability [microsatellite instability (MSI)] are a signature of MMR defects. MicroRNAs (miRs) have been implicated in the control of critical cellular pathways involved in development and cancer. Here we show that overexpression of miR-155 significantly down-regulates the core MMR proteins, hMSH2, hMSH6, and hMLH1, inducing a mutator phenotype and MSI. An inverse correlation between the expression of miR-155 and the expression of MLH1 or MSH2 proteins was found in human colorectal cancer. Finally, a number of MSI tumors with unknown cause of MMR inactivation displayed miR-155 overexpression. These data provide support for miR-155 modulation of MMR as a mechanism of cancer pathogenesis. PMID:20351277

  9. Conjugational hyperrecombination achieved by derepressing the LexA regulon, altering the properties of RecA protein and inactivating mismatch repair in Escherichia coli K-12.

    PubMed Central

    Lanzov, Vladislav A; Bakhlanova, Irina V; Clark, Alvin J

    2003-01-01

    The frequency of recombinational exchanges (FRE) that disrupt co-inheritance of transferred donor markers in Escherichia coli Hfr by F(-) crosses differs by up to a factor of two depending on physiological factors and culture conditions. Under standard conditions we found FRE to be 5.01 +/- 0.43 exchanges per 100-min units of DNA length for wild-type strains of the AB1157 line. Using these conditions we showed a cumulative effect of various mutations on FRE. Constitutive SOS expression by lexA gene inactivation (lexA71::Tn5) and recA gene mutation (recA730) showed, respectively, approximately 4- and 7-fold increases of FRE. The double lexA71 recA730 combination gave an approximately 17-fold increase in FRE. Addition of mutS215::Tn10, inactivating the mismatch repair system, to the double lexA recA mutant increased FRE to approximately 26-fold above wild-type FRE. Finally, we showed that another recA mutation produced as much SOS expression as recA730 but increased FRE only 3-fold. We conclude that three factors contribute to normally low FRE under standard conditions: repression of the LexA regulon, the properties of wild-type RecA protein, and a functioning MutSHL mismatch repair system. We discuss mechanisms by which the lexA, recA, and mutS mutations may elevate FRE cumulatively to obtain hyperrecombination. PMID:12702672

  10. Mismatch repair genes expression defects & association with clinicopathological characteristics in colorectal carcinoma

    PubMed Central

    Kaur, Gurjeet; Masoud, Abdelhafid; Raihan, N.; Radzi, M.; Khamizar, W.; Kam, Lee Suk

    2011-01-01

    Background & objectives: DNA mismatch repair gene (MMR) abnormalities are seen in 95 per cent of hereditary nonpolyposis colorectal cancer (HNPCC) and 10-15 per cent of sporadic colorectal cancers. There are no data on MMR abnormalities in Malaysian colorectal cancer patients. This study was aimed to determine the frequency of abnormal MMR gene protein expression in colorectal carcinoma in Northern Peninsular Malaysia using immunohistochemistry. Methods: Clinicopathological information was obtained from 148 patients’ records who underwent bowel resection for colorectal cancer (CRC) at the three hospitals in Malaysia. Immunohistochemistry for MLH1, MSH2, MSH6 and PMS2 proteins were performed on paraffin embedded tissue containing carcinoma. Results: A total of 148 subjects and 150 colorectal carcinomas of sporadic and hereditary types were assessed. Three patients had synchronous tumours. Twenty eight cancers (18.6%) from 26 subjects (17.6%) had absent immunohistochemical expression of any one of the MMR gene proteins. This comprised absent MLH1 only – 3 cancers, absent MSH2 only – 3, absent MSH6 only – 2, absent PMS2 only – 3, absent MLH1 and PMS2 – 14, absent MSH2 and MSH6 – 2 and absent MLH1, MSH6 and PMS2 – 1. There was significant association between abnormal MMR gene protein expression and proximal colon cancers, mucinous, signet ring and poorly differentiated morphology. Interpretation & conclusions: Cancers with abnormal MMR gene expression were associated with microsatellite instability-high (MSI-H) phenotype. About 15 per cent demonstrated absent MSH2, MSH6 and PMS2 protein expression in isolation or in combination with other MMR genes, which often predicts a germline mutation, synonymous with a diagnosis of HNPCC. This appears to be high frequency compared to reported data. PMID:21911971

  11. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells.

    PubMed

    van Ravesteyn, Thomas W; Dekker, Marleen; Fish, Alexander; Sixma, Titia K; Wolters, Astrid; Dekker, Rob J; Te Riele, Hein P J

    2016-04-12

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype. PMID:26951689

  12. Approaches to diagnose DNA mismatch repair gene defects in cancer.

    PubMed

    Peña-Diaz, Javier; Rasmussen, Lene Juel

    2016-02-01

    The DNA repair pathway mismatch repair (MMR) is responsible for the recognition and correction of DNA biosynthetic errors caused by inaccurate nucleotide incorporation during replication. Faulty MMR leads to failure to address the mispairs or insertion deletion loops (IDLs) left behind by the replicative polymerases and results in increased mutation load at the genome. The realization that defective MMR leads to a hypermutation phenotype and increased risk of tumorigenesis highlights the relevance of this pathway for human disease. The association of MMR defects with increased risk of cancer development was first observed in colorectal cancer patients that carried inactivating germline mutations in MMR genes and the disease was named as hereditary non-polyposis colorectal cancer (HNPCC). Currently, a growing list of cancers is found to be MMR defective and HNPCC has been renamed Lynch syndrome (LS) partly to include the associated risk of developing extra-colonic cancers. In addition, a number of non-hereditary, mostly epigenetic, alterations of MMR genes have been described in sporadic tumors. Besides conferring a strong cancer predisposition, genetic or epigenetic inactivation of MMR genes also renders cells resistant to some chemotherapeutic agents. Therefore, diagnosis of MMR deficiency has important implications for the management of the patients, the surveillance of their relatives in the case of LS and for the choice of treatment. Some of the alterations found in MMR genes have already been well defined and their pathogenicity assessed. Despite this substantial wealth of knowledge, the effects of a large number of alterations remain uncharacterized (variants of uncertain significance, VUSs). The advent of personalized genomics is likely to increase the list of VUSs found in MMR genes and anticipates the need of diagnostic tools for rapid assessment of their pathogenicity. This review describes current tools and future strategies for addressing the relevance

  13. Tumor Mismatch Repair Immunohistochemistry and DNA MLH1 Methylation Testing of Patients With Endometrial Cancer Diagnosed at Age Younger Than 60 Years Optimizes Triage for Population-Level Germline Mismatch Repair Gene Mutation Testing

    PubMed Central

    Buchanan, Daniel D.; Tan, Yen Y.; Walsh, Michael D.; Clendenning, Mark; Metcalf, Alexander M.; Ferguson, Kaltin; Arnold, Sven T.; Thompson, Bryony A.; Lose, Felicity A.; Parsons, Michael T.; Walters, Rhiannon J.; Pearson, Sally-Ann; Cummings, Margaret; Oehler, Martin K.; Blomfield, Penelope B.; Quinn, Michael A.; Kirk, Judy A.; Stewart, Colin J.; Obermair, Andreas; Young, Joanne P.; Webb, Penelope M.; Spurdle, Amanda B.

    2014-01-01

    Purpose Clinicopathologic data from a population-based endometrial cancer cohort, unselected for age or family history, were analyzed to determine the optimal scheme for identification of patients with germline mismatch repair (MMR) gene mutations. Patients and Methods Endometrial cancers from 702 patients recruited into the Australian National Endometrial Cancer Study (ANECS) were tested for MMR protein expression using immunohistochemistry (IHC) and for MLH1 gene promoter methylation in MLH1-deficient cases. MMR mutation testing was performed on germline DNA of patients with MMR-protein deficient tumors. Prediction of germline mutation status was compared for combinations of tumor characteristics, age at diagnosis, and various clinical criteria (Amsterdam, Bethesda, Society of Gynecologic Oncology, ANECS). Results Tumor MMR-protein deficiency was detected in 170 (24%) of 702 cases. Germline testing of 158 MMR-deficient cases identified 22 truncating mutations (3% of all cases) and four unclassified variants. Tumor MLH1 methylation was detected in 99 (89%) of 111 cases demonstrating MLH1/PMS2 IHC loss; all were germline MLH1 mutation negative. A combination of MMR IHC plus MLH1 methylation testing in women younger than 60 years of age at diagnosis provided the highest positive predictive value for the identification of mutation carriers at 46% versus ≤ 41% for any other criteria considered. Conclusion Population-level identification of patients with MMR mutation-positive endometrial cancer is optimized by stepwise testing for tumor MMR IHC loss in patients younger than 60 years, tumor MLH1 methylation in individuals with MLH1 IHC loss, and germline mutations in patients exhibiting loss of MSH6, MSH2, or PMS2 or loss of MLH1/PMS2 with absence of MLH1 methylation. PMID:24323032

  14. Mismatch repair enhances convergent transcription-induced cell death at trinucleotide repeats by activating ATR.

    PubMed

    Chatterjee, Nimrat; Lin, Yunfu; Wilson, John H

    2016-06-01

    Trinucleotide repeat (TNR) expansion beyond a certain threshold results in some 20 incurable neurodegenerative disorders where disease anticipation positively correlates with repeat length. Long TNRs typically display a bias toward further expansion during germinal transmission from parents to offspring, and then are highly unstable in somatic tissues of affected individuals. Understanding mechanisms of TNR instability will provide insights into disease pathogenesis. Previously, we showed that enhanced convergent transcription at long CAG repeat tracks induces TNR instability and cell death via ATR activation. Components of TC-NER (transcription-coupled nucleotide excision repair) and RNaseH enzymes that resolve RNA/DNA hybrids oppose cell death, whereas the MSH2 component of MMR (mismatch repair) enhances cell death. The exact role of the MMR pathway during convergent transcription-induced cell death at CAG repeats is not well understood. In this study, we show that siRNA knockdowns of MMR components-MSH2, MSH3, MLHI, PMS2, and PCNA-reduce DNA toxicity. Furthermore, knockdown of MSH2, MLH1, and PMS2 significantly reduces the frequency of ATR foci formation. These observations suggest that MMR proteins activate DNA toxicity by modulating ATR foci formation during convergent transcription. PMID:27131875

  15. Chromosomal directionality of DNA mismatch repair in Escherichia coli

    PubMed Central

    Hasan, A. M. Mahedi; Leach, David R. F.

    2015-01-01

    Defects in DNA mismatch repair (MMR) result in elevated mutagenesis and in cancer predisposition. This disease burden arises because MMR is required to correct errors made in the copying of DNA. MMR is bidirectional at the level of DNA strand polarity as it operates equally well in the 5′ to 3′ and the 3′ to 5′ directions. However, the directionality of MMR with respect to the chromosome, which comprises parental DNA strands of opposite polarity, has been unknown. Here, we show that MMR in Escherichia coli is unidirectional with respect to the chromosome. Our data demonstrate that, following the recognition of a 3-bp insertion-deletion loop mismatch, the MMR machinery searches for the first hemimethylated GATC site located on its origin-distal side, toward the replication fork, and that resection then proceeds back toward the mismatch and away from the replication fork. This study provides support for a tight coupling between MMR and DNA replication. PMID:26170312

  16. Mismatch Repair Deficiency Does Not Mediate Clinical Resistance to Temozolomide in Malignant Glioma

    PubMed Central

    Maxwell, Jill A.; Johnson, Stewart P.; McLendon, Roger E.; Lister, David W.; Horne, Krystle S.; Rasheed, Ahmed; Quinn, Jennifer A.; Ali-Osman, Francis; Friedman, Allan H.; Modrich, Paul L.; Bigner, Darell D.; Friedman, Henry S.

    2010-01-01

    Purpose A major mechanism of resistance to methylating agents, including temozolomide, is the DNA repair protein O6-alkylguanine-DNA alkyltransferase (AGT). Preclinical data indicates that defective DNA mismatch repair (MMR) results in tolerance to temozolomide regardless of AGT activity. The purpose of this study was to determine the role of MMR deficiency in mediating resistance in samples from patients with both newly diagnosed malignant gliomas and those who have failed temozolomide therapy. Experimental Design The roles of AGT and MMR deficiency in mediating resistance in glioblastoma multiforme were assessed by immunohistochemistry and microsatellite instability (MSI), respectively. The mutation status of the MSH6 gene, a proposed correlate of temozolomide resistance, was determined by direct sequencing and compared with data from immunofluorescent detection of MSH6 protein and reverse transcription-PCR amplification of MSH6 RNA. Results Seventy percent of newly diagnosed and 78 % of failed-therapy glioblastoma multiforme samples expressed nuclear AGT protein in ≥20% of cells analyzed, suggesting alternate means of resistance in 20% to 30% of cases. Single loci MSI was observed in 3% of patient samples; no sample showed the presence of high MSI. MSI was not shown to correlate with MSH6 mutation or loss of MSH6 protein expression. Conclusions Although high AGT levels may mediate resistance in a portion of these samples, MMR deficiency does not seem to be responsible for mediating temozolomide resistance in adult malignant glioma. Accordingly, the presence of a fraction of samples exhibiting both lowAGT expression and MMR proficiency suggests that additional mechanisms of temozolomide resistance are operational in the clinic. PMID:18676759

  17. Mlh2 Is an Accessory Factor for DNA Mismatch Repair in Saccharomyces cerevisiae

    PubMed Central

    Srivatsan, Anjana; Bowen, Nikki; Gries, Kerstin; Desai, Arshad; Putnam, Christopher D.; Kolodner, Richard D.

    2014-01-01

    In Saccharomyces cerevisiae, the essential mismatch repair (MMR) endonuclease Mlh1-Pms1 forms foci promoted by Msh2-Msh6 or Msh2-Msh3 in response to mispaired bases. Here we analyzed the Mlh1-Mlh2 complex, whose role in MMR has been unclear. Mlh1-Mlh2 formed foci that often colocalized with and had a longer lifetime than Mlh1-Pms1 foci. Mlh1-Mlh2 foci were similar to Mlh1-Pms1 foci: they required mispair recognition by Msh2-Msh6, increased in response to increased mispairs or downstream defects in MMR, and formed after induction of DNA damage by phleomycin but not double-stranded breaks by I-SceI. Mlh1-Mlh2 could be recruited to mispair-containing DNA in vitro by either Msh2-Msh6 or Msh2-Msh3. Deletion of MLH2 caused a synergistic increase in mutation rate in combination with deletion of MSH6 or reduced expression of Pms1. Phylogenetic analysis demonstrated that the S. cerevisiae Mlh2 protein and the mammalian PMS1 protein are homologs. These results support a hypothesis that Mlh1-Mlh2 is a non-essential accessory factor that acts to enhance the activity of Mlh1-Pms1. PMID:24811092

  18. The Kub5-Hera/RPRD1B interactome: a novel role in preserving genetic stability by regulating DNA mismatch repair

    PubMed Central

    Patidar, Praveen L.; Motea, Edward A.; Fattah, Farjana J.; Zhou, Yunyun; Morales, Julio C.; Xie, Yang; Garner, Harold R.; Boothman, David A.

    2016-01-01

    Ku70-binding protein 5 (Kub5)-Hera (K-H)/RPRD1B maintains genetic integrity by concomitantly minimizing persistent R-loops and promoting repair of DNA double strand breaks (DSBs). We used tandem affinity purification-mass spectrometry, co-immunoprecipitation and gel-filtration chromatography to define higher-order protein complexes containing K-H scaffolding protein to gain insight into its cellular functions. We confirmed known protein partners (Ku70, RNA Pol II, p15RS) and discovered several novel associated proteins that function in RNA metabolism (Topoisomerase 1 and RNA helicases), DNA repair/replication processes (PARP1, MSH2, Ku, DNA-PKcs, MCM proteins, PCNA and DNA Pol δ) and in protein metabolic processes, including translation. Notably, this approach directed us to investigate an unpredicted involvement of K-H in DNA mismatch repair (MMR) where K-H depletion led to concomitant MMR deficiency and compromised global microsatellite stability. Mechanistically, MMR deficiency in K-H-depleted cells was a consequence of reduced stability of the core MMR proteins (MLH1 and PMS2) caused by elevated basal caspase-dependent proteolysis. Pan-caspase inhibitor treatment restored MMR protein loss. These findings represent a novel mechanism to acquire MMR deficiency/microsatellite alterations. A significant proportion of colon, endometrial and ovarian cancers exhibit k-h expression/copy number loss and may have severe mutator phenotypes with enhanced malignancies that are currently overlooked based on sporadic MSI+ screening. PMID:26819409

  19. The Kub5-Hera/RPRD1B interactome: a novel role in preserving genetic stability by regulating DNA mismatch repair.

    PubMed

    Patidar, Praveen L; Motea, Edward A; Fattah, Farjana J; Zhou, Yunyun; Morales, Julio C; Xie, Yang; Garner, Harold R; Boothman, David A

    2016-02-29

    Ku70-binding protein 5 (Kub5)-Hera (K-H)/RPRD1B maintains genetic integrity by concomitantly minimizing persistent R-loops and promoting repair of DNA double strand breaks (DSBs). We used tandem affinity purification-mass spectrometry, co-immunoprecipitation and gel-filtration chromatography to define higher-order protein complexes containing K-H scaffolding protein to gain insight into its cellular functions. We confirmed known protein partners (Ku70, RNA Pol II, p15RS) and discovered several novel associated proteins that function in RNA metabolism (Topoisomerase 1 and RNA helicases), DNA repair/replication processes (PARP1, MSH2, Ku, DNA-PKcs, MCM proteins, PCNA and DNA Pol δ) and in protein metabolic processes, including translation. Notably, this approach directed us to investigate an unpredicted involvement of K-H in DNA mismatch repair (MMR) where K-H depletion led to concomitant MMR deficiency and compromised global microsatellite stability. Mechanistically, MMR deficiency in K-H-depleted cells was a consequence of reduced stability of the core MMR proteins (MLH1 and PMS2) caused by elevated basal caspase-dependent proteolysis. Pan-caspase inhibitor treatment restored MMR protein loss. These findings represent a novel mechanism to acquire MMR deficiency/microsatellite alterations. A significant proportion of colon, endometrial and ovarian cancers exhibit k-h expression/copy number loss and may have severe mutator phenotypes with enhanced malignancies that are currently overlooked based on sporadic MSI+ screening. PMID:26819409

  20. Replication stalling and heteroduplex formation within CAG/CTG trinucleotide repeats by mismatch repair.

    PubMed

    Viterbo, David; Michoud, Grégoire; Mosbach, Valentine; Dujon, Bernard; Richard, Guy-Franck

    2016-06-01

    Trinucleotide repeat expansions are responsible for at least two dozen neurological disorders. Mechanisms leading to these large expansions of repeated DNA are still poorly understood. It was proposed that transient stalling of the replication fork by the repeat tract might trigger slippage of the newly-synthesized strand over its template, leading to expansions or contractions of the triplet repeat. However, such mechanism was never formally proven. Here we show that replication fork pausing and CAG/CTG trinucleotide repeat instability are not linked, stable and unstable repeats exhibiting the same propensity to stall replication forks when integrated in a yeast natural chromosome. We found that replication fork stalling was dependent on the integrity of the mismatch-repair system, especially the Msh2p-Msh6p complex, suggesting that direct interaction of MMR proteins with secondary structures formed by trinucleotide repeats in vivo, triggers replication fork pauses. We also show by chromatin immunoprecipitation that Msh2p is enriched at trinucleotide repeat tracts, in both stable and unstable orientations, this enrichment being dependent on MSH3 and MSH6. Finally, we show that overexpressing MSH2 favors the formation of heteroduplex regions, leading to an increase in contractions and expansions of CAG/CTG repeat tracts during replication, these heteroduplexes being dependent on both MSH3 and MSH6. These heteroduplex regions were not detected when a mutant msh2-E768A gene in which the ATPase domain was mutated was overexpressed. Our results unravel two new roles for mismatch-repair proteins: stabilization of heteroduplex regions and transient blocking of replication forks passing through such repeats. Both roles may involve direct interactions between MMR proteins and secondary structures formed by trinucleotide repeat tracts, although indirect interactions may not be formally excluded. PMID:27045900

  1. DNA Mismatch Repair System: Repercussions in Cellular Homeostasis and Relationship with Aging

    PubMed Central

    Conde-Pérezprina, Juan Cristóbal; León-Galván, Miguel Ángel; Konigsberg, Mina

    2012-01-01

    The mechanisms that concern DNA repair have been studied in the last years due to their consequences in cellular homeostasis. The diverse and damaging stimuli that affect DNA integrity, such as changes in the genetic sequence and modifications in gene expression, can disrupt the steady state of the cell and have serious repercussions to pathways that regulate apoptosis, senescence, and cancer. These altered pathways not only modify cellular and organism longevity, but quality of life (“health-span”). The DNA mismatch repair system (MMR) is highly conserved between species; its role is paramount in the preservation of DNA integrity, placing it as a necessary focal point in the study of pathways that prolong lifespan, aging, and disease. Here, we review different insights concerning the malfunction or absence of the DNA-MMR and its impact on cellular homeostasis. In particular, we will focus on DNA-MMR mechanisms regulated by known repair proteins MSH2, MSH6, PMS2, and MHL1, among others. PMID:23213348

  2. Dynamic control of strand excision during human DNA mismatch repair

    PubMed Central

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V.; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-01-01

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3′- or 5′-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5′-MMR excision reaction requires the HsMSH2–HsMSH6 heterodimer, the 5′ → 3′ exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1–HsPMS2 heterodimer substantially influences 5′-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2–HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1–HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5′ MMR. PMID:26951673

  3. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    PubMed Central

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A.

    2014-01-01

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting. PMID:25099886

  4. Human mismatch repair, drug-induced DNA damage, and secondary cancer.

    PubMed

    Karran, Peter; Offman, Judith; Bignami, Margherita

    2003-11-01

    DNA mismatch repair (MMR) is an important replication error avoidance mechanism that prevents mutation. The association of defective MMR with familial and sporadic gastrointestinal and endometrial cancer has been acknowledged for some years. More recently, it has become apparent that MMR defects are common in acute myeloid leukaemia/myelodysplastic syndrome (AML/MDS) that follows successful chemotherapy for a primary malignancy. Therapy-related haematological malignancies are often associated with treatment with alkylating agents. Their frequency is increasing and they now account for at least 10% of all AML cases. There is also evidence for an association between MMR deficient AML/MDS and immunosuppressive treatment with thiopurine drugs. Here we review how MMR interacts with alkylating agent and thiopurine-induced DNA damage and suggest possible ways in which MMR defects may arise in therapy-related AML/MDS. PMID:14726020

  5. Combined mismatch repair and POLE/POLD1 defects explain unresolved suspected Lynch syndrome cancers.

    PubMed

    Jansen, Anne Ml; van Wezel, Tom; van den Akker, Brendy Ewm; Ventayol Garcia, Marina; Ruano, Dina; Tops, Carli Mj; Wagner, Anja; Letteboer, Tom Gw; Gómez-García, Encarna B; Devilee, Peter; Wijnen, Juul T; Hes, Frederik J; Morreau, Hans

    2016-07-01

    Many suspected Lynch Syndrome (sLS) patients who lack mismatch repair (MMR) germline gene variants and MLH1 or MSH2 hypermethylation are currently explained by somatic MMR gene variants or, occasionally, by germline POLE variants. To further investigate unexplained sLS patients, we analyzed leukocyte and tumor DNA of 62 sLS patients using gene panel sequencing including the POLE, POLD1 and MMR genes. Forty tumors showed either one, two or more somatic MMR variants predicted to affect function. Nine sLS tumors showed a likely ultramutated phenotype and were found to carry germline (n=2) or somatic variants (n=7) in the POLE/POLD1 exonuclease domain (EDM). Six of these POLE/POLD1-EDM mutated tumors also carried somatic MMR variants. Our findings suggest that faulty proofreading may result in loss of MMR and thereby in microsatellite instability. PMID:26648449

  6. Mismatch repair-dependent G2 checkpoint induced by low doses of SN1 type methylating agents requires the ATR kinase.

    PubMed

    Stojic, Lovorka; Mojas, Nina; Cejka, Petr; Di Pietro, Massimiliano; Ferrari, Stefano; Marra, Giancarlo; Jiricny, Josef

    2004-06-01

    S(N)1-type alkylating agents represent an important class of chemotherapeutics, but the molecular mechanisms underlying their cytotoxicity are unknown. Thus, although these substances modify predominantly purine nitrogen atoms, their toxicity appears to result from the processing of O(6)-methylguanine ((6Me)G)-containing mispairs by the mismatch repair (MMR) system, because cells with defective MMR are highly resistant to killing by these agents. In an attempt to understand the role of the MMR system in the molecular transactions underlying the toxicity of alkylating agents, we studied the response of human MMR-proficient and MMR-deficient cells to low concentrations of the prototypic methylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). We now show that MNNG treatment induced a cell cycle arrest that was absolutely dependent on functional MMR. Unusually, the cells arrested only in the second G(2) phase after treatment. Downstream targets of both ATM (Ataxia telangiectasia mutated) and ATR (ATM and Rad3-related) kinases were modified, but only the ablation of ATR, or the inhibition of CHK1, attenuated the arrest. The checkpoint activation was accompanied by the formation of nuclear foci containing the signaling and repair proteins ATR, the S(*)/T(*)Q substrate, gamma-H2AX, and replication protein A (RPA). The persistence of these foci implied that they may represent sites of irreparable damage. PMID:15175264

  7. Physical and functional interactions between Werner syndrome helicase and mismatch-repair initiation factors

    PubMed Central

    Saydam, Nurten; Kanagaraj, Radhakrishnan; Dietschy, Tobias; Garcia, Patrick L.; Peña-Diaz, Javier; Shevelev, Igor; Stagljar, Igor; Janscak, Pavel

    2007-01-01

    Werner syndrome (WS) is a severe recessive disorder characterized by premature aging, cancer predisposition and genomic instability. The gene mutated in WS encodes a bi-functional enzyme called WRN that acts as a RecQ-type DNA helicase and a 3′-5′ exonuclease, but its exact role in DNA metabolism is poorly understood. Here we show that WRN physically interacts with the MSH2/MSH6 (MutSα), MSH2/MSH3 (MutSβ) and MLH1/PMS2 (MutLα) heterodimers that are involved in the initiation of mismatch repair (MMR) and the rejection of homeologous recombination. MutSα and MutSβ can strongly stimulate the helicase activity of WRN specifically on forked DNA structures with a 3′-single-stranded arm. The stimulatory effect of MutSα on WRN-mediated unwinding is enhanced by a G/T mismatch in the DNA duplex ahead of the fork. The MutLα protein known to bind to the MutS α–heteroduplex complexes has no effect on WRN-mediated DNA unwinding stimulated by MutSα, nor does it affect DNA unwinding by WRN alone. Our data are consistent with results of genetic experiments in yeast suggesting that MMR factors act in conjunction with a RecQ-type helicase to reject recombination between divergent sequences. PMID:17715146

  8. (CA/TG) microsatellite sequences escape the inhibition of recombination by mismatch repair in Saccharomyces cerevisiae.

    PubMed Central

    Gendrel, C G; Dutreix, M

    2001-01-01

    Sequence divergence reduces the frequency of recombination, a process that is dependent on the activity of the mismatch repair system. In the yeast Saccharomyces cerevisiae, repair of mismatches results in gene conversion or restoration, whereas failure to repair mismatches results in postmeiotic segregation (PMS). By examining the conversion and PMS in yeast strains deficient in various MMR genes and heterozygous for large inserts (107 bp) with either a mixed sequence or a 39 (CA/TG) repetitive microsatellite sequence, we demonstrate that: (1) the inhibition of conversion by large inserts depends upon a complex containing both Msh2 and Pms1 proteins; (2) conversion is not inhibited if the single-stranded DNA loop in the heteroduplex is the microsatellite sequence; and (3) large heteroduplex loops with random sequence or repetitive sequence might be repaired by two complexes, containing either Msh2 or Pms1. Our results suggest that inhibition of recombination by heterologous inserts and large loop repair are not processed by the same MMR complexes. We propose that the inhibition of conversion by large inserts is due to recognition by the Msh2/Pms1 complex of mismatches created by intrastrand interactions in the heteroduplex loop. PMID:11779795

  9. Immunohistochemistry and microsatellite instability analysis in molecular subtyping of colorectal carcinoma based on mismatch repair competency

    PubMed Central

    Yuan, Lin; Chi, Yayun; Chen, Weixiang; Chen, Xiaochen; Wei, Ping; Sheng, Weiqi; Zhou, Xiaoyan; Shi, Daren

    2015-01-01

    Mismatch repair defective (MMRd) colorectal carcinoma (CRC) is a distinct molecular phenotype of colorectal cancer, including 12% of sporadic CRC and 3% of Lynch Syndrome. In order to investigate the clinicopathological characteristics of MMRd colorectal carcinoma, and to find the most effective method for preliminary screening, 296 CRC fulfilled revised Bethesda Guideline (RB) were selected from 1450 CRCs to perform both IHC staining for MLH1, MSH2, MSH6, PMS2 and MSI analysis. Sixty-eight tumors were classified as MSI-H by MSI test. Colorectal carcinomas with MSI-H were prone to be proximal located, poorly differentiated, and relatively early staged, with infrequent metastasis to lymph node as well as to distant organs, compared with MSS ones. All of the 68 MMRd CRCs presented abnormal expression of at least one mismatch repair protein (MMRP), with 48 concurrent negative of MLH1 and PMS2, 14 concurrent negative of MSH2 and MSH6, 4 isolated negative of MSH6, 1 isolated negative of PMS2, and 1 concurrent negative of 4 MMRPs. All of the MLH1 negative tumors also showed abnormal expression of PMS2. All of the MSH2 negative cases also presented negative expression of MSH6. The sensitivity and specificity of the 2-antibody IHC test contained only PMS2 and MSH6 for screening for MMRd CRC were 100% and 98.2% respectively, exactly the same as that of the 4-antibody IHC test with all of the 4 MMRPs. The diagnostic accordance rate of the 2-antibody approach and MSI analysis was 98.6%. In conclusion, MMRd CRC has characteristic clinicopathological features different from MSS CRCs. The 2-antibody IHC approach containing MSH6 and PMS2 is the most easy and effective way to detecting MMR deficiency in CRC. PMID:26885030

  10. Interaction between Mismatch Repair and Genetic Recombination in Saccharomyces Cerevisiae

    PubMed Central

    Alani, E.; Reenan, RAG.; Kolodner, R. D.

    1994-01-01

    The yeast Saccharomyces cerevisiae encodes a set of genes that show strong amino acid sequence similarity to MutS and MutL, proteins required for mismatch repair in Escherichia coli. We examined the role of MSH2 and PMS1, yeast homologs of mutS and mutL, respectively, in the repair of base pair mismatches formed during meiotic recombination. By using specifically marked HIS4 and ARG4 alleles, we showed that msh2 mutants displayed a severe defect in the repair of all base pair mismatches as well as 1-, 2- and 4-bp insertion/deletion mispairs. The msh2 and pms1 phenotypes were indistinguishable, suggesting that the wild-type gene products act in the same repair pathway. A comparison of gene conversion events in wild-type and msh2 mutants indicated that mismatch repair plays an important role in genetic recombination. (1) Tetrad analysis at five different loci revealed that, in msh2 mutants, the majority of aberrant segregants displayed a sectored phenotype, consistent with a failure to repair mismatches created during heteroduplex formation. In wild type, base pair mismatches were almost exclusively repaired toward conversion rather than restoration. (2) In msh2 strains 10-19% of the aberrant tetrads were Ab4:4. (3) Polarity gradients at HIS4 and ARG4 were nearly abolished in msh2 mutants. The frequency of gene conversion at the 3' end of these genes was increased and was nearly the frequency observed at the 5' end. (4) Co-conversion studies were consistent with mismatch repair acting to regulate heteroduplex DNA tract length. We favor a model proposing that recombination events occur through the formation and resolution of heteroduplex intermediates and that mismatch repair proteins specifically interact with recombination enzymes to regulate the length of symmetric heteroduplex DNA. PMID:8056309

  11. Hydrolytic function of Exo1 in mammalian mismatch repair

    PubMed Central

    Shao, Hongbing; Baitinger, Celia; Soderblom, Erik J.; Burdett, Vickers; Modrich, Paul

    2014-01-01

    Genetic and biochemical studies have previously implicated exonuclease 1 (Exo1) in yeast and mammalian mismatch repair, with results suggesting that function of the protein in the reaction depends on both its hydrolytic activity and its ability to interact with other components of the repair system. However, recent analysis of an Exo1-E109K knockin mouse has concluded that Exo1 function in mammalian mismatch repair is restricted to a structural role, a conclusion based on a prior report that N-terminal His-tagged Exo1-E109K is hydrolytically defective. Because Glu-109 is distant from the nuclease hydrolytic center, we have compared the activity of untagged full-length Exo1-E109K with that of wild type Exo1 and the hydrolytically defective active site mutant Exo1-D173A. We show that the activity of Exo1-E109K is comparable to that of wild type enzyme in a conventional exonuclease assay and that in contrast to a D173A active site mutant, Exo1-E109K is fully functional in mismatch-provoked excision and repair. We conclude that the catalytic function of Exo1 is required for its participation in mismatch repair. We also consider the other phenotypes of the Exo1-E109K mouse in the context of Exo1 hydrolytic function. PMID:24829455

  12. Role of Deficient Mismatch Repair in the Personalized Management of Colorectal Cancer.

    PubMed

    Zhang, Cong-Min; Lv, Jin-Feng; Gong, Liang; Yu, Lin-Yu; Chen, Xiao-Ping; Zhou, Hong-Hao; Fan, Lan

    2016-01-01

    Colorectal cancer (CRC) represents the third most common type of cancer in developed countries and one of the leading causes of cancer deaths worldwide. Personalized management of CRC has gained increasing attention since there are large inter-individual variations in the prognosis and response to drugs used to treat CRC owing to molecular heterogeneity. Approximately 15% of CRCs are caused by deficient mismatch repair (dMMR) characterized by microsatellite instability (MSI) phenotype. The present review is aimed at highlighting the role of MMR status in informing prognosis and personalized treatment of CRC including adjuvant chemotherapy, targeted therapy, and immune checkpoint inhibitor therapy to guide the individualized therapy of CRC. PMID:27618077

  13. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    NASA Technical Reports Server (NTRS)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  14. MutSα maintains the mismatch repair capability by inhibiting PCNA unloading

    PubMed Central

    Kawasoe, Yoshitaka; Tsurimoto, Toshiki; Nakagawa, Takuro; Masukata, Hisao; Takahashi, Tatsuro S

    2016-01-01

    Eukaryotic mismatch repair (MMR) utilizes single-strand breaks as signals to target the strand to be repaired. DNA-bound PCNA is also presumed to direct MMR. The MMR capability must be limited to a post-replicative temporal window during which the signals are available. However, both identity of the signal(s) involved in the retention of this temporal window and the mechanism that maintains the MMR capability after DNA synthesis remain unclear. Using Xenopus egg extracts, we discovered a mechanism that ensures long-term retention of the MMR capability. We show that DNA-bound PCNA induces strand-specific MMR in the absence of strand discontinuities. Strikingly, MutSα inhibited PCNA unloading through its PCNA-interacting motif, thereby extending significantly the temporal window permissive to strand-specific MMR. Our data identify DNA-bound PCNA as the signal that enables strand discrimination after the disappearance of strand discontinuities, and uncover a novel role of MutSα in the retention of the post-replicative MMR capability. DOI: http://dx.doi.org/10.7554/eLife.15155.001 PMID:27402201

  15. Impact of DNA mismatch repair system alterations on human fertility and related treatments.

    PubMed

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation. PMID:26739522

  16. Impact of DNA mismatch repair system alterations on human fertility and related treatments*

    PubMed Central

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation. PMID:26739522

  17. PCNA and Msh2-Msh6 Activate an Mlh1-Pms1 Endonuclease Pathway Required for Exo1-independent Mismatch Repair

    PubMed Central

    Goellner, Eva M.; Smith, Catherine E.; Campbell, Christopher S.; Hombauer, Hans; Desai, Arshad; Putnam, Christopher D.; Kolodner, Richard D.

    2014-01-01

    Summary Genetic evidence has implicated multiple pathways in eukaryotic DNA mismatch repair (MMR) downstream of mispair recognition and Mlh1-Pms1 recruitment, including Exonuclease 1 (Exo1) dependent and independent pathways. We identified 14 mutations in POL30, which encodes PCNA in Saccharomyces cerevisiae, specific to Exo1-independent MMR. The mutations identified affected amino acids at three distinct sites on the PCNA structure. Multiple mutant PCNA proteins had defects either in trimerization and Msh2-Msh6 binding or in activation of the Mlh1-Pms1 endonuclease that initiates excision during MMR. The latter class of mutations led to hyper-accumulation of repair intermediate Mlh1-Pms1 foci and were enhanced by an msh6 mutation that disrupted the Msh2-Msh6 interaction with PCNA. These results reveal a central role for PCNA in the Exo1-independent MMR pathway and suggest that Msh2-Msh6 localizes PCNA to repair sites after mispair recognition to activate the Mlh1-Pms1 endonuclease for initiating Exo1-dependent repair or for driving progressive excision in Exo1-independent repair. PMID:24981171

  18. High frequency of mismatch repair deficiency among pediatric high grade gliomas in Jordan.

    PubMed

    Amayiri, Nisreen; Tabori, Uri; Campbell, Brittany; Bakry, Doua; Aronson, Melyssa; Durno, Carol; Rakopoulos, Patricia; Malkin, David; Qaddoumi, Ibrahim; Musharbash, Awni; Swaidan, Maisa; Bouffet, Eric; Hawkins, Cynthia; Al-Hussaini, Maysa

    2016-01-15

    Biallelic mismatch repair deficiency (bMMRD) is a cancer predisposition syndrome affecting primarily individuals from consanguinous families resulting in multiple childhood cancers including high grade gliomas (HGG). This is the first study to assess the prevalence of bMMRD among patients with HGG in countries where consanguinity is high. We collected molecular and clinical information on all children diagnosed with HGG and supratentorial primitive neuroectodermal tumors (sPNET) between 2003 and 2013 at King Hussein Cancer Center, Jordan. Comparison was made to a similar cohort from Toronto. Clinical data regarding presence of café au lait macules(CAL), family history of cancer, consanguinity, pathology and treatment were collected. Tumors were centrally reviewed and tested for MMRD by immunohistochemistry of the corresponding proteins. Forty-two patients fulfilled the inclusion criteria, including 36 with HGG. MMRD was observed in 39% of HGG of whom 79% also lost MMR staining in the corresponding normal cells suggestive of bMMRD. P53 dysfunction was highly enriched in MMR deficient tumors (p = 0.0003).The frequency of MMRD was significantly lower in Toronto cohort (23%, p = 0.03). Both evidence of CAL and consanguinity correlated with bMMRD (p = 0.005 and 0.05,respectively) but family history of cancer didn't. HGG with all three bMMRD risk factors had evidence of MMRD and all children affected by multiple bMMRD related cancers had identical gene loss by immunohistochemical staining. In Jordan, the frequency of clinical and immunohistochemical alterations suggestive of bMMRD in pediatric HGG is high. Genetic testing will enable appropriate counseling and cancer screening to improve survival of these patients. PMID:26293621

  19. Loss of DNA mismatch repair imparts a selective advantage in planarian adult stem cells.

    PubMed

    Hollenbach, Jessica P; Resch, Alissa M; Palakodeti, Dasaradhi; Graveley, Brenton R; Heinen, Christopher D

    2011-01-01

    Lynch syndrome (LS) leads to an increased risk of early-onset colorectal and other types of cancer and is caused by germline mutations in DNA mismatch repair (MMR) genes. Loss of MMR function results in a mutator phenotype that likely underlies its role in tumorigenesis. However, loss of MMR also results in the elimination of a DNA damage-induced checkpoint/apoptosis activation barrier that may allow damaged cells to grow unchecked. A fundamental question is whether loss of MMR provides pre-cancerous stem cells an immediate selective advantage in addition to establishing a mutator phenotype. To test this hypothesis in an in vivo system, we utilized the planarian Schmidtea mediterranea which contains a significant population of identifiable adult stem cells. We identified a planarian homolog of human MSH2, a MMR gene which is mutated in 38% of LS cases. The planarian Smed-msh2 is expressed in stem cells and some progeny. We depleted Smed-msh2 mRNA levels by RNA-interference and found a striking survival advantage in these animals treated with a cytotoxic DNA alkylating agent compared to control animals. We demonstrated that this tolerance to DNA damage is due to the survival of mitotically active, MMR-deficient stem cells. Our results suggest that loss of MMR provides an in vivo survival advantage to the stem cell population in the presence of DNA damage that may have implications for tumorigenesis. PMID:21747960

  20. Ribonucleotides Misincorporated into DNA Act as Strand-Discrimination Signals in Eukaryotic Mismatch Repair

    PubMed Central

    Ghodgaonkar, Medini Manohar; Lazzaro, Federico; Olivera-Pimentel, Maite; Artola-Borán, Mariela; Cejka, Petr; Reijns, Martin A.; Jackson, Andrew P.; Plevani, Paolo; Muzi-Falconi, Marco; Jiricny, Josef

    2013-01-01

    Summary To improve replication fidelity, mismatch repair (MMR) must detect non-Watson-Crick base pairs and direct their repair to the nascent DNA strand. Eukaryotic MMR in vitro requires pre-existing strand discontinuities for initiation; consequently, it has been postulated that MMR in vivo initiates at Okazaki fragment termini in the lagging strand and at nicks generated in the leading strand by the mismatch-activated MLH1/PMS2 endonuclease. We now show that a single ribonucleotide in the vicinity of a mismatch can act as an initiation site for MMR in human cell extracts and that MMR activation in this system is dependent on RNase H2. As loss of RNase H2 in S.cerevisiae results in a mild MMR defect that is reflected in increased mutagenesis, MMR in vivo might also initiate at RNase H2-generated nicks. We therefore propose that ribonucleotides misincoporated during DNA replication serve as physiological markers of the nascent DNA strand. PMID:23603115

  1. [DNA mismatch repair and BRAF status in colorectal cancer: Interest for the therapeutic management?].

    PubMed

    Cohen, Romain; Cervera, Pascale; Svrcek, Magali; Dumont, Clément; Garcia, Marie-Line; Chibaudel, Benoist; de Gramont, Aimery; Pocard, Marc; Duval, Alex; Fléjou, Jean-François; André, Thierry

    2015-06-01

    Colorectal cancer (CRC) is the second leading cause of cancer-related mortality in France. Recently, colorectal cancer subtyping consortium (CRCSC) identified 4 consensus molecular subtypes (CMS). CMS1 is enriched for CRC with deficient DNA mismatch repair system (dMMR) and tumors with mutated BRAF. Intriguingly, CMS1 is characterized by better relapse-free survival but worse survival after relapse, compared with the other subtypes. In this review, we provide a comprehensive overview of prognostic and predictive impacts of MMR and BRAF status. We highlight immune checkpoints inhibitors as potentially future therapeutics for CRC with deficient MMR. We also focus on the management of BRAF mutant metastatic CRC, with a particular interest on targeted therapies. PMID:26118880

  2. Aberrant DNA Methylation in Hereditary Non-Polyposis Colorectal Cancer without Mismatch Repair Deficiency

    PubMed Central

    Goel, Ajay; Xicola, Rosa M.; Nguyen, Thuy-Phuong; Doyle, Brian J; Sohn, Vanessa R.; Bandipalliam, Prathap; Reyes, Josep; Cordero, Carmen; Balaguer, Francesc; Castells, Antoni; Jover, Rodrigo; Andreu, Montserrat; Syngal, Sapna; Boland, C. Richard; Llor, Xavier

    2010-01-01

    Background & Aims Approximately half of the families that fulfill Amsterdam criteria for Lynch syndrome or hereditary non-polyposis colorectal cancer (HNPCC) do not have evidence of the germline mismatch repair (MMR) gene mutations that define this syndrome and result in microsatellite instability. The carcinogenic pathways and the best diagnostic approaches to detect microsatellite stable (MSS) HNPCC tumors are unclear. We investigated the contribution of epigenetic alterations to development of MSS HNPCC tumors. Methods Colorectal cancers were divided in four groups: 1. Microsatellite stable, Amsterdam positive (MSS HNPCC) (N=22); 2. Lynch syndrome cancers (identified mismatch repair mutations) (N=21); 3. Sporadic MSS (N=92); 4. Sporadic MSI (N=46). Methylation status was evaluated for CACNAG1, SOCS1, RUNX3, NEUROG1, MLH1, and LINE-1. KRAS and BRAF mutations status was analyzed. Results MSS HNPCC tumors displayed a significantly lower degree of LINE-1 methylation, marker for global methylation, than any other group. Whereas most MSS HNPCC tumors had some degree of CpG island methylation, none presented a high index of methylation. MSS HNPCC tumors had KRAS mutations exclusively in codon 12, but none harbored V600E BRAF mutations. Conclusions Tumors from Amsterdam-positive patients without mismatch repair deficiency (MSS HNPCC) have certain molecular features, including global hypomethylation that distinguish them from all other colorectal cancers. These characteristics could have an important impact on tumor behavior or treatment response. Studies are underway to further assess the cause and effects of these features. PMID:20102720

  3. Differential DNA mismatch repair underlies mutation rate variation across the human genome

    PubMed Central

    Supek, Fran; Lehner, Ben

    2015-01-01

    Cancer genome sequencing has revealed considerable variation in somatic mutation rates across the human genome, with mutation rates elevated in heterochromatic late replicating regions and reduced in early replicating euchromatin1-5. Multiple mechanisms have been suggested to underlie this2,6-10, but the actual cause is unknown. Here we identify variable DNA mismatch repair (MMR) as the basis of this variation. Analysing ~17 million single nucleotide variants from the genomes of 652 tumours, we show that regional autosomal mutation rates at megabase resolution are largely stable across cancer types, with differences related to changes in replication timing and gene expression. However, mutations arising after the inactivation of MMR are no longer enriched in early replicating euchromatin relative to late replicating heterochromatin. Thus, differential DNA repair and not differential mutation supply is the primary cause of the large-scale regional mutation rate variation across the human genome. PMID:25707793

  4. An interplay of the base excision repair and mismatch repair pathways in active DNA demethylation.

    PubMed

    Grin, Inga; Ishchenko, Alexander A

    2016-05-01

    Active DNA demethylation (ADDM) in mammals occurs via hydroxylation of 5-methylcytosine (5mC) by TET and/or deamination by AID/APOBEC family enzymes. The resulting 5mC derivatives are removed through the base excision repair (BER) pathway. At present, it is unclear how the cell manages to eliminate closely spaced 5mC residues whilst avoiding generation of toxic BER intermediates and whether alternative DNA repair pathways participate in ADDM. It has been shown that non-canonical DNA mismatch repair (ncMMR) can remove both alkylated and oxidized nucleotides from DNA. Here, a phagemid DNA containing oxidative base lesions and methylated sites are used to examine the involvement of various DNA repair pathways in ADDM in murine and human cell-free extracts. We demonstrate that, in addition to short-patch BER, 5-hydroxymethyluracil and uracil mispaired with guanine can be processed by ncMMR and long-patch BER with concomitant removal of distant 5mC residues. Furthermore, the presence of multiple mispairs in the same MMR nick/mismatch recognition region together with BER-mediated nick formation promotes proficient ncMMR resulting in the reactivation of an epigenetically silenced reporter gene in murine cells. These findings suggest cooperation between BER and ncMMR in the removal of multiple mismatches that might occur in mammalian cells during ADDM. PMID:26843430

  5. An interplay of the base excision repair and mismatch repair pathways in active DNA demethylation

    PubMed Central

    Grin, Inga; Ishchenko, Alexander A.

    2016-01-01

    Active DNA demethylation (ADDM) in mammals occurs via hydroxylation of 5-methylcytosine (5mC) by TET and/or deamination by AID/APOBEC family enzymes. The resulting 5mC derivatives are removed through the base excision repair (BER) pathway. At present, it is unclear how the cell manages to eliminate closely spaced 5mC residues whilst avoiding generation of toxic BER intermediates and whether alternative DNA repair pathways participate in ADDM. It has been shown that non-canonical DNA mismatch repair (ncMMR) can remove both alkylated and oxidized nucleotides from DNA. Here, a phagemid DNA containing oxidative base lesions and methylated sites are used to examine the involvement of various DNA repair pathways in ADDM in murine and human cell-free extracts. We demonstrate that, in addition to short-patch BER, 5-hydroxymethyluracil and uracil mispaired with guanine can be processed by ncMMR and long-patch BER with concomitant removal of distant 5mC residues. Furthermore, the presence of multiple mispairs in the same MMR nick/mismatch recognition region together with BER-mediated nick formation promotes proficient ncMMR resulting in the reactivation of an epigenetically silenced reporter gene in murine cells. These findings suggest cooperation between BER and ncMMR in the removal of multiple mismatches that might occur in mammalian cells during ADDM. PMID:26843430

  6. Involvement of MBD4 inactivation in mismatch repair-deficient tumorigenesis

    PubMed Central

    Tricarico, Rossella; Cortellino, Salvatore; Riccio, Antonio; Jagmohan-Changur, Shantie; van der Klift, Heleen; Wijnen, Juul; Turner, David; Ventura, Andrea; Rovella, Valentina; Percesepe, Antonio; Lucci-Cordisco, Emanuela; Radice, Paolo; Bertario, Lucio; Pedroni, Monica; de Leon, Maurizio Ponz; Mancuso, Pietro; Devarajan, Karthik; Cai, Kathy Q.; Klein-Szanto, Andres J.P.; Neri, Giovanni; Møller, Pål; Viel, Alessandra; Genuardi, Maurizio; Fodde, Riccardo; Bellacosa, Alfonso

    2015-01-01

    The DNA glycosylase gene MBD4 safeguards genomic stability at CpG sites and is frequently mutated at coding poly-A tracks in mismatch repair (MMR)-defective colorectal tumors (CRC). Mbd4 biallelic inactivation in mice provided conflicting results as to its role in tumorigenesis. Thus, it is unclear whether MBD4 alterations are only secondary to MMR defects without functional consequences or can contribute to the mutator phenotype. We investigated MBD4 variants in a large series of hereditary/familial and sporadic CRC cases. Whereas MBD4 frameshifts were only detected in tumors, missense variants were found in both normal and tumor DNA. In CRC with double-MBD4/MMR and single-MBD4 variants, transition mutation frequency was increased, indicating that MBD4 defects may affect the mutational landscape independently of MMR defect. Mbd4-deficient mice showed reduced survival when combined with Mlh1−/− genotype. Taken together, these data suggest that MBD4 inactivation may contribute to tumorigenesis, acting as a modifier of MMR-deficient cancer phenotype. PMID:26503472

  7. Dual daughter strand incision is processive and increases the efficiency of DNA mismatch repair.

    PubMed

    Hermans, Nicolaas; Laffeber, Charlie; Cristovão, Michele; Artola-Borán, Mariela; Mardenborough, Yannicka; Ikpa, Pauline; Jaddoe, Aruna; Winterwerp, Herrie H K; Wyman, Claire; Jiricny, Josef; Kanaar, Roland; Friedhoff, Peter; Lebbink, Joyce H G

    2016-08-19

    DNA mismatch repair (MMR) is an evolutionarily-conserved process responsible for the repair of replication errors. In Escherichia coli, MMR is initiated by MutS and MutL, which activate MutH to incise transiently-hemimethylated GATC sites. MMR efficiency depends on the distribution of these GATC sites. To understand which molecular events determine repair efficiency, we quantitatively studied the effect of strand incision on unwinding and excision activity. The distance between mismatch and GATC site did not influence the strand incision rate, and an increase in the number of sites enhanced incision only to a minor extent. Two GATC sites were incised by the same activated MMR complex in a processive manner, with MutS, the closed form of MutL and MutH displaying different roles. Unwinding and strand excision were more efficient on a substrate with two nicks flanking the mismatch, as compared to substrates containing a single nick or two nicks on the same side of the mismatch. Introduction of multiple nicks by the human MutLα endonuclease also contributed to increased repair efficiency. Our data support a general model of prokaryotic and eukaryotic MMR in which, despite mechanistic differences, mismatch-activated complexes facilitate efficient repair by creating multiple daughter strand nicks. PMID:27174933

  8. Loss of ARID1A Expression is Related to Gastric Cancer Progression, Epstein-Barr Virus Infection, and Mismatch Repair Deficiency.

    PubMed

    Han, Nayoung; Kim, Min A; Lee, Hye Seung; Kim, Woo Ho

    2016-01-01

    The AT-rich interactive domain 1A (ARID1A) gene encodes a member of the switch/sucrose nonfermentable (SWI-SNF) chromatin remodeling complex, and is considered to work as a tumor suppressor in concert with p53. We investigated the clinical significance of ARID1A protein expression in gastric cancer (GC), and examined its association with Epstein-Barr virus-associated (EBV) GC, mismatch repair (MMR) deficiency, and p53 alteration. We performed immunohistochemistry for ARID1A in 417 GC specimens using tissue microarray. EBV infection was examined using EBV-encoded small RNA in situ hybridization. Evaluation of MMR protein deficiency and p53 alteration was performed using immunohistochemistry, and microsatellite instability status was also assessed. Loss of ARID1A expression was observed in 21.1% of GC (88/417), but was not observed in gastric adenoma tissues or non-neoplastic gastric mucosa tissues. Loss of ARID1A showed positive correlations with advanced pTNM stage and tumor invasion (P=0.029 and 0.001, respectively). Overall survival was significantly influenced by the loss of ARID1A expression in wild-type p53 group (P=0.016, log-rank test). Moreover, ARID1A loss was significantly associated with EBV positivity, loss of MMR protein expression, and microsatellite instability high status (P=0.028, <0.001, and 0.011, respectively). All of the results from our cohort were verified using data from the Cancer Genome Atlas. In conclusion, loss of ARID1A is more common in advanced GC and is related to EBV positivity and MMR deficiency. PMID:26067140

  9. Evolving approach and clinical significance of detecting DNA mismatch repair deficiency in colorectal carcinoma

    PubMed Central

    Shia, Jinru

    2016-01-01

    The last two decades have seen significant advancement in our understanding of colorectal tumors with DNA mismatch repair (MMR) deficiency. The ever-emerging revelations of new molecular and genetic alterations in various clinical conditions have necessitated constant refinement of disease terminology and classification. Thus, a case with the clinical condition of hereditary non-polyposis colorectal cancer as defined by the Amsterdam criteria may be one of Lynch syndrome characterized by a germline defect in one of the several MMR genes, one of the yet-to-be-defined “Lynch-like syndrome” if there is evidence of MMR deficiency in the tumor but no detectable germline MMR defect or tumor MLH1 promoter methylation, or “familial colorectal cancer type X” if there is no evidence of MMR deficiency. The detection of these conditions carries significant clinical implications. The detection tools and strategies are constantly evolving. The Bethesda guidelines symbolize a selective approach that uses clinical information and tumor histology as the basis to select high-risk individuals. Such a selective approach has subsequently been found to have limited sensitivity, and is thus gradually giving way to the alternative universal approach that tests all newly diagnosed colorectal cancers. Notably, the universal approach also has its own limitations; its cost-effectiveness in real practice, in particular, remains to be determined. Meanwhile, technological advances such as the next-generation sequencing are offering the promise of direct genetic testing for MMR deficiency at an affordable cost probably in the near future. This article reviews the up-to-date molecular definitions of the various conditions related to MMR deficiency, and discusses the tools and strategies that have been used in detecting these conditions. Special emphasis will be placed on the evolving nature and the clinical importance of the disease definitions and the detection strategies. PMID:25716099

  10. NPM-ALK mediates phosphorylation of MSH2 at tyrosine 238, creating a functional deficiency in MSH2 and the loss of mismatch repair

    PubMed Central

    Bone, K M; Wang, P; Wu, F; Wu, C; Li, L; Bacani, J T; Andrew, S E; Lai, R

    2015-01-01

    The vast majority of anaplastic lymphoma kinase-positive anaplastic large cell lymphoma (ALK+ALCL) tumors express the characteristic oncogenic fusion protein NPM-ALK, which mediates tumorigenesis by exerting its constitutive tyrosine kinase activity on various substrates. We recently identified MSH2, a protein central to DNA mismatch repair (MMR), as a novel binding partner and phosphorylation substrate of NPM-ALK. Here, using liquid chromatography–mass spectrometry, we report for the first time that MSH2 is phosphorylated by NPM-ALK at a specific residue, tyrosine 238. Using GP293 cells transfected with NPM-ALK, we confirmed that the MSH2Y238F mutant is not tyrosine phosphorylated. Furthermore, transfection of MSH2Y238F into these cells substantially decreased the tyrosine phosphorylation of endogenous MSH2. Importantly, gene transfection of MSH2Y238F abrogated the binding of NPM-ALK with endogenous MSH2, re-established the dimerization of MSH2:MSH6 and restored the sensitivity to DNA mismatch-inducing drugs, indicative of MMR return. Parallel findings were observed in two ALK+ALCL cell lines, Karpas 299 and SUP-M2. In addition, we found that enforced expression of MSH2Y238F into ALK+ALCL cells alone was sufficient to induce spontaneous apoptosis. In conclusion, our findings have identified NPM-ALK-induced phosphorylation of MSH2 at Y238 as a crucial event in suppressing MMR. Our studies have provided novel insights into the mechanism by which oncogenic tyrosine kinases disrupt MMR. PMID:25978431

  11. Understanding the Pathogenicity of Noncoding Mismatch Repair Gene Promoter Variants in Lynch Syndrome.

    PubMed

    Liu, Qing; Thompson, Bryony A; Ward, Robyn L; Hesson, Luke B; Sloane, Mathew A

    2016-05-01

    Lynch syndrome is the most common familial cancer condition that mainly predisposes to tumors of the colon and endometrium. Cancer susceptibility is caused by the autosomal dominant inheritance of a loss-of-function mutation or epimutation in one of the DNA mismatch repair (MMR) genes. Cancer risk assessment is often possible with nonsynonymous coding region mutations, but in many cases patients present with DNA sequence changes within noncoding regions, including the promoters, of MMR genes. The pathogenic role of promoter variants, and hence clinical significance, is unclear and this hinders the clinical management of carriers. In this review, we provide an overview of the classification of MMR gene variants, outline the laboratory assays and online resources that can be used to assess the causality of promoter variants in Lynch syndrome, and highlight some of the practical challenges of demonstrating the pathogenicity of these variants. In conclusion, we propose a guide that could be integrated into the current InSiGHT classification scheme to help determine if a MMR gene promoter variant is pathogenic. PMID:26888055

  12. Visualization of Eukaryotic DNA Mismatch Repair Reveals Distinct Recognition and Repair Intermediates

    PubMed Central

    Hombauer, Hans; Campbell, Christopher S.; Smith, Catherine E.; Desai, Arshad; Kolodner, Richard D.

    2011-01-01

    Summary DNA Mismatch Repair (MMR) increases replication fidelity by eliminating mispaired bases resulting from replication errors. In Saccharomyces cerevisiae mispairs are primarily detected by the Msh2-Msh6 complex and corrected following subsequent recruitment of the Mlh1-Pms1 complex. Here, we visualized functional fluorescent versions of Msh2-Msh6 and Mlh1-Pms1 in living cells. Msh2-Msh6 formed foci in S-phase that colocalized with replication factories; this localized pool accounted for 10–15% of MMR in wild-type cells but was essential for MMR in the absence of the exonuclease Exo1. Mlh1-Pms1 also formed foci that, while requiring Msh2-Msh6 for their formation, rarely colocalized with Msh2-Msh6. Mlh1-Pms1 foci increased when the number of mispaired bases was increased; in contrast, Msh2-Msh6 foci were unaffected. These results suggest that (I) mispair recognition can occur via either a replication factory-targeted or a second distinct pool of Msh2-Msh6, and (II) superstoichiometric Mlh1-Pms1 assembly triggered by mispair-bound Msh2-Msh6 defines sites of active MMR. PMID:22118461

  13. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Semsey, Szabolcs

    2014-12-01

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome.

  14. Targeted next-generation sequencing of 22 mismatch repair genes identifies Lynch syndrome families.

    PubMed

    Talseth-Palmer, Bente A; Bauer, Denis C; Sjursen, Wenche; Evans, Tiffany J; McPhillips, Mary; Proietto, Anthony; Otton, Geoffrey; Spigelman, Allan D; Scott, Rodney J

    2016-05-01

    Causative germline mutations in mismatch repair (MMR) genes can only be identified in ~50% of families with a clinical diagnosis of the inherited colorectal cancer (CRC) syndrome hereditary nonpolyposis colorectal cancer (HNPCC)/Lynch syndrome (LS). Identification of these patients are critical as they are at substantially increased risk of developing multiple primary tumors, mainly colorectal and endometrial cancer (EC), occurring at a young age. This demonstrates the need to develop new and/or more thorough mutation detection approaches. Next-generation sequencing (NGS) was used to screen 22 genes involved in the DNA MMR pathway in constitutional DNA from 14 HNPCC and 12 sporadic EC patients, plus 2 positive controls. Several softwares were used for analysis and functional annotation. We identified 5 exonic indel variants, 42 exonic nonsynonymous single-nucleotide variants (SNVs) and 1 intronic variant of significance. Three of these variants were class 5 (pathogenic) or class 4 (likely pathogenic), 5 were class 3 (uncertain clinical relevance) and 40 were classified as variants of unknown clinical significance. In conclusion, we have identified two LS families from the sporadic EC patients, one without a family history of cancer, supporting the notion for universal MMR screening of EC patients. In addition, we have detected three novel class 3 variants in EC cases. We have, in addition discovered a polygenic interaction which is the most likely cause of cancer development in a HNPCC patient that could explain previous inconsistent results reported on an intronic EXO1 variant. PMID:26811195

  15. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome.

    PubMed

    Sneppen, Kim; Semsey, Szabolcs

    2014-01-01

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome. PMID:25475788

  16. Dominant Mutations in S. cerevisiae PMS1 Identify the Mlh1-Pms1 Endonuclease Active Site and an Exonuclease 1-Independent Mismatch Repair Pathway

    PubMed Central

    Smith, Catherine E.; Mendillo, Marc L.; Bowen, Nikki; Hombauer, Hans; Campbell, Christopher S.; Desai, Arshad; Putnam, Christopher D.; Kolodner, Richard D.

    2013-01-01

    Lynch syndrome (hereditary nonpolypsis colorectal cancer or HNPCC) is a common cancer predisposition syndrome. Predisposition to cancer in this syndrome results from increased accumulation of mutations due to defective mismatch repair (MMR) caused by a mutation in one of the mismatch repair genes MLH1, MSH2, MSH6 or PMS2/scPMS1. To better understand the function of Mlh1-Pms1 in MMR, we used Saccharomyces cerevisiae to identify six pms1 mutations (pms1-G683E, pms1-C817R, pms1-C848S, pms1-H850R, pms1-H703A and pms1-E707A) that were weakly dominant in wild-type cells, which surprisingly caused a strong MMR defect when present on low copy plasmids in an exo1Δ mutant. Molecular modeling showed these mutations caused amino acid substitutions in the metal coordination pocket of the Pms1 endonuclease active site and biochemical studies showed that they inactivated the endonuclease activity. This model of Mlh1-Pms1 suggested that the Mlh1-FERC motif contributes to the endonuclease active site. Consistent with this, the mlh1-E767stp mutation caused both MMR and endonuclease defects similar to those caused by the dominant pms1 mutations whereas mutations affecting the predicted metal coordinating residue Mlh1-C769 had no effect. These studies establish that the Mlh1-Pms1 endonuclease is required for MMR in a previously uncharacterized Exo1-independent MMR pathway. PMID:24204293

  17. Implications of mismatch repair-deficient status on management of early stage colorectal cancer

    PubMed Central

    Kawakami, Hisato; Zaanan, Aziz

    2015-01-01

    For primary colorectal cancers (CRCs), tumor stage has been the best predictor of survival after resection and the key determinant of patient management. However, considerable stage-independent variability in clinical outcome is observed that is likely due to molecular heterogeneity. This is particularly important in early stage CRCs where patients can be cured by surgery alone and only a proportion derives benefit from adjuvant chemotherapy. Thus, the identification of molecular prognostic markers to supplement conventional pathologic staging systems has the potential to guide patient management and influence outcomes. CRC is a heterogeneous disease with molecular phenotypes reflecting distinct forms of genetic instability. The chromosomal instability pathway (CIN) is the most common phenotype, accounting for 85% of all sporadic CRCs. Alternatively, the microsatellite instability (MSI) phenotype represents ~15% of all CRCs and is caused by deficient DNA mismatch repair (MMR) as a consequence of germline mutations in MMR genes or, more commonly, epigenetic silencing of the MLH1 gene with frequent mutations in the BRAF oncogene. MSI tumors have distinct phenotypic features and are consistently associated with a better stage-adjusted prognosis compared with microsatellite stable (MSS) tumors. Among non-metastatic CRCs, the difference in prognosis between MSI and MSS tumors is larger for stage II than stage III patients. On the other hand, the predictive impact of MMR status for adjuvant chemotherapy remains a contentious issue in that most studies demonstrate a lack of benefit for 5-fluorouracil (5-FU)-based adjuvant chemotherapy in stage II MSI-H CRCs, whereas it remains unclear in MSI-H stage III tumors. Here, we describe the molecular aspects of the MMR system and discuss the implications of MMR-deficient/MSI-H status in the clinical management of patients with early stage CRC. PMID:26697201

  18. Mismatch repair deficiency: a temozolomide resistance factor in medulloblastoma cell lines that is uncommon in primary medulloblastoma tumours

    PubMed Central

    von Bueren, A O; Bacolod, M D; Hagel, C; Heinimann, K; Fedier, A; Kordes, U; Pietsch, T; Koster, J; Grotzer, M A; Friedman, H S; Marra, G; Kool, M; Rutkowski, S

    2012-01-01

    Background: Tumours are responsive to temozolomide (TMZ) if they are deficient in O6-methylguanine-DNA methyltransferase (MGMT), and mismatch repair (MMR) proficient. Methods: The effect of TMZ on medulloblastoma (MB) cell killing was analysed with clonogenic survival assays. Expression of DNA repair genes and enzymes was investigated using microarrays, western blot, and immunohistochemistry. DNA sequencing and promoter methylation analysis were employed to investigate the cause of loss of the expression of MMR gene MLH1. Results: Temozolomide exhibited potent cytotoxic activity in D425Med (MGMT deficient, MLH1 proficient; IC50=1.7 μℳ), moderate activity against D341Med (MGMT proficient, MLH1 deficient), and DAOY MB cells (MGMT proficient, MLH1 proficient). MGMT inhibitor O6-benzylguanine sensitised DAOY, but not D341Med cells to TMZ. Of 12 MB cell lines, D341Med, D283Med, and 1580WÜ cells exhibited MMR deficiency due to MLH1 promoter hypermethylation. DNA sequencing of these cells provided no evidence for somatic genetic alterations in MLH1. Expression analyses of MMR and MGMT in MB revealed that all patient specimens (n=74; expression array, n=61; immunostaining, n=13) are most likely MMR proficient, whereas some tumours had low MGMT expression levels (according to expression array) or were totally MGMT deficient (3 out of 13 according to immunohistochemistry). Conclusion: A subset of MB may respond to TMZ as some patient specimens are MGMT deficient, and tumours appear to be MMR proficient. PMID:22976800

  19. Mismatch repair deficiency endows tumors with a unique mutation signature and sensitivity to DNA double-strand breaks

    PubMed Central

    Zhao, Hui; Thienpont, Bernard; Yesilyurt, Betül Tuba; Moisse, Matthieu; Reumers, Joke; Coenegrachts, Lieve; Sagaert, Xavier; Schrauwen, Stefanie; Smeets, Dominiek; Matthijs, Gert; Aerts, Stein; Cools, Jan; Metcalf, Alex; Spurdle, Amanda; Amant, Frederic; Lambrechts, Diether

    2014-01-01

    DNA replication errors that persist as mismatch mutations make up the molecular fingerprint of mismatch repair (MMR)-deficient tumors and convey them with resistance to standard therapy. Using whole-genome and whole-exome sequencing, we here confirm an MMR-deficient mutation signature that is distinct from other tumor genomes, but surprisingly similar to germ-line DNA, indicating that a substantial fraction of human genetic variation arises through mutations escaping MMR. Moreover, we identify a large set of recurrent indels that may serve to detect microsatellite instability (MSI). Indeed, using endometrial tumors with immunohistochemically proven MMR deficiency, we optimize a novel marker set capable of detecting MSI and show it to have greater specificity and selectivity than standard MSI tests. Additionally, we show that recurrent indels are enriched for the ‘DNA double-strand break repair by homologous recombination’ pathway. Consequently, DSB repair is reduced in MMR-deficient tumors, triggering a dose-dependent sensitivity of MMR-deficient tumor cultures to DSB inducers. DOI: http://dx.doi.org/10.7554/eLife.02725.001 PMID:25085081

  20. Structural, molecular and cellular functions of MSH2 and MSH6 during DNA mismatch repair, damage signaling and other noncanonical activities

    PubMed Central

    Edelbrock, Michael A.; Kaliyaperumal, Saravanan; Williams, Kandace J.

    2013-01-01

    The field of DNA mismatch repair (MMR) has rapidly expanded after the discovery of the MutHLS repair system in bacteria. By the mid 1990s yeast and human homologues to bacterial MutL and MutS had been identified and their contribution to hereditary non-polyposis colorectal cancer (HNPCC; Lynch Syndrome) was under intense investigation. The human MutS homologue 6 protein (hMSH6), was first reported in 1995 as a G:T binding partner (GTBP) of hMSH2, forming the hMutSα mismatch-binding complex. Signal transduction from each DNA-bound hMutSα complex is accomplished by the hMutLα heterodimer (hMLH1 and hPMS2). Molecular mechanisms and cellular regulation of individual MMR proteins are now areas of intensive research. This review will focus on molecular mechanisms associated with mismatch binding, as well as emerging evidence that MutSα and in particular, MSH6, is a key protein in MMR-dependent DNA damage response and communication with other DNA repair pathways within the cell. MSH6 is unstable in the absence of MSH2, however it is the DNA lesion-binding partner of this heterodimer. MSH6, but not MSH2, has a conserved Phe-X-Glu motif that recognizes and binds several different DNA structural distortions, initiating different cellular responses. hMSH6 also contains the nuclear localization sequences required to shuttle hMutSα into the nucleus. For example, upon binding to O6meG:T, MSH6 triggers a DNA damage response that involves altered phosphorylation within the N-terminal disordered domain of this unique protein. While many investigations have focused on MMR as a post-replication DNA repair mechanism, MMR proteins are expressed and active in all phases of the cell cycle. There is much more to be discovered about regulatory cellular roles that require the presence of MutSα and, in particular, MSH6. PMID:23391514

  1. When does MMR loss occur during HNPCC progression?

    PubMed

    Shibata, Darryl

    2006-01-01

    Inactivation of DNA mismatch repair (MMR) is the hallmark of hereditary nonpolyposis colorectal cancer (HNPCC) and sporadic colorectal cancers with microsatellite instability (MSI+). MMR loss results in a markedly elevated mutation rate, and many MS mutations are found in MSI+ cancers. In theory, it is possible to estimate the interval between MMR loss and cancer removal by counting numbers of cancer MS mutations--the more MS mutations, the longer the intervals since MMR loss. Using this somatic molecular clock approach, MMR loss is estimated to precede transformation (clonal expansion) and likely occurs in normal appearing colon. Surprising, ages at MMR loss are more consistent with MMR loss as a relatively late event during progression to MSI+ cancer. PMID:17192057

  2. GADD45α modulates curcumin sensitivity through c-Abl- and JNK-dependent signaling pathways in a mismatch repair-dependent manner.

    PubMed

    Naick, Hemanth; Jin, Shunqian; Baskaran, R

    2016-03-01

    Colorectal cancer is a critical health concern because of its incidence as the third most prevalent cancer in the world. Currently, 5-fluorouracil (5-FU), 6-thioguanine, and certain other genotoxic agents are mainstays of treatment; however, patients often die due to emergence of resistant population. Curcumin, a bioactive compound derived from the dietary turmeric (Curcuma longa) is an effective anticancer, anti-inflammatory, and antioxidant agent. Previously, we reported that human colorectal cancer cell lines compromised for mismatch repair (MMR) function exhibit heightened sensitivity to curcumin due to sustained curcumin-induced unrepaired DNA damage compared to proficient population counterparts. In this report, we show that the protein levels of gadd45α, whose transcript levels are increased during DNA damage and stress signals, are upregulated following curcumin treatment in a dose- and time-dependent manner. We further observed that cells compromised for Mlh1 function (HCT116 + Ch2) displayed ~twofold increased GADD45α upregulation compared to similarly treated proficient counterparts (HCT116 + Ch3). Similarly, suppression of Mlh1 using ShRNA increased GADD45α upregulation upon curcumin treatment. On the other hand, suppression of GADD45α using SiRNA-blocked curcumin-induced cell death induction in Mlh1-deficient cells. Moreover, inhibition of Abl through ST571 treatment and its downstream effector JNK through SP600125 treatment blocked GADD45α upregulation and cell death triggered by curcumin. Collective results lead us to conclude that GADD45α modulates curcumin sensitivity through activation of c-Abl > JNK signaling in a mismatch repair-dependent manner. PMID:26833194

  3. A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells

    PubMed Central

    Moriwaki, Takahito; Kato, Yuichi; Nakamura, Chihiro; Ishikawa, Satoru; Zhang-Akiyama, Qiu-Mei

    2015-01-01

    DNA mismatch repair (MMR) contributes to genome integrity by correcting errors of DNA polymerase and inducing cell death in response to DNA damage. Dysfunction of MMR results in increased mutation frequency and cancer risk. Clinical researches revealed that MMR abnormalities induce cancers of non-dividing tissues, such as kidney and liver. However, how MMR suppresses cancer in non-dividing tissues is not understood. To address that mechanism, we analyzed the roles of MMR in non-dividing cells using Caenorhabditis elegans (C. elegans), in which all somatic cells are non-dividing in the adult stage. In this study, we used stable MMR-mutant lines with a balancer chromosome. First, we confirmed that deficiency of MMR leads to resistance to various mutagens in C. elegans dividing cells. Next, we performed drug resistance assays, and found that MMR-deficient adult worms were resistant to SN1-type alkylating and oxidizing agents. In addition, dead cell staining and reporter assays of an autophagy-related gene demonstrated that the cell death was autophagic cell death. Interestingly, this autophagic cell death was not suppressed by caffeine, implying that MMR induces death of non-dividing cells in an atl-1-independent manner. Hence, we propose the hypothesis that MMR prevents cancers in non-dividing tissues by directly inducing cell death. PMID:26413217

  4. Mismatch repair status and synchronous metastases in colorectal cancer: A nationwide cohort study.

    PubMed

    Nordholm-Carstensen, Andreas; Krarup, Peter-Martin; Morton, Dion; Harling, Henrik

    2015-11-01

    The causality between the metastatic potential, mismatch repair status (MMR) and survival in colorectal cancer (CRC) is complex. This study aimed to investigate the impact of MMR in CRC on the occurrence of synchronous metastases (SCCM) and survival in patients with SCCM on a national basis. A nationwide cohort study of 6,692 patients diagnosed with CRC between 2010 and 2012 was conducted. Data were prospectively entered into the Danish Colorectal Cancer Group's database and merged with data from the Danish Pathology Registry and the National Patient Registry. Multivariable and multinomial logistic- and Cox-regression and proportional excess hazards analyses were used for confounder adjustment and to adjust for the general population mortality. In total, 983 of 6,692 patients (14.7%) had dMMR and 935 (14.0%) had SCCM. dMMR was associated with a decreased risk of SCCM, adjusted Odds Ratio (aOR) = 0.54 (95% confidence interval (CI):0.40-0.70, p < 0.001). The association only applied to confined hepatic metastases (aOR = 0.30, 95%CI: 0.18-0.49, p < 0.001), whereas the presence of confined pulmonary metastases (aOR = 0.71, 95% CI: 0.39-1.29, p = 0.258) or synchronous hepatic and pulmonary metastases (aOR = 0.69, 95% CI:0.26-1.29, p = 0.436) were unaffected by MMR. MMR in patients with SCCM had no impact on survival (Cox: adjusted Hazard Ratio (aHR) = 0.76, 95% CI: 0.54-1.06, p = 0.101; Proportional excess hazards: aHR = 0.73, 95% CI: 0.50-1.07, p = 0.111) when adjusting for other prognostic factors. The metastatic pattern varied according to MMR status. MMR had no impact on survival in patients with UICC Stage IV CRC. These findings may be important for the understanding of the metastatic processes and thus for optimizing staging and treatment in CRC patients. PMID:25921209

  5. Constitutional mismatch repair deficiency syndrome: Do we know it?

    PubMed Central

    Ramachandra, C.; Challa, Vasu Reddy; Shetty, Rachan

    2014-01-01

    Constitutional mismatch repair deficiency syndrome is a rare autosomal recessive syndrome caused by homozygous mutations in mismatch repair genes. This is characterized by the childhood onset of brain tumors, colorectal cancers, cutaneous manifestations of neurofibromatosis-1 like café au lait spots, hematological malignancies, and occasionally other rare malignancies. Here, we would like to present a family in which the sibling had glioblastoma, and the present case had acute lymphoblastic lymphoma and colorectal cancer. We would like to present this case because of its rarity and would add to literature. PMID:25400351

  6. The mismatch repair system reduces meiotic homeologous recombination and stimulates recombination-dependent chromosome loss.

    PubMed Central

    Chambers, S R; Hunter, N; Louis, E J; Borts, R H

    1996-01-01

    Efficient genetic recombination requires near-perfect homology between participating molecules. Sequence divergence reduces the frequency of recombination, a process that is dependent on the activity of the mismatch repair system. The effects of chromosomal divergence in diploids of Saccharomyces cerevisiae in which one copy of chromosome III is derived from a closely related species, Saccharomyces paradoxus, have been examined. Meiotic recombination between the diverged chromosomes is decreased by 25-fold. Spore viability is reduced with an observable increase in the number of tetrads with only two or three viable spores. Asci with only two viable spores are disomic for chromosome III, consistent with meiosis I nondisjunction of the homeologs. Asci with three viable spores are highly enriched for recombinants relative to tetrads with four viable spores. In 96% of the class with three viable spores, only one spore possesses a recombinant chromosome III, suggesting that the recombination process itself contributes to meiotic death. This phenomenon is dependent on the activities of the mismatch repair genes PMS1 and MSH2. A model of mismatch-stimulated chromosome loss is proposed to account for this observation. As expected, crossing over is increased in pms1 and msh2 mutants. Furthermore, genetic exchange in pms1 msh2 double mutants is affected to a greater extent than in either mutant alone, suggesting that the two proteins act independently to inhibit homeologous recombination. All mismatch repair-deficient strains exhibited reductions in the rate of chromosome III nondisjunction. PMID:8887641

  7. Colon and Endometrial Cancers with Mismatch Repair Deficiency can Arise from Somatic, Rather Than Germline, Mutations

    PubMed Central

    Haraldsdottir, Sigurdis; Hampel, Heather; Tomsic, Jerneja; Frankel, Wendy L.; Pearlman, Rachel; de la Chapelle, Albert; Pritchard, Colin C.

    2014-01-01

    Background & Aims Patients with Lynch syndrome carry germline mutations in single alleles of genes encoding the MMR proteins MLH1, MSH2, MSH6 and PMS2; when the second allele becomes mutated, cancer can develop. Increased screening for Lynch syndrome has identified patients with tumors that have deficiency in MMR, but no germline mutations in genes encoding MMR proteins. We investigated whether tumors with deficient MMR had acquired somatic mutations in patients without germline mutations in MMR genes using next-generation sequencing. Methods We analyzed blood and tumor samples from 32 patients with colorectal or endometrial cancer who participated in Lynch syndrome screening studies in Ohio and were found to have tumors with MMR deficiency (based on microsatellite instability and/or absence of MMR proteins in immunohistochemical analysis, without hypermethylation of MLH1), but no germline mutations in MMR genes. Tumor DNA was sequenced for MLH1, MSH2, MSH6, PMS2, EPCAM, POLE and POLD1 with ColoSeq and mutation frequencies were established. Results Twenty-two of 32 patients (69%) were found to have two somatic (tumor) mutations in MMR genes encoding proteins that were lost from tumor samples, based on immunohistochemistry. Of the 10 tumors without somatic mutations in MMR genes, 3 had somatic mutations with possible loss of heterozygosity that could lead to MMR deficiency, 6 were found to be false-positive results (19%), and 1 had no mutations known to be associated with MMR deficiency. All of the tumors found to have somatic MMR mutations were of the hypermutated phenotype (>12 mutations/Mb); 6 had mutation frequencies >200 per Mb, and 5 of these had somatic mutations in POLE, which encodes a DNA polymerase. Conclusions Some patients are found to have tumors with MMR deficiency during screening for Lynch syndrome, yet have no identifiable germline mutations in MMR genes. We found that almost 70% of these patients acquire somatic mutations in MMR genes, leading to

  8. Mechanisms in E. coli and Human Mismatch Repair (Nobel Lecture).

    PubMed

    Modrich, Paul

    2016-07-18

    DNA molecules are not completely stable, they are subject to chemical or photochemical damage and errors that occur during DNA replication resulting in mismatched base pairs. Through mechanistic studies Paul Modrich showed how replication errors are corrected by strand-directed mismatch repair in Escherichia coli and human cells. PMID:27198632

  9. Avalanching mutations in biallelic mismatch repair deficiency syndrome.

    PubMed

    Waterfall, Joshua J; Meltzer, Paul S

    2015-03-01

    Tumors from pediatric patients generally contain relatively few somatic mutations. A new study reports a striking exception in individuals in whom biallelic germline deficiency for mismatch repair is compounded by somatic loss of function in DNA proofreading polymerases, resulting in 'ultra-hypermutated' malignant brain tumors. PMID:25711864

  10. Therapy and progression--induced O6-methylguanine-DNA methyltransferase and mismatch repair alterations in recurrent glioblastoma multiforme.

    PubMed

    Agarwal, S; Suri, V; Sharma, M C; Sarkar, C

    2015-01-01

    Despite multimodality treatment protocol including surgical resection, radiotherapy, and chemotherapy in patients with glioblastoma multiforme (GBM), most suffer from treatment failure and tumor recurrence within a few months of initial surgery. The effectiveness of temozolomide (TMZ), the most commonly used chemotherapeutic agent, is largely dependent on the methylation status of the promoter of the gene O6-methylguanine-DNA methyltransferase (MGMT) and the integrity of the mismatch repair (MMR) system. Changes in these regulatory mechanisms at the time of recurrence may influence response to therapy. Deciphering the molecular mechanisms of resistance to these drugs may in future lead to improvised patient management. In this article, we provide an update of the spectrum of molecular changes that occur in recurrent GBMs, and thus may have an impact on patient survival and treatment response. For review, electronic search for the keywords "Recurrent GBM", "Recurrent GBM AND MGMT" "Recurrent glioma AND MGMT", "Recurrent GBM AND MMR" and "Recurrent glioma AND MMR", "Recurrent GBM AND MMR" and "Recurrent glioma AND MMR" was done on PubMed and relevant citations were screened including cross-references. PMID:26960480

  11. Characterisation of antimicrobial resistance-associated integrons and mismatch repair gene mutations in Salmonella serotypes.

    PubMed

    Yang, Baowei; Zheng, Jie; Brown, Eric W; Zhao, Shaohua; Meng, Jianghong

    2009-02-01

    In this study, we examined the presence of integrons and Salmonella genomic island 1 (SGI1) and assessed their contribution to antimicrobial resistance as well as determining the extent of the mutator phenotype in Salmonella isolates. A total of 81 Salmonella enterica serotype Typhimurium isolates were examined for the presence of integrons and SGI1 and for hypermutators using polymerase chain reaction (PCR) and the mutator assay, respectively. An additional 336 Salmonella isolates were also used to screen for hypermutators. Fourteen S. Typhimurium isolates carried class 1 integrons, of which six were shown to possess SGI1. Five putative mutators, S. Typhimurium ST20751, S. enterica serotype Heidelberg 22396 and S. enterica serotype Enteritidis 17929, 17929N and 17929R, were identified among the 417 Salmonella isolates. Complementation analysis with the wild-type mutH, mutL, mutS and uvrD genes indicated that none of the five mutators contained defective mismatch repair (MMR) system alleles. DNA sequence analysis revealed that single point mutations resulting in aspartic acid (codon 87) substitution in the gyrA gene conferred resistance to nalidixic acid and/or other fluoroquinolone drugs (ciprofloxacin and enrofloxacin) among four isolates. Our findings indicated that integrons and SGI1 play an important role in multidrug resistance in Salmonella. The incidence of hypermutators owing to defective MMR in Salmonella appears to be rare. PMID:19013057

  12. DREMECELS: A Curated Database for Base Excision and Mismatch Repair Mechanisms Associated Human Malignancies

    PubMed Central

    Shukla, Ankita; Singh, Tiratha Raj

    2016-01-01

    DNA repair mechanisms act as a warrior combating various damaging processes that ensue critical malignancies. DREMECELS was designed considering the malignancies with frequent alterations in DNA repair pathways, that is, colorectal and endometrial cancers, associated with Lynch syndrome (also known as HNPCC). Since lynch syndrome carries high risk (~40–60%) for both cancers, therefore we decided to cover all three diseases in this portal. Although a large population is presently affected by these malignancies, many resources are available for various cancer types but no database archives information on the genes specifically for only these cancers and disorders. The database contains 156 genes and two repair mechanisms, base excision repair (BER) and mismatch repair (MMR). Other parameters include some of the regulatory processes that have roles in these disease progressions due to incompetent repair mechanisms, specifically BER and MMR. However, our unique database mainly provides qualitative and quantitative information on these cancer types along with methylation, drug sensitivity, miRNAs, copy number variation (CNV) and somatic mutations data. This database would serve the scientific community by providing integrated information on these disease types, thus sustaining diagnostic and therapeutic processes. This repository would serve as an excellent accompaniment for researchers and biomedical professionals and facilitate in understanding such critical diseases. DREMECELS is publicly available at http://www.bioinfoindia.org/dremecels. PMID:27276067

  13. Cadmium inhibits mismatch repair by blocking the ATPase activity of the MSH2-MSH6 complex.

    PubMed

    Banerjee, Sreeparna; Flores-Rozas, Hernan

    2005-01-01

    Cadmium (Cd2+) is a known carcinogen that inactivates the DNA mismatch repair (MMR) pathway. In this study, we have tested the effect of Cd2+ exposure on the enzymatic activity of the mismatch binding complex MSH2-MSH6. Our results indicate that Cd2+ is highly inhibitory to the ATP binding and hydrolysis activities of MSH2-MSH6, and less inhibitory to its DNA mismatch binding activity. The inhibition of the ATPase activity appears to be dose and exposure time dependent. However, the inhibition of the ATPase activity by Cd2+ is prevented by cysteine and histidine, suggesting that these residues are essential for the ATPase activity and are targeted by Cd2+. A comparison of the mechanism of inhibition with N-ethyl maleimide, a sulfhydryl group inhibitor, indicates that this inhibition does not occur through direct inactivation of sulfhydryl groups. Zinc (Zn2+) does not overcome the direct inhibitory effect of Cd2+ on the MSH2-MSH6 ATPase activity in vitro. However, the increase in the mutator phenotype of yeast cells exposed to Cd2+ was prevented by excess Zn2+, probably by blocking the entry of Cd2+ into the cell. We conclude that the inhibition of MMR by Cd2+ is through the inactivation of the ATPase activity of the MSH2-MSH6 heterodimer, resulting in a dominant negative effect and causing a mutator phenotype. PMID:15746000

  14. DNA Helicases in NER, BER, and MMR.

    PubMed

    Kuper, Jochen; Kisker, Caroline

    2013-01-01

    Different DNA repair mechanisms have evolved to protect our genome from modifications caused by endogenous and exogenous agents, thus maintaining the integrity of the DNA. Helicases often play a central role in these repair pathways and have shown to be essential for diverse tasks within these mechanisms. In prokaryotic nucleotide excision repair (NER) for example the two helicases UvrB and UvrD assume vastly different functions. While UvrB is intimately involved in damage verification and acts as an anchor for the other prokaryotic NER proteins UvrA and UvrC, UvrD is required to resolve the post-incision complex leading to the release of UvrC and the incised ssDNA fragment. For the XPD helicase in eukaryotic NER a similar function in analogy to UvrB has been proposed, whereas XPB the second helicase uses only its ATPase activity during eukaryotic NER. In prokaryotic mismatch repair (MMR) UvrD again plays a central role. The different tasks of this protein in the different repair pathways highlight the importance of regulative protein-protein interactions to fine-tune its helicase activity. In other DNA repair pathways the role of the helicases involved is sometimes not as well characterized, and no helicase has so far been described to assume the function of UvrD in eukaryotic MMR. RecQ helicases and FancJ interact with eukaryotic MMR proteins but their involvement in this repair pathway is unclear. Lastly, long-patch base excision repair is linked to the WRN helicase and many proteins within this pathway interact with the helicase leading to increased activity of the interacting proteins as observed for pol β and FEN-1 or the helicase itself is negatively regulated through the interaction with APE-1. However, compared to the precise functions described for the helicases in the other DNA repair mechanisms the role of WRN in BER remains speculative and requires further analysis. PMID:23161013

  15. Emerging importance of mismatch repair components including UvrD helicase and their cross-talk with the development of drug resistance in malaria parasite.

    PubMed

    Ahmad, Moaz; Tuteja, Renu

    2014-12-01

    Human malaria is an important parasitic infection responsible for a significant number of deaths worldwide, particularly in tropical and subtropical regions. The recent scenario has worsened mainly because of the emergence of drug-resistant malaria parasites having the potential to spread across the world. Drug-resistant parasites possess a defective mismatch repair (MMR); therefore, it is essential to explore its mechanism in detail to determine the underlying cause. Recently, artemisinin-resistant parasites have been reported to exhibit nonsynonymous single nucleotide polymorphisms in genes involved in MMR pathways such as MutL homolog (MLH) and UvrD. Plasmodium falciparum MLH is an endonuclease required to restore the defective MMR in drug-resistant W2 strain of P. falciparum. Although the role of helicases in eukaryotic MMR has been questioned, the identification and characterization of the UvrD helicase and their cross-talk with MLH in P. falciparum suggests the possible involvement of UvrD in MMR. A comparative genome-wide analysis revealed the presence of the UvrD helicase in Plasmodium species, while it is absent in human host. Therefore, PfUvrD may emerge as a suitable drug target to control malaria. This review study is focused on recent developments in MMR biochemistry, emerging importance of the UvrD helicase, possibility of its involvement in MMR and the emerging cross-talk between MMR components and drug resistance in malaria parasite. PMID:25771870

  16. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations.

    PubMed

    Sijmons, Rolf H; Hofstra, Robert M W

    2016-02-01

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive Constitutional Mismatch Repair Deficiency syndrome. Both conditions are important to recognize clinically as their identification has direct consequences for clinical management and allows targeted preventive actions in mutation carriers. Lynch syndrome is one of the more common adult-onset hereditary tumor syndromes, with thousands of patients reported to date. Its tumor spectrum is well established and includes colorectal cancer, endometrial cancer and a range of other cancer types. However, surveillance for cancers other than colorectal cancer is still of uncertain value. Prophylactic surgery, especially for the uterus and its adnexa is an option in female mutation carriers. Chemoprevention of colorectal cancer with aspirin is actively being investigated in this syndrome and shows promising results. In contrast, the Constitutional Mismatch Repair Deficiency syndrome is rare, features a wide spectrum of childhood onset cancers, many of which are brain tumors with high mortality rates. Future studies are very much needed to improve the care for patients with this severe disorder. PMID:26746812

  17. Dependence of Colorectal Cancer Risk on the Parent-of-Origin of Mutations in DNA Mismatch Repair Genes

    PubMed Central

    van Vliet, Christine M.; Dowty, James G.; van Vliet, Jane L.; Smith, Letitia; Mead, Leeanne J.; Macrae, Finlay A.; St. John, D. James B.; Giles, Graham G.; Southey, Melissa C.; Jenkins, Mark A.; Velan, Gary M.; Hopper, John L.

    2011-01-01

    Genetic diseases associated with dynamic mutations in microsatellite DNA often display parent-of-origin effects (POEs) in which the risk of disease depends on the sex of the parent from whom the disease allele was inherited. Carriers of germline mutations in mismatch repair (MMR) genes have high risks of colorectal carcinoma (CRC). We investigated whether these risks depend on the parent-of-origin of the mutation. We studied 422 subjects, including 89 MMR gene mutation carriers, from 17 population-based families who were each recruited via a CRC case diagnosed before age 45 years and found to carry a MMR gene mutation. The POE hazard ratio (HRPOE), defined to be the CRC incidence for carriers with maternally derived mutations divided by the corresponding paternal incidence, was estimated using a novel application of modified segregation analysis. HRPOE (95% confidence interval) was estimated to be 3.2 (1.1–9.8) for males (P=0.03) and 0.8 (0.2–2.8) for females (P=0.5) and the corresponding cumulative risks to age 80 years were 88% (54%–100%) for male carriers with maternally derived mutations and 38–48% for all other carriers. If confirmed by larger studies, these results will have important implications for the etiology of CRC and for the clinical management of MMR gene mutation carriers. PMID:21120946

  18. Dependence of colorectal cancer risk on the parent-of-origin of mutations in DNA mismatch repair genes.

    PubMed

    van Vliet, Christine M; Dowty, James G; van Vliet, Jane L; Smith, Letitia; Mead, Leeanne J; Macrae, Finlay A; St John, D James B; Giles, Graham G; Southey, Melissa C; Jenkins, Mark A; Velan, Gary M; Hopper, John L

    2011-02-01

    Genetic diseases associated with dynamic mutations in microsatellite DNA often display parent-of-origin effects (POEs) in which the risk of disease depends on the sex of the parent from whom the disease allele was inherited. Carriers of germline mutations in mismatch repair (MMR) genes have high risks of colorectal carcinoma (CRC). We investigated whether these risks depend on the parent-of-origin of the mutation. We studied 422 subjects, including 89 MMR gene mutation carriers, from 17 population-based families who were each recruited via a CRC case diagnosed before age 45 years and found to carry a MMR gene mutation. The POE hazard ratio (HR(POE)), defined to be the CRC incidence for carriers with maternally derived mutations divided by the corresponding paternal incidence, was estimated using a novel application of modified segregation analysis. HR(POE) (95% confidence interval) was estimated to be 3.2 (1.1-9.8) for males (P = 0.03) and 0.8 (0.2-2.8) for females (P = 0.5) and the corresponding cumulative risks to age 80 years were 88% (54%-100%) for male carriers with maternally derived mutations and 38-48% for all other carriers. If confirmed by larger studies, these results will have important implications for the etiology of CRC and for the clinical management of MMR gene mutation carriers. PMID:21120946

  19. Agenesis of the corpus callosum and gray matter heterotopia in three patients with constitutional mismatch repair deficiency syndrome

    PubMed Central

    Baas, Annette F; Gabbett, Michael; Rimac, Milan; Kansikas, Minttu; Raphael, Martine; Nievelstein, Rutger AJ; Nicholls, Wayne; Offerhaus, Johan; Bodmer, Danielle; Wernstedt, Annekatrin; Krabichler, Birgit; Strasser, Ulrich; Nyström, Minna; Zschocke, Johannes; Robertson, Stephen P; van Haelst, Mieke M; Wimmer, Katharina

    2013-01-01

    Constitutional mismatch repair deficiency (CMMR-D) syndrome is a rare inherited childhood cancer predisposition caused by biallelic germline mutations in one of the four mismatch repair (MMR)-genes, MLH1, MSH2, MSH6 or PMS2. Owing to a wide tumor spectrum, the lack of specific clinical features and the overlap with other cancer predisposing syndromes, diagnosis of CMMR-D is often delayed in pediatric cancer patients. Here, we report of three new CMMR-D patients all of whom developed more than one malignancy. The common finding in these three patients is agenesis of the corpus callosum (ACC). Gray matter heterotopia is present in two patients. One of the 57 previously reported CMMR-D patients with brain tumors (therefore all likely had cerebral imaging) also had ACC. With the present report the prevalence of cerebral malformations is at least 4/60 (6.6%). This number is well above the population birth prevalence of 0.09–0.36 live births with these cerebral malformations, suggesting that ACC and heterotopia are features of CMMR-D. Therefore, the presence of cerebral malformations in pediatric cancer patients should alert to the possible diagnosis of CMMR-D. ACC and gray matter heterotopia are the first congenital malformations described to occur at higher frequency in CMMR-D patients than in the general population. Further systematic evaluations of CMMR-D patients are needed to identify possible other malformations associated with this syndrome. PMID:22692065

  20. DNA Mismatch Repair Interacts with CAF-1- and ASF1A-H3-H4-dependent Histone (H3-H4)2 Tetramer Deposition.

    PubMed

    Rodriges Blanko, Elena; Kadyrova, Lyudmila Y; Kadyrov, Farid A

    2016-04-22

    DNA mismatch repair (MMR) is required for the maintenance of genome stability and protection of humans from several types of cancer. Human MMR occurs in the chromatin environment, but little is known about the interactions between MMR and the chromatin environment. Previous research has suggested that MMR coincides with replication-coupled assembly of the newly synthesized DNA into nucleosomes. The first step in replication-coupled nucleosome assembly is CAF-1-dependent histone (H3-H4)2 tetramer deposition, a process that involves ASF1A-H3-H4 complex. In this work we used reconstituted human systems to investigate interactions between MMR and CAF-1- and ASF1A-H3-H4-dependent histone (H3-H4)2 tetramer deposition. We have found that MutSα inhibits CAF-1- and ASF1A-H3-H4-dependent packaging of a DNA mismatch into a tetrasome. This finding supports the idea that MMR occurs before the DNA mismatch is packaged into the tetrasome. Our experiments have also revealed that CAF-1- and ASF1A-H3-H4-dependent deposition of the histone (H3-H4)2 tetramers does not interfere with MMR reactions. In addition, we have established that unnecessary degradation of the discontinuous strand that takes place in both DNA polymerase δ (Pol δ)- and DNA polymerase ϵ (Pol ϵ)-dependent MMR reactions is suppressed by CAF-1- and ASF1A-H3-H4-dependent deposition of the histone (H3-H4)2 tetramers. These data suggest that CAF-1- and ASF1A-H3-H4-dependent deposition of the histone (H3-H4)2 tetramers is compatible with MMR and protects the discontinuous daughter strand from unnecessary degradation by MMR machinery. PMID:26945061

  1. Developing controllable hypermutable Clostridium cells through manipulating its methyl-directed mismatch repair system.

    PubMed

    Luan, Guodong; Cai, Zhen; Gong, Fuyu; Dong, Hongjun; Lin, Zhao; Zhang, Yanping; Li, Yin

    2013-11-01

    Development of controllable hypermutable cells can greatly benefit understanding and harnessing microbial evolution. However, there have not been any similar systems developed for Clostridium, an important bacterial genus. Here we report a novel two-step strategy for developing controllable hypermutable cells of Clostridium acetobutylicum, an important and representative industrial strain. Firstly, the mutS/L operon essential for methyldirected mismatch repair (MMR) activity was inactivated from the genome of C. acetobutylicum to generate hypermutable cells with over 250-fold increased mutation rates. Secondly, a proofreading control system carrying an inducibly expressed mutS/L operon was constructed. The hypermutable cells and the proofreading control system were integrated to form a controllable hypermutable system SMBMutC, of which the mutation rates can be regulated by the concentration of anhydrotetracycline (aTc). Duplication of the miniPthl-tetR module of the proofreading control system further significantly expanded the regulatory space of the mutation rates, demonstrating hypermutable Clostridium cells with controllable mutation rates are generated. The developed C. acetobutylicum strain SMBMutC2 showed higher survival capacities than the control strain facing butanol-stress, indicating greatly increased evolvability and adaptability of the controllable hypermutable cells under environmental challenges. PMID:24214875

  2. The Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis, a Bacterium Naturally Devoid of the Postreplicative Mismatch Repair Pathway.

    PubMed

    Kucukyildirim, Sibel; Long, Hongan; Sung, Way; Miller, Samuel F; Doak, Thomas G; Lynch, Michael

    2016-01-01

    Mycobacterium smegmatis is a bacterium that is naturally devoid of known postreplicative DNA mismatch repair (MMR) homologs, mutS and mutL, providing an opportunity to investigate how the mutation rate and spectrum has evolved in the absence of a highly conserved primary repair pathway. Mutation accumulation experiments of M. smegmatis yielded a base-substitution mutation rate of 5.27 × 10(-10) per site per generation, or 0.0036 per genome per generation, which is surprisingly similar to the mutation rate in MMR-functional unicellular organisms. Transitions were found more frequently than transversions, with the A:T→G:C transition rate significantly higher than the G:C→A:T transition rate, opposite to what is observed in most studied bacteria. We also found that the transition-mutation rate of M. smegmatis is significantly lower than that of other naturally MMR-devoid or MMR-knockout organisms. Two possible candidates that could be responsible for maintaining high DNA fidelity in this MMR-deficient organism are the ancestral-like DNA polymerase DnaE1, which contains a highly efficient DNA proofreading histidinol phosphatase (PHP) domain, and/or the existence of a uracil-DNA glycosylase B (UdgB) homolog that might protect the GC-rich M. smegmatis genome against DNA damage arising from oxidation or deamination. Our results suggest that M. smegmatis has a noncanonical Dam (DNA adenine methylase) methylation system, with target motifs differing from those previously reported. The mutation features of M. smegmatis provide further evidence that genomes harbor alternative routes for improving replication fidelity, even in the absence of major repair pathways. PMID:27194804

  3. The Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis, a Bacterium Naturally Devoid of the Postreplicative Mismatch Repair Pathway

    PubMed Central

    Kucukyildirim, Sibel; Long, Hongan; Sung, Way; Miller, Samuel F.; Doak, Thomas G.; Lynch, Michael

    2016-01-01

    Mycobacterium smegmatis is a bacterium that is naturally devoid of known postreplicative DNA mismatch repair (MMR) homologs, mutS and mutL, providing an opportunity to investigate how the mutation rate and spectrum has evolved in the absence of a highly conserved primary repair pathway. Mutation accumulation experiments of M. smegmatis yielded a base-substitution mutation rate of 5.27 × 10−10 per site per generation, or 0.0036 per genome per generation, which is surprisingly similar to the mutation rate in MMR-functional unicellular organisms. Transitions were found more frequently than transversions, with the A:T→G:C transition rate significantly higher than the G:C→A:T transition rate, opposite to what is observed in most studied bacteria. We also found that the transition-mutation rate of M. smegmatis is significantly lower than that of other naturally MMR-devoid or MMR-knockout organisms. Two possible candidates that could be responsible for maintaining high DNA fidelity in this MMR-deficient organism are the ancestral-like DNA polymerase DnaE1, which contains a highly efficient DNA proofreading histidinol phosphatase (PHP) domain, and/or the existence of a uracil-DNA glycosylase B (UdgB) homolog that might protect the GC-rich M. smegmatis genome against DNA damage arising from oxidation or deamination. Our results suggest that M. smegmatis has a noncanonical Dam (DNA adenine methylase) methylation system, with target motifs differing from those previously reported. The mutation features of M. smegmatis provide further evidence that genomes harbor alternative routes for improving replication fidelity, even in the absence of major repair pathways. PMID:27194804

  4. APC mutations in colorectal tumors with mismatch repair deficiency.

    PubMed Central

    Huang, J; Papadopoulos, N; McKinley, A J; Farrington, S M; Curtis, L J; Wyllie, A H; Zheng, S; Willson, J K; Markowitz, S D; Morin, P; Kinzler, K W; Vogelstein, B; Dunlop, M G

    1996-01-01

    We have investigated the influence of genetic instability [replication error (RER) phenotype] on APC (adenomatous polyposis coli), a gene thought to initiate colorectal tumorigenesis. The prevalence of APC mutations was similar in RER and non-RER tumors, indicating that both tumor types share this step in neoplastic transformation. However, in a total of 101 sequenced mutations, we noted a substantial excess of APC frameshift mutations in the RER cases (70% in RER tumors versus 47% in non-RER tumors, P < 0.04). These frameshifts were characteristic of mutations arising in cells deficient in DNA mismatch repair, with a predilection for mononucleotide repeats in the RER tumors (P < 0.0002), particularly (A)n tracts (P < 0.00007). These findings suggest that the genetic instability that is reflected by the RER phenotype precedes, and is responsible for, APC mutation in RER large bowel tumors and have important implications for understanding the very earliest stages of neoplasia in patients with tumors deficient in mismatch repair. Images Fig. 2 PMID:8799152

  5. Criteria and prediction models for mismatch repair gene mutations: a review.

    PubMed

    Win, Aung Ko; Macinnis, Robert J; Dowty, James G; Jenkins, Mark A

    2013-12-01

    One of the strongest predictors of colorectal cancer risk is carrying a germline mutation in a DNA mismatch repair (MMR) gene. Once identified, mutation carriers can be recommended for intensive screening that will substantially reduce their high colorectal cancer risk. Conversely, the relatives of carriers identified as non-carriers can be relieved of the burden of intensive screening. Criteria and prediction models that identify likely mutation carriers are needed for cost-effective, targeted, germline testing for MMR gene mutation. We reviewed 12 criteria/guidelines and 8 prediction models (Leiden, Amsterdam-plus, Amsterdam-alternative, MMRpro, PREMM1,2,6, MMRpredict, Associazione Italiana per lo studio della Familiarità ed Ereditarietà dei tumori Gastrointestinali (AIFEG) and the Myriad Genetics Prevalence table) for identifying mutation carriers. While criteria are only used to identify individuals with colorectal cancer (yes/no for screening followed by germline testing), all prediction models except MMRpredict and Myriad tables can predict the probability of carrying mutations for individuals with or without colorectal cancer. We conducted a meta-analysis of the discrimination performance of 17 studies that validated the prediction models. The pooled estimate for the area under curve was 0.80 (95% CI 0.72 to 0.88) for MMRpro, 0.81 (95% CI 0.73 to 0.88) for MMRpredict, 0.84 (95% CI 0.81 to 0.88) for PREMM, and 0.85 (95% CI 0.78 to 0.91) for Leiden model. Given the high degree of overlap in the CIs, we cannot state that one model has a higher discrimination than any of the others. Overall, the existing statistical models have been shown to be sensitive and specific (at a 5% cut-off) in predicting MMR gene mutation carriers. Future models may need to: provide prediction of PMS2 mutations, take into account a wider range of Lynch syndrome-associated cancers when assessing family history, and be applicable to all people irrespective of any cancer diagnosis

  6. Mismatch repair gene defects contribute to the genetic basis of double primary cancers of the colorectum and endometrium.

    PubMed

    Millar, A L; Pal, T; Madlensky, L; Sherman, C; Temple, L; Mitri, A; Cheng, H; Marcus, V; Gallinger, S; Redston, M; Bapat, B; Narod, S

    1999-05-01

    Hereditary non-polyposis colorectal cancer (HNPCC) is a dominantly inherited cancer syndrome caused by germline defects of mismatch repair (MMR) genes. Endometrial cancer is the most common extracolonic neoplasm in HNPCC and is the primary clinical manifestation of the syndrome in some families. The cumulative incidence of endometrial cancer among HNPCC mutation carriers is high, estimated to be from 22 to 43%. We hypothesized that women with double primary cancers of the colorectum and endometrium are likely to be members of HNPCC families. In order to determine how frequently HNPCC manifests in the context of double primary cancers, we examined alterations of two MMR genes, hMSH2 and hMLH1, in 40 unrelated women affected with double primary cancers. These cases were identified using hospital-based and population-based cancer registries in Ontario, Canada. MMR gene mutations were screened by single-strand conformation polymorphism analysis and confirmed by direct sequencing. Eighteen percent (seven of 40) were found to harbor mutations of one of the two MMR genes. Analysis of colorectal and/or endometrial tumors of mutation-negative probands found microsatellite instability in seven of 20 cases. Six of seven mutation-positive probands had strong family histories suggestive of HNPCC. First degree relatives of mutation-positive probands had a very high relative risk (RR) of colorectal cancer (RR = 8.1, CI 3. 5-15.9) and endometrial cancer (RR = 23.8, CI 6.4-61.0). The relative risk of mutation-negative cases was 2.8 (CI 1.7-4.5) for colorectal cancer and 5.4 (CI 2.0-11.7) for endometrial cancer. We recommend that all double primary patients with cancers at these sites should have a genetic evaluation, including molecular analysis for HNPCC where appropriate. PMID:10196371

  7. Cadmium inhibits mismatch repair by blocking the ATPase activity of the MSH2–MSH6 complex

    PubMed Central

    Banerjee, Sreeparna; Flores-Rozas, Hernan

    2005-01-01

    Cadmium (Cd2+) is a known carcinogen that inactivates the DNA mismatch repair (MMR) pathway. In this study, we have tested the effect of Cd2+ exposure on the enzymatic activity of the mismatch binding complex MSH2–MSH6. Our results indicate that Cd2+ is highly inhibitory to the ATP binding and hydrolysis activities of MSH2–MSH6, and less inhibitory to its DNA mismatch binding activity. The inhibition of the ATPase activity appears to be dose and exposure time dependent. However, the inhibition of the ATPase activity by Cd2+ is prevented by cysteine and histidine, suggesting that these residues are essential for the ATPase activity and are targeted by Cd2+. A comparison of the mechanism of inhibition with N-ethyl maleimide, a sulfhydryl group inhibitor, indicates that this inhibition does not occur through direct inactivation of sulfhydryl groups. Zinc (Zn2+) does not overcome the direct inhibitory effect of Cd2+ on the MSH2–MSH6 ATPase activity in vitro. However, the increase in the mutator phenotype of yeast cells exposed to Cd2+ was prevented by excess Zn2+, probably by blocking the entry of Cd2+ into the cell. We conclude that the inhibition of MMR by Cd2+ is through the inactivation of the ATPase activity of the MSH2–MSH6 heterodimer, resulting in a dominant negative effect and causing a mutator phenotype. PMID:15746000

  8. Mismatch repair genes Mlh1 and Mlh3 modify CAG instability in Huntington's disease mice: genome-wide and candidate approaches.

    PubMed

    Pinto, Ricardo Mouro; Dragileva, Ella; Kirby, Andrew; Lloret, Alejandro; Lopez, Edith; St Claire, Jason; Panigrahi, Gagan B; Hou, Caixia; Holloway, Kim; Gillis, Tammy; Guide, Jolene R; Cohen, Paula E; Li, Guo-Min; Pearson, Christopher E; Daly, Mark J; Wheeler, Vanessa C

    2013-10-01

    The Huntington's disease gene (HTT) CAG repeat mutation undergoes somatic expansion that correlates with pathogenesis. Modifiers of somatic expansion may therefore provide routes for therapies targeting the underlying mutation, an approach that is likely applicable to other trinucleotide repeat diseases. Huntington's disease Hdh(Q111) mice exhibit higher levels of somatic HTT CAG expansion on a C57BL/6 genetic background (B6.Hdh(Q111) ) than on a 129 background (129.Hdh(Q111) ). Linkage mapping in (B6x129).Hdh(Q111) F2 intercross animals identified a single quantitative trait locus underlying the strain-specific difference in expansion in the striatum, implicating mismatch repair (MMR) gene Mlh1 as the most likely candidate modifier. Crossing B6.Hdh(Q111) mice onto an Mlh1 null background demonstrated that Mlh1 is essential for somatic CAG expansions and that it is an enhancer of nuclear huntingtin accumulation in striatal neurons. Hdh(Q111) somatic expansion was also abolished in mice deficient in the Mlh3 gene, implicating MutLγ (MLH1-MLH3) complex as a key driver of somatic expansion. Strikingly, Mlh1 and Mlh3 genes encoding MMR effector proteins were as critical to somatic expansion as Msh2 and Msh3 genes encoding DNA mismatch recognition complex MutSβ (MSH2-MSH3). The Mlh1 locus is highly polymorphic between B6 and 129 strains. While we were unable to detect any difference in base-base mismatch or short slipped-repeat repair activity between B6 and 129 MLH1 variants, repair efficiency was MLH1 dose-dependent. MLH1 mRNA and protein levels were significantly decreased in 129 mice compared to B6 mice, consistent with a dose-sensitive MLH1-dependent DNA repair mechanism underlying the somatic expansion difference between these strains. Together, these data identify Mlh1 and Mlh3 as novel critical genetic modifiers of HTT CAG instability, point to Mlh1 genetic variation as the likely source of the instability difference in B6 and 129 strains and suggest that MLH1

  9. Germline variants in POLE are associated with early onset mismatch repair deficient colorectal cancer

    PubMed Central

    Elsayed, Fadwa A; Kets, C Marleen; Ruano, Dina; van den Akker, Brendy; Mensenkamp, Arjen R; Schrumpf, Melanie; Nielsen, Maartje; Wijnen, Juul T; Tops, Carli M; Ligtenberg, Marjolijn J; Vasen, Hans FA; Hes, Frederik J; Morreau, Hans; van Wezel, Tom

    2015-01-01

    Germline variants affecting the exonuclease domains of POLE and POLD1 predispose to multiple colorectal adenomas and/or colorectal cancer (CRC). The aim of this study was to estimate the prevalence of previously described heterozygous germline variants POLE c.1270C>G, p.(Leu424Val) and POLD1 c.1433G>A, p.(Ser478Asn) in a Dutch series of unexplained familial, early onset CRC and polyposis index cases. We examined 1188 familial CRC and polyposis index patients for POLE p.(Leu424Val) and POLD1 p.(Ser478Asn) variants using competitive allele-specific PCR. In addition, protein expression of the POLE and DNA mismatch repair genes was studied by immunohistochemistry in tumours from POLE carriers. Somatic mutations were screened using semiconductor sequencing. We detected three index patients (0.25%) with a POLE p.(Leu424Val) variant. In one patient, the variant was found to be de-novo. Tumours from three patients from two families were microsatellite instable, and immunohistochemistry showed MSH6/MSH2 deficiency suggestive of Lynch syndrome. Somatic mutations but no germline MSH6 and MSH2 variants were subsequently found, and one tumour displayed a hypermutator phenotype. None of the 1188 patients carried the POLD1 p.(Ser478Asn) variant. POLE germline variant carriers are also associated with a microsatellite instable CRC. POLE DNA analysis now seems warranted in microsatellite instable CRC, especially in the absence of a causative DNA mismatch repair gene germline variant. PMID:25370038

  10. Single-nucleotide polymorphisms of the Trypanosoma cruzi MSH2 gene support the existence of three phylogenetic lineages presenting differences in mismatch-repair efficiency.

    PubMed Central

    Augusto-Pinto, Luiz; Teixeira, Santuza M R; Pena, Sérgio D J; Machado, Carlos Renato

    2003-01-01

    We have identified single-nucleotide polymorphisms (SNPs) in the mismatch-repair gene TcMSH2 from Trypanosoma cruzi. Phylogenetic inferences based on the SNPs, confirmed by RFLP analysis of 32 strains, showed three distinct haplogroups, denominated A, B, and C. Haplogroups A and C presented strong identity with the previously described T. cruzi lineages I and II, respectively. A third haplogroup (B) was composed of strains presenting hybrid characteristics. All strains from a haplogroup encoded the same specific protein isoform, called, respectively, TcMHS2a, TcMHS2b, and TcMHS2c. The classification into haplogroups A, B, and C correlated with variation in the efficiency of mismatch repair in these cells. When microsatellite loci of strains representative of each haplogroup were analyzed after being cultured in the presence of hydrogen peroxide, new microsatellite alleles were definitely seen in haplogroups B and C, while no evidence of microsatellite instability was found in haplogroup A. Also, cells from haplogroups B and C were considerably more resistant to cisplatin treatment, a characteristic known to be conferred by deficiency of mismatch repair in eukaryotic cells. Altogether, our data suggest that strains belonging to haplogroups B and C may have decreased mismatch-repair ability when compared with strains assigned to the haplogroup A lineage. PMID:12750325

  11. Nucleotide Excision Repair, Mismatch Repair, and R-Loops Modulate Convergent Transcription-Induced Cell Death and Repeat Instability

    PubMed Central

    Lin, Yunfu; Wilson, John H.

    2012-01-01

    Expansion of CAG•CTG tracts located in specific genes is responsible for 13 human neurodegenerative disorders, the pathogenic mechanisms of which are not yet well defined. These disease genes are ubiquitously expressed in human tissues, and transcription has been identified as one of the major pathways destabilizing the repeats. Transcription-induced repeat instability depends on transcription-coupled nucleotide excision repair (TC-NER), the mismatch repair (MMR) recognition component MSH2/MSH3, and RNA/DNA hybrids (R-loops). Recently, we reported that simultaneous sense and antisense transcription–convergent transcription–through a CAG repeat not only promotes repeat instability, but also induces a cell stress response, which arrests the cell cycle and eventually leads to massive cell death via apoptosis. Here, we use siRNA knockdowns to investigate whether NER, MMR, and R-loops also modulate convergent-transcription-induced cell death and repeat instability. We find that siRNA-mediated depletion of TC-NER components increases convergent transcription-induced cell death, as does the simultaneous depletion of RNase H1 and RNase H2A. In contrast, depletion of MSH2 decreases cell death. These results identify TC-NER, MMR recognition, and R-loops as modulators of convergent transcription-induced cell death and shed light on the molecular mechanism involved. We also find that the TC-NER pathway, MSH2, and R-loops modulate convergent transcription-induced repeat instability. These observations link the mechanisms of convergent transcription-induced repeat instability and convergent transcription-induced cell death, suggesting that a common structure may trigger both outcomes. PMID:23056461

  12. A Study of Molecular Signals Deregulating Mismatch Repair Genes in Prostate Cancer Compared to Benign Prostatic Hyperplasia

    PubMed Central

    Basu, Sanmitra; Majumder, Subhadipa; Bhowal, Ankur; Ghosh, Alip; Naskar, Sukla; Nandy, Sumit; Mukherjee, Subhabrata; Sinha, Rajan Kumar; Basu, Keya; Karmakar, Dilip; Banerjee, Soma; Sengupta, Sanghamitra

    2015-01-01

    Prostate cancer is one of the leading causes of mortality among aging males. There is an unmet requirement of clinically useful biomarkers for early detection of prostate cancer to reduce the liabilities of overtreatment and accompanying morbidity. The present population-based study investigates the factors disrupting expression of multiple functionally related genes of DNA mismatch repair pathway in prostate cancer patients to identify molecular attributes distinguishing adenocarcinoma from benign hyperplasia of prostate. Gene expression was compared between tissue samples from prostate cancer and benign prostatic hyperplasia using real-time-PCR, western blot and immunohistochemistry. Assessment of genotypes of seven single-nucleotide-polymorphisms of three MMR genes was conducted using PCR-coupled RFLP and sequencing. Promoter methylation was interrogated by methylation-specific-PCR and bisulfite-sequencing. Interaction between microRNAs and MMR genes was verified by 3'UTR-based dual luciferase assays. Concurrent reduction of three MMR genes namely hMLH1, hMSH6 and hMSH2 (34-85%, P<0.05) was observed in prostate cancer tissues. hMSH6 polymorphism rs1800932(Pro92Pro) conferred a borderline protection in cancer patients (OR = 0.33, 95% CI = 0.15-0.75). Relative transcript level of hMLH1 was inversely related (r = -0.59, P<0.05) with methylation quotient of its promoter which showed a significantly higher methylation density (P = 0.008, Z = -2.649) in cancer patients. hsa-miR-155, hsa-miR-141 and hsa-miR-21 gene expressions were significantly elevated (66-85%, P<0.05) in tumor specimens and negatively correlated (r = -0.602 to -0.527, P<0.05) with that of MMR genes. hsa-miR-155 & hsa-miR-141 and hsa-miR-155 & hsa-miR-21 were demonstrated to bind to their putative seed sequences in hMLH1 and hMSH6 3’UTRs respectively. Relatively higher expression of DNA methyl-transferases (DNMT1 and DNMT3b) and HIF-1α genes (34-50%, P<0.05) were also detected in tumor tissues

  13. A study of molecular signals deregulating mismatch repair genes in prostate cancer compared to benign prostatic hyperplasia.

    PubMed

    Basu, Sanmitra; Majumder, Subhadipa; Bhowal, Ankur; Ghosh, Alip; Naskar, Sukla; Nandy, Sumit; Mukherjee, Subhabrata; Sinha, Rajan Kumar; Basu, Keya; Karmakar, Dilip; Banerjee, Soma; Sengupta, Sanghamitra

    2015-01-01

    Prostate cancer is one of the leading causes of mortality among aging males. There is an unmet requirement of clinically useful biomarkers for early detection of prostate cancer to reduce the liabilities of overtreatment and accompanying morbidity. The present population-based study investigates the factors disrupting expression of multiple functionally related genes of DNA mismatch repair pathway in prostate cancer patients to identify molecular attributes distinguishing adenocarcinoma from benign hyperplasia of prostate. Gene expression was compared between tissue samples from prostate cancer and benign prostatic hyperplasia using real-time-PCR, western blot and immunohistochemistry. Assessment of genotypes of seven single-nucleotide-polymorphisms of three MMR genes was conducted using PCR-coupled RFLP and sequencing. Promoter methylation was interrogated by methylation-specific-PCR and bisulfite-sequencing. Interaction between microRNAs and MMR genes was verified by 3'UTR-based dual luciferase assays. Concurrent reduction of three MMR genes namely hMLH1, hMSH6 and hMSH2 (34-85%, P<0.05) was observed in prostate cancer tissues. hMSH6 polymorphism rs1800932(Pro92Pro) conferred a borderline protection in cancer patients (OR = 0.33, 95% CI = 0.15-0.75). Relative transcript level of hMLH1 was inversely related (r = -0.59, P<0.05) with methylation quotient of its promoter which showed a significantly higher methylation density (P = 0.008, Z = -2.649) in cancer patients. hsa-miR-155, hsa-miR-141 and hsa-miR-21 gene expressions were significantly elevated (66-85%, P<0.05) in tumor specimens and negatively correlated (r = -0.602 to -0.527, P<0.05) with that of MMR genes. hsa-miR-155 & hsa-miR-141 and hsa-miR-155 & hsa-miR-21 were demonstrated to bind to their putative seed sequences in hMLH1 and hMSH6 3'UTRs respectively. Relatively higher expression of DNA methyl-transferases (DNMT1 and DNMT3b) and HIF-1α genes (34-50%, P<0.05) were also detected in tumor tissues. This

  14. Evaluating the performance of clinical criteria for predicting mismatch repair gene mutations in Lynch syndrome: a comprehensive analysis of 3,671 families.

    PubMed

    Steinke, Verena; Holzapfel, Stefanie; Loeffler, Markus; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Pox, Christian; Royer-Pokora, Brigitte; von Knebel-Doeberitz, Magnus; Büttner, Reinhard; Propping, Peter; Engel, Christoph

    2014-07-01

    Carriers of mismatch repair (MMR) gene mutations have a high lifetime risk for colorectal and endometrial cancers, as well as other malignancies. As mutation analysis to detect these patients is expensive and time-consuming, clinical criteria and tumor-tissue analysis are widely used as pre-screening methods. The aim of our study was to evaluate the performance of commonly applied clinical criteria (the Amsterdam I and II Criteria, and the original and revised Bethesda Guidelines) and the results of tumor-tissue analysis in predicting MMR gene mutations. We analyzed 3,671 families from the German HNPCC Registry and divided them into nine mutually exclusive groups with different clinical criteria. A total of 680 families (18.5%) were found to have a pathogenic MMR gene mutation. Among all 1,284 families with microsatellite instability-high (MSI-H) colorectal cancer, the overall mutation detection rate was 53.0%. Mutation frequencies and their distribution between the four MMR genes differed significantly between clinical groups (p < 0.001). The highest frequencies were found in families fulfilling the Amsterdam Criteria (46.4%). Families with loss of MSH2 expression had higher mutation detection rates (69.5%) than families with loss of MLH1 expression (43.1%). MMR mutations were found significantly more often in families with at least one MSI-H small-bowel cancer (p < 0.001). No MMR mutations were found among patients under 40-years-old with only colorectal adenoma. Familial clustering of Lynch syndrome-related tumors, early age of onset, and familial occurrence of small-bowel cancer were clinically relevant predictors for Lynch syndrome. PMID:24493211

  15. MutL-catalyzed ATP hydrolysis is required at a post-UvrD loading step in methyl-directed mismatch repair.

    PubMed

    Robertson, Adam B; Pattishall, Steven R; Gibbons, Erin A; Matson, Steven W

    2006-07-21

    Methyl-directed mismatch repair is a coordinated process that ensures replication fidelity and genome integrity by resolving base pair mismatches and insertion/deletion loops. This post-replicative event involves the activities of several proteins, many of which appear to be regulated by MutL. MutL interacts with and modulates the activities of MutS, MutH, UvrD, and perhaps other proteins. The purified protein catalyzes a slow ATP hydrolysis reaction that is essential for its role in mismatch repair. However, the role of the ATP hydrolysis reaction is not understood. We have begun to address this issue using two point mutants: MutL-E29A, which binds nucleotide but does not catalyze ATP hydrolysis, and MutL-D58A, which does not bind nucleotide. As expected, both mutants failed to complement the loss of MutL in genetic assays. Purified MutL-E29A protein interacted with MutS and stimulated the MutH-catalyzed nicking reaction in a mismatch-dependent manner. Importantly, MutL-E29A stimulated the loading of UvrD on model substrates. In fact, stimulation of UvrD-catalyzed unwinding was more robust with MutL-E29A than the wild-type protein. MutL-D58A, on the other hand, did not interact with MutS, stimulate MutH-catalyzed nicking, or stimulate the loading of UvrD. We conclude that ATP-bound MutL is required for the incision steps associated with mismatch repair and that ATP hydrolysis by MutL is required for a step in the mismatch repair pathway subsequent to the loading of UvrD and may serve to regulate helicase loading. PMID:16690604

  16. Frequent mutations of the CA simple sequence repeat in intron 1 of EGFR in mismatch repair-deficient colorectal cancers

    PubMed Central

    Buisine, Marie-Pierre; Wacrenier, Agnès; Mariette, Christophe; Leteurtre, Emmanuelle; Escande, Fabienne; Aissi, Sana; Ketele, Amandine; Leclercq, Annette; Porchet, Nicole; Lesuffleur, Thécla

    2008-01-01

    AIM: To investigate the polymorphic simple sequence repeat in intron 1 of the epidermal growth factor receptor gene (EGFR) (CA-SSRI), which is known to affect the efficiency of gene transcription as a putative target of the mismatch repair (MMR) machinery in colorectal tumors. METHODS: The CA-SSR I genotype was analyzed in a total of 86 primary colorectal tumors, selected upon their microsatellite instability (MSI) status [42 with high frequency MSI (MSI-H) and 44 microsatellite stable (MSS)] and their respective normal tissue. The effect of the CA-SSR I genotype on the expression of the EGFR gene was evaluated in 18 specimens using quantitative real-time reverse transcription PCR and immunohistochemistry. RESULTS: Mutations in CA-SSR I were detected in 86% (36 of 42) of MSI-H colorectal tumors and 0% (0 of 44) of MSS tumors, indicating the EGFR gene as a novel putative specific target of the defective MMR system (P < 0.001). Impaired expression of EGFR was detected in most of the colorectal tumors analyzed [6/12 (50%) at the mRNA level and 15/18 (83%) at the peptide level]. However, no association was apparent between EGFR expression and CA-SSR I status in tumors or normal tissues. CONCLUSION: Our results suggest that CA-SSRI sequence does not contribute to the regulation of EGFR transcription in colon, and should thus not be considered as a promising predictive marker for response to EGFR inhibitors in patients with colorectal cancer. PMID:18286687

  17. DNA tandem repeat instability in the Escherichia coli chromosome is stimulated by mismatch repair at an adjacent CAG·CTG trinucleotide repeat.

    PubMed

    Blackwood, John K; Okely, Ewa A; Zahra, Rabaab; Eykelenboom, John K; Leach, David R F

    2010-12-28

    Approximately half the human genome is composed of repetitive DNA sequences classified into microsatellites, minisatellites, tandem repeats, and dispersed repeats. These repetitive sequences have coevolved within the genome but little is known about their potential interactions. Trinucleotide repeats (TNRs) are a subclass of microsatellites that are implicated in human disease. Expansion of CAG·CTG TNRs is responsible for Huntington disease, myotonic dystrophy, and a number of spinocerebellar ataxias. In yeast DNA double-strand break (DSB) formation has been proposed to be associated with instability and chromosome fragility at these sites and replication fork reversal (RFR) to be involved either in promoting or in preventing instability. However, the molecular basis for chromosome fragility of repetitive DNA remains poorly understood. Here we show that a CAG·CTG TNR array stimulates instability at a 275-bp tandem repeat located 6.3 kb away on the Escherichia coli chromosome. Remarkably, this stimulation is independent of both DNA double-strand break repair (DSBR) and RFR but is dependent on a functional mismatch repair (MMR) system. Our results provide a demonstration, in a simple model system, that MMR at one type of repetitive DNA has the potential to influence the stability of another. Furthermore, the mechanism of this stimulation places a limit on the universality of DSBR or RFR models of instability and chromosome fragility at CAG·CTG TNR sequences. Instead, our data suggest that explanations of chromosome fragility should encompass the possibility of chromosome gaps formed during MMR. PMID:21149728

  18. DNA tandem repeat instability in the Escherichia coli chromosome is stimulated by mismatch repair at an adjacent CAG·CTG trinucleotide repeat

    PubMed Central

    Blackwood, John K.; Okely, Ewa A.; Zahra, Rabaab; Eykelenboom, John K.; Leach, David R. F.

    2010-01-01

    Approximately half the human genome is composed of repetitive DNA sequences classified into microsatellites, minisatellites, tandem repeats, and dispersed repeats. These repetitive sequences have coevolved within the genome but little is known about their potential interactions. Trinucleotide repeats (TNRs) are a subclass of microsatellites that are implicated in human disease. Expansion of CAG·CTG TNRs is responsible for Huntington disease, myotonic dystrophy, and a number of spinocerebellar ataxias. In yeast DNA double-strand break (DSB) formation has been proposed to be associated with instability and chromosome fragility at these sites and replication fork reversal (RFR) to be involved either in promoting or in preventing instability. However, the molecular basis for chromosome fragility of repetitive DNA remains poorly understood. Here we show that a CAG·CTG TNR array stimulates instability at a 275-bp tandem repeat located 6.3 kb away on the Escherichia coli chromosome. Remarkably, this stimulation is independent of both DNA double-strand break repair (DSBR) and RFR but is dependent on a functional mismatch repair (MMR) system. Our results provide a demonstration, in a simple model system, that MMR at one type of repetitive DNA has the potential to influence the stability of another. Furthermore, the mechanism of this stimulation places a limit on the universality of DSBR or RFR models of instability and chromosome fragility at CAG·CTG TNR sequences. Instead, our data suggest that explanations of chromosome fragility should encompass the possibility of chromosome gaps formed during MMR. PMID:21149728

  19. Differential nonsense mediated decay of mutated mRNAs in mismatch repair deficient colorectal cancers.

    PubMed

    El-Bchiri, Jamila; Buhard, Olivier; Penard-Lacronique, Virginie; Thomas, Gilles; Hamelin, Richard; Duval, Alex

    2005-08-15

    The nonsense-mediated decay (NMD) system normally targets mRNAs with premature termination codons (PTCs) for rapid degradation. We investigated for a putative role of NMD in cancers with microsatellite instability (MSI-H cancers), because numerous mutant mRNAs containing PTC are generated in these tumors as a consequence of their mismatch repair deficiency. Using a quantitative RT-PCR approach in a large series of colorectal cancer cell lines, we demonstrate a significantly increased rate of degradation of mutant mRNAs containing a PTC compared with wild-type. A specific siRNA strategy was used to inhibit RENT-1 and/or RENT-2 activity, two major genes in the NMD system. This allowed us to show that increased degradation of PTC-containing mRNAs in MSI-H tumors was partly dependent upon NMD activity. The efficiency of NMD for the degradation of mutant mRNAs from target genes was highly variable in these cancers. NMD degraded some of them (TGFssRII, MSH3, GRK4), although allowing the persistent expression of others (BAX, TCF-4). This is of particular interest within the context of a proposed conservation of biological activity for the corresponding mutated proteins. We thus propose that NMD might play an important role in the selection of target gene mutations with a functional role in MSI-H carcinogenesis. PMID:16000315

  20. Mismatch repair inhibits homeologous recombination via coordinated directional unwinding of trapped DNA structures.

    PubMed

    Tham, Khek-Chian; Hermans, Nicolaas; Winterwerp, Herrie H K; Cox, Michael M; Wyman, Claire; Kanaar, Roland; Lebbink, Joyce H G

    2013-08-01

    Homeologous recombination between divergent DNA sequences is inhibited by DNA mismatch repair. In Escherichia coli, MutS and MutL respond to DNA mismatches within recombination intermediates and prevent strand exchange via an unknown mechanism. Here, using purified proteins and DNA substrates, we find that in addition to mismatches within the heteroduplex region, secondary structures within the displaced single-stranded DNA formed during branch migration within the recombination intermediate are involved in the inhibition. We present a model that explains how higher-order complex formation of MutS, MutL, and DNA blocks branch migration by preventing rotation of the DNA strands within the recombination intermediate. Furthermore, we find that the helicase UvrD is recruited to directionally resolve these trapped intermediates toward DNA substrates. Thus, our results explain on a mechanistic level how the coordinated action between MutS, MutL, and UvrD prevents homeologous recombination and maintains genome stability. PMID:23932715

  1. Mutation rates, spectra, and genome-wide distribution of spontaneous mutations in mismatch repair deficient yeast.

    PubMed

    Lang, Gregory I; Parsons, Lance; Gammie, Alison E

    2013-09-01

    DNA mismatch repair is a highly conserved DNA repair pathway. In humans, germline mutations in hMSH2 or hMLH1, key components of mismatch repair, have been associated with Lynch syndrome, a leading cause of inherited cancer mortality. Current estimates of the mutation rate and the mutational spectra in mismatch repair defective cells are primarily limited to a small number of individual reporter loci. Here we use the yeast Saccharomyces cerevisiae to generate a genome-wide view of the rates, spectra, and distribution of mutation in the absence of mismatch repair. We performed mutation accumulation assays and next generation sequencing on 19 strains, including 16 msh2 missense variants implicated in Lynch cancer syndrome. The mutation rate for DNA mismatch repair null strains was approximately 1 mutation per genome per generation, 225-fold greater than the wild-type rate. The mutations were distributed randomly throughout the genome, independent of replication timing. The mutation spectra included insertions/deletions at homopolymeric runs (87.7%) and at larger microsatellites (5.9%), as well as transitions (4.5%) and transversions (1.9%). Additionally, repeat regions with proximal repeats are more likely to be mutated. A bias toward deletions at homopolymers and insertions at (AT)n microsatellites suggests a different mechanism for mismatch generation at these sites. Interestingly, 5% of the single base pair substitutions might represent double-slippage events that occurred at the junction of immediately adjacent repeats, resulting in a shift in the repeat boundary. These data suggest a closer scrutiny of tumor suppressors with homopolymeric runs with proximal repeats as the potential drivers of oncogenesis in mismatch repair defective cells. PMID:23821616

  2. Saturation of DNA mismatch repair and error catastrophe by a base analogue in Escherichia coli.

    PubMed Central

    Negishi, Kazuo; Loakes, David; Schaaper, Roel M

    2002-01-01

    Deoxyribosyl-dihydropyrimido[4,5-c][1,2]oxazin-7-one (dP) is a potent mutagenic deoxycytidine-derived base analogue capable of pairing with both A and G, thereby causing G. C --> A. T and A. T --> G. C transition mutations. We have found that the Escherichia coli DNA mismatch-repair system can protect cells against this mutagenic action. At a low dose, dP is much more mutagenic in mismatch-repair-defective mutH, mutL, and mutS strains than in a wild-type strain. At higher doses, the difference between the wild-type and the mutator strains becomes small, indicative of saturation of mismatch repair. Introduction of a plasmid containing the E. coli mutL(+) gene significantly reduces dP-induced mutagenesis. Together, the results indicate that the mismatch-repair system can remove dP-induced replication errors, but that its capacity to remove dP-containing mismatches can readily be saturated. When cells are cultured at high dP concentration, mutant frequencies reach exceptionally high levels and viable cell counts are reduced. The observations are consistent with a hypothesis in which dP-induced cell killing and growth impairment result from excess mutations (error catastrophe), as previously observed spontaneously in proofreading-deficient mutD (dnaQ) strains. PMID:12196386

  3. Mutations in Haemophilus influenzae mismatch repair genes increase mutation rates of dinucleotide repeat tracts but not dinucleotide repeat-driven pilin phase variation rates.

    PubMed

    Bayliss, Christopher D; Sweetman, Wendy A; Moxon, E Richard

    2004-05-01

    High-frequency, reversible switches in expression of surface antigens, referred to as phase variation (PV), are characteristic of Haemophilus influenzae. PV enables this bacterial species, an obligate commensal and pathogen of the human upper respiratory tract, to adapt to changes in the host environment. Phase-variable hemagglutinating pili are expressed by many H. influenzae isolates. PV involves alterations in the number of 5' TA repeats located between the -10 and -35 promoter elements of the overlapping, divergently orientated promoters of hifA and hifBCDE, whose products mediate biosynthesis and assembly of pili. Dinucleotide repeat tracts are destabilized by mismatch repair (MMR) mutations in Escherichia coli. The influence of mutations in MMR genes of H. influenzae strain Rd on dinucleotide repeat-mediated PV rates was investigated by using reporter constructs containing 20 5' AT repeats. Mutations in mutS, mutL, and mutH elevated rates approximately 30-fold, while rates in dam and uvrD mutants were increased 14- and 3-fold, respectively. PV rates of constructs containing 10 to 12 5' AT repeats were significantly elevated in mutS mutants of H. influenzae strains Rd and Eagan. An intact hif locus was found in 14 and 12% of representative nontypeable H. influenzae isolates associated with either otitis media or carriage, respectively. Nine or more tandem 5' TA repeats were present in the promoter region. Surprisingly, inactivation of mutS in two serotype b H. influenzae strains did not alter pilin PV rates. Thus, although functionally analogous to the E. coli MMR pathway and active on dinucleotide repeat tracts, defects in H. influenzae MMR do not affect 5' TA-mediated pilin PV. PMID:15126452

  4. The mismatch repair system (mutS, mutL and uvrD genes) in Pseudomonas aeruginosa: molecular characterization of naturally occurring mutants.

    PubMed

    Oliver, Antonio; Baquero, Fernando; Blázquez, Jesús

    2002-03-01

    We have recently described the presence of a high proportion of Pseudomonas aeruginosa isolates (20%) with an increased mutation frequency (mutators) in the lungs of cystic fibrosis (CF) patients. In four out of 11 independent P. aeruginosa strains, the high mutation frequency was found to be complemented with the wild-type mutS gene from P. aeruginosa PAO1. Here, we report the cloning and sequencing of two additional P. aeruginosa mismatch repair genes and the characterization, by complementation of deficient strains, of these two putative P. aeruginosa mismatch repair genes (mutL and uvrD). We also describe the alterations in the mutS, mutL and uvrD genes responsible for the mutator phenotype of hypermutable P. aeruginosa strains isolated from CF patients. Seven out of the 11 mutator strains were found to be defective in the MMR system (four mutS, two mutL and one uvrD). In four cases (three mutS and one mutL), the genes contained frameshift mutations. The fourth mutS strain showed a 3.3 kb insertion after the 10th nucleotide of the mutS gene, and a 54 nucleotide deletion between two eight nucleotide direct repeats. This deletion, involving domain II of MutS, was found to be the main one responsible for mutS inactivation. The second mutL strain presented a K310M mutation, equivalent to K307 in Escherichia coli MutL, a residue known to be essential for its ATPase activity. Finally, the uvrD strain had three amino acid substitutions within the conserved ATP binding site of the deduced UvrD polypeptide, showing defective mismatch repair activity. Interestingly, cells carrying this mutant allele exhibited a fully active UvrABC-mediated excision repair. The results shown here indicate that the putative P. aeruginosa mutS, mutL and uvrD genes are mutator genes and that their alteration results in a mutator phenotype. PMID:11952911

  5. Heterogeneous polymerase fidelity and mismatch repair bias genome variation and composition

    PubMed Central

    Lujan, Scott A.; Clausen, Anders R.; Clark, Alan B.; MacAlpine, Heather K.; MacAlpine, David M.; Malc, Ewa P.; Mieczkowski, Piotr A.; Burkholder, Adam B.; Fargo, David C.; Gordenin, Dmitry A.

    2014-01-01

    Mutational heterogeneity must be taken into account when reconstructing evolutionary histories, calibrating molecular clocks, and predicting links between genes and disease. Selective pressures and various DNA transactions have been invoked to explain the heterogeneous distribution of genetic variation between species, within populations, and in tissue-specific tumors. To examine relationships between such heterogeneity and variations in leading- and lagging-strand replication fidelity and mismatch repair, we accumulated 40,000 spontaneous mutations in eight diploid yeast strains in the absence of selective pressure. We found that replicase error rates vary by fork direction, coding state, nucleosome proximity, and sequence context. Further, error rates and DNA mismatch repair efficiency both vary by mismatch type, responsible polymerase, replication time, and replication origin proximity. Mutation patterns implicate replication infidelity as one driver of variation in somatic and germline evolution, suggest mechanisms of mutual modulation of genome stability and composition, and predict future observations in specific cancers. PMID:25217194

  6. Body mass index in early adulthood and colorectal cancer risk for carriers and non-carriers of germline mutations in DNA mismatch repair genes

    PubMed Central

    Win, A K; Dowty, J G; English, D R; Campbell, P T; Young, J P; Winship, I; Macrae, F A; Lipton, L; Parry, S; Young, G P; Buchanan, D D; Martínez, M E; Jacobs, E T; Ahnen, D J; Haile, R W; Casey, G; Baron, J A; Lindor, N M; Thibodeau, S N; Newcomb, P A; Potter, J D; Le Marchand, L; Gallinger, S; Hopper, J L; Jenkins, M A

    2011-01-01

    Background: Carriers of germline mutations in DNA mismatch repair (MMR) genes have a high risk of colorectal cancer (CRC), but the modifiers of this risk are not well established. We estimated an association between body mass index (BMI) in early adulthood and subsequent risk of CRC for carriers and, as a comparison, estimated the association for non-carriers. Methods: A weighted Cox regression was used to analyse height and weight at 20 years reported by 1324 carriers of MMR gene mutations (500 MLH1, 648 MSH2, 117 MSH6 and 59 PMS2) and 1219 non-carriers from the Colon Cancer Family Registry. Results: During 122 304 person-years of observation, we observed diagnoses of CRC for 659 carriers (50%) and 36 non-carriers (3%). For carriers, the risk of CRC increased by 30% for each 5 kg m–2 increment in BMI in early adulthood (hazard ratio, HR: 1.30; 95% confidence interval, CI: 1.08–1.58; P=0.01), and increased by 64% for non-carriers (HR: 1.64; 95% CI: 1.02–2.64; P=0.04) after adjusting for sex, country, cigarette smoking and alcohol drinking (and the MMR gene that was mutated in carriers). The difference in HRs for carriers and non-carriers was not statistically significant (P=0.50). For MLH1 and PMS2 (MutLα heterodimer) mutation carriers combined, the corresponding increase was 36% (HR: 1.36; 95% CI: 1.05–1.76; P=0.02). For MSH2 and MSH6 (MutSα heterodimer) mutation carriers combined, the HR was 1.26 (95% CI: 0.96–1.65; P=0.09). There was no significant difference between the HRs for MutLα and MutSα heterodimer carriers (P=0.56). Conclusion: Body mass index in early adulthood is positively associated with risk of CRC for MMR gene mutation carriers and non-carriers. PMID:21559014

  7. The Prevention of Repeat-Associated Deletions in Saccharomyces Cerevisiae by Mismatch Repair Depends on Size and Origin of Deletions

    PubMed Central

    Tran, H. T.; Gordenin, D. A.; Resnick, M. A.

    1996-01-01

    We have investigated the effects of mismatch repair on 1- to 61-bp deletions in the yeast Saccharomyces cerevisiae. The deletions are likely to involve unpaired loop intermediates resulting from DNA polymerase slippage. The mutator effects of mutations in the DNA polymerase δ (POL3) gene and the recombinational repair RAD52 gene were studied in combination with mismatch repair defects. The pol3-t mutation increased up to 1000-fold the rate of extended (7-61 bp) but not of 1-bp deletions. In a rad52 null mutant only the 1-bp deletions were increased (12-fold). The mismatch repair mutations pms1, msh2 and msh3 did not affect 31- and 61-bp deletions in the pol3-t but increased the rates of 7- and 1-bp deletions. We propose that loops less than or equal to seven bases generated during replication are subject to mismatch repair by the PMS1, MSH2, MSH3 system and that it cannot act on loops >=31 bases. In contrast to the pol3-t, the enhancement of 1-bp deletions in a rad52 mutant is not altered by a pms1 mutation. Thus, mismatch repair appears to be specific to errors of DNA synthesis generated during semiconservative replication. PMID:8844147

  8. Acute lymphoblastic leukemia and lymphoma in the context of constitutional mismatch repair deficiency syndrome.

    PubMed

    Ripperger, Tim; Schlegelberger, Brigitte

    2016-03-01

    Constitutional mismatch repair deficiency (CMMRD) syndrome is one of the rare diseases associated with a high risk of cancer. Causative mutations are found in DNA mismatch repair genes PMS2, MSH6, MSH2 or MLH1 that are well known in the context of Lynch syndrome. CMMRD follows an autosomal recessive inheritance trait and is characterized by childhood brain tumors and hematological malignancies as well as gastrointestinal cancer in the second and third decades of life. There is a high risk of multiple cancers, occurring synchronously and metachronously. In general, the prognosis is poor. About one third of CMMRD patients develop hematological malignancies as primary (sometimes the only) malignancy or as secondary neoplasm. T-cell non-Hodgkin lymphomas, mainly of mediastinal origin, are the most frequent hematological malignancies. Besides malignant diseases, non-neoplastic features are frequently observed, e.g. café-au-lait spots sometimes resembling neurofibromatosis type I, hypopigmented skin lesions, numerous adenomatous polyps, multiple pilomatricomas, or impaired immunoglobulin class switch recombination. Within the present review, we summarize previously published CMMRD patients with at least one hematological malignancy, provide an overview of steps necessary to substantiate the diagnosis of CMMRD, and refer to the recent most relevant literature. PMID:26743104

  9. Mismatch Repair in Schizosaccharomyces Pombe Requires the Mutl Homologous Gene Pms1: Molecular Cloning and Functional Analysis

    PubMed Central

    Schar, P.; Baur, M.; Schneider, C.; Kohli, J.

    1997-01-01

    Homologues of the bacterial mutS and mutL genes involved in DNA mismatch repair have been found in organisms from bacteria to humans. Here, we describe the structure and function of a newly identified Schizosaccharomyces pombe gene that encodes a predicted amino acid sequence of 794 residues with a high degree of homology to MutL related proteins. On the basis of its closer relationship to the eukaryotic ``PMS'' genes than to the ``MLH'' genes, we have designated the S. pombe homologue pms1. Disruption of the pms1 gene causes a significant increase of spontaneous mutagenesis as documented by reversion rate measurements. Tetrad analyses of crosses homozygous for the pms1 mutation reveal a reduction of spore viability from >92% to 80% associated with a low proportion (~50%) of meioses producing four viable spores and a significant, allele-dependent increase of the level of post-meiotic segregation of genetic marker allele pairs. The mutant phenotypes are consistent with a general function of pms1 in correction of mismatched base pairs arising as a consequence of DNA polymerase errors during DNA synthesis, or of hybrid DNA formation between homologous but not perfectly complementary DNA strands during meiotic recombination. PMID:9258673

  10. LYMPH NODE YIELD AFTER COLECTOMY FOR CANCER: IS ABSENCE OF MMR A FACTOR?

    PubMed Central

    Samdani, Tushar; Schultheis, Molly; Stadler, Zsofia; Shia, Jinru; Fancher, Tiffany; Misholy, Justine; Weiser, Martin R.; Nash, Garrett M.

    2015-01-01

    immunohistochemistry based on patient age, family history, pathologic features may reduce the generalizability of these results. Our sample size is too small to identify variables with small measures of effect. The study’s retrospective nature did not permit true assessment of extent of mesenteric resection. Conclusions Patient age, length of bowel resected, lymph node ratio, perineural invasion, tumor size, tumor location were significant predictors of lymph node yield. However, when controlling for surgical and pathological factors, mismatch-repair protein expression did not predict lymph node yield. PMID:25664706

  11. Measles, Mumps, Rubella (MMR)

    MedlinePlus

    ... Pediatrics (AAP): Patient handout Measles - Fact Sheet for Parents Centers for Disease Control and Prevention (CDC) Measles and the Vaccine (Shot) ... of Pediatrics (AAP): Measles information in Spanish for parents Understanding MMR Vaccine Safety Centers for Disease Control and Prevention ... Supporting Organizations ...

  12. Synchronous glioblastoma and medulloblastoma in a child with mismatch repair mutation.

    PubMed

    Amayiri, Nisreen; Al-Hussaini, Maysa; Swaidan, Maisa; Jaradat, Imad; Qandeel, Monther; Tabori, Uri; Hawkins, Cynthia; Musharbash, Awni; Alsaad, Khulood; Bouffet, Eric

    2016-03-01

    Synchronous primary malignant brain tumors are rare. We present a 5-year-old boy with synchronous glioblastoma and medulloblastoma. Both tumor samples had positive p53 stain and loss of PMS2 and MLH1 stains. The child had multiple café au lait spots and a significant family history of cancer. After subtotal resection of both tumors, he received craniospinal radiation with concomitant temozolomide followed by chemotherapy, alternating cycles of cisplatin/lomustine/vincristine with temozolomide. Then, he started maintenance treatment with cis-retinoic acid (100 mg/m(2)/day for 21 days). He remained asymptomatic for 34 months despite a follow-up brain MRI consistent with glioblastoma relapse 9 months before his death. Cis-retinoic acid may have contributed to prolong survival in this child with a probable biallelic mismatch repair syndrome. PMID:26293676

  13. A unique horizontal gene transfer event has provided the octocoral mitochondrial genome with an active mismatch repair gene that has potential for an unusual self-contained function

    PubMed Central

    2011-01-01

    Background The mitochondrial genome of the Octocorallia has several characteristics atypical for metazoans, including a novel gene suggested to function in DNA repair. This mtMutS gene is favored for octocoral molecular systematics, due to its high information content. Several hypotheses concerning the origins of mtMutS have been proposed, and remain equivocal, although current weight of support is for a horizontal gene transfer from either an epsilonproteobacterium or a large DNA virus. Here we present new and compelling evidence on the evolutionary origin of mtMutS, and provide the very first data on its activity, functional capacity and stability within the octocoral mitochondrial genome. Results The mtMutS gene has the expected conserved amino acids, protein domains and predicted tertiary protein structure. Phylogenetic analysis indicates that mtMutS is not a member of the MSH family and therefore not of eukaryotic origin. MtMutS clusters closely with representatives of the MutS7 lineage; further support for this relationship derives from the sharing of a C-terminal endonuclease domain that confers a self-contained mismatch repair function. Gene expression analyses confirm that mtMutS is actively transcribed in octocorals. Rates of mitochondrial gene evolution in mtMutS-containing octocorals are lower than in their hexacoral sister-group, which lacks the gene, although paradoxically the mtMutS gene itself has higher rates of mutation than other octocoral mitochondrial genes. Conclusions The octocoral mtMutS gene is active and codes for a protein with all the necessary components for DNA mismatch repair. A lower rate of mitochondrial evolution, and the presence of a nicking endonuclease domain, both indirectly support a theory of self-sufficient DNA mismatch repair within the octocoral mitochondrion. The ancestral affinity of mtMutS to non-eukaryotic MutS7 provides compelling support for an origin by horizontal gene transfer. The immediate vector of transmission

  14. Insights into protein -- DNA interactions, stability and allosteric communications: A computational study of MutS-DNA recognition complexes

    NASA Astrophysics Data System (ADS)

    Negureanu, Lacramioara; Salsbury, Freddie

    2012-02-01

    DNA mismatch repair proteins (MMR) maintain genetic stability by recognizing and repairing mismatched bases and insertion/deletion loops mistakenly incorporated during DNA replication, and initiate cellular response to certain types of DNA damage. The most abundant MMR mismatch-binding factor in eukaryotes, MutS, recognizes and initiates the repair of base-base mismatches and small insertion/deletions. We performed molecular dynamics simulations on mismatched and damaged MutS-DNA complexes. A comprehensive DNA binding site analysis of relevant conformations shows that MutS proteins recognize the mismatched and platinum cross-linked DNA substrates in significantly different modes. Distinctive conformational changes associated with MutS binding to mismatched and damaged DNA have been identified and they provide insight into the involvement of MMR proteins in DNA-repair and DNA-damage pathways. Stability and allosteric interactions at the heterodimer interface associated with the mismatch and damage recognition step allow for prediction of key residues in MMR cancer-causing mutations. A rigorous hydrogen bonding analysis for ADP molecules at the ATPase binding sites is also presented. A large number of known MMR cancer causing mutations among the residues were found.

  15. MSH-2 and MLH-1 Protein Expression in Muir Torre Syndrome-Related and Sporadic Sebaceous Neoplasms

    PubMed Central

    Morales-Burgos, Adisbeth; Sánchez, Jorge L.; Figueroa, Luz D.; De Jesús-Monge, Wilfredo E.; Cruz-Correa, Marcia R.; González-Keelan, Carmen; Nazario, Cruz María

    2009-01-01

    Background Muir-Torre Syndrome (MTS) is a rare autosomal-dominant disorder characterized by the predisposition to both sebaceous neoplasm and internal malignancies. MTS-associated sebaceous neoplasms reveal mutations in DNA mismatch repair (MMR) genes and microsatellite instability. A significant part of MTS patients represents a phenotypic variant, the hereditary nonpolyposis colorectal cancer (HNPCC). A strong correlation between microsatellite instability and immunostaining has been demonstrated. The early recognition of sebaceous neoplasm as part of MTS, and their differentiation from sporadic sebaceous neoplasm may have an important application in a clinical setting. The absence of MLH-1 or MSH-2 expression by immunostaining identifies tumors with mismatch repair deficiency. Objectives Our aim is to determine whether an immunohistochemical approach, targeting DNA repair proteins MSH-2 and MLH-1 in MTS-related sebaceous neoplasm and their sporadic counterparts, can be used for their identification. Methods We examined 15 sebaceous neoplasms (including 6 internal malignancy- associated sebaceous neoplasms and 8 sporadic sebaceous neoplasms) from 11 patients for the expression of MSH-2 and MLH-1 by immunohistochemistry. Results Four of 5 internal malignancy-associated sebaceous neoplasms showed loss of expression of MSH-2 or MLH-1. Correlation of the immunostaining pattern of the sebaceous neoplasms and the patients’ positive history of colon carcinoma was 80%. Seven of 8 sporadic sebaceous neoplasms showed a positive expression of MSH-2 and MLH-1. The prevalence for loss of expression of MMR proteins in sebaceous neoplasms was 38.5%. MMR immunostaining had 87.5% specificity and 80% sensitivity. Limitations This study is limited by a small sample size, and by bias selection due to the use of non nationwide data-base as the resource of cases. Conclusions Our findings demonstrate that immunohistochemical testing for internal malignancy-associated sebaceous

  16. Rapid Identification of Chemoresistance Mechanisms Using Yeast DNA Mismatch Repair Mutants.

    PubMed

    Ojini, Irene; Gammie, Alison

    2015-09-01

    Resistance to cancer therapy is a major obstacle in the long-term treatment of cancer. A greater understanding of drug resistance mechanisms will ultimately lead to the development of effective therapeutic strategies to prevent resistance from occurring. Here, we exploit the mutator phenotype of mismatch repair defective yeast cells combined with whole genome sequencing to identify drug resistance mutations in key pathways involved in the development of chemoresistance. The utility of this approach was demonstrated via the identification of the known CAN1 and TOP1 resistance targets for two compounds, canavanine and camptothecin, respectively. We have also experimentally validated the plasma membrane transporter HNM1 as the primary drug resistance target of mechlorethamine. Furthermore, the sequencing of mitoxantrone-resistant strains identified inactivating mutations within IPT1, a gene encoding inositolphosphotransferase, an enzyme involved in sphingolipid biosynthesis. In the case of bactobolin, a promising anticancer drug, the endocytosis pathway was identified as the drug resistance target responsible for conferring resistance. Finally, we show that that rapamycin, an mTOR inhibitor previously shown to alter the fitness of the ipt1 mutant, can effectively prevent the formation of mitoxantrone resistance. The rapid and robust nature of these techniques, using Saccharomyces cerevisiae as a model organism, should accelerate the identification of drug resistance targets and guide the development of novel therapeutic combination strategies to prevent the development of chemoresistance in various cancers. PMID:26199284

  17. DNA mismatch repair gene MSH6 implicated in determining age at natural menopause

    PubMed Central

    Perry, John R.B.; Hsu, Yi-Hsiang; Chasman, Daniel I.; Johnson, Andrew D.; Elks, Cathy; Albrecht, Eva; Andrulis, Irene L.; Beesley, Jonathan; Berenson, Gerald S.; Bergmann, Sven; Bojesen, Stig E.; Bolla, Manjeet K.; Brown, Judith; Buring, Julie E.; Campbell, Harry; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Corre, Tanguy; Couch, Fergus J.; Cox, Angela; Czene, Kamila; D'adamo, Adamo Pio; Davies, Gail; Deary, Ian J.; Dennis, Joe; Easton, Douglas F.; Engelhardt, Ellen G.; Eriksson, Johan G.; Esko, Tõnu; Fasching, Peter A.; Figueroa, Jonine D.; Flyger, Henrik; Fraser, Abigail; Garcia-Closas, Montse; Gasparini, Paolo; Gieger, Christian; Giles, Graham; Guenel, Pascal; Hägg, Sara; Hall, Per; Hayward, Caroline; Hopper, John; Ingelsson, Erik; Kardia, Sharon L.R.; Kasiman, Katherine; Knight, Julia A.; Lahti, Jari; Lawlor, Debbie A.; Magnusson, Patrik K.E.; Margolin, Sara; Marsh, Julie A.; Metspalu, Andres; Olson, Janet E.; Pennell, Craig E.; Polasek, Ozren; Rahman, Iffat; Ridker, Paul M.; Robino, Antonietta; Rudan, Igor; Rudolph, Anja; Salumets, Andres; Schmidt, Marjanka K.; Schoemaker, Minouk J.; Smith, Erin N.; Smith, Jennifer A.; Southey, Melissa; Stöckl, Doris; Swerdlow, Anthony J.; Thompson, Deborah J.; Truong, Therese; Ulivi, Sheila; Waldenberger, Melanie; Wang, Qin; Wild, Sarah; Wilson, James F; Wright, Alan F.; Zgaga, Lina; Ong, Ken K.; Murabito, Joanne M.; Karasik, David; Murray, Anna

    2014-01-01

    The length of female reproductive lifespan is associated with multiple adverse outcomes, including breast cancer, cardiovascular disease and infertility. The biological processes that govern the timing of the beginning and end of reproductive life are not well understood. Genetic variants are known to contribute to ∼50% of the variation in both age at menarche and menopause, but to date the known genes explain <15% of the genetic component. We have used genome-wide association in a bivariate meta-analysis of both traits to identify genes involved in determining reproductive lifespan. We observed significant genetic correlation between the two traits using genome-wide complex trait analysis. However, we found no robust statistical evidence for individual variants with an effect on both traits. A novel association with age at menopause was detected for a variant rs1800932 in the mismatch repair gene MSH6 (P = 1.9 × 10−9), which was also associated with altered expression levels of MSH6 mRNA in multiple tissues. This study contributes to the growing evidence that DNA repair processes play a key role in ovarian ageing and could be an important therapeutic target for infertility. PMID:24357391

  18. DNA mismatch repair gene MSH6 implicated in determining age at natural menopause.

    PubMed

    Perry, John R B; Hsu, Yi-Hsiang; Chasman, Daniel I; Johnson, Andrew D; Elks, Cathy; Albrecht, Eva; Andrulis, Irene L; Beesley, Jonathan; Berenson, Gerald S; Bergmann, Sven; Bojesen, Stig E; Bolla, Manjeet K; Brown, Judith; Buring, Julie E; Campbell, Harry; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Corre, Tanguy; Couch, Fergus J; Cox, Angela; Czene, Kamila; D'adamo, Adamo Pio; Davies, Gail; Deary, Ian J; Dennis, Joe; Easton, Douglas F; Engelhardt, Ellen G; Eriksson, Johan G; Esko, Tõnu; Fasching, Peter A; Figueroa, Jonine D; Flyger, Henrik; Fraser, Abigail; Garcia-Closas, Montse; Gasparini, Paolo; Gieger, Christian; Giles, Graham; Guenel, Pascal; Hägg, Sara; Hall, Per; Hayward, Caroline; Hopper, John; Ingelsson, Erik; Kardia, Sharon L R; Kasiman, Katherine; Knight, Julia A; Lahti, Jari; Lawlor, Debbie A; Magnusson, Patrik K E; Margolin, Sara; Marsh, Julie A; Metspalu, Andres; Olson, Janet E; Pennell, Craig E; Polasek, Ozren; Rahman, Iffat; Ridker, Paul M; Robino, Antonietta; Rudan, Igor; Rudolph, Anja; Salumets, Andres; Schmidt, Marjanka K; Schoemaker, Minouk J; Smith, Erin N; Smith, Jennifer A; Southey, Melissa; Stöckl, Doris; Swerdlow, Anthony J; Thompson, Deborah J; Truong, Therese; Ulivi, Sheila; Waldenberger, Melanie; Wang, Qin; Wild, Sarah; Wilson, James F; Wright, Alan F; Zgaga, Lina; Ong, Ken K; Murabito, Joanne M; Karasik, David; Murray, Anna

    2014-05-01

    The length of female reproductive lifespan is associated with multiple adverse outcomes, including breast cancer, cardiovascular disease and infertility. The biological processes that govern the timing of the beginning and end of reproductive life are not well understood. Genetic variants are known to contribute to ∼50% of the variation in both age at menarche and menopause, but to date the known genes explain <15% of the genetic component. We have used genome-wide association in a bivariate meta-analysis of both traits to identify genes involved in determining reproductive lifespan. We observed significant genetic correlation between the two traits using genome-wide complex trait analysis. However, we found no robust statistical evidence for individual variants with an effect on both traits. A novel association with age at menopause was detected for a variant rs1800932 in the mismatch repair gene MSH6 (P = 1.9 × 10(-9)), which was also associated with altered expression levels of MSH6 mRNA in multiple tissues. This study contributes to the growing evidence that DNA repair processes play a key role in ovarian ageing and could be an important therapeutic target for infertility. PMID:24357391

  19. Rapid Identification of Chemoresistance Mechanisms Using Yeast DNA Mismatch Repair Mutants

    PubMed Central

    Ojini, Irene; Gammie, Alison

    2015-01-01

    Resistance to cancer therapy is a major obstacle in the long-term treatment of cancer. A greater understanding of drug resistance mechanisms will ultimately lead to the development of effective therapeutic strategies to prevent resistance from occurring. Here, we exploit the mutator phenotype of mismatch repair defective yeast cells combined with whole genome sequencing to identify drug resistance mutations in key pathways involved in the development of chemoresistance. The utility of this approach was demonstrated via the identification of the known CAN1 and TOP1 resistance targets for two compounds, canavanine and camptothecin, respectively. We have also experimentally validated the plasma membrane transporter HNM1 as the primary drug resistance target of mechlorethamine. Furthermore, the sequencing of mitoxantrone-resistant strains identified inactivating mutations within IPT1, a gene encoding inositolphosphotransferase, an enzyme involved in sphingolipid biosynthesis. In the case of bactobolin, a promising anticancer drug, the endocytosis pathway was identified as the drug resistance target responsible for conferring resistance. Finally, we show that that rapamycin, an mTOR inhibitor previously shown to alter the fitness of the ipt1 mutant, can effectively prevent the formation of mitoxantrone resistance. The rapid and robust nature of these techniques, using Saccharomyces cerevisiae as a model organism, should accelerate the identification of drug resistance targets and guide the development of novel therapeutic combination strategies to prevent the development of chemoresistance in various cancers. PMID:26199284

  20. Muir-Torre Syndrome and founder mismatch repair gene mutations: A long gone historical genetic challenge.

    PubMed

    Ponti, G; Manfredini, M; Tomasi, A; Pellacani, G

    2016-09-10

    A "cancer predisposing syndrome" later labeled as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) or Lynch Syndrome, was firstly described by Warthin, about one century ago. An increased predisposition to the development of multiple familial tumors is described as characteristic of this syndrome where visceral and cutaneous malignancies may appear at an early age namely endometrial, gastric, small bowel, ureteral and renal pelvis, ovarian, hepatobiliary tract, pancreatic, brain (Turcot Syndrome) and sebaceous glands (Muir-Torre Syndrome). The latter, a variant of Lynch Syndrome, is characterized by the presence of sebaceous skin adenomas, carcinomas and/or keratoacanthomas associated with visceral malignancies. Both Lynch Syndrome and Muir-Torre Syndrome have been recognized due to germline mutations in mismatch repair genes MLH1, MSH2 and MSH6. To date, 56 Lynch Syndrome founder mutations dependent on MLH1, MSH2 and, although less frequently found, MSH6 and PMS2 are described. Some of these founder mutations, principally of MSH2 gene, have been described to cause Muir-Torre phenotype and have been traced in large and outbreed Muir-Torre Syndrome families living in different US and European territories. Due to the evidences of highly specific Muir-Torre phenotypes related to the presence of widespread MSH2 founder mutations, preliminary search for these MSH2 common mutations in individuals carrying sebaceous tumors and/or keratoacanthomas, at early age or in association to visceral and familial tumors, permits cost-effective and time-saving diagnostic strategies for Lynch/Muir-Torre Syndromes. PMID:26143115

  1. Emergence of phenotypic variants upon mismatch repair disruption in Pseudomonas aeruginosa.

    PubMed

    Smania, Andrea M; Segura, Ignacio; Pezza, Roberto J; Becerra, Cecilia; Albesa, Inés; Argaraña, Carlos E

    2004-05-01

    MutS is part of the bacterial mismatch repair system that corrects point mutations and small insertions/deletions that fail to be proof-read by DNA polymerase activity. In this work it is shown that the disruption of the P. aeruginosa mutS gene generates the emergence of diverse colony morphologies in contrast with its parental wild-type strain that displayed monomorphic colonies. Interestingly, two of the mutS morphotypes emerged at a high frequency and in a reproducible way and were selected for subsequent characterization. One of them displayed a nearly wild-type morphology while the other notably showed, compared with the wild-type strain, increased production of pyocyanin and pyoverdin, lower excretion of LasB protease and novel motility characteristics, mainly related to swarming. Furthermore, it was reproducibly observed that, after prolonged incubation in liquid culture, the pigmented variant consistently emerged from the mutS wild-type-like variant displaying a reproducible event. It is also shown that these P. aeruginosa mutS morphotypes not only displayed an increase in the frequency of antibiotic-resistant mutants, as described for clinical P. aeruginosa mutator isolates, but also generated mutants whose antibiotic-resistant levels were higher than those measured from spontaneous resistant mutants derived from wild-type cells. It was also found that both morphotypes showed a decreased cytotoxic capacity compared to the wild-type strain, leading to the emergence of invasive variants. By using mutated versions of a tetracycline resistance gene, the mutS mutant showed a 70-fold increase in the reversion frequency of a +1 frameshift mutation with respect to its parental wild-type strain, allowing the suggestion that the phenotypical diversity generated in the mutS population could be produced in part by frameshift mutations. Finally, since morphotypical diversification has also been described in clinical isolates, the possibility that this mut

  2. Metachronous T-Lymphoblastic Lymphoma and Burkitt Lymphoma in a Child With Constitutional Mismatch Repair Deficiency Syndrome.

    PubMed

    Alexander, Thomas B; McGee, Rose B; Kaye, Erica C; McCarville, Mary Beth; Choi, John K; Cavender, Cary P; Nichols, Kim E; Sandlund, John T

    2016-08-01

    Constitutional mismatch repair deficiency (CMMRD) is a cancer predisposition syndrome associated with a high risk of developing early-onset malignancies of the blood, brain, and intestinal tract. We present the case of a patient with T-lymphoblastic lymphoma at the age of 3 years, followed by Burkitt lymphoma 10 years later. This patient also exhibited numerous nonmalignant findings including café au lait spots, lipomas, bilateral renal nodules, a nonossifying fibroma, multiple colonic adenomas, and a rapidly enlarging pilomatrixoma. The spectrum of malignant and nonmalignant neoplasms in this patient highlights the remarkable diversity, and early onset, of lesions seen in children with CMMRD. PMID:27037742

  3. Nucleotide sequence of the Salmonella typhimurium mutS gene required for mismatch repair: homology of MutS and HexA of Streptococcus pneumoniae.

    PubMed Central

    Haber, L T; Pang, P P; Sobell, D I; Mankovich, J A; Walker, G C

    1988-01-01

    The mutS gene product of Escherichia coli and Salmonella typhimurium is one of at least four proteins required for methyl-directed mismatch repair in these organisms. A functionally similar repair system in Streptococcus pneumoniae requires the hex genes. We have sequenced the S. typhimurium mutS gene, showing that it encodes a 96-kilodalton protein. Amino-terminal amino acid sequencing of purified S. typhimurium MutS protein confirmed the initial portion of the deduced amino acid sequence. The S. typhimurium MutS protein is homologous to the S. pneumoniae HexA protein, suggesting that they arose from a common ancestor before the gram-negative and gram-positive bacteria diverged. Overall, approximately 36% of the amino acids of the two proteins are identical when the sequences are optimally aligned, including regions of stronger homology which are of particular interest. One such region is close to the amino terminus. Another, located closer to the carboxy terminus, includes homology to a consensus sequence thought to be diagnostic of nucleotide-binding sites. A third one, adjacent to the second, is homologous to the consensus sequence for the helix-turn-helix motif found in many DNA-binding proteins. We found that the S. typhimurium MutS protein can substitute for the E. coli MutS protein in vitro as it can in vivo, but we have not yet been able to demonstrate a similar in vitro complementation by the S. pneumoniae HexA protein. PMID:3275609

  4. Structure of the MutL C-terminal domain: a model of intact MutL and its roles in mismatch repair.

    PubMed

    Guarné, Alba; Ramon-Maiques, Santiago; Wolff, Erika M; Ghirlando, Rodolfo; Hu, Xiaojian; Miller, Jeffrey H; Yang, Wei

    2004-10-27

    MutL assists the mismatch recognition protein MutS to initiate and coordinate mismatch repair in species ranging from bacteria to humans. The MutL N-terminal ATPase domain is highly conserved, but the C-terminal region shares little sequence similarity among MutL homologs. We report here the crystal structure of the Escherichia coli MutL C-terminal dimerization domain and the likelihood of its conservation among MutL homologs. A 100-residue proline-rich linker between the ATPase and dimerization domains, which generates a large central cavity in MutL dimers, tolerates sequence substitutions and deletions of one-third of its length with no functional consequences in vivo or in vitro. Along the surface of the central cavity, residues essential for DNA binding are located in both the N- and C-terminal domains. Each domain of MutL interacts with UvrD helicase and is required for activating the helicase activity. The DNA-binding capacity of MutL is correlated with the level of UvrD activation. A model of how MutL utilizes its ATPase and DNA-binding activities to mediate mismatch-dependent activation of MutH endonuclease and UvrD helicase is proposed. PMID:15470502

  5. Clinicopathogenomic analysis of mismatch repair proficient colorectal adenocarcinoma uncovers novel prognostic subgroups with differing patterns of genetic evolution.

    PubMed

    Braxton, David R; Zhang, Ray; Morrissette, Jennifer D; Loaiza-Bonilla, Arturo; Furth, Emma E

    2016-10-01

    Cancer somatic genetic evolution is a direct contributor to heterogeneity at the clonal and molecular level in colorectal adenocarcinoma (COAD). We sought to determine the extent to which genetic evolution may be detected in COAD in routinely obtained single clinical specimens and establish clinical significance with regard to clinicopathologic and outcome data. One hundred and twenty three cases of routinely collected mismatch repair proficient COAD were sequenced on the Illumina Truseq Amplicon assay. Measures of intratumoral heterogeneity and the preferential timing of mutational events were assessed and compared to clinicopathologic data. Survival subanalysis was performed on 55 patients. Patient age (p = 0.013) and specimen percent tumor (p = 0.033) was associated with clonal diversity, and biopsy (p = 0.044) and metastasis (p = 0.044) returned fewer mutations per case. APC and TP53 mutations preferentially occurred early while alterations in FBXW7, FLT3, SMAD4, GNAS and PTEN preferentially occurred as late events. Temporal heterogeneity was evident in KRAS and PIK3CA mutations. Hierarchical clustering revealed a TP53 mutant subtype and a MAPK-PIK3CA subtype with differing patterns of late mutational events. Survival subanalysis showed a decreased median progression free survival for the MAPK-PIK3CA subtype (8 months vs. 13 months; univariate logrank p = 0.0380, cox model p= 0.018). Neoadjuvant therapy associated mutations were found for ERBB2 (p = 0.0481) and FBXW7 (p = 0.015). Our data indicate novel molecular subtypes of mismatch repair proficient COAD display differing patterns of genetic evolution which correlate with clinical outcomes. Furthermore, we report treatment acquired and/or selected mutations in ERBB2 and FBXW7. PMID:27194209

  6. Immunohistochemistry for hMLH1 and hMSH2: a practical test for DNA mismatch repair-deficient tumors.

    PubMed

    Marcus, V A; Madlensky, L; Gryfe, R; Kim, H; So, K; Millar, A; Temple, L K; Hsieh, E; Hiruki, T; Narod, S; Bapat, B V; Gallinger, S; Redston, M

    1999-10-01

    Inactivation of deoxyribonucleic acid (DNA) mismatch repair genes, most commonly human mutL homologue 1 (hMLH1) or human mutS homologue 2 (hMSH2), is a recently described alternate pathway in cancer development and progression. The resulting genetic instability is characterized by widespread somatic mutations in tumor DNA, and is termed high-frequency microsatellite instability (MSI-H). Although described in a variety of tumors, mismatch repair deficiency has been studied predominantly in colorectal carcinoma. Most MSI-H colorectal carcinomas are sporadic, but some occur in patients with hereditary nonpolyposis colorectal cancer (HNPCC), and are associated with germline mutations in mismatch repair genes. Until now, the identification of MSI-H cancers has required molecular testing. To evaluate the role of immunohistochemistry as a new screening tool for mismatch repair-deficient neoplasms, the authors studied the expression of hMLH1 and hMSH2, using commercially available monoclonal antibodies, in 72 formalin-fixed, paraffin-embedded tumors that had been tested previously for microsatellite instability. They compared immunohistochemical patterns of 38 MSI-H neoplasms, including 16 cases from HNPCC patients with known germline mutations in hMLH1 or hMSH2, with 34 neoplasms that did not show microsatellite instability. Thirty-seven of 38 MSI-H neoplasms were predicted to have a mismatch repair gene defect, as demonstrated by the absence of hMLH1 and/or hMSH2 expression. This included correspondence with all 16 cases with germline mutations. All 34 microsatellite-stable cancers had intact staining with both antibodies. These findings clearly demonstrate that immunohistochemistry can discriminate accurately between MSI-H and microsatellite-stable tumors, providing a practical new technique with important clinical and research applications. PMID:10524526

  7. Heteroduplex formation and mismatch repair of the "stuck" mutation during mating-type switching in Saccharomyces cerevisiae.

    PubMed Central

    Ray, B L; White, C I; Haber, J E

    1991-01-01

    We sequenced two alleles of the MATa locus of Saccharomyces cerevisiae that reduce homothallic switching and confer viability to HO rad52 strains. Both the MATa-stk (J. E. Haber, W. T. Savage, S. M. Raposa, B. Weiffenbach, and L. B. Rowe, Proc. Natl. Acad. Sci. USA 77:2824-2828, 1980) and MATa-survivor (R. E. Malone and D. Hyman, Curr. Genet. 7:439-447, 1983) alleles result from a T----A base change at position Z11 of the MAT locus. These strains also contain identical base substitutions at HMRa, so that the mutation is reintroduced when MAT alpha switches to MATa. Mating-type switching in a MATa-stk strain relative to a MATa Z11T strain is reduced at least 50-fold but can be increased by expression of HO from a galactose-inducible promoter. We confirmed by Southern analysis that the Z11A mutation reduced the efficiency of double-strand break formation compared with the Z11T variant; the reduction was more severe in MAT alpha than in MATa. In MAT alpha, the Z11A mutation also creates a mat alpha 1 (sterile) mutation that distinguishes switches of MATa-stk to either MAT alpha or mat alpha 1-stk. Pedigree analysis of cells induced to switch in G1 showed that MATa-stk switched frequently (23% of the time) to produce one mat alpha 1-stk and one MAT alpha progeny. This postswitching segregation suggests that Z11 was often present in heteroduplex DNA that was not mismatch repaired. When mismatch repair was prevented by deletion of the PMS1 gene, there was an increase in the proportion of mat alpha 1-stk/MAT alpha sectors (59%) and in pairs of switched cells that both retained the stk mutation (27%). We conclude that at least one strand of DNA only 4 bp from the HO cut site is not degraded in most of the gene conversion events that accompany MAT switching. Images PMID:1922052

  8. Evaluation of CADD Scores in Curated Mismatch Repair Gene Variants Yields a Model for Clinical Validation and Prioritization

    PubMed Central

    van der Velde, K. Joeri; Kuiper, Joël; Thompson, Bryony A.; Plazzer, John‐Paul; van Valkenhoef, Gert; de Haan, Mark; Jongbloed, Jan D.H.; Wijmenga, Cisca; de Koning, Tom J.; Abbott, Kristin M.; Sinke, Richard; Spurdle, Amanda B.; Macrae, Finlay; Genuardi, Maurizio; Sijmons, Rolf H.

    2015-01-01

    ABSTRACT Next‐generation sequencing in clinical diagnostics is providing valuable genomic variant data, which can be used to support healthcare decisions. In silico tools to predict pathogenicity are crucial to assess such variants and we have evaluated a new tool, Combined Annotation Dependent Depletion (CADD), and its classification of gene variants in Lynch syndrome by using a set of 2,210 DNA mismatch repair gene variants. These had already been classified by experts from InSiGHT's Variant Interpretation Committee. Overall, we found CADD scores do predict pathogenicity (Spearman's ρ = 0.595, P < 0.001). However, we discovered 31 major discrepancies between the InSiGHT classification and the CADD scores; these were explained in favor of the expert classification using population allele frequencies, cosegregation analyses, disease association studies, or a second‐tier test. Of 751 variants that could not be clinically classified by InSiGHT, CADD indicated that 47 variants were worth further study to confirm their putative pathogenicity. We demonstrate CADD is valuable in prioritizing variants in clinically relevant genes for further assessment by expert classification teams. PMID:25871441

  9. Mismatch repair defects and Lynch syndrome: The role of the basic scientist in the battle against cancer.

    PubMed

    Heinen, Christopher D

    2016-02-01

    We have currently entered a genomic era of cancer research which may soon lead to a genomic era of cancer treatment. Patient DNA sequencing information may lead to a personalized approach to managing an individual's cancer as well as future cancer risk. The success of this approach, however, begins not necessarily in the clinician's office, but rather at the laboratory bench of the basic scientist. The basic scientist plays a critical role since the DNA sequencing information is of limited use unless one knows the function of the gene that is altered and the manner by which a sequence alteration affects that function. The role of basic science research in aiding the clinical management of a disease is perhaps best exemplified by considering the case of Lynch syndrome, a hereditary disease that predisposes patients to colorectal and other cancers. This review will examine how the diagnosis, treatment and even prevention of Lynch syndrome-associated cancers has benefitted from extensive basic science research on the DNA mismatch repair genes whose alteration underlies this condition. PMID:26710976

  10. Reduced mismatch repair of heteroduplexes reveals "non"-interfering crossing over in wild-type Saccharomyces cerevisiae.

    PubMed

    Getz, Tony J; Banse, Stephen A; Young, Lisa S; Banse, Allison V; Swanson, Johanna; Wang, Grace M; Browne, Barclay L; Foss, Henriette M; Stahl, Franklin W

    2008-03-01

    Using small palindromes to monitor meiotic double-strand-break-repair (DSBr) events, we demonstrate that two distinct classes of crossovers occur during meiosis in wild-type yeast. We found that crossovers accompanying 5:3 segregation of a palindrome show no conventional (i.e., positive) interference, while crossovers with 6:2 or normal 4:4 segregation for the same palindrome, in the same cross, do manifest interference. Our observations support the concept of a "non"-interference class and an interference class of meiotic double-strand-break-repair events, each with its own rules for mismatch repair of heteroduplexes. We further show that deletion of MSH4 reduces crossover tetrads with 6:2 or normal 4:4 segregation more than it does those with 5:3 segregation, consistent with Msh4p specifically promoting formation of crossovers in the interference class. Additionally, we present evidence that an ndj1 mutation causes a shift of noncrossovers to crossovers specifically within the "non"-interference class of DSBr events. We use these and other data in support of a model in which meiotic recombination occurs in two phases-one specializing in homolog pairing, the other in disjunction-and each producing both noncrossovers and crossovers. PMID:18385111

  11. Population Modelling with M&M's[R

    ERIC Educational Resources Information Center

    Winkel, Brian

    2009-01-01

    Several activities in which population dynamics can be modelled by tossing M&M's[R] candy are presented. Physical activities involving M&M's[R] can be modelled by difference equations and several population phenomena, including death and immigration, are studied. (Contains 1 note.)

  12. Structural Features and Functional Dependency on β-Clamp Define Distinct Subfamilies of Bacterial Mismatch Repair Endonuclease MutL.

    PubMed

    Fukui, Kenji; Baba, Seiki; Kumasaka, Takashi; Yano, Takato

    2016-08-12

    In early reactions of DNA mismatch repair, MutS recognizes mismatched bases and activates MutL endonuclease to incise the error-containing strand of the duplex. DNA sliding clamp is responsible for directing the MutL-dependent nicking to the newly synthesized/error-containing strand. In Bacillus subtilis MutL, the β-clamp-interacting motif (β motif) of the C-terminal domain (CTD) is essential for both in vitro direct interaction with β-clamp and in vivo repair activity. A large cluster of negatively charged residues on the B. subtilis MutL CTD prevents nonspecific DNA binding until β clamp interaction neutralizes the negative charge. We found that there are some bacterial phyla whose MutL endonucleases lack the β motif. For example, the region corresponding to the β motif is completely missing in Aquifex aeolicus MutL, and critical amino acid residues in the β motif are not conserved in Thermus thermophilus MutL. We then revealed the 1.35 Å-resolution crystal structure of A. aeolicus MutL CTD, which lacks the β motif but retains the metal-binding site for the endonuclease activity. Importantly, there was no negatively charged cluster on its surface. It was confirmed that CTDs of β motif-lacking MutLs, A. aeolicus MutL and T. thermophilus MutL, efficiently incise DNA even in the absence of β-clamp and that β-clamp shows no detectable enhancing effect on their activity. In contrast, CTD of Streptococcus mutans, a β motif-containing MutL, required β-clamp for the digestion of DNA. We propose that MutL endonucleases are divided into three subfamilies on the basis of their structural features and dependence on β-clamp. PMID:27369079

  13. An Efficient Site-Specific Method for Irreversible Covalent Labeling of Proteins with a Fluorophore.

    PubMed

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M; Shoffner, Matthew; Albers, Aaron E; Bennett, Jared; Zatezalo, Rachel; Barfield, Robyn; Rabuka, David; Lee, Jong-Bong; Fishel, Richard

    2015-01-01

    Fluorophore labeling of proteins while preserving native functions is essential for bulk Förster resonance energy transfer (FRET) interaction and single molecule imaging analysis. Here we describe a versatile, efficient, specific, irreversible, gentle and low-cost method for labeling proteins with fluorophores that appears substantially more robust than a similar but chemically distinct procedure. The method employs the controlled enzymatic conversion of a central Cys to a reactive formylglycine (fGly) aldehyde within a six amino acid Formylglycine Generating Enzyme (FGE) recognition sequence in vitro. The fluorophore is then irreversibly linked to the fGly residue using a Hydrazinyl-Iso-Pictet-Spengler (HIPS) ligation reaction. We demonstrate the robust large-scale fluorophore labeling and purification of E.coli (Ec) mismatch repair (MMR) components. Fluorophore labeling did not alter the native functions of these MMR proteins in vitro or in singulo. Because the FGE recognition sequence is easily portable, FGE-HIPS fluorophore-labeling may be easily extended to other proteins. PMID:26582263

  14. An Efficient Site-Specific Method for Irreversible Covalent Labeling of Proteins with a Fluorophore

    PubMed Central

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M.; Shoffner, Matthew; Albers, Aaron E.; Bennett, Jared; Zatezalo, Rachel; Barfield, Robyn; Rabuka, David; Lee, Jong-Bong; Fishel, Richard

    2015-01-01

    Fluorophore labeling of proteins while preserving native functions is essential for bulk Förster resonance energy transfer (FRET) interaction and single molecule imaging analysis. Here we describe a versatile, efficient, specific, irreversible, gentle and low-cost method for labeling proteins with fluorophores that appears substantially more robust than a similar but chemically distinct procedure. The method employs the controlled enzymatic conversion of a central Cys to a reactive formylglycine (fGly) aldehyde within a six amino acid Formylglycine Generating Enzyme (FGE) recognition sequence in vitro. The fluorophore is then irreversibly linked to the fGly residue using a Hydrazinyl-Iso-Pictet-Spengler (HIPS) ligation reaction. We demonstrate the robust large-scale fluorophore labeling and purification of E.coli (Ec) mismatch repair (MMR) components. Fluorophore labeling did not alter the native functions of these MMR proteins in vitro or in singulo. Because the FGE recognition sequence is easily portable, FGE-HIPS fluorophore-labeling may be easily extended to other proteins. PMID:26582263

  15. Simple Sequence Repeats Together with Mismatch Repair Deficiency Can Bias Mutagenic Pathways in Pseudomonas aeruginosa during Chronic Lung Infection

    PubMed Central

    Moyano, Alejandro J.; Feliziani, Sofía; Di Rienzo, Julio A.; Smania, Andrea M.

    2013-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that chronically infects the airways of cystic fibrosis (CF) patients and undergoes a process of genetic adaptation based on mutagenesis. We evaluated the role of mononucleotide G:C and A:T simple sequence repeats (SSRs) in this adaptive process. An in silico survey of the genome sequences of 7 P. aeruginosa strains showed that mononucleotide G:C SSRs but not A:T SSRs were greatly under-represented in coding regions, suggesting a strong counterselection process for G:C SSRs with lengths >5 bp but not for A:T SSRs. A meta-analysis of published whole genome sequence data for a P. aeruginosa strain from a CF patient with chronic airway infection showed that G:C SSRs but not A:T SSRs were frequently mutated during the infection process through the insertion or deletion of one or more SSR subunits. The mutation tendency of G:C SSRs was length-dependent and increased exponentially as a function of SSR length. When this strain naturally became a stable Mismatch Repair System (MRS)-deficient mutator, the degree of increase of G:C SSRs mutations (5-fold) was much higher than that of other types of mutation (2.2-fold or less). Sequence analysis of several mutated genes reported for two different collections, both containing mutator and non-mutator strains of P. aeruginosa from CF chronic infections, showed that the proportion of G:C SSR mutations was significantly higher in mutators than in non-mutators, whereas no such difference was observed for A:T SSR mutations. Our findings, taken together, provide genome-scale evidences that under a MRS-deficient background, long G:C SSRs are able to stochastically bias mutagenic pathways by making the genes in which they are harbored more prone to mutation. The combination of MRS deficiency and virulence-related genes that contain long G:C SSRs is therefore a matter of concern in P. aeruginosa CF chronic infection. PMID:24278287

  16. Simple sequence repeats and mucoid conversion: biased mucA mutagenesis in mismatch repair-deficient Pseudomonas aeruginosa.

    PubMed

    Moyano, Alejandro J; Smania, Andrea M

    2009-01-01

    In Pseudomonas aeruginosa, conversion to the mucoid phenotype marks the onset of an irreversible state of the infection in Cystic Fibrosis (CF) patients. The main pathway for mucoid conversion is mutagenesis of the mucA gene, frequently due to -1 bp deletions in a simple sequence repeat (SSR) of 5 Gs (G(5)-SSR(426)). We have recently observed that this mucA mutation is particularly accentuated in Mismatch Repair System (MRS)-deficient cells grown in vitro. Interestingly, previous reports have shown a high prevalence of hypermutable MRS-deficient strains occurring naturally in CF chronic lung infections. Here, we used mucA as a forward mutation model to systematically evaluate the role of G(5)-SSR(426) in conversion to mucoidy in a MRS-deficient background, with this being the first analysis combining SSR-dependent localized hypermutability and the acquisition of a particular virulence/persistence trait in P. aeruginosa. In this study, mucA alleles were engineered with different contents of G:C SSRs, and tested for their effect on the mucoid conversion frequency and mucA mutational spectra in a mutS-deficient strain of P. aeruginosa. Importantly, deletion of G(5)-SSR(426) severely reduced the emergence frequency of mucoid variants, with no preferential site of mutagenesis within mucA. Moreover, although mutagenesis in mucA was not totally removed, this was no longer the main pathway for mucoid conversion, suggesting that G(5)-SSR(426) biased mutations towards mucA. Mutagenesis in mucA was restored by the addition of a new SSR (C(6)-SSR(431)), and even synergistically increased when G(5)-SSR(426) and C(6)-SSR(431) were present simultaneously, with the mucA mutations being restricted to -1 bp deletions within any of both G:C SSRs. These results confirm a critical role for G(5)-SSR(426) enhancing the mutagenic process of mucA in MRS-deficient cells, and shed light on another mechanism, the SSR- localized hypermutability, contributing to mucoid conversion in P

  17. Simple sequence repeats together with mismatch repair deficiency can bias mutagenic pathways in Pseudomonas aeruginosa during chronic lung infection.

    PubMed

    Moyano, Alejandro J; Feliziani, Sofía; Di Rienzo, Julio A; Smania, Andrea M

    2013-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that chronically infects the airways of cystic fibrosis (CF) patients and undergoes a process of genetic adaptation based on mutagenesis. We evaluated the role of mononucleotide G:C and A:T simple sequence repeats (SSRs) in this adaptive process. An in silico survey of the genome sequences of 7 P. aeruginosa strains showed that mononucleotide G:C SSRs but not A:T SSRs were greatly under-represented in coding regions, suggesting a strong counterselection process for G:C SSRs with lengths >5 bp but not for A:T SSRs. A meta-analysis of published whole genome sequence data for a P. aeruginosa strain from a CF patient with chronic airway infection showed that G:C SSRs but not A:T SSRs were frequently mutated during the infection process through the insertion or deletion of one or more SSR subunits. The mutation tendency of G:C SSRs was length-dependent and increased exponentially as a function of SSR length. When this strain naturally became a stable Mismatch Repair System (MRS)-deficient mutator, the degree of increase of G:C SSRs mutations (5-fold) was much higher than that of other types of mutation (2.2-fold or less). Sequence analysis of several mutated genes reported for two different collections, both containing mutator and non-mutator strains of P. aeruginosa from CF chronic infections, showed that the proportion of G:C SSR mutations was significantly higher in mutators than in non-mutators, whereas no such difference was observed for A:T SSR mutations. Our findings, taken together, provide genome-scale evidences that under a MRS-deficient background, long G:C SSRs are able to stochastically bias mutagenic pathways by making the genes in which they are harbored more prone to mutation. The combination of MRS deficiency and virulence-related genes that contain long G:C SSRs is therefore a matter of concern in P. aeruginosa CF chronic infection. PMID:24278287

  18. In vivo requirement for RecJ, ExoVII, ExoI, and ExoX in methyl-directed mismatch repair.

    PubMed

    Burdett, V; Baitinger, C; Viswanathan, M; Lovett, S T; Modrich, P

    2001-06-01

    Biochemical studies with model DNA heteroduplexes have implicated RecJ exonuclease, exonuclease VII, exonuclease I, and exonuclease X in Escherichia coli methyl-directed mismatch correction. However, strains deficient in the four exonucleases display only a modest increase in mutation rate, raising questions concerning involvement of these activities in mismatch repair in vivo. The quadruple mutant deficient in the four exonucleases, as well as the triple mutant deficient in RecJ exonuclease, exonuclease VII, and exonuclease I, grow poorly in the presence of the base analogue 2-aminopurine, and exposure to the base analogue results in filament formation, indicative of induction of SOS DNA damage response. The growth defect and filamentation phenotypes associated with 2-aminopurine exposure are effectively suppressed by null mutations in mutH, mutL, mutS, or uvrD/mutU, which encode activities that act upstream of the four exonucleases in the mechanism for the methyl-directed reaction that has been proposed based on in vitro studies. The quadruple exonuclease mutant is also cold-sensitive, having a severe growth defect at 30 degrees C. This phenotype is suppressed by a uvrD/mutU defect, and partially suppressed by mutH, mutL, or mutS mutations. These observations confirm involvement of the four exonucleases in methyl-directed mismatch repair in vivo and suggest that the low mutability of exonuclease-deficient strains is a consequence of under recovery of mutants due to a reduction in viability and/or chromosome loss associated with activation of the mismatch repair system in the absence of RecJ exonuclease, exonuclease VII, exonuclease I, and exonuclease X. PMID:11381137

  19. Development of an Immunosensor Based on Layered Double Hydroxides for MMR Cancer Biomarker Detection.

    PubMed

    Hammami, M; Soussou, A; Idoudi, F; Cohen-Bouhacina, T; Bouhaouala-Zahar, B; Baccar, Z M

    2015-10-01

    As a potential biomarker for the investigation of cancer inflammatory profiles, macrophage mannose receptor (MMR, CD206) is herein selected to develop an immunosensor based on layered double hydroxide (LDH). Like an endocyte C-type lectin receptor, MMR plays an important role in immune homeostasis by scavenging unwanted mannose glycoproteins. It attracts a progressive attention thanks to its particularly high expression within the tumor microenvironment. There is a great of interest to develop an immunosensor based on an antibody specific to MMR for detection of stroma versus tumor cells. In this work, we studied the feasibility of high sensitive MMR cancer Screen Printed Electrode (SPE) immunosensor. Working electrode of commercialized SPE was modified by immobilization of specific antibody (anti-MMR) into thin layer of LDH nanomaterials. Structural, morphological, and surface properties of LDHs were studied by X-Ray diffraction, atomic force microscopy and Infrared spectroscopy in ATR. Cyclic Voltammetry technique was used to study interaction between the human recombinant MMR protein (rHu-MMR, NSO derived) and an immobilized antibody into developed immunosensor. High specific response of -11.72 μA/ng.mL(-1) (with a correlation coefficient of R(2)=0.994 ) were obtained in linear range of 0.05 ng/mL to 10.0 ng/mL of specific recombinant antigen. The limit of detection (LOD) was less than 15.0 pg/mL. From these attractive results, the feasibility of an electrochemical immunosensor for cancer was proved. Additional experiments to study stability and reproducibility the immunosensor should be completed in perspective to use these anti-MMR based immunosensors for sensing human MMR in patient biopsies and sera. PMID:26316191

  20. Incompatibilities Involving Yeast Mismatch Repair Genes: A Role for Genetic Modifiers and Implications for Disease Penetrance and Variation in Genomic Mutation Rates

    PubMed Central

    Demogines, Ann; Wong, Alex; Aquadro, Charles; Alani, Eric

    2008-01-01

    Genetic background effects underlie the penetrance of most genetically determined phenotypes, including human diseases. To explore how such effects can modify a mutant phenotype in a genetically tractable system, we examined an incompatibility involving the MLH1 and PMS1 mismatch repair genes using a large population sample of geographically and ecologically diverse Saccharomyces cerevisiae strains. The mismatch repair incompatibility segregates into naturally occurring yeast strains, with no strain bearing the deleterious combination. In assays measuring the mutator phenotype conferred by different combinations of MLH1 and PMS1 from these strains, we observed a mutator phenotype only in combinations predicted to be incompatible. Surprisingly, intragenic modifiers could be mapped that specifically altered the strength of the incompatibility over a 20-fold range. Together, these observations provide a powerful model in which to understand the basis of disease penetrance and how such genetic variation, created through mating, could result in new mutations that could be the raw material of adaptive evolution in yeast populations. PMID:18566663

  1. Overexpression of MutSα Complex Proteins Predicts Poor Prognosis in Oral Squamous Cell Carcinoma

    PubMed Central

    Wagner, Vivian Petersen; Webber, Liana Preto; Salvadori, Gabriela; Meurer, Luise; Fonseca, Felipe Paiva; Castilho, Rogério Moraes; Squarize, Cristiane Helena; Vargas, Pablo Agustin; Martins, Manoela Domingues

    2016-01-01

    Abstract The DNA mismatch repair (MMR) system is responsible for the detection and correction of errors created during DNA replication, thereby avoiding the incorporation of mutations in dividing cells. The prognostic value of alterations in MMR system has not previously been analyzed in oral squamous cell carcinoma (OSCC). The study comprised 115 cases of OSCC diagnosed between 1996 and 2010. The specimens collected were constructed into tissue microarray blocks. Immunohistochemical staining for MutSα complex proteins hMSH2 and hMSH6 was performed. The slides were subsequently scanned into high-resolution images, and nuclear staining of hMSH2 and hMSH6 was analyzed using the Nuclear V9 algorithm. Univariable and multivariable Cox proportional hazard regression models were performed to evaluate the prognostic value of hMSH2 and hMSH6 in OSCC. All cases in the present cohort were positive for hMSH2 and hMSH6 and a direct correlation was found between the expression of the proteins (P < 0.05). The mean number of positive cells for hMSH2 and hMSH6 was 64.44 ± 15.21 and 31.46 ± 22.38, respectively. These values were used as cutoff points to determine high protein expression. Cases with high expression of both proteins simultaneously were classified as having high MutSα complex expression. In the multivariable analysis, high expression of the MutSα complex was an independent prognostic factor for poor overall survival (hazard ratio: 2.75, P = 0.02). This study provides a first insight of the prognostic value of alterations in MMR system in OSCC. We found that MutSα complex may constitute a molecular marker for the poor prognosis of OSCC. PMID:27258499

  2. MMR vaccination advice over the Internet.

    PubMed

    Schmidt, Katja; Ernst, Edzard

    2003-03-01

    We wanted to investigate what advice UK homeopaths, chiropractors and general practitioners give on measles, mumps and rubella vaccination programme (MMR) vaccination via the Internet. Online referral directories listing e-mail addresses of UK homeopaths, chiropractors and general practitioners and private websites were visited. All addresses thus located received a letter of a (fictitious) patient asking for advice about the MMR vaccination. After sending a follow-up letter explaining the nature and aim of this project and offering the option of withdrawal, 26% of all respondents withdrew their answers. Homeopaths yielded a final response rate (53%, n = 77) compared to chiropractors (32%, n = 16). GPs unanimously refused to give advice over the Internet. No homeopath and only one chiropractor advised in favour of the MMR vaccination. Two homeopaths and three chiropractors indirectly advised in favour of MMR. More chiropractors than homeopaths displayed a positive attitude towards the MMR vaccination. Some complementary and alternative medicine (CAM) providers have a negative attitude towards immunisation and means of changing this should be considered. PMID:12559777

  3. [Acute pancreatitis associated with MMR vaccination].

    PubMed

    Hansen, Lars Folmer; Nordling, Mette Maria; Mortensen, Henrik Bindesbøl

    2003-05-26

    A 12-year-old girl got abdominal pain three weeks after having received the second vaccination against MMR. MRCP showed dilatation of ductus choledochus and edema of caput pancreaticus. No stone was to be seen and the P-calcium level was normal. Hepatitis A virus, Ebstein-Barr virus, cytomegalovirus, enterovirus, serum col hemaggutinins, Yersinia and cystic fibrosis were all negative. Pancreatitis is seen with endemic parotitis and we suggest that MMR vaccination may have a causal connection with the above case. PMID:12830760

  4. Temozolomide Resistance in Glioblastoma Cell Lines: Implication of MGMT, MMR, P-Glycoprotein and CD133 Expression

    PubMed Central

    Prados, Jose; Caba, Octavio; Cabeza, Laura; Berdasco, Maria; Gónzalez, Beatriz; Melguizo, Consolación

    2015-01-01

    Background The use of temozolomide (TMZ) has improved the prognosis for glioblastoma multiforme patients. However, TMZ resistance may be one of the main reasons why treatment fails. Although this resistance has frequently been linked to the expression of O6-methylguanine-DNA methyltransferase (MGMT) it seems that this enzyme is not the only molecular mechanism that may account for the appearance of drug resistance in glioblastoma multiforme patients as the mismatch repair (MMR) complex, P-glycoprotein, and/or the presence of cancer stem cells may also be implicated. Methods Four nervous system tumor cell lines were used to analyze the modulation of MGMT expression and MGMT promoter methylation by TMZ treatment. Furthermore, 5-aza-2’-deoxycytidine was used to demethylate the MGMT promoter and O(6)-benzylguanine to block GMT activity. In addition, MMR complex and P-glycoprotein expression were studied before and after TMZ exposure and correlated with MGMT expression. Finally, the effect of TMZ exposure on CD133 expression was analyzed. Results Our results showed two clearly differentiated groups of tumor cells characterized by low (A172 and LN229) and high (SF268 and SK-N-SH) basal MGMT expression. Interestingly, cell lines with no MGMT expression and low TMZ IC50 showed a high MMR complex expression, whereas cell lines with high MGMT expression and high TMZ IC50 did not express the MMR complex. In addition, modulation of MGMT expression in A172 and LN229 cell lines was accompanied by a significant increase in the TMZ IC50, whereas no differences were observed in SF268 and SK-N-SH cell lines. In contrast, P-glycoprotein and CD133 was found to be unrelated to TMZ resistance in these cell lines. Conclusions These results may be relevant in understanding the phenomenon of TMZ resistance, especially in glioblastoma multiforme patients laking MGMT expression, and may also aid in the design of new therapeutic strategies to improve the efficacy of TMZ in glioblastoma

  5. Mismatch response (MMR) in neonates: Beyond refractoriness.

    PubMed

    Háden, Gábor P; Németh, Renáta; Török, Miklós; Winkler, István

    2016-05-01

    In the adult auditory system, deviant detection and updating the representation of the environment is reflected by the event-related potential (ERP) component termed the mismatch negativity (MMN). MMN is elicited when a rare-pitch deviant stimulus is presented amongst frequent standard pitch stimuli. The same stimuli also elicit a similar discriminative ERP component in sleeping newborn infants (termed the mismatch response: MMR). Both the MMN and the MMR can be confounded by responses generated by differential refractoriness of frequency-selective neural populations. Employing a stimulus paradigm designed to minimize this confounding effect, newborns were presented with sequences of pure tones under two conditions: In the oddball block, rare deviant tones (500Hz; 10%) were delivered amongst frequent standards (700Hz; 90%). In the control block, a comparison tone (500Hz) was presented with the same probability as the deviant (10%) along with the four contextual tones (700Hz, 980Hz, 1372Hz, 1920.8Hz; 22.5% each). The significant difference found between the response elicited by the deviant and the comparison tone showed that the response elicited by the deviant in the oddball sequences cannot be fully explained by frequency-specific refractoriness of the neural generators. This shows that neonates process sounds in a context-dependent manner as well as strengthens the correspondence between the adult MMN and the infant MMR. PMID:26898555

  6. MMR and autism: further evidence against a causal association.

    PubMed

    Farrington, C P; Miller, E; Taylor, B

    2001-06-14

    The hypothesis that MMR vaccines cause autism was first raised by reports of cases in which developmental regression occurred soon after MMR vaccination. A previous study found no evidence to support this hypothesis. It has recently been suggested that MMR vaccine might cause autism, but that the induction interval need not be short. The data from the earlier study were reanalysed to test this second hypothesis. Our results do not support this hypothesis, and provide further evidence against a causal association between MMR vaccination and autism. PMID:11395196

  7. Function of high-mobility group A proteins in the DNA damage signaling for the induction of apoptosis.

    PubMed

    Fujikane, Ryosuke; Komori, Kayoko; Sekiguchi, Mutsuo; Hidaka, Masumi

    2016-01-01

    O(6)-Methylguanine produced in DNA can pair with thymine during DNA replication, thus leading to a G-to-A transition mutation. To prevent such outcomes, cells harboring O(6)-methylguanine-containing mispair undergo apoptosis that requires the function of mismatch repair (MMR) protein complex. To identify the genes involved in the induction of apoptosis, we performed gene-trap mutagenesis and isolated a clone of mouse cells exhibiting an increased resistance to the killing effect of an alkylating agent, N-methyl-N-nitrosourea (MNU). The mutant carries an insertion in the Hmga2 gene, which belongs to a gene family encoding the high-mobility group A non-histone chromatin proteins. To elucidate the function of HMGA proteins in the apoptosis pathway, we introduced siRNAs for HMGA1 and/or HMGA2 into human HeLa MR cells defective in O(6)-methylguanine-DNA methyltransferase. HMGA1- and HMGA2-single knockdown cells showed an increased resistance to MNU, and HMGA1/HMGA2-double knockdown cells exhibited further increased tolerance compared to the control. The phosphorylation of ATR and CHK1, the appearance of a sub-G1 population, and caspase-9 activation were suppressed in the knockdown cells, although the formation of mismatch recognition complex was unaffected. These results suggest that HMGA family proteins function at the step following the damage recognition in the process of apoptosis triggered by O(6)-methylguanine. PMID:27538817

  8. Function of high-mobility group A proteins in the DNA damage signaling for the induction of apoptosis

    PubMed Central

    Fujikane, Ryosuke; Komori, Kayoko; Sekiguchi, Mutsuo; Hidaka, Masumi

    2016-01-01

    O6-Methylguanine produced in DNA can pair with thymine during DNA replication, thus leading to a G-to-A transition mutation. To prevent such outcomes, cells harboring O6-methylguanine-containing mispair undergo apoptosis that requires the function of mismatch repair (MMR) protein complex. To identify the genes involved in the induction of apoptosis, we performed gene-trap mutagenesis and isolated a clone of mouse cells exhibiting an increased resistance to the killing effect of an alkylating agent, N-methyl-N-nitrosourea (MNU). The mutant carries an insertion in the Hmga2 gene, which belongs to a gene family encoding the high-mobility group A non-histone chromatin proteins. To elucidate the function of HMGA proteins in the apoptosis pathway, we introduced siRNAs for HMGA1 and/or HMGA2 into human HeLa MR cells defective in O6-methylguanine-DNA methyltransferase. HMGA1- and HMGA2-single knockdown cells showed an increased resistance to MNU, and HMGA1/HMGA2-double knockdown cells exhibited further increased tolerance compared to the control. The phosphorylation of ATR and CHK1, the appearance of a sub-G1 population, and caspase-9 activation were suppressed in the knockdown cells, although the formation of mismatch recognition complex was unaffected. These results suggest that HMGA family proteins function at the step following the damage recognition in the process of apoptosis triggered by O6-methylguanine. PMID:27538817

  9. The contribution of deleterious germline mutations in BRCA1, BRCA2 and the mismatch repair genes to ovarian cancer in the population

    PubMed Central

    Song, Honglin; Cicek, Mine S.; Dicks, Ed; Harrington, Patricia; Ramus, Susan J.; Cunningham, Julie M.; Fridley, Brooke L.; Tyrer, Jonathan P.; Alsop, Jennifer; Jimenez-Linan, Mercedes; Gayther, Simon A.; Goode, Ellen L.; Pharoah, Paul D.P.

    2014-01-01

    The aim of this study was to estimate the contribution of deleterious mutations in BRCA1, BRCA2, MLH1, MSH2, MSH6 and PMS2 to invasive epithelial ovarian cancer (EOC) in the population. The coding sequence and splice site boundaries of all six genes were amplified in germline DNA from 2240 invasive EOC cases and 1535 controls. Barcoded fragment libraries were sequenced using the Illumina GAII or HiSeq and sequence data for each subject de-multiplexed prior to interpretation. GATK and Annovar were used for variant detection and annotation. After quality control 2222 cases (99.2%) and 1528 controls (99.5%) were included in the final analysis. We identified 193 EOC cases (8.7%) carrying a deleterious mutation in at least one gene compared with 10 controls (0.65%). Mutations were most frequent in BRCA1 and BRCA2, with 84 EOC cases (3.8%) carrying a BRCA1 mutation and 94 EOC cases (4.2%) carrying a BRCA2 mutation. The combined BRCA1 and BRCA2 mutation prevalence was 11% in high-grade serous disease. Seventeen EOC cases carried a mutation in a mismatch repair gene, including 10 MSH6 mutation carriers (0.45%) and 4 MSH2 mutation carriers (0.18%). At least 1 in 10 women with high-grade serous EOC has a BRCA1 or BRCA2 mutation. The development of next generation sequencing technologies enables rapid mutation screening for multiple susceptibility genes at once, suggesting that routine clinical testing of all incidence cases should be considered. PMID:24728189

  10. Parents' perspectives on the MMR immunisation: a focus group study.

    PubMed Central

    Evans, M; Stoddart, H; Condon, L; Freeman, E; Grizzell, M; Mullen, R

    2001-01-01

    BACKGROUND: The uptake of the combined measles, mumps and rubella immunisation (MMR) in Britain has fallen since 1998, when a link was hypothesised with the development of bowel disorders and childhood autism. Despite reassurances about the safety of MMR, uptake levels remain lower than optimal. We need to understand what influences parents' decisions on whether to accept MMR or not so that health professionals can provide a service responsive to their needs. AIM: To investigate what influences parents' decisions on whether to accept or refuse the primary MMR immunisation and the impact of the recent controversy over its safety. DESIGN: Qualitative study using focus group discussions. SETTING: Forty-eight parents, whose youngest child was between 14 months and three years old, attended groups at community halls in six localities in Avon and Gloucestershire. METHODS: Purposive sampling strategy was used to include parents from a variety of socioeconomic backgrounds. Three groups comprised parents who had accepted MMR and three groups comprised parents who had refused MMR. Data analysis used modified grounded theory techniques incorporating the constant comparative method. RESULTS: All parents felt that the decision about MMR was difficult and stressful, and experienced unwelcome pressure from health professionals to comply. Parents were not convinced by Department of Health reassurances that MMR was the safest and best option for their children and many had accepted MMR unwillingly. Four key factors influenced parents' decisions: (a) beliefs about the risks and benefits of MMR compared with contracting the diseases, (b) information from the media and other sources about the safety of MMR, (c) confidence and trust in the advice of health professionals and attitudes towards compliance with this advice, and (d) views on the importance of individual choice within Government policy on immunisation. CONCLUSIONS: Parents wanted up-to-date information about the risks and

  11. Binding discrimination of MutS to a set of lesions and compound lesions (base damage and mismatch) reveals its potential role as a cisplatin-damaged DNA sensing protein.

    PubMed

    Fourrier, Laurence; Brooks, Peter; Malinge, Jean-Marc

    2003-06-01

    The DNA mismatch repair (MMR) system plays a critical role in sensitizing both prokaryotic and eukaryotic cells to the clinically potent anticancer drug cisplatin. It is thought to mediate cytotoxicity through recognition of cisplatin DNA lesions. This drug generates a range of lesions that may also give rise to compound lesions resulting from the misincorporation of a base during translesion synthesis. Using gel mobility shift competition assays and surface plasmon resonance, we have analyzed the interaction of Escherichia coli MutS protein with site-specifically modified DNA oligonucleotides containing each of the four cisplatin cross-links or a set of compound lesions. The major 1,2-d(GpG) cisplatin intrastrand cross-link was recognized with only a 1.5-fold specificity, whereas a 47-fold specificity was found with a natural G/T containing DNA substrate. The rate of association, kon, for binding to the 1,2-d(GpG) adduct was 3.1 x 104 m-1 s-1 and the specificity of binding was essentially dependent on koff. DNA duplexes containing a single 1,2-d(ApG), 1,3-d(GpCpG) adduct, and an interstrand cross-link of cisplatin were not preferentially recognized. Among 12 DNA substrates, each containing a different cisplatin compound lesion derived from replicative misincorporation of one base opposite either of the 1,2-intrastrand adducts, 10 were specifically recognized including those that are more likely formed in vivo based on cisplatin mutation spectra. Moreover, among these lesions, two compound lesions formed when an adenine was misincorporated opposite a 1,2-d(GpG) adduct were not substrates for the MutY-dependent mismatch repair pathway. The ability of MutS to sense differentially various platinated DNA substrates suggests that cisplatin compound lesions formed during misincorporation of a base opposite either adducted base of both 1,2-intrastrand cross-links are more plausible critical lesions for MMR-mediated cisplatin cytotoxicity. PMID:12654906

  12. Acute hemorrhagic edema of infancy after MMR vaccine.

    PubMed

    Binamer, Yousef

    2015-01-01

    Acute hemorrhagic edema of infancy (AHEI) is a rare type of leuckocytoclastic vasculitis. It affects mainly children less than two years of age. Many precipitating factors have been reported, including infectious etiology and vaccination. We are reporting a two-year-old boy with AHEI after measles, mumps, and rubella (MMR) vaccine. To our knowledge this is the second reported case after an MMR vaccine. PMID:26409801

  13. Addressing MMR Vaccine Resistance in Minnesota's Somali Community.

    PubMed

    Bahta, Lynn; Ashkir, Asli

    2015-10-01

    Over the past 10 years, Minnesota clinicians have noticed increased resistance to MMR vaccination among Somali Minnesotans. Misinformation about a discredited study asserting a link between the MMR vaccine and autism has permeated this community as parents have increasingly become concerned about the prevalence of autism spectrum disorder among their children. As a result, MMR vaccination rates among U.S.-born children of Somali descent are declining. This article reports findings from an investigation by the Minnesota Department of Health, which was undertaken to better understand vaccine hesitancy among Somali Minnesotans. Based on these and other findings, we propose a multi-pronged approach for increasing vaccination rates in this population. PMID:26596077

  14. MMR vaccination and autism: is there a link?

    PubMed

    DeStefano, Frank; Thompson, William W

    2002-07-01

    In 1998, a report was published describing 12 patients with inflammatory bowel conditions and regressive developmental disorders consisting primarily of autism. The authors hypothesised that MMR vaccine may have been responsible for the bowel dysfunction which subsequently resulted in the neurodevelopmental disorders. The suggestion that measles vaccine may cause autism through a persistent bowel infection generated much interest since it provided a possible biological mechanism for a causal association. Epidemiological studies, however, have not found an association between MMR vaccination and autism. Autism has a strong genetic component and its associated neurological defects probably occur during embryonic development. It seems unlikely that a vaccination that is given after birth could cause autism. In a minority of cases, autism may have onset after 1 year of age (regressive autism) but the one epidemiological study that included such cases did not find an association with MMR vaccination. Currently, the weight of the available epidemiological and related evidence does not support a causal link between MMR vaccine and autism. PMID:12904145

  15. MMR-Vaccine and Regression in Autism Spectrum Disorders: Negative Results Presented from Japan

    ERIC Educational Resources Information Center

    Uchiyama, Tokio; Kurosawa, Michiko; Inaba, Yutaka

    2007-01-01

    It has been suggested that the measles, mumps, and rubella vaccine (MMR) is a cause of regressive autism. As MMR was used in Japan only between 1989 and 1993, this time period affords a natural experiment to examine this hypothesis. Data on 904 patients with autism spectrum disorders (ASD) were analyzed. During the period of MMR usage no…

  16. hMSH2 is the most commonly mutated MMR gene in a cohort of Greek HNPCC patients

    PubMed Central

    Apessos, A; Mihalatos, M; Danielidis, I; Kallimanis, G; Agnantis, N J; Triantafillidis, J K; Fountzilas, G; Kosmidis, P A; Razis, E; Georgoulias, V A; Nasioulas, G

    2005-01-01

    Germline mutations in genes encoding proteins involved in DNA mismatch repair are responsible for the autosomal dominantly inherited cancer predisposition syndrome hereditary nonpolyposis colorectal cancer (HNPCC). We describe here analysis of hMLH1 and hMSH2 in nine Greek families referred to our centre for HNPCC. A unique disease-causing mutation has been identified in seven out of nine (78%) families. The types of mutations identified are nonsense (five out of seven) (hMLH1: E557X, R226X; hMSH2: Q158X, R359X and R711X), a 2 bp deletion (hMSH2 1704_1705delAG) and a 2.2 kb Alu-mediated deletion encompassing exon 3 of the hMSH2 gene. The majority of mutations identified in this cohort are found in hMSH2 (77.7%). Furthermore, four of the mutations identified are novel. Finally, a number of novel benign variations were observed in both genes. This is the first report of HNPCC analysis in the Greek population, further underscoring the differences observed in the various geographic populations. PMID:15655560

  17. Strategy for Imidazotetrazine Prodrugs with Anticancer Activity Independent of MGMT and MMR

    PubMed Central

    2012-01-01

    The imidazotetrazine ring is an acid-stable precursor and prodrug of highly reactive alkyl diazonium ions. We have shown that this reactivity can be managed productively in an aqueous system for the generation of aziridinium ions with 96% efficiency. The new compounds are potent DNA alkylators and have antitumor activity independent of the O6-methylguanine-DNA methyltransferase and DNA mismatch repair constraints that limit the use of Temozolomide. PMID:24900418

  18. MMR-vaccine and regression in autism spectrum disorders: negative results presented from Japan.

    PubMed

    Uchiyama, Tokio; Kurosawa, Michiko; Inaba, Yutaka

    2007-02-01

    It has been suggested that the measles, mumps, and rubella vaccine (MMR) is a cause of regressive autism. As MMR was used in Japan only between 1989 and 1993, this time period affords a natural experiment to examine this hypothesis. Data on 904 patients with autism spectrum disorders (ASD) were analyzed. During the period of MMR usage no significant difference was found in the incidence of regression between MMR-vaccinated children and non-vaccinated children. Among the proportion and incidence of regression across the three MMR-program-related periods (before, during and after MMR usage), no significant difference was found between those who had received MMR and those who had not. Moreover, the incidence of regression did not change significantly across the three periods. PMID:16865547

  19. Risk, its perception and the media: the MMR controversy.

    PubMed

    Hackett, Alison Jane

    2008-07-01

    This article aims to explore how the media contributes to and generates 'risk' and 'risk perception.' The example of parents refusing to have their children immunised with the measles, mumps and rubella (MMR) vaccine following negative media reporting will be discussed. The media appears to have an important influence on the perception of risk. We are living in a society that is increasingly aware of risk, and in which risk is socially constructed. It is important that healthcare professionals provide clear, consistent, evidence-based information to clients, ensuring that any areas of uncertainty are acknowledged. Otherwise, the public's trust in the healthcare professional will be undermined. PMID:18655642

  20. A polymorphism in the MSH3 mismatch repair gene is associated with the levels of somatic instability of the expanded CTG repeat in the blood DNA of myotonic dystrophy type 1 patients.

    PubMed

    Morales, Fernando; Vásquez, Melissa; Santamaría, Carolina; Cuenca, Patricia; Corrales, Eyleen; Monckton, Darren G

    2016-04-01

    Somatic mosaicism of the expanded CTG repeat in myotonic dystrophy type 1 is age-dependent, tissue-specific and expansion-biased, contributing toward the tissue-specificity and progressive nature of the symptoms. Previously, using regression modelling of repeat instability we showed that variation in the rate of somatic expansion in blood DNA contributes toward variation in age of onset, directly implicating somatic expansion in the disease pathway. Here, we confirm these results using a larger more genetically homogenous Costa Rican DM1 cohort (p<0.001). Interestingly, we also provide evidence that supports subtle sex-dependent differences in repeat length-dependent age at onset and somatic mutational dynamics. Previously, we demonstrated that variation in the rate of somatic expansion was a heritable quantitative trait. Given the important role that DNA mismatch repair genes play in mediating expansions in mouse models, we tested for modifier gene effects with 13 DNA mismatch gene polymorphisms (one each in MSH2, PMS2, MSH6 and MLH1; and nine in MSH3). After correcting for allele length and age effects, we identified three polymorphisms in MSH3 that were associated with variation in somatic instability: Rs26279 (p=0.003); Rs1677658 (p=0.009); and Rs10168 (p=0.031). However, only the association with Rs26279 remained significant after multiple testing correction. Although we revealed a statistically significant association between Rs26279 and somatic instability, we did not detect an association with the age at onset. Individuals with the A/A genotype for Rs26279 tended to show a greater propensity to expand the CTG repeat than other genotypes. Interestingly, this SNP results in an amino acid change in the critical ATPase domain of MSH3 and is potentially functionally dimorphic. These data suggest that MSH3 is a key player in generating somatic variation in DM1 patients and further highlight MSH3 as a potential therapeutic target. PMID:26994442

  1. Media Reports of Links between MMR and Autism: A Discourse Analysis

    ERIC Educational Resources Information Center

    O'Dell, Lindsay; Brownlow, Charlotte

    2005-01-01

    This paper details an analysis of BBC reporting of the proposed links between MMR and autism. The study aimed to identify main issues arising from the media reports into the link between MMR and the development of autism, and how these contribute to common understandings about people with autism. The study employed a form of discourse analysis to…

  2. No Effect of MMR Withdrawal on the Incidence of Autism: A Total Population Study

    ERIC Educational Resources Information Center

    Honda, Hideo; Shimizu, Yasuo; Rutter, Michael

    2005-01-01

    Background: A causal relationship between the measles, mumps, and rubella (MMR) vaccine and occurrence of autism spectrum disorders (ASD) has been claimed, based on an increase in ASD in the USA and the UK after introduction of the MMR vaccine. However, the possibility that this increase is coincidental has not been eliminated. The unique…

  3. BOREAS RSS-3 Reflectance Measured from a Helicopter-Mounted Barnes MMR

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Nickeson, Jaime (Editor); Walthall, Charles L.; Loechel, Sara; deColstoun, Eric Brown

    2000-01-01

    The BOREAS RSS-3 team acquired helicopter-based radiometric measurements of forested sites with a Barnes MMR. The data were collected in 1994 during the three BOREAS IFCs at numerous tower and auxiliary sites in both the NSA and SSA. The 15-degree FOV of the MMR yielded approximately 79-m ground resolution from an altitude of 300 m. The MMR has seven spectral bands that are similar to the Landsat TM bands, ranging from the blue region to the thermal. The data are stored in tabular ASCII files. The data are stored in tabular ASCII files.

  4. Paediatric immunisation: special emphasis on measles and MMR vaccinations.

    PubMed

    Das, M K; Bhattacharyya, N

    2002-05-01

    The dictum, 'prevention is better than cure', is applicable to all ailments but it can be most easily followed for infectious diseases, increasing numbers of which are being contained by specific vaccinations since the first discovery of smallpox vaccine by Edward Jenner in 1796. Advances in immunology and laboratory techniques including cell culture, genetic engineering and animal experiments have contributed significantly to the production of more and more vaccines, used successfully in preventive programmes. Infectious diseases are widely prevalent in the developing countries. The child population is specially vulnerable to many of them. These infections contribute to high morbidity and mortality and immunisation programmes have been undertaken as preventive measures against them at the national level. Paediatricians and experts are actively engaged in formulating and improving these programmes as problems are faced in their implementation. Much new information is continuously being available in the literature, mostly in specialised journals. The general practitioners, particularly those serving in the remote and vast rural areas, are not likely to have access to these recent developments which they need for self-motivation in initiating the parents with confident advice to have their children properly immunised and also for tackling effectively any problem arising out of immunisation. This paper attempts to discuss the subject of paediatric immunisation with special emphasis being laid on measles and MMR vaccinations. PMID:12418635

  5. MMR (measles, mumps, and rubella) vaccine - what you need to know

    MedlinePlus

    ... its entirety from the CDC MMR (Measles, Mumps, & Rubella) Vaccine Information Statement (VIS): www.cdc.gov/vaccines/ ... Why get vaccinated? Measles, mumps, and rubella are serious ... Measles virus causes rash, cough, runny nose, eye irritation, ...

  6. MMR (Measles, Mumps and Rubella) Vaccine: What You Need to Know

    MedlinePlus

    VACCINE INFORMATION STATEMENT MMR Vaccine (Measles, Mumps and Rubella) What You Need to Know Many Vaccine Information ... vis 1 Why get vaccinated? Measles, mumps, and rubella are serious diseases. Before vaccines they were very ...

  7. MMR (measles, mumps, and rubella) vaccine - what you need to know

    MedlinePlus

    ... taken in its entirety from the CDC MMR (Measles, Mumps, & Rubella) Vaccine Information Statement (VIS): www.cdc. ... Why get vaccinated? Measles, mumps, and rubella are serious ... common, especially among children. Measles Measles virus causes ...

  8. Immunogenicity of second dose measles-mumps-rubella (MMR) vaccine and implications for serosurveillance.

    PubMed

    Pebody, R G; Gay, N J; Hesketh, L M; Vyse, A; Morgan-Capner, P; Brown, D W; Litton, P; Miller, E

    2002-01-15

    Measles and mumps, but not rubella, outbreaks have been reported amongst populations highly vaccinated with a single dose of measles-mumps-rubella (MMR) vaccine. Repeated experience has shown that a two-dose regime of measles vaccine is required to eliminate measles. This paper reports the effect of the first and second MMR doses on specific antibody levels in a variety of populations.2-4 years after receiving a first dose of MMR vaccine at age 12-18 months, it was found that a large proportion of pre-school children had measles (19.5%) and mumps (23.4%) IgG antibody below the putative level of protection. Only a small proportion (4.6%) had rubella antibody below the putative protective level. A total of 41% had negative or equivocal levels to one or more antigens. The proportion measles antibody negative (but not rubella or mumps) was significantly higher in children vaccinated at 12 months of age than at 13-17 months. There was no evidence for correlation of seropositivity to each antigen, other than that produced by a small excess of children (1%) negative to all three antigens. After a second dose of MMR, the proportion negative to one or more antigens dropped to <4%. Examination of national serosurveillance data, found that following an MR vaccine campaign in cohorts that previously received MMR, both measles and rubella antibody levels were initially boosted but declined to pre-vaccination levels within 3 years. Our study supports the policy of administering a second dose of MMR vaccine to all children. However, continued monitoring of long-term population protection will be required and this study suggests that in highly vaccinated populations, total measles (and rubella) IgG antibody levels may not be an accurate reflection of protection. Further studies including qualitative measures, such as avidity, in different populations are merited and may contribute to the understanding of MMR population protection. PMID:11803074

  9. Mismatch-mediated error prone repair at the Immunoglobulin genes

    PubMed Central

    Chahwan, Richard; Edelmann, Winfried; Scharff, Matthew D; Roa, Sergio

    2011-01-01

    The generation of effective antibodies depends upon somatic hypermutation (SHM) and class-switch recombination (CSR) of antibody genes by activation induced cytidine deaminase (AID) and the subsequent recruitment of error prone base excision and mismatch repair. While AID initiates and is required for SHM, more than half of the base changes that accumulate in V regions are not due to the direct deamination of dC to dU by AID, but rather arise through the recruitment of the mismatch repair complex (MMR) to the U:G mismatch created by AID and the subsequent perversion of mismatch repair from a high fidelity process to one that is very error prone. In addition, the generation of double-strand breaks (DSBs) is essential during CSR, and the resolution of AID-generated mismatches by MMR to promote such DSBs is critical for the efficiency of the process. While a great deal has been learned about how AID and MMR cause hypermutations and DSBs, it is still unclear how the error prone aspect of these processes is largely restricted to antibody genes. The use of knockout models and mice expressing mismatch repair proteins with separation-of-function point mutations have been decisive in gaining a better understanding of the roles of each of the major MMR proteins and providing further insight into how mutation and repair are coordinated. Here, we review the cascade of MMR factors and repair signals that are diverted from their canonical error free role and hijacked by B cells to promote genetic diversification of the Ig locus. This error prone process involves AID as the inducer of enzymatically-mediated DNA mismatches, and a plethora of downstream MMR factors acting as sensors, adaptors and effectors of a complex and tightly regulated process from much of which is not yet well understood. PMID:22100214

  10. Measles, mumps, rubella vaccine (Priorix; GSK-MMR): a review of its use in the prevention of measles, mumps and rubella.

    PubMed

    Wellington, Keri; Goa, Karen L

    2003-01-01

    GSK-MMR (Priorix) is a trivalent live attenuated measles, mumps and rubella (MMR) vaccine which contains the Schwarz measles, the RIT 4385 mumps (derived from the Jeryl Lynn mumps strain) and the Wistar RA 27/3 rubella strains. GSK-MMR as a primary vaccination demonstrated high immunogenicity in clinical trials in >7500 infants aged 9-27 months, and was as immunogenic as Merck-MMR (MMR II). However, antimumps seroconversion rates and geometric mean titres (GMTs) were significantly higher in infants receiving GSK-MMR compared with Berna-MMR (Triviraten trade mark ) recipients. Coadministration of GSK-MMR with a varicella vaccine (Varilrix; GSK-MMR/V) did not significantly affect the immunogenicity of GSK-MMR. A persistent immune response to GSK-MMR has been demonstrated in follow-up data from several randomised trials. GMTs for measles, mumps and rubella antibodies remained high in GSK-MMR recipients 1-2 years post-vaccination and were similar to those in Merck-MMR recipients. The immunogenicity of GSK-MMR was high, and similar to that of Merck-MMR, when used as a second dose in children aged 4-6 or 11-12 years who had received a primary vaccination with Merck-MMR in their second year of life. Although there are no protective efficacy data concerning the GSK-MMR vaccine to date, the rubella Wistar RA 27/3 rubella and Schwarz measles strains have well established protective efficacy; the new RIT 4385 mumps strain is expected to afford similar protection from mumps to that achieved with mumps vaccines that contain the Jeryl Lynn mumps strain (e.g. Merck-MMR). GSK-MMR was well tolerated as a primary or secondary vaccination, and in most clinical studies comparing GSK-MMR with Merck-MMR as a primary vaccination in infants, GSK-MMR was associated with significantly fewer local adverse events (e.g. pain, swelling and redness). The incidence of local adverse events with GSK-MMR, GSK-MMR/V or Berna-MMR was similar. GSK-MMR and Merck-MMR were associated with similar rates of

  11. What Every Behavior Analyst Should Know About the "MMR Causes Autism" Hypothesis.

    PubMed

    Ahearn, William H

    2010-01-01

    In 1998, the English physician Andrew Wakefield suggested that the MMR vaccine insults the guts of children who then regress developmentally and become autistic. Although his research did not provide firm evidence for this hypothesis, many believe that (a) the MMR vaccine can cause autism; (b) children with autism typically have gastrointestinal problems; and, (c) a necessary component of treating autism is "treating the gut" through dietary restrictions. Research has subsequently shown that Wakefield's hypothesis is unquestionably false, children with autism are not more likely to have gastrointestinal problems, and there is no sound evidence that diets are a valid treatment for autism. This paper will critically review these topics. PMID:22479671

  12. Long-term immunity to measles, mumps and rubella after MMR vaccination among children with bone marrow transplants.

    PubMed

    Spoulou, V; Giannaki, M; Vounatsou, M; Bakoula, C; Grafakos, S

    2004-06-01

    Measles, mumps and rubella (MMR) vaccine-induced long-term immunity was studied in 30 children with bone marrow transplants (BMT). Immunity at baseline for MMR was 13.3, 33.3 and 66.6%, respectively. MMR vaccination failed to induce adequate and persistent responses to measles and mumps; seropositivity at 1 and 12 months for measles was 26.6 and 23.3% and for mumps 46.6 and 36.6%, respectively. In contrast, 27 of 30 children with a BMT were immune to rubella 1 month after immunization and retained protective antibody levels at 12 months. The MMR-induced anamnestic responses to rubella among all responders were associated with the production of high avidity antibodies. We conclude that a single dose of MMR given at 2 years after BMT induces suboptimal and short-lived immune responses to measles and mumps; a second dose should be recommended for paediatric BMT recipients. PMID:15077129

  13. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children

    PubMed Central

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-01-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles–mumps–rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3–5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  14. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.

    PubMed

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-04-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  15. Evaluating a Web-Based MMR Decision Aid to Support Informed Decision-Making by UK Parents: A Before-and-After Feasibility Study

    ERIC Educational Resources Information Center

    Jackson, Cath; Cheater, Francine M.; Peacock, Rose; Leask, Julie; Trevena, Lyndal

    2010-01-01

    Objective: The objective of this feasibility study was to evaluate the acceptability and potential effectiveness of a web-based MMR decision aid in supporting informed decision-making for the MMR vaccine. Design: This was a prospective before-and-after evaluation. Setting: Thirty parents of children eligible for MMR vaccination were recruited from…

  16. Evidence and policymaking: The introduction of MMR vaccine in the Netherlands

    PubMed Central

    Blume, Stuart; Tump, Janneke

    2010-01-01

    Based on a case-study of the introduction of measles-mumps-rubella (MMR) vaccine in the Netherlands two decades ago, using documentary and archival sources, this paper examines the way evidence is used in policymaking. Starting from the question of ‘what counts as evidence’, two central claims are developed. First, the decision to introduce MMR was not one but a series of decisions going back at least seven years, over the course of which the significance attached to various forms of evidence changed. Second, results of international studies were coming gradually to be of greater significance than evidence gathered from within the Netherlands itself. These developments had, and continue to have, major consequences for national scientific competences. PMID:20667640

  17. The blame frame: media attribution of culpability about the MMR-autism vaccination scare.

    PubMed

    Holton, Avery; Weberling, Brooke; Clarke, Christopher E; Smith, Michael J

    2012-01-01

    Scholars have examined how news media frame events, including responsibility for causing and fixing problems, and how these frames inform public judgment. This study analyzed 281 newspaper articles about a controversial medical study linking the measles, mumps, and rubella (MMR) vaccination with autism. Given criticism of the study and its potential negative impact on vaccination rates across multiple countries, the current study examined actors to whom news media attributed blame for the MMR-vaccine association, sources used to support those attributions, and what solutions (e.g., mobilizing information), if any, were offered. This study provides unique insight by examining the evolution of these attributions over the lifetime of the controversy. Findings emphasize how news media may attribute blame in health risk communication and how that ascription plays a potentially vital role in shaping public behavior. Theoretical and practical implications are discussed. PMID:22236220

  18. Duration of the immune response to MMR vaccine in children of two age-different groups.

    PubMed

    Li Volti, S; Giammanco-Bilancia, G; Grassi, M; Garozzo, R; Gluck, R; Giammanco, G

    1993-05-01

    A combined vaccine against measles, mumps and rubella (MMR) was administered to both a group of children aged 10-12 months simultaneously with booster doses of compulsory diphtheria-tetanus toxoids and oral poliovirus vaccine and a group of children aged 15-24 months who had previously received booster doses of the compulsory vaccines. Apart from one subject belonging to the second group who was non responder and one from the same group who did not seroconvert against the mumps virus alone, 5 to 6 weeks after MMR vaccine administration we found protective levels of antibodies against measles, mumps and rubella viruses in all children. The follow up of both groups at 3 years did not reveal difference between the two groups. Protective levels of serum antibodies against measles and mumps were found in the two groups, although a significant decline of rubella antibodies was shown (p < 0.05). Since the immunogenicity of the vaccines in the two groups did not differ, we recommend that the scientific community reconsider the vaccination schedule until now recommended. In our opinion the MMR vaccine should be administered simultaneously with booster doses of diphtheria-tetanus toxoids and oral poliovirus vaccine at 10-12 months of age because this policy improves parents' compliance, markedly reduces community costs and simplifies routine immunization schedule. PMID:8405317

  19. Factors associated with poor adherence to MMR vaccination in parents who follow vaccination schedule

    PubMed Central

    Restivo, Vincenzo; Napoli, Giuseppe; Marsala, Maria Grazia Laura; Bonanno, Valentina; Sciuto, Valentina; Amodio, Emanuele; Calamusa, Giuseppe; Vitale, Francesco; Firenze, Alberto

    2014-01-01

    Due to median vaccination coverage far from elimination level, Italy is still an European country with high number of measles cases per million of people. In this study we explored potential socioeconomic, medical and demographic factors which could influence the propensity of family members for measles vaccination schedule. A cross-sectional study was performed through a questionnaire administered to the parents of children who received the first dose of MMR vaccine in two different vaccination centers in the Palermo area from November 2012 to May 2013. Overall, the role played by internet (OR 19.8 P = 0.001) and the large number of children in a family (OR 7.3 P ≤ 0.001) were the factors more associated to be unvaccinated, whereas the birth order of the child (OR 0.3 P = < 0.05 for the oldest children vs. the closer young one) and reporting a lack of MMR vaccination as a “personal decision” (OR 0.19 P ≤ 0.01) inversely correlated with the risk of quitting vaccination. These findings can be useful for a better knowledge of disaffection to vaccination practice in local settings and could contribute to improve and maintain timely uptake, suggesting approaches to optimize the uptake of MMR tailored to the needs of local populations. PMID:25483527

  20. Acetylation regulates DNA repair mechanisms in human cells.

    PubMed

    Piekna-Przybylska, Dorota; Bambara, Robert A; Balakrishnan, Lata

    2016-06-01

    The p300-mediated acetylation of enzymes involved in DNA repair and replication has been previously shown to stimulate or inhibit their activities in reconstituted systems. To explore the role of acetylation on DNA repair in cells we constructed plasmid substrates carrying inactivating damages in the EGFP reporter gene, which should be repaired in cells through DNA mismatch repair (MMR) or base excision repair (BER) mechanisms. We analyzed efficiency of repair within these plasmid substrates in cells exposed to deacetylase and acetyltransferase inhibitors, and also in cells deficient in p300 acetyltransferase. Our results indicate that protein acetylation improves DNA mismatch repair in MMR-proficient HeLa cells and also in MMR-deficient HCT116 cells. Moreover, results suggest that stimulated repair of mismatches in MMR-deficient HCT116 cells is done though a strand-displacement synthesis mechanism described previously for Okazaki fragments maturation and also for the EXOI-independent pathway of MMR. Loss of p300 reduced repair of mismatches in MMR-deficient cells, but did not have evident effects on BER mechanisms, including the long patch BER pathway. Hypoacetylation of the cells in the presence of acetyltransferase inhibitor, garcinol generally reduced efficiency of BER of 8-oxoG damage, indicating that some steps in the pathway are stimulated by acetylation. PMID:27104361

  1. What are parents' perspectives on psychological empowerment in the MMR vaccination decision? A focus group study

    PubMed Central

    Fadda, Marta; Galimberti, Elisa; Carraro, Valter; Schulz, Peter J

    2016-01-01

    Objectives Most developed countries do not have compulsory immunisation requirements, but instead issue recommendations. Although parents are expected to make an informed, autonomous (ie, empowered) decision regarding their children's vaccinations, there is no evidence about how parents' interpret this demand nor on the latitude of their decision-making. The goal of this study is to gain insights from parents residing in a low measles-mumps-rubella (MMR) uptake area on what constitutes feelings of empowerment in the decision they have to make on their child's MMR vaccination. Design A qualitative study employing focus group interviews. Setting 11 vaccination centres and hospitals in the Province of Trento, Italy. Participants 24 mothers and 4 fathers of children for whom the MMR vaccination decision was still pending participated in 6 focus groups. Results Autonomy and competence were salient themes in relation to empowerment, and were further connected with beliefs regarding legal responsibility and ethics of freedom concerning the decision, parents' relationship with the paediatrician (trust), feelings of relevance of the decision and related stress, and seeking, avoidance, or fear of vaccination-related information. Competence was interpreted as medical knowledge and information-seeking skills, but it was also related to the extent parents perceived the paediatrician to be competent. Conclusions Since parents' interpretation of empowerment goes beyond mere perceptions of being informed and autonomous and differs across individuals, it is important that this construct be correctly interpreted and implemented by best practice, for instance by explicitly adopting a relational conception of autonomy. Knowing whether parents want to make an empowered decision and what their information and autonomy needs are might help health professionals adapt their communication about immunisation, and promote parental perception of making an informed, autonomous decision. PMID

  2. Application of a five-tiered scheme for standardized classification of 2,360 unique mismatch repair gene variants lodged on the InSiGHT locus-specific database

    PubMed Central

    Plazzer, John-Paul; Greenblatt, Marc S.; Akagi, Kiwamu; Al-Mulla, Fahd; Bapat, Bharati; Bernstein, Inge; Capellá, Gabriel; den Dunnen, Johan T.; du Sart, Desiree; Fabre, Aurelie; Farrell, Michael P.; Farrington, Susan M.; Frayling, Ian M.; Frebourg, Thierry; Goldgar, David E.; Heinen, Christopher D.; Holinski-Feder, Elke; Kohonen-Corish, Maija; Robinson, Kristina Lagerstedt; Leung, Suet Yi; Martins, Alexandra; Moller, Pal; Morak, Monika; Nystrom, Minna; Peltomaki, Paivi; Pineda, Marta; Qi, Ming; Ramesar, Rajkumar; Rasmussen, Lene Juel; Royer-Pokora, Brigitte; Scott, Rodney J.; Sijmons, Rolf; Tavtigian, Sean V.; Tops, Carli M.; Weber, Thomas; Wijnen, Juul; Woods, Michael O.; Macrae, Finlay; Genuardi, Maurizio

    2015-01-01

    Clinical classification of sequence variants identified in hereditary disease genes directly affects clinical management of patients and their relatives. The International Society for Gastrointestinal Hereditary Tumours (InSiGHT) undertook a collaborative effort to develop, test and apply a standardized classification scheme to constitutional variants in the Lynch Syndrome genes MLH1, MSH2, MSH6 and PMS2. Unpublished data submission was encouraged to assist variant classification, and recognized by microattribution. The scheme was refined by multidisciplinary expert committee review of clinical and functional data available for variants, applied to 2,360 sequence alterations, and disseminated online. Assessment using validated criteria altered classifications for 66% of 12,006 database entries. Clinical recommendations based on transparent evaluation are now possible for 1,370 variants not obviously protein-truncating from nomenclature. This large-scale endeavor will facilitate consistent management of suspected Lynch Syndrome families, and demonstrates the value of multidisciplinary collaboration for curation and classification of variants in public locus-specific databases. PMID:24362816

  3. Attitudinal and Demographic Predictors of Measles-Mumps-Rubella Vaccine (MMR) Uptake during the UK Catch-Up Campaign 2008–09: Cross-Sectional Survey

    PubMed Central

    Brown, Katrina; Fraser, Graham; Ramsay, Mary; Shanley, Ruth; Cowley, Noel; van Wijgerden, Johan; Toff, Penelope; Falconer, Michelle; Hudson, Michael; Green, John; Kroll, J. Simon; Vincent, Charles; Sevdalis, Nick

    2011-01-01

    Background and Objective Continued suboptimal measles-mumps-rubella (MMR) vaccine uptake has re-established measles epidemic risk, prompting a UK catch-up campaign in 2008–09 for children who missed MMR doses at scheduled age. Predictors of vaccine uptake during catch-ups are poorly understood, however evidence from routine schedule uptake suggests demographics and attitudes may be central. This work explored this hypothesis using a robust evidence-based measure. Design Cross-sectional self-administered questionnaire with objective behavioural outcome. Setting and Participants 365 UK parents, whose children were aged 5–18 years and had received <2 MMR doses before the 2008–09 UK catch-up started. Main Outcome Measures Parents' attitudes and demographics, parent-reported receipt of invitation to receive catch-up MMR dose(s), and catch-up MMR uptake according to child's medical record (receipt of MMR doses during year 1 of the catch-up). Results Perceived social desirability/benefit of MMR uptake (OR = 1.76, 95% CI = 1.09–2.87) and younger child age (OR = 0.78, 95% CI = 0.68–0.89) were the only independent predictors of catch-up MMR uptake in the sample overall. Uptake predictors differed by whether the child had received 0 MMR doses or 1 MMR dose before the catch-up. Receipt of catch-up invitation predicted uptake only in the 0 dose group (OR = 3.45, 95% CI = 1.18–10.05), whilst perceived social desirability/benefit of MMR uptake predicted uptake only in the 1 dose group (OR = 9.61, 95% CI = 2.57–35.97). Attitudes and demographics explained only 28% of MMR uptake in the 0 dose group compared with 61% in the 1 dose group. Conclusions Catch-up MMR invitations may effectively move children from 0 to 1 MMR doses (unimmunised to partially immunised), whilst attitudinal interventions highlighting social benefits of MMR may effectively move children from 1 to 2 MMR doses (partially to fully immunised). Older children may be

  4. MMR Vaccine: When Is the Right Time for the Second Dose?

    PubMed Central

    Thornton, Terrika A.; Helms, Richard A.; Foster, Stephan L.

    2015-01-01

    Outbreaks of measles have been reported over the past 5 years, particularly affecting children between the ages of 1 and 5 years. Most of these children are younger than the age recommended by the Advisory Committee on Immunization Practices for the second dose of measles-mumps-rubella (MMR) vaccine. Question may arise as to whether strict adherence to the scheduled second dose is required or whether there is opportunity for earlier immunization under special circumstances (e.g., traveling abroad, poor response as evidenced by titer levels). The history of measles, its characteristics, and its evolving past and current immunization policies will be reviewed, focusing on the original intent of the recommended schedule and presenting a case in which deviating from current practice could be justified. PMID:25964732

  5. Managing controversy through consultation: a qualitative study of communication and trust around MMR vaccination decisions

    PubMed Central

    McMurray, Robert; Cheater, Francine M; Weighall, Anna; Nelson, Carolyn; Schweiger, Martin; Mukherjee, Suzanne

    2004-01-01

    Background: Controversy over the measles, mumps, and rubella (MMR) vaccine has reduced uptake, raising concerns of a future disease epidemic. Aims: To explore parents' accounts of decision making relating to the MMR vaccine controversy, identifying uptake determinants and education needs. Design of study: Qualitative interviews analysed using the ‘framework’ approach. Setting: Five general practices in the Leeds area, 2002–2003. Method: Sixty-nine interviews conducted with parents of children aged between 4 and 5 years, and 12 interviews with primary care practitioners, managers and immunisation coordinators serving participating sites. Participants were interviewed one-to-one in a place of their choice. Results: The vaccination decision is primarily a function of parental assessments of the relative acceptability and likelihood of possible outcomes. For most parents the evidence of science and medicine plays little role in the decision. Although local general practitioners and health visitors are trusted information sources, the influence of primary care providers on the vaccination decision is limited by concerns over consultation legitimacy, discussion opportunity, and perceptions of financial and political partiality. Parents and practitioners identify a need for new approaches to support decisions and learning when faced with this and similar healthcare controversies. These include new collaborative approaches to information exchange designed to transform rather than supplant existing parent knowledge as part of an ongoing learning process. Conclusion: The study identified new ways in which parents and practitioners need to be supported in order to increase understanding of medical science and secure more informed decisions in the face of health controversy. PMID:15239914

  6. Reasons for measles cases not being vaccinated with MMR: investigation into parents' and carers' views following a large measles outbreak.

    PubMed

    McHale, P; Keenan, A; Ghebrehewet, S

    2016-03-01

    Uptake rates for the combined measles, mumps and rubella (MMR) vaccine have been below the required 95% in the UK since a retracted and discredited article linking the MMR vaccine with autism and inflammatory bowel disease was released in 1998. This study undertook semi-structured telephone interviews among parents or carers of 47 unvaccinated measles cases who were aged between 13 months and 9 years, during a large measles outbreak in Merseyside. Results showed that concerns over the specific links with autism remain an important cause of refusal to vaccinate, with over half of respondents stating this as a reason. A quarter stated child illness during scheduled vaccination time, while other reasons included general safety concerns and access issues. Over half of respondents felt that more information or a discussion with a health professional would help the decision-making process, while a third stated improved access. There was clear support for vaccination among respondents when asked about current opinions regarding MMR vaccine. The findings support the hypothesis that safety concerns remain a major barrier to MMR vaccination, and also support previous evidence that experience of measles is an important determinant in the decision to vaccinate. PMID:26265115

  7. Persistence of measles antibodies, following changes in the recommended age for the second dose of MMR-vaccine in Portugal.

    PubMed

    Gonçalves, Guilherme; Frade, João; Nunes, Carla; Mesquita, João Rodrigo; Nascimento, Maria São José

    2015-09-22

    In populations vaccinated with two doses of combined measles-mumps-rubella vaccine (MMR), the serum levels of antibodies against measles depend on the vaccination schedule, time elapsed from the last dose and the area-specific epidemiological situation. Variables measuring "schedule" are age at first and second doses of MMR and intervals derived from that. Changes in vaccination schedules have been made in Portugal. The specific objectives of this study were to measure the association between those potential determinants and the concentration of measles-specific IgG antibodies, after the second dose of MMR. Convenience samples of three Portuguese birth cohorts were selected for this study (41, 66 and 60 born, respectively, in 2001-2003, 1990-1993 and 1994-1995). Geometric mean concentrations (GMC) for measles IgG were, respectively, 934, 251 and 144mIU/ml; p<0.001). Anti-measles-IgG serum concentration decreased with time since last vaccination (waning immunity) and was not influenced by any other component of vaccination schedule, namely age at vaccination with the second dose of MMR. Waning levels of measles antibodies have been observed elsewhere but not as fast as it was observed in Portuguese birth cohorts in this study. Changes in the vaccination schedules might have to be considered in the future. PMID:26319061

  8. iPE-MMR: An integrated approach to accurately assign monoisotopic precursor masses to tandem mass spectrometric data

    PubMed Central

    Jung, Hee-Jung; Purvine, Samuel O.; Kim, Hokeun; Petyuk, Vladislav A.; Hyung, Seok-Won; Monroe, Matthew E.; Mun, Dong-Gi; Kim, Kyong-Chul; Park, Jong-Moon; Kim, Su-Jin; Tolic, Nikola; Slysz, Gordon W.; Moore, Ronald J.; Zhao, Rui; Adkins, Joshua N.; Anderson, Gordon A.; Lee, Hookeun; Camp, David G.; Yu, Myeong-Hee; Smith, Richard D.; Lee, Sang-Won

    2010-01-01

    Accurate assignment of monoisotopic precursor masses to tandem mass spectrometric (MS/MS) data is a fundamental and critically important step for successful peptide identifications in mass spectrometry based proteomics. Here we describe an integrated approach that combines three previously reported methods of treating MS/MS data for precursor mass refinement. This combined method, “integrated Post-Experiment Monoisotopic Mass Refinement” (iPE-MMR), integrates steps: 1) generation of refined MS/MS data by DeconMSn; 2) additional refinement of the resultant MS/MS data by a modified version of PE-MMR; 3) elimination of systematic errors of precursor masses using DtaRefinery. iPE-MMR is the first method that utilizes all MS information from multiple MS scans of a precursor ion including multiple charge states, in an MS scan, to determine precursor mass. By combining these methods, iPE-MMR increases sensitivity in peptide identification and provides increased accuracy when applied to complex high-throughput proteomics data. PMID:20863060

  9. Reproductive Decision-Making in MMR Mutation Carriers After Results Disclosure: Impact of Psychological Status in Childbearing Options.

    PubMed

    Duffour, Jacqueline; Combes, Audrey; Crapez, Evelyne; Boissière-Michot, Florence; Bibeau, Frédéric; Senesse, Pierre; Ychou, Marc; Courraud, Julie; de Forges, Hélène; Roca, Lise

    2016-06-01

    Reproductive techniques such as prenatal diagnosis (PND) or preimplantation genetic diagnosis (PGD), although debated, are legally forbidden in France in case of Lynch syndrome. The preference of mutation carriers about their reproductive options is not systematically considered in France. We aimed to prospectively assess the reproductive preferences of mismatch repair mutation carriers consulting in our institution (2003-2010, n = 100). We also considered the short- and long-term post-disclosure psychological impact using the Impact of Events Scale-Revised questionnaire to measure the prevalence of posttraumatic stress disorder (PTSD) in those patients. Complete data were obtained for 34 respondents (17 males, 17 females, median age of 33.5 years [22-59]). Seventeen respondents (57 %) preferred spontaneous natural conception versus 28 % and 35 % choosing PND and PGD, respectively. At results disclosure, respondents mainly explained their distress by fear of premature death (43 %) and transmitting mutated genes (42 %). One year later, this last fear remained predominant in 55 % of subjects. None of the main socio-demographical, psychological or medical variables (including fear of transmitting mutations) was significantly associated with the reproductive preferences. Results disclosure had a real and time-decreasing psychological impact on mutation carriers. Reproductive techniques, expected to decrease the hereditary risk, were not significantly preferred to natural conception. PMID:26392361

  10. Using electronic mail to improve MMR uptake amongst third level students.

    PubMed

    Cooney, F; Ryan, A; Schinaia, N; Breslin, A

    2010-03-01

    This study assessed the usefulness of email in informing third level students about special MMR clinics being provided on campus during a mumps outbreak in the North West of Ireland. Email messages were sent directly to students, informing them of the clinics, inviting them to make a clinic appointment by email and providing details of walk-in clinics. At the clinics, all 177 attendees were asked to fill out a questionnaire and the response rate was 89% (n=158). Regarding the main sources of information about the vaccination clinics, email was selected by 117 (74%) students, word-of-mouth by 27 (17%), posters/leaflets by 8 (5%), and other sources by 6 (4%). Use of email as a source of information was rated as very good/excellent by 115 (73%), as good by 35 (22%) and poor/fair by 8 (5%). This study demonstrates that email is a useful and acceptable way of informing third level students about immunisation clinics in an outbreak situation. PMID:20666068

  11. 'That's just what's expected of you … so you do it': mothers discussions around choice and the MMR vaccination.

    PubMed

    Johnson, Sally; Capdevila, Rose

    2014-01-01

    One of the major shifts in the form and experience of contemporary family life has been the increasing insertion of the 'expert' voice into the relationship between parents and children. This paper focuses on an exploration of mothers' engagement with advice around the combined measles, mumps and rubella (MMR) vaccine. Much of the previous literature utilises a 'decision-making' framework, based on 'risk assessment' whereby mothers' decisions are conceptualised as rooted in complex belief systems, and supposes that that by gaining an understanding of these systems, beliefs and behaviour can be modified and uptake improved. However, less attention has been paid to the ways in which mothers negotiate such advice or the ways in which advice is mediated by positionings, practices and relationships. Analysis of data from a focus group with five mothers identified three themes: (i) Sourcing advice and information, (ii) Constructing 'Mother knows best' and (iii) Negotiating agency. Despite the trustworthiness of advice and information being questioned, an awareness of concerns about the MMR, and health professionals being constructed as remote, ultimate conformity to, and compliance with, the 'system' and 'society' were described as determining MMR 'decisions'. PMID:24580033

  12. Missed Opportunities for Measles, Mumps, and Rubella (MMR) Immunization in Mesoamerica: Potential Impact on Coverage and Days at Risk

    PubMed Central

    Mokdad, Ali H.; Gagnier, Marielle C.; Colson, K. Ellicott; Dansereau, Emily; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Haakenstad, Annie; Johanns, Casey K.; Palmisano, Erin B.; Hernandez, Bernardo; Iriarte, Emma

    2015-01-01

    Background Recent outbreaks of measles in the Americas have received news and popular attention, noting the importance of vaccination to population health. To estimate the potential increase in immunization coverage and reduction in days at risk if every opportunity to vaccinate a child was used, we analyzed vaccination histories of children 11–59 months of age from large household surveys in Mesoamerica. Methods Our study included 22,234 children aged less than 59 months in El Salvador, Guatemala, Honduras, Mexico, Nicaragua, and Panama. Child vaccination cards were used to calculate coverage of measles, mumps, and rubella (MMR) and to compute the number of days lived at risk. A child had a missed opportunity for vaccination if their card indicated a visit for vaccinations at which the child was not caught up to schedule for MMR. A Cox proportional hazards model was used to compute the hazard ratio associated with the reduction in days at risk, accounting for missed opportunities. Results El Salvador had the highest proportion of children with a vaccine card (91.2%) while Nicaragua had the lowest (76.5%). Card MMR coverage ranged from 44.6% in Mexico to 79.6% in Honduras while potential coverage accounting for missed opportunities ranged from 70.8% in Nicaragua to 96.4% in El Salvador. Younger children were less likely to have a missed opportunity. In Panama, children from households with higher expenditure were more likely to have a missed opportunity for MMR vaccination compared to the poorest (OR 1.62, 95% CI: 1.06–2.47). In Nicaragua, compared to children of mothers with no education, children of mothers with primary education and secondary education were less likely to have a missed opportunity (OR 0.46, 95% CI: 0.24–0.88 and OR 0.25, 95% CI: 0.096–0.65, respectively). Mean days at risk for MMR ranged from 158 in Panama to 483 in Mexico while potential days at risk ranged from 92 in Panama to 239 in El Salvador. Conclusions Our study found high levels

  13. MutS Homologues hMSH4 and hMSH5: Genetic Variations, Functions, and Implications in Human Diseases.

    PubMed

    Clark, Nicole; Wu, Xiling; Her, Chengtao

    2013-04-01

    The prominence of the human mismatch repair (MMR) pathway is clearly reflected by the causal link between MMR gene mutations and the occurrence of Lynch syndrome (or HNPCC). The MMR family of proteins also carries out a plethora of diverse cellular functions beyond its primary role in MMR and homologous recombination. In fact, members of the MMR family of proteins are being increasingly recognized as critical mediators between DNA damage repair and cell survival. Thus, a better functional understanding of MMR proteins will undoubtedly aid the development of strategies to effectively enhance apoptotic signaling in response to DNA damage induced by anti-cancer therapeutics. Among the five known human MutS homologs, hMSH4 and hMSH5 form a unique heterocomplex. However, the expression profiles of the two genes are not correlated in a number of cell types, suggesting that they may function independently as well. Consistent with this, these two proteins are promiscuous and thought to play distinct roles through interacting with different binding partners. Here, we describe the gene and protein structures of eukaryotic MSH4 and MSH5 with a particular emphasis on their human homologues, and we discuss recent findings of the roles of these two genes in DNA damage response and repair. Finally, we delineate the potential links of single nucleotide polymorphism (SNP) loci of these two genes with several human diseases. PMID:24082819

  14. Radiometric calibration of the reflective bands of NS001-Thematic Mapper Simulator (TMS) and modular multispectral radiometers (MMR)

    NASA Technical Reports Server (NTRS)

    Markham, Brian L.; Wood, Frank M., Jr.; Ahmad, Suraiya P.

    1988-01-01

    The NS001 Thematic Mapper Simulator scanner (TMS) and several modular multispectral radiometers (MMRs) are among the primary instruments used in the First ISLSCP (International Satellite Land Surface Climatology Project) Field Experiment (FIFE). The NS001 has a continuously variable gain setting. Calibration of the NS001 data is influenced by drift in the dark current level of up to six counts during a mirror scan at typical gain settings. The MMR instruments are being used in their 1 deg FOV configuration on the helicopter and 15 deg FOV on the ground.

  15. Observational Study: Familial Relevance and Oncological Significance of Revised Bethesda Guidelines in Colorectal Patients That Have Undergone Curative Resection

    PubMed Central

    Jung, Won Beom; Kim, Chan Wook; Yoon, Yong Sik; Park, In Ja; Lim, Seok-Byung; Yu, Chang Sik; Kim, Jin Cheon

    2016-01-01

    Abstract Amsterdam criteria for the hereditary nonpolyposis colorectal cancer (HNPCC) exclude most suspect cases of possible hereditary colorectal cancer (CRC). By contrast, revised Bethesda guidelines excessively broaden the disease spectrum. The aim of this study is to retrospectively evaluate the cliniciopathilogical characteristics of patients fulfilling the revised Bethesda guidelines and to review the efficacy and limitations of the revised guidelines. This retrospective study enrolled 3609 patients who underwent curative surgery for primary CRC. Patients were classified into the Bethesda group or the control group according to whether they fulfilled the revised Bethesda guidelines. Patients were further categorized when they fulfilled a minimum of 2 items of the revised guidelines. Individual items were analyzed for deficient mismatch repair (d-MMR). The median follow-up was 82.9 (interquartile range, 72–101) months. Patients in the Bethesda group were younger and had a higher rate of reduced mismatch repair (MMR) protein expression, microsatellite instability, and right colonic involvement (all P < 0.001) than the control group. As a predictor of d-MMR, the revised Bethesda guidelines showed a sensitivity of 63.0% and a specificity of 72.6%. Items 1 and 2, respectively, or the item pair 1 and 2, were independent predictors of d-MMR (all P < 0.001). Patients fulfilling the Bethesda guidelines showed clinicopathological features of HNPCC. The revised Bethesda guidelines appear to be a competent predictor of d-MMR. Specifically, items 1 and 2 are significant predictors of d-MMR and may be relevant to the application of the revised Bethesda guidelines. PMID:26871811

  16. Visualizing the Path of DNA through Proteins Using DREEM Imaging.

    PubMed

    Wu, Dong; Kaur, Parminder; Li, Zimeng M; Bradford, Kira C; Wang, Hong; Erie, Dorothy A

    2016-01-21

    Many cellular functions require the assembly of multiprotein-DNA complexes. A growing area of structural biology aims to characterize these dynamic structures by combining atomic-resolution crystal structures with lower-resolution data from techniques that provide distributions of species, such as small-angle X-ray scattering, electron microscopy, and atomic force microscopy (AFM). A significant limitation in these combinatorial methods is localization of the DNA within the multiprotein complex. Here, we combine AFM with an electrostatic force microscopy (EFM) method to develop an exquisitely sensitive dual-resonance-frequency-enhanced EFM (DREEM) capable of resolving DNA within protein-DNA complexes. Imaging of nucleosomes and DNA mismatch repair complexes demonstrates that DREEM can reveal both the path of the DNA wrapping around histones and the path of DNA as it passes through both single proteins and multiprotein complexes. Finally, DREEM imaging requires only minor modifications of many existing commercial AFMs, making the technique readily available. PMID:26774284

  17. Measles immunization strategy: measles antibody response following MMR II vaccination of children at one year of age.

    PubMed

    Ratnam, S; West, R; Gadag, V; Burris, J

    1996-01-01

    Measles antibody levels were determined by the plaque reduction neutralization (PRN) test in 580 one-year-old children before vaccination and four to six weeks after MMR II vaccination. Fifty-one (8.8%) had maternally derived measles antibody at prevaccination, and this was more common among children of women born before 1967 (10.6%) vs. 4.3%; p < 0.01). Among those with maternal antibody, only 22 (43.1%) responded with a protective PRN titre of over 120, in contrast to 463 (87.5%) of the 529 without maternal antibody at prevaccination (p < 0.0001). Also, the geometric mean titre was significantly lower for the former (114.1 vs. 378.5; p < 0.0001). Overall, 15 (2.6%) of the 580 children had no antibody response after vaccination, and a further 80 (13.8%) had a subprotective response (PRN titre < 120). This lack of response could not be attributed entirely to the presence of maternal measles antibody at the time of vaccination. The MMR II vaccine may not be sufficiently immunogenic in inducing adequate measles antibody response after a single dose given at one year of age. PMID:8753636

  18. Antibodies to measles, mumps and rubella in UK children 4 years after vaccination with different MMR vaccines.

    PubMed

    Miller, E; Hill, A; Morgan-Capner, P; Forsey, T; Rush, M

    1995-06-01

    Persistence of antibodies 4 years after vaccination with measles, mumps and rubella (MMR) vaccine from three different manufacturers was compared in 475 children who received a single injection of vaccine when aged 12-18 months. Antibodies to measles and mumps were measured using a plaque reduction neutralisation assay; rubella antibodies were measured by radial haemolysis and latex agglutination. Children given MMR vaccine containing the Urabe mumps strain were less likely to be antibody negative than those given the Jeryl Lynn mumps strain (39/266, 15% vs 39/204, 19%, p = 0.048). However, the relatively high proportions in both groups without detectable mumps neutralising antibody suggests the probable need for a second dose in order to achieve mumps elimination. No significant differences were found in the proportions with detectable antibody to measles between vaccines containing the Schwarz and the Enders-Edmonston strains. Overall, only 3% of vaccinees were without detectable measles antibody, although a further 28% had a level below 200 mille International Units, the putative protective level for clinical measles. Geometric mean titres (GMTs) to measles were twofold higher in girls vaccinated after than before 14 months of age; GMTs in boys were intermediate and showed no age effect. Over 99% of vaccinees were seropositive to rubella, confirming the excellent immunogenicity of the RA 27/3 rubella strain and the potential for elimination of rubella with a single dose strategy. PMID:7483800

  19. [Wakefield's affair: 12 years of uncertainty whereas no link between autism and MMR vaccine has been proved].

    PubMed

    Maisonneuve, Hervé; Floret, Daniel

    2012-09-01

    In 1998, a Lancet paper described 12 cases of children with autism, and having been vaccinated (MMR) in the United Kingdom; medias presented the information to the lay public, stating that a link was possible. In 2004, The Lancet published letters responding to allegations against the paper. Later, it was established that no link existed between MMR and autism; few years and many publications were necessary to conclude to the absence of evidence. In 2010, the General Medical Council published a report against Dr Wakefield, first author of the 1998 paper, and showing that the children hospital records did not contain the evidence; hospital records differed from the published paper; the Lancet retracted the 1998 paper. In 2011, Brian Deer, a journalist, published the complete story in theBMJ: in 1996, Wakefield was approached by lawyers representing an anti-vaccine lobby, and they supported the Wakefield research. Dr Wakefield left England; in 2012 he works in Texas, USA, for anti-vaccine lobbies. PMID:22748860

  20. Small-angle X-ray scattering analysis reveals the ATP-bound monomeric state of the ATPase domain from the homodimeric MutL endonuclease, a GHKL phosphotransferase superfamily protein.

    PubMed

    Iino, Hitoshi; Hikima, Takaaki; Nishida, Yuya; Yamamoto, Masaki; Kuramitsu, Seiki; Fukui, Kenji

    2015-05-01

    DNA mismatch repair is an excision system that removes mismatched bases chiefly generated by replication errors. In this system, MutL endonucleases direct the excision reaction to the error-containing strand of the duplex by specifically incising the newly synthesized strand. Both bacterial homodimeric and eukaryotic heterodimeric MutL proteins belong to the GHKL ATPase/kinase superfamily that comprises the N-terminal ATPase and C-terminal dimerization regions. Generally, the GHKL proteins show large ATPase cycle-dependent conformational changes, including dimerization-coupled ATP binding of the N-terminal domain. Interestingly, the ATPase domain of human PMS2, a subunit of the MutL heterodimer, binds ATP without dimerization. The monomeric ATP-bound state of the domain has been thought to be characteristic of heterodimeric GHKL proteins. In this study, we characterized the ATP-bound state of the ATPase domain from the Aquifex aeolicus MutL endonuclease, which is a homodimeric GHKL protein unlike the eukaryotic MutL. Gel filtration, dynamic light scattering, and small-angle X-ray scattering analyses clearly showed that the domain binds ATP in a monomeric form despite its homodimeric nature. This indicates that the uncoupling of dimerization and ATP binding is a common feature among bacterial and eukaryotic MutL endonucleases, which we suggest is closely related to the molecular mechanisms underlying mismatch repair. PMID:25809295

  1. Identification of Nuclear Protein Targets for Six Leukemogenic Tyrosine Kinases Governed by Post-Translational Regulation

    PubMed Central

    Pierce, Andrew; Williamson, Andrew; Jaworska, Ewa; Griffiths, John R.; Taylor, Sam; Walker, Michael; O’Dea, Mark Aspinall; Spooncer, Elaine; Unwin, Richard D.; Poolman, Toryn; Ray, David; Whetton, Anthony D.

    2012-01-01

    Mutated tyrosine kinases are associated with a number of different haematological malignancies including myeloproliferative disorders, lymphoma and acute myeloid leukaemia. The potential commonalities in the action of six of these leukemogenic proteins on nuclear proteins were investigated using systematic proteomic analysis. The effects on over 3600 nuclear proteins and 1500 phosphopeptide sites were relatively quantified in seven isogenic cell lines. The effects of the kinases were diverse although some commonalities were found. Comparison of the nuclear proteomic data with transcriptome data and cytoplasmic proteomic data indicated that the major changes are due to post-translational mechanisms rather than changes in mRNA or protein distribution. Analysis of the promoter regions of genes whose protein levels changed in response to the kinases showed the most common binding site found was that for NFκB whilst other sites such as those for the glucocorticoid receptor were also found. Glucocorticoid receptor levels and phosphorylation were decreased by all 6 PTKs. Whilst Glucocorticoid receptor action can potentiate NFκB action those proteins where genes have NFκB binding sites were in often regulated post-translationally. However all 6 PTKs showed evidence of NFkB pathway modulation via activation via altered IkB and NFKB levels. Validation of a common change was also undertaken with PMS2, a DNA mismatch repair protein. PMS2 nuclear levels were decreased in response to the expression of all 6 kinases, with no concomitant change in mRNA level or cytosolic protein level. Response to thioguanine, that requires the mismatch repair pathway, was modulated by all 6 oncogenic kinases. In summary common targets for 6 oncogenic PTKs have been found that are regulated by post-translational mechanisms. They represent potential new avenues for therapies but also demonstrate the post-translational regulation is a key target of leukaemogenic kinases. PMID:22745689

  2. Functional Residues on the Surface of the N-terminal domain of Yeast Pms1

    PubMed Central

    Arana, Mercedes E.; Holmes, Shannon F.; Fortune, John M.; Moon, Andrea F.; Pedersen, Lars C.; Kunkel, Thomas A.

    2010-01-01

    Saccharomyces cerevisiae MutLα is a heterodimer of Mlh1 and Pms1 that participates in DNA mismatch repair (MMR). Both proteins have weakly conserved C-terminal regions (CTD), with the CTD of Pms1 harboring an essential endonuclease activity. These proteins also have conserved N-terminal domains (NTD) that bind and hydrolyze ATP and bind to DNA. To better understand Pms1 functions and potential interactions with DNA and/or other proteins, we solved the 2.5Å crystal structure of yeast Pms1 (yPms1) NTD. The structure is similar to thehomologous NTDs of E. coli MutL and human PMS2, including the site involved in ATP binding and hydrolysis. The structure reveals a number of conserved, positively charged surface residues that do not interact with other residues in the NTD and are therefore candidates for interactions with DNA, with the CTD and/or with other proteins. When these were replaced with glutamate, several replacements resulted in yeast strains with elevated mutation rates. Two replacements also resulted in NTDs with decreased DNA binding affinity in vitro, suggesting that these residues contribute to DNA binding that is important for mismatch repair. Elevated mutation rates also resulted from surface residue replacements that did not affect DNA binding, suggesting that these conserved residues serve other functions, possibly involving interactions with other MMR proteins. PMID:20138591

  3. The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex

    PubMed Central

    2012-01-01

    Background Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Results Isolates of the B. plicatilis species complex have 1–4 copies of mmr-b, each composed of 2–9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Conclusions Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may

  4. Information is in the eye of the beholder: Seeking information on the MMR vaccine through an Internet search engine.

    PubMed

    Yom-Tov, Elad; Fernandez-Luque, Luis

    2014-01-01

    Vaccination campaigns are one of the most important and successful public health programs ever undertaken. People who want to learn about vaccines in order to make an informed decision on whether to vaccinate are faced with a wealth of information on the Internet, both for and against vaccinations. In this paper we develop an automated way to score Internet search queries and web pages as to the likelihood that a person making these queries or reading those pages would decide to vaccinate. We apply this method to data from a major Internet search engine, while people seek information about the Measles, Mumps and Rubella (MMR) vaccine. We show that our method is accurate, and use it to learn about the information acquisition process of people. Our results show that people who are pro-vaccination as well as people who are anti-vaccination seek similar information, but browsing this information has differing effect on their future browsing. These findings demonstrate the need for health authorities to tailor their information according to the current stance of users. PMID:25954435

  5. Information is in the eye of the beholder: Seeking information on the MMR vaccine through an Internet search engine

    PubMed Central

    Yom-Tov, Elad; Fernandez-Luque, Luis

    2014-01-01

    Vaccination campaigns are one of the most important and successful public health programs ever undertaken. People who want to learn about vaccines in order to make an informed decision on whether to vaccinate are faced with a wealth of information on the Internet, both for and against vaccinations. In this paper we develop an automated way to score Internet search queries and web pages as to the likelihood that a person making these queries or reading those pages would decide to vaccinate. We apply this method to data from a major Internet search engine, while people seek information about the Measles, Mumps and Rubella (MMR) vaccine. We show that our method is accurate, and use it to learn about the information acquisition process of people. Our results show that people who are pro-vaccination as well as people who are anti-vaccination seek similar information, but browsing this information has differing effect on their future browsing. These findings demonstrate the need for health authorities to tailor their information according to the current stance of users. PMID:25954435

  6. Stabilization of perfect and imperfect tandem repeats by single-strand DNA exonucleases.

    PubMed

    Feschenko, Vladimir V; Rajman, Luis A; Lovett, Susan T

    2003-02-01

    Rearrangements between tandemly repeated DNA sequences are a common source of genetic instability. Such rearrangements underlie several human genetic diseases. In many organisms, the mismatch-repair (MMR) system functions to stabilize repeats when the repeat unit is short or when sequence imperfections are present between the repeats. We show here that the action of single-stranded DNA (ssDNA) exonucleases plays an additional, important role in stabilizing tandem repeats, independent of their role in MMR. For perfect repeats of approximately 100 bp in Escherichia coli that are not susceptible to MMR, exonuclease (Exo)-I, ExoX, and RecJ exonuclease redundantly inhibit deletion. Our data suggest that >90% of potential deletion events are avoided by the combined action of these three exonucleases. Imperfect tandem repeats, less prone to rearrangements, are stabilized by both the MMR-pathway and ssDNA-specific exonucleases. For 100-bp repeats containing four mispairs, ExoI alone aborts most deletion events, even in the presence of a functional MMR system. By genetic analysis, we show that the inhibitory effect of ssDNA exonucleases on deletion formation is independent of the MutS and UvrD proteins. Exonuclease degradation of DNA displaced during the deletion process may abort slipped misalignment. Exonuclease action is therefore a significant force in genetic stabilization of many forms of repetitive DNA. PMID:12538867

  7. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  8. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination.

    PubMed

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-04-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and -deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR. PMID:26743004

  9. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions.

    PubMed

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G; de Wind, Niels

    2015-04-13

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa-Atr-Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  10. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination

    PubMed Central

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-01-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and –deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR. PMID:26743004

  11. The impact of the media on the decision of parents in South Wales to accept measles-mumps-rubella (MMR) immunization.

    PubMed

    Walsh, S; Thomas, D Rh; Mason, B W; Evans, M R

    2015-02-01

    A large measles outbreak occurred in South Wales in 2012/2013. The outbreak has been attributed to low take-up of measles-mumps-rubella (MMR) immunization in the early 2000s. To understand better the factors that led to this outbreak we present the findings of a case-control study carried out in the outbreak area in 2001 to investigate parents' decision on whether to accept MMR. Parents who decided not to take-up MMR at the time were more likely to be older and better educated, more likely to report being influenced by newspapers [adjusted odds ratio (aOR) 3·07, 95% confidence interval (CI) 1·62-5·80], television (aOR 3·30, 95% CI 1·70-6·43), the internet (aOR 7·23, 3·26-16·06) and vaccine pressure groups (aOR 5·20, 95% CI 2·22-12·16), and less likely to be influenced by a health visitor (aOR 0·30, 95% CI 0·16-0·57). In this area of Wales, daily English-language regional newspapers, UK news programmes and the internet appeared to have a powerful negative influence. We consider the relevance of these findings to the epidemiology of the outbreak and the subsequent public health response. PMID:25600667

  12. Update on Lynch syndrome genomics.

    PubMed

    Peltomäki, Päivi

    2016-07-01

    Four main DNA mismatch repair (MMR) genes have been identified, MLH1, MSH2, MSH6, and PMS2, which when mutated cause susceptibility to Lynch syndrome (LS). LS is one of the most prevalent hereditary cancer syndromes in man and accounts for 1-3 % of unselected colorectal carcinomas and some 15 % of those with microsatellite instability and/or absent MMR protein. The International Society for Gastrointestinal Hereditary Tumours (InSiGHT) maintains a database for LS-associated mutations since 1996. The database was recently reorganized to efficiently gather published and unpublished data and to classify the variants according to a five-tiered scheme linked to clinical recommendations. This review provides an update of germline mutations causing susceptibility to LS based on information available in the InSiGHT database and the latest literature. MMR gene mutation profiles, correlations between genotype and phenotype, and possible mechanisms leading to the characteristic spectrum of tumors in LS are discussed in light of the different functions of MMR proteins, many of which directly serve cancer avoidance. PMID:26873718

  13. Tumor Microsatellite Instability in Early Onset Gastric Cancer

    PubMed Central

    Bacani, Julinor; Zwingerman, Rhonda; Di Nicola, Nando; Spencer, Samantha; Wegrynowski, Trish; Mitchell, Kyle; Hay, Kazuko; Redston, Mark; Holowaty, Eric; Huntsman, David; Pollett, Aaron; Riddell, Robert; Gallinger, Steven

    2005-01-01

    Gastric cancer (GC) remains a leading cause of cancer mortality worldwide. Genetic factors are implicated, including DNA mismatch repair (MMR) deficiency manifested as tumor microsatellite instability (MSI). However, a standardized panel of markers and a definition of low-versus-high level MSI in GC are lacking. We examined a population-based cohort of early onset (≤50 yrs) gastric cancer. We identified 211 cases of early onset gastric cancer in Central-East Ontario from 1989 to 1993, with archival material available for 139 cases. Testing included a six-mononucleotide marker panel and a three-MMR immunohistochemical panel. Overall, 30% (41 of 139) of GC were MSI+, with allelic shifts at one to eight markers. An unexpected discordance between the BAT-25, BAT-26, and BAT-40 markers was observed in the MSI+ cases. Six cases showing multiple loci instability (≥3 markers MSI+/MSI-high) demonstrated MMR protein deficiency. Three novel hMLH1 mutations (two germline frameshift and one somatic nonsense) were also found. The only significant clinicopathological associations were increased tumor size in MSI+ cases (P = 0.04) and Lauren histotype (P = 0.006) and tumor grade (P = 0.007) in MSI-high cases. Tumor size, location, depth, nodal status, and Ming subtype were significant prognostic variables. Therefore, we propose a new definition of high-level MSI based on unifying characteristics of instability of more than or equal to three of six mononucleotide markers and loss of MMR protein expression. PMID:16237216

  14. Combined Microsatellite Instability, MLH1 Methylation Analysis, and Immunohistochemistry for Lynch Syndrome Screening in Endometrial Cancers From GOG210: An NRG Oncology and Gynecologic Oncology Group Study

    PubMed Central

    Goodfellow, Paul J.; Billingsley, Caroline C.; Lankes, Heather A.; Ali, Shamshad; Cohn, David E.; Broaddus, Russell J.; Ramirez, Nilsa; Pritchard, Colin C.; Hampel, Heather; Chassen, Alexis S.; Simmons, Luke V.; Schmidt, Amy P.; Gao, Feng; Brinton, Louise A.; Backes, Floor; Landrum, Lisa M.; Geller, Melissa A.; DiSilvestro, Paul A.; Pearl, Michael L.; Lele, Shashikant B.; Powell, Matthew A.; Zaino, Richard J.; Mutch, David

    2015-01-01

    Purpose The best screening practice for Lynch syndrome (LS) in endometrial cancer (EC) remains unknown. We sought to determine whether tumor microsatellite instability (MSI) typing along with immunohistochemistry (IHC) and MLH1 methylation analysis can help identify women with LS. Patients and Methods ECs from GOG210 patients were assessed for MSI, MLH1 methylation, and mismatch repair (MMR) protein expression. Each tumor was classified as having normal MMR, defective MMR associated with MLH1 methylation, or probable MMR mutation (ie, defective MMR but no methylation). Cancer family history and demographic and clinical features were compared for the three groups. Lynch mutation testing was performed for a subset of women. Results Analysis of 1,002 ECs suggested possible MMR mutation in 11.8% of tumors. The number of patients with a family history suggestive of LS was highest among women whose tumors were classified as probable MMR mutation (P = .001). Lynch mutations were identified in 41% of patient cases classified as probable mutation (21 of 51 tested). One of the MSH6 Lynch mutations was identified in a patient whose tumor had intact MSH6 expression. Age at diagnosis was younger for mutation carriers than noncarriers (54.3 v 62.3 years; P < .01), with five carriers diagnosed at age > 60 years. Conclusion Combined MSI, methylation, and IHC analysis may prove useful in Lynch screening in EC. Twenty-four percent of mutation carriers presented with ECs at age > 60 years, and one carrier had an MSI-positive tumor with no IHC defect. Restricting Lynch testing to women diagnosed at age < 60 years or to women with IHC defects could result in missing a substantial fraction of genetic disease. PMID:26552419

  15. Establishment of a standard seed lot system of an Iranian Mumps virus strain; RS-12, for mass production of mumps and MMR vaccines

    PubMed Central

    Shahkarami, M K; Mokhtari Azad, T; Aghaiypour, K; Shafyi, A; Taqavian, M; Mohammadi, A

    2012-01-01

    Background At present the mumps virus strain used for production of mumps vaccine for our local use is Hoshino strain. However, according to our National public health policies, this strain should be replaced with a safer strain. Based on our previous data, the Iranian mumps strain; RS-12 has been proved to be the most suitable alternative to Hoshino strain with little or no adverse events following vaccination Methods The aim of the present study was to optimize propagation of RS-12 strain and prepare standard seeds for vaccine mass production. The virus was inoculated to cells using different methods and different multiplicity of infection (MOI). The viral suspensions were harvested using different methods. Quality control tests were run at different stages. Results Maximum viral yield was achieved when cell suspensions were inoculated at MOI of 1:10 and incubated at 36-37ºC for 48 hours, followed by replacement of the media and incubation at 33-34 ºC for 5-7 days. Filtration did not affect the viral titre. A standard seed lot system was successfully established and experimental batches of MMR vaccines were produced. Conclusion The established seed lot system has met all requirements of WHO regulations and could be used in mass production of safe and efficacious mumps and MMR vaccines. Clinical trials are in progress for this newly produced vaccine. PMID:23115712

  16. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. PMID:26329766

  17. Immunohistochemistry screening of sebaceous lesions for Muir-Torre syndrome in a 26-year period in a Mexican population.

    PubMed

    Archer-Dubon, Carla; Alvarez-Zavala, Bertha; Reyes, Edgardo; Orozco-Topete, Rocio

    2008-01-01

    Muir-Torre syndrome (MTS) is an autosomal dominant genodermatosis defined as the association of rare sebaceous gland skin tumors, keratoacanthomas, and a personal or familial history of malignant visceral tumors. Germline mutations in certain mismatch repair genes (MMR) have been identified in MTS families and their identification is a cornerstone for diagnosis of MTS. We reviewed our series of sebaceous neoplasms and performed immunohistochemistry (IHC) in order to screen for new MTS cases. Sebaceous neoplasms and visceral tumors from the same patient diagnosed between 1980-2006 were included. Immunohistochemistry to determine the presence or absence of MMR gene products in skin and visceral tumors was performed with mouse monoclonal antibodies anti-MSH2, anti-MSH6 and anti-MLH1. Six sebaceous neoplasms were identified in six females. Four patients presented a lack of expression of at least one of the MMR proteins in visceral and cutaneous neoplasms, thus warranting the diagnosis of MTS. Immunohistochemistry is a useful and accessible technique for the characterization of MMR gene expression in patients with sebaceous neoplasms. PMID:19265614

  18. Meta-analysis of mismatch repair polymorphisms within the cogent consortium for colorectal cancer susceptibility.

    PubMed

    Picelli, Simone; Lorenzo Bermejo, Justo; Chang-Claude, Jenny; Hoffmeister, Michael; Fernández-Rozadilla, Ceres; Carracedo, Angel; Castells, Antoni; Castellví-Bel, Sergi; Naccarati, Alessio; Pardini, Barbara; Vodickova, Ludmila; Müller, Heiko; Talseth-Palmer, Bente A; Stibbard, Geoffrey; Peterlongo, Paolo; Nici, Carmela; Veneroni, Silvia; Li, Li; Casey, Graham; Tenesa, Albert; Farrington, Susan M; Tomlinson, Ian; Moreno, Victor; van Wezel, Tom; Wijnen, Juul; Dunlop, Malcolm; Radice, Paolo; Scott, Rodney J; Vodicka, Pavel; Ruiz-Ponte, Clara; Brenner, Hermann; Buch, Stephan; Völzke, Henry; Hampe, Jochen; Schafmayer, Clemens; Lindblom, Annika

    2013-01-01

    In the last four years, Genome-Wide Association Studies (GWAS) have identified sixteen low-penetrance polymorphisms on fourteen different loci associated with colorectal cancer (CRC). Due to the low risks conferred by known common variants, most of the 35% broad-sense heritability estimated by twin studies remains unexplained. Recently our group performed a case-control study for eight Single Nucleotide Polymorphisms (SNPs) in 4 CRC genes. The present investigation is a follow-up of that study. We have genotyped six SNPs that showed a positive association and carried out a meta-analysis based on eight additional studies comprising in total more than 8000 cases and 6000 controls. The estimated recessive odds ratio for one of the SNPs, rs3219489 (MUTYH Q338H), decreased from 1.52 in the original Swedish study, to 1.18 in the Swedish replication, and to 1.08 in the initial meta-analysis. Since the corresponding summary probability value was 0.06, we decided to retrieve additional information for this polymorphism. The incorporation of six further studies resulted in around 13000 cases and 13000 controls. The newly updated OR was 1.03. The results from the present large, multicenter study illustrate the possibility of decreasing effect sizes with increasing samples sizes. Phenotypic heterogeneity, differential environmental exposures, and population specific linkage disequilibrium patterns may explain the observed difference of genetic effects between Sweden and the other investigated cohorts. PMID:24039736

  19. Improvement of ENU Mutagenesis Efficiency Using Serial Injection and Mismatch Repair Deficiency Mice

    PubMed Central

    Pitstick, Rose; Peters, Janet; Carlson, George A.

    2016-01-01

    ENU mutagenesis is a powerful method for generating novel lines of mice that are informative with respect to both fundamental biological processes and human disease. Rapid developments in genomic technology have made the task of identifying causal mutations by positional cloning remarkably efficient. One limitation of this approach remains the mutation frequency achievable using standard treatment protocols, which currently generate approximately 1–2 sequence changes per megabase when optimized. In this study we used two strategies to attempt to increase the number of mutations induced by ENU treatment. One approach employed mice carrying a mutation in the DNA repair enzyme Msh6. The second strategy involved injection of ENU to successive generations of mice. To evaluate the number of ENU-induced mutations, single mice or pooled samples were analyzed using whole exome sequencing. The results showed that there is considerable variability in the induced mutation frequency using these approaches, but an overall increase in ENU-induced variants from one generation to another was observed. The analysis of the mice deficient for Msh6 also showed an increase in the ENU-induced variants compared to the wild-type ENU-treated mice. However, in both cases the increase in ENU-induced mutation frequency was modest. PMID:27441645

  20. Localization of MLH3 at the Centrosomes

    PubMed Central

    Roesner, Lennart M.; Mielke, Christian; Faehnrich, Silke; Merkhoffer, Yvonne; Dittmar, Kurt E. J.; Drexler, Hans G.; Dirks, Wilhelm G.

    2014-01-01

    Mutations in human DNA mismatch repair (MMR) genes are commonly associated with hereditary nonpolyposis colorectal cancer (HNPCC). MLH1 protein heterodimerizes with PMS2, PMS1, and MLH3 to form MutLα, MutLβ, and MutLγ, respectively. We reported recently stable expression of GFP-linked MLH3 in human cell lines. Monitoring these cell lines during the cell cycle using live cell imaging combined with confocal microscopy, we detected accumulation of MLH3 at the centrosomes. Fluorescence recovery after photobleaching (FRAP) revealed high mobility and fast exchange rates at the centrosomes as it has been reported for other DNA repair proteins. MLH3 may have a role in combination with other repair proteins in the control of centrosome numbers. PMID:25116689

  1. Duration of rubella immunity induced by two-dose measles, mumps and rubella (MMR) vaccination. A 15-year follow-up in Finland.

    PubMed

    Davidkin, I; Peltola, H; Leinikki, P; Valle, M

    2000-07-15

    A national two-dose vaccination program with a combined measles, mumps and rubella (MMR-II) vaccine was introduced in Finland, in 1982, immunizing children at the ages of 14-18 months and 6 years. Antibody levels were determined from serial samples from a group of originally 350 children during 15 years. The latest samples were taken 15.5 years after the first vaccination and 70% of the children could still be reached. The aim of this study was to determine the kinetics of rubella antibodies induced by the MMR-II vaccine in these individuals. Rubella antibodies were analyzed from three different cohorts: Group I seronegative children (n=166) vaccinated at 14-18 months and 6 years, Group II seronegative children (n=139) and Group III seropositive children (n=16) vaccinated at 6 and 11-13 years. Samples collected 0-9 years after vaccination were analyzed by hemolysis-in-gel (HIG) and later samples by enzyme immunoassay (EIA) techniques. The primary vaccination induced 100% seropositivity in vaccinees with a mean zone diameter of 10 (+/-1.3), 10.2 (+/-1.1) and 11.5 (+/-0.9) mm, in Groups I, II and III, respectively. The seropositivity rate was still high at 15 years, 99%, 100% and 100% with the geometric mean titer 23, 46 and 105 IU/ml, respectively. At 15 years, antibody levels <15 IU/ml which is the suggested protective level, were found in 31, 9 and 0% of children in Groups I, II and III, respectively. Because almost a third of the individuals in Group I now, at the age of 17 years, had low levels of rubella antibodies, it is possible that rubella infections may re-emerge during pregnancy. A careful surveillance including serological follow-up is therefore very important. PMID:10856790

  2. Do children who receive an ‘early dose’ of MMR vaccine during a measles outbreak return for their regularly scheduled dose? A retrospective population-based study

    PubMed Central

    Guo, Xiaoyan; Simmonds, Kimberley A; Svenson, Jill; MacDonald, Shannon E

    2016-01-01

    Background Children under the age of 12 months may receive an early dose of measles–mumps–rubella (MMR) vaccine to provide short-term protection in the case of a disease outbreak. Following a measles outbreak in Alberta, Canada, there was concern that children who received an early dose may not be returning for their routinely scheduled dose at 12 months, leaving them vulnerable to disease in the long term. Methods This population-based study of children born between 2006 and 2014 used administrative health data to assess coverage and timeliness of the first routine dose of MMR vaccine administered at age 12–24 months for children who received an early dose of the vaccine due to a disease outbreak. We compared this group to children who received an early dose due to travel to a measles-endemic region and to children who did not receive an early dose. Results Only 5.5% of 366 351 children received an early dose. Coverage for the routine dose at age 24 months was 96.5% for children receiving an outbreak dose, 92.2% for those travelling to measles-endemic regions and 86.6% for those without an early dose (p<0.0001). The multivariable Cox proportional hazard analysis, controlling for neighbourhood income, place of residence and interaction effects, determined that, as compared to the general cohort, the outbreak group was most likely to obtain the first routine dose (adjusted HR (aHR): 1.52, 95% CI 1.44 to 1.60), followed by the travel group (aHR: 1.26, 95% CI 1.18 to 1.34). Conclusions It is reassuring that the majority of children who received an early dose returned for their routine dose and did so in a timely manner. PMID:27580838

  3. Visualizing Protein Movement on DNA at the Single-molecule Level using DNA Curtains

    PubMed Central

    Silverstein, Timothy D.; Gibb, Bryan; Greene, Eric C.

    2014-01-01

    A fundamental feature of many nucleic-acid binding proteins is their ability to move along DNA either by diffusion-based mechanisms or by ATP-hydrolysis driven translocation. For example, most site-specific DNA-binding proteins must diffuse to some extent along DNA to either find their target sites, or to otherwise fulfill their biological roles. Similarly, nucleic-acid translocases such as helicases and polymerases must move along DNA to fulfill their functions. In both instances, the proteins must also be capable of moving in crowded environments while navigating through DNA-bound obstacles. These types of behaviors can be challenging to analyze by bulk biochemical methods because of the transient nature of the interactions, and/or heterogeneity of the reaction intermediates. The advent of single-molecule methodologies has overcome some of these problems, and has led to many new insights into the mechanisms that contribute to protein motion along DNA. We have developed DNA curtains as a tool to facilitate single molecule observations of protein-nucleic acid interactions, and we have applied these new research tools to systems involving both diffusive-based motion as well as ATP directed translocation. Here we highlight these studies by first discussing how diffusion contributes to target searches by proteins involved in post-replicative mismatch repair. We then discuss DNA curtain assays of two different DNA translocases, RecBCD and FtsK, which participate in homologous DNA recombination and site-specific DNA recombination, respectively. PMID:24598576

  4. Analysis of DNA repair helicase UvrD from Arabidopsis thaliana and Oryza sativa.

    PubMed

    Tuteja, Renu; Tuteja, Narendra

    2013-10-01

    Mismatch repair (MMR) proteins play important roles in maintaining genome stability in all the organisms. Studies of MMR genes in plants have identified several homologs of the Escherichia coli genes. Crop yield is directly related to genome stability, which is crucially required for optimal plant growth and development. Numerous genotoxic stresses such as UV light, radiations, pollutants and heavy metals cause DNA damage leading to genome instability, which can interfere with the plant growth and crop productivity. But the efficient repair mechanisms can help to overcome the deleterious effects of the damage. Therefore it is important to study the genes involved in various repair pathways in the plants in greater detail. UvrD helicase is a component of MMR complex and plays an essential role in the DNA repair by providing the unwinding function. In the present manuscript we present an in silico analysis of UvrD helicase from two plant species (Arabidopsis and rice). The Arabidopsis thaliana and Oryza sativa UvrD are 1149 (~129 kDa) and 1165 amino-acids (~130 kDa) proteins, respectively. These proteins contain all the conserved domains and are larger than the E. coli UvrD because they contain a longer N-terminal extension. In order to decipher the role of plant UvrD in various stresses it will be important to study the biochemical and functional properties of this enzyme. PMID:23974358

  5. MicroRNA-21 induces resistance to 5-fluorouracil by down-regulating human DNA MutS homolog 2 (hMSH2).

    PubMed

    Valeri, Nicola; Gasparini, Pierluigi; Braconi, Chiara; Paone, Alessio; Lovat, Francesca; Fabbri, Muller; Sumani, Khlea M; Alder, Hansjuerg; Amadori, Dino; Patel, Tushar; Nuovo, Gerard J; Fishel, Richard; Croce, Carlo M

    2010-12-01

    The overexpression of microRNA-21 (miR-21) is linked to a number of human tumors including colorectal cancer, where it appears to regulate the expression of tumor suppressor genes including p21, phosphatase and tensin homolog, TGFβ receptor II, and B-cell leukemia/lymphoma 2 -associated X protein. Here we demonstrate that miR-21 targets and down-regulates the core mismatch repair (MMR) recognition protein complex, human mutS homolog 2 (hMSH2) and 6 (hMSH6). Colorectal tumors that express a high level of miR-21 display reduced hMSH2 protein expression. Cells that overproduce miR-21 exhibit significantly reduced 5-fluorouracil (5-FU)-induced G2/M damage arrest and apoptosis that is characteristic of defects in the core MMR component. Moreover, xenograft studies demonstrate that miR-21 overexpression dramatically reduces the therapeutic efficacy of 5-FU. These studies suggest that the down-regulation of the MMR mutator gene associated with miR-21 overexpression may be an important clinical indicator of therapeutic efficacy in colorectal cancer. PMID:21078976

  6. MicroRNA-21 induces resistance to 5-fluorouracil by down-regulating human DNA MutS homolog 2 (hMSH2)

    PubMed Central

    Valeri, Nicola; Gasparini, Pierluigi; Braconi, Chiara; Paone, Alessio; Lovat, Francesca; Fabbri, Muller; Sumani, Khlea M.; Alder, Hansjuerg; Amadori, Dino; Patel, Tushar; Nuovo, Gerard J.; Fishel, Richard; Croce, Carlo M.

    2010-01-01

    The overexpression of microRNA-21 (miR-21) is linked to a number of human tumors including colorectal cancer, where it appears to regulate the expression of tumor suppressor genes including p21, phosphatase and tensin homolog, TGFβ receptor II, and B-cell leukemia/lymphoma 2 -associated X protein. Here we demonstrate that miR-21 targets and down-regulates the core mismatch repair (MMR) recognition protein complex, human mutS homolog 2 (hMSH2) and 6 (hMSH6). Colorectal tumors that express a high level of miR-21 display reduced hMSH2 protein expression. Cells that overproduce miR-21 exhibit significantly reduced 5-fluorouracil (5-FU)-induced G2/M damage arrest and apoptosis that is characteristic of defects in the core MMR component. Moreover, xenograft studies demonstrate that miR-21 overexpression dramatically reduces the therapeutic efficacy of 5-FU. These studies suggest that the down-regulation of the MMR mutator gene associated with miR-21 overexpression may be an important clinical indicator of therapeutic efficacy in colorectal cancer. PMID:21078976

  7. MSH6 and MUTYH Deficiency Is a Frequent Event in Early-Onset Colorectal Cancer

    PubMed Central

    Giráldez, María Dolores; Balaguer, Francesc; Bujanda, Luis; Cuatrecasas, Miriam; Muñoz, Jenifer; Alonso-Espinaco, Virginia; Larzabal, Mikel; Petit, Anna; Gonzalo, Victoria; Ocaña, Teresa; Moreira, Leticia; Enríquez-Navascués, José María; Boland, C. Richard; Goel, Ajay; Castells, Antoni; Castellví-Bel, Sergi

    2011-01-01

    Purpose Early-onset colorectal cancer (CRC) is suggestive of a hereditary predisposition. Lynch syndrome is the most frequent CRC hereditary cause. The MUTYH gene has also been related to hereditary CRC. A systematic characterization of these two diseases has not been reported previously in this population. Experimental Design We studied a retrospectively collected series of 140 patients ≤50 years old diagnosed with nonpolyposis CRC. Demographic, clinical, and familial features were obtained. Mismatch repair (MMR) deficiency was determined by microsatellite instability (MSI) analysis, and immunostaining for MLH1, MSH2, MSH6, and PMS2 proteins. Germline MMR mutations were evaluated in all MMR-deficient cases. Tumor samples with loss of MLH1 or MSH2 protein expression were analyzed for somatic methylation. Germline MUTYH mutations were evaluated in all cases. BRAF V600E and KRAS somatic mutational status was also determined. Results Fifteen tumors (11.4%) were MSI, and 20 (14.3%) showed loss of protein expression (7 for MLH1/PMS2, 2 for isolated MLH1, 3 for MSH2/MSH6, 7 for isolated MSH6, and 1 for MSH6/PMS2). We identified 11 (7.8%) germline MMR mutations, 4 in MLH1, 1 in MSH2, and 6 in MSH6. Methylation analysis revealed one case with somatic MLH1 methylation. Biallelic MUTYH mutations were detected in four (2.8%) cases. KRAS and BRAF V600E mutations were present in 39 (27.9%) and 5 (3.6%) cases, respectively. Conclusions Loss of MSH6 expression is the predominant cause of MMR deficiency in early-onset CRC. Our findings prompt the inclusion of MSH6 and MUTYH screening as part of the genetic counseling of these patients and their relatives. PMID:20924129

  8. A Genetic Incompatibility Accelerates Adaptation in Yeast.

    PubMed

    Bui, Duyen T; Dine, Elliot; Anderson, James B; Aquadro, Charles F; Alani, Eric E

    2015-07-01

    During mismatch repair (MMR) MSH proteins bind to mismatches that form as the result of DNA replication errors and recruit MLH factors such as Mlh1-Pms1 to initiate excision and repair steps. Previously, we identified a negative epistatic interaction involving naturally occurring polymorphisms in the MLH1 and PMS1 genes of baker's yeast. Here we hypothesize that a mutagenic state resulting from this negative epistatic interaction increases the likelihood of obtaining beneficial mutations that can promote adaptation to stress conditions. We tested this by stressing yeast strains bearing mutagenic (incompatible) and non-mutagenic (compatible) mismatch repair genotypes. Our data show that incompatible populations adapted more rapidly and without an apparent fitness cost to high salt stress. The fitness advantage of incompatible populations was rapid but disappeared over time. The fitness gains in both compatible and incompatible strains were due primarily to mutations in PMR1 that appeared earlier in incompatible evolving populations. These data demonstrate a rapid and reversible role (by mating) for genetic incompatibilities in accelerating adaptation in eukaryotes. They also provide an approach to link experimental studies to observational population genomics. PMID:26230253

  9. Quality Assessment and Correlation of Microsatellite Instability and Immunohistochemical Markers among Population- and Clinic-Based Colorectal Tumors

    PubMed Central

    Cicek, Mine S.; Lindor, Noralane M.; Gallinger, Steven; Bapat, Bharati; Hopper, John L.; Jenkins, Mark A.; Young, Joanne; Buchanan, Daniel; Walsh, Michael D.; Le Marchand, Loic; Burnett, Terrilea; Newcomb, Polly A.; Grady, William M.; Haile, Robert W.; Casey, Graham; Plummer, Sarah J.; Krumroy, Lisa A.; Baron, John A.; Thibodeau, Stephen N.

    2011-01-01

    The detection of defective mismatch repair (MMR), as assessed by the presence of tumor microsatellite instability (MSI) and/or loss of MMR protein expression by IHC, has been useful for risk assessment, prognosis, and prediction of treatment in patients with colorectal cancer. We analyzed tumors for the presence of defective MMR from 5927 Colorectal Cancer Family Registry patients recruited at six international consortium sites. We evaluated the appropriate percentage instability cutoff used to distinguish the three MSI phenotypes [ie, stable (MSS), low instability (MSI-L), and high instability (MSI-H)]; the sensitivity, specificity, and performance characteristics of individual markers; and the concordance between MSI and IHC phenotypes. Guided by the results of the IHC testing, our findings indicate that the distinction between an MSI-H phenotype from a low-instability or MSS phenotype can best be accomplished by using a cutoff of 30% or greater of the markers showing instability. The sensitivity and specificity of the mononucleotide markers were higher than those of the dinucleotide markers. Specifically, BAT26 and BAT25 had the highest sensitivity (94%) and specificity (98%), and the use of mononucleotide markers alone identified 97% of the MSI-H cases correctly. As expected, the presence of MSI-H correlated with an older age of diagnosis, the presence of tumor in the proximal colon, and female sex. PMID:21497289

  10. Analysis of Families with Lynch Syndrome Complicated by Advanced Serrated Neoplasia: The Importance of Pathology Review and Pedigree Analysis

    PubMed Central

    Walsh, Michael D; Buchanan, Daniel D; Walters, Rhiannon; Roberts, Aedan; Arnold, Sven; McKeone, Diane; Clendenning, Mark; Ruszkiewicz, Andrew R; Jenkins, Mark A; Hopper, John L; Goldblatt, Jack; George, Jillian; Suthers, Graeme K; Phillips, Kerry; Young, Graeme P; Macrae, Finlay; Drini, Musa; Woods, Michael O; Parry, Susan; Jass, Jeremy R; Young, Joanne P

    2009-01-01

    The identification of Lynch syndrome has been greatly assisted by the advent of tumour immunohistochemistry (IHC) for mismatch repair (MMR) proteins, and by the recognition of the role of acquired somatic BRAF mutation in sporadic MMR-deficient colorectal cancer (CRC). However, somatic BRAF mutation may also be present in the tumours in families with a predisposition to develop serrated polyps in the colorectum. In a subgroup of affected members in these families, CRCs emerge which demonstrate clear evidence of MMR deficiency with absent MLH1 staining and high-level microsatellite instability (MSI). This may result in these families being erroneously classified as Lynch syndrome or, conversely, an individual is considered “sporadic” due to the presence of a somatic BRAF mutation in a tumour. In this report, we describe two Lynch syndrome families who demonstrated several such inconsistencies. In one family, IHC deficiency of both MSH2 and MLH1 was demonstrated in tumours from different affected family members, presenting a confusing diagnostic picture. In the second family, MLH1 loss was observed in the lesions of both MLH1 mutation carriers and those who showed normal MLH1 germline sequence. Both families had Lynch syndrome complicated by an independently segregating serrated neoplasia phenotype, suggesting that in families such as these, tumour and germline studies of several key members, rather than of a single proband, are indicated to clarify the spectrum of risk. PMID:19241144

  11. Advances in the study of Lynch syndrome in China.

    PubMed

    Lu, Jun-Yu; Sheng, Jian-Qiu

    2015-06-14

    Lynch syndrome, also known as hereditary nonpolyposis colorectal cancer, is an autosomal dominant genetic condition that has a high risk of colon cancer as well as other cancers due to inherited mutations in mismatch repair (MMR) genes. During the last decades, there have been great advances in research on Chinese Lynch syndrome. This review mainly focuses on the genetic basis, clinicopathologic features, diagnosis, intervention, chemoprevention, and surveillance of Lynch syndrome in China. In addition to frequently altered MMR genes, such as MLH1, MSH2, MSH6, and MLH3, other MMR-associated genes, such as those encoding human exonuclease 1, transforming growth factor β receptor 2, and alanine aminopeptidase, metastasis-associated protein 2, adenomatosis polyposis coli down-regulated 1, and hepatic and glial cell adhesion molecule have also been implicated in Chinese Lynch syndrome. Most Chinese researchers focused on the clinicopathologic features of Lynch syndrome, and it is noticeable that the most frequent extracolonic tumor in northeast China is lung cancer, which is different from other areas in China. The Chinese diagnostic criteria for Lynch syndrome have been established to identify gene mutation or methylation. With regard to chemoprevention, celecoxib may be effective to prevent polyps relapse in Lynch syndrome carriers. Additionally, a colonoscopy-based surveillance strategy for the prevention and early detection of neoplasms in Lynch-syndrome carriers has been proposed. PMID:26078562

  12. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    PubMed Central

    Moreno-Ortiz, Jose Miguel; Ayala-Madrigal, María de la Luz; Corona-Rivera, Jorge Román; Maciel-Gutiérrez, Víctor; Franco-Topete, Ramón Antonio; Armendáriz-Borunda, Juan; Pérez-Carbonell, Lucia; Rhees, Jennifer; Gutiérrez-Angulo, Melva

    2016-01-01

    Background. Lynch Syndrome (LS) is characterized by germline mutations in the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC) and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC), and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del) and c.1852_1853delinsGC (p.K618A) in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs) in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel. PMID:27247567

  13. Trypanosoma cruzi MSH2: Functional analyses on different parasite strains provide evidences for a role on the oxidative stress response☆

    PubMed Central

    Campos, Priscila C.; Silva, Viviane G.; Furtado, Carolina; Machado-Silva, Alice; DaRocha, Wanderson D.; Peloso, Eduardo F.; Gadelha, Fernanda R.; Medeiros, Marisa H.G.; Lana, Gustavo de Carvalho; Chen, Ying; Barnes, Rebecca L.; Passos-Silva, Danielle Gomes; McCulloch, Richard; Machado, Carlos Renato; Teixeira, Santuza M.R.

    2011-01-01

    Components of the DNA mismatch repair (MMR) pathway are major players in processes known to generate genetic diversity, such as mutagenesis and DNA recombination. Trypanosoma cruzi, the protozoan parasite that causes Chagas disease has a highly heterogeneous population, composed of a pool of strains with distinct characteristics. Studies with a number of molecular markers identified up to six groups in the T. cruzi population, which showed distinct levels of genetic variability. To investigate the molecular basis for such differences, we analyzed the T. cruzi MSH2 gene, which encodes a key component of MMR, and showed the existence of distinct isoforms of this protein. Here we compared cell survival rates after exposure to genotoxic agents and levels of oxidative stress-induced DNA in different parasite strains. Analyses of msh2 mutants in both T. cruzi and T. brucei were also used to investigate the role of Tcmsh2 in the response to various DNA damaging agents. The results suggest that the distinct MSH2 isoforms have differences in their activity. More importantly, they also indicate that, in addition to its role in MMR, TcMSH2 acts in the parasite response to oxidative stress through a novel mitochondrial function that may be conserved in T. brucei. PMID:21073906

  14. Rapid DNA double-strand breaks resulting from processing of Cr-DNA cross-links by both MutS dimers.

    PubMed

    Reynolds, Mindy F; Peterson-Roth, Elizabeth C; Bespalov, Ivan A; Johnston, Tatiana; Gurel, Volkan M; Menard, Haley L; Zhitkovich, Anatoly

    2009-02-01

    Mismatch repair (MMR) strongly enhances cyto- and genotoxicity of several chemotherapeutic agents and environmental carcinogens. DNA double-strand breaks (DSB) formed after two replication cycles play a major role in MMR-dependent cell death by DNA alkylating drugs. Here, we examined DNA damage detection and the mechanisms of the unusually rapid induction of DSB by MMR proteins in response to carcinogenic chromium(VI). We found that MSH2-MSH6 (MutSalpha) dimer effectively bound DNA probes containing ascorbate-Cr-DNA and cysteine-Cr-DNA cross-links. Binary Cr-DNA adducts, the most abundant form of Cr-DNA damage, were poor substrates for MSH2-MSH6, and their toxicity in cells was weak and MMR independent. Although not involved in the initial recognition of Cr-DNA damage, MSH2-MSH3 (MutSbeta) complex was essential for the induction of DSB, micronuclei, and apoptosis in human cells by chromate. In situ fractionation of Cr-treated cells revealed MSH6 and MSH3 chromatin foci that originated in late S phase and did not require replication of damaged DNA. Formation of MSH3 foci was MSH6 and MLH1 dependent, whereas MSH6 foci were unaffected by MSH3 status. DSB production was associated with progression of cells from S into G(2) phase and was completely blocked by the DNA synthesis inhibitor aphidicolin. Interestingly, chromosome 3 transfer into MSH3-null HCT116 cells activated an alternative, MSH3-like activity that restored dinucleotide repeat stability and sensitivity to chromate. Thus, sequential recruitment and unprecedented cooperation of MutSalpha and MutSbeta branches of MMR in processing of Cr-DNA cross-links is the main cause of DSB and chromosomal breakage at low and moderate Cr(VI) doses. PMID:19141647

  15. Classifying MLH1 and MSH2 variants using bioinformatic prediction, splicing assays, segregation, and tumor characteristics.

    PubMed

    Arnold, Sven; Buchanan, Daniel D; Barker, Melissa; Jaskowski, Lesley; Walsh, Michael D; Birney, Genevieve; Woods, Michael O; Hopper, John L; Jenkins, Mark A; Brown, Melissa A; Tavtigian, Sean V; Goldgar, David E; Young, Joanne P; Spurdle, Amanda B

    2009-05-01

    Reliable methods for predicting functional consequences of variants in disease genes would be beneficial in the clinical setting. This study was undertaken to predict, and confirm in vitro, splicing aberrations associated with mismatch repair (MMR) variants identified in familial colon cancer patients. Six programs were used to predict the effect of 13 MLH1 and 6 MSH2 gene variants on pre-mRNA splicing. mRNA from cycloheximide-treated lymphoblastoid cell lines of variant carriers was screened for splicing aberrations. Tumors of variant carriers were tested for microsatellite instability and MMR protein expression. Variant segregation in families was assessed using Bayes factor causality analysis. Amino acid alterations were examined for evolutionary conservation and physicochemical properties. Splicing aberrations were detected for 10 variants, including a frameshift as a minor cDNA product, and altered ratio of known alternate splice products. Loss of splice sites was well predicted by splice-site prediction programs SpliceSiteFinder (90%) and NNSPLICE (90%), but consequence of splice site loss was less accurately predicted. No aberrations correlated with ESE predictions for the nine exonic variants studied. Seven of eight missense variants had normal splicing (88%), but only one was a substitution considered neutral from evolutionary/physicochemical analysis. Combined with information from tumor and segregation analysis, and literature review, 16 of 19 variants were considered clinically relevant. Bioinformatic tools for prediction of splicing aberrations need improvement before use without supporting studies to assess variant pathogenicity. Classification of mismatch repair gene variants is assisted by a comprehensive approach that includes in vitro, tumor pathology, clinical, and evolutionary conservation data. PMID:19267393

  16. Classifying MLH1 and MSH2 variants using bioinformatic prediction, splicing assays, segregation and tumor characteristics

    PubMed Central

    Arnold, Sven; Buchanan, Daniel D.; Barker, Melissa; Jaskowski, Lesley; Walsh, Michael D.; Birney, Genevieve; Woods, Michael O.; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tavtigian, Sean V.; Goldgar, David E.; Young, Joanne P.; Spurdle, Amanda B.

    2009-01-01

    Reliable methods for predicting functional consequences of variants in disease genes would be beneficial in the clinical setting. This study was undertaken to predict, and confirm in vitro, splicing aberrations associated with mismatch repair (MMR) variants identified in familial colon cancer patients. Six programs were used to predict the effect of 13 MLH1 and 6 MSH2 gene variants on pre-mRNA splicing. mRNA from cycloheximide-treated lymphoblastoid cell lines of variant carriers was screened for splicing aberrations. Tumors of variant carriers were tested for microsatellite instability and MMR protein expression. Variant segregation in families was assessed using Bayes factor causality analysis. Amino acid alterations were examined for evolutionary conservation and physicochemical properties. Splicing aberrations were detected for ten variants, including a frameshift as a minor cDNA product, and altered ratio of known alternate splice products. Loss of splice sites was well predicted by splice site prediction programs SpliceSiteFinder (90%) and NNSPLICE (90%), but consequence of splice site loss was less accurately predicted. No aberrations correlated with ESE predictions for the nine exonic variants studied. Seven of eight missense variants had normal splicing (88%), but only one was a substitution considered neutral from evolutionary/physicochemical analysis. Combined with information from tumor and segregation analysis, and literature review, 16/19 variants were considered clinically relevant. Bioinformatic tools for prediction of splicing aberrations need improvement before use without supporting studies to assess variant pathogenicity. Classification of mismatch repair gene variants is assisted by a comprehensive approach which includes in vitro, tumor pathology, clinical, and evolutionary conservation data. PMID:19267393

  17. Study of the immune response engendered by differents combined measles, mumps and rubella (MMR) vaccines in an area of Andalusia (Spain).

    PubMed

    Cruz Rojo, Concepción; Rodríguez Iglesias, Manuel; Olvera, Juana; Alvarez Girón, Manuela

    2003-12-12

    The objective of the study is to evaluate and compare the degree of serological protection conferred by the three components of two MMR vaccines: "Vac triple MSD" (Aventis Pasteur MSD) and "Triviraten" (Berna), and to study the effects of a second dose of "Priorix" (Glaxo SmithKline), in an unprotected population. In March 2001, this study was conducted in a sample of 86 children aged 3 and 4 years, in two Basic Health Zones of Cádiz (Spain). Mumps, measles and rubella antibody titers were evaluated by IgG enzyme linked immunosorbent assay (ELISA). All the children showing lack of response were revaccinated with the vaccine "Priorix" of GSK; in 12 of these children (all vaccinated previously with "Triviraten"), studies confirmed the existence of seroconversion utilizing the same methodology. The most outstanding finding has been the low percentage of children vaccinated with "Triviraten" possessing protective titers (>1:500) against mumps (14.3%) compared with those vaccinated with "Vac triple MSD" (81.1%, P<0.000001); geometric mean values (GMT) of 164 and 1631, respectively, were obtained. Significant differences, and in the same direction, were also found in respect of measles (83.7 and 100%, and GMT of 889 and 5076), although not so striking. However, all the children studied did have protective titres (>16UI/ml) of antibodies against rubella. Of the 12 children studied who had not responded with protective titers of anti-mumps antibodies, eight children (66.7%) showed seroconversion with "Priorix", and only one child (25%) presented seroconversion in the response to measles. We have thus proved that the "Rubini" strain provides insufficient protection against mumps in our child population. We have also found that the "Edmonston-Zagreb" strain confers less protection against measles than the "Enders" strain, although the "Schwarz" strain, after revaccination of the children who had failed with the "Edmonston-Zagreb" strain, did not achieve a satisfactory

  18. A screen for hydroxymethylcytosine and formylcytosine binding proteins suggests functions in transcription and chromatin regulation

    PubMed Central

    2013-01-01

    Background DNA methylation (5mC) plays important roles in epigenetic regulation of genome function. Recently, TET hydroxylases have been found to oxidise 5mC to hydroxymethylcytosine (5hmC), formylcytosine (5fC) and carboxylcytosine (5caC) in DNA. These derivatives have a role in demethylation of DNA but in addition may have epigenetic signaling functions in their own right. A recent study identified proteins which showed preferential binding to 5-methylcytosine (5mC) and its oxidised forms, where readers for 5mC and 5hmC showed little overlap, and proteins bound to further oxidation forms were enriched for repair proteins and transcription regulators. We extend this study by using promoter sequences as baits and compare protein binding patterns to unmodified or modified cytosine using DNA from mouse embryonic stem cell extracts. Results We compared protein enrichments from two DNA probes with different CpG composition and show that, whereas some of the enriched proteins show specificity to cytosine modifications, others are selective for both modification and target sequences. Only a few proteins were identified with a preference for 5hmC (such as RPL26, PRP8 and the DNA mismatch repair protein MHS6), but proteins with a strong preference for 5fC were more numerous, including transcriptional regulators (FOXK1, FOXK2, FOXP1, FOXP4 and FOXI3), DNA repair factors (TDG and MPG) and chromatin regulators (EHMT1, L3MBTL2 and all components of the NuRD complex). Conclusions 0ur screen has identified novel proteins that bind to 5fC in genomic sequences with different CpG composition and suggests they regulate transcription and chromatin, hence opening up functional investigations of 5fC readers. PMID:24156278

  19. Protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteins are the major structural and functional components of all cells in the body. They are macromolecules that comprise 1 or more chains of amino acids that vary in their sequence and length and are folded into specific 3-dimensional structures. The sizes and conformations of proteins, therefor...

  20. Proteins.

    ERIC Educational Resources Information Center

    Doolittle, Russell F.

    1985-01-01

    Examines proteins which give rise to structure and, by virtue of selective binding to other molecules, make genes. Binding sites, amino acids, protein evolution, and molecular paleontology are discussed. Work with encoding segments of deoxyribonucleic acid (exons) and noncoding stretches (introns) provides new information for hypotheses. (DH)

  1. Modulation of UvrD helicase activity by covalent DNA-protein cross-links.

    PubMed

    Kumari, Anuradha; Minko, Irina G; Smith, Rebecca L; Lloyd, R Stephen; McCullough, Amanda K

    2010-07-01

    UvrD (DNA helicase II) has been implicated in DNA replication, DNA recombination, nucleotide excision repair, and methyl-directed mismatch repair. The enzymatic function of UvrD is to translocate along a DNA strand in a 3' to 5' direction and unwind duplex DNA utilizing a DNA-dependent ATPase activity. In addition, UvrD interacts with many other proteins involved in the above processes and is hypothesized to facilitate protein turnover, thus promoting further DNA processing. Although UvrD interactions with proteins bound to DNA have significant biological implications, the effects of covalent DNA-protein cross-links on UvrD helicase activity have not been characterized. Herein, we demonstrate that UvrD-catalyzed strand separation was inhibited on a DNA strand to which a 16-kDa protein was covalently bound. Our sequestration studies suggest that the inhibition of UvrD activity is most likely due to a translocation block and not helicase sequestration on the cross-link-containing DNA substrate. In contrast, no inhibition of UvrD-catalyzed strand separation was apparent when the protein was linked to the complementary strand. The latter result is surprising given the earlier observations that the DNA in this covalent complex is severely bent ( approximately 70 degrees ), with both DNA strands making multiple contacts with the cross-linked protein. In addition, UvrD was shown to be required for replication of plasmid DNAs containing covalent DNA-protein complexes. Combined, these data suggest a critical role for UvrD in the processing of DNA-protein cross-links. PMID:20444702

  2. EMAST is a Form of Microsatellite Instability That is Initiated by Inflammation and Modulates Colorectal Cancer Progression

    PubMed Central

    Carethers, John M.; Koi, Minoru; Tseng-Rogenski, Stephanie S.

    2015-01-01

    DNA mismatch repair (MMR) function is critical for correcting errors coincident with polymerase-driven DNA replication, and its proteins are frequent targets for inactivation (germline or somatic), generating a hypermutable tumor that drives cancer progression. The biomarker for defective DNA MMR is microsatellite instability-high (MSI-H), observed in ~15% of colorectal cancers, and defined by mono- and dinucleotide microsatellite frameshift mutations. MSI-H is highly correlated with loss of MMR protein expression, is commonly diploid, is often located in the right side of the colon, prognosticates good patient outcome, and predicts poor efficacy with 5-fluorouracil treatment. Elevated microsatellite alterations at selected tetranucleotide repeats (EMAST) is another form of MSI at tetranucleotide repeats that has been observed in multiple cancers, but its etiology and clinical relevance to patient care has only been recently illuminated. Specifically, EMAST is an acquired somatic defect observed in up to 60% of colorectal cancers and caused by unique dysfunction of the DNA MMR protein MSH3 (and its DNA MMR complex MutSβ, a heterodimer of MSH2-MSH3), and in particular a loss-of-function phenotype due to a reversible shift from its normal nuclear location into the cytosol in response to oxidative stress and the pro-inflammatory cytokine interleukin-6. Tumor hypoxia may also be a contributor. Patients with EMAST colorectal cancers show diminished prognosis compared to patients without the presence of EMAST in their cancer. In addition to defective DNA MMR recognized by tetranucleotide (and di- and tri-nucleotide) frameshifts, loss of MSH3 also contributes to homologous recombination-mediated repair of DNA double stranded breaks, indicating the MSH3 dysfunction is a complex defect for cancer cells that generates not only EMAST but also may contribute to chromosomal instability and aneuploidy. Areas for future investigation for this most common DNA MMR defect among

  3. Decoupling of DNA damage response signaling from DNA damages underlies temozolomide resistance in glioblastoma cells☆

    PubMed Central

    Cui, Bo; Johnson, Stewart P.; Bullock, Nancy; Ali-Osman, Francis; Bigner, Darell D.; Friedman, Henry S.

    2010-01-01

    Glioblastoma multiforme (GBM) is the most aggressive primary brain tumor in adults. Current therapy includes surgery, radiation and chemotherapy with temozolomide (TMZ). Major determinants of clinical response to TMZ include methylation status of the O6-methylguanine-DNA methyltransferase (MGMT) promoter and mismatch repair (MMR) status. Though the MGMT promoter is methylated in 45% of cases, for the first nine months of follow-up, TMZ does not change survival outcome. Furthermore, MMR deficiency makes little contribution to clinical resistance, suggesting that there exist unrecognized mechanisms of resistance. We generated paired GBM cell lines whose resistance was attributed to neither MGMT nor MMR. We show that, responding to TMZ, these cells exhibit a decoupling of DNA damage response (DDR) from ongoing DNA damages. They display methylation-resistant synthesis in which ongoing DNA synthesis is not inhibited. They are also defective in the activation of the S and G2 phase checkpoint. DDR proteins ATM, Chk2, MDC1, NBS1 and gammaH2AX also fail to form discrete foci. These results demonstrate that failure of DDR may play an active role in chemoresistance to TMZ. DNA damages by TMZ are repaired by MMR proteins in a futile, reiterative process, which activates DDR signaling network that ultimately leads to the onset of cell death. GBM cells may survive genetic insults in the absence of DDR. We anticipate that our findings will lead to more studies that seek to further define the role of DDR in ultimately determining the fate of a tumor cell in response to TMZ and other DNA methylators. PMID:23554659

  4. Targeting and Processing of Site-specific DNA Interstrand Crosslinks

    PubMed Central

    Vasquez, Karen M.

    2010-01-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, and thus ICL-inducing agents such as cyclophosphamide, melphalan, cisplatin, psoralen and mitomycin C have been used clinically as anti-cancer drugs for decades. ICLs can also be formed endogenously as a consequence of cellular metabolic processes. ICL-inducing agents continue to be among the most effective chemotherapeutic treatments for many cancers; however, treatment with these agents can lead to secondary malignancies, in part due to mutagenic processing of the DNA lesions. The mechanisms of ICL repair have been characterized more thoroughly in bacteria and yeast than in mammalian cells. Thus, a better understanding the molecular mechanisms of ICL processing offers the potential to improve the efficacy of these drugs in cancer therapy. In mammalian cells it is thought that ICLs are repaired by the coordination of proteins from several pathways, including nucleotide excision repair (NER), base excision repair (BER), mismatch repair (MMR), homologous recombination (HR), translesion synthesis (TLS), and proteins involved in Fanconi anemia (FA). In this review, we focus on the potential functions of NER, MMR, and HR proteins in the repair of and response to ICLs in human cells and in mice. We will also discuss a unique approach, using psoralen covalently linked to triplex-forming oligonucleotides to direct ICLs to specific sites in the mammalian genome. PMID:20196133

  5. Advances in the understanding of Fanconi Anemia Complementation Group D2 Protein (FANCD2) in human cancer

    PubMed Central

    Shen, Yihang; Zhang, Jun; Yu, Herbert; Fei, Peiwen

    2015-01-01

    Fanconi anemia (FA) is a rare human genetic disease, resulting from dysfunction in any of 17 known complementation proteins: FANC-A, B, C, D1, D2, E, F, G, I, J, L, M, N, O, P, Q & S, and other unknowns. Besides the severe bone marrow failure, an extremely high incidence of cancer as well as many other clinic symptoms associated with FA patients, FA cells are known of insufficiency in homologous recombination, DNA mismatch repair, nucleotide excision repair, translesion DNA synthesis, and other molecular defects, leading to genome instability. Those similar molecular and cellular/tissue features show that all FA proteins function in one common signaling pathway, namely, the FA pathway. The monoubiquitination of FANCD2 is the central step of the FA pathway activation upon DNA damage or during DNA replication. The molecular functions of FANCD2 emerge as a very attractive filed of investigation in cancer research. Herein, we review the recent progresses in FANCD2 functions at these rapidly progressed aspects. PMID:26640811

  6. RNA 3'-end mismatch excision by the severe acute respiratory syndrome coronavirus nonstructural protein nsp10/nsp14 exoribonuclease complex.

    PubMed

    Bouvet, Mickaël; Imbert, Isabelle; Subissi, Lorenzo; Gluais, Laure; Canard, Bruno; Decroly, Etienne

    2012-06-12

    The replication/transcription complex of severe acute respiratory syndrome coronavirus is composed of at least 16 nonstructural proteins (nsp1-16) encoded by the ORF-1a/1b. This complex includes replication enzymes commonly found in positive-strand RNA viruses, but also a set of RNA-processing activities unique to some nidoviruses. The nsp14 protein carries both exoribonuclease (ExoN) and (guanine-N7)-methyltransferase (N7-MTase) activities. The nsp14 ExoN activity ensures a yet-uncharacterized function in the virus life cycle and must be regulated to avoid nonspecific RNA degradation. In this work, we show that the association of nsp10 with nsp14 stimulates >35-fold the ExoN activity of the latter while playing no effect on N7-MTase activity. Nsp10 mutants unable to interact with nsp14 are not proficient for ExoN activation. The nsp10/nsp14 complex hydrolyzes double-stranded RNA in a 3' to 5' direction as well as a single mismatched nucleotide at the 3'-end mimicking an erroneous replication product. In contrast, di-, tri-, and longer unpaired ribonucleotide stretches, as well as 3'-modified RNAs, resist nsp10/nsp14-mediated excision. In addition to the activation of nsp16-mediated 2'-O-MTase activity, nsp10 also activates nsp14 in an RNA processing function potentially connected to a replicative mismatch repair mechanism. PMID:22635272

  7. Human MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-01-07

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  8. Human MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1997-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  9. The prognostic value of polycomb group protein B-cell-specific moloney murine leukemia virus insertion site 1 in stage II colon cancer patients.

    PubMed

    Espersen, Maiken L M; Linnemann, Dorte; Christensen, Ib J; Alamili, Mahdi; Troelsen, Jesper T; Høgdall, Estrid

    2016-07-01

    The aim of this study was to investigate the prognostic value of B-cell-specific moloney murine leukemia virus insertion site 1 (BMI1) protein expression in primary tumors of stage II colon cancer patients. BMI1 protein expression was assessed by immunohistochemistry in a retrospective patient cohort consisting of 144 stage II colon cancer patients. BMI1 expression at the invasive front of the primary tumors correlated with mismatch repair status of the tumors. Furthermore, BMI1 expression at the luminal surface correlated with T-stage, tumor location, and the histological subtypes of the tumors. In a univariate Cox proportional hazard analysis, no statistical significant association between risk of relapse and BMI1 protein expression at the invasive front (HR: 1.12; 95% CI 0.78-1.60; p = 0.53) or at the luminal surface of the tumor (HR: 1.06; 95% CI 0.75-1.48; p = 0.70) was found. Likewise, there was no association between 5-year overall survival and BMI1 expression at the invasive front (HR: 1.12; 95% CI 0.80-1.56; p = 0.46) or at the luminal surface of the tumor (HR: 1.16; 95% CI 0.86-1.60; p = 0.33). In conclusion, BMI1 expression in primary tumors of stage II colon cancer patients could not predict relapse or overall survival of the patients, thus having a limited prognostic value in stage II colon cancer patients. PMID:27102362

  10. Lack of Association between Membrane-Type 1 Matrix Metalloproteinase Expression and Clinically Relevant Molecular or Morphologic Tumor Characteristics at the Leading Edge of Invasive Colorectal Carcinoma.

    PubMed

    Arndt, Annette; Kraft, Klaus; Wardelmann, Eva; Steinestel, Konrad

    2015-01-01

    Colorectal cancer (CRC) is one of the leading causes of death from cancer in the western world, but tumor biology and clinical course show great interindividual variation. Molecular and morphologic tumor characteristics, such as KRAS/BRAF mutation status, mismatch repair (MMR) protein expression, tumor growth pattern, and tumor cell budding, have been shown to be of key therapeutic and/or prognostic relevance in CRC. Membrane-type 1 matrix metalloproteinase (MT1-MMP) is a membrane-anchored zinc-binding endopeptidase that is expressed at the leading edge of various invasive carcinomas and promotes tumor cell invasion through degradation of the extracellular matrix. The aim of this study was to investigate possible associations between MT1-MMP expression and molecular tumor characteristics as well as morphologic features of tumor aggressiveness in a consecutive series of 79 CRC tissue samples. However, although MT1-MMP was expressed in 41/79 samples (52%), there was no significant association between MT1-MMP expression and KRAS/BRAF mutation status, MMR protein expression, presence of lymphovascular invasion, tumor growth pattern, tumor-infiltrating lymphocytes, or tumor cell budding in our sample cohort (P > 0.05). Thus, we conclude that although MT1-MMP may play a role in CRC invasion, it is not of key relevance to the current models of CRC invasion and aggressiveness. PMID:26106602

  11. Lack of Association between Membrane-Type 1 Matrix Metalloproteinase Expression and Clinically Relevant Molecular or Morphologic Tumor Characteristics at the Leading Edge of Invasive Colorectal Carcinoma

    PubMed Central

    Arndt, Annette; Kraft, Klaus; Wardelmann, Eva; Steinestel, Konrad

    2015-01-01

    Colorectal cancer (CRC) is one of the leading causes of death from cancer in the western world, but tumor biology and clinical course show great interindividual variation. Molecular and morphologic tumor characteristics, such as KRAS/BRAF mutation status, mismatch repair (MMR) protein expression, tumor growth pattern, and tumor cell budding, have been shown to be of key therapeutic and/or prognostic relevance in CRC. Membrane-type 1 matrix metalloproteinase (MT1-MMP) is a membrane-anchored zinc-binding endopeptidase that is expressed at the leading edge of various invasive carcinomas and promotes tumor cell invasion through degradation of the extracellular matrix. The aim of this study was to investigate possible associations between MT1-MMP expression and molecular tumor characteristics as well as morphologic features of tumor aggressiveness in a consecutive series of 79 CRC tissue samples. However, although MT1-MMP was expressed in 41/79 samples (52%), there was no significant association between MT1-MMP expression and KRAS/BRAF mutation status, MMR protein expression, presence of lymphovascular invasion, tumor growth pattern, tumor-infiltrating lymphocytes, or tumor cell budding in our sample cohort (P > 0.05). Thus, we conclude that although MT1-MMP may play a role in CRC invasion, it is not of key relevance to the current models of CRC invasion and aggressiveness. PMID:26106602

  12. Fanconi anemia pathway regulates convergent transcription-induced cell death at trinucleotide repeats in human cells

    PubMed Central

    Chatterjee, Nimrat; Lin, Yunfu; Wilson, John H.

    2016-01-01

    Almost 20 incurable neurodegenerative disorders are caused by trinucleotide repeat (TNR) expansion beyond a certain threshold, with disease time of onset and severity positively correlating with repeat length. Typically, long TNRs display a bias toward further expansion and repeats continue to expand not only during germline transmissions from parents to offspring, but also remain highly unstable in somatic tissues of patients. Hence, understanding TNR instability mechanisms sheds light on underlying disease pathology. Recently, we showed that activated ATR is the major signal for convergent-transcription-induced cell death at CAG repeats and is regulated by the mismatch repair (MMR) pathway. Additionally, components of other DNA repair pathways such as transcription-coupled nucleotide excision repair (TC-NER) and R-loop resolution by RNaseH reduce cell death. Because activated ATR signals the Fanconi anemia (FA) pathway of interstrand crosslink DNA repair, we asked whether the FA pathway also modulates convergent-transcription-induced cell death at expanded CAG repeats. We show here that siRNA knockdown of FA components—FANCI, FANCJ, FANCM, FANCA, and FANCD2—decreases cell death, suggesting that FA proteins, like MMR proteins, are activators of cell death during convergent transcription.

  13. Characterisation of cisplatin coordination sites in cellular Escherichia coli DNA-binding proteins by combined biphasic liquid chromatography and ESI tandem mass spectrometry.

    PubMed

    Will, Joanna; Sheldrick, William S; Wolters, Dirk

    2008-03-01

    Combined multidimensional liquid chromatography and electrospray ionisation tandem mass spectrometry was employed to analyse platinated tryptic peptides from Escherichia coli cells treated with the anticancer drug cis-[PtCl2(NH3)2] at pH 7.0. Prerequisites for the LC/LC/MS/MS analysis of protein targets that are fulfilled by cisplatin are (a) that the original protein binding sites have a high kinetic stability over the range 2.3 < pH < 8.5, and (b) that the metal fragment remains coordinated to a significant number of b+ and y+ peptide ions under MS/MS fragmentation conditions. Matching the MS/MS spectra of the platinated tryptic peptides to sequences of proteins in the E. coli database enabled the identification of 31 protein targets for cisplatin. Whereas six of these are high-abundance enzymes and ribosomal proteins in E. coli cells, five low-abundance DNA-binding proteins were also identified as specific targets. These include the DNA mismatch repair protein mutS, the DNA helicase II (uvrD) and topoisomerase I (top1). Two efflux proteins (acrD, mdtA), the redox regulator thioredoxin 1 (thiO) and the external filament-like type-1 fimbrial protein A chain (fimA1) were also characterised as specific cisplatin-binding proteins. Kinetically favoured carboxylate (D, E) and hydroxy (S, T, Y) O atoms were identified as the Pt coordination sites in 18 proteins and methionyl S atoms in 9 proteins. PMID:18157731

  14. Site- and strand-specific nicking of DNA by fusion proteins derived from MutH and I-SceI or TALE repeats

    PubMed Central

    Gabsalilow, Lilia; Schierling, Benno; Friedhoff, Peter; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Targeted genome engineering requires nucleases that introduce a highly specific double-strand break in the genome that is either processed by homology-directed repair in the presence of a homologous repair template or by non-homologous end-joining (NHEJ) that usually results in insertions or deletions. The error-prone NHEJ can be efficiently suppressed by ‘nickases’ that produce a single-strand break rather than a double-strand break. Highly specific nickases have been produced by engineering of homing endonucleases and more recently by modifying zinc finger nucleases (ZFNs) composed of a zinc finger array and the catalytic domain of the restriction endonuclease FokI. These ZF-nickases work as heterodimers in which one subunit has a catalytically inactive FokI domain. We present two different approaches to engineer highly specific nickases; both rely on the sequence-specific nicking activity of the DNA mismatch repair endonuclease MutH which we fused to a DNA-binding module, either a catalytically inactive variant of the homing endonuclease I-SceI or the DNA-binding domain of the TALE protein AvrBs4. The fusion proteins nick strand specifically a bipartite recognition sequence consisting of the MutH and the I-SceI or TALE recognition sequences, respectively, with a more than 1000-fold preference over a stand-alone MutH site. TALE–MutH is a programmable nickase. PMID:23408850

  15. Mismatch-induced lethality due to a defect in Escherichia coli RecQ helicase in exonuclease-deficient background: Dependence on MutS and UvrD functions.

    PubMed

    Yamana, Yoshimasa; Sonezaki, Shuji; Ogawa, Hiroaki I; Kusano, Kohji

    2010-05-01

    Escherichia coli DNA-unwinding protein RecQ has roles in the regulation of general recombination and the processing of stalled replication forks. In this study, we found that knockout of the recQ gene in combination with xonA xseA recJ mutations, which inhibit methyl-directed mismatch repair (MMR), caused about 100-fold increase in sensitivity to a purine analog 2-aminopurine (2AP). Intriguingly, inactivation of a MMR initiator due to the either mutation mutS or uvrD completely suppressed the 2AP sensitivity caused by recQ xonA xseA recJ mutations, suggesting that RecQ helicase might act on the DNA structures that are generated by the processing of DNA by the MutSLH complex and UvrD helicase. Moreover, the recQ gene knockout in combination with xonA xseA recJ mutations enhanced 2AP-induced filament formation, and increased by twofold the rate of spontaneous forward mutations in the thyA locus but did not increase the rate of rifampicin-resistant mutations. We discuss about the possible interplay between E. coli RecQ helicase and mismatch recognition factors. PMID:20018207

  16. Crossing over during Caenorhabditis elegans meiosis requires a conserved MutS-based pathway that is partially dispensable in budding yeast.

    PubMed Central

    Zalevsky, J; MacQueen, A J; Duffy, J B; Kemphues, K J; Villeneuve, A M

    1999-01-01

    Formation of crossovers between homologous chromosomes during Caenorhabditis elegans meiosis requires the him-14 gene. Loss of him-14 function severely reduces crossing over, resulting in lack of chiasmata between homologs and consequent missegregation. Cytological analysis showing that homologs are paired and aligned in him-14 pachytene nuclei, together with temperature-shift experiments showing that him-14 functions during the pachytene stage, indicate that him-14 is not needed to establish pairing or synapsis and likely has a more direct role in crossover formation. him-14 encodes a germline-specific member of the MutS family of DNA mismatch repair (MMR) proteins. him-14 has no apparent role in MMR, but like its Saccharomyces cerevisiae ortholog MSH4, has a specialized role in promoting crossing over during meiosis. Despite this conservation, worms and yeast differ significantly in their reliance on this pathway: whereas worms use this pathway to generate most, if not all, crossovers, yeast still form 30-50% of their normal number of crossovers when this pathway is absent. This differential reliance may reflect differential stability of crossover-competent recombination intermediates, or alternatively, the presence of two different pathways for crossover formation in yeast, only one of which predominates during nematode meiosis. We discuss a model in which HIM-14 promotes crossing over by interfering with Holliday junction branch migration. PMID:10545458

  17. Cadmium-induced genetic instability in mice testis.

    PubMed

    Oliveira, Helena; Lopes, Tina; Almeida, Tânia; Pereira, Maria de Lourdes; Santos, Conceição

    2012-12-01

    Cadmium is a well recognized carcinogenic, cytotoxic and mutagenic transition metal. Recent evidence suggests that the proteins participating in the DNA repair systems, especially in excision and mismatch repair (MMR), are sensitive targets of cadmium toxicity. Microsatellite instability (MSI) is regarded as one of the phenotypes of defective DNA MMR and, consequently, as a marker of high risk for cancer. The purpose of this work is to determine whether cadmium, in the form of cadmium chloride (CdCl(2)), may induce microsatellite mutations in murine testes. For this study, 2-month-old male ICR-CD1 mice were treated by a single subcutaneous injection of 1, 2 and 3 mg CdCl(2)/kg body weight and killed after 35 days. A panel of six microsatellite markers, previously reported as being the most sensitive in detecting MSI in murine tumours, was used in this study. The results show that CdCl(2) in the doses of 2 and 3 mg/kg induced a decrease in the testis weight and severe histopathologic changes with complete disorganization of testicular structure and evidences of severe necrosis. In addition, the animals exposed to the lowest CdCl(2) dose presented MSI in the testis. The results indicate the existence of MSI in at least two nuclear loci suggesting putative genotoxic effects induced by cadmium. PMID:22699117

  18. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species

    PubMed Central

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-01-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  19. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species.

    PubMed

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-03-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  20. Prevalence of Lynch Syndrome among Patients with Newly Diagnosed Endometrial Cancers

    PubMed Central

    Egoavil, Cecilia; Alenda, Cristina; Castillejo, Adela; Paya, Artemio; Peiro, Gloria; Sánchez-Heras, Ana-Beatriz; Castillejo, Maria-Isabel; Rojas, Estefanía; Barberá, Víctor-Manuel; Cigüenza, Sonia; Lopez, Jose-Antonio; Piñero, Oscar; Román, Maria-Jose; Martínez-Escoriza, Juan-Carlos; Guarinos, Carla; Perez-Carbonell, Lucia; Aranda, Francisco-Ignacio; Soto, Jose-Luis

    2013-01-01

    Background Lynch syndrome (LS) is a hereditary condition that increases the risk for endometrial and other cancers. The identification of endometrial cancer (EC) patients with LS has the potential to influence life-saving interventions. We aimed to study the prevalence of LS among EC patients in our population. Methods Universal screening for LS was applied for a consecutive series EC. Tumor testing using microsatellite instability (MSI), immunohistochemistry (IHC) for mismatch-repair (MMR) protein expression and MLH1-methylation analysis, when required, was used to select LS-suspicious cases. Sequencing of corresponding MMR genes was performed. Results One hundred and seventy-three EC (average age, 63 years) were screened. Sixty-one patients (35%) had abnormal IHC or MSI results. After MLH1 methylation analysis, 27 cases were considered suspicious of LS. From these, 22 were contacted and referred for genetic counseling. Nineteen pursued genetic testing and eight were diagnosed of LS. Mutations were more frequent in younger patients (<50 yrs). Three cases had either intact IHC or MSS and reinforce the need of implement the EC screening with both techniques. Conclusion The prevalence of LS among EC patients was 4.6% (8/173); with a predictive frequency of 6.6% in the Spanish population. Universal screening of EC for LS is recommended. PMID:24244552

  1. The Medicinal Chemistry of Imidazotetrazine Prodrugs

    PubMed Central

    Moody, Catherine L.; Wheelhouse, Richard T

    2014-01-01

    Temozolomide (TMZ) is the standard first line treatment for malignant glioma, reaching “blockbuster” status in 2010, yet it remains the only drug in its class. The main constraints on the clinical effectiveness of TMZ therapy are its requirement for active DNA mismatch repair (MMR) proteins for activity, and inherent resistance through O6-methyl guanine-DNA methyl transferase (MGMT) activity. Moreover, acquired resistance, due to MMR mutation, results in aggressive TMZ-resistant tumour regrowth following good initial responses. Much of the attraction in TMZ as a drug lies in its PK/PD properties: it is acid stable and has 100% oral bioavailability; it also has excellent distribution properties, crosses the blood-brain barrier, and there is direct evidence of tumour localisation. This review seeks to unravel some of the mysteries of the imidazotetrazine class of compounds to which TMZ belongs. In addition to an overview of different synthetic strategies, we explore the somewhat unusual chemical reactivity of the imidazotetrazines, probing their mechanisms of reaction, examining which attributes are required for an active drug molecule and reviewing the use of this combined knowledge towards the development of new and improved anti-cancer agents. PMID:25014631

  2. Germline mutation analysis of MLH1 and MSH2 in Malaysian Lynch syndrome patients

    PubMed Central

    Zahary, Mohd Nizam; Kaur, Gurjeet; Abu Hassan, Muhammad Radzi; Singh, Harjinder; Naik, Venkatesh R; Ankathil, Ravindran

    2012-01-01

    AIM: To investigate the protein expression profile of mismatch repair (MMR) genes in suspected cases of Lynch syndrome and to characterize the associated germline mutations. METHODS: Immunohistochemical analysis of tumor samples was performed to determine the protein expression profile of MMR protein. Germline mutation screening was carried out on peripheral blood samples. The entire exon regions of MLH1 and MSH2 genes were amplified by polymerase chain reaction, screened by denaturing high performance liquid chromatography (dHPLC) and analyzed by DNA sequencing to characterize the germline mutations. RESULTS: Three out of 34 tissue samples (8.8%) and four out of 34 tissue samples (11.8%) showed loss of nuclear staining by immunohistochemistry, indicating the absence of MLH1 and MSH2 protein expression in carcinoma cells, respectively. dHPLC analysis followed by DNA sequencing showed these samples to have germline mutations of MSH2 gene. However, no deleterious mutations were identified in any of the 19 exons or coding regions of MLH1 gene, but we were able to identify MLH1 promoter polymorphism, -93G > A (rs1800734), in 21 out of 34 patients (61.8%). We identified one novel mutation, transversion mutation c.2005G > C, which resulted in a missense mutation (Gly669Arg), a transversion mutation in exon 1, c.142G > T, which resulted in a nonsense mutation (Glu48Stop) and splice-site mutation, c.2006-6T > C, which was adjacent to exon 13 of MSH2 gene. CONCLUSION: Germline mutations were identified in four Malaysian Lynch syndrome patients. Immunohistochemical analysis of tumor tissue proved to be a good pre-screening test before proceeding to germline mutation analysis of DNA MMR genes. PMID:22371642

  3. Early onset of colorectal cancer in a 13-year-old girl with Lynch syndrome.

    PubMed

    Ahn, Do Hee; Rho, Jung Hee; Tchah, Hann; Jeon, In-Sang

    2016-01-01

    Lynch syndrome is the most common inherited colon cancer syndrome. Patients with Lynch syndrome develop a range of cancers including colorectal cancer (CRC) and carry a mutation on one of the mismatched repair (MMR) genes. Although CRC usually occurs after the fourth decade in patients with Lynch syndrome harboring a heterozygous MMR gene mutation, it can occur in children with Lynch syndrome who have a compound heterozygous or homozygous MMR gene mutation. We report a case of CRC in a 13-year-old patient with Lynch syndrome and congenital heart disease. This patient had a heterozygous mutation in MLH1 (an MMR gene), but no compound MMR gene defects, and a K-RAS somatic mutation in the cancer cells. PMID:26893603

  4. Early onset of colorectal cancer in a 13-year-old girl with Lynch syndrome

    PubMed Central

    Ahn, Do Hee; Rho, Jung Hee; Tchah, Hann

    2016-01-01

    Lynch syndrome is the most common inherited colon cancer syndrome. Patients with Lynch syndrome develop a range of cancers including colorectal cancer (CRC) and carry a mutation on one of the mismatched repair (MMR) genes. Although CRC usually occurs after the fourth decade in patients with Lynch syndrome harboring a heterozygous MMR gene mutation, it can occur in children with Lynch syndrome who have a compound heterozygous or homozygous MMR gene mutation. We report a case of CRC in a 13-year-old patient with Lynch syndrome and congenital heart disease. This patient had a heterozygous mutation in MLH1 (an MMR gene), but no compound MMR gene defects, and a K-RAS somatic mutation in the cancer cells. PMID:26893603

  5. MutL traps MutS at a DNA mismatch

    PubMed Central

    Qiu, Ruoyi; Sakato, Miho; Sacho, Elizabeth J.; Wilkins, Hunter; Zhang, Xingdong; Modrich, Paul; Hingorani, Manju M.; Erie, Dorothy A.; Weninger, Keith R.

    2015-01-01

    DNA mismatch repair (MMR) identifies and corrects errors made during replication. In all organisms except those expressing MutH, interactions between a DNA mismatch, MutS, MutL, and the replication processivity factor (β-clamp or PCNA) activate the latent MutL endonuclease to nick the error-containing daughter strand. This nick provides an entry point for downstream repair proteins. Despite the well-established significance of strand-specific nicking in MMR, the mechanism(s) by which MutS and MutL assemble on mismatch DNA to allow the subsequent activation of MutL’s endonuclease activity by β-clamp/PCNA remains elusive. In both prokaryotes and eukaryotes, MutS homologs undergo conformational changes to a mobile clamp state that can move away from the mismatch. However, the function of this MutS mobile clamp is unknown. Furthermore, whether the interaction with MutL leads to a mobile MutS–MutL complex or a mismatch-localized complex is hotly debated. We used single molecule FRET to determine that Thermus aquaticus MutL traps MutS at a DNA mismatch after recognition but before its conversion to a sliding clamp. Rather than a clamp, a conformationally dynamic protein assembly typically containing more MutL than MutS is formed at the mismatch. This complex provides a local marker where interaction with β-clamp/PCNA could distinguish parent/daughter strand identity. Our finding that MutL fundamentally changes MutS actions following mismatch detection reframes current thinking on MMR signaling processes critical for genomic stability. PMID:26283381

  6. Four novel MSH2 / MLH1 gene mutations in portuguese HNPCC families.

    PubMed

    Isidro, G; Veiga, I; Matos, P; Almeida, S; Bizarro, S; Marshall, B; Baptista, M; Leite, J; Regateiro, F; Soares, J; Castedo, S; Boavida, M G

    2000-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) is considered to be determined by germline mutations in the mismatch repair (MMR) genes, especially MSH2 and MLH1. While screening for mutations in these two genes in HNPCC portuguese families, 3 previously unreported MSH2 and 1 MLH1 mutations have been identified in families meeting strict Amsterdam criteria. Hum Mutat 15:116, 2000. PMID:10612836

  7. Association between the expression levels of TAZ, AXL and CTGF and clinicopathological parameters in patients with colon cancer

    PubMed Central

    ZHANG, SHU-DONG; MCCRUDDEN, CIAN M.; YUEN, HIU-FUNG; LEUNG, KA LAI; HONG, WAN-JIN; KWOK, HANG FAI

    2016-01-01

    Colon cancer accounts for a large proportion of all the cancer-associated morbidities worldwide. Genetic analysis and stratification of patients based on survival may identify genetic signatures potentially useful for prognostic or treatment planning purposes. Previous studies have reported that the messenger (m)RNA expression levels of tafazzin (TAZ), AXL receptor tyrosine kinase (AXL) and connective tissue growth factor (CTGF) were able to predict the survival of patients with colon cancer in two independent colon cancer datasets. However, limited clinicopathological data were available from these two datasets. By contrast, a large colon cancer dataset comprising 566 patients has been recently published in the Gene Expression Omnibus database, which contains data regarding tumor stage and location, and genetic status of mismatch repair (MMR), Kirsten rat sarcoma viral oncogene homolog (KRAS), B-Raf proto-oncogene serine/threonine kinase (BRAF) and tumor protein p53 (TP53). In the present study, the mRNA expression levels of TAZ, AXL and CTGF were evaluated, and the TAZ-AXL-CTGF signature was correlated with the available pathological parameters and survival data. Overexpression of TAZ, AXL and CTGF was observed to be associated with severe pathological stage, deficiency in MMR, colon cancer subtype C4 and mutations in the BRAF gene. In addition, overexpression of TAZ-AXL-CTGF was associated with short overall survival in patients with mutations in the TP53 gene, colon cancer subtype C6, proficient MMR and wild-type status of the KRAS and BRAF genes. Furthermore, the prognostic value of TAZ-AXL-CTGF overexpression was observed to be independent of all the clinicopathological parameters and mutational statuses analyzed. The results of the present study confirm the previously reported findings, and suggest that the TAZ-AXL-CTGF mRNA signature is a potential prognostic indicator in colon cancer. PMID:26893723

  8. Extensive Microsatellite Variation in Rice Induced by Introgression from Wild Rice (Zizania latifolia Griseb.)

    PubMed Central

    Dong, Zhenying; Wang, Hongyan; Dong, Yuzhu; Wang, Yongming; Liu, Wei; Miao, Gaojian; Lin, Xiuyun; Wang, Daqing; Liu, Bao

    2013-01-01

    Background It is widely accepted that interspecific hybridization may induce genomic instability in the resultant hybrids. However, few studies have been performed on the genomic analysis of homoploid hybrids and introgression lines. We have reported previously that by introgressive hybridization, a set of introgression lines between rice (Oryza sativa L.) and wild rice (Zizania latifolia Griseb.) was successfully generated, and which have led to the release of several cultivars. Methodology Using 96 microsatellite markers located in the nuclear and organelle genomes of rice, we investigated microsatellite stability in three typical introgression lines. Expression of a set of mismatch repair (MMR) genes and microsatellite-containing genes was also analyzed. Results/Conclusions Compared with the recipient rice cultivar (Matsumae), 55 of the 96 microsatellite loci revealed variation in one or more of the introgression lines, and 58.2% of the altered alleles were shared by at least two lines, indicating that most of the alterations had occurred in the early stages of introgression before their further differentiation. 73.9% of the non-shared variations were detected only in one introgression line, i.e. RZ2. Sequence alignment showed that the variations included substitutions and indels that occurred both within the repeat tracts and in the flanking regions. Interestingly, expression of a set of MMR genes altered dramatically in the introgression lines relative to their rice parent, suggesting participation of the MMR system in the generation of microsatellite variants. Some of the altered microsatellite loci are concordant with changed expression of the genes harboring them, suggesting their possible cis-regulatory roles in controlling gene expression. Because these genes bear meaningful homology to known-functional proteins, we conclude that the introgression-induced extensive variation of microsatellites may have contributed to the novel phenotypes in the

  9. Exo1 phosphorylation status controls the hydroxyurea sensitivity of cells lacking the Pol32 subunit of DNA polymerases delta and zeta

    PubMed Central

    Doerfler, Lillian; Schmidt, Kristina H.

    2015-01-01

    Exo1 belongs to the Rad2 family of structure-specific nucleases and possesses 5′-3′ exonuclease activity on double-stranded DNA substrates. Exo1 interacts physically with the DNA mismatch repair (MMR) proteins Msh2 and Mlh1 and is involved in the excision of the mispaired nucleotide. Independent of its role in MMR, Exo1 contributes to long-range resection of DNA double-strand break (DSB) ends to facilitate their repair by homologous recombination (HR), and was recently identified as a component of error-free DNA damage tolerance pathways. Here we show that Exo1 activity increases the hydroxyurea sensitivity of cells lacking Pol32, a subunit of DNA polymerases δ and ζ Both, phospho-mimicking and dephospho-mimicking exo1 mutants act as hypermorphs, as evidenced by an increase in HU sensitivity of pol32Δ cells, suggesting that they are trapped in an active form and that phosphorylation of Exo1 at residues S372, S567, S587, S692 is necessary, but insufficient, for the accurate regulation of Exo1 activity at stalled replication forks. In contrast, neither phosphorylation status is important for Exo1's role in MMR or in the suppression of genome instability in cells lacking Sgs1 helicase. This ability of an EXO1 deletion to suppress the HU hypersensitivity of pol32Δ cells is in contrast to the negative genetic interaction between deletions of EXO1 and POL32 in MMS-treated cells as well as the role of EXO1 in DNA-damage treated rad53 and mec1 mutants. PMID:25457771

  10. Efficacy of Adjuvant 5-Fluorouracil Therapy for Patients with EMAST-Positive Stage II/III Colorectal Cancer

    PubMed Central

    Hamaya, Yasushi; Guarinos, Carla; Tseng-Rogenski, Stephanie S.; Iwaizumi, Moriya; Das, Ritabrata; Jover, Rodrigo; Castells, Antoni; Llor, Xavier; Andreu, Montserrat; Carethers, John M.

    2015-01-01

    Elevated Microsatellite Alterations at Selected Tetranucleotide repeats (EMAST) is a genetic signature found in up to 60% of colorectal cancers (CRCs) that is caused by somatic dysfunction of the DNA mismatch repair (MMR) protein hMSH3. We have previously shown in vitro that recognition of 5-fluorouracil (5-FU) within DNA and subsequent cytotoxicity was most effective when both hMutSα (hMSH2-hMSH6 heterodimer) and hMutSβ (hMSH2-hMSH3 heterodimer) MMR complexes were present, compared to hMutSα > hMutSβ alone. We tested if patients with EMAST CRCs (hMutSβ defective) had diminished response to adjuvant 5-FU chemotherapy, paralleling in vitro findings. We analyzed 230 patients with stage II/III sporadic colorectal cancers for which we had 5-FU treatment and survival data. Archival DNA was analyzed for EMAST (>2 of 5 markers mutated among UT5037, D8S321, D9S242, D20S82, D20S85 tetranucleotide loci). Kaplan-Meier survival curves were generated and multivariate analysis was used to determine contribution to risk. We identified 102 (44%) EMAST cancers. Ninety-four patients (41%) received adjuvant 5-FU chemotherapy, and median follow-up for all patients was 51 months. Patients with EMAST CRCs demonstrated improved survival with adjuvant 5FU to the same extent as patients with non-EMAST CRCs (P<0.05). We observed no difference in survival between patients with stage II/III EMAST and non-EMAST cancers (P = 0.36). There is improved survival for stage II/III CRC patients after adjuvant 5-FU-based chemotherapy regardless of EMAST status. The loss of contribution of hMSH3 for 5-FU cytotoxicity may not adversely affect patient outcome, contrasting patients whose tumors completely lack DNA MMR function (MSI-H). PMID:25996601

  11. Loss of switch/sucrose non-fermenting complex protein expression is associated with dedifferentiation in endometrial carcinomas.

    PubMed

    Karnezis, Anthony N; Hoang, Lien N; Coatham, Mackenzie; Ravn, Sarah; Almadani, Noorah; Tessier-Cloutier, Basile; Irving, Julie; Meng, Bo; Li, Xiaodong; Chow, Christine; McAlpine, Jessica; Kuo, Kuan-Ting; Mao, Tsui-Lien; Djordjevic, Bojana; Soslow, Robert A; Huntsman, David G; Blake Gilks, C; Köbel, Martin; Lee, Cheng-Han

    2016-03-01

    Dedifferentiated endometrial carcinoma is an aggressive type of endometrial cancer that contains a mix of low-grade endometrioid and undifferentiated carcinoma components. We performed targeted sequencing of eight dedifferentiated carcinomas and identified somatic frameshift/nonsense mutations in SMARCA4, a core ATPase of the switch/sucrose non-fermenting (SWI/SNF) complex, in the undifferentiated components of four tumors. Immunohistochemical analysis confirmed the loss of SMARCA4 in the undifferentiated component of these four SMARCA4-mutated cases, whereas the corresponding low-grade endometrioid component showed retained SMARCA4 expression. An expanded survey of other members of the SWI/SNF complex showed SMARCB1 loss in the undifferentiated component of two SMARCA4-intact tumors, and all SMARCA4- or SMARCB1-deficient tumors showed concomitant loss of expression of SMARCA2. We subsequently examined the expression of SMARCA2, SMARCA4, and SMARCB1 in an additional set of 22 centrally reviewed dedifferentiated carcinomas and 31 grade 3 endometrioid carcinomas. Combining the results from the index and the expansion set, 15 of 30 (50%) of the dedifferentiated carcinomas examined showed either concurrent SMARCA4 and SMARCA2 loss (37%) or concurrent SMARCB1 and SMARCA2 loss (13%) in the undifferentiated component. The loss of SMARCA4 or SMARCB1 was mutually exclusive. All 31 grade 3 endometrioid carcinomas showed intact expression of these core SWI/SNF proteins. The majority (73%) of the SMARCA4/SMARCA2-deficient and half of SMARCB1/SMARCA2-deficient undifferentiated component developed in a mismatch repair-deficient molecular context. The observed spatial association between SWI/SNF protein loss and histologic dedifferentiation suggests that inactivation of these core SWI/SNF proteins may contribute to the development of dedifferentiated endometrial carcinoma. PMID:26743474

  12. Protein signatures as potential surrogate biomarkers for stratification and prediction of treatment response in chronic myeloid leukemia patients

    PubMed Central

    Alaiya, Ayodele A.; Aljurf, Mahmoud; Shinwari, Zakia; Almohareb, Fahad; Malhan, Hafiz; Alzahrani, Hazzaa; Owaidah, Tarek; Fox, Jonathan; Alsharif, Fahad; Mohamed, Said Y.; Rasheed, Walid; Aldawsari, Ghuzayel; Hanbali, Amr; Ahmed, Syed Osman; Chaudhri, Naeem

    2016-01-01

    There is unmet need for prediction of treatment response for chronic myeloid leukemia (CML) patients. The present study aims to identify disease-specific/disease-associated protein biomarkers detectable in bone marrow and peripheral blood for objective prediction of individual’s best treatment options and prognostic monitoring of CML patients. Bone marrow plasma (BMP) and peripheral blood plasma (PBP) samples from newly-diagnosed chronic-phase CML patients were subjected to expression-proteomics using quantitative two-dimensional gel electrophoresis (2-DE) and label-free liquid chromatography tandem mass spectrometry (LC-MS/MS). Analysis of 2-DE protein fingerprints preceding therapy commencement accurately predicts 13 individuals that achieved major molecular response (MMR) at 6 months from 12 subjects without MMR (No-MMR). Results were independently validated using LC-MS/MS analysis of BMP and PBP from patients that have more than 24 months followed-up. One hundred and sixty-four and 138 proteins with significant differential expression profiles were identified from PBP and BMP, respectively and only 54 proteins overlap between the two datasets. The protein panels also discriminates accurately patients that stay on imatinib treatment from patients ultimately needing alternative treatment. Among the identified proteins are TYRO3, a member of TAM family of receptor tyrosine kinases (RTKs), the S100A8, and MYC and all of which have been implicated in CML. Our findings indicate analyses of a panel of protein signatures is capable of objective prediction of molecular response and therapy choice for CML patients at diagnosis as ‘personalized-medicine-model’. PMID:27573699

  13. Protein signatures as potential surrogate biomarkers for stratification and prediction of treatment response in chronic myeloid leukemia patients.

    PubMed

    Alaiya, Ayodele A; Aljurf, Mahmoud; Shinwari, Zakia; Almohareb, Fahad; Malhan, Hafiz; Alzahrani, Hazzaa; Owaidah, Tarek; Fox, Jonathan; Alsharif, Fahad; Mohamed, Said Y; Rasheed, Walid; Aldawsari, Ghuzayel; Hanbali, Amr; Ahmed, Syed Osman; Chaudhri, Naeem

    2016-09-01

    There is unmet need for prediction of treatment response for chronic myeloid leukemia (CML) patients. The present study aims to identify disease-specific/disease-associated protein biomarkers detectable in bone marrow and peripheral blood for objective prediction of individual's best treatment options and prognostic monitoring of CML patients. Bone marrow plasma (BMP) and peripheral blood plasma (PBP) samples from newly-diagnosed chronic-phase CML patients were subjected to expression-proteomics using quantitative two-dimensional gel electrophoresis (2-DE) and label-free liquid chromatography tandem mass spectrometry (LC-MS/MS). Analysis of 2-DE protein fingerprints preceding therapy commencement accurately predicts 13 individuals that achieved major molecular response (MMR) at 6 months from 12 subjects without MMR (No-MMR). Results were independently validated using LC-MS/MS analysis of BMP and PBP from patients that have more than 24 months followed-up. One hundred and sixty-four and 138 proteins with significant differential expression profiles were identified from PBP and BMP, respectively and only 54 proteins overlap between the two datasets. The protein panels also discriminates accurately patients that stay on imatinib treatment from patients ultimately needing alternative treatment. Among the identified proteins are TYRO3, a member of TAM family of receptor tyrosine kinases (RTKs), the S100A8, and MYC and all of which have been implicated in CML. Our findings indicate analyses of a panel of protein signatures is capable of objective prediction of molecular response and therapy choice for CML patients at diagnosis as 'personalized-medicine-model'. PMID:27573699

  14. Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer

    PubMed Central

    Carethers, John M; Stoffel, Elena M

    2015-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management. PMID:26309352

  15. A large observational study to concurrently assess persistence of measles specific B-cell and T-cell immunity in individuals following two doses of MMR vaccine.

    PubMed

    Haralambieva, Iana H; Ovsyannikova, Inna G; O'Byrne, Megan; Pankratz, V Shane; Jacobson, Robert M; Poland, Gregory A

    2011-06-15

    The measurement of measles-specific neutralizing antibodies, directed against the surface measles virus hemagglutinin and fusion proteins, is considered the gold standard in measles serology. We assessed functional measles-specific neutralizing antibody levels in a racially diverse cohort of 763 young healthy adolescents after receipt of two doses of measles-mumps-rubella vaccine, by the use of an automated plaque reduction microneutralization (PRMN) assay, and evaluated their relevance to protective antibody levels, as well as their associations with demographic and clinical variables. We also concurrently assessed measles-specific IFNγ Elispot responses and their relation to the observed antibody concentrations. The geometric mean titer for our cohort was 832mIU/mL (95% CIs: 776; 891). Sixty-eight subjects (8.9%) had antibody concentrations of less than the protective threshold of 210mIU/mL (corresponding to PRMN titer of 120; suggesting protection against symptomatic disease), and 177 subjects (23.2%) demonstrated persisting antibody concentrations above 1841mIU/mL (corresponding to PRMN titer of 1052; suggesting total protection against viral infection), 7.4 years after vaccination, in the absence of wild-type virus boosting. The mean measles-specific IFNγ Elispot response for our cohort was 46 (95% CIs: 43; 49) IFNγ-positive spots per 200,000 cells with no relation of cellular immunity measures to the observed antibody concentrations. No significant associations between antibody titers and demographic and clinical variables, including gender and race, were observed in our study. In conclusion, in a large observational study of measles immunity, we used an automated high-throughput measles virus-specific neutralization assay to measure humoral immunity, and concurrently determined measles-specific cellular immunity to aid the assessment of potential susceptibility to measles in vaccinated populations. PMID:21539880

  16. The C-terminal domain of the MutL homolog from Neisseria gonorrhoeae forms an inverted homodimer.

    PubMed

    Namadurai, Sivakumar; Jain, Deepti; Kulkarni, Dhananjay S; Tabib, Chaitanya R; Friedhoff, Peter; Rao, Desirazu N; Nair, Deepak T

    2010-01-01

    The mismatch repair (MMR) pathway serves to maintain the integrity of the genome by removing mispaired bases from the newly synthesized strand. In E. coli, MutS, MutL and MutH coordinate to discriminate the daughter strand through a mechanism involving lack of methylation on the new strand. This facilitates the creation of a nick by MutH in the daughter strand to initiate mismatch repair. Many bacteria and eukaryotes, including humans, do not possess a homolog of MutH. Although the exact strategy for strand discrimination in these organisms is yet to be ascertained, the required nicking endonuclease activity is resident in the C-terminal domain of MutL. This activity is dependent on the integrity of a conserved metal binding motif. Unlike their eukaryotic counterparts, MutL in bacteria like Neisseria exist in the form of a homodimer. Even though this homodimer would possess two active sites, it still acts a nicking endonuclease. Here, we present the crystal structure of the C-terminal domain (CTD) of the MutL homolog of Neisseria gonorrhoeae (NgoL) determined to a resolution of 2.4 Å. The structure shows that the metal binding motif exists in a helical configuration and that four of the six conserved motifs in the MutL family, including the metal binding site, localize together to form a composite active site. NgoL-CTD exists in the form of an elongated inverted homodimer stabilized by a hydrophobic interface rich in leucines. The inverted arrangement places the two composite active sites in each subunit on opposite lateral sides of the homodimer. Such an arrangement raises the possibility that one of the active sites is occluded due to interaction of NgoL with other protein factors involved in MMR. The presentation of only one active site to substrate DNA will ensure that nicking of only one strand occurs to prevent inadvertent and deleterious double stranded cleavage. PMID:21060849

  17. Diagnostic method employing MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1998-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  18. Diagnostic method employing MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1998-11-17

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  19. MLH1 promoter hypermethylation in the analytical algorithm of Lynch syndrome: a cost-effectiveness study.

    PubMed

    Gausachs, Mireia; Mur, Pilar; Corral, Julieta; Pineda, Marta; González, Sara; Benito, Llúcia; Menéndez, Mireia; Espinàs, Josep Alfons; Brunet, Joan; Iniesta, María Dolores; Gruber, Stephen B; Lázaro, Conxi; Blanco, Ignacio; Capellá, Gabriel

    2012-07-01

    The analytical algorithm of Lynch syndrome (LS) is increasingly complex. BRAF V600E mutation and MLH1 promoter hypermethylation have been proposed as a screening tool for the identification of LS. The aim of this study was to assess the clinical usefulness and cost-effectiveness of both somatic alterations to improve the yield of the diagnostic algorithm of LS. A total of 122 colorectal tumors from individuals with family history of colorectal cancer that showed microsatellite instability and/or loss of mismatch repair (MMR) protein expression were studied. MMR germline mutations were detected in 57 cases (40 MLH1, 15 MSH2 and 2 MSH6). BRAF V600E mutation was assessed by single-nucleotide primer extension. MLH1 promoter hypermethylation was assessed by methylation-specific multiplex ligation-dependent probe amplification in a subset of 71 cases with loss of MLH1 protein. A decision model was developed to estimate the incremental costs of alternative case-finding methods for detecting MLH1 mutation carriers. One-way sensitivity analysis was performed to assess robustness of estimations. Sensitivity of the absence of BRAF mutations for depiction of LS patients was 96% (23/24) and specificity was 28% (13/47). Specificity of MLH1 promoter hypermethylation for depiction of sporadic tumors was 66% (31/47) and sensitivity of 96% (23/24). The cost per additional mutation detected when using hypermethylation analysis was lower when compared with BRAF study and germinal MLH1 mutation study. Somatic hypermethylation of MLH1 is an accurate and cost-effective pre-screening method in the selection of patients that are candidates for MLH1 germline analysis when LS is suspected and MLH1 protein expression is absent. PMID:22274583

  20. MMR Vaccine (Measles, Mumps, and Rubella)

    MedlinePlus

    Attenuvax® Measles Vaccine ... R-Vax® II (as a combination product containing Measles Vaccine, Rubella Vaccine) ... M-R® II (as a combination product containing Measles Vaccine, Mumps Vaccine, Rubella Vaccine)

  1. Minority MMR Overrepresentation and Special Education Reform.

    ERIC Educational Resources Information Center

    Reschly, Daniel J.

    1988-01-01

    Recommendations from "Placing Children in Special Education" are reviewed, focusing on: (1) inaccurate interpretation of overrepresentation of minority mildly mentally retarded students, (2) use of prereferral interventions, (3) cross-categorical programing, (4) application of an outcomes criterion, and (5) expansion of regular education options…

  2. Molecular alloys: experimental and theoretical investigations on the substitution of zinc by cadmium and mercury in the homologous series [Mo(M'R)12] and [M(M'R)8] (M=Pd, Pt; M'=Zn, Cd, Hg).

    PubMed

    Bollermann, Timo; Cadenbach, Thomas; Gemel, Christian; von Hopffgarten, Moritz; Frenking, Gernot; Fischer, Roland A

    2010-12-01

    The synthesis and structural characterization of novel, metal-rich, highly coordinated compounds [Mo(M'R)(12)] and [M(M'R)(8)] (M: Pd, Pt, Mo; M': Zn, Cd; R: Me=CH(3), Cp*=pentamethylcyclopentadienyl) are reported. Additionally, a description of the bonding situation of the new compounds by means of quantum-chemical calculations is presented including the Hg analogues. Reaction of [Pt(GaCp*)(4)] with CdMe(2) results in the formation of the unprecedented all-Cd coordinated [Pt(CdMe)(4)(CdCp*)(4)] (1). Similarly, the treatment of the all-Zn coordinated [Pd(ZnMe)(4)(ZnCp*)(4)] with CdMe(2) affords the novel Zn/Cd mixed compound [Pd(CdMe)(4)(ZnCp*)(4)] (2). The related Zn/Cd mixed compound [Mo(ZnCp*)(3)(CdMe)(9)] (3) is prepared by reaction of [Mo(ZnCp*)(4)(GaMe)(4)] with an excess amount of CdMe(2). All compounds were analyzed by (1)H and (13)C NMR spectroscopy, elemental analysis, and single-crystal X-ray diffraction. The bonding situation of these highly coordinated, metal-rich molecules 1-3 were studied by quantum-chemical calculations using density functional theory (DFT) at the BP86/TZ2P+ level, atoms-in-molecules (AIM) analysis, and energy-decomposition analysis (EDA), as well as the its natural orbitals for chemical valence variation (EDA-NOCV) and including the hypothetically all-Hg-coordinated analogues. The results point out that the radial interactions M-M' in the icosahedral compounds that have twelve ligands are best described as classical electron-pair-sharing covalent bonds, whereas the dodecahedral species, which have eight ligands, exhibit metal-ligand donor-acceptor bonds. The attractive interactions between the metal-ligand fragments M'R by means of M'-M' bonds are weaker but not insignificant. All complexes fulfill the 18-electron rule. The analysis clarifies the electronic structures as being distinctly different from typical endohedral clusters M@(M''R)(n) that exhibit strong peripheral M''-M'' interactions: The M'-M' bonds are not strong enough

  3. Clinicopathologic Features of Colorectal Carcinoma in HIV-Positive Patients

    PubMed Central

    Sigel, Carlie; Cavalcanti, Marcela S.; Daniel, Tanisha; Vakiani, Efsevia; Shia, Jinru; Sigel, Keith

    2016-01-01

    Background Emerging evidence suggests differences in colo-rectal cancer in HIV-infected patients (HIV+) compared with HIV− patients. Microsatellite instability (MSI), occurring in a subset of colorectal cancer, is present at a higher rate in certain cancers in HIV+ patients. Colorectal cancer with MSI share some characteristics with those reported for HIV+ colorectal cancer. On this premise, we studied clinical and pathologic features of HIV+ colorectal cancer and evaluated for MSI using matched HIV− colorectal cancer controls. Methods Two nested, matched cohorts were identified from a hospital-based cohort of colorectal cancer patients. HIV+ colo-rectal cancers were identified and random control patients were matched for selected characteristics. Mismatch repair protein (MMR) IHC was performed as the detection method for MSI. Variables were compared between cases and controls using fixed-effects logit modeling to account for matching. Results We included 184 colorectal cancer samples (38 HIV+, 146 HIV− control). Median patient age at colorectal cancer onset was 55. When compared with HIV− colorectal cancer, HIV+patients were more likely to have smoked (P = 0.001), have right-sided colorectal cancer (37% vs. 14%; P = 0.003), and tumor-infiltrating lymphocytes (TIL) above 50/10 high-power fields (21% vs. 7%). There was no difference in MMR protein expression (P = 0.6). HIV+ colorectal cancer patients had reduced overall survival (P = 0.02) but no difference in progression-free survival. Conclusions HIV+ patients developed colorectal cancer at a lower median age than population estimates, had a higher frequency of right-sided disease, and increased TILs, suggesting potential biologic differences compared with uninfected patients. Impact Clinicopathologic differences in colorectal cancer of HIV+ persons may have implications for tumor pathogenesis. PMID:27197294

  4. Prospective Multicenter Study of the Impact of Oncotype DX Colon Cancer Assay Results on Treatment Recommendations in Stage II Colon Cancer Patients

    PubMed Central

    Srivastava, Geetika; Renfro, Lindsay A.; Behrens, Robert J.; Lopatin, Margarita; Chao, Calvin; Soori, Gamini S.; Dakhil, Shaker R.; Mowat, Rex B.; Kuebler, J. Philip; Kim, George; Mazurczak, Miroslaw; Lee, Mark

    2014-01-01

    Purpose. The Oncotype DX colon cancer assay is a clinically validated predictor of recurrence risk in stage II colon cancer patients. This prospective study evaluated the impact of recurrence score (RS) results on physician recommendations regarding adjuvant chemotherapy in T3, mismatch repair-proficient (MMR-P) stage II colon cancer patients. Patients and Methods. Stage IIA colon cancer patients were enrolled in 17 centers. Patient tumor specimens were assessed by the RS test (quantitative reverse transcription-polymerase chain reaction) and mismatch repair (immunohistochemistry). For each patient, the physician’s recommended postoperative treatment plan of observation, fluoropyrimidine monotherapy, or combination therapy with oxaliplatin was recorded before and after the RS and mismatch repair results were provided. Results. Of 221 enrolled patients, 141 patients had T3 MMR-P tumors and were eligible for the primary analysis. Treatment recommendations changed for 63 (45%; 95% confidence interval: 36%–53%) of these 141 T3 MMR-P patients, with intensity decreasing for 47 (33%) and increasing for 16 (11%). Recommendations for chemotherapy decreased from 73 patients (52%) to 42 (30%), following review of RS results by physician and patient. Increased treatment intensity was more often observed at higher RS values, and decreased intensity was observed at lower values (p = .011). Conclusion. Compared with traditional clinicopathological assessment, incorporation of the RS result into clinical decision making was associated with treatment recommendation changes for 45% of T3 MMR-P stage II colon cancer patients in this prospective multicenter study. Use of the RS assay may lead to overall reduction in adjuvant chemotherapy use in this subgroup of stage II colon cancer patients. PMID:24710310

  5. NMR characterization of the interaction of the endonuclease domain of MutL with divalent metal ions and ATP.

    PubMed

    Mizushima, Ryota; Kim, Ju Yaen; Suetake, Isao; Tanaka, Hiroaki; Takai, Tomoyo; Kamiya, Narutoshi; Takano, Yu; Mishima, Yuichi; Tajima, Shoji; Goto, Yuji; Fukui, Kenji; Lee, Young-Ho

    2014-01-01

    MutL is a multi-domain protein comprising an N-terminal ATPase domain (NTD) and C-terminal dimerization domain (CTD), connected with flexible linker regions, that plays a key role in DNA mismatch repair. To expand understanding of the regulation mechanism underlying MutL endonuclease activity, our NMR-based study investigated interactions between the CTD of MutL, derived from the hyperthermophilic bacterium Aquifex aeolicus (aqMutL-CTD), and putative binding molecules. Chemical shift perturbation analysis with the model structure of aqMutL-CTD and circular dichroism results revealed that tight Zn(2+) binding increased thermal stability without changing secondary structures to function at high temperatures. Peak intensity analysis exploiting the paramagnetic relaxation enhancement effect indicated the binding site for Mn(2+), which shared binding sites for Zn(2+). The coexistence of these two metal ions appears to be important for the function of MutL. Chemical shift perturbation analysis revealed a novel ATP binding site in aqMutL-CTD. A docking simulation incorporating the chemical shift perturbation data provided a putative scheme for the intermolecular interactions between aqMutL-CTD and ATP. We proposed a simple and understandable mechanical model for the regulation of MutL endonuclease activity in MMR based on the relative concentrations of ATP and CTD through ATP binding-regulated interdomain interactions between CTD and NTD. PMID:24901533

  6. NMR Characterization of the Interaction of the Endonuclease Domain of MutL with Divalent Metal Ions and ATP

    PubMed Central

    Mizushima, Ryota; Kim, Ju Yaen; Suetake, Isao; Tanaka, Hiroaki; Takai, Tomoyo; Kamiya, Narutoshi; Takano, Yu; Mishima, Yuichi; Tajima, Shoji; Goto, Yuji; Fukui, Kenji; Lee, Young-Ho

    2014-01-01

    MutL is a multi-domain protein comprising an N-terminal ATPase domain (NTD) and C-terminal dimerization domain (CTD), connected with flexible linker regions, that plays a key role in DNA mismatch repair. To expand understanding of the regulation mechanism underlying MutL endonuclease activity, our NMR-based study investigated interactions between the CTD of MutL, derived from the hyperthermophilic bacterium Aquifex aeolicus (aqMutL-CTD), and putative binding molecules. Chemical shift perturbation analysis with the model structure of aqMutL-CTD and circular dichroism results revealed that tight Zn2+ binding increased thermal stability without changing secondary structures to function at high temperatures. Peak intensity analysis exploiting the paramagnetic relaxation enhancement effect indicated the binding site for Mn2+, which shared binding sites for Zn2+. The coexistence of these two metal ions appears to be important for the function of MutL. Chemical shift perturbation analysis revealed a novel ATP binding site in aqMutL-CTD. A docking simulation incorporating the chemical shift perturbation data provided a putative scheme for the intermolecular interactions between aqMutL-CTD and ATP. We proposed a simple and understandable mechanical model for the regulation of MutL endonuclease activity in MMR based on the relative concentrations of ATP and CTD through ATP binding-regulated interdomain interactions between CTD and NTD. PMID:24901533

  7. Elimination of Chromosomal Island SpyCIM1 from Streptococcus pyogenes Strain SF370 Reverses the Mutator Phenotype and Alters Global Transcription

    PubMed Central

    Nguyen, Scott V.; Rahman, Maliha; McCullor, Kimberly A.; King, Catherine J.; Fischetti, Vincent A.; McShan, W. Michael

    2015-01-01

    Streptococcus pyogenes chromosomal island M1 (SpyCIM1) integrates by site-specific recombination into the 5’ end of DNA mismatch repair (MMR) gene mutL in strain SF370SmR, blocking transcription of it and the downstream operon genes. During exponential growth, SpyCIM1 excises from the chromosome and replicates as an episome, restoring mutL transcription. This process is reversed in stationary phase with SpyCIM1 re-integrating into mutL, returning the cells to a mutator phenotype. Here we show that elimination of SpyCIM1 relieves this mutator phenotype. The downstream MMR operon genes, multidrug efflux pump lmrP, Holliday junction resolution helicase ruvA, and DNA base excision repair glycosylase tag, are also restored to constitutive expression by elimination of SpyCIM1. The presence of SpyCIM1 alters global transcription patterns in SF370SmR. RNA sequencing (RNA-Seq) demonstrated that loss of SpyCIM1 in the SpyCIM1 deletion mutant, CEM1Δ4, impacted the expression of over 100 genes involved in virulence and metabolism both in early exponential phase, when the SpyCIM1 is episomal, as well as at the onset of stationary phase, when SpyCIM1 has reintegrated into mutL. Among these changes, the up-regulation of the genes for the antiphagocytic M protein (emm1), streptolysin O (slo), capsule operon (hasABC), and streptococcal pyrogenic exotoxin (speB), are particularly notable. The expression pattern of the MMR operon confirmed our earlier observations that these genes are transcribed in early exponential phase but silenced as stationary phase is approached. Thus, the direct role of SpyCIM1 in causing the mutator phenotype is confirmed, and further, its influence upon the biology of S. pyogenes was found to impact multiple genes in addition to the MMR operon, which is a novel function for a mobile genetic element. We suggest that such chromosomal islands are a remarkable evolutionary adaptation to promote the survival of its S. pyogenes host cell in changing

  8. VE1 immunohistochemistry predicts BRAF V600E mutation status and clinical outcome in colorectal cancer

    PubMed Central

    Schafroth, Christian; Galván, José A.; Centeno, Irene; Koelzer, Viktor H.; Dawson, Heather E.; Sokol, Lena; Rieger, Gregor; Berger, Martin D.; Hädrich, Marion; Rosenberg, Robert; Nitsche, Ulrich; Schnüriger, Beat; Langer, Rupert; Inderbitzin, Daniel; Lugli, Alessandro; Zlobec, Inti

    2015-01-01

    Aim VE1 is a monoclonal antibody detecting mutant BRAFV600E protein by immunohistochemistry. Here we aim to determine the inter-observer agreement and concordance of VE1 with mutational status, investigate heterogeneity in colorectal cancers and metastases and determine the prognostic effect of VE1 in colorectal cancer patients. Methods Concordance of VE1 with mutational status and inter-observer agreement were tested on a pilot cohort of colorectal cancers (n = 34), melanomas (n = 23) and thyroid cancers (n = 8). Two prognostic cohorts were evaluated (n = 259, Cohort 1 and n = 226, Cohort 2) by multiple-punch tissue microarrays. VE1 staining on preoperative biopsies (n = 118 patients) was compared to expression in resections. Primary tumors and metastases from 13 patients were tested for VE1 heterogeneity using a tissue microarray generated from all available blocks (n = 100 blocks). Results Inter-observer agreement was 100% (kappa = 1.0). Concordance between VE1 and V600E mutation was 98.5%. Cohort 1: VE1 positivity (seen in 13.5%) was associated with older age (p = 0.0175) and MLH1 deficiency (p < 0.0001). Cohort 2: VE1 positivity (seen in 12.8%) was associated with female gender (p = 0.0016), right-sided tumor location (p < 0.0001), higher tumor grade (p < 0.0001) and mismatch repair (MMR)-deficiency (p < 0.0001). In survival analysis, MMR status and postoperative therapy were identified as possible confounding factors. Adjusting for these features, VE1 was an unfavorable prognostic factor. Preoperative biopsy staining matched resections in all cases except one. No heterogeneity was found across any primary/metastatic tumor blocks. Conclusion VE1 is highly concordant for V600E and homogeneously expressed suggesting staining can be analysed on resection specimens, preoperative biopsies, metastatic lesions and tissue microarrays. PMID:26496026

  9. Chromosomal islands of Streptococcus pyogenes and related streptococci: molecular switches for survival and virulence

    PubMed Central

    Nguyen, Scott V.; McShan, William M.

    2014-01-01

    Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5′ end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges. PMID:25161960

  10. Chromosomal islands of Streptococcus pyogenes and related streptococci: molecular switches for survival and virulence.

    PubMed

    Nguyen, Scott V; McShan, William M

    2014-01-01

    Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5' end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges. PMID:25161960

  11. Pre-trial inter-laboratory analytical validation of the FOCUS4 personalised therapy trial

    PubMed Central

    Richman, Susan D; Adams, Richard; Quirke, Phil; Butler, Rachel; Hemmings, Gemma; Chambers, Phil; Roberts, Helen; James, Michelle D; Wozniak, Sue; Bathia, Riya; Pugh, Cheryl; Maughan, Timothy; Jasani, Bharat

    2016-01-01

    Introduction Molecular characterisation of tumours is increasing personalisation of cancer therapy, tailored to an individual and their cancer. FOCUS4 is a molecularly stratified clinical trial for patients with advanced colorectal cancer. During an initial 16-week period of standard first-line chemotherapy, tumour tissue will undergo several molecular assays, with the results used for cohort allocation, then randomisation. Laboratories in Leeds and Cardiff will perform the molecular testing. The results of a rigorous pre-trial inter-laboratory analytical validation are presented and discussed. Methods Wales Cancer Bank supplied FFPE tumour blocks from 97 mCRC patients with consent for use in further research. Both laboratories processed each sample according to an agreed definitive FOCUS4 laboratory protocol, reporting results directly to the MRC Trial Management Group for independent cross-referencing. Results Pyrosequencing analysis of mutation status at KRAS codons12/13/61/146, NRAS codons12/13/61, BRAF codon600 and PIK3CA codons542/545/546/1047, generated highly concordant results. Two samples gave discrepant results; in one a PIK3CA mutation was detected only in Leeds, and in the other, a PIK3CA mutation was only detected in Cardiff. pTEN and mismatch repair (MMR) protein expression was assessed by immunohistochemistry (IHC) resulting in 6/97 discordant results for pTEN and 5/388 for MMR, resolved upon joint review. Tumour heterogeneity was likely responsible for pyrosequencing discrepancies. The presence of signet-ring cells, necrosis, mucin, edge-effects and over-counterstaining influenced IHC discrepancies. Conclusions Pre-trial assay analytical validation is essential to ensure appropriate selection of patients for targeted therapies. This is feasible for both mutation testing and immunohistochemical assays and must be built into the workup of such trials. Trial registration number ISRCTN90061564. PMID:26350752

  12. Increased HIF1 alpha in SDH and FH deficient tumors does not cause microsatellite instability.

    PubMed

    Lehtonen, Heli J; Mäkinen, Markus J; Kiuru, Maija; Laiho, Päivi; Herva, Riitta; van Minderhout, Ivonne; Hogendoorn, Pancras C W; Cornelisse, Cees; Devilee, Peter; Launonen, Virpi; Aaltonen, Lauri A

    2007-09-15

    Germline mutations in nuclear genes encoding mitochondrial enzymes fumarate hydratase (FH) and succinate dehydrogenase (subunits SDHB/C/D) have been implicated in the development of tumor syndromes referred to as hereditary leiomyomatosis and renal cell cancer (HLRCC) and hereditary paragangliomatosis (HPGL), respectively. FH and SDH are operating in the tricarboxylic acid cycle (the TCA cycle, the Krebs cycle). In the FH and SDH deficient tumors, accumulation of the substrates, fumarate and succinate, has been shown to cause stabilization of hypoxia inducible factor 1 alpha (HIF1 alpha). According to recent studies, HIF1 alpha could contribute to the hypoxia induced genomic instability seen in many cancers, through repression of mismatch repair (MMR) protein MSH2. In this study, in agreement with previous works, we found HIF1 alpha to be moderately or highly stabilized in 67% (16/24) and 77% (48/62) of HLRCC tumors and SDHB/C/D paragangliomas (PGL) and pheochromocytomas (PHEO), respectively. In addition, a set of 54 other familial and nonfamilial PGLs/PHEOs were studied. Moderately or highly stabilized HIF1 alpha was present in 68% (26/38) of the PGLs but in PHEOs (n = 16) no such pattern was observed. We then analyzed the suggested link between HIF1 alpha stabilization and MSH2 repression, in HLRCC and HPGL tumor material. No microsatellite instability (MSI) or lack of MSH2 expression was, however, observed. Thus we failed to provide in vivo evidence for the proposed link between HIF1 alpha stabilization and functional MMR deficiency, in TCAC deficient tumors. PMID:17520677

  13. UvrD limits the number and intensities of RecA-green fluorescent protein structures in Escherichia coli K-12.

    PubMed

    Centore, Richard C; Sandler, Steven J

    2007-04-01

    RecA is important for recombination, DNA repair, and SOS induction. In Escherichia coli, RecBCD, RecFOR, and RecJQ prepare DNA substrates onto which RecA binds. UvrD is a 3'-to-5' helicase that participates in methyl-directed mismatch repair and nucleotide excision repair. uvrD deletion mutants are sensitive to UV irradiation, hypermutable, and hyper-rec. In vitro, UvrD can dissociate RecA from single-stranded DNA. Other experiments suggest that UvrD removes RecA from DNA where it promotes unproductive reactions. To test if UvrD limits the number and/or the size of RecA-DNA structures in vivo, an uvrD mutation was combined with recA-gfp. This recA allele allows the number of RecA structures and the amount of RecA at these structures to be assayed in living cells. uvrD mutants show a threefold increase in the number of RecA-GFP foci, and these foci are, on average, nearly twofold higher in relative intensity. The increased number of RecA-green fluorescent protein foci in the uvrD mutant is dependent on recF, recO, recR, recJ, and recQ. The increase in average relative intensity is dependent on recO and recQ. These data support an in vivo role for UvrD in removing RecA from the DNA. PMID:17259317

  14. MSH6- or PMS2-deficiency causes re-replication in DT40 B cells, but it has little effect on immunoglobulin gene conversion or on repair of AID-generated uracils

    PubMed Central

    Campo, Vanina A.; Patenaude, Anne-Marie; Kaden, Svenja; Horb, Lori; Firka, Daniel; Jiricny, Josef; Di Noia, Javier M.

    2013-01-01

    The mammalian antibody repertoire is shaped by somatic hypermutation (SHM) and class switch recombination (CSR) of the immunoglobulin (Ig) loci of B lymphocytes. SHM and CSR are triggered by non-canonical, error-prone processing of G/U mismatches generated by activation-induced deaminase (AID). In birds, AID does not trigger SHM, but it triggers Ig gene conversion (GC), a ‘homeologous’ recombination process involving the Ig variable region and proximal pseudogenes. Because recombination fidelity is controlled by the mismatch repair (MMR) system, we investigated whether MMR affects GC in the chicken B cell line DT40. We show here that Msh6−/− and Pms2−/− DT40 cells display cell cycle defects, including genomic re-replication. However, although IgVλ GC tracts in MMR-deficient cells were slightly longer than in normal cells, Ig GC frequency, donor choice or the number of mutations per sequence remained unaltered. The finding that the avian MMR system, unlike that of mammals, does not seem to contribute towards the processing of G/U mismatches in vitro could explain why MMR is unable to initiate Ig GC in this species, despite initiating SHM and CSR in mammalian cells. Moreover, as MMR does not counteract or govern Ig GC, we report a rare example of ‘homeologous’ recombination insensitive to MMR. PMID:23314153

  15. Msh2 deficiency leads to chromosomal abnormalities, centrosome amplification, and telomere capping defect

    SciTech Connect

    Wang, Yisong; Liu, Yie

    2006-01-01

    Msh2 is a key mammalian DNA mismatch repair (MMR) gene and mutations or deficiencies in mammalian Msh2 gene result in microsatellite instability (MSI+) and the development of cancer. Here, we report that primary mouse embryonic fibroblasts (MEFs) deficient in the murine MMR gene Msh2 (Msh2-/-) showed a significant increase in chromosome aneuploidy, centrosome amplification, and defective mitotic spindle organization and unequal chromosome segregation. Although Msh2-/- mouse tissues or primary MEFs had no apparent change in telomerase activity, telomere length, or recombination at telomeres, Msh2-/- MEFs showed an increase in chromosome end-to-end fusions or chromosome ends without detectable telomeric DNA. These data suggest that MSH2 helps to maintain genomic stability through the regulation of the centrosome and normal telomere capping in vivo and that defects in MMR can contribute to oncogenesis through multiple pathways.

  16. Association of a let-7 miRNA binding region of TGFBR1 with hereditary mismatch repair proficient colorectal cancer (MSS HNPCC).

    PubMed

    Xicola, Rosa M; Bontu, Sneha; Doyle, Brian J; Rawson, Jamie; Garre, Pilar; Lee, Esther; de la Hoya, Miguel; Bessa, Xavier; Clofent, Joan; Bujanda, Luis; Balaguer, Francesc; Castellví-Bel, Sergi; Alenda, Cristina; Jover, Rodrigo; Ruiz-Ponte, Clara; Syngal, Sapna; Andreu, Montserrat; Carracedo, Angel; Castells, Antoni; Newcomb, Polly A; Lindor, Noralane; Potter, John D; Baron, John A; Ellis, Nathan A; Caldes, Trinidad; LLor, Xavier

    2016-08-01

    The purpose of this study was to identify novel colorectal cancer (CRC)-causing alleles in unexplained familial CRC cases. In order to do so, coding regions in five candidate genes (MGMT, AXIN2, CTNNB1, TGFBR1 and TGFBR2) were sequenced in 11 unrelated microsatellite-stable hereditary non-polyposis CRC (MSS HNPCC) cases. Selected genetic variants were genotyped in a discovery set of 27 MSS HNPCC cases and 85 controls. One genetic variant, rs67687202, in TGFBR1 emerged as significant (P = 0.002), and it was genotyped in a replication set of 87 additional MSS HNPCC-like cases and 338 controls where it was also significantly associated with MSS HNPCC cases (P = 0.041). In the combined genotype data, rs67687202 was associated with a moderate increase in CRC risk (OR = 1.68; 95% CI = 1.13-2.50; P = 0.010). We tested a highly correlated SNP rs868 in 723 non-familial CRC cases compared with 629 controls, and it was not significantly associated with CRC risk (P = 0.370). rs868 is contained in a let-7 miRNA binding site in the 3'UTR of TGFBR1, which might provide a functional basis for the association in MSS HNPCC. In luciferase assays, the risk-associated allele for rs868 was associated with half the luciferase expression in the presence of miRNA let-7b-5p compared with protective allele, suggesting more binding of let-7b-5p and less TGFBR1 expression. Thus, rs868 potentially is a CRC risk-causing allele. Our results support the concept that rs868 is associated with lower TGFBR1 expression thereby increasing CRC risk. PMID:27234654

  17. Reduced migration of MLH1 deficient colon cancer cells depends on SPTAN1

    PubMed Central

    2014-01-01

    Introduction Defects in the DNA mismatch repair (MMR) protein MLH1 are frequently observed in sporadic and hereditary colorectal cancers (CRC). Affected tumors generate much less metastatic potential than the MLH1 proficient forms. Although MLH1 has been shown to be not only involved in postreplicative MMR but also in several MMR independent processes like cytoskeletal organization, the connection between MLH1 and metastasis remains unclear. We recently identified non-erythroid spectrin αII (SPTAN1), a scaffolding protein involved in cell adhesion and motility, to interact with MLH1. In the current study, the interaction of MLH1 and SPTAN1 and its potential consequences for CRC metastasis was evaluated. Methods Nine cancer cell lines as well as fresh and paraffin embedded colon cancer tissue from 12 patients were used in gene expression studies of SPTAN1 and MLH1. Co-expression of SPTAN1 and MLH1 was analyzed by siRNA knock down of MLH1 in HeLa, HEK293, MLH1 positive HCT116, SW480 and LoVo cells. Effects on cellular motility were determined in MLH1 deficient HCT116 and MLH1 deficient HEK293T compared to their MLH1 proficient sister cells, respectively. Results MLH1 deficiency is clearly associated with SPTAN1 reduction. Moreover, siRNA knock down of MLH1 decreased the mRNA level of SPTAN1 in HeLa, HEK293 as well as in MLH1 positive HCT116 cells, which indicates a co-expression of SPTAN1 by MLH1. In addition, cellular motility of MLH1 deficient HCT116 and MLH1 deficient HEK293T cells was impaired compared to the MLH1 proficient sister clones. Consequently, overexpression of SPTAN1 increased migration of MLH1 deficient cells while knock down of SPTAN1 decreased cellular mobility of MLH1 proficient cells, indicating SPTAN1-dependent migration ability. Conclusions These data suggest that SPTAN1 levels decreased in concordance with MLH1 reduction and impaired cellular mobility in MLH1 deficient colon cancer cells. Therefore, aggressiveness of MLH1-positive CRC might be

  18. Communication of Genetic Test Results to Family and Health Care Providers Following Disclosure of Research Results

    PubMed Central

    Graves, Kristi D.; Sinicrope, Pamela S.; Esplen, Mary Jane; Peterson, Susan K.; Patten, Christi A.; Lowery, Jan; Sinicrope, Frank A.; Nigon, Sandra K.; Borgen, Joyce; Gorin, Sherri Sheinfeld; Keogh, Louise A.; Lindor, Noralane M.

    2014-01-01

    Purpose Few studies have examined methods to promote communication following the return of DNA mismatch repair (MMR) genetic test results obtained during research. The purpose of the present study was to evaluate a telephone protocol for returning research results of MMR gene testing to identify Lynch Syndrome. Methods We invited individuals with known MMR mutations in their family who were enrolled in the Colon Cancer Family Registry at the Mayo Clinic to participate. Participants completed surveys before and 6-months after MMR test result disclosure. Results Among 107 participants, 79% opted to learn their MMR test results; of these, 44 (41%) carried MMR mutations. Post-disclosure, 54% reported screening for any type of cancer. Among carriers, >74% reported communicating results to family; communication was predicted by baseline confidence in coping with the genetic test result (Z=1.97, P=.04). Result disclosure to a physician was predicted by greater perceived cancer risk (Z=2.08, P=.03) and greater intention to share results with family (Z=3.07, P=.002). Conclusions Research vs. clinically-based gene disclosure presents challenges. A telephone disclosure process for the return of research-based results among Lynch syndrome families led to high rates of result uptake and participant communication of results to providers and family members. PMID:24091800

  19. Role of AtMSH7 in UV-B-induced DNA damage recognition and recombination.

    PubMed

    Lario, Luciana Daniela; Botta, Pablo; Casati, Paula; Spampinato, Claudia Patricia

    2015-06-01

    The mismatch repair (MMR) system maintains genome integrity by correcting replication-associated errors and inhibiting recombination between divergent DNA sequences. The basic features of the pathway have been highly conserved throughout evolution, although the nature and number of the proteins involved in this DNA repair system vary among organisms. Plants have an extra mismatch recognition protein, MutSγ, which is a heterodimer: MSH2-MSH7. To further understand the role of MSH7 in vivo, we present data from this protein in Arabidopsis thaliana. First, we generated transgenic plants that express β-glucuronidase (GUS) under the control of the MSH7 promoter. Histochemical staining of the transgenic plants indicated that MSH7 is preferentially expressed in proliferating tissues. Then, we identified msh7 T-DNA insertion mutants. Plants deficient in MSH7 show increased levels of UV-B-induced cyclobutane pyrimidine dimers relative to wild-type (WT) plants. Consistent with the patterns of MSH7 expression, we next analysed the role of the protein during somatic and meiotic recombination. The frequency of somatic recombination between homologous or homeologous repeats (divergence level of 1.6%) was monitored using a previously described GUS recombination reporter assay. Disruption of MSH7 has no effect on the rates of somatic homologous or homeologous recombination under control conditions or after UV-B exposure. However, the rate of meiotic recombination between two genetically linked seed-specific fluorescent markers was 97% higher in msh7 than in WT plants. Taken together, these results suggest that MSH7 is involved in UV-B-induced DNA damage recognition and in controlling meiotic recombination. PMID:25465032

  20. Reconstitution of TGFBR2 in HCT116 colorectal cancer cells causes increased LFNG expression and enhanced N-acetyl-d-glucosamine incorporation into Notch1.

    PubMed

    Lee, Jennifer; Katzenmaier, Eva-Maria; Kopitz, Jürgen; Gebert, Johannes

    2016-08-01

    Transforming growth factor-β (TGF-β) signaling plays a key role in regulating normal cell growth and differentiation, and mutations affecting members of this pathway contribute to cancer development and metastasis. In DNA mismatch repair (MMR)-deficient colorectal cancers that exhibit the microsatellite instability (MSI) phenotype, biallelic frameshift mutations in the transforming growth factor β receptor type 2 (TGFBR2) gene occur at high frequency that lead to altered signal transduction and downstream target gene expression. Although recent evidence suggests that altered TGF-β signaling can modulate protein glycosylation patterns in MSI-high colorectal tumor cells, affected genes have not been identified. Here, we investigated in a more systematic approach, expression changes of TGFBR2-regulated genes, involved in glycosylation using a TGFBR2-reconstituted colorectal cancer cell line (HCT116-TGFBR2) and Glyco-Gene Chip analysis. Based on this oligonucleotide array of about 1000 human glycosylation-related genes, several candidates including HES1, PDGFB, JUNB and LFNG were found to be upregulated in a TGFBR2-dependent manner and subsequently validated by real-time RT-PCR analyses. Focusing on the glycosyltransferase LFNG and its target signaling protein Notch1, dual labeling with [3H]-N-acetyl-d-glucosamine ([3H]-GlcNAc) and [35S]-l-methionine revealed a significant increase in N-acetyl-d-glucosamine incorporation into immunoprecipitated Notch1 receptor upon TGFBR2 expression whereas the protein level remained unaffected. These data suggest that TGFBR2 signaling can affect Notch1 glycosylation via regulation of glycosyltransferase LFNG expression and provide a first mechanistic example for altered glycosylation in MSI colorectal tumor cells. PMID:27156840

  1. Participation of DNA repair in the response to 5-fluorouracil

    PubMed Central

    Wyatt, Michael D.; Wilson, David M.

    2008-01-01

    The anti-metabolite 5-fluorouracil (5-FU) is employed clinically to manage solid tumors including colorectal and breast cancer. Intracellular metabolites of 5-FU can exert cytotoxic effects via inhibition of thymidylate synthetase, or through incorporation into RNA and DNA, events that ultimately activate apoptosis. In this review, we cover the current data implicating DNA repair processes in cellular responsiveness to 5-FU treatment. Evidence points to roles for base excision repair (BER) and mismatch repair (MMR). However, mechanistic details remain unexplained, and other pathways have not been exhaustively interrogated. Homologous recombination is of particular interest, because it resolves unrepaired DNA intermediates not properly dealt with by BER or MMR. Furthermore, crosstalk among DNA repair pathways and S-phase checkpoint signaling has not been examined. Ongoing efforts aim to design approaches and reagents that (i) approximate repair capacity and (ii) mediate strategic regulation of DNA repair in order to improve the efficacy of current anti-cancer treatments. PMID:18979208

  2. Hereditary Colon Cancer: Lynch Syndrome

    PubMed Central

    Jang, Eunjeong

    2010-01-01

    Lynch syndrome is the most common familial colorectal cancer syndrome. It is linked to germline mutations in one of four DNA mismatch repair (MMR) genes. A comprehensive family history is one important way to identify at-risk individuals. The elucidation of the molecular genetics of this syndrome has made it possible to screen for the disorder with molecular tests. Microsatellite instability and/or immunohistochemistry followed by germline testing for mutations in MMR genes is now a standard approach for clinically suspected cases. Correctly recognizing Lynch syndrome is essential for the application of appropriate screening and surveillance measures. Close surveillance and risk-reducing operations can decrease cancer-related mortality. In addition, counseling is an important component of the management of any family with Lynch syndrome. PMID:20559516

  3. Genetic reconstruction of individual colorectal tumor histories

    PubMed Central

    Tsao, Jen-Lan; Yatabe, Yasushi; Salovaara, Reijo; Järvinen, Heikki J.; Mecklin, Jukka-Pekka; Aaltonen, Lauri A.; Tavaré, Simon; Shibata, Darryl

    2000-01-01

    It is difficult to observe human tumor progression as precursor lesions are systematically removed. Alternatives to direct observations, commonly used to reveal the hidden past of species and populations, are sequence comparisons or molecular clocks. Noncoding microsatellite (MS) loci were employed as molecular tumor clocks in 13 human mutator phenotype (MSI+) colorectal tumors. Quantitative analysis revealed that specific patterns of somatic MS mutations accumulate with division after loss of mismatch repair (MMR). Tumors had unique patterns of MS mutation, and, therefore, based on this model, each tumor had its own unique history. Loss of MMR occurred very early relative to terminal clonal expansion, with an estimated average of 2,300 divisions since loss of MMR and 280 divisions since expansion. Contrary to the classical adenoma-cancer sequence, MSI+ adenomas were nearly as old as cancers (2,000 versus 2,400 divisions since loss of MMR). Negative clinical examinations preceded six tumors, independently documenting an absence of visible precursors during early MSI+ adenoma or cancer progression. These findings further extend a window beyond visible progression since loss of MMR appears to start a genetic phase involving clone sizes or phenotypes below a threshold of clinical detection. This previously occult prologue before visible neoplasia is longer and therefore likely more important than generally appreciated. PMID:10655514

  4. High incidence of microsatellite instability and loss of heterozygosity in three loci in breast cancer patients receiving chemotherapy: a prospective study

    PubMed Central

    2012-01-01

    Background The aim of the study was to evaluate potential chemotherapy-induced microsatellite instability, loss of heterozygosity, loss of expression in mismatch repair proteins and associations with clinical findings in breast cancer patients, especially resistance to chemotherapy and/or development of other tumors in the four years following chemotherapy treatment. Methods A comprehensive study of chemotherapy-related effects with a follow-up period of 48 months post treatment was conducted. A total of 369 peripheral blood samples were collected from 123 de novo breast cancer patients. Microsatellite instability and loss of heterozygosity in five commonly used marker loci (including Tp53-Alu of the tumor suppressor gene TP53) were analyzed in blood samples. Sampling was conducted on three occasions; 4–5 weeks prior to the first chemotherapy session (pre-treatment), to serve as a baseline, followed by two consecutive draws at 12 weeks intervals from the first collection. Mismatch repair protein expression was evaluated in cancer tissues using immunohistochemistry for three mismatch-repair related proteins. Results A total of 70.7% of the patients showed microsatellite instability for at least one locus, including 18.6% marked as high-positive and 52.1% as low-positive; 35.8% showed loss of heterozygosity in addition to microsatellite instability, while 29.3% exhibited microsatellite stability. The following incidence rates for microsatellite instability and loss of heterozygosity were detected: 39.1% positive for Tp53-Alu, 31.1% for locus Mfd41, and 25.3% for locus Mfd28. A higher occurrence of loss of heterozygosity was noted with alleles 399 and 404 of Tp53-Alu. The mismatch repair protein expression analysis showed that the chemotherapy caused a loss of 29.3% in hMLH1 expression, and 18.7% and 25.2% loss in hMSH2 and P53 expression, respectively. A strong correlation between low or deficient hMSH2 protein expression and occurrence of mismatch repair

  5. Immunohistochemical staining for p16 and BRAFV600E is useful to distinguish between sporadic and hereditary (Lynch syndrome-related) microsatellite instable colorectal carcinomas.

    PubMed

    Boissière-Michot, Florence; Frugier, Hélène; Ho-Pun-Cheung, Alexandre; Lopez-Crapez, Evelyne; Duffour, Jacqueline; Bibeau, Frédéric

    2016-08-01

    DNA mismatch repair (MMR) protein analysis by immunohistochemistry (IHC) can identify colorectal cancer (CRC) with microsatellite instability (MSI). As MLH1-deficient CRC can be hereditary or sporadic, markers to distinguish between them are needed. MLH1 promoter methylation assay is the reference method; however, sometimes, it is challenging on formalin-fixed paraffin-embedded tissue samples. We assessed by IHC the expression of BRAFV600E, p16, MGMT, and CDX2 in 55 MLH1-deficient MSI CRC samples (of which 8 had a germline MLH1 mutation) to determine whether this panel differentiates between sporadic and hereditary CRCs. We also analyzed MLH1 promoter methylation by methylation-specific PCR and pyrosequencing and BRAF status by genotyping. None of the hereditary CRCs showed MLH1 methylation, BRAF mutation, BRAFV600E-positive immunostaining, or loss of p16 expression. We detected MLH1 promoter methylation in 67 % and a BRAF mutation in 42 % of CRC, all showing MLH1 promoter methylation. BRAFV600E IHC and BRAF genotyping gave concordant results in all but two samples. Loss of expression of p16 was found in 30 % of CRC with methylation of the MLH1 promoter, but its expression was retained in all non-methylated and part of MLH1-methylated tumors (100 % specificity, 30 % sensitivity). CDX2 and MGMT expression was not associated with MLH1 status. Thus, BRAFV600E and p16 IHC may help in differentiating sporadic from hereditary MLH1-deficient CRC with MSI. Specifically, p16 IHC might be used as a surrogate marker for MLH1 promoter methylation, because all p16-negative CRCs displayed MLH1 methylation, whereas hereditary CRCs were all p16-positive. PMID:27220764

  6. Nimotuzumab enhances temozolomide-induced growth suppression of glioma cells expressing mutant EGFR in vivo.

    PubMed

    Nitta, Yusuke; Shimizu, Saki; Shishido-Hara, Yukiko; Suzuki, Kaori; Shiokawa, Yoshiaki; Nagane, Motoo

    2016-03-01

    A mutant form of epidermal growth factor receptor (EGFR), EGFRvIII, is common in glioblastoma (GBM) and confers enhanced tumorigenic activity and drug resistance. Nimotuzumab, an anti-EGFR antibody, has shown preclinical and clinical activity to GBM, but its specific activity against EGFRvIII has not been fully investigated. Human glioma U87MG or LNZ308 cells overexpressing either wild-type (wt) EGFR or EGFRvIII were treated with nimotuzumab, temozolomide, or both. Expression and phosphorylation status of molecules were determined by Western blot analysis. Methylation status of promoter region of O(6) -methylguanine-DNA methyltransferase (MGMT) was detected by methylation-specific PCR. Antitumor activity was tested using nude mice bearing either subcutaneous or intracerebral xenografts along with analyses of EGFR phosphorylation status, proliferation, apoptosis, and vessel density. Nimotuzumab treatment resulted in reduction of EGFRvIII tyrosine phosphorylation with a decrease in Akt phosphorylation that was greater than that of wtEGFR. Correspondingly, antitumor effects, growth suppression and survival elongation, were more significant in mice bearing either subcutaneous or intracerebral tumor expressing EGFRvIII than in those expressing wtEGFR. These effects were markedly increased when temozolomide was combined with nimotuzumab. The post-treatment recurrent brain tumors exhibited a decrease in expression of the mismatch repair (MMR) proteins, MSH6 and MLH1, but their methylated MGMT status did not changed. Nimotuzumab has in vivo antitumor activity against GBM, especially those expressing EGFRvIII, when combined with temozolomide. This could provide a basis for preselection of patients with GBM by EGFR status who might benefit from the nimotuzumab and temozolomide combination therapy. PMID:26778701

  7. Requirement of p53 targets in chemosensitization of colonic carcinoma to death ligand therapy.

    PubMed

    Wang, Shulin; El-Deiry, Wafik S

    2003-12-01

    Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) exhibits specific tumoricidal activity and is under development for cancer therapy. Mismatch-repair-deficient colonic tumors evade TRAIL-induced apoptosis through mutational inactivation of Bax, but chemotherapeutics including Camptosar (CPT-11) restore TRAIL sensitivity. However, the signaling pathways in restoring TRAIL sensitivity remain to be elucidated. Here, we imaged p53 transcriptional activity in Bax-/- carcinomas by using bioluminescence, in vivo, and find that p53 is required for sensitization to TRAIL by CPT-11. Small interfering RNAs directed at proapoptotic p53 targets reveal TRAIL receptor KILLER/DR5 contributes significantly to TRAIL sensitization, whereas Bak plays a minor role. Caspase 8 inhibition protects both CPT-11 pretreated wild-type and Bax-/- HCT116 cells from TRAIL-induced apoptosis, whereas caspase 9 inhibition only rescued the wild-type HCT116 cells from death induced by TRAIL. The results suggest a conversion in the apoptotic mechanism in HCT116 colon carcinoma from a type II pathway involving Bax and the mitochondria to a type I pathway involving efficient extrinsic pathway caspase activation. In contrast to Bax-/- cells, Bak-deficient human cancers undergo apoptosis in response to TRAIL or CPT-11, implying that these proteins have nonoverlapping functions. Our studies elucidate a mechanism for restoration of TRAIL sensitivity in MMR-deficient Bax-/- human cancers through p53-dependent activation of KILLER/DR5 and reconstitution of a type I death pathway. Efforts to identify agents that up-regulate DR5 may be useful in cancer therapies restoring TRAIL sensitivity. PMID:14645705

  8. Self-assembly of E. coli MutL and its complexes with DNA

    PubMed Central

    Niedziela-Majka, Anita; Maluf, Nasib K.; Antony, Edwin; Lohman, Timothy M.

    2011-01-01

    The E. coli MutL protein regulates the activity of several enzymes, including MutS, MutH and UvrD, during methyl-directed mismatch repair (MMR) of DNA. We have investigated the self association properties of MutL and its binding to DNA using analytical sedimentation velocity and equilibrium. Self association of MutL is quite sensitive to solution conditions. At 25°C in Tris at pH 8.3 MutL assembles into a heterogeneous mixture of large multimers. In the presence of potassium phosphate at pH 7.4, MutL forms primarily stable dimers, with the higher order assembly states suppressed. The weight averaged sedimentation coefficient of MutL dimer in this buffer is equal to s̅20,w = 5.20 ± 0.08, suggesting a highly asymmetric dimer (f/fo = 1.58 ± 0.02). Upon binding the non-hydrolyzable ATP analogue, AMPPNP/Mg2+, the MutL dimer becomes more compact (s̅20,w = 5.71 ± 0.08 S, f/fo = 1.45 ± 0.02), probably reflecting reorganization of the N-terminal ATPase domains. A MutL dimer binds to an 18 bp duplex with a 3’-(dT20) single stranded flanking region, with apparent affinity in the micromolar range. AMPPNP binding to MutL increases its affinity for DNA by a factor of ~10. These results indicate that the presence of phosphate minimizes further MutL oligomerization beyond a dimer and that differences in solution conditions likely explain apparent discrepancies in previous studies of MutL assembly. PMID:21793594

  9. Medullary carcinoma in the colorectum: a systematic review and meta-analysis.

    PubMed

    Pyo, Jung-Soo; Sohn, Jin Hee; Kang, Guhyun

    2016-07-01

    Medullary carcinoma (MC) is a very rare variant of colorectal carcinoma (CRC). Its clinicopathologic findings are not fully elucidated. The aim of this study was to investigate the clinicopathological characteristics of MC in the colorectum through a systematic review and meta-analysis. The meta-analysis examined the incidence, age, sex, site, mismatch repair deficiency (MMRd), MMR protein expression, ARID1A expression, BRAF(V600E) mutation, KRAS mutation, and survival rate of MC. The 21469 CRCs included 462 MCs in 16 eligible studies, representing an estimated incidence of MC of 0.027 (95% confidence interval [CI] 26 0.016-0.045). MC frequently occurred in female patients and in the right colon. Lymph node metastasis of MC was significantly lower than that of poorly differentiated adenocarcinoma/undifferentiated adenocarcinoma (PDA/UDA). In addition, MC had a higher MMRd rate (0.892, 95% CI 0.758-0.956), higher BRAF(V600E) mutation rate (0.652, 95% CI 0.143-0.954) and lower KRAS mutation rate (0.171, 95% CI 0.065-0.378) than PDA/UDA and conventional adenocarcinoma. Patients with MC had significantly better overall survival rate compared to patients with PDA/UDA (hazard ratio 0.441, 95% CI 0.262-0.742). However, there was no significant difference of overall survival rate between MC and conventional adenocarcinoma patients. MC predominantly occurred in females and in the right colon, and had different molecular characteristics and behaviors compared to PDA/UDA and conventional adenocarcinoma. PMID:27001432

  10. Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy

    MedlinePlus

    ... vaccination programs have greatly decreased their incidence. These viruses are still common in some parts of the ... rare to get it again. Because these are viruses, there is no cure, but you can treat ...

  11. MMR vaccine and autism: an update of the scientific evidence.

    PubMed

    DeStefano, Frank; Thompson, William W

    2004-02-01

    An hypothesis published in 1998 suggested that measles-mumps-rubella vaccine may cause autism as a result of persistent measles virus infection of the gastrointestinal tract. Results of early studies were not supportive and in 2001 a review by the Institute of Medicine concluded that the evidence favors the rejection of a causal relationship at the population level between measles-mumps-rubella vaccine and autistic spectrum disorder. Studies published since the Institute of Medicine report have continued not to find an increased risk of autistic spectrum disorder associated with measles-mumps-rubella. The vaccine also has not been found to be associated with a unique syndrome of developmental regression and gastrointestinal disorders. The evidence now is convincing that the measles-mumps-rubella vaccine does not cause autism or any particular subtypes of autistic spectrum disorder. PMID:14761240

  12. Association of Family History with Cancer Recurrence and Survival Among Patients with Stage III Colon Cancer

    PubMed Central

    Chan, Jennifer A.; Meyerhardt, Jeffrey A.; Niedzwiecki, Donna; Hollis, Donna; Saltz, Leonard B.; Mayer, Robert J.; Thomas, James; Schaefer, Paul; Whittom, Renaud; Hantel, Alexander; Goldberg, Richard M.; Warren, Robert S.; Bertagnolli, Monica; Fuchs, Charles S.

    2011-01-01

    Context A family history of colorectal cancer in a first-degree relative increases the risk of developing colorectal cancer. However, the influence of family history on cancer recurrence and survival among patients with established disease remains uncertain. Objective To examine the association of family history of colorectal cancer with cancer recurrence and survival of patients with colon cancer. Design, Setting, and Participants Prospective observational study of 1,087 patients with stage III colon cancer enrolled in a randomized adjuvant chemotherapy trial (CALGB 89803) between April 1999 and May 2001. Patients provided data on family history at baseline and were followed up until March 2007 for disease recurrence and death (median follow-up 5.6 years). In a subset of patients, we assessed microsatellite instability (MSI) and expression of the mismatch repair (MMR) proteins, MLH1 and MSH2, in tumor specimens. Main Outcome Measure Disease-free survival, recurrence-free survival, and overall survival according to the presence or absence of a family history of colorectal cancer. Results Among 1,087 eligible patients, 195 (17.9%) reported a family history of colorectal cancer in a first-degree relative. Cancer recurrence or death occurred in 57/195 patients (29%; 95% confidence interval [CI], 23%-36%) with a family history of colorectal cancer and 343/892 patients (38%; 95% CI, 35%-42%) without a family history. Compared to patients without a family history, the adjusted hazard ratios (HR) among those with ≥1 affected first-degree relatives were 0.72 (95% CI, 0.54-0.96) for disease-free survival (DFS), 0.74 (95% CI, 0.55-0.99) for recurrence-free survival (RFS), and 0.75 (95% CI, 0.54-1.05) for overall survival (OS). This reduction in risk of cancer recurrence or death associated with a family history became stronger with an increasing number of affected first-degree relatives. Compared to participants without a family history of colorectal cancer, those with 1

  13. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2007-09-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  14. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2014-07-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  15. Evolution in fast forward: a potential role for mutators in accelerating Staphylococcus aureus pathoadaptation.

    PubMed

    Canfield, Gregory S; Schwingel, Johanna M; Foley, Matthew H; Vore, Kelly L; Boonanantanasarn, Kanitsak; Gill, Ann L; Sutton, Mark D; Gill, Steven R

    2013-02-01

    Pathogen evolution and subsequent phenotypic heterogeneity during chronic infection are proposed to enhance Staphylococcus aureus survival during human infection. We tested this theory by genetically and phenotypically characterizing strains with mutations constructed in the mismatch repair (MMR) and oxidized guanine (GO) system, termed mutators, which exhibit increased spontaneous-mutation frequencies. Analysis of these mutators revealed not only strain-dependent increases in the spontaneous-mutation frequency but also shifts in mutational type and hot spots consistent with loss of GO or MMR functions. Although the GO and MMR systems are relied upon in some bacterial species to prevent reactive oxygen species-induced DNA damage, no deficit in hydrogen peroxide sensitivity was found when either of these DNA repair pathways was lost in S. aureus. To gain insight into the contribution of increased mutation supply to S. aureus pathoadaptation, we measured the rate of α-hemolysin and staphyloxanthin inactivation during serial passage. Detection of increased rates of α-hemolysin and staphyloxanthin inactivation in GO and MMR mutants suggests that these strains are capable of modifying virulence phenotypes implicated in mediating infection. Accelerated derivation of altered virulence phenotypes, combined with the absence of increased ROS sensitivity, highlights the potential of mutators to drive pathoadaptation in the host and serve as catalysts for persistent infections. PMID:23204459

  16. Total protein

    MedlinePlus

    The total protein test measures the total amount of two classes of proteins found in the fluid portion of your ... nutritional problems, kidney disease or liver disease . If total protein is abnormal, you will need to have more ...

  17. Storage Proteins

    PubMed Central

    Fujiwara, Toru; Nambara, Eiji; Yamagishi, Kazutoshi; Goto, Derek B.; Naito, Satoshi

    2002-01-01

    Plants accumulate storage substances such as starch, lipids and proteins in certain phases of development. Storage proteins accumulate in both vegetative and reproductive tissues and serve as a reservoir to be used in later stages of plant development. The accumulation of storage protein is thus beneficial for the survival of plants. Storage proteins are also an important source of dietary plant proteins. Here, we summarize the genome organization and regulation of gene expression of storage protein genes in Arabidopsis. PMID:22303197

  18. Dietary Proteins

    MedlinePlus

    ... grains and beans. Proteins from meat and other animal products are complete proteins. This means they supply all of the amino acids the body can't make on its own. Most plant proteins are incomplete. You should eat different types of plant proteins every day to get ...

  19. Protein Analysis

    NASA Astrophysics Data System (ADS)

    Chang, Sam K. C.

    Proteins are an abundant component in all cells, and almost all except storage proteins are important for biological functions and cell structure. Food proteins are very complex. Many have been purified and characterized. Proteins vary in molecular mass, ranging from approximately 5000 to more than a million Daltons. They are composed of elements including hydrogen, carbon, nitrogen, oxygen, and sulfur. Twenty α-amino acids are the building blocks of proteins; the amino acid residues in a protein are linked by peptide bonds. Nitrogen is the most distinguishing element present in proteins. However, nitrogen content in various food proteins ranges from 13.4 to 19.1% (1) due to the variation in the specific amino acid composition of proteins. Generally, proteins rich in basic amino acids contain more nitrogen.

  20. Validation and extension of the PREMM1,2 model in a population-based cohort of colorectal cancer patients

    PubMed Central

    Balaguer, Francesc; Balmaña, Judith; Castellví-Bel, Sergi; Steyerberg, Ewout W.; Andreu, Montserrat; Llor, Xavier; Jover, Rodrigo; Syngal, Sapna; Castells, Antoni

    2008-01-01

    Summary Background and aims Early recognition of patients at risk for Lynch syndrome is critical but often difficult. Recently, a predictive algorithm -the PREMM1,2 model- has been developed to quantify the risk of carrying a germline mutation in the mismatch repair (MMR) genes, MLH1 and MSH2. However, its performance in an unselected, population-based colorectal cancer population as well as its performance in combination with tumor MMR testing are unknown. Methods We included all colorectal cancer cases from the EPICOLON study, a prospective, multicenter, population-based cohort (n=1,222). All patients underwent tumor microsatellite instability analysis and immunostaining for MLH1 and MSH2, and those with MMR deficiency (n=91) underwent tumor BRAF V600E mutation analysis and MLH1/MSH2 germline testing. Results The PREMM1,2 model with a ≥5% cut-off had a sensitivity, specificity and positive predictive value (PPV) of 100%, 68% and 2%, respectively. The use of a higher PREMM1,2 cut-off provided a higher specificity and PPV, at expense of a lower sensitivity. The combination of a ≥5% cut-off with tumor MMR testing maintained 100% sensitivity with an increased specificity (97%) and PPV (21%). The PPV of a PREMM1,2 score ≥20% alone (16%) approached the PPV obtained with PREMM1,2 score ≥5% combined with tumor MMR testing. In addition, a PREMM1,2 score of <5% was associated with a high likelihood of a BRAF V600E mutation. Conclusions The PREMM1,2 model is useful to identify MLH1/MSH2 mutation carriers among unselected colorectal cancer patients. Quantitative assessment of the genetic risk might be useful to decide on subsequent tumor MMR and germline testing. PMID:18061181

  1. Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients

    PubMed Central

    van Wezel, Tom; Jagmohan-Changur, Shantie C.; Ruano, Dina; van der Klift, Heleen M.; van den Akker, Brendy E. W. M.; Laros, Jeroen F. J.; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G. W.; Gómez-García, Encarna B.; Tops, Carli M. J.; Vasen, Hans F.; Devilee, Peter; Hes, Frederik J.; Morreau, Hans; Wijnen, Juul T.

    2016-01-01

    Background and Aims Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Methods Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Results Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). Conclusions This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes. PMID:27300758

  2. MutS and UvrD proteins stimulate exonuclease action: insights into exonuclease-mediated strand repair.

    PubMed

    Noothi, Sunil K; Minda, Renu; Rao, Basuthkar J

    2009-08-25

    MutS and UvrD proteins individually stimulate Escherichia coli exonuclease VII activity on blunt-ended short duplex DNA substrates. Stimulation by both proteins is ATP-dependent but not mismatch-specific and is not accompanied by apparent strand separation. Under similar conditions, MutS and UvrD proteins in fact confer resistance to exonuclease VII action on ssDNA targets, thereby implying that a novel state of a double-stranded DNA intermediate, which we term a "destabilized duplex", is involved in exonuclease-mediated strand degradation. We find that DNA strands in such a destabilized duplex can be displaced by the challenge of a molar excess of homologous single- and double-stranded DNA targets, in trans. Such an action of the UvrD protein is ATP-dependent. We discuss these results in relation to the (i) directional excision repair of E. coli MMR, (ii) downregulation of repeat deletions by exonucleases during replication slippage, and (iii) the fork reversal function of UvrD at stalled replication forks. PMID:19618961

  3. Total protein

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003483.htm Total protein To use the sharing features on this page, please enable JavaScript. The total protein test measures the total amount of two classes ...

  4. Whey Protein

    MedlinePlus

    ... shows that taking whey protein in combination with strength training increases lean body mass, strength, and muscle size. ... grams/kg of whey protein in combination with strength training for 6-10 weeks. For HIV/AIDS-related ...

  5. Protein Microarrays

    NASA Astrophysics Data System (ADS)

    Ricard-Blum, S.

    Proteins are key actors in the life of the cell, involved in many physiological and pathological processes. Since variations in the expression of messenger RNA are not systematically correlated with variations in the protein levels, the latter better reflect the way a cell functions. Protein microarrays thus supply complementary information to DNA chips. They are used in particular to analyse protein expression profiles, to detect proteins within complex biological media, and to study protein-protein interactions, which give information about the functions of those proteins [3-9]. They have the same advantages as DNA microarrays for high-throughput analysis, miniaturisation, and the possibility of automation. Section 18.1 gives a brief overview of proteins. Following this, Sect. 18.2 describes how protein microarrays can be made on flat supports, explaining how proteins can be produced and immobilised on a solid support, and discussing the different kinds of substrate and detection method. Section 18.3 discusses the particular format of protein microarrays in suspension. The diversity of protein microarrays and their applications are then reported in Sect. 18.4, with applications to therapeutics (protein-drug interactions) and diagnostics. The prospects for future developments of protein microarrays are then outlined in the conclusion. The bibliography provides an extensive list of reviews and detailed references for those readers who wish to go further in this area. Indeed, the aim of the present chapter is not to give an exhaustive or detailed analysis of the state of the art, but rather to provide the reader with the basic elements needed to understand how proteins are designed and used.

  6. Protein Structure

    ERIC Educational Resources Information Center

    Asmus, Elaine Garbarino

    2007-01-01

    Individual students model specific amino acids and then, through dehydration synthesis, a class of students models a protein. The students clearly learn amino acid structure, primary, secondary, tertiary, and quaternary structure in proteins and the nature of the bonds maintaining a protein's shape. This activity is fun, concrete, inexpensive and…

  7. Computational and synthetic studies towards improving rescinnamine as an inducer of MSH2-dependent apoptosis in cancer treatment

    PubMed Central

    AbdelHafez, ElShimaa M. N.; Diamanduros, Andrew; Negureanu, Lacramioara; Luy, Yan; Bean, J. Hayley; Zielke, Katherine; Crowe, Brittany; Vasilyeva, Aksana; Clodfelter, Jill E.; Aly, Omar M.; Abuo-Rahma, Gamal El-Din A. A.; Scarpinato, Karin D.; Salsbury, Freddie R.; King, S. Bruce

    2014-01-01

    We, and others, have previously shown that mismatch repair proteins, in addition to their repair function, contribute to cell death initiation. In response to some drugs, this cell death activity is independent of the repair function of the proteins. Rescinnamine, a derivative of the indole alkaloid reserpine, a drug used to treat hypertension several decades ago, was shown to target the cell death-initiating activity of mismatch repair proteins. When used in animals, the hypotensive action of this drug prevents applying appropriate concentrations for statistically significant tumor reduction. Using a combination of computational modeling, chemical synthesis and cell assays, we determine how rescinnamine can be structurally modified and what effect these modifications have on cell survival. These results inform further computational modeling to suggest new synthetic lead molecules to move toward further biological testing. PMID:25485184

  8. Association of MSH6 mutation with glioma susceptibility, drug resistance and progression

    PubMed Central

    Xie, Chaoran; Sheng, Hansong; Zhang, Nu; Li, Shiting; Wei, Xiangyu; Zheng, Xuesheng

    2016-01-01

    MutS homolog 6 (MSH6) is one of the mismatch repair proteins and is encoded by the MSH6 gene, which is located on chromosome 2 and is 23,806 bp in length, including 10 exons and 83 untranslated regions. The MSH6 protein consists of 1,358 amino acid residues and forms a heterodimer with another mismatch repair protein, MSH2. The MSH2-MSH6 heterodimeric complex is able to recognize base-base substitution and single-base insertion/deletion mismatches. Germline mutations of MSH6 lead to high susceptibility to glioma, as well as a number of benign or malignant tumors in other organs. However, somatic MSH6 mutations are not associated with susceptibility to glioma. Somatic MSH6 mutations usually follow temozolomide treatment and result in resistance to temozolomide. Subsequently, MSH6 mutations cause a hypermutation in the glioma cell genome, which may accelerate tumor progression. PMID:27446556

  9. Protein folds and protein folding

    PubMed Central

    Schaeffer, R. Dustin; Daggett, Valerie

    2011-01-01

    The classification of protein folds is necessarily based on the structural elements that distinguish domains. Classification of protein domains consists of two problems: the partition of structures into domains and the classification of domains into sets of similar structures (or folds). Although similar topologies may arise by convergent evolution, the similarity of their respective folding pathways is unknown. The discovery and the characterization of the majority of protein folds will be followed by a similar enumeration of available protein folding pathways. Consequently, understanding the intricacies of structural domains is necessary to understanding their collective folding pathways. We review the current state of the art in the field of protein domain classification and discuss methods for the systematic and comprehensive study of protein folding across protein fold space via atomistic molecular dynamics simulation. Finally, we discuss our large-scale Dynameomics project, which includes simulations of representatives of all autonomous protein folds. PMID:21051320

  10. Use of a small palindrome genetic marker to investigate mechanisms of double-strand-break repair in mammalian cells.

    PubMed Central

    Li, J; Baker, M D

    2000-01-01

    We examined mechanisms of mammalian homologous recombination using a gene targeting assay in which the vector-borne region of homology to the chromosome bore small palindrome insertions that frequently escape mismatch repair when encompassed within heteroduplex DNA (hDNA). Our assay permitted the product(s) of each independent recombination event to be recovered for molecular analysis. The results revealed the following: (i) vector-borne double-strand break (DSB) processing usually did not yield a large double-strand gap (DSG); (ii) in 43% of the recombinants, the results were consistent with crossover at or near the DSB; and (iii) in the remaining recombinants, hDNA was an intermediate. The sectored (mixed) genotypes observed in 38% of the recombinants provided direct evidence for involvement of hDNA, while indirect evidence was obtained from the patterns of mismatch repair (MMR). Individual hDNA tracts were either long or short and asymmetric or symmetric on the one side of the DSB examined. Clonal analysis of the sectored recombinants revealed how vector-borne and chromosomal markers were linked in each strand of individual hDNA intermediates. As expected, vector-borne and chromosomal markers usually resided on opposite strands. However, in one recombinant, they were linked on the same strand. The results are discussed with particular reference to the double-strand-break repair (DSBR) model of recombination. PMID:10757769

  11. UMD-MLH1/MSH2/MSH6 databases: description and analysis of genetic variations in French Lynch syndrome families

    PubMed Central

    Grandval, Philippe; Fabre, Aurélie J.; Gaildrat, Pascaline; Baert-Desurmont, Stéphanie; Buisine, Marie-Pierre; Ferrari, Anthony; Wang, Qing; Béroud, Christophe; Olschwang, Sylviane

    2013-01-01

    Lynch syndrome is an autosomal dominant disease caused by germ line heterozygous mutations mainly involving the MSH2, MLH1 and MSH6 genes that belong to the DNA MisMatch Repair (MMR) genes family. The French network counting the 16 licensed laboratories involved in Lynch syndrome genetic testing developed three locus-specific databases with the UMD® software (www.umd.be/MLH1/, www.umd.be/MSH2/ and www.umd.be/MSH6/) that presently contain a total of 7047 sequence variations including 707 distinct variations of a priori unknown functional significance (VUS) that were identified through complete mutation screening or targeted predictive testing. Mutation carriers are at high risk for developing early-onset colorectal and endometrial adenocarcinomas. Consensus clinical guidelines have been proposed, allowing the efficient detection of curable lesions. The major challenge of genetic testing is to reliably classify the genomic variations in those patients who seek genetic counseling. Combining the interactive tools of the software, the relevant published data and mainly original information produced by the French MisMatch Repair network, the UMD-MLH1/MSH2/MSH6 databases provide interpretation data for the 707 VUS that were classified according to the IARC 5-Class system. These public databases are regularly updated to improve the classification of all registered VUS, exploring their role in cancer pre-disposition based on structural and functional approaches. PMID:23729658

  12. A Detailed Immunohistochemical Analysis of a Large Series of Cervical and Vaginal Gastric-type Adenocarcinomas.

    PubMed

    Carleton, Claire; Hoang, Lien; Sah, Shatrughan; Kiyokawa, Takako; Karamurzin, Yevgeniy S; Talia, Karen L; Park, Kay J; McCluggage, W Glenn

    2016-05-01

    Adenocarcinomas exhibiting gastric differentiation represent a recently described and uncommon subtype of non-human papillomavirus (HPV)-related cervical adenocarcinoma. They comprise a spectrum from a well-differentiated variant (adenoma malignum/mucinous variant of minimal deviation adenocarcinoma) to a more poorly differentiated overtly malignant form, generally referred to as gastric-type adenocarcinoma. Rarely, such tumors have also been described as primary vaginal neoplasms. Gastric-type adenocarcinomas exhibit considerable morphologic overlap with adenocarcinomas originating outside the female genital tract, especially mucinous adenocarcinomas arising in the pancreas and biliary tract. Moreover, they often metastasize to unusual sites, such as the ovary and peritoneum/omentum, where they can be mistaken for metastatic adenocarcinomas from other, nongynecologic sites. There is little information regarding the immunophenotype of gastric-type adenocarcinomas, and knowledge of this is important to aid in the distinction from other adenocarcinomas. In this study, we undertook a detailed immunohistochemical analysis of a large series of cervical (n=45) and vaginal (n=2) gastric-type adenocarcinomas. Markers included were cytokeratin (CK)7, CK20, CDX2, carcinoembryonic antigen, CA125, CA19.9, p16, estrogen receptor, progesterone receptor, MUC6, PAX8, PAX2, p53, hepatocyte nuclear factor 1 beta, carbonic anhydrase IX, human epidermal receptor 2 (HER2), and mismatch repair (MMR) proteins. All markers were classified as negative, focal (<50% of tumor cells positive), or diffuse (≥50% tumor cells positive) except for p53 (classified as "wild-type" or "mutation-type"), HER2 (scored using the College of American Pathologists guidelines for gastric carcinomas), and MMR proteins (categorized as retained or lost). There was positive staining with CK7 (47/47-45 diffuse, 2 focal), MUC6 (17/21-6 diffuse, 11 focal), carcinoembryonic antigen (25/31-12 diffuse, 13 focal

  13. A proposal: Evolution of PCNA's role as a marker of newly replicated DNA

    PubMed Central

    Georgescu, Roxana; Langston, Lance; O'Donnell, Mike

    2015-01-01

    Processivity clamps that hold DNA polymerases to DNA for processivity were the first proteins known to encircle the DNA duplex. At the time, polymerase processivity was thought to be the only function of ring shaped processivity clamps. But studies from many laboratories have identified numerous proteins that bind and function with sliding clamps. Among these processes are mismatch repair and nucleosome assembly. Interestingly, there exist polymerases that are highly processive and do not require clamps. Hence, DNA polymerase processivity does not intrinsically require that sliding clamps evolved for this purpose. We propose that polymerases evolved to require clamps as a way of ensuring that clamps are deposited on newly replicated DNA. These clamps are then used on the newly replicated daughter strands, for processes important to genomic integrity, such as mismatch repair and the assembly of nucleosomes to maintain epigenetic states of replicating cells during development. PMID:25704660

  14. A proposal: Evolution of PCNA's role as a marker of newly replicated DNA.

    PubMed

    Georgescu, Roxana; Langston, Lance; O'Donnell, Mike

    2015-05-01

    Processivity clamps that hold DNA polymerases to DNA for processivity were the first proteins known to encircle the DNA duplex. At the time, polymerase processivity was thought to be the only function of ring shaped processivity clamps. But studies from many laboratories have identified numerous proteins that bind and function with sliding clamps. Among these processes are mismatch repair and nucleosome assembly. Interestingly, there exist polymerases that are highly processive and do not require clamps. Hence, DNA polymerase processivity does not intrinsically require that sliding clamps evolved for this purpose. We propose that polymerases evolved to require clamps as a way of ensuring that clamps are deposited on newly replicated DNA. These clamps are then used on the newly replicated daughter strands, for processes important to genomic integrity, such as mismatch repair and the assembly of nucleosomes to maintain epigenetic states of replicating cells during development. PMID:25704660

  15. Protein Dynamics

    NASA Astrophysics Data System (ADS)

    Frauenfelder, Hans

    2011-03-01

    Proteins combine properties of solids, liquids, and glasses. Schrödinger anticipated the main features of biomolecules long ago by stating that they had to be solid-like, but able to assume many different conformations. Indeed proteins can assume a gigantic number of conformational substates with the same primary sequence but different conformations. The different substates are described as craters in a very-high-dimensional energy landscape. The energy landscape is organized in a hierarchy of tiers, craters within craters within craters. Protein motions are pictured as transition between substates - jumps from crater to crater. Initially we assumed that these jumps were controlled by internal barriers between substates, but experiments have shown that nature selected a different approach. Proteins are surrounded by one to two layers of water and are embedded in a bulk solvent. Structural motions of the protein are controlled by the alpha fluctuations in the solvent surrounding the protein. Some internal motions most likely involving side chains are controlled electrostatically by beta fluctuations in the hydration shell. The dynamics of proteins is consequently dominated by the environment (H. Frauenfelder et al. PNAS 106, 5129 (2009). One can speculate that this organization permits exchange of information among biomolecules. The energy landscape is not just organized into two tiers, alpha and beta, but cryogenic experiments have revealed more tiers and protein more properties similar to that of glasses. While proteins function at ambient temperatures, cryogenic studies are necessary to understand the physics relevant for biology.

  16. Ubiquitin-specific Peptidase 10 (USP10) Deubiquitinates and Stabilizes MutS Homolog 2 (MSH2) to Regulate Cellular Sensitivity to DNA Damage.

    PubMed

    Zhang, Mu; Hu, Chen; Tong, Dan; Xiang, Shengyan; Williams, Kendra; Bai, Wenlong; Li, Guo-Min; Bepler, Gerold; Zhang, Xiaohong

    2016-05-13

    MSH2 is a key DNA mismatch repair protein, which plays an important role in genomic stability. In addition to its DNA repair function, MSH2 serves as a sensor for DNA base analogs-provoked DNA replication errors and binds to various DNA damage-induced adducts to trigger cell cycle arrest or apoptosis. Loss or depletion of MSH2 from cells renders resistance to certain DNA-damaging agents. Therefore, the level of MSH2 determines DNA damage response. Previous studies showed that the level of MSH2 protein is modulated by the ubiquitin-proteasome pathway, and histone deacetylase 6 (HDAC6) serves as an ubiquitin E3 ligase. However, the deubiquitinating enzymes, which regulate MSH2 remain unknown. Here we report that ubiquitin-specific peptidase 10 (USP10) interacts with and stabilizes MSH2. USP10 deubiquitinates MSH2 in vitro and in vivo Moreover, the protein level of MSH2 is positively correlated with the USP10 protein level in a panel of lung cancer cell lines. Knockdown of USP10 in lung cancer cells exhibits increased cell survival and decreased apoptosis upon the treatment of DNA-methylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and antimetabolite 6-thioguanine (6-TG). The above phenotypes can be rescued by ectopic expression of MSH2. In addition, knockdown of MSH2 decreases the cellular mismatch repair activity. Overall, our results suggest a novel USP10-MSH2 pathway regulating DNA damage response and DNA mismatch repair. PMID:26975374

  17. MutS/MutL crystal structure reveals that the MutS sliding clamp loads MutL onto DNA

    PubMed Central

    Groothuizen, Flora S; Winkler, Ines; Cristóvão, Michele; Fish, Alexander; Winterwerp, Herrie HK; Reumer, Annet; Marx, Andreas D; Hermans, Nicolaas; Nicholls, Robert A; Murshudov, Garib N; Lebbink, Joyce HG; Friedhoff, Peter; Sixma, Titia K

    2015-01-01

    To avoid mutations in the genome, DNA replication is generally followed by DNA mismatch repair (MMR). MMR starts when a MutS homolog recognizes a mismatch and undergoes an ATP-dependent transformation to an elusive sliding clamp state. How this transient state promotes MutL homolog recruitment and activation of repair is unclear. Here we present a crystal structure of the MutS/MutL complex using a site-specifically crosslinked complex and examine how large conformational changes lead to activation of MutL. The structure captures MutS in the sliding clamp conformation, where tilting of the MutS subunits across each other pushes DNA into a new channel, and reorientation of the connector domain creates an interface for MutL with both MutS subunits. Our work explains how the sliding clamp promotes loading of MutL onto DNA, to activate downstream effectors. We thus elucidate a crucial mechanism that ensures that MMR is initiated only after detection of a DNA mismatch. DOI: http://dx.doi.org/10.7554/eLife.06744.001 PMID:26163658

  18. MutS/MutL crystal structure reveals that the MutS sliding clamp loads MutL onto DNA.

    PubMed

    Groothuizen, Flora S; Winkler, Ines; Cristóvão, Michele; Fish, Alexander; Winterwerp, Herrie H K; Reumer, Annet; Marx, Andreas D; Hermans, Nicolaas; Nicholls, Robert A; Murshudov, Garib N; Lebbink, Joyce H G; Friedhoff, Peter; Sixma, Titia K

    2015-01-01

    To avoid mutations in the genome, DNA replication is generally followed by DNA mismatch repair (MMR). MMR starts when a MutS homolog recognizes a mismatch and undergoes an ATP-dependent transformation to an elusive sliding clamp state. How this transient state promotes MutL homolog recruitment and activation of repair is unclear. Here we present a crystal structure of the MutS/MutL complex using a site-specifically crosslinked complex and examine how large conformational changes lead to activation of MutL. The structure captures MutS in the sliding clamp conformation, where tilting of the MutS subunits across each other pushes DNA into a new channel, and reorientation of the connector domain creates an interface for MutL with both MutS subunits. Our work explains how the sliding clamp promotes loading of MutL onto DNA, to activate downstream effectors. We thus elucidate a crucial mechanism that ensures that MMR is initiated only after detection of a DNA mismatch. PMID:26163658

  19. Transient overexpression of DNA adenine methylase enables efficient and mobile genome engineering with reduced off-target effects

    PubMed Central

    Lennen, Rebecca M.; Nilsson Wallin, Annika I.; Pedersen, Margit; Bonde, Mads; Luo, Hao; Herrgård, Markus J.; Sommer, Morten O. A.

    2016-01-01

    Homologous recombination of single-stranded oligonucleotides is a highly efficient process for introducing precise mutations into the genome of E. coli and other organisms when mismatch repair (MMR) is disabled. This can result in the rapid accumulation of off-target mutations that can mask desired phenotypes, especially when selections need to be employed following the generation of combinatorial libraries. While the use of inducible mutator phenotypes or other MMR evasion tactics have proven useful, reported methods either require non-mobile genetic modifications or costly oligonucleotides that also result in reduced efficiencies of replacement. Therefore a new system was developed, Transient Mutator Multiplex Automated Genome Engineering (TM-MAGE), that solves problems encountered in other methods for oligonucleotide-mediated recombination. TM-MAGE enables nearly equivalent efficiencies of allelic replacement to the use of strains with fully disabled MMR and with an approximately 12- to 33-fold lower off-target mutation rate. Furthermore, growth temperatures are not restricted and a version of the plasmid can be readily removed by sucrose counterselection. TM-MAGE was used to combinatorially reconstruct mutations found in evolved salt-tolerant strains, enabling the identification of causative mutations and isolation of strains with up to 75% increases in growth rate and greatly reduced lag times in 0.6 M NaCl. PMID:26496947

  20. Mature Microsatellites: Mechanisms Underlying Dinucleotide Microsatellite Mutational Biases in Human Cells

    PubMed Central

    Baptiste, Beverly A.; Ananda, Guruprasad; Strubczewski, Noelle; Lutzkanin, Andrew; Khoo, Su Jen; Srikanth, Abhinaya; Kim, Nari; Makova, Kateryna D.; Krasilnikova, Maria M.; Eckert, Kristin A.

    2013-01-01

    Dinucleotide microsatellites are dynamic DNA sequences that affect genome stability. Here, we focused on mature microsatellites, defined as pure repeats of lengths above the threshold and unlikely to mutate below it in a single mutational event. We investigated the prevalence and mutational behavior of these sequences by using human genome sequence data, human cells in culture, and purified DNA polymerases. Mature dinucleotides (≥10 units) are present within exonic sequences of >350 genes, resulting in vulnerability to cellular genetic integrity. Mature dinucleotide mutagenesis was examined experimentally using ex vivo and in vitro approaches. We observe an expansion bias for dinucleotide microsatellites up to 20 units in length in somatic human cells, in agreement with previous computational analyses of germ-line biases. Using purified DNA polymerases and human cell lines deficient for mismatch repair (MMR), we show that the expansion bias is caused by functional MMR and is not due to DNA polymerase error biases. Specifically, we observe that the MutSα and MutLα complexes protect against expansion mutations. Our data support a model wherein different MMR complexes shift the balance of mutations toward deletion or expansion. Finally, we show that replication fork progression is stalled within long dinucleotides, suggesting that mutational mechanisms within long repeats may be distinct from shorter lengths, depending on the biochemistry of fork resolution. Our work combines computational and experimental approaches to explain the complex mutational behavior of dinucleotide microsatellites in humans. PMID:23450065

  1. Meat intake, cooking methods, dietary carcinogens, and colorectal cancer risk: findings from the Colorectal Cancer Family Registry.

    PubMed

    Joshi, Amit D; Kim, Andre; Lewinger, Juan Pablo; Ulrich, Cornelia M; Potter, John D; Cotterchio, Michelle; Le Marchand, Loic; Stern, Mariana C

    2015-06-01

    Diets high in red meat and processed meats are established colorectal cancer (CRC) risk factors. However, it is still not well understood what explains this association. We conducted comprehensive analyses of CRC risk and red meat and poultry intakes, taking into account cooking methods, level of doneness, estimated intakes of heterocyclic amines (HCAs) that accumulate during meat cooking, tumor location, and tumor mismatch repair proficiency (MMR) status. We analyzed food frequency and portion size data including a meat cooking module for 3364 CRC cases, 1806 unaffected siblings, 136 unaffected spouses, and 1620 unaffected population-based controls, recruited into the CRC Family Registry. Odds ratios (OR) and 95% confidence intervals (CI) for nutrient density variables were estimated using generalized estimating equations. We found no evidence of an association between total nonprocessed red meat or total processed meat and CRC risk. Our main finding was a positive association with CRC for pan-fried beefsteak (P(trend) < 0.001), which was stronger among MMR deficient cases (heterogeneity P = 0.059). Other worth noting associations, of borderline statistical significance after multiple testing correction, were a positive association between diets high in oven-broiled short ribs or spareribs and CRC risk (P(trend) = 0.002), which was also stronger among MMR-deficient cases, and an inverse association with grilled hamburgers (P(trend) = 0.002). Our results support the role of specific meat types and cooking practices as possible sources of human carcinogens relevant for CRC risk. PMID:25846122

  2. Interfacial Protein-Protein Associations

    PubMed Central

    Langdon, Blake B.; Kastantin, Mark; Walder, Robert; Schwartz, Daniel K.

    2014-01-01

    While traditional models of protein adsorption focus primarily on direct protein-surface interactions, recent findings suggest that protein-protein interactions may play a central role. Using high-throughput intermolecular resonance energy transfer (RET) tracking, we directly observed dynamic, protein-protein associations of bovine serum albumin on poly(ethylene glycol) modified surfaces. The associations were heterogeneous and reversible, and associating molecules resided on the surface for longer times. The appearance of three distinct RET states suggested a spatially heterogeneous surface – with areas of high protein density (i.e. strongly-interacting clusters) coexisting with mobile monomers. Distinct association states exhibited characteristic behavior, i.e. partial-RET (monomer-monomer) associations were shorter-lived than complete-RET (protein-cluster) associations. While the fractional surface area covered by regions with high protein density (i.e. clusters) increased with increasing concentration, the distribution of contact times between monomers and clusters was independent of solution concentration, suggesting that associations were a local phenomenon, and independent of the global surface coverage. PMID:24274729

  3. Sequence context effect for hMSH2-hMSH6 mismatch-dependent activation

    PubMed Central

    Mazurek, Anthony; Johnson, Christopher N.; Germann, Markus W.; Fishel, Richard

    2009-01-01

    Numerous DNA mismatches and lesions activate MutS homologue (MSH) ATPase activity that is essential for mismatch repair (MMR). We have found that a mismatch embedded in a nearest-neighbor sequence context containing symmetric 3′-purines (2 × 3′-purines) enhanced, whereas symmetric 3′-pyrimidines (2 × 3′-pyrimidines) reduced, hMSH2-hMSH6 ATPase activation. The 3′-purine/pyrimidine effect was most evident for G-containing mispairs. A similar trend pervaded mismatch binding (KD) and the melting of unbound oligonucleotides (Tm; ΔG). However, these latter measures did not accurately predict the hierarchy of MSH ATPase activation. NMR studies of imino proton lifetime, solvent accessibility, and NOE connectivity suggest that sequence contexts that provoke improved MSH-activation displayed enhanced localized DNA flexibility: a dynamic DNA signature that may account for the wide range of lesions that activate MSH functions. PMID:19237577

  4. Hereditary non-BRCA gynecological tumors.

    PubMed

    Vellone, Valerio G; Paudice, Michele; Varesco, Liliana

    2016-10-01

    Early diagnosis and proper management of gynecologic malignancies represent a challenge in modern oncology. A growing interest has arisen around the gynecological manifestations of hereditary cancer syndromes. In particular, the discovery of the BRCA1 and BRCA2 genes in ovarian cancer and the mismatch repair genes (MMR) in endometrial carcinoma has revolutionized our approach to the diagnosis and screening of women for ovarian and uterine cancers. The clinical, genetic and pathological features of hereditary cancer syndromes with gynecological manifestations are reviewed focusing on Lynch Syndrome, also known as hereditary nonpolyposis colorectal carcinoma (HNPCC), Peutz-Jeghers Syndrome (PJS), Cowden Syndrome or multiple hamartoma syndrome, Gorlin Syndrome or nevoid basal-cell carcinoma syndrome (NBCCS) and Reed's Syndrome or hereditary leiomyomatosis and renal cell cancer (HLRCC). PMID:26930387

  5. Molecular structures of crossover and noncrossover intermediates during gap repair in yeast: implications for recombination mechanisms and the regulation of recombination fidelity

    PubMed Central

    Mitchel, Katrina; Zhang, Hengshan; Welz-Voegele, Caroline; Jinks-Robertson, Sue

    2010-01-01

    SUMMARY The molecular structures of crossover (CO) and noncrossover (NCO) intermediates were determined by sequencing the products formed when a gapped plasmid was repaired using a diverged chromosomal template. Analyses were done in the absence of mismatch repair (MMR) to allow efficient detection of strand-transfer intermediates, and the results reveal striking differences in the extents and locations of heteroduplex DNA (hDNA) in NCO versus CO products. These data indicate that most NCOs are produced by synthesis-dependent strand annealing rather than by a canonical double-strand break repair pathway, and that resolution of Holliday junctions formed as part of the latter pathway is highly constrained to generate CO products. We suggest a model in which the length of hDNA formed by the initiating strand invasion event determines susceptibility of the resulting intermediate to antirecombination and ultimately whether a CO- or a NCO-producing pathway is followed. PMID:20417600

  6. GNL3L Is a Nucleo-Cytoplasmic Shuttling Protein: Role in Cell Cycle Regulation

    PubMed Central

    Thoompumkal, Indu Jose; Mahalingam, Sundarasamy

    2015-01-01

    GNL3L is an evolutionarily conserved high molecular weight GTP binding nucleolar protein belonging to HSR1-MMR1 subfamily of GTPases. The present investigation reveals that GNL3L is a nucleo-cytoplasmic shuttling protein and its export from the nucleus is sensitive to Leptomycin B. Deletion mutagenesis reveals that the C-terminal domain (amino acids 501–582) is necessary and sufficient for the export of GNL3L from the nucleus and the exchange of hydrophobic residues (M567, L570 and 572) within the C-terminal domain impairs this process. Results from the protein-protein interaction analysis indicate that GNL3L interaction with CRM1 is critical for its export from the nucleus. Ectopic expression of GNL3L leads to lesser accumulation of cells in the ‘G2/M’ phase of cell cycle whereas depletion of endogenous GNL3L results in ‘G2/M’ arrest. Interestingly, cell cycle analysis followed by BrdU labeling assay indicates that significantly increased DNA synthesis occurs in cells expressing nuclear export defective mutant (GNL3L∆NES) compared to the wild type or nuclear import defective GNL3L. Furthermore, increased hyperphosphorylation of Rb at Serine 780 and the upregulation of E2F1, cyclins A2 and E1 upon ectopic expression of GNL3L∆NES results in faster ‘S’ phase progression. Collectively, the present study provides evidence that GNL3L is exported from the nucleus in CRM1 dependent manner and the nuclear localization of GNL3L is important to promote ‘S’ phase progression during cell proliferation. PMID:26274615

  7. Structure of the Endonuclease Domain of MutL: Unlicensed to Cut

    SciTech Connect

    Pillon, M.; Lorenowicz, J; Uckelmann, M; Klocko, A; Chung, Y; Modrich, P; Walker, G; Simmons, L; Friedhoff, P; Guarne, A

    2010-01-01

    DNA mismatch repair corrects errors that have escaped polymerase proofreading, increasing replication fidelity 100- to 1000-fold in organisms ranging from bacteria to humans. The MutL protein plays a central role in mismatch repair by coordinating multiple protein-protein interactions that signal strand removal upon mismatch recognition by MutS. Here we report the crystal structure of the endonuclease domain of Bacillus subtilis MutL. The structure is organized in dimerization and regulatory subdomains connected by a helical lever spanning the conserved endonuclease motif. Additional conserved motifs cluster around the lever and define a Zn{sup 2+}-binding site that is critical for MutL function in vivo. The structure unveils a powerful inhibitory mechanism to prevent undesired nicking of newly replicated DNA and allows us to propose a model describing how the interaction with MutS and the processivity clamp could license the endonuclease activity of MutL. The structure also provides a molecular framework to propose and test additional roles of MutL in mismatch repair.

  8. Identification and evaluation of a potent novel ATR inhibitor, NU6027, in breast and ovarian cancer cell lines

    PubMed Central

    Peasland, A; Wang, L-Z; Rowling, E; Kyle, S; Chen, T; Hopkins, A; Cliby, W A; Sarkaria, J; Beale, G; Edmondson, R J; Curtin, N J

    2011-01-01

    Background: The ataxia telangiectasia mutated and Rad3-related kinase (ATR) has a key role in the signalling of stalled replication forks and DNA damage to cell cycle checkpoints and DNA repair. It has long been recognised as an important target for cancer therapy but inhibitors have proved elusive. As NU6027, originally developed as a CDK2 inhibitor, potentiated cisplatin in a CDK2-independent manner we postulated that it may inhibit ATR. Methods: Cellular ATR kinase activity was determined by CHK1 phosphorylation in human fibroblasts with inducible dominant-negative ATR-kinase dead expression and human breast cancer MCF7 cells. Cell cycle effects and chemo- and radiopotentiation by NU6027 were determined in MCF7 cells and the role of mismatch repair and p53 was determined in isogenically matched ovarian cancer A2780 cells. Results: NU6027 is a potent inhibitor of cellular ATR activity (IC50=6.7 μ) and enhanced hydroxyurea and cisplatin cytotoxicity in an ATR-dependent manner. NU6027 attenuated G2/M arrest following DNA damage, inhibited RAD51 focus formation and increased the cytotoxicity of the major classes of DNA-damaging anticancer cytotoxic therapy but not the antimitotic, paclitaxel. In A2780 cells sensitisation to cisplatin was greatest in cells with functional p53 and mismatch repair (MMR) and sensitisation to temozolomide was greatest in p53 mutant cells with functional MMR. Importantly, NU6027 was synthetically lethal when DNA single-strand break repair is impaired either through poly(ADP-ribose) polymerase (PARP) inhibition or defects in XRCC1. Conclusion: NU6027 inhibits ATR, impairing G2/M arrest and homologous recombination thus increasing sensitivity to DNA-damaging agents and PARP inhibitors. It provides proof of concept data for clinical development of ATR inhibitors. PMID:21730979

  9. Heterozygous colon cancer-associated mutations of SAMHD1 have functional significance.

    PubMed

    Rentoft, Matilda; Lindell, Kristoffer; Tran, Phong; Chabes, Anna Lena; Buckland, Robert J; Watt, Danielle L; Marjavaara, Lisette; Nilsson, Anna Karin; Melin, Beatrice; Trygg, Johan; Johansson, Erik; Chabes, Andrei

    2016-04-26

    Even small variations in dNTP concentrations decrease DNA replication fidelity, and this observation prompted us to analyze genomic cancer data for mutations in enzymes involved in dNTP metabolism. We found that sterile alpha motif and histidine-aspartate domain-containing protein 1 (SAMHD1), a deoxyribonucleoside triphosphate triphosphohydrolase that decreases dNTP pools, is frequently mutated in colon cancers, that these mutations negatively affect SAMHD1 activity, and that several SAMHD1 mutations are found in tumors with defective mismatch repair. We show that minor changes in dNTP pools in combination with inactivated mismatch repair dramatically increase mutation rates. Determination of dNTP pools in mouse embryos revealed that inactivation of one SAMHD1 allele is sufficient to elevate dNTP pools. These observations suggest that heterozygous cancer-associated SAMHD1 mutations increase mutation rates in cancer cells. PMID:27071091

  10. Msh2 deficiency leads to dysmyelination of the corpus callosum, impaired locomotion, and altered sensory function in mice

    PubMed Central

    Diouf, Barthelemy; Devaraju, Prakash; Janke, Laura J.; Fan, Yiping; Frase, Sharon; Eddins, Donnie; Peters, Jennifer L.; Kim, Jieun; Pei, Deqing; Cheng, Cheng; Zakharenko, Stanislav S.; Evans, William E.

    2016-01-01

    A feature in patients with constitutional DNA-mismatch repair deficiency is agenesis of the corpus callosum, the cause of which has not been established. Here we report a previously unrecognized consequence of deficiency in MSH2, a protein known primarily for its function in correcting nucleotide mismatches or insertions and deletions in duplex DNA caused by errors in DNA replication or recombination. We documented that Msh2 deficiency causes dysmyelination of the axonal projections in the corpus callosum. Evoked action potentials in the myelinated corpus callosum projections of Msh2-null mice were smaller than wild-type mice, whereas unmyelinated axons showed no difference. Msh2-null mice were also impaired in locomotive activity and had an abnormal response to heat. These findings reveal a novel pathogenic consequence of MSH2 deficiency, providing a new mechanistic hint to previously recognized neurological disorders in patients with inherited DNA-mismatch repair deficiency. PMID:27476972

  11. Heterozygous colon cancer-associated mutations of SAMHD1 have functional significance

    PubMed Central

    Rentoft, Matilda; Lindell, Kristoffer; Tran, Phong; Chabes, Anna Lena; Watt, Danielle L.; Marjavaara, Lisette; Nilsson, Anna Karin; Melin, Beatrice; Trygg, Johan; Johansson, Erik

    2016-01-01

    Even small variations in dNTP concentrations decrease DNA replication fidelity, and this observation prompted us to analyze genomic cancer data for mutations in enzymes involved in dNTP metabolism. We found that sterile alpha motif and histidine-aspartate domain-containing protein 1 (SAMHD1), a deoxyribonucleoside triphosphate triphosphohydrolase that decreases dNTP pools, is frequently mutated in colon cancers, that these mutations negatively affect SAMHD1 activity, and that several SAMHD1 mutations are found in tumors with defective mismatch repair. We show that minor changes in dNTP pools in combination with inactivated mismatch repair dramatically increase mutation rates. Determination of dNTP pools in mouse embryos revealed that inactivation of one SAMHD1 allele is sufficient to elevate dNTP pools. These observations suggest that heterozygous cancer-associated SAMHD1 mutations increase mutation rates in cancer cells. PMID:27071091

  12. Whey Protein

    MedlinePlus

    ... intolerance, for replacing or supplementing milk-based infant formulas, and for reversing weight loss and increasing glutathione ( ... allergic reactions compared to infants who receive standard formula. However, taking why protein might not be helpful ...

  13. Designed protein-protein association.

    PubMed

    Grueninger, Dirk; Treiber, Nora; Ziegler, Mathias O P; Koetter, Jochen W A; Schulze, Monika-Sarah; Schulz, Georg E

    2008-01-11

    The analysis of natural contact interfaces between protein subunits and between proteins has disclosed some general rules governing their association. We have applied these rules to produce a number of novel assemblies, demonstrating that a given protein can be engineered to form contacts at various points of its surface. Symmetry plays an important role because it defines the multiplicity of a designed contact and therefore the number of required mutations. Some of the proteins needed only a single side-chain alteration in order to associate to a higher-order complex. The mobility of the buried side chains has to be taken into account. Four assemblies have been structurally elucidated. Comparisons between the designed contacts and the results will provide useful guidelines for the development of future architectures. PMID:18187656

  14. Down-regulated expression of monocyte/macrophage major histocompatibility complex receptors in human and mouse monocytes by expression of their ligands

    PubMed Central

    Yamana, H; Tashiro-Yamaji, J; Hayashi, M; Maeda, S; Shimizu, T; Tanigawa, N; Uchiyama, K; Kubota, T; Yoshida, R

    2014-01-01

    Mouse monocyte/macrophage major histocompatibility complex (MHC) receptor 1 (MMR1; or MMR2) specific for H-2Dd (or H-2Kd) molecules is expressed on monocytes from non-H-2Dd (or non-H-2Kd), but not those from H-2Dd (or H-2Kd), inbred mice. The MMR1 and/or MMR2 is essential for the rejection of H-2Dd- and/or H-2Kd-transgenic mouse skin onto C57BL/6 (H-2DbKb) mice. Recently, we found that human leucocyte antigen (HLA)-B44 was the sole ligand of human MMR1 using microbeads that had been conjugated with 80 types of HLA class I molecules covering 94·2% (or 99·4%) and 92·4% (or 96·2%) of HLA-A and B molecules of Native Americans (or Japanese), respectively. In the present study, we also explored the ligand specificity of human MMR2 using microbeads. Microbeads coated with HLA-A32, HLA-B13 or HLA-B62 antigens bound specifically to human embryonic kidney (HEK)293T or EL-4 cells expressing human MMR2 and to the solubilized MMR2-green fluorescent protein (GFP) fusion protein; and MMR2+ monocytes from a volunteer bound HLA-B62 molecules with a Kd of 8·7 × 10−9 M, implying a three times down-regulation of MMR2 expression by the ligand expression. H-2Kd (or H-2Dd) transgene into C57BL/6 mice down-regulated not only MMR2 (or MMR1) but also MMR1 (or MMR2) expression, leading to further down-regulation of MMR expression. In fact, monocytes from two (i.e. MMR1+/MMR2+ and MMR1–/MMR2–) volunteers bound seven to nine types of microbeads among 80, indicating ≤ 10 types of MMR expression on monocytes. The physiological role of constitutive MMRs on monocytes possibly towards allogeneic (e.g. fetal) cells in the blood appears to be distinct from that of inducible MMRs on macrophages toward allografts in tissue. PMID:24842626

  15. Protein Crystallization

    NASA Technical Reports Server (NTRS)

    Chernov, Alexander A.

    2005-01-01

    Nucleation, growth and perfection of protein crystals will be overviewed along with crystal mechanical properties. The knowledge is based on experiments using optical and force crystals behave similar to inorganic crystals, though with a difference in orders of magnitude in growing parameters. For example, the low incorporation rate of large biomolecules requires up to 100 times larger supersaturation to grow protein, rather than inorganic crystals. Nucleation is often poorly reproducible, partly because of turbulence accompanying the mixing of precipitant with protein solution. Light scattering reveals fluctuations of molecular cluster size, its growth, surface energies and increased clustering as protein ages. Growth most often occurs layer-by-layer resulting in faceted crystals. New molecular layer on crystal face is terminated by a step where molecular incorporation occurs. Quantitative data on the incorporation rate will be discussed. Rounded crystals with molecularly disordered interfaces will be explained. Defects in crystals compromise the x-ray diffraction resolution crucially needed to find the 3D atomic structure of biomolecules. The defects are immobile so that birth defects stay forever. All lattice defects known for inorganics are revealed in protein crystals. Contribution of molecular conformations to lattice disorder is important, but not studied. This contribution may be enhanced by stress field from other defects. Homologous impurities (e.g., dimers, acetylated molecules) are trapped more willingly by a growing crystal than foreign protein impurities. The trapped impurities induce internal stress eliminated in crystals exceeding a critical size (part of mni for ferritin, lysozyme). Lesser impurities are trapped from stagnant, as compared to the flowing, solution. Freezing may induce much more defects unless quickly amorphysizing intracrystalline water.

  16. Bacteriophage protein-protein interactions.

    PubMed

    Häuser, Roman; Blasche, Sonja; Dokland, Terje; Haggård-Ljungquist, Elisabeth; von Brunn, Albrecht; Salas, Margarita; Casjens, Sherwood; Molineux, Ian; Uetz, Peter

    2012-01-01

    Bacteriophages T7, λ, P22, and P2/P4 (from Escherichia coli), as well as ϕ29 (from Bacillus subtilis), are among the best-studied bacterial viruses. This chapter summarizes published protein interaction data of intraviral protein interactions, as well as known phage-host protein interactions of these phages retrieved from the literature. We also review the published results of comprehensive protein interaction analyses of Pneumococcus phages Dp-1 and Cp-1, as well as coliphages λ and T7. For example, the ≈55 proteins encoded by the T7 genome are connected by ≈43 interactions with another ≈15 between the phage and its host. The chapter compiles published interactions for the well-studied phages λ (33 intra-phage/22 phage-host), P22 (38/9), P2/P4 (14/3), and ϕ29 (20/2). We discuss whether different interaction patterns reflect different phage lifestyles or whether they may be artifacts of sampling. Phages that infect the same host can interact with different host target proteins, as exemplified by E. coli phage λ and T7. Despite decades of intensive investigation, only a fraction of these phage interactomes are known. Technical limitations and a lack of depth in many studies explain the gaps in our knowledge. Strategies to complete current interactome maps are described. Although limited space precludes detailed overviews of phage molecular biology, this compilation will allow future studies to put interaction data into the context of phage biology. PMID:22748812

  17. Recombinant protein production technology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombinant protein production is an important technology for antibody production, biochemical activity study, and structural determination during the post-genomic era. Limiting factors in recombinant protein production include low-level protein expression, protein precipitation, and loss of protein...

  18. A Mutation in a Saccharomyces Cerevisiae Gene (Rad3) Required for Nucleotide Excision Repair and Transcription Increases the Efficiency of Mismatch Correction

    PubMed Central

    Yang, Y.; Johnson, A. L.; Johnston, L. H.; Siede, W.; Friedberg, E. C.; Ramachandran, K.; Kunz, B. A.

    1996-01-01

    RAD3 functions in DNA repair and transcription in Saccharomyces cerevisiae and particular rad3 alleles confer a mutator phenotype, possibly as a consequence of defective mismatch correction. We assessed the potential involvement of the Rad3 protein in mismatch correction by comparing heteroduplex repair in isogenic rad3-1 and wild-type strains. The rad3-1 allele increased the spontaneous mutation rate but did not prevent heteroduplex repair or bias its directionality. Instead, the efficiency of mismatch correction was enhanced in the rad3-1 strain. This surprising result prompted us to examine expression of yeast mismatch repair genes. We determined that MSH2, but not MLH1, is transcriptionally regulated during the cell-cycle like PMS1, and that rad3-1 does not increase the transcript levels for these genes in log phase cells. These observations suggest that the rad3-1 mutation gives rise to an enhanced efficiency of mismatch correction via a process that does not involve transcriptional regulation of mismatch repair. Interestingly, mismatch repair also was more efficient when error-editing by yeast DNA polymerase δ was eliminated. We discuss our results in relation to possible mechanisms that may link the rad3-1 mutation to mismatch correction efficiency. PMID:8889512

  19. Colorectal poorly differentiated neuroendocrine carcinomas frequently exhibit BRAF mutations and are associated with poor overall survival.

    PubMed

    Olevian, Dane C; Nikiforova, Marina N; Chiosea, Simon; Sun, Weijing; Bahary, Nathan; Kuan, Shih-Fan; Pai, Reetesh K

    2016-03-01

    The molecular alterations in colorectal poorly differentiated neuroendocrine carcinoma remain incompletely characterized, particularly with respect to mutations in BRAF and KRAS. We analyzed 32 colorectal poorly differentiated neuroendocrine carcinomas and 40 colorectal poorly differentiated conventional adenocarcinomas for mutations in KRAS and BRAF and for DNA mismatch repair protein abnormalities to correlate histopathology with molecular alterations and survival. Compared with poorly differentiated conventional adenocarcinoma, poorly differentiated neuroendocrine carcinoma frequently harbored BRAF mutations (59% versus 5%; P < .001) and less frequently demonstrated KRAS codon 12 or 13 mutations (17% versus 43%; P = .03). BRAF mutations were identified in both pure poorly differentiated neuroendocrine carcinoma (60%) and poorly differentiated neuroendocrine carcinoma associated with a signet ring cell adenocarcinoma component (82%). Most (93%) poorly differentiated neuroendocrine carcinomas demonstrated proficient DNA mismatch repair by either microsatellite instability polymerase chain reaction or DNA mismatch repair immunohistochemistry. Patients with poorly differentiated neuroendocrine carcinoma had a significantly worse overall survival compared with patients with poorly differentiated conventional adenocarcinoma (P < .001). There was no significant difference in overall survival between patients with pure poorly differentiated neuroendocrine carcinoma and patients with both poorly differentiated neuroendocrine carcinoma and adenocarcinoma components (P = .5). In conclusion, colorectal poorly differentiated neuroendocrine carcinomas frequently harbor BRAF mutations and are associated with poor overall survival. PMID:26826419

  20. Protein inference: A protein quantification perspective.

    PubMed

    He, Zengyou; Huang, Ting; Liu, Xiaoqing; Zhu, Peijun; Teng, Ben; Deng, Shengchun

    2016-08-01

    In mass spectrometry-based shotgun proteomics, protein quantification and protein identification are two major computational problems. To quantify the protein abundance, a list of proteins must be firstly inferred from the raw data. Then the relative or absolute protein abundance is estimated with quantification methods, such as spectral counting. Until now, most researchers have been dealing with these two processes separately. In fact, the protein inference problem can be regarded as a special protein quantification problem in the sense that truly present proteins are those proteins whose abundance values are not zero. Some recent published papers have conceptually discussed this possibility. However, there is still a lack of rigorous experimental studies to test this hypothesis. In this paper, we investigate the feasibility of using protein quantification methods to solve the protein inference problem. Protein inference methods aim to determine whether each candidate protein is present in the sample or not. Protein quantification methods estimate the abundance value of each inferred protein. Naturally, the abundance value of an absent protein should be zero. Thus, we argue that the protein inference problem can be viewed as a special protein quantification problem in which one protein is considered to be present if its abundance is not zero. Based on this idea, our paper tries to use three simple protein quantification methods to solve the protein inference problem effectively. The experimental results on six data sets show that these three methods are competitive with previous protein inference algorithms. This demonstrates that it is plausible to model the protein inference problem as a special protein quantification task, which opens the door of devising more effective protein inference algorithms from a quantification perspective. The source codes of our methods are available at: http://code.google.com/p/protein-inference/. PMID:26935399

  1. Mycobacterium tuberculosis efpA encodes an efflux protein of the QacA transporter family.

    PubMed Central

    Doran, J L; Pang, Y; Mdluli, K E; Moran, A J; Victor, T C; Stokes, R W; Mahenthiralingam, E; Kreiswirth, B N; Butt, J L; Baron, G S; Treit, J D; Kerr, V J; Van Helden, P D; Roberts, M C; Nano, F E

    1997-01-01

    The Mycobacterium tuberculosis H37Rv efpA gene encodes a putative efflux protein, EfpA, of 55,670 Da. The deduced EfpA protein was similar in secondary structure to Pur8, MmrA, TcmA, LfrA, EmrB, and other members of the QacA transporter family (QacA TF) which mediate antibiotic and chemical resistance in bacteria and yeast. The predicted EfpA sequence possessed all transporter motifs characteristic of the QacA TF, including those associated with proton-antiport function and the motif considered to be specific to exporters. The 1,590-bp efpA open reading frame was G+C rich (65%), whereas the 40-bp region immediately upstream had an A+T bias (35% G+C). Reverse transcriptase-PCR assays indicated that efpA was expressed in vitro and in situ. Putative promoter sequences were partially overlapped by the A+T-rich region and by a region capable of forming alternative secondary structures indicative of transcriptional regulation in analogous systems. PCR single-stranded conformational polymorphism analysis demonstrated that these upstream flanking sequences and the 231-bp, 5' coding region are highly conserved among both drug-sensitive and multiply-drug-resistant isolates of M. tuberculosis. The efpA gene was present in the slow-growing human pathogens M. tuberculosis, Mycobacterium leprae, and Mycobacterium bovis and in the opportunistic human pathogens Mycobacterium avium and Mycobacterium intracellular. However, efpA was not present in 17 other opportunistically pathogenic or nonpathogenic mycobacterial species. PMID:9008277

  2. Female Hormonal Factors and the Risk of Endometrial Cancer in Lynch Syndrome

    PubMed Central

    Dashti, Seyedeh Ghazaleh; Chau, Rowena; Ouakrim, Driss Ait; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Winship, Ingrid M.; Arnold, Julie; Ahnen, Dennis J.; Haile, Robert W.; Casey, Graham; Gallinger, Steven; Thibodeau, Stephen N.; Lindor, Noralane M.; Le Marchand, Loïc; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.; Win, Aung Ko

    2015-01-01

    Importance Apart from hysterectomy, there is no consensus recommendation for reducing endometrial cancer risk for women with a mismatch repair (MMR) gene mutation (Lynch syndrome). Objective To investigate the association between hormonal factors and endometrial cancer risk in Lynch syndrome. Design, Setting, and Participants A retrospective cohort study including 1,128 women with a MMR gene mutation identified from the Colon Cancer Family Registry was conducted. Data were analyzed using a weighted cohort approach. Participants were recruited between 1997 and 2012, from centers across the United States, Australia, Canada, and New Zealand. Exposures Age at menarche, first and last live birth, and menopause, number of live births, hormonal contraceptive use, and postmenopausal hormone use. Main Outcome and Measures Self-reported diagnosis of endometrial cancer. Results Endometrial cancer was diagnosed in 133 women (incidence per 100 person-years, 0.29; 95% confidence interval [CI], 0.24 to 0.34). A lower risk of endometrial cancer was associated with later age at menarche (hazard ratio [HR] per year, 0.85 [95%CI, 0.73 to 0.99]; P=.04), parity (parous vs nulliparous: HR, 0.21 [95%CI, 0.10 to 0.42]; P<.001), and hormonal contraceptive use (≥1 year vs <1 year: HR, 0.39 [95%CI, 0.23 to 0.64]; P<.001). There was no statistically significant association between endometrial cancer and age at first and last live birth, age at menopause, and postmenopausal hormone use. Conclusions and Relevance For women with a MMR gene mutation, some endogenous and exogenous hormonal factors were associated with a lower risk of endometrial cancer. These directions and strengths of associations were similar to those for the general population. If replicated, these findings suggest that women with a MMR gene mutation may be counseled like the general population in regard to hormonal influences on endometrial cancer risk. PMID:26151267

  3. Distinct Phenotypes Caused by Mutation of MSH2 in Trypanosome Insect and Mammalian Life Cycle Forms Are Associated with Parasite Adaptation to Oxidative Stress

    PubMed Central

    Bolderson, Jason; Campos, Priscila C.; Miranda, Julia B.; Alves, Ceres L.; Machado, Carlos R.; McCulloch, Richard; Teixeira, Santuza M. R.

    2015-01-01

    Background DNA repair mechanisms are crucial for maintenance of the genome in all organisms, including parasites where successful infection is dependent both on genomic stability and sequence variation. MSH2 is an early acting, central component of the Mismatch Repair (MMR) pathway, which is responsible for the recognition and correction of base mismatches that occur during DNA replication and recombination. In addition, recent evidence suggests that MSH2 might also play an important, but poorly understood, role in responding to oxidative damage in both African and American trypanosomes. Methodology/Principal Findings To investigate the involvement of MMR in the oxidative stress response, null mutants of MSH2 were generated in Trypanosoma brucei procyclic forms and in Trypanosoma cruzi epimastigote forms. Unexpectedly, the MSH2 null mutants showed increased resistance to H2O2 exposure when compared with wild type cells, a phenotype distinct from the previously observed increased sensitivity of T. brucei bloodstream forms MSH2 mutants. Complementation studies indicated that the increased oxidative resistance of procyclic T. brucei was due to adaptation to MSH2 loss. In both parasites, loss of MSH2 was shown to result in increased tolerance to alkylation by MNNG and increased accumulation of 8-oxo-guanine in the nuclear and mitochondrial genomes, indicating impaired MMR. In T. cruzi, loss of MSH2 also increases the parasite capacity to survive within host macrophages. Conclusions/Significance Taken together, these results indicate MSH2 displays conserved, dual roles in MMR and in the response to oxidative stress. Loss of the latter function results in life cycle dependent differences in phenotypic outcomes in T. brucei MSH2 mutants, most likely because of the greater burden of oxidative stress in the insect stage of the parasite. PMID:26083967

  4. Microsatellite instability in colorectal-cancer patients with suspected genetic predisposition.

    PubMed

    Calistri, D; Presciuttini, S; Buonsanti, G; Radice, P; Gazzoli, I; Pensotti, V; Sala, P; Eboli, M; Andreola, S; Russo, A; Pierotti, M; Bertario, L; Ranzani, G N

    2000-01-20

    Hereditary non-polyposis colorectal cancer (HNPCC) is a dominantly inherited syndrome linked to DNA-mismatch-repair (MMR) gene defects, which also account for microsatellite instability (MSI) in tumour tissues. Diagnosis is based mainly on family history, according to widely accepted criteria (Amsterdam Criteria: AC). Aim of this work was to assess MSI in colorectal-cancer patients with suspected genetic predisposition, and to verify whether MSI represents a tool to manage MMR gene (hMSH2 and hMLH1) mutation analysis. We investigated 13 microsatellites (including the 5 NCI/ICG-HNPCC markers) in 45 patients with suspected hereditary predisposition (including 16 subjects from HNPCC families fulfilling the AC). We found MSI-H (high frequency of instability, i.e., in > or =30% of the markers) in 85% of the HNPCC patients and in 16% of the non-HNPCC subjects. The 5 NCI/ICG-HNPCC microsatellites proved to be the most effective in detecting MSI, being mononucleotide repeats the most unstable markers. We investigated the association between hMSH2- and hMLH1 gene mutations and MSI. Our results indicate that AC are highly predictive both of tumour instability and of MMR-gene mutations. Therefore, as the most likely mutation carriers, HNPCC subjects might be directly analyzed for gene mutations, while to test for MSI in selected non-HNPCC patients and to further investigate MMR genes in MSI-H cases, appears to be a cost-effective way to identify subjects, other than those from kindred fulfilling AC, who might benefit from genetic testing. PMID:10719736

  5. Interfacing protein lysine acetylation and protein phosphorylation

    PubMed Central

    Tran, Hue T.; Uhrig, R. Glen; Nimick, Mhairi; Moorhead, Greg B.

    2012-01-01

    Recognition that different protein covalent modifications can operate in concert to regulate a single protein has forced us to re-think the relationship between amino acid side chain modifications and protein function. Results presented by Tran et al. 2012 demonstrate the association of a protein phosphatase (PP2A) with a histone/lysine deacetylase (HDA14) on plant microtubules along with a histone/lysine acetyltransferase (ELP3). This finding reveals a regulatory interface between two prevalent covalent protein modifications, protein phosphorylation and acetylation, emphasizing the integrated complexity of post-translational protein regulation found in nature. PMID:22827947

  6. Length, protein protein interactions, and complexity

    NASA Astrophysics Data System (ADS)

    Tan, Taison; Frenkel, Daan; Gupta, Vishal; Deem, Michael W.

    2005-05-01

    The evolutionary reason for the increase in gene length from archaea to prokaryotes to eukaryotes observed in large-scale genome sequencing efforts has been unclear. We propose here that the increasing complexity of protein-protein interactions has driven the selection of longer proteins, as they are more able to distinguish among a larger number of distinct interactions due to their greater average surface area. Annotated protein sequences available from the SWISS-PROT database were analyzed for 13 eukaryotes, eight bacteria, and two archaea species. The number of subcellular locations to which each protein is associated is used as a measure of the number of interactions to which a protein participates. Two databases of yeast protein-protein interactions were used as another measure of the number of interactions to which each S. cerevisiae protein participates. Protein length is shown to correlate with both number of subcellular locations to which a protein is associated and number of interactions as measured by yeast two-hybrid experiments. Protein length is also shown to correlate with the probability that the protein is encoded by an essential gene. Interestingly, average protein length and number of subcellular locations are not significantly different between all human proteins and protein targets of known, marketed drugs. Increased protein length appears to be a significant mechanism by which the increasing complexity of protein-protein interaction networks is accommodated within the natural evolution of species. Consideration of protein length may be a valuable tool in drug design, one that predicts different strategies for inhibiting interactions in aberrant and normal pathways.

  7. Mutations in polI but not mutSLH destabilize Haemophilus influenzae tetranucleotide repeats.

    PubMed

    Bayliss, Christopher D; van de Ven, Tamsin; Moxon, E Richard

    2002-03-15

    Haemophilus influenzae (Hi), an obligate upper respiratory tract commensal/pathogen, uses phase variation (PV) to adapt to host environment changes. Switching occurs by slippage of nucleotide repeats (microsatellites) within genes coding for virulence molecules. Most such microsatellites in Hi are tetranucleotide repeats, but an exception is the dinucleotide repeats in the pilin locus. To investigate the effects on PV rates of mutations in genes for mismatch repair (MMR), insertion/deletion mutations of mutS, mutL, mutH, dam, polI, uvrD, mfd and recA were constructed in Hi strain Rd. Only inactivation of polI destabilized tetranucleotide (5'AGTC) repeat tracts of chromosomally located reporter constructs, whereas inactivation of mutS, but not polI, destabilized dinucleotide (5'AT) repeats. Deletions of repeats were predominant in polI mutants, which we propose are due to end-joining occurring without DNA polymerization during polI-deficient Okazaki fragment processing. The high prevalence of tetranucleotides mediating PV is an exceptional feature of the Hi genome. The refractoriness to MMR of hypermutation in Hi tetranucleotides facilitates adaptive switching without the deleterious increase in global mutation rates that accompanies a mutator genotype. PMID:11889052

  8. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  9. Oxidation-mediated DNA cross-linking contributes to the toxicity of 6-thioguanine in human cells.

    PubMed

    Brem, Reto; Karran, Peter

    2012-09-15

    The thiopurines azathioprine and 6-mercaptopurine have been extensively prescribed as immunosuppressant and anticancer agents for several decades. A third member of the thiopurine family, 6-thioguanine (6-TG), has been used less widely. Although known to be partly dependent on DNA mismatch repair (MMR), the cytotoxicity of 6-TG remains incompletely understood. Here, we describe a novel MMR-independent pathway of 6-TG toxicity. Cell killing depended on two properties of 6-TG: its incorporation into DNA and its ability to act as a source of reactive oxygen species (ROS). ROS targeted DNA 6-TG to generate potentially lethal replication-arresting DNA lesions including interstrand cross-links. These triggered processing by the Fanconi anemia and homologous recombination DNA repair pathways. Allopurinol protected against 6-TG toxicity by acting as a ROS scavenger and preventing DNA damage. Together, our findings provide mechanistic evidence to support the proposed use of thiopurines to treat HR-defective tumors and for the coadministration of 6-TG and allopurinol as an immunomodulation strategy in inflammatory disorders. PMID:22822082

  10. Mechanisms of Chemoresistance in Malignant Glioma

    PubMed Central

    Sarkaria, Jann N.; Kitange, Gaspar J.; James, C. David; Plummer, Ruth; Calvert, Hilary; Weller, Michael; Wick, Wolfgang

    2008-01-01

    Intrinsic or acquired chemoresistance is a major cause of treatment failure in patients with malignant brain tumors. Alkylating agents, the mainstay of treatment for brain tumors, damage the DNA and induce apoptosis, but the cytotoxic activity of these agents is dependent on DNA repair pathways. For example, O6-methylguanine DNA adducts can cause double-strand breaks, but this is dependent on a functional mismatch repair (MMR) pathway. Thus, tumor cell lines deficient in MMR are resistant to alkylating agents. Perhaps the most important mechanism of resistance to alkylating agents is the DNA repair enzyme O6-methylguanine methyltransferase (MGMT), which can eliminate the cytotoxic O6-methylguanine DNA adduct before it causes harm. Another mechanism of resistance to alkylating agents is the base excision repair (BER) pathway. Consequently, efforts are ongoing to develop effective inhibitors of BER. Poly(ADP-ribose)polymerase (PARP-1) plays a pivotal role in BER and is an important therapeutic target. Developing effective strategies to overcome chemoresistance requires the identification of reliable preclinical models that recapitulate human disease and can be used to facilitate drug development. This manuscript describes the diverse mechanisms of chemoresistance operating in malignant glioma and efforts to develop reliable preclinical models and novel pharmacologic approaches to overcome resistance to alkylating agents. PMID:18483356

  11. Polynucleotide phosphorylase plays an important role in the generation of spontaneous mutations in Escherichia coli.

    PubMed

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander; Miller, Jeffrey H

    2012-10-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rif(r) and the gyrB gene leading to Nal(r) and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  12. Polynucleotide Phosphorylase Plays an Important Role in the Generation of Spontaneous Mutations in Escherichia coli

    PubMed Central

    Becket, Elinne; Tse, Lawrence; Yung, Madeline; Cosico, Alexander

    2012-01-01

    Polynucleotide phosphorylase (PNP) plays a central role in RNA degradation, generating a pool of ribonucleoside diphosphates (rNDPs) that can be converted to deoxyribonucleoside diphosphates (dNDPs) by ribonucleotide reductase. We report here that spontaneous mutations resulting from replication errors, which are normally repaired by the mismatch repair (MMR) system, are sharply reduced in a PNP-deficient Escherichia coli strain. This is true for base substitution mutations that occur in the rpoB gene leading to Rifr and the gyrB gene leading to Nalr and for base substitution and frameshift mutations that occur in the lacZ gene. These results suggest that the increase in the rNDP pools generated by polynucleotide phosphorylase (PNP) degradation of RNA is responsible for the spontaneous mutations observed in an MMR-deficient background. The PNP-derived pool also appears responsible for the observed mutations in the mutT mutator background and those that occur after treatment with 5-bromodeoxyuridine, as these mutations are also drastically reduced in a PNP-deficient strain. However, mutation frequencies are not reduced in a mutY mutator background or after treatment with 2-aminopurine. These results highlight the central role in mutagenesis played by the rNDP pools (and the subsequent dNTP pools) derived from RNA degradation. PMID:22904280

  13. Crystal structure of Δ-Ru(bpy)2dppz2+ bound to mismatched DNA reveals side-by-side metalloinsertion and intercalation

    PubMed Central

    Song, Hang; Kaiser, Jens T.; Barton, Jacqueline K.

    2012-01-01

    DNA mismatches represent a novel target in developing diagnostics and therapeutics for cancer, since deficiencies in DNA-mismatch repair (MMR) are implicated in many cancers and cells that are MMR-deficient show a high frequency of mismatches. We use metal complexes with bulky intercalating ligands serve as probes for DNA mismatches. Here, we report the high resolution (0.92 Å) crystal structure of the ruthenium ‘light switch’ complex Δ-Ru(bpy)2dppz2+ (bpy = 2,2′-bipyridine and dppz = dipyridophenazine), known to show luminescence on binding to duplex DNA, bound to both mismatched and well matched sites in the oligonucleotide 5′-(dCGGAAATTACCG)2-3′ (underline denotes AA mismatches). Two crystallographically independent views reveal that the complex binds mismatches through metalloinsertion, where the dppz inserts into the duplex through the minor groove, ejecting both mispaired adenosines. Additional ruthenium complexes are intercalated at well-matched sites, creating an array of complexes in the minor groove stabilized through stacking interactions between bpy ligands and extruded adenosines. This structure attests to the generality of metalloinsertion and metallointercalation as DNA binding modes. PMID:22824892

  14. EDITORIAL: Precision proteins Precision proteins

    NASA Astrophysics Data System (ADS)

    Demming, Anna

    2010-06-01

    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  15. EDITORIAL: Precision proteins Precision proteins

    NASA Astrophysics Data System (ADS)

    Demming, Anna

    2010-06-01

    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  16. Maintenance energy requirements of beef cows and relationship with cow and calf performance, metabolic hormones, and functional proteins.

    PubMed

    Cooper-Prado, M J; Long, N M; Davis, M P; Wright, E C; Madden, R D; Dilwith, J W; Bailey, C L; Spicer, L J; Wettemann, R P

    2014-08-01

    Gestating Angus, nonlactating, spring-calving cows were used to determine variation in maintenance energy requirements (MR); to evaluate the relationship among MR and cow and calf performance, plasma concentrations of IGF-I, T4, glucose, insulin, and ruminal temperature; and to describe the LM proteome and evaluate protein abundance in cows with different MR. Cows (4 to 7 yr of age) with a BCS of 5.0 ± 0.2 and BW of 582 ± 37 kg in the second to third trimester of gestation were studied in 3 trials (trial 1, n = 23; trial 2, n = 32; trial 3, n = 38). Cows were individually fed a complete diet in amounts to meet predicted MR (Level 1 Model of NRC), and feed intake was adjusted weekly until constant BW was achieved for at least 21 d (maintenance). Cows were classified on the basis of MR as low (>0.5 SD less than mean, LMR), moderate (±0.5 SD of mean, MMR), or high (>0.5 SD more than mean, HMR) MR. Blood samples were taken at maintenance and at 2 mo postpartum in trial 2. Muscle biopsies were taken from LMR and HMR after cows consumed actual MR for 28 d (trial 2) or 21 d (trial 3). Proteins from LM were separated by 2-dimensional difference gel electrophoresis and were identified, and abundance was quantified and compared. The greatest differences in MR between cows were 29%, 24%, and 25% in trials 1, 2, and 3, respectively. Daily MR (NEm, kcal·BW(-0.75)·d(-1)) averaged 89.2 ± 6.3, 93.0 ± 4.9, and 90.4 ± 4.6 in trials 1, 2, and 3, respectively. Postpartum BW and BCS, calf birth and weaning weights, postpartum luteal activity, and ruminal temperature were not influenced by MR of the cows. Concentrations of IGF-I were greater (P = 0.001) in plasma of MMR compared with LMR cows consuming predicted MR diets, and MR was negatively correlated with concentrations of IGF-I in plasma (r = -0.38; P = 0.05) at 2 mo postpartum. A total of 103 proteins were isolated from LM; 52 gene products were identified. Abundance of specific proteins in the LM was not influenced (P > 0

  17. Shotgun protein sequencing.

    SciTech Connect

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  18. Protein Crystal Based Nanomaterials

    NASA Technical Reports Server (NTRS)

    Bell, Jeffrey A.; VanRoey, Patrick

    2001-01-01

    This is the final report on a NASA Grant. It concerns a description of work done, which includes: (1) Protein crystals cross-linked to form fibers; (2) Engineering of protein to favor crystallization; (3) Better knowledge-based potentials for protein-protein contacts; (4) Simulation of protein crystallization.

  19. Protein folding, protein homeostasis, and cancer

    PubMed Central

    Van Drie, John H.

    2011-01-01

    Proteins fold into their functional 3-dimensional structures from a linear amino acid sequence. In vitro this process is spontaneous; while in vivo it is orchestrated by a specialized set of proteins, called chaperones. Protein folding is an ongoing cellular process, as cellular proteins constantly undergo synthesis and degradation. Here emerging links between this process and cancer are reviewed. This perspective both yields insights into the current struggle to develop novel cancer chemotherapeutics and has implications for future chemotherapy discovery. PMID:21272445

  20. Split-Protein Systems: Beyond Binary Protein-Protein Interactions

    PubMed Central

    Shekhawat, Sujan S.; Ghosh, Indraneel

    2011-01-01

    It has been estimated that 650,000 protein-protein interactions exist in the human interactome [1], a subset of all possible macromolecular partnerships that dictate life. Thus there is a continued need for the development of sensitive and user-friendly methods for cataloguing biomacromolecules in complex environments and for detecting their interactions, modifications, and cellular location. Such methods also allow for establishing differences in the interactome between a normal and diseased cellular state and for quantifying the outcome of therapeutic intervention. A promising approach for deconvoluting the role of macromolecular partnerships is split-protein reassembly, also called protein fragment complementation. This approach relies on the appropriate fragmentation of protein reporters, such as the green fluorescent protein or firefly luciferase, which when attached to possible interacting partners can reassemble and regain function, thereby confirming the partnership. Split-protein methods have been effectively utilized for detecting protein-protein interactions in cell-free systems, E. coli, yeast, mammalian cells, plants, and live animals. Herein, we present recent advances in engineering split-protein systems that allow for the rapid detection of ternary protein complexes, small molecule inhibitors, as well as a variety of macromolecules including nucleic acids, poly(ADP) ribose, and iron sulfur clusters. We also present advances that combine split-protein systems with chemical inducers of dimerization strategies that allow for regulating the activity of orthogonal split-proteases as well as aid in identifying enzyme inhibitors. Finally, we discuss autoinhibition strategies leading to turn-on sensors as well as future directions in split-protein methodology including possible therapeutic approaches. PMID:22070901

  1. Split-protein systems: beyond binary protein-protein interactions.

    PubMed

    Shekhawat, Sujan S; Ghosh, Indraneel

    2011-12-01

    It has been estimated that 650,000 protein-protein interactions exist in the human interactome (Stumpf et al., 2008), a subset of all possible macromolecular partnerships that dictate life. Thus there is a continued need for the development of sensitive and user-friendly methods for cataloguing biomacromolecules in complex environments and for detecting their interactions, modifications, and cellular location. Such methods also allow for establishing differences in the interactome between a normal and diseased cellular state and for quantifying the outcome of therapeutic intervention. A promising approach for deconvoluting the role of macromolecular partnerships is split-protein reassembly, also called protein fragment complementation. This approach relies on the appropriate fragmentation of protein reporters, such as the green fluorescent protein or firefly luciferase, which when attached to possible interacting partners can reassemble and regain function, thereby confirming the partnership. Split-protein methods have been effectively utilized for detecting protein-protein interactions in cell-free systems, Escherichia coli, yeast, mammalian cells, plants, and live animals. Herein, we present recent advances in engineering split-protein systems that allow for the rapid detection of ternary protein complexes, small molecule inhibitors, as well as a variety of macromolecules including nucleic acids, poly(ADP) ribose, and iron sulfur clusters. We also present advances that combine split-protein systems with chemical inducers of dimerization strategies that allow for regulating the activity of orthogonal split-proteases as well as aid in identifying enzyme inhibitors. Finally, we discuss autoinhibition strategies leading to turn-on sensors as well as future directions in split-protein methodology including possible therapeutic approaches. PMID:22070901

  2. Protein in diet

    MedlinePlus

    ... basic structure of protein is a chain of amino acids. You need protein in your diet to help ... Protein foods are broken down into parts called amino acids during digestion. The human body needs a number ...

  3. Protein-losing enteropathy

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/007338.htm Protein-losing enteropathy To use the sharing features on this page, please enable JavaScript. Protein-losing enteropathy is an abnormal loss of protein ...

  4. Protein electrophoresis - serum

    MedlinePlus

    ... digestive tract to absorb proteins ( protein-losing enteropathy ) Malnutrition Kidney disorder called nephrotic syndrome Scarring of the ... may indicate: Abnormally low level of LDL cholesterol Malnutrition Increased gamma globulin proteins may indicate: Bone marrow ...

  5. Immunogenicity and safety of measles-mumps-rubella and varicella vaccines coadministered with a fourth dose of Haemophilus influenzae type b and Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine in toddlers

    PubMed Central

    Bryant, Kristina A.; McVernon, Jodie; Marchant, Colin D.; Nolan, Terry; Marshall, Gary S.; Richmond, Peter; Marshall, Helen; Nissen, Michael; Lambert, Stephen B.; Aris, Emmanuel; Mesaros, Narcisa; Miller, Jacqueline M.

    2012-01-01

    A pooled analysis was conducted of 1257 toddlers who received a fourth dose of Haemophilus influenzae type b-Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine (HibMenCY-TT) or Hib conjugate vaccine (Hib polysaccharide conjugated to N. meningitidis outer membrane protein) coadministered with measles-mumps-rubella (MMR) and varicella (VAR) vaccines (NCT00134719/NCT00289783). Noninferiority of immunological responses to MMR and VAR was demonstrated between groups and incidences of MMR- and VAR-specific solicited symptoms were similar, indicating that HibMenCY-TT can be coadministered with MMR and VAR. PMID:22617844

  6. Domains mediate protein-protein interactions and nucleate protein assemblies.

    PubMed

    Costa, S; Cesareni, G

    2008-01-01

    Cell physiology is governed by an intricate mesh of physical and functional links among proteins, nucleic acids and other metabolites. The recent information flood coming from large-scale genomic and proteomic approaches allows us to foresee the possibility of compiling an exhaustive list of the molecules present within a cell, enriched with quantitative information on concentration and cellular localization. Moreover, several high-throughput experimental and computational techniques have been devised to map all the protein interactions occurring in a living cell. So far, such maps have been drawn as graphs where nodes represent proteins and edges represent interactions. However, this representation does not take into account the intrinsically modular nature of proteins and thus fails in providing an effective description of the determinants of binding. Since proteins are composed of domains that often confer on proteins their binding capabilities, a more informative description of the interaction network would detail, for each pair of interacting proteins in the network, which domains mediate the binding. Understanding how protein domains combine to mediate protein interactions would allow one to add important features to the protein interaction network, making it possible to discriminate between simultaneously occurring and mutually exclusive interactions. This objective can be achieved by experimentally characterizing domain recognition specificity or by analyzing the frequency of co-occurring domains in proteins that do interact. Such approaches allow gaining insights on the topology of complexes with unknown three-dimensional structure, thus opening the prospect of adopting a more rational strategy in developing drugs designed to selectively target specific protein interactions. PMID:18491061

  7. Drugging Membrane Protein Interactions.

    PubMed

    Yin, Hang; Flynn, Aaron D

    2016-07-11

    The majority of therapeutics target membrane proteins, accessible on the surface of cells, to alter cellular signaling. Cells use membrane proteins to transduce signals into cells, transport ions and molecules, bind cells to a surface or substrate, and catalyze reactions. Newly devised technologies allow us to drug conventionally "undruggable" regions of membrane proteins, enabling modulation of protein-protein, protein-lipid, and protein-nucleic acid interactions. In this review, we survey the state of the art of high-throughput screening and rational design in drug discovery, and we evaluate the advances in biological understanding and technological capacity that will drive pharmacotherapy forward against unorthodox membrane protein targets. PMID:26863923

  8. Protein sensing with engineered protein nanopores*

    PubMed Central

    Mohammad, Mohammad M.; Movileanu, Liviu

    2013-01-01

    The use of nanopores is a powerful new frontier in single-molecule sciences. Nanopores have been used effectively in exploring various biophysical features of small polypeptides and proteins, such as their folding state and structure, ligand interactions, and enzymatic activity. In particular, the α-hemolysin protein pore (αHL) has been used extensively for the detection, characterization and analysis of polypeptides, because this protein nanopore is highly robust, versatile and tractable under various experimental conditions. Inspired by the mechanisms of protein translocation across the outer membrane translocases of mitochondria, we have shown the ability to use nanopore-probe techniques in controlling a single protein using engineered αHL pores. Here, we provide a detailed protocol for the preparation of αHL protein nanopores. Moreover, we demonstrate that placing attractive electrostatic traps is instrumental in tackling single-molecule stochastic sensing of folded proteins. PMID:22528256

  9. Nanotechnologies in protein microarrays.

    PubMed

    Krizkova, Sona; Heger, Zbynek; Zalewska, Marta; Moulick, Amitava; Adam, Vojtech; Kizek, Rene

    2015-01-01

    Protein microarray technology became an important research tool for study and detection of proteins, protein-protein interactions and a number of other applications. The utilization of nanoparticle-based materials and nanotechnology-based techniques for immobilization allows us not only to extend the surface for biomolecule immobilization resulting in enhanced substrate binding properties, decreased background signals and enhanced reporter systems for more sensitive assays. Generally in contemporarily developed microarray systems, multiple nanotechnology-based techniques are combined. In this review, applications of nanoparticles and nanotechnologies in creating protein microarrays, proteins immobilization and detection are summarized. We anticipate that advanced nanotechnologies can be exploited to expand promising fields of proteins identification, monitoring of protein-protein or drug-protein interactions, or proteins structures. PMID:26039143

  10. PREFACE: Protein protein interactions: principles and predictions

    NASA Astrophysics Data System (ADS)

    Nussinov, Ruth; Tsai, Chung-Jung

    2005-06-01

    Proteins are the `workhorses' of the cell. Their roles span functions as diverse as being molecular machines and signalling. They carry out catalytic reactions, transport, form viral capsids, traverse membranes and form regulated channels, transmit information from DNA to RNA, making possible the synthesis of new proteins, and they are responsible for the degradation of unnecessary proteins and nucleic acids. They are the vehicles of the immune response and are responsible for viral entry into the cell. Given their importance, considerable effort has been centered on the prediction of protein function. A prime way to do this is through identification of binding partners. If the function of at least one of the components with which the protein interacts is known, that should let us assign its function(s) and the pathway(s) in which it plays a role. This holds since the vast majority of their chores in the living cell involve protein-protein interactions. Hence, through the intricate network of these interactions we can map cellular pathways, their interconnectivities and their dynamic regulation. Their identification is at the heart of functional genomics; their prediction is crucial for drug discovery. Knowledge of the pathway, its topology, length, and dynamics may provide useful information for forecasting side effects. The goal of predicting protein-protein interactions is daunting. Some associations are obligatory, others are continuously forming and dissociating. In principle, from the physical standpoint, any two proteins can interact, but under what conditions and at which strength? The principles of protein-protein interactions are general: the non-covalent interactions of two proteins are largely the outcome of the hydrophobic effect, which drives the interactions. In addition, hydrogen bonds and electrostatic interactions play important roles. Thus, many of the interactions observed in vitro are the outcome of experimental overexpression. Protein disorder

  11. Protein sequence comparison and protein evolution

    SciTech Connect

    Pearson, W.R.

    1995-12-31

    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

  12. Sorghum and millet proteins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Sorghum and millet proteins are an important source of dietary protein for significant numbers of people living throughout Africa and parts of Asia. Compared to other food proteins, such as those found in milk, eggs and wheat, little is known about the functionality of sorghum and millet proteins. ...

  13. Whey protein fractionation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Concentrated whey protein products from cheese whey, such as whey protein concentrate (WPC) and whey protein isolate (WPI), contain more than seven different types of proteins: alpha-lactalbumin (alpha-LA), beta-lactoglobulin (beta-LG), bovine serum albumin (BSA), immunoglobulins (Igs), lactoferrin ...

  14. Protein in diet

    MedlinePlus

    ... protein. The basic structure of protein is a chain of amino acids. You need protein in your diet to help your body repair cells and make new ones. Protein is also important for growth and development in children, teens, and pregnant women.

  15. Techniques in protein methylation.

    PubMed

    Lee, Jaeho; Cheng, Donghang; Bedford, Mark T

    2004-01-01

    Proteins can be methylated on the side-chain nitrogens of arginine and lysine residues or on carboxy-termini. Protein methylation is a way of subtly changing the primary sequence of a peptide so that it can encode more information. This common posttranslational modification is implicated in the regulation of a variety of processes including protein trafficking, transcription and protein-protein interactions. In this chapter, we will use the arginine methyltransferases to illustrate different approaches that have been developed to assess protein methylation. Both in vivo and in vitro methylation techniques are described, and the use of small molecule inhibitors of protein methylation will be demonstrated. PMID:15173617

  16. Biochemical Approaches for Discovering Protein-Protein Interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Protein-protein interactions or protein complexes are indigenous to nearly all cellular processes, ranging from metabolism to structure. Elucidating both individual protein associations and complex protein interaction networks, while challenging, is an essential goal of functional genomics. For ex...

  17. Urine Protein and Urine Protein to Creatinine Ratio

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Urine Protein and Urine Protein to Creatinine Ratio Share this page: Was this page helpful? Also known as: 24-Hour Urine Protein; Urine Total Protein; Urine Protein to Creatinine Ratio; ...

  18. [Protein expression and purification].

    PubMed

    Růčková, E; Müller, P; Vojtěšek, B

    2014-01-01

    Production of recombinant proteins is essential for many applications in both basic research and also in medicine, where recombinant proteins are used as pharmaceuticals. This review summarizes procedures involved in recombinant protein expression and purification, including molecular cloning of target genes into expression vectors, selection of the appropriate expression system, and protein purification techniques. Recombinant DNA technology allows protein engineering to modify protein stability, activity and function or to facilitate protein purification by affinity tag fusions. A wide range of cloning systems enabling fast and effective design of expression vectors is currently available. A first choice of protein expression system is usually the bacteria Escherichia coli. The main advantages of this prokaryotic expression system are low cost and simplicity; on the other hand this system is often unsuitable for production of complex mammalian proteins. Protein expression mediated by eukaryotic cells (yeast, insect and mammalian cells) usually produces properly folded and posttranslationally modified proteins. How-ever, cultivation of insect and, especially, mammalian cells is time consuming and expensive. Affinity tagged recombinant proteins are purified efficiently using affinity chromatography. An affinity tag is a protein or peptide that mediates specific binding to a chromatography column, unbound proteins are removed during a washing step and pure protein is subsequently eluted. PMID:24945544

  19. Protein- protein interaction detection system using fluorescent protein microdomains

    DOEpatents

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2010-02-23

    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  20. An infant with MLH3 variants, FOXG1-duplication and multiple, benign cranial and spinal tumors: A clinical exome sequencing study.

    PubMed

    Kansal, Rina; Li, Xinmin; Shen, Joseph; Samuel, David; Laningham, Fred; Lee, Hane; Panigrahi, Gagan B; Shuen, Andrew; Kantarci, Sibel; Dorrani, Naghmeh; Reiss, Jean; Shintaku, Peter; Deignan, Joshua L; Strom, Samuel P; Pearson, Christopher E; Vilain, Eric; Grody, Wayne W

    2016-02-01

    A 4-month-old male infant presented with severe developmental delay, cerebellar, brainstem, and cutaneous hemangiomas, bilateral tumors (vestibular, hypoglossal, cervical, and lumbar spinal), and few café-au-lait macules. Cerebellar and lumbar tumor biopsies revealed venous telangiectasia and intraneural perineuroma, respectively. Sequencing NF1, NF2, and RASA1 (blood), and NF2 and SMARCB1 (lumbar biopsy) was negative for pathogenic mutations. Clinical exome sequencing (CES), requested for tumor syndrome diagnosis, revealed two heterozygous missense variants, c.359T>C;p.Phe120Ser and c.3344G>A;p.Arg1115Gln, in MLH3 (NM_001040108.1), a DNA mismatch repair (MMR) gene, Polyphen-predicted as probably damaging, and benign, respectively. Sanger sequencing confirmed both variants in the proband, and their absence in the mother; biological father unavailable. Both biopsied tissues were negative for microsatellite instability, and expressed MLH1, MSH2, PMS2, MSH6, and MLH3 immunohistochemically. Chromosomal microarray showed a 133 kb segment copy number duplication of 14q12 region encompassing FOXG1, possibly explaining the developmental delay, but not the tumors. The presence of MLH3 variants with multiple benign neural and vascular tumors was intriguing for their possible role in the pathogenesis of these neoplasms, which were suspicious for, but not diagnostic of, constitutional MMR deficiency. However, functional assays of non-neoplastic patient-derived cells showed intact base-base MMR function. Also, no previous FOXG1-aberrant patient was reported with tumors. We now report a 3-year-old FOXG1-duplicated patient with a yet undescribed tumor syndrome with clinical features of neurofibromatosis types I and II, where several validation studies could not ascertain the significance of CES findings; further studies may elucidate precise mechanisms and diagnosis for clinical management, including tumor surveillance. PMID:26542077

  1. Isolated Loss of PMS2 Immunohistochemical Expression is Frequently Caused by Heterogenous MLH1 Promoter Hypermethylation in Lynch Syndrome Screening for Endometrial Cancer Patients.

    PubMed

    Kato, Aya; Sato, Naoki; Sugawara, Tae; Takahashi, Kazue; Kito, Masahiko; Makino, Kenichi; Sato, Toshiharu; Shimizu, Dai; Shirasawa, Hiromistu; Miura, Hiroshi; Sato, Wataru; Kumazawa, Yukiyo; Sato, Akira; Kumagai, Jin; Terada, Yukihiro

    2016-06-01

    Lynch syndrome (LS) is an autosomal-dominant inherited disorder mainly caused by a germline mutation in the DNA mismatch repair (MMR) genes (MLH1, MSH2, MSH6, and PMS2) and is associated with increased risk for various cancers, particularly colorectal cancer and endometrial cancer (EC). Women with LS account for 2% to 6% of EC patients; it is clinically important to identify LS in such individuals for predicting and/or preventing additional LS-associated cancers. PMS2 germline mutation (PMS2-LS) is the rarest contribution to LS etiology among the 4 LS-associated MMR germline mutations, and its detection is complicated. Therefore, prudent screening for PMS2-LS is important as it leads to an efficient LS identification strategy. Immunohistochemistry is recommended as a screening method for LS in EC. Isolated loss of PMS2 (IL-PMS2) expression is caused not only by PMS2-LS but also by MLH1 germline mutation or MLH1 promoter hypermethylation (MLH-PHM). This study aimed to determine the association between MLH1-PHM and IL-PMS2 to avoid inappropriate genetic analysis. We performed MLH1 methylation analysis and MLH1/PMS2 germline mutation testing on the IL-PMS2 cases. By performing MMR-immunohistochemistry on 360 unselected ECs, we could select 8 (2.2%) cases as IL-PMS2. Heterogenous MLH1 staining and MLH1-PHM were detected in 4 of 8 (50%) IL-PMS2 tumors. Of the 5 IL-PMS2 patients who underwent genetic analysis, 1 had PMS2 germline mutation with normal MLH1 expression (without MLH1-PHM), and no MLH1 germline mutation was detected. We suggest that MLH1 promoter methylation analysis for IL-PMS2 EC should be performed to exclude sporadic cases before further PMS2 genetic testing. PMID:26848797

  2. Isolated Loss of PMS2 Immunohistochemical Expression is Frequently Caused by Heterogenous MLH1 Promoter Hypermethylation in Lynch Syndrome Screening for Endometrial Cancer Patients

    PubMed Central

    Sato, Naoki; Sugawara, Tae; Takahashi, Kazue; Kito, Masahiko; Makino, Kenichi; Sato, Toshiharu; Shimizu, Dai; Shirasawa, Hiromistu; Miura, Hiroshi; Sato, Wataru; Kumazawa, Yukiyo; Sato, Akira; Kumagai, Jin; Terada, Yukihiro

    2016-01-01

    Lynch syndrome (LS) is an autosomal-dominant inherited disorder mainly caused by a germline mutation in the DNA mismatch repair (MMR) genes (MLH1, MSH2, MSH6, and PMS2) and is associated with increased risk for various cancers, particularly colorectal cancer and endometrial cancer (EC). Women with LS account for 2% to 6% of EC patients; it is clinically important to identify LS in such individuals for predicting and/or preventing additional LS-associated cancers. PMS2 germline mutation (PMS2-LS) is the rarest contribution to LS etiology among the 4 LS-associated MMR germline mutations, and its detection is complicated. Therefore, prudent screening for PMS2-LS is important as it leads to an efficient LS identification strategy. Immunohistochemistry is recommended as a screening method for LS in EC. Isolated loss of PMS2 (IL-PMS2) expression is caused not only by PMS2-LS but also by MLH1 germline mutation or MLH1 promoter hypermethylation (MLH-PHM). This study aimed to determine the association between MLH1-PHM and IL-PMS2 to avoid inappropriate genetic analysis. We performed MLH1 methylation analysis and MLH1/PMS2 germline mutation testing on the IL-PMS2 cases. By performing MMR-immunohistochemistry on 360 unselected ECs, we could select 8 (2.2%) cases as IL-PMS2. Heterogenous MLH1 staining and MLH1-PHM were detected in 4 of 8 (50%) IL-PMS2 tumors. Of the 5 IL-PMS2 patients who underwent genetic analysis, 1 had PMS2 germline mutation with normal MLH1 expression (without MLH1-PHM), and no MLH1 germline mutation was detected. We suggest that MLH1 promoter methylation analysis for IL-PMS2 EC should be performed to exclude sporadic cases before further PMS2 genetic testing. PMID:26848797

  3. Meat intake, cooking methods, dietary carcinogens, and colorectal cancer risk: findings from the Colorectal Cancer Family Registry

    PubMed Central

    Joshi, Amit D; Kim, Andre; Lewinger, Juan Pablo; Ulrich, Cornelia M; Potter, John D; Cotterchio, Michelle; Le Marchand, Loic; Stern, Mariana C

    2015-01-01

    Diets high in red meat and processed meats are established colorectal cancer (CRC) risk factors. However, it is still not well understood what explains this association. We conducted comprehensive analyses of CRC risk and red meat and poultry intakes, taking into account cooking methods, level of doneness, estimated intakes of heterocyclic amines (HCAs) that accumulate during meat cooking, tumor location, and tumor mismatch repair proficiency (MMR) status. We analyzed food frequency and portion size data including a meat cooking module for 3364 CRC cases, 1806 unaffected siblings, 136 unaffected spouses, and 1620 unaffected population-based controls, recruited into the CRC Family Registry. Odds ratios (OR) and 95% confidence intervals (CI) for nutrient density variables were estimated using generalized estimating equations. We found no evidence of an association between total nonprocessed red meat or total processed meat and CRC risk. Our main finding was a positive association with CRC for pan-fried beefsteak (Ptrend < 0.001), which was stronger among MMR deficient cases (heterogeneity P = 0.059). Other worth noting associations, of borderline statistical significance after multiple testing correction, were a positive association between diets high in oven-broiled short ribs or spareribs and CRC risk (Ptrend = 0.002), which was also stronger among MMR-deficient cases, and an inverse association with grilled hamburgers (Ptrend = 0.002). Our results support the role of specific meat types and cooking practices as possible sources of human carcinogens relevant for CRC risk. PMID:25846122

  4. Systematic Study on Genetic and Epimutational Profile of a Cohort of Amsterdam Criteria-Defined Lynch Syndrome in Singapore

    PubMed Central

    Goh, Xue Wei; Tan, Soo Yong; Loi, Carol Tien Tau; Tan, Yuen Ming; Law, Hai Yang; Koh, Poh Koon; Tang, Choong Leong

    2014-01-01

    Background Germline defects of mismatch repair (MMR) genes underlie Lynch Syndrome (LS). We aimed to gain comprehensive genetic and epigenetic profiles of LS families in Singapore, which will facilitate efficient molecular diagnosis of LS in Singapore and the region. Methods Fifty nine unrelated families were studied. Mutations in exons, splice-site junctions and promoters of five MMR genes were scanned by high resolution melting assay followed by DNA sequencing, large fragment deletions/duplications and promoter methylation in MLH1, MSH2, MSH6 and PMS2 were evaluated by multiplex ligation-dependent probe amplification. Tumor microsatellite instability (MSI) was assessed with five mononucleotide markers and immunohistochemical staining (IHC) was also performed. Results Pathogenic defects, all confined to MLH1 and MSH2, were identified in 17 out of 59 (28.8%) families. The mutational spectrum was highly heterogeneous and 28 novel variants were identified. One recurrent mutation in MLH1 (c.793C>T) was also observed. 92.9% sensitivity for indication of germline mutations conferred by IHC surpassed 64.3% sensitivity by MSI. Furthermore, 15.6% patients with MSS tumors harbored pathogenic mutations. Conclusions Among major ethnic groups in Singapore, all pathogenic germline defects were confined to MLH1 and MSH2. Caution should be applied when the Amsterdam criteria and consensus microsatellite marker panel recommended in the revised Bethesda guidelines are applied to the local context. We recommend a screening strategy for the local LS by starting with tumor IHC and the hotspot mutation testing at MLH1 c.793C>T followed by comprehensive mutation scanning in MLH1 and MSH2 prior to proceeding to other MMR genes. PMID:24710284

  5. Lynch syndrome and cervical cancer.

    PubMed

    Antill, Yoland C; Dowty, James G; Win, Aung Ko; Thompson, Tina; Walsh, Michael D; Cummings, Margaret C; Gallinger, Steven; Lindor, Noralane M; Le Marchand, Loïc; Hopper, John L; Newcomb, Polly A; Haile, Robert W; Church, James; Tucker, Katherine M; Buchanan, Daniel D; Young, Joanne P; Winship, Ingrid M; Jenkins, Mark A

    2015-12-01

    Carriers of germline mutations in DNA mismatch repair (MMR) genes are at increased risk of several cancers including colorectal and gynecologic cancers (Lynch syndrome). There is no substantial evidence that these mutations are associated with an increased risk of cervical cancer. A total of 369 families with at least one carrier of a mutation in a MMR gene (133 MLH1, 174 MSH2, 35 MSH6 and 27 PMS2) were ascertained via population cancer registries or via family cancer clinics in Australia, New Zealand, Canada, and USA. Personal and family histories of cancer were obtained from participant interviews. Modified segregation analysis was used to estimate the hazard ratio (incidence rates for carriers relative to those for the general population), and age-specific cumulative risks of cervical cancer for carriers. A total of 65 cases of cervical cancer were reported (including 10 verified by pathology reports). The estimated incidence was 5.6 fold (95% CI: 2.3-13.8; p = 0.001) higher for carriers than for the general population with a corresponding cumulative risk to 80 years of 4.5% (95% CI: 1.9-10.7%) compared with 0.8% for the general population. The mean age at diagnosis was 43.1 years (95% CI: 40.0-46.2), 3.9 years younger than the reported USA population mean of 47.0 years (p = 0.02). Women with MMR gene mutations were found to have an increased risk of cervical cancer. Due to limited pathology verification we cannot be certain that a proportion of these cases were not lower uterine segment endometrial cancers involving the endocervix, a recognized cancer of Lynch syndrome. PMID:26077226

  6. Designing Fluorinated Proteins.

    PubMed

    Marsh, E N G

    2016-01-01

    As methods to incorporate noncanonical amino acid residues into proteins have become more powerful, interest in their use to modify the physical and biological properties of proteins and enzymes has increased. This chapter discusses the use of highly fluorinated analogs of hydrophobic amino acids, for example, hexafluoroleucine, in protein design. In particular, fluorinated residues have proven to be generally effective in increasing the thermodynamic stability of proteins. The chapter provides an overview of the different fluorinated amino acids that have been used in protein design and the various methods available for producing fluorinated proteins. It discusses model proteins systems into which highly fluorinated amino acids have been introduced and the reasons why fluorinated residues are generally stabilizing, with particular reference to thermodynamic and structural studies from our laboratory. Lastly, details of the methodology we have developed to measure the thermodynamic stability of oligomeric fluorinated proteins are presented, as this may be generally applicable to many proteins. PMID:27586337

  7. Surface Mediated Protein Disaggregation

    NASA Astrophysics Data System (ADS)

    Radhakrishna, Mithun; Kumar, Sanat K.

    2014-03-01

    Preventing protein aggregation is of both biological and industrial importance. Biologically these aggregates are known to cause amyloid type diseases like Alzheimer's and Parkinson's disease. Protein aggregation leads to reduced activity of the enzymes in industrial applications. Inter-protein interactions between the hydrophobic residues of the protein are known to be the major driving force for protein aggregation. In the current paper we show how surface chemistry and curvature can be tuned to mitigate these inter-protein interactions. Our results calculated in the framework of the Hydrophobic-Polar (HP) lattice model show that, inter-protein interactions can be drastically reduced by increasing the surface hydrophobicity to a critical value corresponding to the adsorption transition of the protein. At this value of surface hydrophobicity, proteins lose inter-protein contacts to gain surface contacts and thus the surface helps in reducing the inter-protein interactions. Further, we show that the adsorption of the proteins inside hydrophobic pores of optimal sizes are most efficient both in reducing inter-protein contacts and simultaneously retaining most of the native-contacts due to strong protein-surface interactions coupled with stabilization due to the confinement. Department of Energy (Grant No DE-FG02-11ER46811).

  8. PINT: Protein-protein Interactions Thermodynamic Database.

    PubMed

    Kumar, M D Shaji; Gromiha, M Michael

    2006-01-01

    The first release of Protein-protein Interactions Thermodynamic Database (PINT) contains >1500 data of several thermodynamic parameters along with sequence and structural information, experimental conditions and literature information. Each entry contains numerical data for the free energy change, dissociation constant, association constant, enthalpy change, heat capacity change and so on of the interacting proteins upon binding, which are important for understanding the mechanism of protein-protein interactions. PINT also includes the name and source of the proteins involved in binding, their Protein Information Resource, SWISS-PROT and Protein Data Bank (PDB) codes, secondary structure and solvent accessibility of residues at mutant positions, measuring methods, experimental conditions, such as buffers, ions and additives, and literature information. A WWW interface facilitates users to search data based on various conditions, feasibility to select the terms for output and different sorting options. Further, PINT is cross-linked with other related databases, PIR, SWISS-PROT, PDB and NCBI PUBMED literature database. The database is freely available at http://www.bioinfodatabase.com/pint/index.html. PMID:16381844

  9. DNA mimicry by proteins.

    PubMed

    Dryden, D T F; Tock, M R

    2006-04-01

    It has been discovered recently, via structural and biophysical analyses, that proteins can mimic DNA structures in order to inhibit proteins that would normally bind to DNA. Mimicry of the phosphate backbone of DNA, the hydrogen-bonding properties of the nucleotide bases and the bending and twisting of the DNA double helix are all present in the mimics discovered to date. These mimics target a range of proteins and enzymes such as DNA restriction enzymes, DNA repair enzymes, DNA gyrase and nucleosomal and nucleoid-associated proteins. The unusual properties of these protein DNA mimics may provide a foundation for the design of targeted inhibitors of DNA-binding proteins. PMID:16545103

  10. Should childhood MMR vaccination be compulsory? Rights, duties and the public interest.

    PubMed

    Sheather, Julian

    2013-06-01

    When children and young people lack the capacity to make decisions about their care and treatment, decisions have to be made on their behalf based on an assessment of their welfare or interests. In law, parents, or others with the relevant parental responsibility, are ordinarily regarded as the appropriate decision-makers. One way of framing this is to say that parents have certain decision-making rights with respect to their children. Such rights, however, are not generally regarded as absolute, rather they can be seen as secondary to and limited by the duties that parents have with regard to their children, duties to promote their welfare. It is against these parental duties that children could, at least in theory if not in practice, claim a right to certain kinds of protection. The legal rights of parents here, as opposed to the rights of the children, can be thought of as rights that secure for parents the freedom from interference necessary to fulfill the underlying duty. PMID:23732893

  11. Should childhood MMR vaccination be compulsory? Rights, duties and the public interest

    PubMed Central

    Sheather, Julian

    2013-01-01

    When children and young people lack the capacity to make decisions about their care and treatment, decisions have to be made on their behalf based on an assessment of their welfare or interests. In law, parents, or others with the relevant parental responsibility, are ordinarily regarded as the appropriate decision-makers. One way of framing this is to say that parents have certain decision-making rights with respect to their children. Such rights, however, are not generally regarded as absolute, rather they can be seen as secondary to and limited by the duties that parents have with regard to their children, duties to promote their welfare. It is against these parental duties that children could, at least in theory if not in practice, claim a right to certain kinds of protection. The legal rights of parents here, as opposed to the rights of the children, can be thought of as rights that secure for parents the freedom from interference necessary to fulfill the underlying duty. PMID:23732893

  12. Individualized Education Programs: A Comparison of Students with BD, LD, and MMR.

    ERIC Educational Resources Information Center

    Nickles, James L.; And Others

    1992-01-01

    This study examined the categories of objectives in the Individualized Education Programs of children with behavior disorders, learning disabilities, or mild mental retardation in five states. The study found differences among disability groups in objective categories (academic, career/vocational, behavior, and basic living skills) but less…

  13. Physics of protein motility and motor proteins

    NASA Astrophysics Data System (ADS)

    Kolomeisky, Anatoly B.

    2013-09-01

    Motor proteins are enzymatic molecules that transform chemical energy into mechanical motion and work. They are critically important for supporting various cellular activities and functions. In the last 15 years significant progress in understanding the functioning of motor proteins has been achieved due to revolutionary breakthroughs in single-molecule experimental techniques and strong advances in theoretical modelling. However, microscopic mechanisms of protein motility are still not well explained, and the collective efforts of many scientists are needed in order to solve these complex problems. In this special section the reader will find the latest advances on the difficult road to mapping motor proteins dynamics in various systems. Recent experimental developments have allowed researchers to monitor and to influence the activity of single motor proteins with a high spatial and temporal resolution. It has stimulated significant theoretical efforts to understand the non-equilibrium nature of protein motility phenomena. The latest results from all these advances are presented and discussed in this special section. We would like to thank the scientists from all over the world who have reported their latest research results for this special section. We are also grateful to the staff and editors of Journal of Physics: Condensed Matter for their invaluable help in handling all the administrative and refereeing activities. The field of motor proteins and protein motility is fast moving, and we hope that this collection of articles will be a useful source of information in this highly interdisciplinary area. Physics of protein motility and motor proteins contents Physics of protein motility and motor proteinsAnatoly B Kolomeisky Identification of unique interactions between the flexible linker and the RecA-like domains of DEAD-box helicase Mss116 Yuan Zhang, Mirkó Palla, Andrew Sun and Jung-Chi Liao The load dependence of the physical properties of a molecular motor

  14. Protein C blood test

    MedlinePlus

    ... a normal substance in the body that prevents blood clotting. A blood test can be done to see ... history of blood clots. Protein C helps control blood clotting. A lack of this protein or problem with ...

  15. Protein S blood test

    MedlinePlus

    ... a normal substance in your body that prevents blood clotting. A blood test can be done to see ... family history of blood clots. Protein S helps control blood clotting. A lack of this protein or problem with ...

  16. Protein electrophoresis - urine

    MedlinePlus

    ... nephropathy Kidney failure Multiple myeloma Nephrotic syndrome Acute urinary tract infection Risks There are no risks associated with this ... Primary amyloidosis Protein in diet Protein urine test Urinary tract infection - adults Update Date 5/29/2014 Updated by: ...

  17. [Protein-losing enteropathy].

    PubMed

    Amiot, A

    2015-07-01

    Protein-losing enteropathy is a rare syndrome of gastrointestinal protein loss. The primary causes can be classified into lymphatic leakage due to increased interstitial pressure and increased leakage of protein-rich fluids due to erosive or non-erosive gastrointestinal disorders. The diagnosis of protein-losing enteropathy should be considered in patients with chronic diarrhea and peripheral oedema. The diagnosis of protein-losing enteropathy is most commonly based on the determination of fecal alpha-1 antitrypsin clearance. Most protein-losing enteropathy cases are the result of either lymphatic obstruction or a variety of gastrointestinal disorders and cardiac diseases, while primary intestinal lymphangiectasia (Waldmann's disease) is less common. Treatment of protein-losing enteropathy targets the underlying disease but also includes dietary modification, such as high-protein and low-fat diet along with medium-chain triglyceride supplementation. PMID:25618488

  18. Learning about Proteins

    MedlinePlus

    ... body, and protecting you from disease. All About Amino Acids When you eat foods that contain protein, the ... called amino (say: uh-MEE-no) acids. The amino acids then can be reused to make the proteins ...

  19. Hydrodynamic effects in proteins

    NASA Astrophysics Data System (ADS)

    Szymczak, Piotr; Cieplak, Marek

    2011-01-01

    Experimental and numerical results pertaining to flow-induced effects in proteins are reviewed. Special emphasis is placed on shear-induced unfolding and on the role of solvent mediated hydrodynamic interactions in the conformational transitions in proteins.

  20. Hydrodynamic effects in proteins.

    PubMed

    Szymczak, Piotr; Cieplak, Marek

    2011-01-26

    Experimental and numerical results pertaining to flow-induced effects in proteins are reviewed. Special emphasis is placed on shear-induced unfolding and on the role of solvent mediated hydrodynamic interactions in the conformational transitions in proteins. PMID:21406855

  1. Mannosylated Mucin-Type Immunoglobulin Fusion Proteins Enhance Antigen-Specific Antibody and T Lymphocyte Responses

    PubMed Central

    Johansson, Tomas; Nilsson, Anki; Chatzissavidou, Nathalie; Sjöblom, Magnus; Rova, Ulrika; Holgersson, Jan

    2012-01-01

    Targeting antigens to antigen-presenting cells (APC) improve their immunogenicity and capacity to induce Th1 responses and cytotoxic T lymphocytes (CTL). We have generated a mucin-type immunoglobulin fusion protein (PSGL-1/mIgG2b), which upon expression in the yeast Pichia pastoris became multivalently substituted with O-linked oligomannose structures and bound the macrophage mannose receptor (MMR) and dendritic cell-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN) with high affinity in vitro. Here, its effects on the humoral and cellular anti-ovalbumin (OVA) responses in C57BL/6 mice are presented. OVA antibody class and subclass responses were determined by ELISA, the generation of anti-OVA CTLs was assessed in 51Cr release assays using in vitro-stimulated immune spleen cells from the different groups of mice as effector cells and OVA peptide-fed RMA-S cells as targets, and evaluation of the type of Th cell response was done by IFN-γ, IL-2, IL-4 and IL-5 ELISpot assays. Immunizations with the OVA − mannosylated PSGL-1/mIgG2b conjugate, especially when combined with the AbISCO®-100 adjuvant, lead to faster, stronger and broader (with regard to IgG subclass) OVA IgG responses, a stronger OVA-specific CTL response and stronger Th1 and Th2 responses than if OVA was used alone or together with AbISCO®-100. Also non-covalent mixing of mannosylated PSGL-1/mIgG2b, OVA and AbISCO®-100 lead to relatively stronger humoral and cellular responses. The O-glycan oligomannoses were necessary because PSGL-1/mIgG2b with mono- and disialyl core 1 structures did not have this effect. Mannosylated mucin-type fusion proteins can be used as versatile APC-targeting molecules for vaccines and as such enhance both humoral and cellular immune responses. PMID:23071675

  2. Understanding protein folding: small proteins in silico.

    PubMed

    Zimmermann, Olav; Hansmann, Ulrich H E

    2008-01-01

    Recent improvements in methodology and increased computer power now allow atomistic computer simulations of protein folding. We briefly review several advanced Monte Carlo algorithms that have contributed to this development. Details of folding simulations of three designed mini proteins are shown. Adding global translations and rotations has allowed us to handle multiple chains and to simulate the aggregation of six beta-amyloid fragments. In a different line of research we have developed several algorithms to predict local features from sequence. In an outlook we sketch how such biasing could extend the application spectrum of Monte Carlo simulations to structure prediction of larger proteins. PMID:18036571

  3. Imaging Protein-protein Interactions in vivo

    PubMed Central

    Seegar, Tom; Barton, William

    2010-01-01

    Protein-protein interactions are a hallmark of all essential cellular processes. However, many of these interactions are transient, or energetically weak, preventing their identification and analysis through traditional biochemical methods such as co-immunoprecipitation. In this regard, the genetically encodable fluorescent proteins (GFP, RFP, etc.) and their associated overlapping fluorescence spectrum have revolutionized our ability to monitor weak interactions in vivo using Förster resonance energy transfer (FRET)1-3. Here, we detail our use of a FRET-based proximity assay for monitoring receptor-receptor interactions on the endothelial cell surface. PMID:20972411

  4. DNA repair systems as targets of cadmium toxicity

    SciTech Connect

    Giaginis, Constantinos; Gatzidou, Elisavet; Theocharis, Stamatios . E-mail: theocharis@ath.forthnet.gr

    2006-06-15

    Cadmium (Cd) is a heavy metal and a potent carcinogen implicated in tumor development through occupational and environmental exposure. Recent evidence suggests that proteins participating in the DNA repair systems, especially in excision and mismatch repair, are sensitive targets of Cd toxicity. Cd by interfering and inhibiting these DNA repair processes might contribute to increased risk for tumor formation in humans. In the present review, the information available on the interference of Cd with DNA repair systems and their inhibition is summarized. These actions could possibly explain the indirect contribution of Cd to mutagenic effects and/or carcinogenicity.

  5. CSF myelin basic protein

    MedlinePlus

    CSF myelin basic protein is a test to measure the level of myelin basic protein (MBP) in the cerebrospinal fluid (CSF). The CSF ... less than 4 ng/mL of myelin basic protein in the CSF. Normal value ranges may vary ...

  6. Modeling Protein Domain Function

    ERIC Educational Resources Information Center

    Baker, William P.; Jones, Carleton "Buck"; Hull, Elizabeth

    2007-01-01

    This simple but effective laboratory exercise helps students understand the concept of protein domain function. They use foam beads, Styrofoam craft balls, and pipe cleaners to explore how domains within protein active sites interact to form a functional protein. The activity allows students to gain content mastery and an understanding of the…

  7. Palmitoylation of Hedgehog proteins.

    PubMed

    Buglino, John A; Resh, Marilyn D

    2012-01-01

    Hedgehog (Hh) proteins are secreted signaling proteins that contain amide-linked palmitate at the N-terminus and cholesterol at the C-terminus. Palmitoylation of Hh proteins is critical for effective long- and short-range signaling. The palmitoylation reaction occurs during transit of Hh through the secretory pathway, most likely in the lumen of the ER. Attachment of palmitate to Hh proteins is independent of cholesterol modification and autoprocessing and is catalyzed by Hhat (Hedgehog acyltransferase). Hhat is a member of the membrane bound O-acyltransferase (MBOAT) family, a subgroup of multipass membrane proteins that catalyze transfer of fatty acyl groups to lipids and proteins. Several classes of secreted proteins have recently been shown to be substrates for MBOAT acyltransferases, including Hh proteins and Spitz (palmitoylated by Hhat), Wg/Wnt proteins (modified with palmitate and/or palmitoleate by Porcupine) and ghrelin (octanoylated by ghrelin O-acyltransferase). These findings highlight protein fatty acylation as a mechanism that not only influences membrane binding of intracellular proteins but also regulates the signaling range and efficacy of secreted proteins. PMID:22391306

  8. Protein electrophoresis - serum

    MedlinePlus

    Normal value ranges are: Total protein: 6.4 to 8.3 g/dL (grams per deciliter) Albumin: 3.5 to 5.0 g/dL Alpha-1 ... Decreased total protein may indicate: Abnormal loss of protein from the digestive tract or the inability of the digestive tract ...

  9. CSF total protein

    MedlinePlus

    CSF total protein is a test to determine the amount of protein in your spinal fluid, also called cerebrospinal fluid (CSF). ... The normal protein range varies from lab to lab, but is typically about 15 to 60 mg/dL. Note: mg/dL = ...

  10. Modeling Protein Self Assembly

    ERIC Educational Resources Information Center

    Baker, William P.; Jones, Carleton Buck; Hull, Elizabeth

    2004-01-01

    Understanding the structure and function of proteins is an important part of the standards-based science curriculum. Proteins serve vital roles within the cell and malfunctions in protein self assembly are implicated in degenerative diseases. Experience indicates that this topic is a difficult one for many students. We have found that the concept…

  11. Texturized dairy proteins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dairy proteins are amenable to structural modifications induced by high temperature, shear and moisture; in particular, whey proteins can change conformation to new unfolded states. The change in protein state is a basis for creating new foods. The dairy products, nonfat dried milk (NDM), whey prote...

  12. Destabilized bioluminescent proteins

    DOEpatents

    Allen, Michael S.; Rakesh, Gupta; Gary, Sayler S.

    2007-07-31

    Purified nucleic acids, vectors and cells containing a gene cassette encoding at least one modified bioluminescent protein, wherein the modification includes the addition of a peptide sequence. The duration of bioluminescence emitted by the modified bioluminescent protein is shorter than the duration of bioluminescence emitted by an unmodified form of the bioluminescent protein.

  13. Protein - Which is Best?

    PubMed

    Hoffman, Jay R; Falvo, Michael J

    2004-09-01

    Protein intake that exceeds the recommended daily allowance is widely accepted for both endurance and power athletes. However, considering the variety of proteins that are available much less is known concerning the benefits of consuming one protein versus another. The purpose of this paper is to identify and analyze key factors in order to make responsible recommendations to both the general and athletic populations. Evaluation of a protein is fundamental in determining its appropriateness in the human diet. Proteins that are of inferior content and digestibility are important to recognize and restrict or limit in the diet. Similarly, such knowledge will provide an ability to identify proteins that provide the greatest benefit and should be consumed. The various techniques utilized to rate protein will be discussed. Traditionally, sources of dietary protein are seen as either being of animal or vegetable origin. Animal sources provide a complete source of protein (i.e. containing all essential amino acids), whereas vegetable sources generally lack one or more of the essential amino acids. Animal sources of dietary protein, despite providing a complete protein and numerous vitamins and minerals, have some health professionals concerned about the amount of saturated fat common in these foods compared to vegetable sources. The advent of processing techniques has shifted some of this attention and ignited the sports supplement marketplace with derivative products such as whey, casein and soy. Individually, these products vary in quality and applicability to certain populations. The benefits that these particular proteins possess are discussed. In addition, the impact that elevated protein consumption has on health and safety issues (i.e. bone health, renal function) are also reviewed. Key PointsHigher protein needs are seen in athletic populations.Animal proteins is an important source of protein, however potential health concerns do exist from a diet of protein

  14. Protein crystallization with paper

    NASA Astrophysics Data System (ADS)

    Matsuoka, Miki; Kakinouchi, Keisuke; Adachi, Hiroaki; Maruyama, Mihoko; Sugiyama, Shigeru; Sano, Satoshi; Yoshikawa, Hiroshi Y.; Takahashi, Yoshinori; Yoshimura, Masashi; Matsumura, Hiroyoshi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Takano, Kazufumi

    2016-05-01

    We developed a new protein crystallization method that incorporates paper. A small piece of paper, such as facial tissue or KimWipes, was added to a drop of protein solution in the traditional sitting drop vapor diffusion technique, and protein crystals grew by incorporating paper. By this method, we achieved the growth of protein crystals with reducing osmotic shock. Because the technique is very simple and the materials are easy to obtain, this method will come into wide use for protein crystallization. In the future, it could be applied to nanoliter-scale crystallization screening on a paper sheet such as in inkjet printing.

  15. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M.; Waldo, Geoffrey S.; Kiss, Csaba

    2011-03-22

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  16. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M.; Waldo, Geoffrey S.; Kiss, Csaba

    2012-05-01

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  17. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M.; Waldo, Geoffrey S.; Kiss, Csaba

    2011-11-29

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  18. Selective Precipitation of Proteins.

    PubMed

    Matulis, Daumantas

    2016-01-01

    Selective precipitation of proteins can be used as a bulk method to recover the majority of proteins from a crude lysate, as a selective method to fractionate a subset of proteins from a protein solution, or as a very specific method to recover a single protein of interest from a purification step. This unit describes a number of methods suitable for selective precipitation. In each of the protocols that are outlined, the physical or chemical basis of the precipitation process, the parameters that can be varied for optimization, and the basic steps for developing an optimized precipitation are described. PMID:26836410

  19. Forces Stabilizing Proteins

    PubMed Central

    Pace, C. Nick; Scholtz, J. Martin; Grimsley, Gerald R.

    2014-01-01

    The goal of this article is to summarize what has been learned about the major forces stabilizing proteins since the late 1980s when site-directed mutagenesis became possible. The following conclusions are derived from experimental studies of hydrophobic and hydrogen bonding variants. 1. Based on studies of 138 hydrophobic interaction variants in 11 proteins, burying a –CH2– group on folding contributes 1.1 ± 0.5 kcal/mol to protein stability. 2. The burial of nonpolar side chains contributes to protein stability in two ways: first, a term that depends on the removal of the side chains from water and, more importantly, the enhanced London dispersion forces that result from the tight packing in the protein interior. 3. Based on studies of 151 hydrogen bonding variants in 15 proteins, forming a hydrogen bond on folding contributes 1.1 ± 0.8 kcal/mol to protein stability. 4. The contribution of hydrogen bonds to protein stability is strongly context dependent. 5. Hydrogen bonds by side chains and peptide groups make similar contributions to protein stability. 6. Polar group burial can make a favorable contribution to protein stability even if the polar group is not hydrogen bonded. 7. Hydrophobic interactions and hydrogen bonds both make large contributions to protein stability. PMID:24846139

  20. Mechanism of protein decarbonylation.

    PubMed

    Wong, Chi-Ming; Marcocci, Lucia; Das, Dividutta; Wang, Xinhong; Luo, Haibei; Zungu-Edmondson, Makhosazane; Suzuki, Yuichiro J

    2013-12-01

    Ligand/receptor stimulation of cells promotes protein carbonylation that is followed by the decarbonylation process, which might involve thiol-dependent reduction (C.M. Wong et al., Circ. Res. 102:301-318; 2008). This study further invest